CA2282859A1 - Method for the production of vaccines against cell surface proteins - Google Patents

Abstract

A method for identifying the repertoire of proteins exposed on the surface of a virus, bacterium or cell, and to the preparation of vaccines thereto. The method includes vectorially labelling proteins on the membrane surface; isolating the labelled membrane surface proteins by two dimensional gel electrophoresis; and sequencing the isolated membrane surface proteins. Also included are methods of producing a vaccine against the virus, bacterium or cell, methods of detecting infertility, methods of producing contraception and the vaccines and contraceptives produced by the methods.

Description

TIT1 E OF THE iNV>i NTION
Method for the Production of Vaccines Against Cell Surface Proteins GOVERNMENT SUP ORT
This work was supported in part by grant NIH HD 29099 and P30-28934 from the National Institutes of Health. The government may have certain rights in the invention.
BACKGROUND OF THE INVENTION
Field of the Invent~~n The invention relates generally to a method for identifying the repertoire of proteins exposed on the surface of a cell, and to the preparation of vaccines thereto.
In particular, the invention relates to a method for identifying the repertoire of proteins present on the surface of human spermatozoa (sperm) to the proteins identified by the method, and to the production of contraceptive vaccines therefrom.
Discussion of the Background It is through their surfaces that living organisms interact with their environments. It is against the epitopes present on cell and viral surfaces that the immune system directs both antibody and T cell mediated immune responses. Methods which allow surface molecules on living organisms to be identified, isolated and genetically manipulated provide a means to develop vaccines, since it is against the cell/viral surface that immune responses are directed.
The mammalian spermatozoon is a highly differentiated cell. It is the product of a complex series of changes which are organized spatially and temporally into a set of cell associations known as the cycle of the seminiferous epithelium ( 1 ). During spermatogenesis, round undifferentiated spermatogonia are transformed via spermatocytes and spermatids into highly asymmetric and motile spermatozoa, and in humans 12 steps in the differentiation of spermatids alone can be recognized (2). As a result of these numerous differentiation events, spermatozoa are unusual cells in many respects. The nuclear chromatin becomes highly condensed and inactive in synthesis of RNA, and unique cytoplasmic components appear, such as the acrosome of the sperm head and the outer dense fibers and fibrous ribs of the tail.
Although not immediately apparent from its microscopic appearance, even the sperm plasma membrane undergoes extensive differentiation during spermatogenesis. Different membrane domains are formed on the sperm surface (3), as shown in freeze-fracture preparations (4) and in immunocytochemical studies of differences in the distributions of sperm membrane components (S). Furthermore, the sperm surface is not static after leaving the seminiferous epithelium; its components undergo alteration and redistribution as a result of additional maturation in the epididymis, and following capacitation and the acrosome reaction in the female reproductive tract (6,7).
It is through their surfaces that sperm interact with their surroundings in the male and female tracts as they pass from the testis to the oviduct. Most important, the plasma membrane (plasmalemma) of the sperm contacts the egg investments, and the membrane overlying the equatorial segment of the acrosome is believed to be the initial site of fusion with the egg plasma membrane (8).
Chong Xu et al. (2G) recently reported that G4 plasmalemmal silver stained proteins could be detergent extracted from human spermatozoa membrane vesicles isolated by nitrogen cavitation, differential centrifugation, IEF/PAGE electrophoresis.
However, a drawback of the nitrogen cavitation technique in analysis of sperm surface proteins is the necessity of pooling samples collected over several weeks to achieve sufficient starting material. In addition, there are lingering uncertainties whether cavitation methods yield "membrane" proteins which derive only from the plasma membrane (20).
Although two-dimensional electrophoresis has been employed in the study of human sperm proteins in the past (18-2G), reconciliation of the protein patterns between these previous reports was difficult due to the lack of procedure standardization.
The comprehensive cataloging of human sperm surface proteins has been hampered because available data were limited in one or more of the following ways: I ) resolution, 2) reproducibility, 3) pH range, 4) specificity of surface labeling techniques, or 5) plasma membrane purification procedures.

In view of the aforementioned deficiencies attendant with the prior art methods of . analyzing cell surface proteins, it is clear that there exists a need in the art for a standardized method of analysis, identification, characterization, isolation and cataloging of cell surface proteins in general, and sperm surface proteins in particular.
SUMMARY OF THE INVENTION
Accordingly, one object of this invention is to provide a novel method for the analysis of membrane surface proteins including the steps of a. vectorially labeling proteins on the membrane surface;
b. isolating the labeled membrane surface proteins by two dimensional gel electrophoresis; and c. sequencing the isolated membrane surface proteins.
Another object of the invention is to provide a method for producing a vaccine against membrane surface proteins including the steps of a. vectorially labeling proteins on the membrane surface;
b. isolating the labeled membrane surface proteins by two dimensional gel electrophoresis;
c. sequencing the isolated membrane surface proteins;
d. cloning the DNA encoding the membrane surface proteins; and e. recombinantly producing the membrane surface proteins using the DNA
isolated in step (d).
Yet another object of the invention is to provide a method for diagnosing infertility including a. labeling the membrane surface proteins obtained in by the above-described method;
b. reacting the labeled membrane surface proteins with sera from a patient in which the presence or absence of infertility is to be diagnosed; and c. detecting formation of an complex between an antibody present in the sera and the labeled membrane surface protein.

Still another object is to provide a vaccine produced by the above-described method.
A further object of the invention is to provide a diagnostic test kit including the cell surface proteins produced by the above-described method.
Another object of the invention is to provide a method for inducing contraception in a patient including administering to a patient in need thereof an amount of sperm cell surface proteins produced by the above-described method sufficient to prevent fertilization of an egg in said patient.
An additional object of the invention is to provide a method for producing a contraceptive including administering to a mammal the recombinant proteins produced by the above-described method and isolating antibodies produced by the mammal against the recombinant proteins.
Still another object of the invention is to provide a contraceptive produced by the above-described method.
With the foregoing and other objects, advantages and features of the invention that will become hereinafter apparent, the nature of the invention may be more clearly understood by reference to the following detailed description of the preferred embodiments of the invention and to the appended claims.
BRIEF DESCRIPTION OF THE DRAWINGS
A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following detailed description when considered in connection with the accompanying drawings, wherein:
Figure 1 shows the two-dimensional gel electrophoretic analysis of silver stained human spermatozoa [A&B] and seminal plasma proteins from an azospermic patient [C&D]
solubilized in lysis buffer A (see methods). Proteins were separated by IEF/PAGE {A&C) and by NEPHGE/PAGE (B&D) resulting in resolution of approximately 1300 sperm protein spots. The pH-gradients of the first dimensional gels are indicated at the top of the figure.
Note the overlap in pH-range between the two first dimension techniques. SDS-PAGE was PCT/(JS98/02913 performed with the anode at the bottom of the gels. Molecular weights (x I 0-3) are indicated in the left margin. There are relatively few high molecular weight proteins in the liquified seminal plasma ~ & D), while numerous protein spots below 20 kDa are evident.
Degradation patterns of seminal plasma proteins can be followed by the oblique trails seen between basic proteins in D (horizontal arrows). Computer comparison of seminal plasma and sperm protein patterns identified 9 co-migrating proteins of similar shape (black and white arrows). The white arrow in A and C indicates the position of albumin, which apparently adheres to the sperm surface.
Figure 2 illustrates the variations in the amount of a 39.5 kDa protein in sperm obtained from three healthy young men. The 3 samples were treated identically including simultaneous electrophoretic separation in the same buffertank. The figure shows enlarged areas of the 3 IEF/PAGE gels. The estimated ratio of density of the silver stained 39.5 lcDa protein, indicated by arrows, varied from 0.412 in A to 3.703 in C. Such concentration variation was also observed among surface proteins (Figure 7).
Figure 3 is a time course study of radioiodine incorporation into human sperm proteins. Four aliquots of 30 x I OG percoll harvested sperm from the same donor were radiolabeled, employing 10 IODO-BEADS and 150 pCi of Na'ZSI in 4 ml of Dulbecco's PBS
per aliquot. The iodine incorporation was stopped after 5, 10, 15 and 20 minutes by removal of the cells from the catalytic beads by pipetting. The spermatozoa were pelleted by centrifugation and the amount of iodine incorporated was compared to the amount of iodine in the reaction buffer by counting in a Gamma counter.
Figure 4 shows a comparison of labeled sperm proteins extracted in lysis buffer A
without pre-treatment (A) and after a Percoll density centrifugation following vectorial labeling (B). The number of labeled proteins is decreased in the sperm sample which underwent the second Percoll separation (B). Proteins labeled in panel A
included the polymorphic infra-acrosomal protein SP-10 (horizontal arrowheads) and actin (white arrow), indicating that labeling of cytoplasmic constituents had occurred. [See Figure 6 for an immunoblot of SP-10]. In contrast, the control cytoplasmic markers were not labeled in panel B. Thus, the Percoll centrifugation following surface labeling was considered essential to ensure that only surface proteins were analyzed.
Figure 5 illustrates the two-dimensional IEF PAGE of vectorially iodinated human sperm proteins showing companion western blots reacted with monoclonal antibodies to cytoplasmic components. Sperm from a single donor were radioiodinated, subjected to Percoll centrifugation and solubilized in buffer A under nonreducin~
conditions (A&B) or with reducing agent present (100mM DTT)(C&D). An ampholine composition of 28%
pH 3 -3.5, 20% pH 5-7, 7% pH 7-9 and 45% pH 3.5- 10 was used to enhance resolution of acidic proteins. A: Autoradiogram of unreduced proteins immobilized on NC-membrane.
The position of actin in the radioiodination pattern is indicated by arrows. B:
Western blot of the proteins in A incubated with a rnAb to actin prior to autoradiography. Four isoforms of actin were resolved at the expected MW of 43 kDa and with pI's between 5.1-5.2. In insert BI, the autoradiogram was placed on top of the corresponding immunoblot. The expanded region clearly demonstrates that monomeric actin was not iodinated. The horizontal arrows in B1 and B2 indicate the position of two proteins of 51 and 52 kDa, immunologically crossreactive with actin. The proteins were very weakly stained at a 1:3000 dilution of the antibody (Figure SB), but were more clearly demonstrated when the antibody was used at a 1:1 S00 dilution (insert B2). C: Autoradiogram of reduced proteins immobilized on NC-membrane.
Horizontal arrows indicate the position of several abundant proteins which participate in high molecular weight complexes stabilized by S-S bridges. D: Western blot of C
incubated with mAb to ~3-tubulin prior to autoradiography. At least seven isoforms of (3-tubulin were immunostained at their expected MW of 57 kDa and with pI's between 4.6 and 5.4, following sperm protein extraction in presence of DTT. The position of (3-tubulin in the autoradiogram is indicated by vertical arrows in Figure SC. Although the position of some of the tubulin isoforms on the autoradiogram is covered by emissions from surrounding iodinated proteins, ~i-tubulin itself was not radioiodinated by the procedure.
Figure 6 shows protein imaging by reflected absorbance demonstrates that the polymorphic intra-acrosomal protein SP-10 is not vectorially iodinated.
Radiolabeled proteins were solubilized with NP-40 and urea, separated by IEF/PAGE, transferred to NC-paper and incubated with the mAb MHS 10. After colorometric development with the DAB
-G-substrate, the SP-10 immunoreaction product was imaged on the autoradiogram [B] by reflectance from an image enhancement screen, allowing the exact position of the SP-10 forms to be visualized as a shadow. The characteristic SP-10 pattern, in which the higher molecular weight forms are more acidic than the lower molecular weight fornis, matches the published data (32, 33). Although it contains 3 tyrosine and 12 histidine residues (32) which may potentially be iodinated, the intra-acrosomal protein SP-10 was not detected as a radioiodinated protein as long as acrosome reacted spermatozoa were removed by a post labeling Percoll gradient centrifugation.
Figure 7 compares autoradiograms of vectorially labeled human sperm proteins from two donors following 2-D electrophoresis and transfer to NC membranes shows and illustrates the overall high reproducibility of the patterns of iodinated proteins from donor to donor. An equal number of radioiodinated cells from each donor was solubilized and equal volumes of solubilizate applied to IEF/PAGE (A&C) and NEPHGE/PAGE (B&D).
Certain iodinated surface proteins such as the 89->95 kDa group (vertical arrows) displayed variations in relative concentration as judged by the optical density integrated against the total density of all proteins on the autoradiogram.
Figure 8 is a two-dimensional gel electrophoretic analysis of NHS-LC-Biotin labeled human sperm proteins solubilized by NP-40 and urea, and separated by IEF/PAGE
(A,C and E) or by NEPHGE/PAGE (B, D, F) before being transferred to NC-membranes. A and B:
Biotinylated sperm proteins were visualized by ECL following incubation with AP-conjugated avidin. C and D: Non-biotinylated sperm proteins incubated with AP-avidin alone demonstrated five endogenous avidin-binding proteins with MW of 77 kDa and pl between 6 and 6.5 (vertical arrows in C). The position of these endogenous avidin binding proteins in the surface biotinylation pattern is indicated by similar arrows in A. E and F:
Biotinylated sperm proteins stained by colloidal gold following transfer to NC-paper. The proteins in E were incubated with the polyclonal antisern R-10, raised against recombinant macaque PH-20, a sperm surface hyaluronidase. Three PH-20 protein spots of apparent MW
of 53 kDa were immunolabeled (upwards pointing arrows in E). The 65 kDa antigen (acidic end of gel) was also stained with rabbit preimmune serum. The three 53 KDa spots were -7_ WO 98/36771 PC'f/US98/02913 labeled with biotin (similar arrows in A) indicating that three forms of PH20 are accessible to _ surface biotinylation. In F the preimmune sera for PH20 was utilized. The open arrow indicates the position of the basic 53 kDa form on the NEPHGE gel. The 53 kDa form of PH20 was not immunostained.
Figure 9 shows a two-dimensional gel electrophoretic analysis of biotinylated human sperm proteins solubilized in lysis buffer B (SDS,CHAPS,UREA). A and B:
Proteins visualized by silverstaining. C and D: Biotinylated proteins visualized with AP-avidin and ECL after electrotransfer to NC-paper. E: Immunoblot showing the position of (3-tubulin detected by incubation with mAb TU27. The position of ~3-tubulin in the silverstained and biotinylated 2-D patterns (A & C) is indicated by identical downward arrows.
The high molecular weight complexes indicated by an open arrow in Figure 9A were shown to contain a-tubulin following immunoblotting with a mAb. Note that neither a- nor ~3-tubulin was biotinylated. F: Immunoblot showing the fibrous sheath antigens detected by mAb S69. The position of the fibrous sheath components in the silverstained and biotinylated 2-D patterns is indicated by a similar oblique arrow in B and D. The fibrous sheath proteins were not biotin labeled. G and H: Immunoblot of the sperm surface hyaluronidase PH20. Two isotypes of PH-20 were immunostained, at 64 kDa and at 53 kDa. At higher magnification the 53 kDa form could be resolved into five isoforms. The strongest biotinylation occurred of the most acidic isoform of the 53 kDa component of PH-20. The weak immunoreactive spot of 65 kDa (indicated by upward pointing oblique arrowhead in Figure 9G and by arrows in Figures 8A & E) was also present in the rabbit pre-immune control (data not shown).
Figure 10 is an immunoblot with the mAb RC-20 showing sperm proteins phosphorylated in tyrosine residues. Fresh human sperm were solubilized in lysis buffer A, separated by IEFFPAGE and transferred to a PVDF membrane. The dominant phospho-proteins had a MW of 89-95 kDa and pI between 5.5 and 5.8. Several more weakly stained proteins can also be seen. Arrowheads indicate five groups of phosphoproteins which were vectorially labeled (see Table 1).
Figure 11 shows a composite computer image of the 1397 human spermatozoa) proteins which could be detected by silver staining following NP-40/urea solubilization.
_8_ _ Ninety four of the ninety eight proteins which were labeled by both surface iodination and surface biotinylation could be matched to silver stained proteins and are encircled. The characteristics of these proteins are given in Table 1. This Table is referred to as the Spenm Surface Index.
Figure 12 shows amino acid microsequence data obtained by Edman degradation and tandem mass spectrometry from a sperm protein of 63 Kda, pI 4.3 chosen for design of complementary and reverse-complementary oligonucleotides (SEQ ID NOS:16-18, 12, 19-20). From this microsequence information pools of degenerate oligonucleotide primers were synthesized to initiate PCR [see Fig. 13].
Figure 13 shows PCR products resulting from amplification of human testis RNA
using degenerate oligonucleotides derived from microsequence data of 63 Kda, pI 4.3 protein reveal a single prominent PCR product at approximately 400 bp.
Figure 14 shows DNA sequence obtained from clone derived by RT-PCR utilizing optimized, degenerate primers. Numbers indicate base pair position in sequenced clone and in the Calreticulin gene; (c) designates the RT-PCR clone (SEQ ID N0:25) while (H) designates the human Calreticulin cDNA from GenBank (SEQ ID N0:26).
Figure 15 shows microsequences derived by tandem mass spectrometry from sperm surface protein I-23 and complementary and reverse-complement oligonucleotides (SEQ ID
N0:27-40).
Figure 16 shows DNA sequence encoding a portion of sperm surface protein I-23 (SEQ ID N0:41 ). This DNA sequence was obtained from sequencing PCR products amplified from human testicular DNA using pools of degenerate primers synthesized based upon microsequences shown in Figure 15.
Figure 17 is an Encyclopedia of 967 silver stained human sperm proteins in the isoelectric point range of 3.5->6.5 obtained by laser scanning and computer digitization of 2-D electrophorograms in which the first dimension was iso-electric focusing.
Figure 18 is an Encyclopedia of 435 silver stained human sperm proteins in the isoelectric point range of 6.5->10.5 obtained by laser scanning and digitization of 2-D
electrophorograms in which the first dimension was nonequilibrium pH gradient electrophoresis.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
In accordance with the present invention there may be employed conventional molecular biology, microbiology, and protein chemistry and recombinant DNA
techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al, "Molecular Cloning: A Laboratory Manual" (1989); "Current Protocols in Molecular Biology" Volumes I-III [Ausubel, R. M., ed. (1994)]; "Cell Biology:
A Laboratory Handbook" Volumes I-III [J. E. Cells, ed. (1994))]; "Current Protocols in Immunology"
Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide Synthesis" (M.J.
Gait ed. 1984);
"Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. ( 1985)];
"Transcription And Translation" [B.D. Hames & S.J. Higgins, eds. (1984)]; "Animal Cell Culture"
[R.I.
Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B.
Perbal, "A
Practical Guide To Molecular Cloning" (1984).
Therefore, if appearing herein, the following terms shall have the definitions set out below.
A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control.
A "vector" is a replicon, such as plasmid, phage or cosmid, to which another DNA
segment may be attached so as to bring about the replication of the attached segment.
A "DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or a double-stranded helix.
This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA
molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA
(i.e., the strand -i0-6??1 PCT/US98/02913 having a sequence homologous to the mRNA).
An "origin of replication" refers to those DNA sequences that participate in DNA
synthesis.
A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A
coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
A "promoter sequence" is a DNA regulatory region capable of binding RNA
polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (S' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S 1 ), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes.
Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.
An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA
polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
A "signal sequence" can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.
The term "oligonucleotide," as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more ribo- or deoxyribo-nucleotides, preferably more than three. Its exact size will depend upon many factors which, in turn, depend upon the ultimate function and use of the oligonucleotide.
The term "primer" as used herein refers to an oligonucleotide, whether occurnng naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in the presence of nucleotides and an inducing agent such as a DNA polymerise and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon many factors, including temperature, source of primer and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.
The primers herein are selected to be "substantially" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the strand to hybridize therewith and thereby form the template for the synthesis of the extension product.
As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
A cell has been "transformed" by exogenous or heterologous DNA when such DNA
has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A
"clone" is a population of cells derived from a single cell or common ancestor by mitosis.
A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.
Two DNA sequences are "substantially homologous" when at least about 75%
(preferably at least about 80%, and most preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system.
Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA
Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.
Two amino acid sequences are "substantially homologous" when at least about 70%
of the amino acid residues (preferably at least about 80%, and most preferably at least about 90 or 95%) are identical, or represent conservative substitutions.
A "heterologous" region of the DNA construct is m identifiable segment of DNA

within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.
An "antibody" is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope. The term encompasses polyclonal, monoclonal, and chimeric antibodies, the last mentioned described in further detail in U.S. Patent Nos.
4,816,397 and 4,816,567.
An "antibody combining site" is that structural portion of an antibody molecule comprised of heavy and light chain variable and hypervariable regions that specifically binds antigen.
The phrase "antibody molecule" in its various grammatical forms as used herein contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule.
Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and those portions of an immunoglobulin molecule that contains the paratope, -including those portions known in the art as Fab, Fab', F(ab'), and F(v), which portions are preferred for use in the diagnostic and therapeutic methods described herein.
Fab and F(ab')2 portions of antibody molecules are prepared by the proteolytic reaction of papain and pepsin, respectively, on substantially intact antibody molecules by methods that are well-known. See for example, U.S. Patent No. 4,342,566 to Theofilopolous et al. Fab' antibody molecule portions are also well-known and are produced from F(ab')Z
portions followed by reduction of the disulfide bonds linking the two heavy chain portions as with mercaptoethanol, and followed by alkylation of the resulting protein mercaptan with a reagent such as iodoacetamide. An antibody containing intact antibody molecules is preferred herein.
The phrase "monoclonal antibody" in its various grammatical forms refers to an antibody having only one species of antibody combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen; e.g., a bispecific (chimeric) monoclonal antibody.
The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to prevent, and preferably reduce by at least about 30 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, a clinically significant change in the S
phase activity of a target cellular mass, or other feature of pathology such as for example, elevated blood pressure, fever or white cell count as may attend its presence and activity.
A DNA sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence. The term "operatively linked" includes having an appropriate start signal (e.g., ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.
The term "standard hybridization conditions" refers to salt and temperature conditions substantially equivalent to 5 x SSC and 65 °C for both hybridization and wash. However, one skilled in the art will appreciate that such "standard hybridization conditions" are dependent on particular conditions including the concentration of sodium and magnesium in the buffer, nucleotide sequence length and concentration, percent mismatch, percent formamide, and the like. Also important in the determination of "standard hybridization conditions" is whether the two sequences hybridizing are RNA-RNA, DNA-DNA or RNA-DNA. Such standard hybridization conditions are easily determined by one skilled in the art according to well known formulae, wherein hybridization is typically 10-20°C below the predicted or determined Tm with washes of higher stringency, if desired.
Detailed knowledge of the sperm surface molecules is useful, not only to aid in understanding the complex processes of differentiation and maturation, but also because the plasma membrane is critical to sperm function.
The combination of vectorial labeling and detergent solubilization in the method of the present invention permits analysis of relatively few cells, bacteria or virus, allowing day to day variations in specific protein patterns (physiologically or experimentally induced) to be studied in a single individual or sample. Further, vectorial labeling techniques provide information concerning the exofacial orientation of plasmalemmal proteins, which cannot be achieved by the nitrogen cavitation technique alone.
For the first time both acidic, neutral and basic human spermatozoa proteins are analysed in a single method, and two methods for labeling surface exposed proteins are compared. A comprehensive 2-D database for membrane surface proteins, particularly human spermatozoa proteins can be established.
One way in which a comprehensive understanding of the composition of the sperm plasma membrane can be put to immediate use is in the design of contraceptive vaccines.
Knowledge of the molecules accessible to antibodies and T cell mediators on the surface of a biological target provides a rational basis for the development of vaccines.
In the case of contraceptive vaccines based on sperm antigens, immune responses are sought which agglutinate, immobilize, or lyse sperm or interact with surface-accessible proteins to block events in the fertilization process. Were females to develop antibodies to sperm surface proteins in the secretions of the cervix, uterus and oviduct, progress of sperm through the female genital tract can be interdicted at several anatomical levels.
The ideal sperm-based contraceptive vaccine may be envisioned to contain a mixture of sperm antigens derived from all major domains of the sperm plasmalemma, including head, midpiece and tail, as well as the inner acrosomal membrane, which forms the limiting membrane over the sperm head following the acrosome reaction (9). Although monoclonal or polyclonal antibodies that block sperm functions have led to the identification of several candidate sperm vaccine immunogens on both the plasmalemma and associated with the inner acrosomal membrane ( 10), a comprehensive analysis of the full range of potential human sperm surface immunogens has not heretofore been undertaken.
Two-dimensional gel electrophoresis as developed by O'Farrell ( 11,12), which is incorporated herein by reference in its entirety, in combination with computerized gel analysis, can be used for analysis of complex mixtures of polypeptides.
Specialized computer software facilitates the quantitative analysis of two-dimensional gels, including the capability for comparison of various computer images, which permits a detailed description of alterations in protein patterns resulting from experimental manipulations or changing environmental stimuli {13-17}.
The present invention identifies the major surface proteins by vectorial labeling followed by detergent extraction, 2-D electrophoresis and computer image analysis. From the information obtained using this method, a cell surface protein encyclopedia index, membrane surface protein encyclopedia or sperm protein encyclopedia may be obtained which assigns numbers to the various proteins (1397 total for sperm proteins), defines their coordinates {Mr and pI) and lists their "integrated intensity" which is a measure of staining intensity relative to all other proteins.
The cell or microbial membrane may be disrupted using any method known in the art, including detergent treatment, disruption using mortar and pestle, sonication and the like.
Detergents may include Nonidet P-40 (NP-40), TWEEN, SDS and the like.
Denaturants such as urea, among others, may also be used.
The labeling may be performed using any label suitable for labeling of surface proteins. Examples of labels include iodine (I'zs ) and biotin. "Prime targets" for further analysis, including sequencing, are proteins which are preferably labeled using more than one method.

The separation of proteins using two dimensional (2-D) gel electrophoresis is well known in the art. Preparative 2-D gels may be 1-un such that significant (sequenceable) amounts of proteins can be obtained from spots identified by gel analysis.
When necessary, electrophoretic separation of proteins is achieved by varying the ampholine concentrations of the first dimension, which allows a restricted area of the 2-D
map to be expanded to fill the entire 2-D gel format. This permits greater separation of proteins within a given region of the pI and Mr spectrum, thus increasing resolution in regions where many proteins are clustered, and it allows higher loads of protein, thus optimizing yield. Proteins are stained with Ponceau, Coomassie, silver or gold depending on each protein's characteristics and subsequent uses. After electrophoresis on 2-D gels, proteins are electroblotted onto membrane supports or digested in the acrylamide gel with trypsin or lysyl peptidase to yield peptides for Edman degradation or tandem mass spectrometry.
The database for the surface proteins can serve as a reference in future analysis of plasma membrane proteins and as a guide for selection of targets for microsequencing or generation of antibodies. Antigens that are candidates for microsequencing include those which are reactive with infertile or vasectomy sera. Another prime microsequencing candidate is sperm agglutinating antigen 1 [SAGA-1]. MES-8 mAb agglutinates 100% of sperm in human semen, impedes sperm penetration of cervical mucus, inhibits the penetration of hamster ova by human sperm, inhibits irt vitro fertilization of mouse ova with isologous sperm and inhibits binding of human sperm to human zona pellucida by 70%. SAGA-antigen is localized to the entire sperm surface.
Affinity purification methods may also be used for enriching proteins of interest that are present in relatively low abundance. Washed, harvested cell, bacteria or viruses can be vectorially labeled with NHS-SS-Biotin (alternatively with NHSO Iminobiotin), a biotinylation probe with a reducible disulfide. Proteins are solubilized under non-reducing conditions and the biotinylated surface complexes precipitated with beads coated with immobilized streptavidin. The precipitated proteins can be eluted by reduction following washing and analyzed by two-dimensional electrophoresis. Microsequencing of biotinylated surface proteins enriched with this affinity bead method can be undertaken from heavily loaded preparative 2-D gels or following reverse phase HPLC separation.
Sequencing of protein spots is performed by any method known in the art.
Preferably, the sequencing is performed by Edman degradation and mass spectrometry, preferably tandem mass spectrometry (TMS).
Coomassie stained protein spots on PVDF membrane are loaded into a blot cartridge for sequence analysis. To obtain internal sequence, the proteins are digested in the gel in particular with lysyl endopeptidase or other proteases, and the peptides extracted and separated on a column, particularly a 1 mm diameter C 18 column. The mass and purity of the separated peptides are determined by matrix assisted laser desorption and ionization time of flight mass spectrometry using a Finnigan LaserMAT. The solution containing the separated peptide of interest can be applied to a glass fiber filter which has been subjected to condition cycles after coating with Polybrene. The NH-terminal amino acid sequence of the peptide is determined with a protein sequences. lntact [whole] proteins cm be subjected to twenty to thirty cycles of Edman degradation, while sequencing of internal peptides proceed as far as appropriate based upon their mass, as calculated from mass spectrometry. The sequencing method may employ standard Edman chemistry in which the NH-terminal amino acid is derivatized with phenylisothiocyanate and then cleaved with trifluoroacetic acid to give an anilinothiozolinone amino acid, which is subsequently converted with acid to a phenylthiohydantoin (PTH) amino acid. The PTH amino acids can be identified and quantitated by an Applied Biosystems 140 HPLC, particularly by using a 2.1 mm diameter C18 column optimized for PTH amino acid analysis.
High sensitivity internal sequencing can be performed by tandem mass spectrometry.
Protein spots are reduced and alkylated in the polyacrylamide gel before treatment with protease (typically trypsin) in ammonium bicarbonate. The peptides produced by this means can then be extracted from the polyacrylamide, particularly with SO%
acetonitrile/5% formic acid, and the extract then concentrated to near dryness and reconstituted, preferably in 1 acetic acid. The peptides can be analyzed in a LC-electrospray mass spectrometry system, particularly using 75 gm i.d. capillary HPLC column interfaced to a Finnigan electrospray ionization-tandem quadrupole mass spectrometer. Results can be analyzed to determine the molecular weights of the peptides, and the information utilized to reprogram the tandem mass spectrometer for collisionally activated dissociation (CAD) analysis of specific peptides. In the CAD experiment, an ion of a given haze ratio (mlz) is mass selected by the first mass analyzer. This process selects the peptide for sequencing based on its molecular weight and effectively eliminates from analysis all other peptides.
The selected peptide is fragmented by collision with argon atoms and the products of those fragmentation reactions are mass analyzed by the second mass analyzer of the tandem mass spectrometer system. This yields a CAD mass spectrum from the amino acid sequence of the peptide. The process is repeated under computer control to obtain sequence information for each peptide in the digest.
Sequencing by mass spectrometry is very sensitive and can yield internal sequence data from samples which contain 1 to 10 pico moles of starting material. The use of the first mass filter of the tandem mass spectrometer separates the various peptides which result from digestion of the protein, thus avoiding the chromatography step needed to obtain pure peptides in the Edman sequencing method. However, Edman sequencing can obtain data from the N-terminus of an intact protein (if the NTH terminus is not blocked) yielding thirty, or in some cases, more amino acid residues. Although less sensitive than mass spectrometry sequencing, Edman degradation can sequence longer peptides than the mass spectrometer, and it readily distinguishes leucine and isoleucine, where the mass spectrometer does not.
The Edman method does require purification of the peptide before it is loaded into the instrument, highlighting the need to separate and concentrate proteins carefully by preparative 2-D electrophoresis. The Edman method requires approximately 10 to 15 pmoles of starting material to achieve internal sequences of sufficient length for designing oligonucleotides. However, as little as 2 pmoles are sufficient for long amino terminal sequence analyses of full length proteins.
From the amino acid sequence information obtained, oligonucleotides may be designed, preferably degenerate oiigonucleotides representing all possible codon combinations of the sequence (ar alternatively, using inosine in the third position in the codon), and such oligonucleotides can be used in cloning by hybridization to libraries containing cDNA encoding membrane surface proteins, or amplification by polymerase chain reaction (PCR), preferably RT-PCR.
The RT-PCR approach utilizing two anchoring primers has the advantages of the simplicity and speed of the PCR protocol. However, because the genetic code is degenerate, selection of oligonucleotides based upon known amino acid sequences may require the synthesis of a large number of probes corresponding to a given amino acid sequence.
At least two amino acid sequences of 7 or more residues in length from each protein are desired. [However, in those cases where two sequences are not obtained, one sequence can be used in conjunction with 5' and 3' RACE]. Optimal primer length for PCR
is 20 to 30 nucleotides. It follows that a minimum of 7 contiguous amino acids of unequivocal sequence must be obtained from at least 2 locations in a given protein's primary structure in order to design two primers which are at least 20 bases in length.
A combination of factors should be considered in detecting the exact composition of each oligonucleotide and which portion of a given amino acid sequence will be chosen for targeting, including: the G-C content of the proposed oligonucleotide, the number of reliable amino acid residues that have been sequenced, and the temperature of melting that is inherent to a proposed oligonucleotide pool. In order to manufacture oligonucleotides that fail within the optimal size of 20-30 bases in length a minimum stretch of at least 7 amino acids should be obtained by microsequencing. If longer amino acid sequences can be obtained there are more opportunities for optimal oligonucleotide design. An N-terminal and an internal protein sequence or two internal amino acid sequences will permit oligonucleotide pools to be created from separated regions of the RNA to be amplified in order to facilitate RT-PCR of a suitable length cDNA fragment. Probes can be employed in various ways: 1 ) two sets of anchored oligonucleotides can be used in RT-PCR reactions to amplify a cDNA
fragment which can in turn be used to screen cDNA lbraries to obtain full length cDNAs, 2) one or more oligonucleotide sets can be used to anchor a PCR-RACE reaction to amplify a 3' or 5' cDNA fragment which also can be used to screen cDNA libraries; 3) a combination of PCR
and PCR-RACE can be used to obtain full length cDNAs by piecing together sequences from separate PCR reactions; and 4) oligonucleotides can be used to screen cDNA
libraries directly.
In circumstances in which one amino acid sequence has been obtained from the unknown protein, a modified RACE protocol may be employed using a single "anchoring"
optimized oligonucleotide pool to derive either '3' or 5' sequences upstream or downstream from the known sequence. In this method a single internal amino acid sequence can be used to design reverse complementary oligonucleotides to either the proposed sense (S'-RACE) or anti-sense (3'-RACE) strands. The second oligonucleotide for anchoring the amplification reaction is derived from known sequences of linkers placed on the 5' or 3'-ends of commercially available cDNA libraries. This methodology is now available in kit form (Marathon-Ready cDNAST"''; Clonetech).
Suitable cDNA libraries include: 1) 5'-Stretch (Clonetech), 2) ~,-zap and 3) .1-gt 11 cDNA libraries. All three libraries have been used to retrieve full length ORFs of various testis proteins. The methodology of probing libraries with amplified cDNA
probes is well documented. Briefly, oligonucleotides can be end-labeled with (~,-'zP)-rATP
and polynucleotide kinase according to manufacturers instructions, purified and used for hybridization. As a positive control, Northern Blots can be probed first to establish whether the PCR product will recognize a specific mRNA message within total RNA. The 5'-Stretch cDNA library (Clonetech) can be plated according to the manufacturers instructions on 150 mm agar and lifted in duplicate with MSI filters (Fisher). The filters can then be LJV
crosslinked, prehybridized and hybridized in standard solutions overnight.
Filters can then be exposed to X-ray film and the resulting positive clones identified from duplicate filters to eliminate false positives. The films can then be realigned with the original culture plates and cores taken. Primary plaques can be replated and rescreened until all plaques on a given plate give a positive response. Samples of the phage at each step of purification should be retained at -20°C. Once isolated, the clones will be amplified by PCR utilizing primers manufactured to phage sequences adjacent to the cloning site utilized during library manufacture. PCR-amplified cDNA inserts can be enzyme restricted and the resulting fragments separated and sized on agarose gels. Restriction analysis of separate clones may yield fragments of similar size, lending confidence that the degenerate oligonucleotide has recognized identical clones.

Direct screening of cDNA libraries with degenerate oligonucleotides can be done, but generally are only performed if the PCR-based approaches have not worked. A
mixture of 32p end-labeled oligonucleotides can be chosen based on phylogenetically biased codons encoding the amino acid microsequence. Oligonucleolides are designed according to the parameters described above with the emphasis placed on developing a pool with as low a degeneracy as possible (c 300). Positive results have been obtained from oligonucleotide pools of 17-oligomers. In the event that the oligonucleotide pool is larger than this cutoff, multiple pools can be used that contain all the combinatorial possibilities. A
primary control experiment can be performed first by hybridizing the end-labeled pools) to Northern blots containing poly-(A)- mRNA to determine the hybridization conditions that yield positive bands upon washing and exposure to X-ray films. Once hybridization and washing conditions (salt and temperature) are set, cDNA libraries listed above can be plated out in duplicate, lifted and probed with the labeled oligonucleotide pools in conditions as suggested by Ausubel. Duplicate lifts can be compared to eliminate false positives and secondary and tertiary screening performed to ensure purity and correctness of the proposed clone. If available, the same library lifts can be rescreened with a second oligonucleotide mixture derived from another region of the unknown protein.
Alternatively, antibodies to the membrane surface proteins may be used to screen expression libraries.
Monospecific antisera can be generated to protein spots isolated from 2-D
gels. Two approaches can be taken: 1 ) Animals can be immunized with protein containing cores of acrylamide gel which are emulsified in Freunds complete adjuvant according to standard intramuscular immunization; or 2) strips of nitrocellulose containing specific transferred sperm proteins can be implanted subcutaneously and intraperitoneally after dipping the strip in Freunds complete adjuvant. Aliquots of the monospecific sera generated by these methods can be Western blotted to determine an endpoint titer and to verify specificity to the protein spot of interest. If a given antisera has a low titer, solutions of enriched antibody may be created using the Olmstead technique which employs nitrocellulose bound proteins from a specific protein band or spot to affinity purify antibodies. The expression libraries can be plated in sufficient numbers to account for all three reading frames in both directions (G X the density used for nucleotide probing), grown at 37°C for 3-4 hours before induction with 10 mM IPTG-soaked filters, and incubated at 42°C. Monospecific sera and pre-immune sera from the identical animal can be absorbed twice overnight at 4°C with E.E. coli bound to cyanogen bromide activated Sepharose, in order to eliminate reactivity with E.E. coli proteins.
cDNA-bearing phage clones containing the largest inserts by restriction analysis are then converted to plasmid form. Highly purified plasmid DNA necessary for accurate sequencing of long stretches can be prepared by amplification of plasmid-bearing bacteria in large scale (% 100 ml) cultures followed by CsCI equilibrium centrifugation by standard methodologies. Standard primers to plasmid sequences bracketing the cloning site are manufactured to be used for sequencing. Sequencing is preferably performed by dideoxy-chain termination method utilizing a Sequenase~ kit. Sequencing proceeds in both directions and new cDNA-specific primers are manufactured to internal sequences and sequencing continues until the sequences overlap. Alternatively, four color sequencing can be conducted on a Applied Biosystems Prism 377 automated DNA sequencer. An open reading frame can be sought by computer analysis as well as a putative start site to determine if the clone is full-length. In addition, the original sequence of amino acids obtained by microsequencing should be identified.
In the event that sequences cannot be derived so as to allow "doubleanchored"
RT-PCR derivation of cDNAs clones, oligo-d(T) can be used as the second "anchoring"
oligonucleotide.
Occasionally some areas of clones yield ambiguous results due to compressions.
In this event readable sequences can be obtained using the TaqTrack~ Sequencing Kit (Promega) that allows sequencing reactions to be performed at 72°C
rather than at 37°C.
Higher temperatures during the reaction stage usually result in more reliable melting of any potential single-stranded areas and yield reliable, lucid sequences.
Sequences can also be compared to gene data banks to search for identity or homology with known proteins.
To assess the putative tissue specificity of antigens in human and primate models, Northern blot analysis of RNA from major monkey and human organs can be employed.
Total RNA can be isolated from various tissues stored at -70°C. Poly (A+) RNA is purified from total RNA by oligo-d(T) chromatography. RNA cm be concentrated by ethanol precipitation prior to resuspension in sterile distilled water (105 ml). The amount of Poly A+
RNA in each sample can be quantitated by reading its optical density at 260 nm [OD 1.0= 40 mg/ml]. Equal amounts of Poly A+ RNA samples from each tissue to be tested (e.g. 2 mg) are separated on a denaturing agarose/formaldehyde gel and the RNA is transferred to nylon.
After rinsing the nylon for 5 min in 2X SSC, the RNA is cross-linked to the nylon with UV
light. The nylon is prehybridized and then hybridized overnight at 65°C
in fresh hybridization buffer containing 10 mg/ml of probe labeled with 3zP-dCTP.
Probes may consist of cDNA for the antigen under study or control probe of ~3-actin or cyclophilin. The probes can be labeled by random priming using a protocol and kit purchased from Promega.
When necessary, both low stringency and high stringency conditions should be tested.
Autoradiographs are exposed using an intensifying screen. Following hybridization with a test probe, the nylon blots are stripped and reprobed with one of the controls (beta-actin or cyclophilin) to check for equal loading of RNA.
The tissue specificity of antigens can also be assesed using RNA from each tissue which is reverse transcribed and the resulting cDNAs amplified by the polymerise chain reaction (PCR). Primers specific for the RNA of interest, which map to the initiation and termination of translation, respectively, can be employed. A positive control can make use of beta-actin specific primers, selected on the basis of conserved regions in beta-actin cDNAs and separated by 198 nucleotides of intervening sequence. PCR products are visualized and their sizes estimated following staining with ethidium bromide. Whether the PCR products actually correspond to the material of interest can be determined by hybridization in southern blots with cDNAs specific for the antigen under study.
Tissue specificity of antigens can be assessed in yet another way by immunohistochemical studies, preferably employing affinity purified antibodies. A bank of paraffin embedded tissues can be collected and maintained. Proteins can be localized in the bank of tissues by immunoperoxidase labeling of paraffin-embedded sections.
Tissues can be fixed for several hours with 10% neutral buffered formalin (Sigma). The tissue is dehydrated - through an ethanol series, embedded in paraffin, sectioned and mounted onto slides. Before use, sections are dewaxed, rehydrated and treated with 0.25% hydrogen peroxide to block endogenous peroxidase activity. Non-specific protein binding sites can be blocked by incubating the slides in PBS with 5% normal goat serum (NGS). Slides are incubated with either affinity purified rabbit polyclonal antibodies generated to the recombinant protein or control preimmune sera diluted in PBS-NGS and washed, and then incubated with peroxidase-conjugated goat anti-rabbit IgG/IgM in PBS-NGS. Slides are washed with PBS, and immunoreactive proteins can be visualized by staining with TrueBlue peroxidase substrate (KPL} or gold enhanced staining. The presence of a blue or black precipitate indicates immunoreactive protein(s).
In sperm surface protein microsequence analysis performed to date, homologies to heat shock protein 90 alpha (82%), gastrin binding protein (94.7%), human calreticulin ( 100% with 15 amino acids), mouse fibrous sheath protein (64%), and serum amyloid-component precursor have been found.
Approximately 40% of the proteins microsequenced appear to be novel.
Table I shows the co-ordinates of the novel spern~ surface proteins.
Table I. Microsequenced Surface Proteins from the Sperm Encyclopedia [see Table 11 for additional surfact proteins]
Protein Sample VectorialMethods Residues Data Analysis of Coordinates1=Protein immobilizedlabelingSequencingObtained*
MW, on pl PVDF membrane I=125-I

2=Peptides B=Biotin from in gel digestion 92.5 kDa, 2 I/B TMS 12 seq., Novel surface 5.3 5-12 as 92 kDa, 2 I/B E 9 as Novel surtace 5.6 90 kDa. 2 I/B TMS 2 seq., Novel surface 5.7 7-10 as 90 kDa, 1 I/B E 6 as Novel surface 4.9 88 kDa, 2 I/B TMS 6 seq., Novel surface 4.0 5-10 as 32 kDa. 2 IIB TMS 3 seq., Novel surtace 5.2 8-9 as . .~.a..l...,..1,f Innn+1, .., of cnnmnnree i ~-n-.umam ucyouuuvm .. ... r...r...,.,. ,. ., _..___ ____..._ , ,., ", TMS=Tandem mass-spectrometry The membrane surface proteins identified by the present method have both diagnostic and therapeutic uses.
In instances where it is desired to reduce or inhibit the binding of the membrane surface protein to a cell or other target, an appropriate inhibitor, including antibodies to the membrane surface protein, could be introduced to block the interaction of the membrane surface protein with a ligand or receptor thereto.
Agents exhibiting either mimicry or antagonism to the membrane surface proteins or control over their production, may be prepared in pharmaceutical compositions, with a suitable carrier and at a strength effective for administration by various means to a patient experiencing an adverse medical condition associated with the presence of the target cell, bacterium or virus, for the treatment thereof. A variety of administrative techniques may be utilized, among them parenteral techniques such as subcutaneous, intravenous and intraperitoneal injections, catheterizations and the like. Average quantities of the membrane surface proteins or their subunits may vary and in particular should be based upon the recommendations and prescription of a qualified physician or veterinarian.
In a preferred embodiment, the invention is directed to administration of the membrane surface proteins or antibodies thereto to inhibit the interaction of a sperm cell with an egg, to inhibit the transport of sperm within the female reproductive tract, or to immobilize sperm, i.e., as a contraceptive.
The membrane surface proteins and antibodies including both polyclonal and monoclonal antibodies, may possess certain diagnostic applications and may for example, be utilized for the purpose of detecting and/or measuring conditions such as bacterial or viral infection, immunity to sperm cells or the like. For example, the membrane surface proteins or their subunits may be used to produce both polyclonal and monoclonal antibodies to themselves in a variety of cellular media, by known techniques such as the hybridoma technique utilizing, for example, fused mouse spleen lymphocytes and myeloma cells.
Likewise, small molecules that mimic or antagonize the activity(ies) of the membrane surface proteins of the invention may be discovered or synthesized, and may be used in diagnostic and/or therapeutic protocols.

As an alternative to generating polyclonal antibodies to whole proteins, sufficient amino acid sequences may be obtained from microsequencing to permit development of synthetic peptide immunogens. These peptide immunogens may be used as immunocontraceptive agents. Alternatively, if cloning a protein of interest is not achieved using the RT-PCR, or direct library probing with oligonucleotides or polyclonal antibodies as outfitted above, anti-peptide antisera can be generated to chimeric peptides.
In this strategy, the amino acid sequence can be conjugated to a promiscuous T cell epitope from tetanus toxoid, VDDALRNSTKIYSYFPSV (SEQ ID NO:1), using an intervening, GPSL (SEQ ID
N0:2), linker. Antipeptide antisera can then be used to screen cDNA expression libraries.
For generation of polyclonal antibodies to recombinant antigen, New Zealand white female rabbits can receive recombinant antigen (about 500 pg) in Complete (once) and Incomplete Freunds Adjuvant (five) for a total of six injections at three week intervals. Sera can be obtained weekly after the second injection.
For generation of affinity purified antibodies, cyanogen bromide activated sepharose {Sigma Chemical Co, St Louis MO) can be used as the immobilizing phase for the purified recombinant antigen. The polyclonal antibody is pumped over the antigen affinity column to allow antibody to bind. Bound antibody is eluted, and fractions are monitored by UV
absorbance. Fractions can be pooled and then blotted with anti-rabbit Ig reagents to demonstrate which of the bands are purified Ig. ELISA end point titration of the various batches of purified IgG can be run at identical protein concentrations against a constant amount of recombinant antigen to demonstrate retention of antigen binding.
In studies of sperm antigens, affinity purified antibodies to recombinant sperm antigens can be immunoreacted with Western blots of 2-D gels loaded with sperm membrane extracts.
Sperm functional assays can be performed to evaluate the affinity purified antibodies to the recombinant antigen to react with the native antigen on the sperm surface and to affect sperm function{s). These assays can include localization of antigens on the sperm by immunofluorescence and confirmation of surface location by FACS; tests of sperm/egg [Sperm Penetration Assay) and sperm/zona interaction [Hemi-zona assay); sperm agglutination and immobilization.

The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal, antibody-producing cell lines can also be created by techniques other than fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g., M. Schreier et al., "Hybridoma Techniques"
(1980);
Hammerling et al., "Monoclonal Antibodies And T-cell Hybridomas" ( 1981 );
Kennett et al., "Monoclonal Antibodies" (1980); see also U.S. Patent Nos. 4,341,761;
4,399,121; 4,427,783;
4,444,887; 4,451,570; 4,466,917; 4,472,500; 4,491,632; 4,493,890.
Panels of monoclonal antibodies produced against the membrane surface peptides can be screened for various properties; i.e., isotype, epitope, affinity, etc. Of particular interest are monoclonal antibodies that neutralize the activity of the membrane surface protein or its subunits. High affinity antibodies are also useful when immunoaffinity purification of native or recombinant membrane surface proteins is possible.
Preferably, the antibody used in the diagnostic methods of this invention is an affinity purified polyclonal antibody. More preferably, the antibody is a monoclonal antibody (mAb). In addition, it is preferable for the antibody molecules used herein be in the form of Fab, Fab', F(ab')z or F(v) portions of whole antibody molecules.
As suggested earlier, the diagnostic method of the present invention comprises examining a cellular or serum sample or medium by means of an assay including an effective amount of binding partner to a membrane surface protein, such as an antibody, preferably an affinity-purified polyclonal antibody, and more preferably a mAb. In addition, it is preferable for the antibody molecules used herein be in the form of Fab, Fab', F(ab')2 or F(v) portions or whole antibody molecules. As previously discussed, patients capable of benefitting from this method include those suffering from bacterial or viral infection, or those in which contraception is desired.
Methods for isolating the membrane surface proteins and inducing antibodies and for determining and optimizing the ability of antibodies to assist in the examination of the target cells are all well-known in the art. Methods for producing polyclonal anti-polypeptide antibodies are well-known in the art. See U.S. Patent No. 4,493,795 to Nestor et al. A

monoclonal antibody, typically containing Fab andlor F(ab')z portions of useful antibody molecules, can be prepared using the hybridoma technology described in Antibodies - A
Laborator~~ Manual, Harlow and Lane, eds., Cold Spring Harbor Laboratory, New York (1988), which is incorporated herein by reference. Briefly, to form the hybridoma from which the monoclonal antibody composition is produced, a myeloma or other self perpetuating cell line is fused with lymphocytes obtained from the spleen of a mammal hyperimmunized with the membrane surface proteins, or binding portions thereof.
Splenocytes are typically fused with myeloma cells using polyethylene glycol (PEG) 6000. Fused hybrids are selected by their sensitivity to HAT. Hybridomas producing a monoclonal antibody useful in practicing this invention are identified by their ability to immunoreact with the membrane surface proteins and their ability to inhibit specified infective activity or fertilization of target cells.
A monoclonal antibody useful in practicing the present invention can be produced by initiating a monoclonal hybridoma culture comprising a nutrient medium containing a hybridoma that secretes antibody molecules of the appropriate antigen specificity. The culture is maintained under conditions and for a time period sufficient for the hybridoma to secrete the antibody molecules into the medium. The antibody-containing medium is then collected. The antibody molecules can then be further isolated by well-known techniques.
Media useful for the preparation of these compositions are both well-known in the art and commercially available and include synthetic culture media, inbred mice and the like.
An exemplary synthetic medium is Dulbecco's minimal essential medium (DMEM;
Dulbecco et al., Virol. 8:396 ( 1959)) supplemented with 4.5 gm/1 glucose, 20 mm glutamine, and 20%
fetal calf serum. An exemplary inbred mouse strain is the Balb/c.
Methods for producing monoclonal antibodies are also well-known in the art.
See Niman et al., Proc. Natl. Acad. Sci. USA, 80:4949-4953 ( 1983). Typically, the membrane surface proteins or peptide analogs are used either alone or conjugated to an immunogenic carrier, as the immunogen in the before described procedure for producing monoclonal antibodies. The hybridomas are screened for the ability to produce an antibody that immunoreacts with the membrane surface proteins.

The present invention further contemplates therapeutic compositions useful in practicing the therapeutic methods of this invention. A subject therapeutic composition includes, in admixture, a pharmaceutically acceptable excipient (carrier) and one or more of a membrane surface protein,(i.e., of a cell, bacterium or virus) particularly a sperm antigen polypeptide analog thereof or fragment thereof, as described herein as an active ingredient.
In a preferred embodiment, the composition comprises a sperm antigen or mixture thereof capable of inhibiting conception.
The preparation of therapeutic compositions which contain polypeptides, analogs or active fragments as active ingredients is well understood in the art.
Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions, however, solid fonms suitable for solution in, or suspension in, liquid prior to injection can also be prepared. The preparation can also be emulsified. The active therapeutic ingredient is often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, and/or pH buffering agents which enhance the effectiveness of the active ingredient.
A polypeptide, analog or active fragment can be formulated into the therapeutic composition as neutralized pharmaceutically acceptable salt forms.
Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide or antibody molecule) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed from the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
The therapeutic polypeptide-, analog- or active fragment-containing compositions are conventionally administered intravenously, as by injection of a unit dose, for example. The term "unit dose" when used in reference to a therapeutic composition of the present invention refers to physically discrete units suitable as unitary dosage for humans, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i.e., carrier, or vehicle.
The compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount. The quantity to be administered depends on the subject to be treated, capacity of the subject's immune system to utilize the active ingredient, and degree of binding capacity desired. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosages may range from about 0.1 to 20, preferably about 0.5 to about 10, and more preferably one to several, milligrams of active ingredient per kilogram body weight of individual per day and depend on the route of administration. Suitable regimes for initial administration and booster shots are also variable, but are typified by an initial administration followed by repeated doses at one or more hour intervals by a subsequent injection or other administration. Alternatively, continuous intravenous infusion sufficient to maintain concentrations of ten nanomolar to ten micromolar in the blood are contemplated.
The therapeutic compositions may further include an effective amount of the antagonist or antibody to the membrane surface proteins, and one or more of the following active ingredients: an antibiotic, a steroid.
Another feature of this invention is the expression of the proteins encoded by the DNA sequences obtained following labeling, analysis and sequencing. As is well known in the ari, DNA sequences may be expressed by operatively linking them to an expression control sequence in an appropriate expression vector and employing that expression vector to transform an appropriate unicellular host.
Such operative linking of a DNA sequence of this invention to an expression control sequence, of course, includes, if not already part of the DNA sequence, the provision of an initiation codon, ATG, in the correct reading frame upstream of the DNA
sequence.
A wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA
sequences.
Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E. coli plasmids col El, pCRI, pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g., the numerous derivatives of phage ~,, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2p plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
Any of a wide variety of expression control sequences -- sequences that control the expression of a DNA sequence operatively linked to it -- may be used in these vectors to express the DNA sequences of this invention. Such useful expression control sequences include, for example, the early or late promoters of SV40, CMV, vaccinia, polyoma or adenovirus, the lac system, the tip system, the TAC system, the TRC system, the LTR system, the major operator and promoter regions of phage ~., the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g., PhoS), the promoters of the yeast a-mating factors, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
A wide variety of unicellular host cells are also useful in expressing the DNA
sequences of this invention. These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomvces, fungi such as yeasts, and animal cells, such as CHO, Rl.l, B-W and L-M cells, African Green Monkey kidney cells (e.g., COS I, COS 7, BSC1, BSC40, and BMT10), insect cells (e.g., Sf7), and human cells and plant cells in tissue culture.
It will be understood that not all vectors, expression control sequences and hosts will function equally well to express the DNA sequences of this invention. Neither will all hosts function equally well with the same expression system. However, one skilled in the art will be able to select the proper vectors, expression control sequences, and hosts without undue experimentation to accomplish the desired expression without departing from the scope of this invention. For example, in selecting a vector, the host must be considered because the vector must function in it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, will also be considered.
In selecting an expression control sequence, a variety of factors will normally be considered. These include, for example, the relative strength of the system, its controllability, and its compatibility with the particular DNA sequence or gene to be expressed, particularly as regards potential secondary structures. Suitable unicellular hosts will be selected by consideration of, e.g., their compatibility with the chosen vector, their secretion characteristics, their ability to fold proteins correctly, and their fermentation requirements, as well as the toxicity to the host of the product encoded by the DNA sequences to be expressed, and the ease of purification of the expression products.
Considering these and other factors a person skilled in the art will be able to construct a variety of vector/expression control sequence/host combinations that will express the protein encoded by the DNA sequences of this invention on fermentation or in large scale animal culture.
cDNAs are preferably cloned under the control of bacteriophage T7 RNA
polymerase/promoter system in the E coli expression vector pET22h(+) (Novagen, Madison, WI). If present, the endogenous signal peptide can be replaced with the bacterial signal pelB
sequence. It is essential for expression in the pET vector that the foreign gene be fused in frame with a) the pelB sequence, at the 5' end (to facilitate the export of produced protein into the periplasmic space) and b) a stretch of six histidines {his-tag) at the 3' end (to provide an anchor for purification by immobilized ion affinity chromatography).
Polymerase chain reaction (PCR) cloning strategy can be used for making the constructs for gene expression such that full length proteins will be expressed whenever possible. Inserts can be verified by sequencing. Clones bearing the antigen's coding regions can be grown in 3X
terrific broth supplemented with ampicillin (100 ~g/ml) at 37°C. When cells reach an A~~~ of O.G, cultures can be induced by the addition of 0.4 mM IPTG. As a negative control, the host cell culture can be treated in a similar manner.
In order to optimize the time of harvest of expressed protein, the constructs can be analyzed for their time course of induction in E. coli. For large scale production of recombinant constructs, 14 liter cultures can be grown in a New Brunswick fermentor. The 6 histidine residues at the carboxyl terminus will facilitate process purification method using His-BindTM metal chelation resin. To verify the final purity of the isolated recombinant antigens, Coomassie blue [Amido black] and silver staining can be conducted on SDS-PAGE gels loaded with varying concentrations of the purified product.
Affinity purified antibodies may be generated to the recombinant protein can be tested on 2-D immunoblots to determine whether the identical protein spot originally selected is immunoreactive, thus providing an additional [immunological identity] proof that the desired cDNA has been obtained. By studying whether these antibodies bind to the sperm surface in immunofluorescence and FACS and evaluating their effects on protein function in a variety of in vitro assays, a role for a given protein in functional events mediated at the cell or virus surface can be confirmed.
It is further intended that membrane surface protein analogs may be prepared from nucleotide sequences of the proteins derived within the scope of the present invention.
Analogs, such as fragments, may be produced, for example, by pepsin digestion of material separated by gel analysis, or produced recombinantly. Other analogs, such as muteins, can be produced by standard site-directed mutagenesis of coding sequences.
As mentioned above, a DNA sequence encoding the membrane surface protein can be prepared synthetically rather than cloned. The DNA sequence can be designed with the appropriate codons for the amino acid sequence. In general, one will select preferred codons for the intended host if the sequence will be used for expression. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge, Nature, 292:756 (1981);
Nambair et al., Science, 223:1299 (1984); Jay et al., J. Biol. Chem., 259:6311 (1984).
Synthetic DNA sequences allow convenient construction of genes which will express membrane surface protein analogs or "muteins". Alternatively, DNA encoding muteins can be made by site-directed mutagenesis of native genes or cDNAs, and muteins can be made directly using conventional polypeptide synthesis.
The present invention extends to the preparation of antisense oligonucleotides and ribozymes that may be used to interfere with the expression of the membrane surface protein at the translational level. This approach utilizes antisense nucleic acid and ribozymes to block translation of a specific mRNA, either by masking that mRNA with an antisense nucleic acid or cleaving it with a ribozyme.
Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule. (See Weintraub, 1990; Marcus-Sekura, 1988.) In the cell, they hybridize to that mRNA, forming a double stranded molecule.
The cell does not translate an mRNA in this double-stranded form. Therefore, antisense nucleic acids interfere with the expression of mRNA into protein. Oligomers of about fifteen nucleotides and molecules that hybridize to the AUG initiation codon will be particularly efficient, since they are easy to synthesize and are likely to pose fewer problems than larger molecules when introducing them into cells. Antisense methods have been used to inhibit the expression of many genes in vitro (Marcus-Sekura, 1988; Hambor et al., 1988).
Ribozymes are RNA molecules possessing the ability to specifically cleave other single stranded RNA molecules in a manner somewhat analogous to DNA
restriction endonucleases. Ribozymes were discovered from the observation that certain mRNAs have the ability to excise their own introns. By modifying the nucleotide sequence of these RNAs, researchers have been able to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, 1988.). Because ribozymes are sequence-specific, only mRNAs with particular sequences are inactivated.
Investigators have identified two types of ribozymes, Tetrahymena-type and "hammerhead"-type. (Hasselhoff and Gerlach, 1988) Tetrahymena-type ribozymes recognize four-base sequences, while "hammerhead"-type recognize eleven- to eighteen-base sequences. The longer the recognition sequence, the more likely it is to occur exclusively in the target mRNA species. Therefore, hammerhead-type ribozymes are preferable to Tetrahymena-type ribozymes for inactivating a specific mRNA species, and eighteen base recognition sequences are preferable to shorter recognition sequences.
The DNA sequences described herein may thus be used to prepare antisense molecules against, and ribozymes that cleave mRNAs for membrane surface proteins and their ligands.
The present invention also relates to a variety of diagnostic applications, including methods for detecting the presence of particular cells or infectious agents, or antibodies thereto (i.e., in patient sera) by reference to their ability to bind to or compete with the binding of the membrane surface proteins. As mentioned earlier, the membrane surface proteins can be used to produce antibodies to themselves by a variety of known techniques, and such antibodies could then be isolated and utilized as in tests for the presence of particular target cells or infectious agents. Such antibodies may be used to analyze the cell surface proteins, and particularly in the case of analysis of sperm proteins, may be used to characterized sperm agglutination, sperm immobilization, surface immunofluorescence, FACS analysis, sperm penetration assays, hemi-zona assays, and localization on the 2-D
surface map.
As described in detail above, antibody(ies) can be produced and isolated by standard methods including the well known hybridoma techniques. For convenience, the antibody(ies) to the membrane surface protein will be referred to herein as Ab, and antibody(ies) raised in another species as Ab2.
The presence of cells or infectious agents containing the repertoire of membrane surface proteins can be ascertained by the usual immunological procedures applicable to such determinations. A number of useful procedures are known. Three such procedures which are especially useful utilize either the surface protein labeled with a detectable label, antibody Ab, labeled with a detectable label, or antibody Ab2 labeled with a detectable label. The procedures may be summarized by the following equations wherein the asterisk indicates that the particle is labeled, and "MSP" stands for the membrane surface protein:
A. MSP* + Ab, = MSP*Ab, B. MSP + Ab* = MSPAb,*
C. MSP + Ab, + Abz* = MSPAb,Abz*

W0.98/36771 PCT/US98/02913 The procedures and their application are all familiar to those skilled in the art and accordingly may be utilized within the scope of the present invention. The "competitive"
procedure, Procedure A, is described in U.S. Patent Nos. 3,654,090 and 3,850,752.
Procedure C, the "sandwich" procedure, is described in U.S. Patent Nos. RE
31,006 and 4,016,043. Still other procedures are known such as the "double antibody," or "DASP"
procedure.
In each instance, the membrane surface protein forms complexes with one or more antibody(ies) or binding partners and one member of the complex is labeled with a detectable label. The fact that a complex has formed and, if desired, the amount thereof, can be determined by known methods applicable to the detection of labels.
It will be seen from the above, that a characteristic property of Abz is that it will react with Ab,. This is because Ab, raised in one mammalian species has been used in another species as an antigen to raise the antibody Abz. For example, Abz may be raised in goats using rabbit antibodies as antigens. Abz therefore would be anti-rabbit antibody raised in goats. For purposes of this description and claims, Ab, will be referred to as a primary or anti-membrane surface protein antibody, and Abz will be referred to as a secondary or anti-Ab, antibody.
The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to ultraviolet light, and others.
A number of fluorescent materials are known and can be utilized as labels.
These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow. A particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate.
The membrane surface protein or its binding partners) can also be labeled with a radioactive element or with an enzyme. The radioactive label can be detected by any of the currently available counting procedures. The preferred isotope may be selected from'H, '4C, 3zp~ 3sS~ s~Cl~ siCr~ s~Co~ saCo~ s9Fe~ ~oY~ izsl~ ~sil~ ~d ~a~Re.
Enzyme labels are likewise useful, and can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques. The enzyme is conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like.
Many enzymes which can be used in these procedures are known and can be utilized. The preferred are peroxidase,13-glucuronidase, I3-D-glucosidase, f3-D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. U.S. Patent Nos. 3,654,090;
3,850,752; and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods.
In a further embodiment of this invention, commercial test kits suitable for use by a medical specialist may be prepared to determine the presence or absence of the repertoire of membrane surface proteins on suspected target cells. In accordance with the testing techniques discussed above, one class of such kits will contain at least the labeled membrane surface proteins) or its(their) binding partner(s), for instance an antibody specific thereto, and directions, of course, depending upon the method selected, e.g., "competitive,"
"sandwich," "DASP" and the like. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.
Accordingly, a test kit may be prepared for the demonstration of the presence or capability of cells for presence of the cell or infectious agent, comprising:
(a) a predetermined amount of at least one labeled immunochemically reactive component obtained by the direct or indirect attachment of the present membrane surface protein or a specific binding partner thereto, to a detectable label;
(b) other reagents; and (c) directions for use of said kit.
More specifically, the diagnostic test kit may comprise:
(a) a known amount of the membrane surface protein as described above (or a binding partner) generally bound to a solid phase to form an immunosorbent, or in the alternative, bound to a suitable tag, or plural such end products, etc. (or their binding partners) one of each;
(b) if necessary, other reagents; and (c) directions for use of said test kit.

In a further variation, the test kit may be prepared and used for the purposes stated above, which operates according to a predetermined protocol (e.g.
"competitive," "sandwich,"
"double antibody," etc.), and comprises:
(a) a labeled component which has been obtained by coupling the membrane surface protein to a detectable label;
(b) one or more additional immunochemical reagents of which at least one reagent is a ligand or an immobilized ligand, which ligand is selected from the group consisting of:
{i) a ligand capable of binding with the labeled component (a);
(ii) a ligand capable of binding with a binding partner of the labeled component (a);
(iii) a ligand capable of binding with at least one of the components) to be determined; and (iv) a ligand capable of binding with at least one of the binding partners of at least one of the components) to be deternlined; and (c) directions for the performance of a protocol for the detection and/or determination of one or more components of an immunochemical reaction between the membrane surface protein and a specific binding partner thereto.
In accordance with the above, an assay system for screening potential drugs effective to modulate the activity or binding of the membrane surface protein may be prepared. The membrane surface protein may be introduced into a test system, and the prospective drug may also be introduced into the resulting cell culture, and the culture thereafter examined to observe any changes in the activity of or binding of the cells, due either to the addition of the prospective drug alone, or due to the effect of added quantities of the known membrane surface protein. Suitable assays may include sperm motility assays or in vitro fertilization.
In addition, suitable animal models, particularly for fertility trials, include mouse and macaque.
The membrane surface proteins may also be used as vaccines, or in the case of spern~
antigens, as contraceptives.
Once several unique, testis specific sperm surface immunogens are identified, they WO 98/36x71 PCTNS98/02913 may be moved smoothly and efficiently through the contraceptive development pathway using a system of triage. Candidate molecules should meet the strict criteria of surface localization, testis specificity, and activity in at least one functional test. Proteins whose cDNAs have been cloned and sequenced are tested for tissue specificity. If testis specific, they will be expressed as recombinant proteins and antibodies to the recombinant protein generated. These antibodies will be used to validate the surface localization and biological effects of the immunogenic epitopes in functional assays.
Proteins repeatedly shown by vectorial labeling methods to be exposed on the human sperm surface proteins include isoantigens defined by infertile sera, autoantigens defined by sera from vasectomized men, and antigens which induce sperm agglutination.
These proteins are candidates for immunocontraception.
In order to avoid autoimmune complications it is particularly important that the molecules selected for immunocontraceptive development exhibit tissue specificity. i.e., that they be expressed only in the intended target tissue, the testis, and on sperm. It is prudent to address tissue specificity at the vaccinogen discovery phase rather than later during toxicological and teratological safety studies. This strategy minimizes unnecessary expenditure of time and resources on immunogens which are widely distributed in tissues aid thus are potentially capable of inducing immune pathologies. The potential complications of immunization with contraceptive vaccines include: 1 ) immediate hypersensitivity and anaphylactic responses; 2) delayed hypersensitivity responses; and 3) autoimmune response and autoimmune disease due to immune reaction with endogenous antigens of the immunized subjects. Many of these concerns may be obviated by selection of non-crossreactive immunogens specific to the testis and sperm. Immunohistochemical, Northern and RT-PCR
studies of tissue specificity of proposed contraceptive immunogens provide important supporting evidence. The Northern blots and RT-PCR methods, although providing evidence for tissue specificity at the mRNA level, may not detect epitopes present in a selected vaccinogen that may be present in another unrelated molecule [due to conformational folding or other types of molecular mimicry]. Thus, immunohistochemical tests complement the molecular methods and may reveal cross reactive epitopes which cannot be predicted solely on the basis of comparisons of primary amino acid sequence.
The combination of Northern blot, RT-PCR and immunohistochemical methods can identify gamete-specific antigens that carry less risk of autoimmune disease.
This provides information as to the step of spermatogenesis at which a given protein is first expressed, providing insight - a given testis specific- gene is active before or following meiosis. Such knowledge is germane to identifying post-meiotic genes for study of transcriptional regulation, a possible route to discovering a means to regulate spermatogenesis, and to developing a male contraceptive.
In order to proceed with immunogenicity and fertility trials of candidate sperm immunogens, their homologues can be cloned in mice and monkeys and the recombinant proteins expressed and purified.
Both monkey and mouse homologues may be cloned using testis libraries previously reparted in the literature. [Proc. Natl. Acad. Sci. USA 84: 5311-5315 {1984);
Mol. Repd.
Dev. 34: 140-148 (1993).]
Female B6AF 1 mice, 6-8 weeks of age, can be immunized with approximately 20 ug of the homologous recombinant immunogen. The immunogen can be emulsified with an equal volume of complete Freund's adjuvant (CFA) for a final volume of 100 ul.
Animals in the control group will receive PBS/CFA. Each animal can be injected in two sites at the base of the tail. Two to three booster immunizations in incomplete Freund's adjuvant can be given at two week intervals. Blood is collected by tail bleeds before immunization, two weeks post-immunization and 7-10 days after each boost. Sera is assayed for antibodies by ELISA
using sperm extract and recombinant immunogen as targets. The sera can be further tested for reactivity to native protein by immunofluorescence and immunoblot analyses of mouse sperm and sperm extracts, respectively. Beginning one week after the final boost with recombinant immunogen, each female mouse is housed continuously with one male mouse of proven fertility. The females will be checked each morning for the presence of a vaginal plug indicating mating has occurred. On day 1 S after introduction of the males, the females are sacrificed and the embryos counted.
Macaques can be injected intramuscularly with 500 ug in squalene-arlacel A
followed by booster immunizations at three week intervals with 200 ug or control squalene. Sera, cervical mucus and oviductal fluid (collected via a surgically implanted oviductal cannula can be collected prior to immunization and at weekly intervals. Antibodies can be assessed by ELISA on both recombinant immunogen and native sperm extract targets. The sera can be further tested for reactivity to native protein by immunoblot and immunofluorescence analyses with monkey and human sperm and sperm extracts. The sera can then be further tested for their ability to exhibit sperm functional tests. Imrnunogens that evoke high titers of antibodies to the recombinant immunogen that also cross react with the sperm surface and block at least one functional test proceed to fertility trials.
For the fertility trial, macaques are immunized as above with recombinant immunogen ( 1 S animals) or control squalene ( 15 animals). Sera is collected prior to immunization and at weekly intervals. Antibodies are assessed by ELISA, Western and immunofluorescence analyses. Following the last immunization, each female is co-habitated for five days with a male of proven fertility during the fertile period of her cycle beginning three days prior to expected ovulation. Matings begin during the third cycle after the initial immunization and continue for nine consecutive cycles or until she is confirmed pregnant.
Pregnancies are terminated by the administration of the anti-progestational agent, sulprostone. Daily observations is made to detect abortions prior to six weeks of pregnancy.
In the fertility trial, test of significance between fertility rates for the vaccinated and control animals can rely primarily on nonparametric randomization procedures.
Fisher's exact test and tests based on binomial proportion can be employed. In addition, the significance of the difference between vaccinated and control groups in numbers of fertile and non-fertile animals can be determined by traditional Chi square analysis.
The time to pregnancy can be analyzed using a variety of life table methods, including nonparametric comparisons of survival curves, the test of Mantel-Haenszel, various probability models and proportional hazards regression models. Similar procedures can be utilized to examine the association between antibody titers and the time to a fertility outcome.
Depending on the outcome of the study, for example, it may prove instructive to compare the antisperm antibody levels of vaccinated fertile animals with vaccinated non-fertile animals.

WO 98/36771 PCTlUS98/02913 Alternatively, the antisperm antibody levels of animals that became fertile at different times may be compared. For group responses which involve continuous outcomes, two-sample comparisons can be made using the nonparametric Wilcox rank sum test and the usual two-sample t-test. In some instances, regression models (including analysis of variance and covariance) can be examined along with weighting and transformation of data to improve model fit and to optimize statistical estimation and inference.
If immunization of either mice or monkeys causes a high degree of infertility, the result supports the continued investigation of the immunogen. If the efficacy is high in primates, it indicates that the human immunogen would be useful in a formulation for human immunogenicity testing (Phase I). If the effect on fertility is modest, it would support inclusion of the immunogen as one component of a mufti-determinant contraceptive vaccine formulation. If a given immunogen shows no effect, the result would indicate that the immunogen should either 1) be discounted for further study or 2) retested in an alternative delivery systems which might induce higher or more sustained titers of antibodies in the female reproductive tract.
If 75% infertility or better is achieved for a given immunogen in the experimental group, two possible options are: 1 ) to continue to mate the infertile animals and begin a reversibility/continuing infertility study or 2) to perform histopathology. If the latter is chosen, tissues can be obtained at the conclusion of the fertility-trial from vaccinated females and immersed in fixative. Standard formaldehyde fixation, paraffin embedding and H&E
staining can be performed on the cerebellum, cerebrum (frontal and temporal regions), brain stem, cardiac muscle, dorsal aorta, skeletal muscle, pancreas, spleen, letter, adrenal, stomach, gall bladder, duodenum, jejunum, colon, kidney, bladder, ovary, uterus, mammary gland, umbilical cord, and parotid gland.
An effective contraceptive vaccine against sperm antigens requires an immune response that elicits maximal antibody titers in the female reproductive tract. Systemic immunization with the sperm antigen SP-10 evokes IgG antibody responses in the oviductal fluids and intracervical immunization affords an effective alternative immunization route. If systemic immunization alone results in insufficient amounts of antisperm antibodies in the WO 98/36771 PCT/(JS98/02913 reproductive tract fluid during immunogenicity trials, immunization regimens that include intra-cervical immunization to selectively increase the amount of IgA and IgG
antibodies in female macaque reproductive tract fluids can be tested.
Having generally described this invention, a further understanding can be obtained by reference to certain specific examples which are provided herein for purposes of illustration only and are not intended to be limiting unless otherwise specified.
EXAMPLES
Experimental procedures Materials Ammonium persulfate, BSA, citric acid, PMSF (phenylmethylsulfonyl fluoride diethanolamine, glycerol, urea (Sigma Uitra), Trizma Base (Sigma Ultra), Nonidet P40, CHAPS, PDA (N,N'-diacryloylpiperazine), DTT, iodoacetamide, leupeptin and pepstatin A
were obtained from Sigma. EDTA was purchased from J.T. Baker. Silver nitrate was from Mallinckrodt Chemicals. Sodium bicarbonate, sodium chloride and sodium hydroxide (all ACS grade) were from Fisher. SDS (sodium dodecylsulfate, Ultrapure), glycine (electrophoresis grade) and sodium phosphate were obtained from ICN. Percoll, Ampholines pH 3.5-5, pH 5-7, pH 7-9 and pH 3.5-10, Pharmalyte pH 6.5-9, pH 5-8 and pH 8-10.5 and a carbamylated calibration kit for 2D electrophoresis were purchased from Pharmacia Biotech.
Enhanced chemiluminescence (ECL) kits for Western blot analyses were obtained from Amersham Corp. {for detection of peroxidase conjugates) and from Tropix (for detection of alkaline phosphatase conjugates). Protogold for staining of blotted proteins was purchased from Goldmark. TLCK (N-p-tosyl-L-lysine chloromethyl ketone) and TEMED were from Boehringer Mannheim. Lectin conjugates were from Vector. Carrier free Na'z5I
was from Amersham Corp. Intensifying screens NEF-490 and NEF-491 were purchased from Du Pont.
HRP-conjugated avidin and 2-D SDS-PAGE standards were obtained from BIO-RAD.
NHS-LC-Biotin, Iodo-Beads and AP-conjugated avidin were from Pierce. All secondary antibodies used in Western blotting were obtained from Jackson ImmunoResearch Lab.

Example 1 Preparation of Spermatozoa Semen specimens were obtained from normal, healthy young men by masturbation.
Only ejaculates with normal semen parameters (28) were used in this study.
Individual semen samples were allowed to liquify at room temperature (normally for 1/2 to 3 hours) and the mature sperm were separated from seminal plasma, immature germ cells and non-sperm cells (mainly white blood cells and epithelial cells) by Percoll density gradient centrifugation.
Liquified semen was carefully loaded over a two-layer Percoll density gradient consisting of 80% (l.m bottom layer) and 55% (2ml top layer) isotonic Percoll solution prepared in Ham's F-10 medium. After centrifugation at 300 x g for 18 minutes at room temperature, the sperm pellet at the bottom of the 80% layer was collected and washed three times in Ham's F-10 medium by centrifugation at 450 x g. The cells were counted prior to the last centrifugation, and the pellet was used for vectorial labeling. Light microscopic evaluation was used to confirm enrichment of motile mature spermatozoa, and all samples showed > 90%
motility.
Example 2 Seminal plasma analysis Seminal plasma samples from two patients which had undergone vasectomy were analysed by 2D gel electrophoresis. Following collection the samples were allowed to liquefy at room temperature, examined by microscopy to verify the absence of spermatozoa or immature germ cells, centrifuged at 10,000 x g for 5 minutes to remove non-germ cells and prostatic crystals, and stored in aliquots at -70°C until use.
Example 3 Radioiodination Percoll purified spermatozoa were suspended in Ham's F-10 medium to a final concentration of 20 x 10''/ ml. Washed Iodo-Beads (one bead per 8 x 10~
spermatozoa) and carrier free Na'ZSI (10 uCi per lOG spermatozoa) were added to the sample.
Radiolabeling was performed by incubating the sample for 10 minutes at 20°C on a rocking table. The cells were removed from the Iodo-Beads by pipetting and immediately subjected to a second Percoll density gradient centrifugation, prior to washing three times in Ham's F-10 medium.
The cells were counted prior to the final wash and the resulting pellet was used for extraction of sperm proteins (see below). Autoradiography was performed using a sandwich of components in order: intensifying screen, blot, two layers of film and intensifying screen. X-ray films were routinely exposed for 3 weeks.
xa 1 4 Biotinvlation Percoll purified spermatozoa were suspended in Dulbecco's phosphate buffered saline containing 3 mg/ml of NHS-LC-Biotin (~SmM), to a final concentration of 50 x 10'' spermatozoa per ml. Biotinylation of the sperm surface was performed by incubating the sample for 10 minutes at 37°C on a rocking table. The spermatozoa were then subjected to a second Percoll density gradient centrifugation followed by three washes in Ham's F-10 medium. The cells were counted prior to the final wash and the resulting pellet was used for solubilization or stored at -70°C.
After preliminary studies to optimize detection of biotinylated proteins, the procedure to detect biotinylated sperm proteins following electrotransfer to NC-membranes was as follows: 2D western blots were rinsed twice in PBS pH 7.4 and then excess binding sites on the nitrocellulose membrane were blocked by incubation in PBS containing 5%
gelatin and 0.1% Tween 20 for lh at 20°C (29). This was followed by a 5 minute wash in PBS and incubation with alkaline phosphatase conjugated avidin (50 ul in 250 ml PBS
containing 0.5% gelatin and 0.01% Tween 20) for lh at 20°C. Chemiluminescence detection of alkaline phosphatase with the substrate CSPD was performed according to the manufacturer's directions {TROPIX). Colorimetric detection of AP was performed with the substrates BCIP
and NBT as previously described (17). Samples from 5 donors (including samples from 2 of the 4 donors examined by radioiodination) were examined by this vectorial labeling technique.

Ex m 5 Solubilization Procedures Spermatozoa were routinely solubilized in a lysis buffer {A) containing: 2%
(v/v) NP-40; 9.8 M urea; 100 mM DTT; 2% (v/v) ampholines pH 3.5-10; and the protease inhibitors 2 mM PMSF, 5 mM iodoacetamide, 5 mM EDTA, 3 mghnl TLCK, 1.46 ,uM Pepstatin A and 2.1 ,uM Leupeptin. S x 10g cells per ml were solubilized by constant shaking at 4°C for 60 minutes. Insoluble material was removed by centrifugation at 10,000 x g for 2 minutes, and the supernatant was applied to the first-electrophoretic dimension. Frozen seminal plasma samples from vasectomized patients were thawed by addition of four volumes of Ivsis buffer A containing the above noted protease inhibitors.
Other experiments employed an anionic/zwitterionic lysis buffer {B) [as given by Hochstrasser (30)], consisting of 2% (w/v) SDS, 3% (w/v) CHAPS, 7.2 M urea, 100 mM
DTT, 4% ampholines pH 3.5-10 and protease inhibitors. Solubilization took place at 22°C
for 45 min. with a sperm concentration of 3.5 x I OR cells per nil. Samples were agitated every five minutes by inversion of the microcentrifuge tubes, to minimize unfolding of DNA, because constant shaking or heating in presence of SDS and reducing agents leads to solubilization of the nuclear envelope and unfolding of the supercoiled DNA
(Naaby-Hansen and Bjerrum, unpublished results). Protein concentrations were determined by using the Pierce biocinchoninic acid method according to the manufacturer's specifications, employing bovine serum albumin (BSA) as a standard.
Example 6 Electrophoresis Isoelectric focusing (IEF) was performed in 15 x 0.15 cm acrylamide rods, using either the gel composition proposed by Hochstrasser et al (30) or by Cells et al ( 1 G). Carrier ampholine compositions were either 20% pH 5-7, 20% pH 7-9 and 60% pH 3.5-10 or 28%
pH 3.5-~, 20% pH 5-7, 7% pH 7-9 and 45% pH 3.5-10.65 ,ul of sperm extract (approx.
0. l5mg of protein) or 35 ,ul of seminal plasma sample (approx. O.I Smg of protein) were applied per rod. The tubes were filled by gently overlaying the sample with a buffer containing 5% NP-40, 1% ampholines pH 3.5-10, 8 M urea and 100 mM DTT.
Focusing was conducted for a total of 19,300 volt-hours using voltage stepping: 2h at 200V, Sh at SOOV, 4h at 800V, 6h at 1200V and 3h at 2000V.
Nonequilibrium pH gradient electrophoresis (NEPHGE) was performed in 14 x 0.15 cm acrylamide rods using the gel composition described by Celis et al ( 16).
The carrier ampholyte composition was 37% pH S-8, 13% pH 6.5-9, 37% pH 8-10.5 and 13% pH
3.5-10.
55 ul (approx. 0.13 mg of protein) of spermatozoa extract or 30 ul of seminal plasma sample (approx. 0.13 mg of protein) were applied per rod. These protein concentrations gave similar spot sizes on NEPHGE gels as achieved by slightly higher concentrations on IEF
gels using Hochstrasser's protocol. Electrophoresis was conducted for a total of 9800 volt-hours, 400 volts for 11 hours and 600 volts for 9 hours.
Second dimensional SDS-PAGE was carried out in 0.15 cm thick, 16 x 16 cm or 16 x 20 cm slab gels using linear gradient gels (T= 7.5-15% or 9-1 S%) in a Protean II xi Multi-Cell apparatus (Bio-Rad). Silver staining was performed according to Hvchstrasser et al (30).
Electrotransfer to nitrocellulose membranes was accomplished as previously described (23).
Electrotransfer to PVDF membranes (0.2 um pore size, Pierce) was carried out as described by Herizel et al. (31 ) using the transfer buffer composition of Matsudaira (32)( l OmM 3-[cyclohexylamino)-1-propanesulfonic acid, 10% methanol, pH 11 ). Routinely, six 2-D gels were transferred simultaneously at a constant current of O.SA for 2 hours using three transblot cells (Bio-Rad) connected to the same power supply.
Example 7 Immnnoblotting Analysis Following electrophoretic transfer of the 2-D separated polypeptides, the immobilizing membranes were rinsed twice for 5 minutes in PBS pH 7.4 and excess binding sites were blocked by incubation for 30 minutes at room temperature in PBS pH

7.4 containing 5% dry milk and 0.05% Tween 20. 2-D blots were incubated with 100 ml of primary antibody for 2 hours at 22 °C
or overnight at 4°C, under constant slow rocking. The following antibodies were employed:

WO 98/36771 PCT/US98l02913 antiactin (mouse mAb clone C4, Boehringer Mannheim, 0.3 ,ug/ml), anti-~i-tubulin (mouse mAb Tu 27BC, hybridoma supernatant, gift from Dr. Robert Bloodgood, University if Virginia, diluted 1:5), anti-a-tubulin (mouse mAb, clone DM-lA, Sigma, diluted 1:10,000), anti-SP-10 (mouse mAb MHS-10, diluted 1:5,000), anti-fibrous sheath proteins (mouse mAb S69, gift from Dr. C.G.Lee, University of Vancouver, BC, diluted 1:1,000) and anti-PH-20 (rabbit polyclonal Ab R-10, gift from Dr. Paul Primakoff, UC Davis, diluted 1:3,000).
Secondary enzyme conjugated antibodies (goat anti mouse Ig and goat anti rabbit Ig) were diluted 1:5000 in PBS plus 0.05% Tween 20, and the blots were incubated for 1.5 h at 20°C.
None of the secondary antibodies bound to blotted human sperm proteins.
Horseradish peroxidase conjugates were visualized calorimetrically using DAB as a substrate or by ECL
using the manufacturer's protocol (Amersham Corp.).
To detect phosphorylated tyrosine residues the mAb RC-20 (Transduction Laboratories) was employed. The blots were blocked by incubation in 1% BSA in IOmM
Tris, pH7.5, O.1M NaCI, 0.1% Tween 20, for 20 minutes at 7°C.
Horseradish peroxidase conjugated mAb RC-20 was diluted 1:2500 in the above buffer, the blots were incubated for 20 minutes at 37°C, and binding was detected by ECL.
In order to identify the exact location of an immunoreactive antigen in the complex 2-D protein pattern, in some experiments antibody incubations were preceded by gold staining with Protogold (Goldmark Biologicals). The manufacturer's protocol was followed, with the modification that blocking of the membrane was performed in 0.05% Tween 20 for minutes. This concentration of Tween 20, instead of the recommended 0.3% Tween 20, resulted in better spot resolution with less confluent staining patterns in areas with high density of polypeptides.
Example 8 Gel Scanning and Computer Analysis Stained gels were scanned in a wet state with a high resolution Kodak camera, and the information was digitized on a SUN computer. X-ray films from autoradiographic and chemiluminescence experiments were scanned with either the Kodak camera or a Howtek scanmaster 3+ Laser scanner. The resulting 2-D images were analysed with a Bioimage program "2D Analyzer". Sperm samples from 40 donors were analysed in over 500 2-D gels in order to optimize the procedures. Following establishment of a reliable protocol, sperm samples from 8 donors were analysed repeatedly on 2-D gels, and the protein patterns were compared in order to reduce the likelihood of cataloging artifactual spots.
Spots that appeared on two or more analyses from each donor were considered valid. Spot matching in different gel images was performed by the computer program after as many reference spots as possible (for silver stained gels the maximum 100 allowed by the software) had been manually matched by the operator. The isoelectric points and molecular weights of unknown spots were interpolated by the computer program on the basis of the position of co-migrating internal standards, and, in addition, the molecular weight results were manually verified by calculation from semilogarithmic plots. The internal standards (BIO-RAD) were:
hen egg white conalbumin type I, MW 76,000, pI 6.0,6.3 and 6.6; bovine serum albumin, MW
66,200, pI 5.4, S.S and 5.6; bovine muscle actin, MW 43,000 pI 5.0 and 5.1;
rabbit muscle glyceraldehyde-3-phosphate dehydrogenase (GAPDH), MW 36,000, pI 8.3 and 8.5;
bovine carbonic anhydrase, MW 31,000, pI 5.9 and 6.0; soybean trypsin inhibitor, MW
21,500, pI
4.5; and equine myoglobin, MW 17,500, pI 7Ø Carbamylated creatine phosphokinase (MW
40,000 and apparent pI range 4.9-7.1) and carbamylated GAPDH (MW 36,000 and apparent pI range 4.7-8.3) (Pharmacia) were applied as pI markers.
Results Silver stained 2-D gels (20 x 16 cm) of nonionic detergent/urea solubilized human sperm proteins resolved 1397 different protein spots (963 by IEF/PAGE and 434 by NEPHGE/PAGE) (Figure I A&B). 1345 of the 1397 proteins were identified in samples from at least two of the donors. 1191 proteins (838 by IEF/PAGE and 353 by NEPHGE/PAGE) were resolved when the anionic/zwitterionic lysis buffer was employed for sperm solubilization (Figure 9 A&B). The protein pattern was highly reproducible, although minor variations between donors were observed. For example, Figure 2 illustrates differences in the abundance of a 39.5 kDa protein among 3 donors.

The 2-D pattern of human sperm proteins differs significantly from the 2-D
pattern of human seminal plasma (HSP) proteins (Figure 1 ). More than 300 seminal plasma proteins were visualized by silver staining following 2-D electrophoretic separation (Figure l, C&D).
Seminal plasma polypeptides which co-migrated with sperm proteins were identified by computer matching of silverstained gels containing sperm proteins, seminal plasma proteins, or a mixture of both, which insured a precise comparison. By this approach nine proteins with MW above 20 kDa were identified as sperm coating proteins derived from the seminal plasma (indicated by arrows in Figure 1 ). All nine were vectorially labeled with either radioiodine or biotin or both (see Figures 7,8 and 11). In general, the identification of sperm coating proteins from the seminal plasma with molecular masses below 20 kDa was difficult due to an abundance of seminal plasma degradation products, especially in the basic pH-range (Figure 1D), in accordance with the observations by Edwards et at. {33).
In one experiment silver stained gels containing sperm harvested after 1 hour were compared to gels loaded with proteins from the same sample allowed to liquify for 3 hours. No significant difference in the protein pattern could be detected, indicating that no major modifications of the sperm surface proteins were induced by seminal plasma enzymes following liquefaction (data not shown).
Example 9 Radioiodination of human spermatozoa surface proteins The kinetics of'ZSI incorporation into human sperm proteins were examined with and without IODO-BEADS catalysis. The optimal reaction time was 10 minutes, after which the rate of incorporation of radioiodine into the sperm pellet declined, indicating that surface accessible phenols were saturated (Figure 3). In the absence of the catalytic N-chlorobenzenesulfoamide coated beads, less than 1 % of the '25I was incorporated into the cells. Although radioiodine was incorporated at a higher rate with higher concentrations of beads, the use of more beads resulted in progressive membrane destruction, radiolabeling of internal protein standards, and decreased sperm motility. Therefore, we further reduced the number of the oxidating beads to one bead per 8 x l OG spermatozoa. This reduced the amount of radioiodine incorporation to 50% compared to the former bead/cell ratio, but preserved postlabeling sperm motility.
To determine whether radioiodination occurred only on the sperm surface, autoradiography was performed from nitrocellulose or PVDF blots which had been immunostained with antibodies for cytoskeletal and intra-acrosomal proteins (Figures 4, 5 and 6). To eliminate damaged or acrosome reacted cells from the analysis, the sperm population was separated by Percoll density gradient centrifugation immediately following radioiodination. Comparison of iodinated sperm with [Fig 4B] and without [Fig 4A] the Percoll density centrifugation showed that, although extracts of sperm that underwent the second density gradient centrifugation had fewer labeled proteins, there was higher resolution of individual proteins, and no labeling of the intracellular control marker proteins (the acrosomal protein, SP-10, Figures 4 and 6; actin, Figures 4 and S; fibrous sheath components, Figure 9; and tubulin, Figure S). This strongly supports the surface specificity of the modified radioiodination procedure. When extracts of radioiodinated sperm in presence and absence of reducing agents were compared, several surface proteins participating in high molecular weight complexes, stabilized by interchain disulfide bridges, were identified (Figure 5).
Samples of spermatozoa from 4 donors were analysed after radioiodination, post-labeling Percoll density gradient separation, and extraction with NP-40 and urea. The pattern of radioiodinated proteins was highly reproducible from donor to donor as may be appreciated by comparing two of the donors, Figures 7A+B to 7C+D. Computer image analysis of gels from the four donors showed consistent radioiodination of 181 spernz surface proteins ( 103 IEF/PAGE and 78 NEPHGE/PAGE ) with Mr between 5 and 150 Kd and pI
ranging from pH 4 to 11. Minor interdonor variations were noted in the charge as well as in the relative concentration of some of the labeled proteins, as estimated by optical density;
e.g., the 90-95 Kd protein complexes indicated by arrows in Figure 7. The high level of reproducibility from experiment to experiment may be further appreciated by comparing iodinated proteins in Figures 4 and 7.

Example 10 Biotinylation of human sperm surface proteins The 2-D patterns of biotinylated proteins from samples of spermatozoa incubated with the sulfonated NHS-LC-biotin for 10, 20, 30 and 45 minutes were compared using the ECL
detection method (data not shown). No difference was observed between the number of proteins labeled after a 10 or 20 minute exposure to biotin. However longer incubation times (30-45 minutes) resulted in progressive labeling of cytoskeletal and intraacrosomal proteins;
thus, a 10 minute biotinylation period was used in subsequent studies. Because addition of 1 % bovine serum albumin to the first washing buffer to react with residual biotin (as recommended in many biotinylation protocols), resulted in adherence of significant amounts of biotinylated BSA to the spermatozoa) surface, sperm samples were instead submitted to Percoll density gradient centrifugation following labeling.
Figures 8A & B display chemiluminescent films of two-dimensional gels containing biotinylated spermatozoa) proteins solubilized by the nonionic lysis buffer A.
Biotinylated sperm samples from 5 donors were separated by IEF and NEPHGE, and the images were compared by computer analysis. Two hundred twenty eight biotinylated protein spots with Mr between 5 and 120 Kd and pH ranging from pH 4 to pH 10 were resolved and catalogued.
Interestingly, when unbiotinylated sperm proteins were incubated with AP-avidin alone as a control (Figures 8C and 8D), a cluster of five spermatozoa) proteins with Mr of 76 kDa and pI between 6 and 6.5 bound labeled avidin. The nature of these endogenous avidin-binding proteins is presently being investigated. No endogenous alkaline phosphatase activity was detected in these or other proteins when control blots were developed without prior exposure to AP- avidin (data not shown).
When the anioniclzwitterionic lysis buffer B was employed to extract sperm protein (Figures 9A & B) 208 biotinylated proteins could be resolved (Figures 9C & D).
Several protein constellations in the biotin pattern could be recognized from the pattern achieved following extraction with non-ionic detergent (compare Figures 9C and 9D to Figures 8A and 8B).
To validate the specificity of the biotinylation and extraction methods for the sperm surface, control cytoplasmic proteins were immunolocali2ed and their biotinylation status was determined by comparison to the ECL-film. None of the internal controls actin, tubutin, fibrous sheath components or SP-10 were biotinylated (Figure 9).
In contrast to results with known cytoplasmic proteins, the immunoblots in Figures 9G and H show the position of the sperm surface hyalurorlidase PH-20 after SDS/CHAPS
extraction and immunobIotting with the polyclonal rabbit antiserum R-10. Two molecular weight forms of PH-20 at 64 and 53 kDa were extracted by SDS/CHAPS (arrows in Figures 9G and H). The 53 kDa antigen could be resolved into 3 isoforms following solubilization with NP-40/Urea (Figure 8E) and into 5 isoforms following solubilization with SDS1CHAPS/urea (Figure 9G). The exact position of the PH-20 antigens in the silver stained and biotinylated 2-D patterns is shown in Figures 9A and 9C. Biotinylation of PH-20, a known surface protein (34) serves as a positive control for surface specificity of the labeling procedure.
Exam) la a 11 Demonstration of surface proteins phosphorylated on tyrosine residues The anti-phosphotyrosine Mab, RC-20 bound phosphoproteins from fresh ejaculated sperm (Figure 10). The proteins which were most heavily phosphorylated in tyrosine residues had molecular masses of 89-95 Kda (arrows in Figure l0A). Computer analysis revealed five groups of surface proteins phosphorylated in tyrosine residues.
The 22 protein isoforms of these groups are indicated by a star in Table III.
Exams l2 Computer analysis of 2D results Figure 11 presents a computer generated image of the human spermatozoa) proteins visualized by silver staining following solubilization with NP-40 and UREA.
Ninety four of the ninety eight proteins which were labeled by both surface iodination and surface biotinylation and could be matched to silver stained proteins are encircled in Figure 11. The Mr, Pi and relative abundance (based on gaussian quantification) are recorded in Table III for the dual labeled surface proteins. Blots of labeled proteins were exposed for various lengths of time to ensure optimal detection of both weak and strong signals. To eliminate the possibility that variations in migration between labeled and unlabeled proteins affected the analyses, autoradiograms and biotin ECL films were matched to the corresponding silver stained gels or gold stained blots. These composite images were then matched to composite images of silver stained gels of unlabeled proteins.
The present invention advances understanding of the composition of membrane proteins, particularly of human sperm by establishing a comprehensive 2-D gel database including 1397 proteins which were solubilized by NP-40/IJREA and 1191 proteins which were resolved following SDS/CHAPS/UREA treatment. To generate this database, techniques were developed to achieve high resolution and to permit detection of a range of acidic. neutral and basic sperm proteins using both IEF and NEPHGE for first-dimensional electrophoretic separation. A recent report described the resolution of 680 human sperm proteins in one 2-D gel (26), while the present invention utilized conditions by which more than 1000 protein spots were resolved in one gel. The improved resolution was achieved by modif cation of the sperm purification and solubilization procedures, adjustment of the ampholine composition, and optimization of the run times and voltage stepping for both IEF
and NEPHGE [see methods]. In particular, the increased voltage during NEPHGE
had a profound effect on the resolution of SDS/CHAPS solubilized proteins, causing less horizontal streaking than when shorter focusing times and less voltage were used.
Comparison of the repertoire of sperm proteins solubilized by the two lysis buffers employed in the present method showed important differences. For example, the anionicizwitterionic/urea lysis buffer was required to achieve solubilization of several cytoskeletal components. Further, this extraction method led to the resolution of five 53 kDa isofotms of the sperm surface hyaluronidase PH-20, whereas only three 53 k-Da isoforms were resolved using a nonioniciurea lysis buffer. Nevertheless, the non-ionic/urea solubilization method was the method of choice for this study because it readily solubiiized the plasma membrane with minimal contamination from cytoskeletal structures and because it resulted in the most reliable pI determination (e.g.,compare the migration of (3-tubulin in Figure 5 and 9).
Forty-four silver stained gels representing different sperm samples from 8 donors were analyzed by the "2-D Analyzer" software. Minor inter-individual variations in the abundance and/or the electrophoretic migration of some proteins were observed.
Variations in gene expression, genetic heterogeneity, and variations in post-translational modifications could account for these differences. An example of the latter is phosphorylation in tyrosine residues of the heterogeneous group of surface proteins with MW between 89-95 kDa. A
similar size tyrosine-phosphorylated protein has recently been shown to possess protein kinase activity (35) which was stimulated by human ZP-3, suggesting that this protein might be involved in zona pellucida binding and initiation of the acrosome reaction.
Although variations in phosphorylation and glycosylation may account for the some of the inter-individual variations in electrophoretic migration observed, further studies, such as analysis of surface changes during capacitation, carbohydrate sidechain analysis, protein microsequencing and cDNA cloning, are needed before definite conclusions about the nature and functional importance of the variations can be drawn.
"Sperm coating" proteins derived from secretions of the epididymis, prostate or seminal vesicles are known to adhere to the surface of ejaculated spermatozoa (36,37). The migration of several seminal plasma proteins was similar to that of spennatozoal proteins in 2-D gels, and 9 sperm surface proteins were identified that appeared to be of seminal plasma origin. Additional analyses are also contemplated by the present invention, including analysis of unliquified seminal plasma proteins (33,38), different washing and harvesting procedures, analysis of epididymal fluid and sperm, and microsequencing of the electrophoretically separated proteins, to confirm the origin of these surface proteins.
Some of the protein spots in the 2-D patterns were identified through immunoblotting or comigration analysis (e.g.,albumin and carbonic anhydrase). The preparation of immunological reagents to sperm proteins allows the identification of many of the protein in the sperm surface protein encyclopedia by immunoblotting. Tentative identif cation of some sperm proteins has also been made by comparison of the sperm database with other 2-D gel protein databases (16,39). Moreover, selected surface proteins may be microsequenced WO 98/36771 PCT/fJS98/02913 following purification by 2-D gel electrophoresis, Edman degradation and tandem mass-spectrometry. Previously unknown protein sequences have been successfully obtained by this approach (Naaby-Hansen et al., in preparation). Thus, updating of the sperm protein encyclopedia on a continuing basis can be used to monitor progress in understanding the molecular identity of sperm proteins and to serve as guide to the proteins that remain to be characterized. The database of membrane proteins is also useful in the study of clinical, genetic and toxicologic disorders affecting the male gamete and/or gametogenesis.
181 radio-iodinated sperm protein spots were resolved following NP-40/UREA
solubilization, and 228 proteins were labeled by surface biotinylation. 98 proteins were labeled by both techniques. One explanation for the differing results between radioiodination and biotinylation is that different amino acid residues were targeted by the labeling agents. In radioiodination, labeling occurs by electrophilic addition of cationic 125-iodine to tyrosine residues and to a lesser extent to the other phenols, histidine and trytophan (40), while NHS-LC-biotin reacts with primary amine groups (e.g., lysine residues or free amino-groups on carbohydrates or lipids) (41 ). Further, stearic hindrance by carbohydrate sidechains may interfere with biotinylation or its subsequent detection by avidin binding. If it is assumed that only 60% of the proteins in sperm are detected by silver staining as previously shown for a somatic cell line (42), an estimate of approximately 2300 sperm proteins is deduced. The deduced number approximates the number of [35S] methionine labeled proteins (>3000) found in somatic cells (16,39) by similar separation techniques. Thus the 311 surface proteins labeled by one or the other method represent approximately 12% of the total sperm proteins.
The 98 proteins labeled by both iodination and biotinylation comprise a subset of proteins which are considered prime candidates for microsequencing.
Principal concerns in procedures for labeling cell surface proteins with radio-iodine or biotin include: 1) establishing surface specificity (e.g., little or no labeling of cytoplasmic components); and 2) achieving sufficient specific labeling in surface accessible residues (43,44). Surface specific labeling has been previously reported with iodine using N-chlorobenzenesulfonamide as the oxidizing reagent on polystyrene beads [IODO-BEADS) (45) and with sulfonated N-hydroxysuccinimide ester forms of biotin (41,46,47). In the present method the known intracellular proteins actin, tubulin, fibrous sheathin, and the intra-acrosomal protein, SP-10, all lacked labeling by both methods, but it was important to remove damaged and acrosome reacted cells with Percoll density gradient centrifugation following the labeling procedures to ensure the surface specificity of the analysis.

A sperm protein with an apparent mass of G3 kDa and an isoelectric point of 4.3 was separated from other sperm proteins using lysis buffer A [NP-40/Urea] and preparative 2-dimensional gel electrophoresis using 23 x 23 cm gels. The protein was transferred to PVDF
membrane and the membrane was stained with Coomassie blue and the protein spot of interest was cut for Edman rnicrosequencing. For mass spectrometry, the 60kDa protein spot was cored directly out of the preparative acrylamide gel using a fine scaple and the protein was digested as below. Two methods of microsequencing were utilized, Edman degradation and Tandem Mass Spectrometry.
Edman degradation The protein spot on PVDF membrane was sequenced in an Applied Biosystems 470A
protein sequencer operated according to the manufacturers specifications, using a cartridge and cycles for PVDF membranes.
Mass-spectrometry analysis The spot was cut from the gel as closely as possible, minimizing extra polyacrylamide and divided into a number of smaller pieces. The pieces were washed and destained in 500 pl 50% methanol overnight. The gel pieces were dehydrated in acetonitrile, rehydrated in 50 pl of mM dithiolthreitol in 0.1 M ammonium bicarbonate and reduced at 55°C
for 1 h. The DTT
solution was removed and the sample alkylated in 50 ul 50 mM iodoacetamide/0.1 M ammonium bicarbonate at room temperature for 1 h in the dark. The reagent was removed and the gel pieces washed with 100 pl 0.1 M ammonium bicarbonate and dehydrated in 100 p.l acetonitrile for 5 min. The acetonitrile was remove and the gel pieces rehydrated in 100 pl 0.1 M
ammonium bicarbonate. The pieces were dehydrated in 100 p.l acetonitrile, the acetonitrile removed and the pieces completely dried by vacuum centrifugation. The gel pieces were rehydrated in 12.5 ng/pl trypsin [blocked for autodigestion] in SO mM ammonium bicarbonate and incubated on ice for 45 min. Any excess trypsin solution was removed and 20 pl 50 mM ammonium bicarbonate added. The sample was digested overnight at 37 °C and the peptides formed extracted from the polyacrylamide in two 200 p.l 50% acetonitrile/5% formic acid. These extracts were combined and evaporated to <20 ~1 for LC-MS analysis.
The LC-MS system constisted of Finningan-MAT TSQ7000 system with an electrospray ion source interfaced to a 10 cm x 75 um id POROS 10 RC reversed phase cappilary column.
One ql volumes of the extract were injected and the peptides eluted from the column by an acetonitrile/0.1 M acetic acid gradient at a flow rate of 0.6 uL/min. The electrospray ion source was operated at 4.5 kV with a 1.2 ~Lhnin coaxial sheath liquid flow of 70%
methanol/30%
water/0.125% acetic acid and a coaxial nitrogen flow adjusted as needed for optimum sensitivity.
The digest was analyzed by capillary LC-electrospray mass spectrometry to measure the molecular weight of the peptides present in the digest. Peptide sequences for the peptides detected were determined by collisionally activated dissociation using LC-electrospray-tandem mass spectrometry with argon as the collision gas.
RESULTS
Edman degradation 15 N-terminal amino acids were determined by Edman degradation. The obtained sequence EPAVYFKEQFLDGDG (SEQ ID No: 3)revealed 100% identity to human calreticulin (GenPep. accession # M84739).
Mass-spectrometry The molecular weights determined by LC-MS analysis and amino acid sequences determined by LC-tandem MS of peptides in this digest are shown in Table 1.
Nine peptides were observed and sequence information was obtained for six of the peptides.
Database searches using CAD spectrum information (MSTag) and partial peptide sequences (BLAST) identified five of these peptides in the sequence of human calreticulin (Table 2).

r ca N

cC

d~

N

.b i vi w U

M

et' _ bn ~1.

M U
J

cn v~ c~

cd L
w U

O

Cd O N

N

N
L

C~- w v f~

) H

w ~

~' w x ~ u"
c ., a > z w n o o b ~, ~ ~ ~ > ~

> x ~- w > > ~ a ~, Q

U

>, art .o Ll A

-d d + 3 U x o O
x w A

o b~ ~, ~ ; w a ~ ~ ~ ~b ~. C7 ~.~. b ~

a d ~ ~ ~ ~
~ O ~ ~ o ~ C

~
. y L1,~ ~ ..r~~ U'~ ~ W~ ~ ~ ~c~t i '~ ~

U

n r.w U
~ ~-.
~

,~
x x v 4+ 3 ~

. . y n ~rc~ O o Wit;~o00 "..a ~ o ~ o x N ~ N ~ O ~ O v -~

b V'1 O ..-~..., N -~ r fi M c V 00 ~
00 .-~ .~.-, - --.

r . ~ .-.

0~ c~

_ O O

N , ~ N M cY ~ ~D l~- 00O~ .
N
O

.~ ~ z ' x Design of Degenerate Oligonucleotides.
Two peptide sequences were chosen as templates for the design of degenerate oligonucleotides: Peptide Sequence #1- EPAVYFKEQFLD (SEQ ID NO: 15) and Peptide Sequence #2- KVHVIFNYK (SEQ ID NO: 11 ). See Figure 12.
Figure 12 shows amino acid microsequence data obtained by Edman degradation and tandem mass spectrometry from a sperm protein of 63 Kda, pI 4.3 chosen for design of complimentary and reverse-complimentary oligonucleotides. From this microsequence information pools of degenerate oligonucleotide primers were synthesized to initiate PRC
[see Fig. 13].
Protein seauence #I and its Sense-Oligonucleotide is shown below (SEQ ID NOS:
16-18).
N-Terminus- E P A V Y F
5'-GA(A/G)-CC(T/C/A/G)-GC(T/C/A/G)-GT(T/C/A/G)-TA(T/C)-TT(T/C)-Optimized Oligo 5'-GC(T/C)- GT(C/G)- TAC- TTC-K E Q F L -C-Terminus AA(A/G)-GA(A/G)-CA(A/G)-TT(T/C)-CT(T/C/A/G) AAG- GAG- CAG- TTC- CT-3' Protein sequence #2 and its Sense-Oligonucleotide is shown below (SEQ ID NOS:
12, 19, 20).
N-Terminus- K V H V I F
5'-AA(A/G)-GT(T/C/A/G)-CA(T/C)-GT(T/C/A/G)-AT(T/C)-TT(T/C)-Optimized Oligo 5'-AG- -GTG-CA(T/C)-GTG- ATC- TTC-N Y K
AA(T/C)-TA(T/C)-AA(A/G)-3' AAC- TAC- AAG-3' Due the degeneracy of the genetic code, optimum codon usage (Lathe, 1985) was employed to design "optimized oligonucleatides". Additional parameters that went into the design were that: A) areas of protein sequence with the least degeneracy were utilized to decrease the complexity of the oligonucleotide design; B) degenerate oligonucleotides were manufactured in order to cover all reasonable sequence permutations and C) oligonucleotides were maufactured in lengths of 20-30 nucleotides (Ausubel et al., 1996) depending on the G-C
content of the proposed oligonucleotide, the number of reliable amino acid residues that were sequenced and the temperature of melting that is inherent to that particular oligonucleotide pool. Protein sequence #1 (EPAVYFKEQFLDGD)(SEQ ID NO: 21) gave rise to the possible oligonucleotide sequence 5'-GA(A/G)-CC(T/C/A/G)-GC(T/C/A/G)-GT(T/C/A/G)-TA(T/C)-TT(T/C)-AA(A/G)-GA(A/G)-CA(A/G)-TT(T/C)-CT(T/C/A/G) or (SEQ ID NO: 17) TT(A/G)-GA(T/C)-GG(T/C/A/G)-GA(T/C)-3' (SEQ ID NO: 22). Applying optimized codon usage and the other parameters described above a final oligonucleotide sequence was derived as follows: 5'-GC(T/C)-GC(C/G)-TAC-TTC-AAG-GAG-CAG-TTC-CT-3' {SEQ ID NO:
23). Likewise, Protein sequence #2 (KVHV(I/L)FNYK)(SEQ ID NO: 7) when optimized and the reverse compliment taken, gave rise to the oligonucleotide sequence S'-CTT-GTA-GTT-GAA-GAT-CAC-(A/G)TG-CAC-CT-3' (SEQ ID NO: 24). Manufacture of oligonucleotide probes was performed by the Unversity of Virginia Core Group Facilities.
RT PCR-Cloning Using Pools of Degenerate Oligonucleotides PCR cloning was performed by first reverse transcribing 0.05 ~cg poly-(A)+ RNA
in a 20 /.cl reaction by combining 0.5 ,ug oligo-d(T),2_,R RNA and diethylpyrocarbonate (DEPC)-treated H20 prior to heating to 65°C for 10 min. Subsequently, 2 /cl 10X RT
buffer, 0.5 ~cl placental ribonuclease inhibitor (36 U/~l;Promega), 1 ,ul 10 mM 4dNTPs and 1 ~1 AMV
reverse transcriptase (23 U/~l;Stratagene) were added, vortexed and the mixture was incubated for 60 min at 42°C. After the addition of 80 ~cl DEPC-treated H20, 1 ,ul aliquots of the cDNA
solution were amplified for 40 cycles (94°C for 45 sec, 38/44/50/56°C for 45 sec, 72°C for 2 min) as specified by the Taq polymerase manufacturer (Promega or Perkin Elmer).
Separation and isolation of the PCR products was achieved by electrophoresis of reaction aliquots in 2.4% agarose gels made 1 X in TAE (40 mM Tris-acetate, 1 mM EDTA) buffer and collection of specific fragments. After precipitation and quantitation PCR
fragments were ligated into pCR-Script vectors according to manufacturers instructions (Stratagene) and sequenced.
The degenerate optimized oligonucleotides were employed in PCR reactions with testicular cDNA manufactured by reverse transcription of human testicular poly-(A)+ RNA.
The PCR reactions were analyzed on agarose gels [Figure 13] to demonstrate a single prominent PCR product migrating at approximately 400 bps from the reactions with the 38, 44 and 50°C annealing temperatures (Fig. 13, lanes 5, 8, 11 ) versus the negative controls performed at the same temperatures (Fig. 13, lanes 3, 4, G, 7, 9, 10, 12, 13).
Electroelution of the 400 by band, cloning into the pCR-Script vector, sequencing and computer analysis revealed that the sequence of the band, was identical to somatic calreticulin cDNA (GenBank accession #m84739) and therefore the 2-D gel spot from which the oligonucleotides primers were derived, was a testicular form of calreticulin (Figure 14).
Figure 14 shows the DNA sequence (SEQ ID NO: 25) obtained from clone derived by RT-PCR utilizing optimized, degenerate primers. Numbers indicate base pair position in sequenced clone and in the Calreticulin gene; (c) designates the RT-PCR clone (SEQ ID NO:
25) while (H) designates the human Calreticulin cDNA from GenBank (SEQ ID NO:
2G).
TTCCCGCTGGATCGAATCCAAACACAAGTCAGATTTTGGCAAATTCGTTCTCAGTTCCGG 80c IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIilllllllllll CAAGTTCTACGGTGACAGAGNAAAANATAAAGGTTTGCAGACAAGCCAGGATGCACGCTT 140c IIIIIIIillllllll I III IIIIIIIIIII~IIIIIillllllllllllllll TTATGCTCTGTCGGCCAGTTTCGAGCCTTTCAGCAACAAAGGCCAAACGCTGGTGGTGCA 200c IIIIIIIIIIIIIIIIIIIIIIIiilllllllillllllllllll Illlllllllllll GTTCACGGTGAAACATGAGCAGAACATCGACTGTGGGGGCGGCTATGTGAAGCTGTTTCC260c IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIilllllllllllllllllllll TAATAGTTTGGACCAGACAGACATGCACGGAGACTCAGAATACAACATCATGTTTGGTCC320c 111111111111111111111111111111111111111111111111 l l l l l l l l i l l l CGACATCTGTGGCCCTGGCACCAAAAAGGTGCATGTGATCTTCAACTACAAG372c IIIIIIIIIIIIIIIIIIIIIIII IIlII IIIII IIIIIIIIIIIIIII

This example demonstrates successful isolation of human testicular cDNA
employing the amino acid sequence data obtained by microsequencing a 2-D gel protein spot.

A sperm protein, I-23, from the sperm surface encyclopedia {index} [Table III]
with an apparent mass of 54 kDa and an isoelectric point of 5.3 was separated from other sperm proteins using lysis buffer A j NP-40/Clrea] and preparative 2-dimensional gel electrophoresis using 23 x 23 cm gels. This protein was selected as one example of a dually vectorially labelled cell surface molecule. For mass spectrometry, the I-23 protein spot was cored directly out of the preparative acrylamide gel using a fine staple and the protein was digested in the acrylamide gel and processed for tandem mass spectrometry as described above in Example 13.
Figure 1 S shows protein microsequences derived by tandem masss spectrometry from sperm surface protein I-23.
Figure 1 S shows microsequences obtained from Protein I-23 in the Sperm Surface Index. A) Sequences are a compilation of both CAD analysis and CAD analysis of N-terminal derivative. X designates I or L which cannot be distinguished by low energy CAD. (-designates an unknown amino acid which will require further analysis. (Y/Z) designates two possible alternative amino acids for that position which will require further analysis. Lower case letters designate preliminary assignments of sequence. B) Design of complimentary and reverse-complimentary oligonucleotides.
A) Peptide Seauences- (SEQ ID NOS: 27-35) Peptide #1- SPXXSXK Peptide #7- VTNSTGGSpxk Peptide #2- XQANNA--K Peptide #8- uninterpretable _ Peptide #3- VATEFAFR Peptide #9- --PEVD--tR

Peptide #4- --XSXNXR Peptide #10-uninterpretable Peptide #S- --SMXXDTK Peptide #11- --QAENA---K

Peptide #6- MET(x/n)(e/q)XDR

B) Protein sequence #3: Sense-Oligonucleotide is shown (SEQ ID NOS: 29, 36, 37).
N-Terminus-V A T E F
S'-GT(C/T/A/G)-GC(C/T/A/G)-AC(C/T/A/G)-GA(A/G)-TT(T/C)-Optimized Oligo S'-GTG- G(C/T)C- AC(A/C)- GAG- TT(T/C)-A F R- C-Terminus GC(CTAG)-TT(TC)-CG(CTAG)[AG(A/G)]-3' G(CT)C- TTC- (C/A)G-3' Protein sequence #7: Sense-Oligonucleotide is shown (SEQ ID NOS: 38-40).
N-Terminus-V T N S T
S'-GT(CTAG)-AC(CTAG)-AA(TC)-AG(TC)-AC(CTAG)-TC(C/T/A/G) Optimized Oligo S'-GT(G/C)- ACC- AAC- (A/T)(G/C)C-ACC
G G- C-Tern~inus GG(C/T/A/G)-GG(C/T/A/G)-3' GGC- GCC-3' RT-PCR was performed as described above in example 13 and the products analysed on agarose gels as shown in example 13. The major PCR product was approximately 1000 bp. This was cloned into the pCR-Script vector and sequenced. The sequence of this novel sperm surface protein is shown in figure 16.
Figure 16 shows 1011 by DNA sequence (SEQ ID NO: 41 ) obtained from clone derived by RT-PCR utilizing optimized, degenerate primers for sperm surface protein I-23.

This example demonstrates the process of identifying and isolating cDNAs of novel cell surf ce vaccinogens beginning with dually labelled cell surface proteins on 2-D gels followed by microsequencing, optimized oligonucleotide design and RT-PCR. This combined process thus creates a rational procedure for vaccine design to surface antigens on any biological target and with respect to sperm, paves the way for contraceptive vaccine design to relevant surface antigens that may evoke immobilizing or agglutinating antibodies.
The following is a list of documents related to the above disclosure and particularly to the experimental procedures and discussions. The documents should be considered as incorporated by reference in their _ entirety.
References 1 Clermont,Y. (1963) Amer. J. Anat., 112,35-45 2 Clermont,Y. (1955) Amer. J. Anat., 96,229-253 3 Myles,D.G. and Primakoff,P. (1985) pp. 239-250 in "Hybridoma technology in the biosciences", Ed. Springer,T.A., Plenum Press, New York.
4 Friend,D.S. (1982) J.Cell.Biol., 93,243-249 S Myles,D.G.,PrimakoffP., and Bellve,A.R. ( 1981 ) Cell, 23,433-439 6 Myles,D.G.,and PrimakoffP.(1984) J.Cell Biol.,99,1634- 1641 7 Bearer,E.,and Friend,D.S.(1990) J.Electron Microsc.Technol., 16,281-297 8 Yanagimachi,R. (1994) pp. 189-317 in "The Physiology of Reproduction", Eds.Knobil,E. and Neill,J.D., Raven Press, New York.

9 Herr,J.C., Flickinger,C.J., Homyk,M., Klotz,K., and John,E. (1990) Biol.
Reprod. 42, Alexander,N.J., Griffin,D., Spieler,J.M., and Waiter,G.M.H. (1990) Gamete Interaction: Prospects for Immunocontraception. Wiley-Liss, Inc.
11 O'Farrell,P. (1975) J.Biol.Chem. 250, 4007-4021 12 O'Farrell,P.Z., Goodman,H.M., and O'Farrell,P.H. (1977) Cell. 12, 1133-1142 13 Garrels,J.I. (1989) J.Biol.Chem. 264, 5269-5282 14 Garrels,J.L, and Franza,B.R. (1989) J.Biol.Chem, 264, 5283-5298 Garrels,J.L, and Franza,B.R. (i989) J,Biol.Chem. 264, 5299-5312 16 Celis,J.E., et al. (1992) Electrophoresis. 13,893-959 17 Wirth,P.J., Doninger,J., Thorgeirsson,S.S., and Di Paolo,J.A. (1986) Cancer Res. 46, 18 Ochs,D., and WoIfD.P. (1985) Biol. Reprod. 33, 1223-1226 19 Naaby-Hansen,S., Lihme,A.O.F., Bog-Hansen,T.C., and Bjerrum,O.J. (1985) pp.

251 in "Lectins", Vol.4, Eds. T.C. Bog-Hansen and J.Breborowicz. Walter de Gruyter aid Co., Berlin-New York - 20 Mack,S.R., Zaneveld.L.J.D., Peterson,R.N., Hunt,W., and Russell,L.D.
(1987) J.Exp.Zoology.,243, 339-346 21 Morgentaler,A.,Schopperle,W.M., Crocker.R.H., and De Wolf,W.C. (1990) Fert.Steril. 54 (5),902-905 22 Primakoff,P., Lathrop,W., and Bronson,R. (1990) Biol.Reprod. 42,929-942 ' 23 Naaby-Hansen,S. (I 990) J.Reprod.Immunol. 17,167-185 24 Naaby-Hansen,S. ( 1990) J.Reprod.Imrnunol. 17,187-205 25 Kritsas,J.J., Schopperle,W.M., DewoIf,W.C., and Morgentaler,A. (1992) Electrophoresis. 13,445-449 26 Xu,C., Rigney,D.R., and Anderson,D.J. (1994) J.Androl. 15,595-602 27 Hunt,D.F., Yates,J.R., Shabanowitz,J., Winston,S., and Hauer,C.R. (1986) Proc.Natl.Acad.Sci.,USA. 83, 6233-6237 28 World Health Organization. WHO Laboratory Manual for the Examination of Human Semen and Semen-Cervical Mucus Interaction. Cambridge,UK : Cambridge University Press; 1992 29 Lee,S-L., Stevens,J., Wang,W.W., and Lanzillo,J.J. (1994) Biotechniques.
17,60-62 30 Hochstrasser,D.F., Harrington,M.G., Hochstrasser,A-C., Miller,M.J., and Merril,C.R.
(1988) Anal.Biochem. 173, 424-435 31 Henzel,W.J., Billeci,T.M., Stults,J.T., Wong,S.C., Grimley,C., and Watanabe,C.
{1993) Proc.Natl.Acad.Sci.,USA. 90,5011-5015 32 Matsudaira,P. (1987) J.Biol.Chem. 262,10035-10038 33 Edwards,J.J., Tollaksen,S.L., and Anderson,N.G. (198I) Clin.Chem. 27(8), 34 Myles,D.G., and PrimakoffP. (1984) J.Cell Biol. 99, 1634-1641 35 Burks,D.J., Carballada,R., Moore,H.D.M., and P.M.Salling (1995) Science.
269, 83-s6 36 Eddy,E.M., and O'Brien,A. (1994) pp. 29-77 in "The Physiology of Reproduction", second edition. Eds. Knobil,E., and Neill,J.D. Raven Press,Ltd.,New York 37 Boue,F., Lassalle,B., Duquenne,C., Villaroya,S., Testart,J., Lefevre,A., and Finaz,C.
( 1992) Mol.Reprod.Devel. 33,470-480 38 Lee,C., Keefer,M., Zhao,Z.W., Kroes,R., Berg,L., Liu,X., and Sensibar,J.
(1989) J.
Androl. 10(6), 432-438 39 Celis, J.E., et al. ( 1991 ) Electrophoresis, 12, 765-801 40 Seevers,R.H., and Counsell,R.E. (1982) Chem.Rev. 82,575-590 41 Cole,S.R., Ashman,L.K., and Ey,P.L. (1987) Mol.immunol. 24(7),699-705 42 Patton,W.F., Pluskat, M.G., Skea,W.M., Buecher,J.L., Lopez,M.F., Zimmermann,R., Belanger,L.M., and Hatch, P.D. (1990) Biotechniques. 8, 518-527 43 Markwell,M.A.K., and Fox,C.F. (I 978) Biochemistry. 17(22), 4807-4817 44 Hubbard,A., and Cohn,Z. (1975) J,Cell Biol. 64,438-460 45 Richardson,K., and Parker,C.D. (1985} Infect.Immun. 48, 87-93 46 Hurley,W.L., Finkelstein,E., and Holst,B.D. (1985) J.Immun.Meth. 85, 195-47 Ingalls,H.M., Goodloe-Holland,C.M., and Luna,E.J. {1986) Proc.Natl.Acad.Sci.,USA.
83, 4779-4783 Having now fully described the invention, it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the invention as set forth herein.

H

Gl W H

z ~ o H ',~ O

U W ~r z W

H

H

L7 O W cn z, H

H

H O

U] H ~(,' a ~ r~

a o ~

x z x a w w w a H

W

x U

v~ h E~ ~ Ca ~ Z

w W

O R~ O ~ fi;

~ W 't'3 O c1 r U H x cn w ~., U W ~ W
U

d' Cn ~

~ ~ n O C7 U Ix u7 -l cnO ~ C~.
~

~ z H z w a r~ H
z W 3 O U O tnC7 ~ W
U~

~ U x W ~ H

t~ H ~ ~ c~
a z x ~ H a z x w w ~ a ~ o a o w a o w a U w x a ..N r~ H
w x z w 3 ~ ~ w ~ H ~ ~ N w a a H ~1 W W ..H
H W

fx w o o a ~ H ~ ~ a~ a z ~' x O O ~ H H H O H W W
H

z H ~ w ~ ~ U cnU N

w W

H a a a~ x -. w ~.
~c ' ~ H o ~ m U a w w ~L H
~

r.~ H U U

W

-W ~-- .,.i -,~ -,..~ .r C~ .
.

_7 WO 98/36.771 PCT/US98/02913 M

r-1 O

., N

i N

l~ O

C~O rl O

p (~r1 lfl N

W $ O lQ

N C!) CO M I~

r~~",v \ I~L

,p\ U7 OD O .

-,~~n~a o ~ _ .. z ~ o a~ o, o rx o 0 c~~ ~ ~ M ~ b ~ ~ z N o o O z " ~ ~ M N .. -rl 4J

i N U7 U ~-I
~ H

U ~ R;W H S W Z CY.M N U rt3 D~

H ~C W Cza W W O .-ii ,~ H
~

U ~ .~-Wl CICIi E-~ E-~f=.~crM E-~ O ''Cj ~ ~ ~ O cn ~ .~m rd w w ~ z ~ ~n. x cnz w z M S z H .~~ v H a~ N z o x H

~ o z o w U o ~ x ~ H H z r~z o z ~ M a w ~a ~.~, H tnw H z W E-aH W O ~ O o H H O cn ~

, O E'~FC IrIH \ H l~ U CO~,W

U H ~ U H a H w H w a ~ ~ -~z w~
rxz w H H a H z w ~ U ~C z " w w H c~ a ~ w w x z a o ~ v, ~ ..~ w o H w H x x a o H H ~ w U c~H

~ a, H z cn ~c ~nrx ~ a~w x U H " a ~

P.~ E- mC a H c~ \

~ w w w a r~ ~ ~ o w ~ a a w w z a~a~

O W O E-~C1rH a W W W ~ W W U W ,'~E-~
O

U O u~ W r.~G4U ~ z c.~fx O E-aE-~ O W a E-~v~
E-~

W O W H .~

as~ a x ~ m v H ~ cnv a ~ a~ H a ~ m ~
a O

.,~ .,-~ ~C f~., -, z --H

N

_TL _ O

a w v a~ '-, v H

v H

.. ~ p ..

rl a H N

O ~ O

z x z H

a a H ,~.I H

v W

a cn 2s v a w ~n ~ w -~

v~ ~ U b~ cra U

v Ul N H ~1 v rtf 3 ~; ~ -r-I~-I''[j 't~

o H ~' o ~
~

~ z ~ v ~

v W ~
.
~

H ~C ~-l E ~ - ~ H

Ra W H H Cn ri C1~ W
~
O

H ~ U W H
-~a v a a ~ 4 v '~

w ~n ~ ~ w w ~n ~n ~ w ~ w cn ..
ca w r~ x a o ~ w E-~ Ll ~ L~ UN a H f~ v ~ zw ~ o a w w w w w w a a sy v ~ H o a a w U W O W ~ ~ ~ U W
a d w ,'~ H ~ W
~

- o a ~ ~ H a~ v a a o ~n o o ~, -~ -;~ ra v rs., .~ .~ -~, -~ ~ ~ ~ ~n z -- ~~ x o H ~- .r N

m n c7 m L~

v a v .. ,~ o a~ ~

z a .. .~, v a c7 b v Cn U .--i W cIa .~-I rl ~ H ~ ~' v ~ ~r v H o b -~~ ro . a .. E., ~ -~~ b o cn ~ .~~nr~ .~ z o m o .~,~nra z H .~U v ~ o v z H ~ U v ,~~ f~ ~ LJ.I~--'i~i A-irl~S ~, ~J
-Wn ~l W~ cn.~ N E-~ !~ Ca WE cra.~ N

H H O U7rl ~ W H HfaO Cl~rl Um ~ W H ~ U ~ W

W U H m W ~ ~ ~ ~ ~ W
W

c rtiW L7 0.~ v~ cra r~W C7 W
ra ~ q ~ ~

~ W O ~ O

O ~ W ~ O ~ W ~

w w z w w w w w w z w ~ w U W ~ E-~O ~ U rti U W ~ C-~O ~l a E-ac~E-~ '.'aE-acryH

O W U W aC O W

w O O W

H O~ ~C!~U W -ll ~ O H t ~Cf~U Cl -l r ~

W ,.~ _.~ O W ~ W '.~ .r~. O

u7 ~ U~ Pa U~

C4' f~.' O ~ O

Gr.,-r-1 .~-I.~-I~I C~ .

z -- .~ ?C C.7~ z -- .~, H _ ~ ~. H

N N

z z a a H ~ H U7 O a w a~ a a w a~

w u~ ~ w ~n -~ ~~, ~

~ m n N ~ N m ~ ~

~ - ~ ~ ~ -o z H 'u'~v ' ~' ~

t~ ~ o ~ z H
~
u H ,~r 04' (fS ~i ~ H Ul ~. ..
-ri -ri fa N N a w cnw a~ N ~ a w cn ~ ~

H ~ ~ W ~, a~ ~ H '~
~

v ~ w ~

a ~ ~n a ~ E a ~ w v W
' ~

.n w rn cn r.C raw C7 w u~ cn ~ w ..
r~

w ~s x r~o ~ w ~a x a G7 ~ GY x a H ~1 rt Ix U
U E-~
E-n ~ ~

w w ~ w w x w z z w U ~ U ~ E-~O a U H U ~ N
W W

W p W E-~cl~N U W ''a Ei U7 ''~

C7 ~ O W

O d W d r r~ H ~C f~U ~l r u~ H O~ U
-ll ~C
al w ,-, w., ~ ~ ~
E ~

x O O -, --, .., ~ O

' ~ ~

?C ,--i Z

H ~ v H

N N

_7 O O

z z a w H H ~-I

o, ...~ v o, H

w ~n ~ w -~

cn U 01 cn U

l~ H ~i N U1 (a ~ -~- y -~
n z o o r z a a~~ o z H U a~ ~ o ~

_ ~ ~ ~
w v H Ca E cn- H

rl~ ~ H ~ ~ ~

~ U S-iW H

x ~ a' ~ a ~
' ~ ~ ~ w '~ ~ '~a o ~ w o ~ w ~ x x a H a ~n x uH a H a ra ~ z w ~

w w w .n w w ~

o a v ~ a ~ N o a a w o W H ~nH U w x a a w ~

H

o a a~ arc w ~ a o a g m r~ ~ m ~ cn x w -~ -x H ~ z -- ~~ x a H

N

a rt o O S.~

H

W

(l~ H ~ (n 'b cl~U r-I W Cn U r--I

H ~ ~' ~ ~ ~ ' 0o N os H ~ N

- ~ - ~ y n H ~ ~ ~ ~ o ~ o ~ ~ n r a . z _ tx E r~..~ C~ H rd ~ E

Ca W rt cn.~ N H ~ ~1 W rti ~ -~ N

H H O U~r-IQ~ W H E-i O Cl)ri C

~-' .. ~ ~ o, ~ -~z .. ..

~ ~

'~ 'TW O ~ w '~ ~ '~

x ~a x x a o rx a H -.~ a H r~ ~a rx a H ~~ a H

z ~ x ~

w w w w z w w w U W ~ E-~O a U ~ a W ~ E-~O ~-l O W a H t11E-~U W H W '~E-ru~E-~

O

H ",~.,....-..~ W ~ H '~ W

H a r~cna r~ a o~ ~ H a ~ w a a a w .J~ ~..v o w ~

w ~ ~ o o ~ o w -;-~ .~ .~ ~ w -z _. .~, ~ a ,~ z --H ~. .r H .r N N

_77_ v ..

.. "~ 0 o~ E~ H
H

~ z z a ~

, a H ~., H N

ri U1 .G' a o ~ ~ W ~

" ~ ..

cn Q, o U U ~1 U~ S~ ~ U
U

Ul rl H fCj ~ N W -I H
(~

~ ~ -~n ~ -~ H -~ -n a z o o z o n o c o ~ z H ~ U v ~ o ~ z H
~
U

H r-I (~a-ri(~~ ~'-.C~ ~'--~~ P.~. ..
~ -rl (ff H ~ Ll W ~ u7-~ v E-~ ~ a W C!~
E

W H ca r-~Ra ~ H U
~
~

~ U ~ W ~ W

rx cn pr o,-.~Z .. .. ~ r-, a m z ~ -~
~

U ~ ~ W ~ ~1?-~W U ~C W ~ C~
~

cJ~ U~ ..raW L7 W Cn U7 FC W
w ~

w ~s ~ x a o ~ w o x a O U ~ ~ q W O x U

W

5C -7W ~ O
L

W Cra W z W I3~W W Gc.iW
z c~

U N U W ?-~E-~O ~-l U ~ U E-~
W
~

W '-aE-~U~H U W O W v~
'~
Ei W ~ O L7 O

a ~ H a ~cP4U ~1 ~-l t t~ H d U
FC
fYl O

O ~

-rir-I Cs, -ri -ri -r-I~ fi.i-r-I -x o ,~ z -- -~ ~ ~ H z --H .J ~ H

N N
_7$_ N

H H

z z a a H Ul H S-1 a a ~ v a H

_ W

Cn i-~ N U t57 c U la N ',~ ri H ~'', v U7 f~

N ~ .~-n~ ro z o o z a~ .~ o ~ z H U m .~ o a~
~

H ~ _ '~ ~
w a ~ cn~ v H w r-i S~ P.i H E-~O U7ri a pa (~

~

~ ~ ~ ~ H
L(1 W Ul ~ W C7 f~ ~

H ~ ~H q ~l -r ~ ~ N
r O ~

W U U
W

O ~ ~ ~ O a U
-l U W O W H C!1E~ U
''~

~ W x a a O W

a m H ~ f.~1U CW - O~
r.~ -l x .

-~ ~C ~ ,-n a ~

H
N

a it o O

z x H

H v U1 b v Ot a~ .. -,~ v . craU ri W cn U r--I

~ ~ ~

riH ~ N ri v-I H

E-~O T5-~~ '-d ' L7 .. E-, O 'Lj-~l-a'CS

Z v~ ~ -~cn~ -~ z o v~ ~ -~~nr H -.-1U N 1.1 p r-I ~., H rlU N l~

Ri E ~ G' ~ H (IS LY.~ (tS S-'-.

LlW c~ u7-~ N N ~ fa Wc~ u~-~ v H E-a O U7r-ISaa W H L'-~ O U1rl S1~

U ~ ~ W H ~ UN ~ W

~ . a U a ~ ~ E q ~ W

E ~ W Wn cn r~W C7 W cn cn r~W L7 ~
~ p ~ ~ H a N H ~

fx H ~ ~ E1 ~ '~ w ~

w z w w w w z w w v w ~ H o a a s~ a w ~ H o a W a H cnE-~U W H O W '~H cnE-~

O

W O O W

H O~ aCf~U fW l i C H i ~Cf~U fW -l - -W ~.~ .~~ p W ~ W

O ~ E

p p ., ., ~ ~., .-.

Z v ~C C7 ~

H . ~ H

N N

m v a~

..

o in ,~
o H ~ ~ w O c~ o ~

z W

H ~., U1 H ~ UJ

r-i '~ ri o, ~ .. .~., v W Cn U r-I W CA U r1 tn f.~, u1 U t~ ~ U1 Um o U to Us ~ ~ ~ ~

r.~ H O '~- ~-tb H O 't3-~

Z O cn ~ -~m rt -~ Z O u~ ~ -Hu~

O ?, Z H -~U N ~ O N Z H -~U

H rl Ra E ~ .~rCZI H .~i (1~.,E fa..

H C7 C~ W rtf cn-~ a~ H W p Wr~ cn (~ H H O cn~ Q., W H H O tn H ~, U N ~ W H ~ U~ ~ W

a ~ ~ w~ ~ ~ ~ ~ ~ w a H
~

~r, w cn u~ ~ ..r~w c~ a, ~n ~n ~C ~ r~w ~

w ~ x a o ~ w H x x a a~ rx U H a H a ~s c~ U H ..
'~ z w ~ ~

w w w w w z w U O U W ~ H O ~l U ~ U W ~ H

W ~ O W '~H u~H U W O W a H u~

FC

d d a O

~ H FC04U fa t O H O W t~lU
C

C7 ~ ~ " '..~.~.~ ~ W

O ~ O

~ -x ~ ~-, z H ~ ~ H

N N

M
M

N

a .. v ..

b .. -,~ ..

~ ~ z z a ~ a - z m a~ N

or o " ~ a~ ~ a U

~ _ w r u~ ~ U ~drdtT W l1 ~ co rl ~ ~

~ b ~ H

ra -~ z o cn v ~ u~~a s~ z ~ o ~ o v z H cn a~ v o ~c z , H ~ (x rdU " G ..~ H U

-~ a~ N a~ r~ w .~-~cn-~ ~ N ~ r~

ri ~ W H N ~ Cnrl O L1 W, H

H S-1 U C''1r~W H U' ~ ~ o a N '~ a M ~ w ~ w ~

w c ~ ~
n H A H w H a a ~ rx " a x ~ ~ ~ H

w w w z w w w o a U ~a U w ~ N o a U ~

N w o w a N 'nN ~ w H o a c H

a o a o H a ~calU f~ O W H

~ ~ cn u~ cn Z

O O

-~ .~ ~ .rt -~ .~ L7 .~ ~ c~ z -- -~ x z z ,~

- _ . H '-' .~ U H

U

N FC N

N N

ri .. -,~ ..

z a z U ~1 U

H -ri H

v u~ v v ~ a ~ v ~ a CJs -r-1 r~ U W Ul -rl .-i U W

U rti''~~1 ~ cn ~ U ~ b ~1 ~ W

H C~.I-r-1~a ~r r-i H C~-r1~i ~, H ~ ~ ~ ~ -c v c ~ Z O c v ~ m ~ ~ Z
n n n H m v v o E-~ z H ~n v v o f~'~ U ~ ~ H U fx rtSU ~ ,.~ H

W .i~-~U~-~ ~ E-~ U Ca W .~-~U~-~ .u N

H v m r--~o w E-r H E-~ v cn~ o w U lflr-IW H E--~ U I~r-iW H H

N U z .. .. ~ O a ~ N U z .. ..
fa~ W U

W ~ Ca~ W U

W C7 GL cn aC W ~ ..~ W C7 W
x A O ~ W U x a C O ~ W
U N O N q U H ~ W

C W ~ ~ O L W ~ O

W z c1c Pa W W C7 G~ W z W C.uW W N

U W ~ E-~O ~l U L7 U W ~ E-nO ~l U

a E-~cnE-~U W ~ O W '~E-~U7E-~

U W d H

- ~ ~CasU a o a H a ~c~ClU f~ O ~ H

~ '-'..~ .-, v~ N ~

- ~ -~ x ~' '~

z -~ x z - .., ~ H
,-.

N

N
O

N

-,1 ..

U O

U f~

-ri H Il~

U1 v 'L~

v r, a .. -,~ v .. ~ -,~ ,--~ U W U7 U r-I

o U ~Sb tT ~ cn H U rt 01 N H j.2i-rl.~"', .f', N H .S', v a - ~ ~ -~~ ~
~

o c v ~ ~ ~ ~ z o r n n z H m v v o ~ z H -~U v p.' c~U ~ .~ E-- y Y ~ ca f~ W .~-rlCl~-~-I.u E-~ Ca W rti as-rIN

H E-~ v ~n~ O f~ U H E-~ O cn~ C~

U U

N U 'Z,.. .. (L; H O~ r-)-ri'z,.. ..

~ ~

~ w ~ p., U7 U U7 .. W ~ G1, x x w o ~ w ~ x x a o ~ U E-a l E-~

!x U E-~ ~ ~l E-a C~ H z ~ w -w ~

w z w w w w U W ~ E-~O ~-l U N U W ~ E-~O ~-l '~Enc~H W O W '~Eia~H

O W U H

a a ~ o a N O~ ~CcnU a .7 H ~ ~ m U a c.

o ~ ~ ~ ~, o -~ ~ z -z :~ x H . . v ~ (~ H '-' N

N N

~

_ N
H

r1 N

.. ~ ..

-i ~-i N
O

N W rl '~ N

.. -~

z ~ ~ z a ~ a ~ .

v a c~ ~ ai ' o , ~ . v w .. ~; i .~

c!~ U~ N U ~ '~b1 ~ Cl) r1 U '(~bl ca N ~ ~ -~~ r' N H -rlG
C2~

. ~ y ~

z o ~n a~racnra s~ z o ~ ~ ~
v r a o v z H ~, a~ v o z H
~

tx rtSU ~ ,.~ H 0.,' U
rti H c~ Ca W ~ -~cn-~ .N En C-~ W -~ua ~ -~

H H ~ O ~'i' H E-~ N U1 rl S-1 U N rlW U ~ W
~

P.'. ~ O~ ~ r-IU z .. .. ~y Ot ~ U
U f-m N

n W ~ f~~ W U W ~ f~
?a v~ U ~ ..~ W C7 W cu ~ ~ ~ W
.. C~

f~ ca ~ U H ~ H ~1 C~: UN ..q0 ~ ~

~ W ~ ~

W W z W W W ~
z U it U W ~ E-~O ~ U U ~ E-r W O

W O W '.'aEiU~H ~ W "~ E-~cn E-~

~ O W

o H a r o ~CPOU ~l ~ O~ r.~ H O~ CllU
_ FC f~

cWl~ p --..r.r'. O W W

, ~ ~ o o . .~ .~ .~, ~
, _ C~ ',~.," -v ,~ H ~.
r~ r-I

H ~

L~

N E-~N

N
M

'L~N ''C~

-,~..

U O U

itz U L U

rIH -rl -,o~ ~ s~ v U W cn -~-i ~-iU

~ ~n ~r U ~''d .~', CV H ~'rl~i .. . [--~ U

~ z o ~n vra ~nr~

z .~ a ~ ~U

H U r~ w ,~-~ cn.~

O i~ H H E-~ N cJ~~ O

H E-r U ~~ W

U ~ N a W U W ~ ~ W

U ~ x ~ O

~ W x la E-~(~ L~ C~ U En aH

~ ~ Z~ ~ O

W W C W P
7 .~W

H ~

a ~ U

U W ~ O W

W ~ U H ~ ~. W

a a H H a ~m ~ a a H

U fx r.~ O

-~-~ E-~ C=.~w -~ --~~ ~ z --U N

U

N l0 N CO d' O
~-1 rl N M
~7 H FC U
U

U

H

H

H

H

H ~C H ~C
H

U C7 U r.~
rC

U

H FC U H
H

~

H L~ r~

U U
U

H

N ~

N ~ U C7 "

z z H N ~
a ~

a r~ H H H
a c~

a a -~ ai a ~ ~

a . ~

H ~ -~~ ~ H ~

N H ~ L

~7 .. .. E-, N U -,...a~ U [~ H UU

z o cn ~nr~m r~ z r~ U H

O H z H ~ ~ FC O ~ U rC
U

H U P:.i7U " ~ z H U C7 U

H U ~1 W -~~ -.~~1 H ~C r'~

~
G4 ~ H HN (UCn~-1U W U C7 rC

U U a ~ M a ~ ~ z H ~C
~C

~ ~ W

v~ H u~ ~C ~ W C7 !~ ~ aC C~ H U

W tx x x CaO ~ W U FC H C7 ~C

W U fx U H ~-IH f~ U C7 C7 r.~U

O ~ H U U H
~

U W C

E-~ U ~ H O a U ~

z r.~ z z ~ H cnH ~ z C7 C7 U
U

H ~ _..-.~ ,-.W ~ H C7 U
~ ~

Or H d r~ppU ~1 O r.~C7 H C7 ~ W ~

cn C7 c ~ U~ L7 U C7 C7 J~ C7 H O U H U H

C- L
-~ .7H

-~ -?C r.~ z -~ ?C C7 H U U

. ~ -- ~ U U
E._., H
.

~7 C--~

N ~

U H H U' _87_ n7 O O O O O N

l~ N CO ~ O II) rl r-i N ('~1C'~1 t7 H ~C U U

H U L7 E-~ C7 H ~

H ~C ~C C rC
-~

U L7 U FC ~C ~C

~ H U H H

(- .7 FC C FC
-~ C 7 H U U U U

U ~ ~ U U H H

H C C
7 .7 U ~ U ~

H H U U

H z ~ C H
.7 H p ~

~ C7 C7 ~C

U U

. -~ v O~ ~C ~C ~ L-~

cl~rt ~ W

~-''T31 ~ ~

U' N H ~ H H C7 L7 L7 C7 H N U -~~ C7 H H U U C7 o cn ~nr~~n~s z ~ ~c U H

z z o ~ a ~

~ ,~U . ~ U o q H _ ~ ~ W ~ U ~ ~
~

N C r U P .7 II- .~ C

U 111,-iGx] H C'J U C7 U U
~

U O~ ~ M ~ ~ FC H ~ ~C U

~ ~ W

W C~ W ua r.~ L7 H U C7 r.~

U x f~O ~ W U C7 H C~ FC U

C7 fx U H ~-IH f~ U FC C7 FC U C7 C7 O L7W ~ O E-i L7 ~C C7 FC L7 E-~LL, W z f~ figW W ~ U U

O ~ ~ ~

''~H ~ U W U U

U O W H L,7 U U

O H ,.'7.-.~ ~ ~ W ~ H C7 U FC CJ
~

o H a ~ r~v r o o~ ~c o H ~ o U N H H H

7 ~C C

U O ~ U U H H

-~ x C7 H L

H H U H U

U C

U ~ r.~ H ~ FC

U

U E-i U H C~ H

N N

O O m z z a a a H H ([5 U7 (n (iS

.. v o~ " w v a x .~

.. ~, ~ w " u~ -~ ~ w _~, t~ U ~f u~ u~ oo U U 0~ u7 U

N H ~ v ~ N H r~ ~ v ra ~s H zs-~ ~ b " a .. H b -~ s~v " x o ~n .~u~ ~a -~ z o cn o .~m ~a-~ z o z ~--~ U N 1-1 O rtS z ~--~f.~U N 1J Q (a ~i ~, (~" ~. C~.iH ~ Qi 'r1~ " .~rNI H r-I
-ri ~ W t!a.~ v H >C fa W E Ua .~v E~ ~C
~

H E-a O Clar-IC~ W H E~ caO (/~r-IR.~ W
(~

w a ~ ~ ~ ~ ~ ~ ~ w v ~

~n w ~n n " ~ w a a~ m u~ " ~ w ~ a~ cn ~

x r~ o ~ w ~ x x a o ~ w rx a " a H a ra x a H " a H a H

z w ~ ~ z w ~

w w w w w w w w v ~ H o a a ra a w ~ H o a v w o W N ~n H ~ w ~ o ~ a H ~n H ~ w a C

H

w cnU a o a o H W ~Ccnv a o ~

w cn a ~ --,.~ v ~ ~ ~n a x x ~.. ~ ~ o --r~ -~ .~ .~ v w -v .~ .~ ~s -z ~ -~, ~ ~ ~ z -~ x H _ ~.. ~- H

N N

_89_ o~

N

O

z H tJ1 .. a~ a ~ b ~

.. c~ ~ w .. ~n -~, -~

U bl Cl) N o U Ol U U

N H .(''-, ~ ,.f., (-~1H Li, N
fa fIS

.. E-, b -~~ 'd W .. ~., ~ -~i-~'ty o cn -~ m ra-~ z o ~n -~m ~a o o z H U a~.~ o ~ z H ~ ~
~ ~

r-If~ ~"'.,~ H rl LY. (fS ~i C~
-ri ~ ~ ~

H H ~ U1r1~ W H H ~ Ulr~
f~$ (f5 U 's~"W H U U ~ W

~ a ~ w ~ w ~ -~a ~ w ' ~ w a a~ u~ ~ w .. ~aw a a~
cn ~x a o x rx x a o ~ w ~ rx U H a H
U a H r~ ~
H

~ a z ~ ~ ~

W ~ ~ w w w w z U ~ H O a U ~ U ~ H O a W W

a ~ ~ N w w ~ ~ ~ U
a O w U H O

W as v r~o a a H a cnv a o ~ ~C

~

x o ~ o w -~ -~-I -~ ra w z -- -~ ~ ~ ,~ z --H .~ .~ H

N N

M M

z z a a a H ~J1 H ~-1 a ~C ., v o~ N .. v b ~

w .. u, ,--~ w ..
.~

cn rd H U ~1 Cl~p, N CJ C31 U U

((S M H ~ v CJs M H ~.,-' v fa ((f ,~' . (-I ''(~-rl~-1'L~ ~' ~ '"~-r-1$~-I'Lj z o ~n -.~u~~ -~ z o u~ -~u~~
o o o ~ z H a v ~ o ra z H v v ~ ~

H U7 Qi ~S ~ QI I--I~ f1i ~ ~.iC.11 -rl -r-I

E-~ ~C ~1 w cn-~ v E-~~C C~ w cn-~ v E E

U ~ W ri ~ P.v H U rl (a f(f ~ ~ W

a x ~, w ~ ~ a ~ w v ~ ~ ~ a ~ w ' ~

~ w ~n ~n ~ raw a a~ cn ~ .. ~ w a a~
..

w s~ x a o ~ w .u ~ a o cvn o x w o ~ ~' ~ o x w o a ~ a ~ ~

~

w w w w a~ w w w w w w w z z a ~a a ~ H o a a a a ~ H o a w w w ~ o W H ~nH ~ w ~ o W H ~nH
a a H ,"> ~ .-..~ W ~ H ~ W
~.

o~ ~a H a caa a a a ra H a cna ca a ~ ~c x ~ ~ ._.r ~

~a o ~s o -~ ~ w -~ :~ -:-,~s w ~s x ,~ z -- ~~ ~ x ,~ z --H v v H

N N
-9t-a ..

N M ~ O

M M x H

~ ~

H [j1 U1 H f-1 W

N 'Z3 o, ~, .. .~, W U7 U i-I W U7 U r-I

cn p, M U ~ ~ cn ~., ~ U c~ t51 U~ M H ~', N r-1 M H

H O '~-~~ 'b C7 . E-~ 0 ''~-~~ 'b z o v~ ~ .~u~~a ~~ z o m a -,~~n~a o ra z H ~~U v ~ o ~ z H -~~ v H (CS fYa~ fa' ~i pi H r-I Qi W CS ~i N x ca w ra cn-.~a~ H ~ a wra cn-~ a~

H H O CI~r-IO-~ f~ H E-~ O Cl~rl (7a H rti U ~ ~ w H i~ Uo ~ W

a ~ ,~.r.,z .. .. ~ .~ a ~ ,~-r,z .. ..
~

U x ~n W ~ a ~ w U H ~n w r~~ w cn v~ r.~ c~w L7 w cn ~n ~ ..rtiw L7 w w ~a x x a o ~ w ~ x a o ~a rx U H a H a a~ x U H a H
~

x w ~ '~ z ~

w w z w w w w U ~ U W ~ H O a U ~ U W ~ E-~O a '~H v~~ ~ W O W a H vaH

W H O W ~C

o o a ~ H a ~ m U r~ a ~ ~ H ~ ~ r~U a ~ --~ .J_. ~ w H

C7 c o O ~ O

N C~ -~ -~ -~ rtS w z -- -~, ~c ~ ~ z -~, H ~ ~ H

N N

_92_ a .. ~, S.a m rt o o M ~ ,~ M x .. .. _ O S-I O rd U

z ,~ z H x C-.1 U

H ((f U7 H t~ -rl td 'b ~ U7 N

a x -~ a~ a x W U7 U r-I W Cl~ -r-I r-IU

U7 (CS Lf7 U (a C31 Cl~ tip l0 U r~''OOl (~ M H ("., N r-~ f'7 H Q~rl~i["., .. x .. [~ p b -r-I~ 'b r.~ E-~ U -~-Ii-1 z o cn ~ -.~~n~a -~, z o ~n a~~a~n~a s~

~ Z ~ a Z

~ E ..~ R~ c x~ U ..
n E-~~C ~1 W rti cn-~ ~ N FC ~1 W.~-~cn W H H O Cnr1 Cdr ~ H H v Cnrl O

H ~ U .--i~ W H ~ U~ ~ W

~ a ~ ',.iz .. .. ~; ,-~ Or N U z ..
~ ..

U ,n ~ Ca~ W U CWn W ~ q ~ W
u) cry rdW C7 W U7 U) FC w ~ W C7 w ~ ~ x o ~ w ra x x w o ~1 ~ t~ U H a E-~ ~7 ~ ~ U H aE-~
~

a z w ~ w ~

w w w w W z w U o U w ~ H o a U ~ U w ~ H o a z s~ z z a N ~ H ~ z ~ z z a H ~nN

W W O W U W L~ O W U

H ~ ~ W ~ H ~ ~ W

a r~ H a ~cm a a a a ~ N o~ ~ cna a a m x x ~s o ~a o =

-~,~ w ~ .~, .;~ ~a w -~
-.

~c x ~ z -- -~ ~ x ~ z -- -.... H ~ ~.- H

N N

N N

M '~ M M

.. .,.~.. ..

z ~ z z U (~ W

H -rl H H

, ~ U a ~ ~ ~ a ' o .. ~ . ~ ..

U7 r U rd'dt5~ ~ U7 co U U p1 c!~

M H ~ -ri~i ~ M H (~ ~., UJ

E-, U .,-~~ .. .. ~, '~-.~S~ 'd z rx o ~ a~~ ~ ~ ~ z o ~ o -~~ ~ -~ z o c~ z H cn a~ v o z H ~ ~ a~ .~ o H Q,' R:(dU " S"...~; H ~J"~ CY,-r1(Ij W-,'CSI H

H z ~l W ,.~w cn-~ ~ E-~ 3 L1 W E cn-.-~~ E-~

G4 C~ H H N Cl~ri O W z H H cCSO CJ~rl Cla GL

H U U ~nrrW H N U ~ W

fx ~ O~ ~ N U z .. ., p; C7 O~ ~ L~.r1Z .. ..
~ ~ ~ W U

U W ~ ~l~ W U W f U7 E-~U1 r.C w ~ W C7 W cJ W 1~ ~ ..r~W L7 x C O ~ W
~

W H x x C~O ~ W .

U O U C7W ~ O ~ q t~l~O U C7W ~ p ~ f~

W C7 C~ W Z L4 W W W U f~ W z W W W W

U ~ U W ~ E-~O a U ~ U W ~ H O a U

z H z z a H ~ H ~ z ~ z z a H cnN ~ z W E-~O W U W ~ O W U W

fx H ~ W ',> Cl~ H ~ W

o~ ~ H a ~ a~~ a a o~ cn H a ~ r~a a a a o ~ o : ~

.;~ .~ .~ x _ .
~ , x ~ z --~ .-~

? . V ~ H _.
z .

~

an H N U N

U

N
O

M '~ V~

_~ .. -,~ ..

z ~ z U l~ U f~

rl H -ri H

U7 v W v v r-, o~ .. ~ v W

., ov U rti'd01 ~ CJ~ o U ~ Tl0~ ~ c J~

rd M H (~1rl~, ~i '~ H A-IrlGi ~i C7 H U -r-I~-I .. . ~.., U ,.~~ ..
.

o cn v ra~nr~ ~ z o cn v ~ ~nca ~ z z H in N v O z H U7 v ~ O

r-I R.'UfU C: ..L~,H p'.,(~U 'S..,',i; H

C7 f~ W .C7-~c~~ ~ H ~1 W .caw cn-~ .u H

H H v cn~ O W H H N cn~-IO W

~-1 U t-1riW H U n-IriW H

N U z .. .. ~ z pr ~ N U z .. ..
H u1 W ~ Ll~ W U

W ~ fa~ W U

cn ~ W U 0. W L7 cla ~ W C7 W C!) ~x x a o ~ w ~ x ~ x A O ~ w O U C7W ~ O H W CZ O U 7 W ~ p H f~

w w z a a~ w w . w w z a~ w w w o z U W ?~H O a U z U W ~ H O a U

O W '~H cnH U W O W a H cnH

~C FC U W

H '.7 W ~ ~ H ~ .-.~..~ ~ W

~ H a ~ r~u ~ a a o H a ~cw u a a a H

~, o ._ ~ ~ o a z ~ ~ '~

~ ~~ x z z ~~ x H ~ '. U H
.

z N H N

U

I

N lD N CO ~' O l0 N CO
v-I r1 N M M d~
U ~ ~ z H ~ z ~ ~ ~ H ~ v z a ~

a c~ U c~ v U U

U C7 H C7 C7 rC C7 C7 U z C7 z L7 ~

U

U ~ L U H H

a ~

~ ~ ~ a ~ ~

v ~ H z z H z H U U

U H U U

L ~ ~ ~ C

U z H U L7 C7 U

C~ z z U C7 C7 z U ~ H z C7 z U

~ ~ ~

o Z a H z ~ z z ~ z H ~ U c~ v H H U ~ U

m ~1 H E- C C C
~ 7 7 7 U ~ FC L7 z C7 C7 ~ U

.. ~ N OI L7 z z z ~C ~C

p_, ,-i W

U 'di~ ~ U z H U U C7 ~

H N U -~~ ~ ~ U z H U

p cJ~ ~ rt3tnrt5 z z U U U C7 z ~ .C7 N FC O ~ U U U z C7 H

U s~ z H z z z U C7 ~C

f~ W .-I-~ct~-.~C~ H C7 H H C7 ~ U

--~ H r-IN C!~r-nU C1~ C7 ~ ~ U H H U
H

z o U C7 H z Z U H E z n a ~ ~ A ~ W

U ~ ..p W O p-, ~ U z U L7 U H U

L7 ~ x f~O ~ W L7 ~ U z U U H H

z cx U H ~l H L H c7 U C7 U H H

C7 C7W ~ O ~ z C7 ~7 U C7 O

w w z w w w w ~ z U ~C t7 ~C c~

U U W ~ H O ~l U U U C~ FC

U z z ~ H cnH D z L7 L7 FC C~ ~ z W ~ H H

~ r.~ C7 H

H Or r.~CqU 4a O d C7 C7 z ~C z Z U FC

~.~ ~ ~

~ ~ ~ U U H H U Z

U ~ ~

~ U U H H ~ ~ ~

Z -~ >C ~ C
.7 '~ '~ U Z ~

~ C7 ~ C C~ C7 V ~ U
H

C H FC O z H r.C

ct' O l0 N dD ~ O l0 rl LJ1 l0 1D I~ I~ c0 01 01 O

U C7 ~C ~ ~ ~

r. C7 C7 ~ H H

H ~ z a ~

~ a ~ z z H ~ ~ ~ ~ ~ ~ H

z z a ~ ' ~ z ' c~ v ~ v z ~ z ~ H

r.~ U C7 U Z

z ~ ~C ~ H
~ U

C7 t C FC ~ ~ Z U C

U U U U F

~C H L7 FC C U

U U U ~ U

C7 C C C C H ~ U

~C L7 ~ U Z E-~ U

~ ~

FC L~ L7 U ~ U

~ U

H ~ U

E-~ L7 C7 U C

U ~ H

~C ~C C7 ~

U H U ~ U

FC ~C H

U z ~ U

Z C Z C~ H H C

U ~

E-~ L7 C~ 7 U ~ U
C

H ~ N U U

C C FC C U r.~ U
_7 7 7 U

H U H N ~

H U U

C7 U ~C ~ FC C H

C7 U ~C C7 U C7 U Z U

~ Z U Z U ~

C. U C7 L. ~C
.7 .7 ~

C7 U C7 L7 L7 U ~ U

Z ~ U U U U

C C7 Ch C U

~ FC ~C U ~ C7 ~C E-a H H U U

FC FC C C ~C U FC
.7 .7 _97_

Claims (14)

Claims:

1. A method for the analysis of membrane surface proteins comprising the steps of a. vectorially labeling proteins on the membrane surface;
b. isolating the labeled membrane surface proteins by two dimensional gel electrophoresis; and c. sequencing the isolated membrane surface proteins.

2. The method of Claim 1, wherein the membrane is present on a virus, bacterium or cell.

3. The method of Claim 2, wherein the membrane is present on a sperm cell.

4. The method of Claim 1, wherein the membrane proteins are labeled with iodine or biotin, or a mixture thereof.

5. A method for producing a vaccine against membrane surface proteins comprising the steps of a. vectorially labeling proteins on the membrane surface;
b. isolating the labeled membrane surface proteins by two dimensional gel electrophoresis;
c. sequencing the isolated membrane surface proteins;
d. cloning the DNA encoding the membrane surface proteins; and e. recombinantly producing the membrane surface proteins using the DNA
isolated in step (d) for use as peptide immunogens.

6. The method of Claim 5, wherein the membrane is present on a virus, microbacterium or cell.

7. The method of Claim 5, wherein the membrane is present on a sperm cell.

8. The method of Claim 5, wherein the membrane proteins are labeled with iodine or biotin, or a mixture thereof.

9. A method for diagnosing infertility comprising a. labeling the membrane surface proteins obtained in Claim 5;
b. reacting the labeled membrane surface proteins with sera from a patient in which the presence or absence of infertility is to be diagnosed; and c. detecting formation of an complex between an antibody present in the sera and the labeled membrane surface protein.

10. A diagnostic kit comprising the cell surface proteins produced in Claim 5.

11. A method for inducing contraception in a patient comprising administering to a patient in need thereof an amount of the cell surface proteins produced in Claim 5 sufficient to prevent fertilization of an egg in said patient.

12. A method for producing a contraceptive comprising administering to a mammal the recombinant proteins produced in Claim 5 and isolating antibodies against the recombinant proteins produced by the mammal.

13. The contraceptive produced by the method of Claim 12.

14. A vaccine produced by the method of Claim 2.