CA2266408A1 - A basal cell carcinoma tumor suppressor gene - Google Patents

Abstract

This invention provides for a tumor suppressor gene inactivation of which is a causal factor in nevoid basal cell carcinoma syndrome and various sporadic basal cell carcinomas. The NBCCS gene is a homologue of the Drosophila patched (ptc) gene.

Description

A BASAL CELL CARCINOl\LA TUMOR SUPPRESSOR GENE
CROSS REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part of U.S. Application No. 60/017,906, filed on May 17, 1996 and U.S. Application No: 60/019765, filed on June 14, 1996, both of which are herein incorporated by reference for all purposes.

BACKGROUND OF THE INVENTION
This invention pertains to the field of oncology. In particular, this invention pertains to the discovery of a tumor suppressor gene implicated in the etiology of nevoid basal cell carcinoma syndrome (NBCCS) and various cancers including basal cell carcinomas.
Many cancers are believed to result from a series of genetic alterations leading to progressive disordering of normal cellular growth mech~ni.~m.~ (Nowell (1976) Science 194:23, Foulds (1958) J. Chronic Dis. 8:2). In particular, the deletion or multiplication of copies of whole chromosomes or chromosomal segments, or specific regions of the genome are common (see, e.g., Smith et al. ( 1991) Breast Cancer ~es. Treat.
18: Suppl. 1: 5-14; van de Vijer & Nusse (1991) Biochim. Biophys. Acta. 1072: 33-50; Sato et al. (1990) Cancer. Res. 50: 7184-7189). In particular, the amplification and deletion of DNA sequences co.~ g proto-oncogenes and tumor-su~")ressor genes, respectively, are frequently characteristic of tumorigenesis. Dutrillaux et al. (1990) Cancer Genet. Cytogenet.
49: 203-217.
One cancer-related syndrome that appears to have a strong genetic base is the nevoid basal cell carcinoma syndrome (NBCCS). The nevoid basal cell carcinoma syndrome, also known as Gorlin syndrome and the basal cell nevus syndrome, is anautosomal domin~lt disorder that predisposes to both cancer and developmental de~ects (Gorlin (1995) Dermatologic Clinics 13: 113-125). Its prevalence has been estim~tecl at 1 per 56,000, and 1-2% of medulloblastomas and 0.5% of basal cell carcinomas (BCCs) are attributable to the syndrome (Springate (1986) J. Pediatr. Surg 21: 908-910; Evans et al.
(1991) British J. Cancer. 64: 959-961). In addition to basal cell carcinomas (BCCs) and .

W O97/43414 rcTrusg71o8433 medulloblastomas, NBCCS patients are also at an increased risk for ovarian fibromas, meningiomas, fibrosarcomas, rhabdomyosarcomas, cardiac fibromas and ovarian dermoids (Evans et al. (1991) supra., Evans et al. (1993) J. Med. Genet. 30: 460-464; Gorlin (1995) supra ).
Non-neoplastic features including, odontogenic keratocysts (which are most aggressive in the second and third ~lec~des of life), pathognomonic dyskeratotic pittina of the hands and feet, and progressive intracranial calcification (usually evident from the second decade) are very comrnon. There is a broad range of skeletal defects (Gorlin (1995) supra.;
Shanley et al. (1994) Am. J. Med. Genet. 50: 282-290) including rib, vertebral and shoulder anomalies, pectus excavatum, immobile thumbs and polydactyly. Craniofacial and brain abnormalities include cleft palate, characteristic coarse fades, strabismus, dysgenesis of the corpus callosum macrocephaly and frontal bossing (Gorlin (1995) supra). Generalized overgrowth (Bale et al. (1991) Am. J. Med. Genet. 40: 206-210) and acromegalic appearance are common, but growth horrnone and IGF 1 levels are not elevated.
Implications for the affected individual can be severe, predominantly due to the prolific basal cell carcinomas which can number more than 500 in a lifetime (Shanley et al. ( 1994) supra). Expression of many features of the syndrome is variable, but the severity tendstobreedtruewithinfamilies(Anderson etal. (1967) Am. J. Hum. Genet., 19:12-22).
This variation between families may reflect specific phenotypic effects of dirrelenl mutations, modifier genes, or environmental factors (sunlight exposure is likely to play a role in the age of onset and incidence of basal cell carcinomas). One third to one half of patients have no affected relatives and are presumed to be the product of new germ cell mutations (Gorlin (1995) supra.). Unilateral and segmental NBCCS are attributed to somatic mutation in one cell of an early embryo (Gutierrez and Mora (1986) J. Am. Acad Dermatol. 15: 1023-1029).
The NBCCS syndrome was mapped to one or more genes at chromosome 9q22-31 (Gailani et al. (1992) Cell 69: 111-117; Reis et al. (1992) Lancet 339: 617; Farndon et al. (1992) Lancet 339' 581-2). In addition, it has been demonstrated that the same region is deleted in a high ~elcelltage of basal cell carcinomas and other tumors related to the disorder (Gailani et al. (1992) supra.) thus suggesting that the NBCCS gene functions as a tumor su~ essor. Inactivation of NBCCS gene(s) may be a necessary if not sufficient event WO 97/43414 PCT/US97tO8433 for the development of basal cell carcinomas (Shanley et al. (1995) Hum. Mol. Genet. 4:
129-133; Gailani etal. (1996)J. Natl. Canc. Inst. 88: 349-354).
Since the original mapping of the gene in 1992, linkage studies have narrowed the NBCCS region to a 4 cM interval between D9S180 and D9S196 (Goldstein et al. (1994) Am. J. Hum. Genet. 54: 765-773; Wicking et al. (1994) Genomics 22: 505-511).
Reported recombination involving an unaffected individual tentatively placed the gene proximal to D9S287 (Farndon et al. (1994) Genomics 23: 486-489). The 9q22 region, however, is very gene rich and appeared to contain at least two tumor suppressor genes. In addition, Harshman et al. (1995) Hum. Mol. Genet. 4: 1259-1266, showed that different methods of identifying cDNAs from a genomic region result in a surprisingly different array of candidate genes. Thus, prior to this invention the specific NBCCS gene was unknown.

SUMMARY OF THE INVENTION
This invention provides for a nucleic acid sequence (e.g, a cDNA) associated with nevoid basal cell carcinoma syndrome (NBCCS) and with various cancers including various sporadic basal cell carcinomas (BCCs). The NBCCS gene disclosed herein appears to be a tumor-suppressor gene and is a homologue of the Drosophila patched (~tc) gene.
The human NBCCS gene is therefore also referred to herein as the human PA TCHED (PTC) gene.
Absence, partial inactivation (e.g., thro~lgh haploinsufficiency or mutation), complete inactivation, or otherwise altered e~ es~ion of the NBCCS (PTC) gene causes or creates a predisposition to NBCCS and/or to the onset of basal cell carcinomas.
In one ~ Ç~ d embodiment, this invention provides an isol,ated human nucleic acid encoding a nevoid basal cell carcinoma syndrome (NBCCS) (PTC) protein, wherein said nucleic acid specifically hybridizes, under stringent conditions, to a second nucleic acid consisting of a nucleic acid sequence selected from the group consisting of SEQ
ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, in the presence of a human genomic Iibrary under stringent conditions. The isolated nucleic acid is at least 30, preferably at least 50, more preferably at least 100, and most preferably at least 200 nucleotides in length.
In another embodiment, the isolated NBCCS nucleic acid has at least 75 percent sequence identity, preferably at least 85 percent, sequence identity, more preferably at least 90% sequence identity and most preferably at least 95 percent or even at least 98%

sequence identity across a window of at least 30 nucleotides, preferably across a window of at least 50 nucleotides, more preferably across a window of at least 80 nucleotides, and most preferably across a window of at least 100 nucleotides, 200 nucleotides, 500 nucleotides or even the full length with the nucleic acid of SEQ ID Nos: 1, 58, or 59.
In one embodiment, the isolated human NBCCS nucleic acid is amplified from a genomic library using any of the primer pairs provided in Table 2. In another embodiment, the NBCCS nucleic acid is identified by specific hybridization with any of the nucleic acids amplified from a genomic library using any of the primer pairs provided in Table 2. In a particularly prcrel~d embodiment the nucleic acid is a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.
In another embodiment, this invention provides for an isolated human nevoid basal cell carcinoma syndrome (NBCCS) (PTC) nucleic acid sequence, wherein said nucleic acid encodes a polypeptide subsequence of at least 10 contiguous arnino acid residues of the polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ
ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, or conservative substitutions of said polypeptide subsequence. The isolated human NBCCS nucleic acid is preferably at least 50, more preferably at least 100, and most preferably at least 200, 400, 500, or even 800 residues (amino acids) in length. In a particularly preferred embodiment, the nucleic acid encodes a polypeptide sequence encoded by a nucleic acid selected from the group con~i~ting of SEQ
ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59. Even more preferably, the NBCCS
nucleic acid is a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID
NO: 58, and SEQ. ID NO: 59.
In still yet another embodiment, this invention provides an isolated nucleic acid encoding a human nevoid basal cell carcinoma (NBCCS) (PTC) polypeptide comprising at least 10 contiguous amino acids from a polypeptide sequence encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, wherein: said polypeptide, when presented as an antigen, elicits the production of an antibody which specifically binds to a polypeptide sequence encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59;
and said polypeptide does not bind to antisera raised against a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59 which has been fully immunosorbed with a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59. Even more preferably this NBCCS nucleic acid hybridizes to a clone of the human PTC gene present in a human genomic library under stringent conditions and even more preferably hybridizes to a nucleic acid selected from the group consisting of SEQ
ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.
The invention also provides isolated nucleic acids that include one or more mutations compared to a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59. The mutations can be, for example, missense mutations, nonsense mutations, fr~meshift mutations, and splicing mutations. Alternatively, the mutations can be in regulatory regions that affect expression of the NBCCS gene.
In another embodiment, this invention provides for vectors incorporating any of the above-described nucleic acids. The vectors preferably include the above-described nucleic acid operably linked (under the control of ) a promoter; either constitutive or inducible. The vector can also include an initiation and a termin~tion codon.
This invention also provides for an isolated human NBCCS (PTC) polypeptide, said polypeptide comprising a subsequence of at least 10 contiguous amino acids of a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, or conservative substitutions of said polypeptide subsequence. This NBCCS polypeptide is preferably at least 50, more preferably at least 100, and most preferably at least 200, 400, 500, or even 800 residues (arnino acids) in length. The polypeptide can be a polypeptide encoded by a nucleic acid amplified from genomic DNA or an RNA using any of the primers pairs provided in Table 2.
In a particularly plerelled embodiment, the NBCCS polypeptide is a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.
This invention also includes an isolated NBCCS (PTC) polypeptide comprising at least 10 contiguous amino acids from a polypeptide sequence encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ.
ID NO: 59, wherein: said polypeptide, when presented as an antigen, elicits the production of an antibody which specifically binds to a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59; and said polypeptide does not bind to antisera raised against a polypeptide encoded by a nucleic acid . , . .... ~ .

sequence selected from the group con~ ting of SEQ ID NO: I, SEQ ID NO: 58, and SEQ.
ID NO: 59 which has been fully immunosorbed with a polypeptide encoded by a sequence selected from the group con~i.cting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.
This polypeptide is preferably at least 50, more preferably at least 100, and most preferably at least 200, 400, 500, or even 800 amino acid residues in length. In a particularly preferred embodiment, this polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.
The polypeptides of this invention can include conservative substitutions of any of the above-described polypeptides. In a particularly plef~,.ed embodiment the above-described nucleic acids and/or proteins, or subsequences thereof, are not a PTC nucleic acid or polypeptide from a Drosophila, a murine, or C. elegans.
In another embodiment, this invention provides for anti-NBCCS antibodies.
Particularly preferred antibodies specifically bind a polypeptide comprising at least 10, more preferably at least 20, 40, 50, and most preferably at least 100, 200, 400, and even 800 contiguous amino acids, or even the full length polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59 wherein: said polypeptide, when presented as an antigen, elicits the production of an antibody which specifically binds to a polypeptide encoded by a nucleic acid selected from the group con~i~ting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59; and said polypeptide does not bind to antisera raised against a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ.
ID NO: 59 which has been fully immunosorbed with a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NQ: 58, and SEQ.
ID NO: 59. The antibody can be polyclonal or monoclonal. The antibody can also be hllm~ni7~1 or human.
This invention also provides for cells (e.g., recombinant cells such as hybridomas or triomas) ~ essillg any of the above-described antibodies.
This invention also provides for methods of detecting a predisposition to nevoid basal cell carcinoma syndrome (NBCCS) or to a basal cell carcinoma. The methods include the steps of i) providing a biological sample of the org~ni~m; and ii) detecting a human NBCCS (PTC) gene or gene product in the sample. The provision of a biological sarnple and detection methods are described herein. In particular, detecting can involve wo 97t434l4 Pc~/uss7l08433 detecting the presence or absence, or quantifying an NBCCS gene or subsequence thereof including any of the above-described nucleic acids. The detecting can also involve detecting the presence or absence or ~uantifying a NBCCS polypeptide or subsequence thereof including any of the above-described polypeptides. The detecting can involve detecting the 5 presence or absence of normal or abnormal NBCCS nucleic acids or polypeptides. For example, one can detect a predisposition to BCC or NBCCS by detecting the presence of a mutation in a NBCCS nucleic acid. Particularly p.ef~lled assays include hybridization assays and/or sequencing for nucleic acids and irnmunoassays for NBCCS polypeptides.
In another embodiment, this invention provides for pharmacological 10 compositions comprising a ph~rm~cel1tically acceptable carrier and a molecule selected from the group consisting of an vector encoding an NBCCS polypeptide or subsequence thereof, an NBCCS polypeptide or subsequence thereof, and an anti-NBCCS antibody as described herein.
This invention also provides for primers for the amplification of one or more 15 exons of the NBCCS (PTC) gene. These primers include, but are not limited to the primers provided in Table 2.
This invention also provides kits for the detection and/or quantification of NBCCS gene or gene product. The kits can include a container cont~inin~ one or more of any of the above identified nucleic acids, amplification primers, and antibodies with or 20 without labels, free, or bound to a solid support as described herein. The kits can also include instructions for the use of one or more of these reagents in any of the assays described herein.
Finally, this invention also provides therapeutic methods. These include a methods of treating basal cell carcinoma and/or nevoid basal cell carcinoma syndrome and/or 25 solar keratoses in a m~mm~1. The methods can involve transfecting cells of the In~mm~l with a vector ~x~les~ing a nevoid basal cell carcinoma syndrome (NBCCS) polypeptide such that the cells express a functional NBCCS polypeptide as described herein. The transfection can be in vivo or ex vivo. Ex vivo transfection is preferably followed by re-infusion of the cells back into the organism as described herein. Other methods involve ~flmini~tering to the 30 m~mm~1 a therapeutically effective dose of a composition comprising a NBCCS (PTC) polypeptide and a ph~rm~cological excipient as described herein. The methods are preferably performed on m~mm~l~ such as mice, rats, rabbits, sheep, goats, pigs, more preferably on primates including human patients.

Definitions The term "antibody" refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragmentc thereof which specifically bind and recognize an analyte (antigen). The recogni_ed immunoglobulin genes include the kappa, larnbda, alpha, g~mm~ delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as g~mm~ mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 1 10 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these light and heavy chains res~e~ ,rely.
Antibodies exist e.g, as intact immunoglobulins or as a number of well characterized fr~gment~ produced by digestion with various peptidases. Thus, for example, 20 pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'2 a dimer of Fab which itself is a light chain joined to VH CH1 by a disulfide bond. The F(ab)'2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)'2 dimer into an Fab' monomer. The Fab' monomer is essçnti~lly an Fab with part of the hinge region (see, Fundamental lmmunology, Third 25 Edition, W.E. Paul, ed., Raven Press, N.Y. 1993). While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fr~gment.~ may be synthPsi7Pd de novo either chemically or by ~ltili7ing recombinant DNA
methodology. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies or those synthesi7Pd de novo using 30 recombinant DNA methodologies (e.g., single chain Fv).

An "anti-NBCCs" antibody is an antibody or antibody fragment that specifically binds a polypeptide encoded by the NBCCS gene, cDNA, or subsequencethereof.
A "chimeric antibody" is an antibody molecule in which (a) the constant 5 region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class, effector function and/or species, or an entirely dir~e.e,lt molecule which confers new })~op~"ies to the chimeric antibody, e.g, an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced or exchanged with a variable region 10 having a different or altered antigen specificity.
The term "immunoassay" is an assay that utilizes an antibody to specifically bind an analyte. The immunoassay is characterized by the use of specific binding properties of a particular antibody to isolate, target, and/or quantify the analyte.
The terms "isolated" "purified" or "biologically pure" refer to material which 15 is substantially or ess~nti~lly free from co"l~onents which normally accompany it as found in its native state.
The term "nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited,encomp~cses known analogs of natural nucleotides that can function in a similar manner as 20 naturally occurring nucleotides.
The terms "polypeptide", "peptide" and "pr.otein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid 25 polymers.
A "label" is a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include 32p, fluorescenl dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, dioxigenin, or haptens and proteins for which antisera or monoclonal antibodies are 30 available (e.g, the peptide of SEQ ID NO 1 can be made detect~hle, e.g., by inco")o~ g a radio-label into the peptide, and used to detect antibodies specifically reactive with the peptide).

W 097t43414 PCTrUS97108433 As used herein a "nucleic acid probe" is defined as a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. As used herein, a probe may include natural (i.e. A, G, C, or T) or modified 5 bases (7-deazaguanosine, inosine, etc. ). In addition, the bases in a probe may be joined by a linkage other than a phosphodiester bond, so long as it does not interfere with hybridization.
Thus, for example, probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. It will be understood by one of skill in the art that probes may bind target sequences lacking complete complçrnent~rity with 10 the probe sequence depending upon the stringency of the hybridization conditions. The probes are preferably directly labeled as with isotopes, chromophores, lumiphores, chromogens, or indirectly labeled such as with biotin to which a streptavidin complex may later bind. By assaying for the presence or absence of the probe, one can detect the presence or absence of the select sequence or subsequence.
A "labeled nucleic acid probe" is a nucleic acid probe that is bound, either covalently, through a linker, or through ionic, van der Waals or hydrogen bonds to a label such that the presence of the probe may be detected by detecting the presence of the label bound to the probe.
The term "target nucleic acid" refers to a nucleic acid (often derived from a 20 biological sample), to which a nucleic acid probe is designed to specifically hybridize. It is either the presence or absence of the target nucleic acid that is to be detected, or the amount of the target nucleic acid that is to be quantified. The target nucleic acid has a sequence that is complementary to the nucleic acid sequence of the corresponding probe directed to the target. The term target nucleic acid may refer to the specific subsequence of a larger nucleic 25 acid to which the probe is directed or to the overall sequence (e.g, gene or mRNA) whose ession level it is desired to detect. The difference in usage will be al)p~ fromcontext.
"Subsequence" refers to a sequence of nucleic acids or arnino acids that comprise a part of a longer sequence of nucleic acids or amino acids (e.g., polypeptide) 30 respectively.
The term "recombinant" when used with reference to a cell, or nucleic acid, or vector, indicates that the cell, or nucleic acid, or vector, has been modified by the W O 97/43414 PCTrUS97/08433 introduction of a heterologous nucleic acid or the alteration of a native nucleic acid, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at 5 all.
The term "identical" in the context of two nucleic acids or polypeptide sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence. Optimal ~lignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1981) Adv. Appl.
0 Math. 2: 482, by the homology alignment algolill.. " of Needleman and Wunsch (I970) J.
Mol. Biol. 48 :443, by the search for similarity method of Pearson and Lipman (1988) Proc.
Natl. Acad Sci. USA 85: 2444, by computerized implementations ofthese algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.
An additional algorithm that is suitable for determining sequence similarity is the BLAST algorithm, which is described in Altschul et al. ( 1990) ~ Mol. Biol. 215: 403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm nih gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of 20 length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a d~t~h~ce sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra.). These initialneighborhood word hits act as seeds for initi~tjng searches to find longer HSPs co.~ g them. The word hits are extended in both directions along each sequence for as far as the 25 cumulative ~lignm~nt score can be increased. Extension of the word hits in each direction are halted when: the cllmul~tive ~lignment score falls offby the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST al~oli~ p~dlllcters W, T and X determine the sensitivity and speed of the 30 ~lignment The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad Sci. USA 89: 10915-.. . . , . , .~. ..........

10919) alienm~nt~ (B) of 50, ~ecl~lion (E) of 10, M=5, N=-4, and a comparison of both strands.
The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see, e.g., Karlin and Altschul (1993) Proc. Nat'l. Acad. Sci. USA
90: 5873-5787. One measure of similarity provided by the BLAST algorithrn is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For exarnple, a nucleic acid is considered similar to an NBCCS gene or cDNA if the smallest sum probability in a comparison of the test nucleic acid to an NBCCS nucleic acid (e.g, SEQ ID
10 Nos: 1, 58, or 59) is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
The term "substantial identity" or "substantial similarity" in the context of a polypeptide indicates that a polypeptides comprises a sequence with at least 70% sequence identity to a reference sequence, or preferably 80%, or more preferably 85% sequence 15 identity to the reference sequence, or most preferably 90% identity over a comparison window of about 10-20 amino acid residues. An indication that two polypeptide sequences are subst~nti~lly identical is that one peptide is imml-nologically reactive with antibodies raised against the second peptide. Thus, a polypeptide is substantially identical to a second polypeptide, for example, where the two peptides differ only by a conservative substitution.
An indication that two nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
Another indication that two nucleic acid sequences are ~ub~lLially identical is that the two molecules hybridize to each other under stringent conditions.
"Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mi~m~t~hes that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target polynucleotide sequence.
The phrase "hybridizing specifically to", refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. The term "stringent conditions" refers to conditions under which a probe will hybridize to its . . .

W O 97/43414 PCTrUS97/08433 target subsequence, but to no other sequences. Stringent conditions are sequence-dependent and will be dirrerel~t in different circllm~t~n(~es Longer sequences hybridize specifically at higher telllpeldlul~s. Generally, stringent conditions are selected to be about 5~C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
5 The Tm is the tellll ~dl~e (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes compl~mçnt~ry to the target sequence hybridize to the target sequence at equilibrium. (As the target sequences are generally present in excess, at Tm, 50% of the probes are occupied at equilibrium). Typically, ~llhlgent conditions will be those in which the salt concentration is less than about 1.0 M Na ion, typically about 0.01 to 1.0 M
10 Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30~C for short probes (e.g., 10 to 50 nucleotides) and at least about 60~C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
The phrases "specifically binds to a protein" or "specifically immunoreactive 15 with", when referring to an antibody refers to a binding reaction which is determinative of the presence of the protein in the presence of a heterogeneous population of proteins and other biologics. Thus, under dçci~n~ted immunoassay conditions, the specified antibodies bind preferentially to a particular protein and do not bind in a significant amount to other proteins present in the sample. Specific binding to a protein under such conditions requires 20 an antibody that is selected for its specificity for a particular protein. A variety of imrnunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, 25 for a description of immunoassay formats and conditions that can be used to determine specific immlmoreactivity.
A "conservative substitution", when describing a protein refers to a change in the amino acid composition of the protein that does not subst~nti~lly alter the protein's activity. Thus, "conservatively modified variations" of a particular amino acid sequence 30 refers to amino acid substitutions of those amino acids that are not critical for protein activity or substitution of amino acids with other amino acids having similar properties (e.g., acidic, basic, positively or negatively charged, polar or non-polar, etc. ) such that the substitutions of W O 97/43414 PCT~US97/08433 even critical amino acids do not sl-t.st~nti~lly alter activity. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another:
1) Alanine (A), Serine (S), Threonine (T);

2) Aspartic acid (D), Glutamic acid (~);

3) Asparagine (N), Ghlt~mine (Q);

4) Arginine (R), Lysine (K);

5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenyl~l~nine (F), Tyrosine (Y), Tryptophan (W).
10 See also, Creighton (1984) Proteins, W.H. Freeman and Company. In addition, individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids in an encoded sequence are also "conservatively modified variations" .
The terms human "PTC' or human "NBCCS gene or cDNA" are used 15 interchangeably to refer to the human homologue of the Drosophila patched (ptc~ gene disclosed herein. As explained below, the human PTC gene is a tumor ~uppressor gene also involved in the etiology of nevoid basal carcinoma cell syndrome.
A "gene product", as used herein, refers to a nucleic acid whose presence, absence, quantity, or nucleic acid sequence is indicative of a presence, absence, quantity, or 20 nucleic acid composition of the gene. Gene products thus include, but are not limited to, an mRNA transcript, a cDNA reverse transcribed from an mRNA, an RNA transcribed from that cDNA, a DNA amplified from the cDNA, an RNA transcribed from the amplified DNA
or subsequences of any of these nucleic acids. Polypeptides ~ essed by the gene or subsequences thereof are also gene products. The particular type of gene product will be 25 evident from the context of the usage of the term.
An "abnormal PTC (or NBCCS) gene or cDNA" refers to a NBCCS gene or cDNA that encodes a non-functional NBCCS polypeptide, or an NBCCS polypeptide ofsubstantially reduced functionality. Non-functional, or reduced functionality, NBCCS
polypeptides are characterized by a predisposition (i. e., an increased likelihood as compared 30 to the "normal" population) for, or the onset of, nevoid basal cell carcinoma syndrome.
Similarly, "abnormal PTC (or NBCCS) gene product" refers to a nucleic acid encoding a non-functional or reduced functionality NBCCS polypeptide or the non-functional or .

reduced functionality NBCCS polypeptide itself. Abnormal NBCCS (PTC) genes or gene products include, for example, NBCCS genes or subse~uences altered by mutations (e.g.
insertions, deletions, point mutations, etc. ), splicing errors, premature termination codons, mi.~.~ing initiators, etc. Abnormal NBCCS polypeptides include polypeptides expressed by S abnormal NBCCS genes or nucleic acid gene products or subsequences thereof. Abnormal e,.plession of NBCCS genes includes unde.c~lession (as compared to the "norrnal" healthy population) of NBCCS e.g., through partial or complete inactivation, haploinsufficiency, etc.

BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows an integrated frarnework map of the NBCCS region. Both linkage and tumor deletion studies place ~BCCS between D9S196 and D9S180 but areconflicting, with regard to whether the gene lies proximal or distal to D9S~87. The order of six polymorphic markers, D9S197, D9S196-D9S280-F~ACC-D9S287-D9S180, is derived from genetic linlcage data (Farndon e~ al.,1994; Pericak-Vance et al., 1995). D9S196 and D9S197 show no measurable recombination. Pulsed-field gel electrophoresis (PFGE) and FISH give a minimum distance of 2 Mb between D9S196 and D95180. Key inforrnationabout YAC, BAC, and cosmid contigs in the NBCCS region is shown. In total, 22 overlapping YACs and more than 800 cosmids were isolated from this region. BAC and cosmid contigs covering more than 1.2 Mb have been submitted to the Genome Data Base.
Figure 2 shows a map of the PTC locus. The gene lies on 4 overlapping cosmids including 226G7, 42H11, 55A16, and 96F9 (LI,09NCOl, 96-well coordinates).
The coding exons of the gene are shown as filled boxes and non-coding (untr~n~l~ted) exons as open boxes. Splice variants of the 5' non-coding, region of the gene indicate at least two alternate first exons and possibly a third alternate exon (see Example 2).
Figure 3 provides a map of the promoter region of the NBCCS (PTC) gene.
Figure 4 illustrates segregation of a premature tetrnin~tion mutation of PTC in an NBCCS pedigree. I'he C 1081 T (Q2 1 0X) mutation segregating in this kindred creates a Bfal site. PCR with fl~nking primers produces a 260 bp product, which digests to 171 bp and 90 bp fr~gment~ in affected family members. The PCR product remains undigested in - 30 unaffected farnily members.
Figure 5 shows a fr~mt ~hift mutation of PTC in a sporadic NBCCS patient.
(Figure 5A) Both parents ( 1 and 2) of an affected individual (3) were free of phenotypic . . . .

features of NBCCS. (Figure SB) The patient was heterozygous for a single stranded conformation polymorphism (SSCP) variant in Exon 12 that was not present in her parents, and sequ~n~in~ of a PCR product from genomic DNA showed two sequences out of frame following base 2000. The abnormal conformer was sequenced and contained a 1 bp 5 insertion resulting in a premature stop nine amino acids downstrearn. Sequences of PCR
products from both parents were normal.
Figure 6 shows an ultraviolet B-in~llcecl mutation of PTC in a sporadic basal cell carcinoma. (Figure 6A) CC to TT mutation in the rem~ining allele with allelic loss of the NBCCS region. This DNA alteration, which results in a premature stop, is typical of 10 ultraviolet B mutagenesis. (Figure 6B) Constitutional DNA from the patient has a normal sequence Figure 7 shows a PTC deletion in a sporadic BCC. (Figure 7A) A 14 bp deletion in the rem~ining allele of a turnor with allelic loss of the NBCCS region. Despite the fact that this tumor was removed from the nose, a highly sunlight-exposed area, the 15 mutation cannot be related specifically to ultraviolet radiation. (Figure 7B) Constitutional DNA had the normal sequence.
Figure 8 shows the nucleotide sequence (SEQ ID NO: l ) of the human PTC
cDNA (Genbank Accession No. U43148). The sequence of PTC is shown, including theopen reading frame and fl~nking 5' and 3' sequences. The corresponding amino acid 20 sequence is presented in SEQ ID NO:60.
Figure 9 shows mutations in the human PTC gene in DNA obtained from desmoplastic medulloblastomas D322, D292 and D86. Figure 9A: microsatellite D9S302 shows loss of heterozygositv in tumor D322. In this tumor, the rem~ining allele of exon 6 exhibits an altered mobility. DNA sequencing shows a single base pair deletion in the tumor 25 DNA which results in a fr~m~shift and resulting truncation of the PTC protein. Figure 9B
shows SSCP variants in exon 10 in tumor D292 without allelic loss of chromosome 9q.
sequencing of the altered allele shows a four base pair insertion at position 1393. Figure 9C
shows the sequencing of exon 10 in tumor D86. This tumor, which has LOH, has a six base pair in-frame deletion at position 1444 (CTG GGC). This leads to a deletion of two amino 30 acids (glycine and leucine) in tr~n~mernhrane region 3.
Figure 10 shows PTC mRNA levels as determined using a semi-quantitative RT-PCR approach as described in Exarnple 5. 250 ng of RNA in 10 111 was reverse W O 97143414 PCTAUS97~8433 transcribed in the presence of 40 pg of each of the standard RNAs with internal deletions for PTC, ~2-microglobin and GAPDH. The cDNAs were then amplified with primers for PTC
and the housekeeping genes. The products were s~ aled and quantitated on an ABI 373A
sequencer. The expression level of the three genes were determined as the ratio of signals of S the sample (right peaks) to the specific standards (left peaks). Figure I OA: PTC mRNA
e~lession in two representative tumors of the classical variant of MB; Figure 1 OB:
expression in desmoplastic MBs; Figure lOC: expression in adult human cerebellum.
Figure 11 is a sçhl?m~tic diagram of the PTC protein with the location of germ line mutations indicated. The putative tr~n~membrane domains are designated "TM1" to 10 "TM12"; the hatched boxes represent the two putative extracellular loops. An asterisk (*) denotes a mi~s~n.ce; a triangle (--) denotes a nonsense or fr~me~hift; and a diamond (-) denotes putative splicing variants. Open boxes above correspond to exons encoding relevant domains.

DETAILED DESCRIPTION
This invention pertains to the discovery of a tumor suppressor gene associated with the etiology of nevoid basal cell carcinoma syndrome. In addition, this invention pertains to the discovery that various cancers, including sporadic basal cell carcinomas (BCCs) can arise with somatic loss of both copies of the same gene.
Nevoid basal cell carcinoma syndrome, also known as Gorlin syndrome and the basal cell nevus syndrome, is an autosomal clomin~nt disorder that predisposes to both cancer and developmental defects (Gorlin (1995) Dermatologic Clinics, 13: 113-125). Its prevalence has been estim~ted at 1 per 56,000, and 1-2% of medulloblastomas and 0.5% of basal cell carcinomas (BCCS) are attributable to the syndrome (Springate (1986) J. Pediatr.
Surg 21: 908-910; Evans et al. (1991) British J. Cancer., 64: 959-961). In addition to basal cell carcinomas (BCCs) and medulloblastomas, NBCCS patients are also at an increased risk for ovarian fibromas, lnenin~iomas, fibrosarcomas, rhabdomyosalcoll.as, cardiac fibromas andovariandermoids(Evansetal. (199l)supra.,Evansetal. (1993)J. Med. Genet. 30:
460-464; Gorlin (1995) supra.).
Implications for the affected individual can be severe, predominantly due to the prolific basal cell carcinomas which can number more than 500 in a lifetime (Shanley et al. (1994) supra). Expression of many features of the syndrome is variable, but the severity tends to breed true within families (Anderson e~ al. (1967) Am. J. Hum. Genet., 19: 12-22).
This variation between families may reflect specific phenotypic effects of different mutations, modifier genes, or environment~l factors (sunlight exposure is likely to play a role in the age of onset and incidence of basal cell carcinomas). One third to one half of 5 patients have no affected relatives and are presurned to be the product of new germ cell mutations (Gorlin (1995) supra.). Unilateral and segment~l NBCCS are attributed to somatic mutation in one cell of an early embryo (Gutierrez and Mora, ( 1986) supra. ) I. Uses of the NBCCS (PTC) cDNA.
As indicated above, the NBCCS gene of this invention is a tumor suppressor gene. Defects in the ~xl,lession of this gene are associated the onset of various cancers, particularly with sporadic basal cell carcinoma in somatic cells. Heritable defects in the expression of the NBCCS gene are a causal factor in the etiology of NBCCS and its nrl~nt developmental abnormalities (see example 2, below).
While basal cell carcinomas and many features of NBCCS are believed to be due to homozygous inactivation of PTC generalized or symmetric features such as overgrowth, macrocephaly, and facial dysmorphology are believed to be due to haploinsufficiency or other meçll~ni.cm~ of partial gene inactivation.
Clearly, detection of defective NBCCS (PTC) gene expression is of clinical 20 value. The presence of an NBCCS (PTC) gene, cDNA, mRNA, protein, or subsequence of the gene, cDNA, or protein in a biological sample is useful, e.g., as a marker to asses in vivo and/or in situ RNA l,~scli~lion and/or translation, in cancer diagnostics (as in the detection or verification of basal cell carcinoma), in plolJh~,ylaxis for NBCCS or BCC as an indication of a heritable predilection for NBCCS or BCC, or in DNA forensic analysis such as DNA
25 finge~ ling. Full-length NBCCS cDNA, individual exons, or subsequences thereof are also useful as probes (particularly when labeled) for the detection of the presence or absence and/or quantitation of normal or abnormal (e.g., truncated or mutated) NBCCS (PTC) DNA
or RNA in a biological sample. The labeled probes can also be useful as in fluorescent karyotyping analysis as markers of the NBCCS gene. Because the NBCCS cDNA or 30 subsequences thereof is shown herein to map to human chromosome 9q22.3, one of skill can use the gene, cDNA, or subsequences, as a probe to asses whether there are any gross chromosomal abnormalities in this region of chromosome 9. This is useful, for instance, in in utero screening of a fetus to monitor for the presence of chromosomal abnormalities in particular for a predilection of NBCCS or basal cell carcinomas.
Similarly, the proteins encoded by the NBCCS cDNA can be used as diagnostic markers for NBCCS and/or basal cell carcinomas. The proteins or subsequences S thereof can also be used as antigens for raising anti-NBCCS protein antibodies. The antibodies are useful for immunoassays for the detection of normal or abnormal expression of NBCCS proteins, and for the isolation of NBCCS polypeptides (as with affinitychromatography) .
Vectors encoding the NBCCS proteins are useful for expressing those 10 proteins to provide immunogens for antibody production. Vectors encoding the NBCCS
proteins are also useful for transforming cells in vitro or in vivo to express NBCCS proteins.
In vivo transformation of cells to express heterologous NBCCS genes can be used to offset deficient e~e;,~iOn of the NBCCS protein.
Cells and/or tissues expressing the NBCCS (PTC) gene may be used to 15 monitor ~les~ion levels of NBCCS polypeptides in a wide variety of contexts. For example, where the effects of a drug on NBCCS ekpl~sion is to be determined the drug will be ~mini~tered to the transformed (to express NBCCS) org~ni.cm, tissue, or cell.Expression levels, or ~ tssion products will be assayed as described below and the results compa~ed results from to org;~ni~m~, tissues, or cells similarly treated, but without the drug 20 being tested.

II. The NBCCS (PTC) ~ene.
A) The human PTC ~ene.
Sequence Listing ID NO: 1 provides both nucleic acid and polypeptide 25 sequence listings for the human PTC cDNA of this invention. The sequence of human PTC, as shown, consists of an open reading frame of 3888 nucleotides flanked by 441 and 2240 nucleotides on the S' end and on the 3' end, respectively (SEQ ID NO- 1, Fig. 8). The open reading frame of human PTC cDNA encodes for a putative protein of 1296 amino acids.
The open reading frame starts with an ATG codon that has a moderate match for the 30 translational start consensus sequence in vertebrates (GAGGCTATGT (SEQ ID NO: 6) in PTC versus GCCGCCATGG (SEQ ID NO: 7) (Kozak (1991) J. Biol. Chem. 266: 19867-19870)). This codon codes for the first amino acid of one human form of the PTC protein .. . .. .

consisting of 1296 amino acids with a relative molecular weight (Mr) of 131 X 103. It shows 61% sequence identity to its Drosophila counterpart. The open reading frame extends an additional 354 nucleotides u~ eal~l of the ATG codon (starting at base pair 88 of the sequence shown in Figure 8). The 3' untr~n~l~tçcl region contains a canonical polyadenylation signal (AATAAA (SEQ ID NO: 8)) as well as mRNA destabilizing (ATTTA (SEQ ID NO: 9)) motifs. These are localized 1401 nucleotides and 547, 743, and 1515 nucleotides after the termin~tion codon, respectively. A second hurnan PTC protein contains an open reading frame that continues right through to the 5' end, and may be initiated by upstream sequences.
~) Isolation of cDNA and/or probes.
The nucleic acids (e.g., NBCCS cDNA, or subsequences (probes)) of the present invention are cloned, or arnplified by in vitro methods, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR), the transcription-based amplification system 15 (TAS), the self-sustained sequence replication system (SSR). A wide variety of cloning and in vitro amplification methodologies are well-known to persons of skill. Exarnples of these techniques and instructions sufficient to direct persons of skill through many cloning exercises are found in Berger and Kimmel, Guide to Molecular Cloning Techniques,Methods in Enzymology 152 Ac~flemic Press, Inc., San Diego, CA (Berger); Sambrook et al.
20 (1989) Molecular Cloning - ,4 Laboratory Manual (2nd ed.) Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor Press, NY, (Sambrook et al.); Current Protocols in Molecular Biology, F.M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1994 Supplement) (Ausubel); Cashion et al., U.S. patent number 5,017,478; and Carr, European Patent No.
25 0,246,864. Exarnples of techniques sufficient to direct persons of skill through in vitro amplification methods are found in Berger, Sarnbrook, and Ausubel, as well as Mullis et al., (1987) U.S. Patent No. 4,683,202; PCR Protocols A Guide to Methods and Applications (Innis et al. eds) Academic Press Inc. San Diego, CA (1990) (Innis); Arnheim & Levinson (October 1, 1990) C&EN 36-47; The Journal Of NIHResearch (1991) 3: 81-94; (Kwoh et 30 al. (1989) Proc. Natl. Acad. Sci. US~ 86: 1173; Guatelli et al. (1990) Proc. Natl. Acad. Sci.
US,4 87, 1874; Lomell etal. (1989) J. Clin. Chem., 35: 1826; T.~n-legren etal., (1988) .. . . ~ . .... . . . . ..

W O97/43414 PCTrUS97/08433 2]
Science, 241: 1077-1080; Van Brunt (1990) Biotechnology, 8: 291-294; Wu and Wallace, (1989) Gene, 4: 560; and Barringer et al. (1990) Gene, 89: 117.
In one preferred embodiment, the human NBCCS (PTC) cDNA can be isolated by routine cloning methods. The cDNA sequence provided in SEQ ID NO: l can be used to provide probes that specifically hybridize to the NBCCS gene, in a genomic DNA
sample, or to the NBCCS mRNA, in a total RNA sample (e.g., in a Southern blot). Once the target l~BCCS nucleic acid is identified (e.g., in a Southern blot), it can be isolated according to standard methods known to those of skill in the art (see, e.g., Sambrook et al. (19~9) Molecular Cloning: A Laboratory Manual, 2nd Ed., Vols. 1-3, Cold Spring Harbor 10 Laboratory; Berger and Kimmel (1987) Methods in Enzymology, Vol. 152. Guide to Molecular Cloning Techniques, San Diego: Academic Press, Inc.; or Ausubel e~ al. (1987) Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York). Methods of screening human cDNA libraries for the NBCCS gene are provided in Example l.
In another preferred embodiment, the human PTC cDNA can be isolated by amplification methods such as polymerase chain reaction (PCR). Table 2 provides primers suitable for the amplification of all 21 exons of the cDNA. In addition, app,o~liate PCR
protocols are provided in Example 2.

C~ Labelin~ of nuc}eic acid probes.
Where the NBCCS cDNA or its subsequences are to be used as nucleic acid probes, it is often desirable to label the sequences with detectable labels. The labels may be incorporated by any of a number of means well known to those of skill in the art. However, in a preferred embodiment, the label is simultaneously incorporated during the amplification 25 step in the preparation of the sample nucleic acids. Thus, for example, polymerase chain reaction (PCR) with labeled primers or labeled nucleotides will provide a labeled amplification product. In another plercll~d embodiment, transcription amplification using a labeled nucleotide (e.g. fluorescein-labeled UTP and/or CTP) incorporates a label into the transcribed nucleic acids.
Alternatively, a label may be added directly to an original nucleic acid sample (e.g, mRNA, polyA mRNA, cDNA, etc.) or to the amplification product after the amplification is completed. Means of ~tt~rhing labels to nucleic acids are well known to those of skill in the art and include, for exarnple nick translation or end-labeling (e.g with a labeled RNA) by kin~ing of the nucleic acid and subsequent attachment (ligation) of a nucleic acid linker joining the sample nucleic acid to a label (e.g., a fluorophore).
Detectable labels suitable for use in the present invention include any 5 composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., DynabeadsTM), fluorescent dyes (e.g., fluorescein, texas red, rho~1~mine, green fluorescent protein, and the like), radiolabels (e.g., 3H, '2sI,35S, 14C, or 32p), enzymes (e.g, horse radish peroxidase, 10 alkaline phosphatase and others cornmonly used in an ELISA), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g, polystyrene, polypropylene, latex, etc.) beads. Patents teaching the use of such labels include U.S. Patent Nos. 3,817,837; 3,850,752;
3,939,350, 3,996,345; 4,277,437; 4,275,149; and 4,366,241.
Means of detecting such labels are well known to those of skill in the art.
15 Thus, for exarnple, radiolabels may be .letected using photographic film or scintillation counters, fluol~sc~l,t markers may be detected using a photodetector to detect emitted light.
Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and colorimetric labels are detected by simply visll~li7ing the colored label.
III. Antibodies to the NBCCS polYpeptide(s).
Antibodies are raised to the NBCCS polypeptides of the present invention, including individual, allelic, strain, or species variants, and fragments thereof, both in their naturally occurring (full-length) forrns and in recombinant forms. Additionally, antibodies 25 are raised to these polypeptides in either their native configurations or in non-native configurations. Anti-idiotypic antibodies can also be generated. Many methods of m~king antibodies are known to persons of skill. The following discussion is presented as a general overview of the techniques available; however, one of skill will recognize that many variations upon the following methods are known.

A) Antibodv Production A number of immunogens are used to produce antibodies specifically reactive with NBCCS polypeptides. Recombinant or synthetic polypeptides of 10 amino acids in length, or greater, selected from amino acid sub-sequences of SEQ ID NO I are the preferred 5 polypeptide immunogen (antigen) for the production of monoclonal or polyclonal antibodies.
In one class of pLef~ d emborlimPnt~, an immunogenic peptide conjugate is also included as an immllnogen. Naturally occurring polypeptides are also used either in pure or impure form.
Recombinant polypeptides are expressed in eukaryotic or prokaryotic cells (as 10 described below) and purified using standard techniques. The polypeptide, or a synthetic version thereof, is then injected into an animal capable of producing antibodies. Either monoclonal or polyclonal antibodies can be generated for subsequent use in immunoassays to measure the presence and quantity of the polypeptide.
Methods of producing polyclonal antibodies are l~nown to those of skill in the 15 art. In brief, an immunogen (antigen), preferably a purified polypeptide, a polypeptide coupled to an applopl;ate carrier (e.g., GST, keyhole limpet hemanocyanin, etc.), or a polypeptide incorporated into an imml~ni7~tion vector such as a recombinant vaccinia virus (see, U.S. Patent No. 4,722,848) is mixed with an adjuvant and ~nim~l.c are immunized with the mixture. The animal's immune response to the immunogen l,le~dldtion is monitored by 20 taking test bleeds and determinine the titer of reactivity to the polypeptide of interest. When a~.opl;ately high titers of antibody to the immunogen are obtained, blood is collected from the animal and antisera are prepared. Further fractionation of the antisera to enrich for antibodies reactive to the polypeptide is performed where desired (see, e.g, Coligan (1991) Curren~ Protocols in Immunology Wiley/Greene, NY; and Harlow and Lane (1989) 25 Antibodies: A Laboratory Manual Cold Spring Harbor Press, NY).
Antibodies, including binding fr~gment~ and single chain recombinant versions thereof, against predetermined fr~ement~ of NBCCS polypeptides are raised by immunizing ~nim~l~, e.g., with conjugates of the fr~ementc with carrier proteins as described above. Typically, the immunogen of interest is a peptide of at least about 5 amino acids, 30 more typically the peptide is 10 arnino acids in length, preferably, the fragment is 15 amino acids in length and more preferably the fragment is 20 amino acids in length or greater. The peptides are typically coupled to a carrier protein (e.g., as a fusion protein), or are CA 02266408 1998-ll-12 recombinantly expressed in an immunization vector. Antigenic determin~nt~ on peptides to which antibodies bind are typically 3 to 10 amino acids in length.
Monoclonal antibodies are ple~ d from cells secreting the desired antibody.
These antibodies are screened for binding to normal or modified polypeptides, or screened 5 for agonistic or antagonistic activity, e.g, activity mediated through a NBCCS protein.
Specific monoclonal and polyclonal antibodies will usually bind with a KD of at least about 0.1 mM, more usually at least about 50 IlM, and most preferably at least about I ~M or better.
In some instances, it is desirable to prepare monoclonal antibodies from 10 various m~mm~ n hosts, such as mice, rodents, primates, hllm~n.c, etc. Description of techniques for plepa~ g such monoclonal antibodies are found in, e.g, Stites et al. (eds.) Basic and Clinical Immunology (4th ed.) Lange Medical Publications, Los Altos, CA, and references cited therein; Harlow and Lane, supra; Goding (1986) Monoclonal Antibodies.
Principles and Practice (2d ed.) Academic Press, New York, NY; and Kohler and Milstein (1975) Nature 256: 495-497. Summ~ri7ed briefly, this method proceeds by injecting an animal with an immunogen. The animal is then sacrificed and cells taken from its spleen, which are fused with myeloma cells. The result is a hybrid cell or "hybridoma" that is capable of reproducing in vitro. The population of hybridomas is then screened to isolate individual clones, each of which secrete a single antibody species to the immunogen. In this 20 manner, the individual antibody species obtained are the products of immortalized and cloned single B cells from the immune animal generated in response to a specific site recognized on the immunogenic substance.
Alternative methods of immortalization include transfonnation with Epstein Barr Virus, oncogenes, or retroviruses, or other methods known in the art. Colonies arising 25 from single immortalized cells are screened for production of antibodies of the desired specificity and affinity for the antigen, and yield of the monoclonal antibodies produced by such cells is enhanced by various techniques, including injection into the peritoneal cavity of a vertebrate (preferably m~mm~ n) host. The polypeptides and antibodies of the present invention are used with or without modification, and include chimeric antibodies such as 30 hllm~ni7e~1 murine antibodies.
Other suitable techniques involve selection of libraries of recombinant antibodies in phage or similar vectors (see, e.g., Huse etal. (1989) Science 246: 1275-1281;

, . . ~ .... . .

CA 02266408 l998-ll-l2 W O97/43414 PCTrUS97/08433 and Ward, et al. (1989) Nature 341:544-546; and Vaughan et al. (1996) Nature Biotechnology, 14:309-314).
Frequently, the polypeptides and antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionucleotides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like. Patents te~chine the use of such labels include U.S. Patent Nos.
3,817,837;3,850,752;3,939,350;3,996,345;4,277,437;4,275,149;arld 4,366,241. Also, recombinant immnnoglobulins may be produced. See, Cabilly, U.S. Patent No. 4,816,567;
and Queen et al. (1989) Proc. Nat'l Acad. Sci. USA 86:10029-10033.
The antibodies of this invention are also used for affinity chromatography in isolating NBCCS polypeptides. Columns are ple~ ed, e.g, with the antibodies linked to a solid support, e.g., particles, such as agarose, Sephadex, or the like, where a cell Iysate is passed through the column, washed, and treated with increasing concentrations of a mild denaturant, whereby purified NBCCS polypeptides are released.
The antibodies can be used to screen expression libraries for particular expression products such as normal or abnormal human NBCCS protein. Usually the antibodies in such a procedure are labeled with a moiety allowing easy detection of presence of antigen by antibody binding.
Antibodies raised against NBCCS polypeptides can also be used to raise anti-idiotypic antibodies. These are useful for detecting or diagnosing various pathological conditions related to the presence of the respective antigens.

B) Human or h~ ni7.P~I (chimeric) antibodv production.
The anti-NBCCS antibodies of this invention can also be ~lmini~tered to an organism (e.g, a human patient) for therapeutic purposes (e.g., to block the action an NBCCS polypeptide or as targeting molecules when conjugated or fused to effectormolecules such as labels, cytotoxins, enzymes, growth factors, drugs, etc.). Antibodies 30 ~rlministered to an organism other than the species in which they are raised are often immunogenic. Thus, for example, murine antibodies a-l~nini~tered to a human often induce an immunologic response against the antibody (e.g., the human anti-mouse antibody ..

(HAMA) response) on multiple ~lmini.~trations. The immunogenic properties of theantibody are reduced by altering portions, or all, of the antibody into characteristically human sequences thereby producing chimeric or human antibodies, respectively.

i) Hlln~ani7e~l (chimeric) antibodies.
Hllm~ni7~fl (chimeric) antibodies are immunoglobulin molecules comprising a human and non-human portion. More specifically, the antigen combining region (or variable region) of a hum~ni7~cl chimeric antibody is derived from a non-human source (e.g, murine) and the constant region of the chimeric antibody (which confers biological effector function to the irnmunoglobulin) is derived from a human source. The hnm~ni7Pcl chimeric antibody should have the antigen binding (e.g., anti-NBCCS polypeptide) specificity of the non-human antibody molecule and the effector function conferred by the human antibody molecule. A large number of methods of generating chimeric antibodies are well known to those of skill in the art (see, e.g, U.S. Patent Nos: 5,502,167, 5,500,362, 5,491,088, 5,482,856, 5,472,693, 5,354,847, 5,292,867, 5,231,026, 5,204,244, 5,202,238, 5,169,939, 5,081,235, 5,075,431, and 4,975,369).
In general, the procedures used to produce these chimeric antibodies consist of the following steps (the order of some steps may be interchanged): (a) identifying and cloning the correct gene segment encoding the antigen binding portion of the antibody molecule; this gene segment (known as the VDJ, variable, diversity and joining regions for heavy chains or VJ, variable, joining regions for light chains (or simply as the V or Variable region) may be in either the cDNA or genomic form; (b) cloning the gene segments encoding the constant region or desired part thereof; (c) ligating the variable region to the constant region so that the complete chimeric antibody is encoded in a transcribable and tr~n.cl~t~ble form; (d) lig~ting this construct into a vector Co"~ g a selectable marker and gene control regions such as promoters, enhancers and poly(A) addition signals; (e) amplifying this construct in a host cell (e.g, bacteria); (f) introducing the DNA into eukaryotic cells (transfection) most often m~mm~ n Iymphocytes; and culturing the host cell underconditions suitable for expression of the chimeric antibody.
Antibodies of several distinct antigen binding specificities have been manipulated by these protocols to produce chimeric proteins (e.g., anti-TNP: Boulianne et al.
(1984) Natllre, 312: 643; and anti-tumor antigens: S~h~g~n et al. (1986) J. Immunol., 137:

1066). Likewise several different effector functions have been achieved by linking new sequences to those encoding the antigen binding region. Some of these include en~ymes (Neuberger et al. (1984) Nature 312: 604), immunoglobulin constant regions from another species and constant regions of another immunoglobulin chain (Sharon et al. ( 1984) Nature 309: 364; Tan etal., (1985)J. lmmunol. 135: 3565-3567).
In one plefe~,ed embodiment, a recombinant DNA vector is used to transfect a cell line that produces an anti-NBCCS antibody. The novel recombinant DNA vector contains a "replacement gene" to replace all or a portion of the gene encoding the immunoglobulin constant region in the cell line (e.g, a replacement gene may encode all or a 10 portion of a constant region of a human immunoglobulin, a specific immunoglobulin class, or an enzyme, a toxin, a biologically active peptide, a growth factor, inhibitor, or a linker peptide to facilitate conjugation to a drug, toxin, or other molecule, etc.), and a "target sequence" which allows for targeted homologous recombination with immunoglobulinsequences within the antibody producing cell.
In another embodiment, a recombinant DNA vector is used to transfect a cell line that produces an antibody having a desired effector function, (e.g, a constant region of a human immunoglobulin) in which case, the replacement gene contained in the recombinant vector may encode all or a portion of a region of an anti-NBCCS antibody and the target sequence contained in the recombinant vector allows for homologous recombination and targeted gene modification within the antibody producing cell. In either embodiment, when only a portion of the variable or constant region is replaced, the resulting chimeric antibody may define the same antigen and/or have the same effector function yet be altered or improved so that the chimeric antibody may demonstrate a greater antigen specificity, greater affinity binding constant, increased effector function, or increased secretion and production by the transfected antibody producing cell line, etc.
Regardless of the embodiment practiced, the processes of selection for integrated DNA (via a selectable marker), screening for chimeric antibody production, and cell cloning, can be used to obtain a clone of cells producing the chimeric antibody.
Thus, a piece of DNA which encodes a modification for a monoclonal antibody can be targeted directly to the site of the expressed immunoglobulin gene within a B-cell or hybridoma cell line. DNA constructs for any particular modification may be used to alter the protein product of any monoclonal cell line or hybridoma. Such a procedure . .. , . _.

circumvents the costly and time consuming task of cloning both heavy and light chain variable region genes from each B-cell clone expressing a useful antigen specificity. In addition to circumventing the process of cloning variable region genes, the level of ~x~ession of chimeric antibody should be higher when the gene is at its natural chromosomal location rather than at a random position. Detailed methods for prep~dtion of chimeric (h.lnn~ni7P~l) antibodies can be found in U.S. Patent 5,482,856.

ii) Human antibodies.
In another embodiment, this invention provides for fully human anti-NBCCS
10 antibodies. Human antibodies consist entirely of characteristically human polypeptide sequences. The human anti-NBCCS antibodies of this invention can be produced in using a wide variety of methods (see, e.g, Larrick et al., U.S. Pat. No. 5,001,065, for review).
In one preferred embodiment, the human anti-NBCCS antibodies of the present invention are usually produced initially in trioma cells. Genes encoding the 15 antibodies are then cloned and ~ essed in other cells, particularly, nonhuman m~mm~ n cells.
The general approach for producing human antibodies by trioma technology has been described by Ostberg et al. (1983) Hybridoma 2: 361-367, Ostberg, U.S. Pat.
No. 4,634,664, and Engelman et al., U.S. Pat. No. 4,634,666. The antibody-producing cell 20 lines obtained by this method are called triomas because they are descended from three cells;
two human and one mouse. Triomas have been found to produce antibody more stably than ordinary hybridomas made from human cells.
P~c~dLion of trioma cells requires an initial fusion of a mouse myeloma cell line with lmimmllni7~d human peripheral B Iymphocytes. This fusion generates a xenogenic 25 hybrid cell cont~ining both human and mouse chromosomes (see, Engelman, supra.).
Xenogenic cells that have lost the capacity to secrete antibodies are selected. Preferably, a xenogenic cell is selected that is resistant to 8-a_aguanine. Cells possessing reci.~t~nce to 8-azaguanine are unable to propagate on hypox~nthine-aminopterin-thymidine (HAT) or azaserine-hypoxanthine (AH) media.
The capacity to secrete antibodies is conferred by a further fusion between the xenogenic cell and B-lymphocytes immnni7~d against an NBCCS polypeptide or an epitope thereof. The B-lymphocytes are obtained from the spleen, blood or Iymph nodes of .. , .. .,,, , ~, ~ . ..

W O 97/43414 PCTnUS97/08433 human donor. If antibodies against a specific antigen or epitope are desired, it is preferable to use that antigen or epitope thereof as the immunogen rather than NBCCS polypeptide.
Alternatively, B-lymphocytes are obtained from an unimmunized individual and stimulated with an NBCCS polypeptide, or a epitope thereof, in vitro. In a further variation, B-5 Iymphocytes are obtained from an infected, or otherwise immunized individual. and thenhyperimmllni7f d by exposure to an NBCCS polypeptide for about seven to fourteen days, in vltro.
The immunized B-lymphocytes prepared by one of the above procedures are fused ~vith a xenogenic hybrid cell by well known methods. For example, the cells are treated with 40-S0% polyethylene glycol of MW 1000-4000, at about 37~C for about 5-10 min. Cells are separated from the fusion mixture and propagated in media selective for the desired hybrids. When the xenogenic hybrid cell is resistant to 8-azaguanine, immortalized trioma cells are conveniently selected by successive passage of cells on HAT or AH
medium. Other selective procedures are, of course, possible depending on the nature of the cells used in fusion. Clones secreting antibodies having the required binding specificity are identified by assaying the trioma culture medium for the ability to bind to an NBCCS
polypeptide or an epitope thereof. Triomas producing human antibodies having the desired specificity are subcloned by the limiting dilution technique and grown in vitro in culture medium, or are injected into selected host animals and grown in vivo.
The trioma cell lines obtained are then tested for the ability to bind an NBCCS polypeptide or an epitope thereof. Antibodies are separated from the resulting culture medium or body fluids by conventional antibody-fractionation procedures, such as ammonium sulfate pleci~ilalion, DEAE cellulose chromatography and affinity chromatography .
Although triomas are genetically stable they do not produce antibodies at very high levels. Expression levels can be increased by cloning antibody genes from the trioma into one or more ~,~plession vectors, and transforming the vector into a cell line such as the cell lines typically used for expression of recombinant or hl-m~ni7ed immunoglobulins. As well as increasing yield of antibody, this strategy offers the additional advantage that imrnunoglobulins are obtained from a cell line that does not have a human component, and does not therefore need to be subjected to the especially extensive viral screening required for hDan cell lines.

The genes encoding the heavy and light chains of immunoglobulins secreted by trioma cell lines are cloned according to methods, including the polymerase chain reaction, known in the art (see, e.g., Sambrook et al., Molecular Cloning. A Laboratory Manual, 2nd ed., Cold Spring Harbor, N.Y., 1989; Berger & Kimmel, Methods in ~nzymology, Vol. 152: Guide to Molecular Cloning Techniques, Academic Press, Inc., San Diego, Calif., 1987, Co et al. (1992~ ~ Immunol., 148: 1149). For example, genes encoding heavy and light chains are cloned from a trioma's genomic DNA or cDNA produced by reverse transcription of the trioma's RNA. Cloning is accomplished by conventional techniques including the use of PCR primers that hybridize to the sequences flanking or 10 overlapping the genes, or segments of genes, to be cloned.
Typically, recombinant constructs comprise DNA segments encoding a complete human immunoglobulin heavy chain and/or a complete human immunoglobulinlight chain of an immllnoglobulin expressed by a trioma cell line. Alternatively, DNA
segments encoding only a portion of the primary antibody genes are produced, which 15 portions possess binding and/or effector activities. Other recombinant constructs contain segments of trioma cell line irnmunoglobulin genes fused to segments of other immunoglobulin genes, particularly segments of other human constant region sequences (heavy andlor light chain). Human constant region sequences can be selected from various reference sources, including but not limited to those listed in Kabat et al. (1987) Sequences 20 of Proteins of Immunological Interest, U.S. Department of Health and Human Services.
In addition to the DNA segment.c encoding anti-NBCCS immunoglobulins or fragments thereof, other subst~nti~lly homologous modified immllnoglobulins can be readily designed and m~nuf~etured l1tili7ing various recombinant DNA techniques,known to those skilled in the art such as site-directed mutagenesis (see Gillman & Smith (1979) Gene, 8:
25 81-97; Roberts et al. (1987) Nature 328: 731 -734). Such modified segments will usually retain antigen binding capacity and/or effector function. Moreover, the modified segment~
are usually not so far changed from the original trioma genomic sequences to prevent hybridization to these sequences under stringent conditions. Because, like many genes, immunoglobulin genes contain separate functional regions, each having one or more distinct 30 biological activities, the genes may be fused to functional regions from other genes to produce fusion proteins (e.g., immunotoxins) having novel properties or novel combinations of properties.

The recombinant polynucleotide constructs will typically include arl expression control sequence operably linked to the coding sequences, including naturally-associated or heterologous promoter regions. Preferably, the e~c~ression control sequences will be eukaryotic promoter systems in vectors capable of transforming or transfecting 5 eukaryotic host cells. Once the vector has been incorporated into the a~ opl;ate host, the host is m~int~inPd under conditions suitable for high level expression of the nucleotide sequences, and the collection and purification of the human anti-NBCCS imrnunoglobulins.
These e~,c,ssion vectors are typically replicable in the host org~nicm~ either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression 10 vectors will contain selection markers, e.g., ampicillin-re~i~t~nre or hygromycin-resistance, to perrnit detection of those cells transformed with the desired DNA sequences.
In general, prokaryotes can be used for cloning the DNA sequences encoding a human anti-NBCCS immunoglobulin chain. E. coli is one prokaryotic host particularly useful for cloning the DNA sequences of the present invention. Microbes, such as yeast are 15 also useful for ~I,ression. Saccharomyces is a preferred yeast host, with suitable vectors having expression control sequences, an origin of replication, termination sequences and the like as desired. Typical promoters include 3-phosphoglycerate kinase and other glycolytic enzymes. Inducible yeast promoters include, among others, promoters from alcoholdehydrogenase 2, isocytochrome C, and enzymes responsible for maltose and galactose 20 utilization.
lv~ m~ n cells are a particularly ple~lled host for ~ ssillg nucleotide segments encoding immunoglobulins or fragments thereof (see, e.g., Winnacker, From Genes to Clones, VCH Publishers, N.Y., 1987). A number of suitable host cell lines capable of secreting intact heterologous proteins have been developed in the art, and include CHO
25 cell lines, various COS cell lines, HeLa cells, L cells and myeloma cell lines. Preferably, the cells are nonhuman. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer (Queen et al. (1986) Immunol. Rev. 89: 49), and necess~ry proces~ing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and Lldllsc"l~lional terminator sequences.
30 Preferred ~xpression control sequences are promoters derived from endogenous genes, cytomegalovirus, SV40, adenovirus, bovine papillomavirus, and the like (see, e.g, Co et al.
(1992) J. Immunol. 148: 1 149).

The vectors cont~ining the DNA segments of interest can be transferred into the host cell by well-known methods, depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment, electroporation, lipofection, biolistics or viral-based transfection may 5 be used for other cellular hosts. Other methods used to transform m~mm~ n cells include the use of polybrene, protoplast fusion, liposomes, elecl~v~uoldlion, and microinjection (see, generally, Sambrook et al., supra).
Once expressed, human anti-NBCCS immunoglobulins of the invention can be purified according to standard procedures of the art, including HPLC purification, fraction 10 column chromatography, gel electrophoresis and the like (see, generally, Scopes, Protein Purification, Springer-Verlag, NY, 1982 ). Detailed protocols for the production of human antibodies can be found in U.S. Patent 5,506,132.
Other approaches in vitro immunization of hurnan blood. In this approach, human blood lymphocytes capable of producing hurnan antibodies are produced. Human 15 peripheral blood is collected from the patient and is treated to recover mononuclear cells.
The suppressor T-cells then are removed and rem~ining cells are suspended in a tissue culture medium to which is added the antigen and autologous serum and, preferably, a nonspecific Iymphocyte activator. The cells then are incubated for a period of time so that they produce the specific antibody desired. The cells then can be fused to human myeloma 20 cells to irnmortalize the cell line, thereby to permit continuous production of antibody (see U.S. Patent 4,716,111).
In another approach, mouse-human hybridomas which produces human anti-NBCCS are prepared (see, e.g., 5,506,132). Other approaches include ir~,,.u"i7~tion of murines transformed to express human immunoglobulin genes, and phage display screening 25 (Vaughan et al. supra. ).

IV. Expression of NBCCS pol~l.e~,tides.
A) De novo chemical svnthesis.
The NBCCs proteins or subsequences thereof may be synthesized using 30 standard chemical peptide synthesis techniques. Where the desired subsequences are relatively short (e.g, when a particular antigenic determinant is desired) the molecule may be synth~si71ocl as a single contiguous polypeptide. Where larger molecules are desired, . , .

W O 97/43414 rCTrUS97/08433 subsequences can be synthtosi7ed separately (in one or more units) and then fused by conden~tion of the amino terrninus of one molecule with the carboxyl terrninus of the other molecule thereby forming a peptide bond.
Solid phase synthesis in which the C-tç-min~l amino acid of the sequence is ~ rh.od to an insoluble support followed by sequential addition of the rem~ining amino acids in the sequence is the l~lere.led method for the chemical synthesis of the polypeptides of this invention. Techniques for solid phase synthesis are described by Barany and Merrifield, Solid-Phase Peptide Synthesis; pp. 3-284 in The Peptides: Analysis, Synthesis, Biology. Vol 2: Special Methods in Peptide Synthesis, Part A., Merrifield, et al. J. Am.
0 Chem. Soc., 85: 2149-2156 (1963), and Stewart et al., Solid Phase Peptide Synthesis, 2nd ed.
Pierce Chem. Co., Rockford, Ill. (1984).

B) Recombinant expression.
In a preferred embodiment, the NBCCS proteins or subsequences thereof, are 15 synthesized using recombinant DNA methodology. Generally this involves creating a DNA
sequence that encodes the fusion protein, placing the DNA in an expression cassette under the control of a particular promoter, ~pl~ssing the protein in a host, isolating the expressed protein and, if required, rellalu~ g the protein.
DNA encoding the NBCCS proteins or subsequences of this invention may be 20 l~lcp~ed by any suitable method as described above, including, for example, cloning and restriction of a~lopliate sequences or direct chemical synthesis by methods such as the phosphotriester method of Narang et al. Meth. Enzymol. 68: 90-99 (1979); the phosphodiester method of Brown et al., Meth. Enzymol. 68: 109- 151 (1979); the diethylphosphoramidite method of Beaucage et al., Tetra. Lett., 22: 1859-1862 (1981); and 25 the solid support method of U.S. Patent No. 4,458,066.
Chemical synthesis produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. One of skill would recognize that while chemical synthesis of DNA is limited to sequences of about 100 30 bases, longer sequences may be obtained by the ligation of shorter se~uences.

.

Alternatively, subsequences may be cloned and the ap~,opliate subsequences cleaved using apl,lopliate restriction enzymes. The fragments may then be ligated to produce the desired DNA sequence.
In one embodiment, NBCCS proteins of this invention may be cloned using 5 DNA amplification methods such as polymerase chain reaction (PCR). Thus, for example, the nucleic acid sequence or subsequence is PCR amplified, using a sense primer containing one restriction site (e.g, NdeI) and an ~nti~en~e primer containing another restriction site (e.g, ~indIII). This will produce a nucleic acid encoding the desired NBCCS sequence or subsequence and having tennin~l restriction sites. This nucleic acid can then be easily 10 ligated into a vector cont~ining a nucleic acid encoding the second molecule and having the ap~lopliate corresponding restriction sites. Suitable PCR primers can be determined by one of skill in the art using the Sequence information provided in SEQ ID NO: l . Appropriate restriction sites can also be added to the nucleic acid encoding the NBCCS protein or protein subsequence by site-directed mutagenesis. The plasmid cont~ining the NBCCS sequence or 15 subsequence is cleaved with the ~pl~,iate restriction endonuclease and then ligated into the vector encoding the second molecule according to standard methods.
The nucleic acid sequences encoding NBCCS proteins or protein subsequences may be expressed in a variety of host cells, including E. coli, other bacterial hosts, yeast, and various higher eukaryotic cells such as the COS, CHO and HeLa cells lines 20 and myeloma cell lines. As the NBCCS proteins are typically found in eukaryotes, a eukaryote host is pl~felled. The recombinant protein gene will be operably linked to apl)lol,l;ate ekplession control sequences for each host. For E. coli this includes a promoter such as the T7, trp, or lambda promoters, a ribosome binding site and preferably a transcription termin~tion signal. For eukaryotic cells, the control sequences will include a 25 promoter and preferably an enh~nrer derived from immunoglobulin genes, SV40, cytomegalovirus, etc., and a polyadenylation sequence, and may include splice donor and acceptor sequences.
The plasmids of the invention can be transferred into the chosen host cell by well-known methods such as calcium chloride transformation for E. coli and calcium 30 phosphate tre~tment or electroporation for m~mm~ n cells. Cells transformed by the plasmids can be selected by resistance to antibiotics conferred by genes contained on the plasmids, such as the amp, gpt, neo and hyg genes.

. .

CA 02266408 1998-ll-12 W O97/43414 PCT~US97/08433 Once expressed, the recombinant NBCCS proteins can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (see, generally, R.
Scopes, Protein Purification, Springer-Verlag, N.Y. (1982), Deutscher, Methods in Enzymology Vol. 182. Guide to Protein Purification., Ac~mic Press, Inc. N.Y. (1990)).
Substantially pure compositions of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity are most preferred. Once purified, partially or tohomogeneity as desired, the polypeptides may then be used (e.g, as immunogens for antibody production).
One of skill in the art would recognize that after chemical synthesis, biological t~pr~ion, or purification, the NBCCS protein(s) may possess a conformation subst~nti~lly different than the native conformations of the constituent polypeptides. In this case, it may be necessary to denature and reduce the polypeptide and then to cause the polypeptide to re-fold into the ~,ercll~d conformation. Methods of reducing and denaturing proteins and inducing re-folding are well known to those of skill in the art tSee, Debinski et al. (1993) ~ Biol. Chem., 268: 14065-14070; Kreitman and Pastan (1993) Bioconjug. Chem., 4: 581-585; and Buchner, et al., (1992) Anal. Biochem., 205: 263-270). Debinski et al., for example, describe the denaturation and reduction of inclusion body proteins in guanidine-DTE. The protein is then refolded in a redox buffer cont~ining oxidized glutathione and L-arginine.
One of skill would recognize that modifications can be made to the NBCCS
proteins without dimini~hing their biological activity. Some modifications may be made to facilitate the cloning, e~p,~ssion, or incorporation of the targeting molecule into a fusion protein. Such modifications are well known to those of skill in the art and include, for example, a methionine added at the amino terminus to provide an initiation site, or additional amino acids (e.g., poly His) placed on either tenninl-s to create conveniently located restriction sites or termination codons or purification sequences.

V. Detection of NBCCS
As indicated above, abnormal (e.g., altered or deficient) e~les~ion of the human PTC gene is a causal factor in the development of basal cell carcinomas and, where the alteration is a heritable character, in the etiology of nevoid basal cell carcinoma . .

syndrome and/or the various developmental abnormalities characteristic of this syndrome. It is believed that development of neoplasia requires complete inactivation of the NBCCS
gene, however, partial inactivation creates a predisposition, either through haploinsufficiency or through increased susceptibility to complete inactivation (e.g, through a second S mutation), to basal cell carcinomas and/or NBCCS.
Thus, it is desirable to determine the presence or absence, or quantify, the expression of NBCCS polypeptides of the nucleic acids encoding the NBCCS polypeptides.
This may be accomplished by assaying the gene product; NBCCS polypeptides themselves, or alternatively, by assaying the nucleic acids (DNA or mRNA) that encode the NBCCS
10 polypeptides. In particular, it is desirable to determine whether NBCCS expression is present, absent, or abnormal (e.g. because of an abnormal gene product or because of abnormal expression levels as, for example, with a hemizygous gene). Particularly, where it is desired to determine a heritable propensity for abnormal NBCCS gene expression, it is preferred to assay the host DNA for abnormal NBCCS genes or gene transcripts (mRNAs).
A) Sample Collection and Fn)~
The NBCCS (PTC) gene or gene product (i.e., mRNA or polypeptide) is preferably detected and/or quantified in a biological sample. As used herein, a biological sample is a sample of biological tissue or fluid that, in a healthy and/or pathological state, 20 contains an NBCCS (PTC) nucleic acid or polypeptide. Such samples include, but are not limited to, sputum, amniotic fluid, blood, blood cells (e.g., white cells), tissue or fine needle biopsy samples, urine, peritoneal fluid, and pleural fluid, or cells thelerlul,~. Biological samples may also include sections of tissues such as frozen sections taken for histological purposes. Although the sample is typically taken from a human patient, the assays can be 25 used to detect NBCCS genes or gene products in samples from any m~mm~l, such as dogs, cats, sheep, cattle, and pigs.
The sample may be pl~llealed as n~ocess~ry by dilution in an a~plopl;ate buffer solution or concellLldted, if desired. Any of a number of standard aqueous buffer solutions, employing one of a variety of buffers, such as phosphate, Tris, or the like, at 30 physiological pH can be used.

.. . .
. .

W O 97/43414 PCT~US97/08433 B) Nucleic acid assays.
In one embodiment, this invention provides for methods of detecting and/or quantifying hurnan NBCCS (PTC) e~ression by assaying the underlying NBCCS gene (or a - fragment thereof) or by assaying the NBCCS gene transcript (mRNA). The assay can be for S the presence or absence of the normal gene or gene product, for the presence or absence of an abnormal gene or gene product, or quantification of the transcription levels of normal or abnormal NBCCS gene product.

i) Nucleic acid sample.
In a preferred embodiment, nucleic acid assays are performed with a sarnple of nucleic acid isolated from the organism to be tested. In the simplest embodiment, such a nucleic acid sarnple is the total mRNA isolated from a biological sample. The nucleic acid (e.g., either genomic DNA or mRNA) may be isolated from the sample according to any of a number of methods well known to those of skill in the art. One of skill will appreciate that where alterations in the copy number of the NBCCS gene are to be detected genomic DNA is preferably isolated. Conversely, where expression levels of a gene or genes are to be detected, preferably RNA (mRNA) is isolated.
Methods of isolating total DNA or mRNA are well known to those of skill in the art. For example, methods of isolation and purification of nucleic acids are described in detail in Chapter 3 of Laboratory Techniques in Biochemistry and Molecular Biology.
Hybridization With Nucleic Acid Probes, Part 1. Theory and Nucleic Acid Preparation, P.
Tijssen, ed. Elsevier, N.Y. (1993) and Chapter 3 of Laboratory Techniques in Biochemistry and Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, P. Tijssen, ed. Elsevier, N.Y. (1993)).
In a preferred embodiment, the total nucleic acid is isolated from a given sarnple using, for example, an acid guanidinium-phenol-chloroform extraction method and polyA+ mRNA is isolated by oligo dT colurnn chromatography or by using (dT)n magnetic beads (see, e.g, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed.), Vols.
1-3, Cold Spring ~Iarbor Laboratory, ( 1989), or Current Pro~ocols in Molecular Biology, F.
Ausubel et al., ed. Greene Publishing and Wiley-Interscience, New York (1987)).
Frequently, it is desirable to amplify the nucleic acid sarnple prior to hybridization. One of skill in the art will appreciate that whatever amplification method is W O 97/43414 PCTrUS97108433 used, if a qu~~ ive result is desired, care must be taken to use a method that m~int:~in~ or controls for the relative frequencies of the amplified nucleic acids.
Methods of "qualllilalive" arnplification are well known to those of skill in the art. For example, quantitative PCR involves simultaneously co-amplifying a known quantity 5 of a control sequence using the same primers. This provides an internal standard that may be used to calibrate the PCR reaction. The high density array may then include probes specific to the internal standard for quantification of the amplified nucleic acid.
One ~refelled internal standard is a synthetic AW106 cRNA. The AW106 cRNA is combined with RNA isolated from the sample according to standard techniques 10 known to those of skill in the art. The RNA is then reverse transcribed using a reverse transcriptase to provide copy DNA. The cDNA sequences are then arnplified (e.g, by PCR) using labeled primers. The amplification products are separated, typically by electrophoresis, and the amount of radioactivity (proportional to the amount of amplified product) is determined. The amount of mRNA in the sample is then calculated by 15 comparison with the signal produced by the known AW106 RNA standard. Detailedprotocols for quanLil~live PCR are provided in PCR Protocols, A Guide to Merhods and Applications, Innis et al., Ac~ mic Press, Inc. N.Y., (1990).
Other suitable amplification methods include, but are not limited to polymerase chain reaction (PCR) (Innis et al. ( 1990) PCR Protocols. A guide to Methods 20 and Application. Ac~dçmic Press, Inc. San Diego), ligase chain reaction (LCR) (see Wu and Wallace (1989) Genomics 4: 560, Landegren et al. (1988) Science 241: 1077, and Barringer et al. (1990) Gene 89: 117, transcription amplification (Kwoh et al. (1989) Proc. Natl. Acad Sci. USA 86. 1173), and self-sustained sequence replication (Guatelli et al. (1990) Proc. Nat.
Acad. Sci. USA 87: 1874).
ii) Hybri~li7.~tion assays.
A variety of methods for specific DNA and RNA measurement using nucleic acid hybridization techniques are known to those of skill in the art (see Sambrook et al.
supra). For example, one method for evaluating the presence, absence, or quantity of DNA
30 encoding NBCCS proteins in a sample involves a Southern transfer. Briefly, the digested genomic DNA is run on agarose slab gels in buffer and transferred to membranes.

W 097/43414 PCT~US97/08433 39 Hybridization is carried out using the nucleic acid probes specific for the target NBCCS sequence or subsequence. Nucleic acid probes are designed based on the nucleic acid sequences encoding NBCCCS proteins (see SEQ ID NO: 1). The probes can be full length or less than the full length of the nucleic acid sequence encoding the NBCCS
S protein. Shorter probes are empirically tested for specificity. Preferably nucleic acid probes are 20 bases or longer in length. (See Sambrook et al. for methods of selecting nucleic acid probe sequences for use in nucleic acid hybridization.) Vi.~u~1i7~tion of the hybridized portions allows the qualitative ~leterrnin~tion of the presence or absence of DNA encoding NBCCS proteins.
Similarly, a Northern transfer may be used for the detection of mRNA
encoding NBCCS proteins. In brief, the mRNA is isolated from a given cell sarnple using, for example~ an acid guanidinium-phenol-chloroform extraction method. The mRNA is then electrophoresed to separate the rnRNA species and the mRNA is transferred from the gel to a nitrocellulose membrane. As with the Southern blots, labeled probes are used to identify the presence or absence of NBCCS proteins.
A variety of nucleic acid hybridization forrnats are known to those skilled in the art. For example, comrnon formats include sandwich assays and competition ordisplacement assays. Hybridization techniques are generally described in "Nucleic Acid Hybridization, A Practical Approach," Ed. Hames, B.D. and Higgins, S.J., IRL Press, (1985); Gall and Pardue Proc. Natl. Acad. Sci. U.S.A. 63: 378-383 (1969); and John et al.
Nature 223: 582-587 (1969).
For example, sandwich assays are commercially useful hybridization assays for ~letecting or isolating nucleic acid sequences. Such assays utilize a "capture" nucleic acid covalently immobilized to a solid support and a labeled "signal" nucleic acid in solution.
The clinical sample will provide the target nucleic acid. The "capture" nucleic acid and "signal" nucleic acid probe hybridize with the target nucleic acid to forrn a "sandwich"
hybridization complex. To be effective, the signal nucleic acid cannot hybridize with the capture nucleic acid.
Typically, labeled signal nucleic acids are used to detect hybridization.
Complem~r~t~ry nucleic acids or signal nucleic acids may be labeled by any one of several methods typically used to detect the presence of hybridized polynucleotides. The most common method of detection is the use of autoradiography with 3H, '25I,35S, '4C, or 32p wo 97/43414 PCT/us97/08433 labelled probes or the like. Other labels include ligands which bind to labeled antibodies, fluorophores, chemiluminescent agents, enzymes, and antibodies which can serve as specific binding pair members for a labeled ligand.
Detection of a hybridization complex may require the binding of a signal S generating complex to a duplex of target and probe polynucleotides or nucleic acids.
Typically, such binding occurs through ligand and anti-ligand interactions as between a ligand-conjugated probe and an anti-ligand conjugated with a signal.
The label may also allow indirect detection of the hybridization complex. For example, where the label is a hapten or antigen, the sample can be detected by using 10 antibodies. In these systems, a signal is generated by ~t~r~linE fluorescent or enzyme molecules to the antibodies or, in some cases, by ~ c~ment to a radioactive label. (Tijssen, P., "Practice and Theory of Enzyme Immunoassays," Laboratory Techniques in Bio-chemistry and Molecular Biology, Burdon, R.H., van Knippenberg, P.H., Eds., Elsevier (1985), pp. 9-20.).
The sensitivity of the hybridization assays may be ~nh~nced through use of a nucleic acid amplification system which multiplies the target nucleic acid being detected.
Examples of such systems include the polymerase chain reaction (PCR) system and the ligase chain reaction (LCR) system. Other methods recently described in the art are the nucleic acid sequence based amplification (NASBATM, Cangene, ~i.c.~ g~ Ontario) and 20 Q Beta Replicase systems.
An alternative means for ~lelr~ ;ng the level of expression of a gene encoding an NBCCS protein is in situ hybridization. In situ hybridization assays are well known and are generally described in Angerer, et al., Methods Enzymol., 152: 649-660 (1987). In an in situ hybridization assay, cells or tissue specimens are fixed to a solid 25 support, typically a glass slide. If DNA is to be probed, the cells are denatured with heat or alkali. The cells are then contacted with a hybridization solution at a moderate tempeldLIlle to permit annealing of labeled probes specific to NBCCS proteins. The probes are preferably labeled with radioisotopes or fluorescent reporters. Detection of NBCCS by in situ hybridization is detailed in Example 2.

, .~. . , ~

iii) AmPlification based assavs.
In another embodiment, the NBCCS gene or gene product can be detected (assayed) using an amplification based assay. In an amplification based assay, all or part of the NBCCS gene or transcript (e.g., mRNA or cDNA) is amplified and the amplification product is then detecte~ Where there is no underlying gene or gene product to act as a template amplification is non-specific or non-existent and there is no single arnplification product. Where the underlying gene or gene product is present, the target sequence is amplified providing an indication of the presence, absence, or quantity of he underlying gene or mRNA.
Amplification-based assays are well known to those of skill in the art (see, e.g., Innis, supra.). The cDNA sequence provided for the NBCCS gene is sufficient to enable one of skill to routinely select primers to amplify any portion of the gene. In addition, Table 2 provides primer pairs for the PCR amplification of each of the 21 exons comprising the NBCCS (PTC) gene. Example 2, below, provides amplification protocols and illustrates detection of the NBCCS (PTC) gene using PCR.
Amplification primers can be selected to provide amplification products that span specific deletions, truncations, and insertions, as discussed below (see, Section iv, below) thereby facilitating the detection of specific abnormalities.

iv) Specific detection of abnorr ~litie~ (e.~., mutations).
Abnormal NBCCS (PTC) genes or gene products are characterized by premature stop codons, deletions, or insertions. Typical abnormal genes (PTC mutations) are illustrated in Tables 3, 5, 6, 7 and 9. Premature stop codons and deletions can be detected by decreased size of the gene or gene product (mRNA transcript or cDNA).
Similarly, insertions can be detected by increased size of the gene or gene product.
Alternatively, mutations can be determined by sequencing of the gene or gene product according to standard methods.
In addition, arnplification assays and hybridization probes can be selected to specifically target particular abnormalities. ~or example, where the abnormality is a deletion, nucleic acid probes or amplification primers can be selected that specifically hybridize to or amplify, respectively, the nucleic acid sequence that is deleted in the abnormal gene. The probe will fail to hybridize, or the amplification reaction will fail to CA 02266408 l998-ll-l2 W 097/43414 PCTrUS97/08433 42 provide specific arnplification, to abnormal versions of the NBCCS (PTC) nucleic acids which have the deletion. Alternatively, the probe or arnplification reaction can be designed to span the entire deletion or either end of the deletion (deletion junction). Similarly, probes and arnplification primers can be selected that specifically target point mutations or 5 insertions. Methods for detecting specific mutations were described in, for exarnple, US
Patent No. 5,512,441. In the case of PCR, amplification primers can be designed to hybridize to a portion of the NBCCS (PTC) gene but the tçnnin~l nucleotide at the 3' end of the primer can be used to discriminate between the mutant and wild-type forms of NBCCS (PTC) gene.
If the terminal base m~tçlles the point mutation or the wild-type sequence, polymerase 10 dependent extension can proceed and an amplification product is detected. This method for detecting point mutations or polymorphisms was described in detail by Somrner et al., (1989) Mayo Clin. Proc. 64:1361-1372. By using a~uplopl;ate controls, one can develop a kit having both positive and negative amplification products. The products can be detected using specific probes or by simply detecting their presence or absence. A variation of the 15 PCR method uses LCR where the point of discrimination, i e., either the point mut~tion or the wild-type bases fall between the LCR oligonucleotides. The ligation of the oligonucleotides becomes the means for discrimin~tin~ between the mutant and wild-type forms of the NBCCS (PTC) gene.
A variety of automated solid-phase detection techniques are also applop~iate 20 for detecting the presence or absence of mutations in the NBCCS (PTC) gene. For instance, very large scale immobilized polymer arrays (VLSIPSTM), available from Affymetrix, Inc. in Santa Clara, CA are used for the detection of nucleic acids having specific sequences of interest. See, Fodor et al. (1991) Science, 251: 767- 777; Sheldon e~ al. (1993) Clinical Chemistry 39(4): 718-719, and Kozal et al. (1996) Nature Medicine 2(7): 753-759. For 25 example, oligonucleotides that hybridize to all known NBCCS (PTC) mutations can be synthe~i7~cl on a DNA chip (such chips are available from Affymetrix) and the nucleic acids from samples hybridized to the chip for simultaneous analysis of the sample nucleic acid for the presence or absence of any of the known NBCCS (PTC) mutations. Protocols fordetecting mutations are also described in, for example, Tijssen (1993) Laboratory 30 Techniques in biochemistry and molecular biology--hybridization with nucleic acidprobes parts I and II, Elsevier, New York, and Choo (ed) (1994) Methods In Molecular Biology ~ . . .

Volume 33- In Situ Hybridization Protocols, Humana Press Inc., New Jersey (see also, other books in the Methods in Molecular Biology series).

iv) Detection of expression levels.
Where it is desired to quantify the transcription level (and thereby expression)of a normal or mllt~te~l NBCCS genes in a sample, the nucleic acid sample is one in which the concentration of the mRNA transcript(s) of the NBCCS gene, or the concentration of the nucleic acids derived from the mRNA transcript(s), is pl'OpO~ lional to the transcription level (and therefore e~lession level) of that gene. Similarly, it is preferred that the hybridization 10 signal intensity be proportional to the amount of hybridized nucleic acid. While it is prefe~led that the proportionality be relatively strict (e.g., a doubling in transcription rate results in a doubling in mRNA transcript in the sample nucleic acid pool and a doubling in hybridization signal), one of skill will appreciate that the proportionality can be more relaxed and even non-linear. Thus, for example, an assay where a S fold difference in concentration 15 of the target mRNA results in a 3 to 6 fold difference in hybridization intensity is sufficient for most purposes. Where more precise quantification is required al,plopliate controls can be run to correct for variations introduced in sample plel,~d~ion and hybridization as described herein. In addition, serial dilutions of "standard" target mRNAs can be used to prepare calibration curves according to methods well known to those of skill in the art. Of course, 20 where simple detection of the presence or absence of a transcript is desired, no elaborate control or calibration is required.

C) NBCCS poly~ ide assays.
The expression of the human NBCCS (PTC) gene can also be detected and/or 25 quantified by (letectin~ or quantifying the expressed NBCCS polypeptide. The NBCCS
polypeptides can be ~etected and qu~ntified by any of a number of means well known to those of skill in the art. These may include analytic biochemical methods such as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like, or various 30 immunological methods such as fluid or gel pl~,.,ipi~ reactions, immunodiffusion (single or double), immunoelectrophoresis, radioimml-no~cs~y(RIA), enzyme-linked immllnt)sorbent assays (ELISAs), immunofluorescent assays, western.blotting, and the like.

In a particularly preferred embodiment, the NBCCS polypeptides are detected in an electrophoretic protein separation, more preferably in a two-dimensional electrophoresis, while in a most preferred embodiment, the NBCCS polypeptides are detected using an imrnunoassay.
As used herein, an immunoassay is an assay that utilizes an antibody to specifically bind to the analyte (NBCCS polypeptide). The immunoassay is thus char~cteri7~cl by detection of specific binding of a NBCCS polypeptide to an anti-NBCCS
antibody as opposed to the use of other physical or chemical properties to isolate, target, and quantify the analyte.
1) Electrophoretic Assavs.
As indicated above, the presence or absence of NBCCS polypeptides in a biological sample can be determined using electrophoretic methods. Means of detecting proteins using electrophoretic techniques are well known to those of skill in the art (see 15 generally, R. Scopes (1982) Protein Purification, Springer-Verlag, N.Y.; Deutscher, (1990) Methods in Enzymology Vol. 182. Guide to Protein Purification., Academic Press, Inc., N.Y.).

2) Immunolo~ical Bindin~ Assavs.
In a plefelled embodiment, the NBCCS polypeptides are detected and/or quantified using any of a number of well recognized imrnunological binding assays (see, e.g., U.S. Patents 4,366,241; 4,376,110; 4,517,288; and 4,837,168). For a review ofthe general immunoassays, see also Methods in Cell Biology Volume 37: Antibodies in Cell Biology, Asai, ed. Academic Press, Inc. New York (1993); Basic and Clinical Immunology 25 7th Edition, Stites & Terr, eds. (1991). Immunological binding assays (or immunoassays) typically utilize a "capture agent" to specifically bind to and often immobilize the analyte (in this case NBCCS polypeptide or subsequence). The capture agent is a moiety that specifically binds to the analyte. In a preferred embodiment, the capture agent is an antibody that specifically binds NBCCS polypeptide(s). The antibody (anti-NBCCS) may be 30 produced by any of a number of means well known to those of skill in the art as described above in Section III(A).

, . . . , ~

CA 02266408 1998-ll-12 W O 97/43414 PCTrUS97tO8433 Imrnunoassays also often utilize a labeling agent to specifically bind to and label the binding complex formed by the capture agent and the analyte. The labeling agent may itself be one of the moieties comprising the antibody/analyte complex. Thus, the - labeling agent may be a labeled NBCCS polypeptide or a labeled anti-NBCCS antibody.
5 Alternatively, the labeling agent may be a third moiety, such as another antibody, that specifically binds to the antibody/NBCCS complex.
In a ~,erel,ed embodiment, the labeling agent is a second hurnan NBCCS
antibody bearing a label. Alternatively, the second NBCCS antibody may lack a label, but it may, in turn, be bound by a labeled third antibody specific to antibodies of the species from 10 which the second antibody is derived. The second can be modified with a detectable moiety, such as biotin, to which a third labeled molecule can specifically bind, such as enzyme-labeled streptavidin.
Other proteins capable of specifically binding irnrnunoglobulin constant regions, such as protein A or protein G may also be used as the label agent. These proteins 15 are normal constituents of the cell walls of streptococcal bacteria. They exhibit a strong non-immunogenic reactivity with irnmunoglobulin constant regions from a variety of species (see, generally Kronval, et al. (1973) J. Immunol., l l l: 1401-1406, and Akerstrom, et al.
(1985)J. Immunol., 135: 2589-2542).
Throughout the assays, incubation and/or washing steps may be required after 20 each combination of reagents. Incubation steps can vary from about 5 seconds to several hours, preferably from about 5 min~ltes to about 24 hours. However, the incubation time will depend upon the assay format, analyte, volume of solution, concentrations, and the like.
Usually, the assays will be carried out at ambient t~ pclalule, although they can be conducted over a range of temperatures, such as 10~C to 40~C.
a) Non-Competitive Assav Formats.
Immunoassays for detecting NBCCS polypeptide may be either competitive or noncompetitive. Noncompetitive imrnunoassays are assays in which the arnount of captured analyte (in this case NBCCS) is directly measured. In one ple~ ed "sandwich"
30 assay, for example, the capture agent (anti-NBCCS antibodies) can be bound directly to a solid substrate where they are immobilized. These immobilized antibodies then capture NBCCS present in the test sample. The NBCCS thus imrnobilized is then bound by a WO 97/43414 PCT/US97tO8433 labeling agent, such as a second human NBCCS antibody bearing a label. Alternatively, the second NBCCS antibody may lack a label, but it may, in turn, be bound by a labeled third antibody specific to antibodies of the species from which the second antibody is derived.
The second can be modified with a ~etect~ble moiety, such as biotin, to which a third labeled S molecule can specifically bind, such as enzyme-labeled streptavidin.

b) Competitive assav formats.
In comp~liLi~e assays, the amount of analyte (NBCCS) present in the sample is measured indirectly by measuring the amount of an added (exogenous) analyte (NBCCS) 10 displaced (or competed away) from a capture agent (anti NBCCS antibody) by the analyte present in the sample. In one competitive assay, a known arnount of, in this c~e, NBCCS is added to the sarnple and the sample is then contacted with a capture agent, in this case an antibody that specifically binds NBCCS. The amount of NBCCS bound to the antibody is inversely proportional to the concentration of NBCCS present in the sample.
In a particularly pler~l.ed embodiment, the antibody is immobilized on a solid substrate. The amount of NBCCS bound to the antibody may be determined either by measuring the amount of NBCCS present in an NBCCS/antibody complex, or alternatively by measuring the amount of rem~inin~ uncomplexed NBCCS. The amount of NBCCS may be detected by providing a labeled NBCCS molecule.
A hapten inhibition assay is another preferred colll,ue~ e assay. In this assay a known analyte, in this case NBCCS is immobilized on a solid substrate. A known amount of anti-NBCCS antibody is added to the sample, and the sample is then contacted with the immobilized NBCCS. In this case, the amount of anti-NBCCS antibody bound to the immobilized NBCCS is inversely proportional to the amount of NBCCS present in the 25 sample. Again the amount of imrnobilized antibody may be detected by detecting either the immobilized fraction of antibody or the fraction of the antibody that remains in solution.
Detection may be direct where the antibody is labeled or indirect by the subsequent addition of a labeled moiety that specifically binds to the antibody as described above.

c) Other assav formats.
In a particularly preferred embo~limen~, Western blot (immunoblot) analysis is used to detect and quantify the presence of NBCCS in the sarnple. The technique W O 97t43414 PCTrUS97/08433 generally comprises sepa~aLillg sample proteins by gel electrophoresis on the basis of molecular weight, transferring the separated proteins to a suitable solid support, (such as a nitrocellulose filter, a nylon filter, or derivatized nylon filter), and incubating the sarnple with the antibodies that specifically bind NBCCS. The anti-NBCCS antibodies specifically 5 bind to NBCCS on the solid support. These antibodies may be directly labeled or alternatively may be subsequently detected using labeled antibodies (e.g., labeled sheep anti-mouse antibodies) that specifically bind to the anti-NBCCS.
Other assay forrnats include liposome immunoassays (LIA), which use liposomes clecign~d to bind specific molecules (e.g., antibodies) and release encapsulated 10 reagents or markers. The released chemicals are then detected according to standard techniques (see, Monroe et al. (1986) Amer. Clin. Prod. Rev. 5:34-41).

d) Scor;n~ of the assa~.
The assays of this invention as scored (as positive or negative for NBCCS
15 polypeptide) according to standard methods well known to those of skill in the art. The particular method of scoring will depend on the assay format and choice of label. For example, a Western Blot assay can be scored by visu~ ing the colored product produced by the enzymatic label. A clearly visible colored band or spot at the correct molecular weight is scored as a positive result, while the absence of a clearly visible spot or band is scored as a 20 negative. In a preferred emb~Aim~nt a positive test will show a signal intensity (e.g, NBCCS polypeptide quantity) at least twice that of the background and/or control and more preferably at least 3 times or even at least 5 times greater than the background and/or negative control.

e~ Reduction of non-specific bin-lin~
One of skill in the art will appreciate that it is often desirable to reduce non-specific binding in immunoassays. Particularly, where the assay involves an antigen or antibody immobilized on a solid substrate it is desirable to minimi7~ the amount of non-specific binding to the substrate. Means of reducing such non-specific binding are well known to those of skill in the art. Typically, this involves coating the substrate with a proteinaceous composition. In particular, protein compositions such as bovine serum wo 97/43414 PCT/US97/08433 albumin (BSA), nonfat powdered milk, and gelatin are widely used with powdered milk being most plerellcd.

f~ Labels.
The particular label or detectable group used in the assay is not a critical aspect of the invention, so long as it does not significantly interfere with the specific binding of the antibody used in the assay. The ~letect~ble group can be any material having a detectable physical or chemical plupclly. Such detectable labels have been well-developed in the field of immlmo~s~ys and, in general, most any label useful in such methods can be 10 applied to the present invention. Thus, a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels in the present invention include magnetic beads (e.g DynabeadsrM), fluorescent dyes (e.g, fluoresceil1 isothiocyanate, texas red, rhodamine, and the like), radiolabels (e.g, 3H, l25I, 35S, 14C, or 32p), enzymes (e.g, horse radish peroxidase, alk~line 15 phosph~t~e and others commonly used in an ELISA), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g polystyrene, polypropylene, latex, etc.) beads.
The label may be coupled directly or indirectly to the desired component of the assay according to methods well known in the art. As indicated above, a wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of 20 conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.
Non-radioactive labels are often ~tt~ched by indirect means. Generally, a ligand molecule (e.g., biotin) is covalently bound to the molecule. The ligand then binds to an anti-ligand (e.g, streptavidin) molecule which is either inherently detect~ble or covalently 25 bound to a signal system, such as a detectable enzyme, a fluo.esc~lll compound, or a chemiluminescent compound. A number of ligands and anti-ligands can be used. Where a ligand has a natural anti-ligand, for example, biotin, thyroxine, and cortisol, it can be used in conjunction with the labeled, naturally occurring anti-lig~nlls. Alternatively, any haptenic or antigenic compound can be used in combination with an antibody.
The molecules can also be conjugated directly to signal gene,~ g compounds, e.g., by conjugation with an enzyme or fluorophore. Erl7ymes of interest as labels will primarily be hydrolases, particularly phosph~t~ces, esterases and glycosidases, or CA 02266408 1998-ll-12 oxidoreductases, particularly peroxidases. Fluorescent compounds include fluorescein and its derivatives, rhodarnine and its derivatives, dansyl, umbelliferone, etc. Chemiluminescent compounds include luciferin, and 2,3-dihydrophth~1~7.inediones, e.g, luminol. For a review - of various labeling or signal producing systems which may be used, see, U.S. Patent No.
4,391,904).
Means of detecting labels are well known to those of skill in the art. Thus, forexample, where the label is a radioactive label, means for detection include a scintillation counter or photographic film as in autoradiography. Where the label is a fluorescent label, it may be detected by exciting the fluorochrome with the ~plopliate wavelength of light and detecting the resulting fluorescence. The fluorescence may be detected visually, by means of photographic film, by the use of electronic detectors such as charge coupled devices (CCDs) or photomultipliers and the like. Similarly, enzymatic labels may be detected by providing the a~,o~;ate substrates for the enzyme and detecting the resulting reaction product.
Finally simple colorimetric labels may be detected simply by observing the color associated with the label. Thus, in various dipstick assays, conjugated gold often appears pink, while various conjugated beads appear the color of the bead.
Some assay formats do not require the use of labeled components. For instance, agglutination assays can be used to detect the presence of the target antibodies. In this case, antigen-coated particles are agglntin~ted by samples comprising the target antibodies. In this format, none of the colllponents need be labeled and the presence of the target antibody is detected by simple visual inspection.

~) Substrates.
As mentioned above, depending upon the assay, various components, including the antigen, target antibody, or anti-human antibody, may be bound to a solid surface. Many methods for immobilizing biomolecules to a variety of solid surfaces are known in the art. For in~ts~nce, the solid surface may be a membrane (e.g, nitrocellulose), a microtiter dish (e.g., PVC, polypropylene, or polystyrene), a test tube (glass or plastic), a dipstick (e.g. glass, PVC, polypropylene, polystyrene, latex, and the like), a microcentrifuge tube, or a glass or plastic bead. The desired component may be covalently bound or noncovalently ~tt~rh~d through nonspecific bonding.

A wide variety of organic and inorganic polymers, both natural and synthetic may be employed as the material for the solid surface. Illustrative polymers include polyethylene, polypropylene, poly(4-methylbutene), polystyrene, polymethacrylate, poly(ethylene terephth~l~t~), rayon, nylon, poly(vinyl butyrate), polyvinylidene difluoride S (PVDF), silicones, polyforrnaldehyde, cellulose, cellulose acetate, nitrocellulose, and the like. Other materials which may be employed, include paper, glasses, ceramics, metals, metalloids, semiconductive materials, cçment.~ or the like. In addition, are included substances that form gels, such as proteins (e.g, gelatins), lipopolysaccharides, silicates, agarose and polyacrylamides can be used. Polymers which form several a~ueous phases, 10 such as dextrans, polyalkylene glycols or surfactants, such as phospholipids, long chain (12-24 carbon atoms) alkyl ammoniurn salts and the like are also suitable. Where the solid surface is porous, various pore sizes may be employed depending upon the nature of the system.
In pfepa~ g the surface, a plurality of different materials may be employed, 15 particularly as l~min~tes, to obtain various properties. For example, protein coatings, such as gelatin can be used to avoid non-specific binding, simplify covalent conjugation, enhance signal detection or the like.
If covalent bonding between a compound and the surface is desired, the surface will usually be polyfunctional or be capable of being polyfunction~li7e-1 Functional 20 groups which may be present on the surface and used for linking can include carboxylic acids, aldehydes, amino groups, cyano groups, ethylenic groups, hydroxyl groups, mercapto groups and the like. The manner of linking a wide variety of compounds to various surfaces is well known and is arnply illustrated in the literature. See, for example, Immobilized Enzymes, Ichiro Chibata, Halsted Press, New York, 1978, and Cuatrecasas ( 1970) J. Biol.
25 Chem. 245 3059).
In addition to covalent bonding, various methods for noncovalently binding an assay component can be used. Noncovalent binding is typically nonspecific absorption of a compound to the surface. Typically, the surface is blocked with a second compound to prevent nonspecific binding of labeled assay components. Alternatively, the surface is 30 design~d such that it nonspecifically binds one co~ onellt but does not significantly bind another. For exarnple, a surface bearing a lectin such as Concanavalin A will bind a carbohydrate cont~ining compound but not a labeled protein that lacks glycosylation.

WO97/43414 PCTrUS97/08433 Various solid surfaces for use in noncovalent attachment of assay components are reviewed in U.S. Patent Nos. 4,447,576 and 4,254,082.

C) Evaluation of NBCCS expression levels and/or abnormal ex~ression.
One of skill will appreciate that abnormal expression levels or abnormal expression products (e.g, mutated transcripts, truncated or non-sense polypeptides) are identified by comparison to normal ~ ession levels and normal ex~iession products.
Normal levels of exl.ression or normal e~ s~ion products can be determined for any particular population, subpopulation, or group of org~ni~ according to standard methods 10 well known to those of skill in the art. Typically this involves identifying healthy organi~m~
(i.e. org~ni~m~ without NBCCS or basal cell carcinomas) and measuring expression levels of the NBCCS (PTC) gene (as described herein) or sequencing the gene, mRNA, or reverse transcribed cDNA, to obtain typical (normal) sequence variations. Application of standard statistical methods used in molecular genetics permits dete.min~ion of baseline levels of 15 e~lei,sion, and normal gene products as well as significant deviations from such baseline levels.

D) Detection kits.
The present invention also provides for kits for the diagnosis of or~ni~m~
20 (e.g, patients) with a predisposition (at risk) nevoid basal cell carcinoma or for sporadic basal cell carcinomas. The kits preferably include one or more reagents for ~ e. .~ g the presence or absence of the NBCCS gene, for quantifying expression of the NBCCS gene, or for detecting an abnormal NBCCS gene or e~ es~ion products of an abnormal NBCCS gene.
Preferred reagents include nucleic acid probes that specifically bind to the normal NBCCS
25 gene, cDNA, or subsequence thereof, probes that specifically bind to abnormal NBCCS gene (e.g, NBCCS ColllAil~ g premature truncations, insertions, or deletions), antibodies that specifically bind to normal NBCCS polypeptides or subsequences thereof, or antibodies that specifically bind to abnormal NBCCS polypeptides or subsequences thereof. The antibody or hybridization probe may be free or immobilized on a solid support such as a test tube, a 30 microtiter plate, a dipstick and the like. The kit may also contain instructional materials teA~hin~ the use of the antibody or hybridization probe in an assay for the detection of a predisposition for NBCCS.

CA 02266408 1998-ll-12 W O 97t43414 P~ 9~/08433 The kits may include alternatively, or in combination with any of the other components described herein, an anti-NBCCS antibody. The antibody can be monoclonal or polyclonal. The antibody can be conjugated to another moiety such as a label and/or it can be immobilized on a solid support (substrate).
The kit(s) may also contain a second antibody for detection of NBCCS
polypeptide/antibody complexes or for detection of hybridized nucleic acid probes. The kit may contain applopl;ate reagents for detection of labels, positive and negative controls, washing solutions, dilution buffers and the like.

10 Vl. Modulation of expression of endo~enous NBCCS ~enes.
In still another embodiment, this invention provides methods of regulating the expression of endogenous NBCCS genes. The eA~ession of an NBCCS gene product maybe increased as a method of plG~ g mitigating or elimin~1ing the tumorigenic potential of a cell. Conversely, upregulation of NBCCS gene may induce neoplastic transformation and 15 provide a convenient and controllable model system for the study of basal cell carcinomas.
Methods of altering the GA~iession of endogenous genes are well known to those of skill in the art. Typically such methods involve altering or replacing all or a portion of the regulatory sequences controlling Gx~les~ion of the particular gene that is to be regulated. In a plGrGI.Gd embodiment, the regulatory sequences (e.g., the native promoter) 20 ~I1e~1I of the NBCCS gene is altered.
This is typically accomplished by the use of homologous recombination to introduce a heterologous nucleic acid into the native regulatory sequences. To downregulate expression the NBCCS gene product, simple mutations that either alter the reading frame or disrupt the promoter are suitable. To upregulate expression of the NBCCS gene product, the 25 native promoter(s) can be substituted with heterologous promoter(s) that induce higher than normal levels of transcription.
In a particularly plGr~lled embodiment, nucleic acid sequences comprising the structural gene in question or U~ l sequences are utilized for targeting heterologous recombination constructs. U~u~LlGam and downstream sequences can be readily determined 30 using the information provided herein. Such sequences, for example, can be extended using 5'- or 3'- RACE. and homologous recombination constructs created with only routine experiment~tion.

The use of homologous recombination to alter ~ es~ion of endogenous genes is described in detail in U.S. Patent 5,272,071, WO 91/09955, WO 93/09222, WO
96/29411, WO 95/31560, and WO 91/12650.

5 VII. NBCCS (PTC) Therapeutics.
A~ Pharmaceutical Compositions The NBCCS polypeptides, NBCCS polypeptide subsequences, anti-NBCCS
antibodies, and anti-NBCCS antibody-effector (e.g, enzyme, toxin, hormone, growth factor, drug, etc. ) conjugates or fusion proteins of this invention are useful for parenteral, topical, 10 oral, or local ~imini.ctration, such as by aerosol or transdermally, for prophylactic and/or therapeutic l~ .I The ph~rrn~ceutical compositions can be ~mini~tered in a variety of unit dosage forms depending upon the method of ~mini.ctration. For example, unit dosage forms suitable for oral ~mini~tration include powder, tablets, pills, capsules and lozenges.
It is recognized that the NBCCS polypeptides and related compounds described of, when 15 a~lmini~tçred orally, must be protected from digestion. This is typically accomplished either by complexing the protein with a composition to render it resistant to acidic and enzymatic hydrolysis or by p~rl~ging the protein in an applupliately resistant carrier such as a liposome. Means of protecting proteins from digestion are well known in the art.The ph~rrn~re~ltical compositions of this invention are particularly useful for 20 topical a-lmini~tration to treat basal cell carcinomas, or their precursors, solar keratoses. In another embodiment, the compositions are useful for parenteral ~lmini~tration~ such as intravenous ~minictration or ~-lmini~tration into a body cavity or lumen of an organ. The compositions for ~mini~tration will commonly comprise a solution of the NBCCS
polypeptide, antibody or antibody chimera/fusion dissolved in a ph~rrn~eutically acceptable 25 carrier, preferably an aqueous carrier. A variety of aqueous carriers can be used, e.g, buffered saline and the like. These solutions are sterile and generally free of undesirable matter. These compositions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharrn~ce~ltically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering 30 agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of chimeric molecule in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of ~lminictratjon selected and the patient's needs.
Thus, a typical pharmaceutical composition for intravenous ~rlmini~tration would be about 0.1 to 10 mg per patient per day. Dosages from 0.1 up to about 100 mg per 5 patient per day may be used, particularly when the drug is ~rlmini.ctçred to a secluded site and not into the blood strearn, such as into a body cavity or into a lumen of an organ.
Substantially higher dosages are possible in topical ~-lmini.ctration. Actual methods for ,lepdling parenterally ~lmini~trable compositions will be known or ~palellt to those skilled in the art and are described in more detail in such publications as Reming~on's 10 Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pennsylvania (1980).
The compositions cont~inin~g the present NBCCS polypeptides, antibodies or antibody chimer/fusions, or a cocktail thereof (i.e., with other proteins), can be ~(lmini.~tered for therapeutic treatments. In therapeutic applications, compositions are ~lministered to a patient suffering from a disease (e.g, NBCCS or basal cell carcinoma) in an arnount 15 sufficient to cure or at least partially arrest the disease and its complications. An arnount adequate to accomplish this is defined as a "therapeutically effective dose." Arnounts effective for this use will depend upon the severity of the disease and the general state of the patient's health.
Single or multiple ~t1mini~trations of the compositions may be ~llmini.~tered 20 depending on the dosage and frequency as required and tolerated by the patient. In any event, the composition should provide a sufficient quantity of the proteins of this invention to effectively treat the patient.
Among various uses of the NBCCS polypeptides, polypeptide subsequences, anti-NBCCS antibodies and anti-NBCCS-effector chimeras/fusions of the present invention 25 are included a variety of disease conditions caused by nevoid basal cell carcinoma syndrome and/or basal cell carcinomas. Preferred applications include treatment of NBCCS, in particular tre~tment of the developmental anomalies characteristic of NBCCS and tre~tment of cancers, in particular basal cell carcinomas.

B) Cellular Transformation and Gene TheraPv.
The present invention provides packageable human NBCCS (PTC) nucleic acids (cDNAs) for the transformation of cells in vitro and in vivo. These packageable nucleic acids can be inserted into any of a number of well known vectors for the transfection and transformation oftarget cells and org~ni~m~ as described below. The nucleic acids are transfected into cells, ex vivo or in vivo, through the interaction of the vector and the target cell. The NBCCS cDNA, under the control of a promoter, then expresses the NBCCS
5 protein thereby mitigating the effec~s of absent NBCCS genes or partial inactivation of the NBCCS gene or abnormal expression of the NBCCS gene.
Such gene therapy procedures have been used to correct acquired and inherited genetic defects, cancer, and viral infection in a number of contexts. The ability to express artificial genes in h~lm~n~ facilitates the pre~ention and/or cure of many important 10 human tlice~es, including many diseases which are not arnenable to treatment by other therapies. As an example, in vivo expression of cholesterol-regulating genes, genes which selectively block the replication of HIV, and tumor-s~l~pl~ssillg genes in human patients drarnatically improves the tre~tm~nt of heart ~ e~e, AIDS, and cancer, respectively. For a review of gene therapy procedures, see Anderson, Science (1992) 256:808-813; Nabel and Felgner (1993) TIBTECH 11: 211-217; Mitani and Caskey (1993) TIBTECH I 1: 162-166;
Mulligan (1993) Science 926-932; Dillon (1993) TIBTECH 11: 167-175; Miller (1992) Nature 357: 455-460; Van Brunt (1988) Biotechnology 6(10): 1149-1154; Vigne (1995) Restorative Neurology and Neuroscience 8: 35-36; Kremer and Perricaudet (1995) British Medical Bulletin 51 ( l ) 31 -44; Ha~ et al. (1995) in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds) Springer-Verlag, Heidelberg Germany; and Yu et al., Gene Therapy (1994) 1: 13-26.
Delivery of the gene or genetic material into the cell is the first critical step in gene therapy treatment of disease. A large number of delivery methods are well kno~vn to those of skill in the art. Such methods include, for example liposome-based gene delivery (Debs and Zhu (1993) WO 93/24640; Mannino and Gould-Fogerite (1988) BioTechniques 6(7): 682-691; Rose U.S. Pat No. 5,279,833; Brigham (1991) WO 91/06309; and Felgner e~
al. (1987) Proc. Natl. Acad. Sci. USA 84: 7413-7414), and replication-defective retroviral vectors harboring a theldpeutic polynucleotide sequence as part of the retroviral genome (see, e.g, Miller et al. (l990) Mol. Cell. Biol. 10:4239 (1990); Kolberg (1992) J. NIHRes.
4:43, and Cornetta et al. Hum. Gene Ther. 2:215 (1991)). Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus(GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), WO 97/43414 PCT~US97/08433 and combinations thereof. See, e.g, Buchscher et al. (1992) ~ ~irol. 66(5) 2731 -2739;
Johann et al. (1992)J. Virol. 66 (5):1635-1640 (1992); Sommerfelt et al., (1990) Virol.
176:58-59; Wilson et al. (1989) J. Virol. 63:2374-2378; Miller et al., J. Virol. 65:2220-2224 (1991); Wong-Staal et al., PCT~JS94/05700, and Rosenburg and Fauci (1993) in Fundamental Immunology, Third Edition Paul (ed) Raven Press, Ltd., New York and the references therein, and Yu et al., Gene ~herapy (1994) supra).
AAV-based vectors are also used to transduce cells with target nucleic acids, e.g, in the in vitro production of nucleic acids and peptides, and in in YiVo and ex vivo gene therapy procedures. See, West et al. (1987) Virology 160:38-47; Carter et al. (1989) U.S.
10 Patent No. 4,797,368; Carter et al. WO 93/24641 (1993); Kotin (1994) Human Gene Therapy 5:793-801; Muzyczka (1994) J. Clin. Invest. 94: 1351 and Samulski (supra) for an overview of AAV vectors. Construction of recombinant AAV vectors are described in a number of publications, including Lebkowski, U.S. Pat. No. 5,173,414; Tratschin et al.
(1985) Mol. Cell. Biol. 5(11):3251-3260; Tratschin, et al. (1984) Mol. Cell. Biol. 4:2072-15 2081; Hermonat and Muzyczka (1984) Proc. Natl. Acad. Sci. USA 81 :6466-6470;
McT ~llghlin et al. (1988) and Samulski et al. (1989) ~ Virol. 63:03822-3828. Cell lines that can be transformed by rAAV include those described in Lebkowski et al. (1988) Mol. Cell.
Biol. 8: 3988-3996.

A) Ex vivo transformation of cells.
Ex vivo cell transformation for diagnostics, research, or for gene therapy (e.g,via re-infusion of the transformed cells into the host organism) is well known to those of skill in the art. In a plcf~ ,d embodiment, cells are isolated from the subiect org~ni~m, transfected with the NBCCS gene or cDNA of this invention, and re-infused back into the subject organism (e.g., patient). Various cell types suitable for ex vivo transformation are well known to those of skill in the art. Particular preferred cells are progenitor or stem cells (see, e.g, Freshney et al., Culture of Animal Cells, a Manual of Basic Technigue, third edition Wiley-Liss, New York (1994)) and the references cited therein for a discussion of how to isolate and culture cells from patients).
As indicated above, in a plc~lcd embodiment, the packageable nucleic acid encodes an NBCCS polypeptide under the control of an activated or constitutive promoter.

...... . .

The transformed cell(s) express functional NBCCS polypeptide which mitigates the effects of deficient or abnormal NBCCS gene e~l,ression.
In one particularly preferred embodiment, stem cells are used in ex-vivo procedures for cell transformation and gene therapy. The advantage to using stem cells is 5 that they can be differerlti~ted into other cell types in vitro, or can be introduced into a m~mm~l (such as the donor of the cells) where they will engraft in the bone marrow.
Methods for differçnti~ting CD34+ cells in vitro into clinically important immune cell types using cytokines such a GM-CSF, IFN-~ and TNF-a are known (see, Inaba et al. (1992) J
Exp. Med. 176: 1693-1702,andSzabolcsetal. (1995) 154: 5851-5861).
l O Stem cells are isolated for transduction and differentiation using known methods. For example, in mice, bone marrow cells are isolated by sacrificing the mouse and cutting the leg bones with a pair of scissors. Stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4+
and CD8+ (T cells), CD45~ (panB cells), GR-1 (granulocytes), and Iad (differentiated antigen presenting cells). For an example of this protocol see, Inaba et al. (1992) J. Exp. Med 176:
1693-1702.
In humans, bone marrow aspirations from iliac crests are performed e.g., under general anesthesia in the operating room. The bone marrow aspirations is approximately l,000 ml in quantity and is collected from the posterior iliac bones and crests.
20 If the total number of cells collected is less than about 2 x 108/kg, a second aspiration using the sternum and anterior iliac crests in addition to posterior crests is performed. During the operation, two units of irradiated packed red cells are ~rlmini~tered to replace the volume of marrow taken by the aspiration. Human hematopoietic progenitor and stem cells are characterized by the presence of a CD34 surface membrane antigen. This antigen is used for 25 purification, e.g, on affinity columns which bind CD34. After the bone marrow is harvested, the mononuclear cells are separated from the other components by means of ficoll gradient centrifugation. This is performed by a semi-automated method using a cell separator (e.g., a Baxter Fenwal CS3000+ or Terumo rn~ in~). The light density cells, composed mostly of mononuclear cells are collected and the cells are incubated in plastic 30 flasks at 37~C for 1.5 hours. The adherent cells (monocytes, macrophages and B-Cells) are discarded. The non-adherent cells are then collected and incubated with a monoclonal anti-CD34 antibody (e.g., the murine antibody 9C5) at 4~C for 30 minutes with gentle rotabon.

The final concentration for the anti-CD34 antibody is 10 ~lg/ml. After two washes, par~m~gnetic microspheres (DynaBeads, supplied by Baxter Immunotherapy Group, Santa Ana, California) coated with sheep antimouse IgG (Fc) antibody are added to the cell suspension at a ratio of 2 cells/bead. After a further incubation period of 30 minutes at 4~C, the rosetted cells with magnetic beads are collected with a magnet. Chymopapain (supplied by Baxter Tmmlln-)therapy Group, Santa Ana, California) at a final concentration of 200 U/ml is added to release the beads from the CD34+ cells. Alternatively, and preferably, an affinity column isolation procedure can be used which binds to CD34, or to antibodies bound to CD34 (see, the examples below). See, Ho et al. (1995) Stem Cells 13 (suppl. 3): 100-105.
0 See also, ~3renner (1993) Journal of Hematotherapy 2: 7-17.
In another embodiment, hematopoietic stem cells are isolated from fetal cord blood. Yu et al. (1995) Proc. Natl. Acad. Sci. USA 92: 699-703 describe a preferred method of transducing CD34+ cells from human fetal cord blood using retroviral vectors.

B) In vivo transformation Vectors (e.g, retroviruses, adenoviruses, liposomes, etc.) cot~l~it~ g th~ldpeulic nucleic acids can be arlmini~t~red directly to the organism for transduction of cells in vivo. Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells. The packaged nucleic acids are 20 a~1minictered in any suitable manner, preferably with pharmaceutically acceptable carriers.
Suitable methods of ~lmini.ctering such packaged nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to ~imi~ ter a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
Pharmaceutically acceptable carriers are determined in part by the particular composition being ~mini~tered, as well as by the particular method used to ;~ mini~ter the composition Accordingly, there is a wide variety of suitable formulations of ph~ eutical compositions of the present invention.
Formulations suitable for oral ~imini.~tration can consist of (a) liquid solutions, such as an effective amount of the packaged nucleic acid suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each cont~ining a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) .. .. .. _ . ..

WO 97t43414 PCT/US97/08433 suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, tr~g~c~nth, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, m~gnesium stearate, stearic acid, and other excipients, 5 colorants, fillers, binders, diluents, buffering agents, moist~nine agents, preservatives, flavoring agents, dyes, ~lisintegrating agents, and ph~nn~ceutically compatible carriers.
Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tr~g~r~nth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like cont~ining, in 10 addition to the active ingredient, carriers known in the art.
The packaged nucleic acids, alone or in combination with other suitable components, can be made into aerosol formulations (i.e., they can be "nebulized") to be ~mini.stered via inhalation. Aerosol formulations can be placed into l,ies~;zed acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
Suitable formulations for rectal a-lmini~tration include, for example, suppositories, which consist of the packaged nucleic acid with a suppository base. Suitable suppository bases include natural or synthetic triglycerides or paraffin hydrocarbons. In addition, it is also possible to use gelatin rectal capsules which consist of a combination of the packaged nucleic acid with a base, including, for example, liquid triglycerides, 20 polyethylene glycols, and paldf~lm hydrocarbons.
Formulations suitable for parenteral ~l1mini.ctration~ such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intraderrnal, intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the forrnulation 25 isotonic with the blood of the int~nded recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. In the practice of this invention, compositions can be ~mini.stered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intr~thec~liy. Parenteral ~lministration and intravenous ~-lministration are the plefelled 30 methods of ~rlmini.ctration. The formulations of packaged nucleic acid can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.

W 097/43414 rCTrUS97/08433 Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Cells transduced by the packaged nucleic acid as described above in the context of ex vivo therapy can also be ~t1ministered intravenously or parenterally as described above.
The dose aAmini.ctered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time. The dose will be det~rmin~d by the efficacy of the particular vector employed and the condition of the patient, as well as the body weight or surface area of the patient to be treated. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the ~lmini~tration of a particular vector, or transduced cell type in a particular patient.
In determining the effective amount of the vector to be ~lmini.ctered in the treatment or prophylaxis NBCCS predilection or onset or basal cell carcinoma predilection or onset, the physician evaluates circulating plasma levels of the vector, vector toxicities, 15 progression of the disease, and the production of anti-vector antibodies. In general, the dose equivalent of a naked nucleic acid from a vector is from about I ~g to 100 ~lg for a typical 70 kilogram patient, and doses of vectors which include a retroviral particle are calculated to yield an equivalent amount of therapeutic nucleic acid.
For ~-lmini~tration, inhibitors and tr~n~dnce~ cells of the present invention can be ~flministered at a rate deterrnined by the LD-50 of the inhibitor, vector, or tr~n~-~uced cell type, and the side-effects of the inhibitor, vector or cell type at various concentrations, as applied to the mass and overall health of the patient. A~mini~tration can be accomplished via single or divided doses.
In a preferred embodiment, prior to infusion, blood samples are obtained and saved for analysis. Between 1 X 108 and 1 X 1012 transduced cells are infused intravenously over 60- 200 minllt~s Vital signs and oxygen saturation by pulse oximetry are closely monitored. Blood samples are obtained 5 minutes and 1 hour following infusion and saved for subsequent analysis. Leukopheresis, tr~n~duction and reinfusion can be repeated are repeated every 2 to 3 months. After the first treatment, infusions can be performed on a outpatient basis at the discretion of the clinician. If the reinfusion is given as an outpatient, the participant is monitored for at least 4, and preferably 8 hours following the therapy.

Transduced cells are ple~a~ed for reinfusion according to established methods. See, Abr~h~m~en et al. (1991) J. Clin. Apheresis, 6: 48-53; Carter et al. (1988) J.
Clin. Apheresis, 4:113-117, Aebersoldetal. (1988)J. Immunol. Meth., 112: 1-7; Muul etal.
(1987) J: l~munol. Methods 101: 171 - 181 and Carter et al. (1987) Transfusion 27: 362-365.
After a period of about 2-4 weeks in culture, the cells should number between I x I o8 and I
x 1 o'2. In this regard, the growth characteristics of cells var.v from patient to patient and from cell type to cell type. About 72 hours prior to reinfusion of the transduced cells, an aliquot is taken for analysis of phenotype, and percentage of cells ~ ,ressh~g the therapeutic agent.
EXAMPLES
The following examples are offered to illustrate, but not to limit the present invention.
Example 1 Clonin~ of a Human Patched Homolo~ue This example describes the isolation of a complete human PA TCHED cDNA
sequence which encodes a putative protein of 1172 arnino acids, and displays 61 % sequence identity to the Drosophila P~ TCHED protein. Drosophila patched (ptc) is a segment polarity gene required for the correct patterning of larval segments and im~gin~l discs during 20 fly development (Nakano et al. (1989) Nature 341: 508-13; Hooper et al. (1989) Cell 59:
751 -765). Based on genetic studies, patched is a component of the signaling pathway of the morphogen hedgehog (Basler et al. (1994) Nature 368: 208-214; Capdevila et al. (1994) EMBO J. 13: 71-82; Tngh~ (1991) Nature 353: 184-187). Since patched is a putative membrane-spanning protein, and is e~p~essed in hedgehog responsive cells, it has been 25 proposed to be the hedgehog receptor (Ingham (1991) supra.).
In vertebrates, several hedgehog homologs have been identified. The best characterized of them, sonic hedgehog, has been implicated in the dorsal-ventral patterning of neural tube (Roelink et al. (1994) Cell 76: 761-775; Roelink (1995) Cell 81: 445-455), in the differentiation of somites (Johnson et al. (1994) Cell 79: 1165-1173) and in the establishing of the anterior-posterior axis of the limb bud (Riddle et al. (1993) Cell, 75:
1401 - 1416). The biochemical basis of hedgehog ~ign~ling in vertebrates remains poorly understood and has been hampered largely by the lack of a proven receptor for the molecule.

Experimental Procedures Cosmid Isolation Cosmids used in this study were isolated from a human chromosome 9-5 specific genomic cosmid library (LL09NCOI"P", Biomedical Sciences Division7 LawrenceLivermore National Laboratory, Liverrnore, CA 94550) by screening with the YAC clone ICI-2ef8 (UK Human Genome Mapping Project Resource Centre). This clone contains the microsatellite marker D9S287 which has been localized to chromosome 9q22.3 (Povey et al.
(1994)Ann. Hum. Genet., 58: 177-250). TheisolationofYACDNAandhybridizationwas performedasdescribedbyVorechovskyetal. (1994)Genomics, 21: 517-24. The localization of the cosmids was confirmed by hybridization to YAC ICI-2ef 8 resolved by means of pulse-field gel electrophoresis. The 96 well plate format of the cosmid clones that contain PTC is 42HIl, 96F9, 218A8, 226G7.
Library screening Human cDNA clones were isolated from a fetal brain cDNA library in the lambda ZAPII phage vector (Stratagene, La Jolla, California, USA), using standard procedures. The probes were labeled with [32P]dCTP by random priming (Redisrime,Amersham). Positive clones were rescued using the 704 helper phage/pBluescript excision system (Rapid Excision Kit, Stratagene) and sequenced. Mouse genomic clones were20 isolated from a 129SV lambda FixII library (Stratagene). Phage DNA was cut with EcoRI
and hybridized with PTC specific probes. Mouse cDNA clones were isolated from an 11.5 dpc mouse embryo (Swiss male) library constructed in lambda gtl 0. Hybridization was performed at 55~C. Positive clones were subcloned into pBluescript II SK (Stratagene) digested with NotI.

Seql~nei~g Templates for sequencing were prepared from overnight cultures of rescued cDNA clones and/or EcoRI cosmid fragments subcloned in pBluescript KS(+) using aplasmid purification kit (Qiagen). Sequencing was perforrned with the Taq Dyedeoxy 30 Termin~tor Cycle sequencing kit (Applied Biosystems) according to the mzlnuf;lcturer's instructions. Sequencing reactions were resolved on an ABI 373A automated sequencer.
Sequence analysis was performed using the GCG software. BLAST searches were performed with the NCBI network service. PTC sequences have been deposited in GENBANK under accession #U43148.

Northern hybridization Expression of human PTC rnRNA was examined by Northern hybridization of human tissue blots (Clontech) using cDNA probes labeled with [32P]dCTP. Hybridization solution contained 5x SSPE, lOx Denhardt's solution, 100 mg/ml denatured, sheared herring sperrn DNA, 50% formarnide and 2% SDS. Washes were performed at 60~C with 2x SSCandO.1%SDS.
Chr~,.. r~so.. ~l loo~liz/~ti~n The chromosomal localization of human PTC was identified by PCR analysis of DNA panels obtained from hurnan-harnster hybrid cells. The panel con~i~ted of both whole chromosome 9 hybrids and deletion hybrids of 9q22.3. The primers used were PTC 1 (5'-TTG CAT AAC CAG CGA GTCT-3' (SEQ ID NO: 2)) and PTC2 (5'-CAA ATG TAC
GAG CAC TTC AAGG-3' (SEQ ID NO: 3)). Murine Ptc was mapped by means of intel~pecirlc backcross mapping. The panels were provided by the Jackson Laboratory (Bar Harbor, ME) and are the BSB panel from a cross (C57BL/6J x M. spretus) x C57BL/6J and a similar BSS panel made up of DNA from the reciprocal backcross (C57BL/6JEi x 20 SPRET/Ei) x SPRET/Ei. Mapping was perforrned by means of SSCP (single strand conformation polymorphism) analysis with the primers W18F3 (5'-CTG TCA AGG TGA
ATG GAC-3' (SEQ ID NO: 4) and W18R3 (5'-GGG GTT ATT CTG TAA AAGG-3' (SEQ
ID NO: 5)). PCR reactions were performed in the presence of [32P]dCTP. The samples were resolved on a 6% acrylarnide gel (2.6% cross-linking) at 4~C at 70 watts within 1.5 hours.
25 Genetic linkage was performed by segregation analysis.

In situ hybridization ~ hole mount in situ hybridization on mouse embryos and subsequent sectioning was performed as described by Christiansen, et al. (1995) Mech. Dev. 51: 341 -50.
30 The mouse Ptc probe was a 706 bp Notl /PstI cDNA fragment from the 5' end of the gene, subcloned in pBluescriptII SK. The probe was linearized with SacII, the overhang blunted by incubation with 5 U/mg Klenow at 22~C for 15 minutes, and antisense RNA synthesized by transcribing with T7 RNA polymerase.

Results and Discussion Cloning of a human PTC Itomolog Cosmids used in this study were isolated from a human chromosome 9-specific genomic cosmid library using the YAC clone ICI-2ef~. This clone contains the microsatellite marker D9S287 which has been localized to chromosome 9q22.3. Sequencing of a 1.8 kb EcoRI fragment of cosmid 42Hll yielded an open reading frame with significant 10 homology to three consecutive stretches of the Drosophila ptc protein. Using the 1.8 kb EcoR~ fragment as a probe the complete human and partial mouse PTC cDNA sequences were isolated.
The sequence of the human PTC cDNA consists of an open reading frame of 3888 nucleotides; also sequenced were 441 and 2240 nucleotides on the 5' end and on the 3' 15 end, respectively (SEQ ID NO: l; Figure 8). The open reading frarne of human PTC cDNA
encodes for a putative protein of 1290 amino acids. This open reading frarne is initiated by an ATG codon that has a moderate match for the translational start consensus sequence in vertebrates (GAGGCTAUGT (SEQ ID NO: 6) in PTC versus GCCGCCAUGG (SEQ ID
NO: 7) (Kozak (1991) J. Biol. Chem., 266: 19867-19870)). Assuming that this codon 20 encodes for the first amino acid of the protein, humanptc consists of 1296 amino acids with a relative molecular weight (Mr) of 131 x 103. It shows 61 % sequence identity to its Drosophila counterpart. Upstream of the ATG, the open reading frame extends for another 354 nucleotides (starting at base pair 88 of the sequence shown in Figure 8). The 3' untr~n.~l~ted region contains a canonical polyadenylation signal (AATAAA (SEQ ID NO: 8)) 25 as well as mRNA destabilizing ATTTA (SEQ ID NO: 9) motifs. These are localized 1401 nucleotides and 547, 743, and 1515 nucleotides after the termination codon, respectively.
An alternative transcript is observed that splices from exon 3 to exon 2a. The open reading frame ends in exon 2a (see, SEQ ID NO: 59) but does not contain an AUG.
Exon 2 can splice to one of three different first exons. Exon lb (see SEQ ID NO: 58) is 30 homologous to the described first exon of the mouse mRNA and has an ATG followed by ORF. Exon 1 a has ORF through the entire length and a potential splice acceptor site (see, e.g, SEQ ID No: 58). Exon 3 contains the first in-frame ATG for all the transcripts except . _.. . . .... ~ .

W 097/43414 PCT~US97/08433 the one initiating in exon 1 b. A map of the promoter region of NBCCS (PCT) is provided in .

Flgure 3.
Hydropathy analysis (Kyte etal. (1982)~ Mol. Biol., 157: 105-32) ofthe entire open reading frame of human PTC predicts the presence of eight main hydrophobic S stretches. Distribution of the hydrophobic blocks is remarkably well conserved between species indicating that human PTC, like its Drosophila counterpart, is an integral membrane protein.

Chromosomal loc~ z~ti~n of PTC
Chromosomal loç~li7~tion of human PTC on 9q22.3 was confirmed by PCR
analysis of chromosome 9 hybrids, and deletion hybrids of 9q22.3, human-hamster hybrid DNA panels. The primers used (PTC1, PTC2) were derived from a sequence of a 1.8 kb EcoRI fragment of cosmid 42Hll. Primer PTC1 is derived from an exon sequence and PTC2 from an intron sequence. All DNA hybridization and cDNA sequencing data suggest that 15 human PTC is a single copy gene. Murine Ptc maps to a short region of chromosome 13, close to the murine Facc locus (no recombination out of 188 meioses). This region contains the mouse mutations flexed tail (~) and purkinje cell degeneration (pcd), and it is syntenic with human 9q22-q31. Bothfand pcd involve abnormal development of cells of the bone or brain and could be allelic to Ptc.
Expression of PTC
Northern blot analysis revealed five distinct PTC transcripts in all human tissues ex~mine~l Expression of these transcripts appears to be dir~ tia~ly regulated.
During mouse embryogenesis, expression of Ptc is first detected at E ~.0 dpc in ventral 25 neuroepithelial tissue in two separate domains along the midline. Expression persists in ventral neural cells through to 9.5 dpc and transcripts are also detected in lateral mesenchyme surrounding the neural tube. Ptc transcription is detected in the somites soon after the time of their a~peal~lce and follows a rostro-caudal gradient of e~pres~ion. Somite expression is restricted to epithelial cells within the medial aspects of each somite.
30 Expression of Ptc is also detected in the posterior ectoderm of each limb bud from 10.0 dpc to 12. 5 dpc. This region corresponds to surface ectoderm that covers the ZPA. Other sites of Ptc ~I,ression during this period include the inner surf aces of the branchial arches which WO 97/434~4 PCT/US97/08433 flank the oropharyngeal region, cells surrounding the placodes of the vibrissae and the genital emin~n(~e.
The expression pattern of Ptc points to a close relationship between Ptc and the hedgehog fa~nily of morphogens. This relationship was originally established in Drosophzla (Ingham et al. (1991) Nature, 353: 184-187). In vertebrates, the bestcharacterized hedgehog homolog, sonic hedgehog, has been implied in the induction of the floorplate and motor neurons within the ventral neural tube (Jessell et al. (1990) Ha7~ey Lect., 86: 87-128; Yamada et al. (1993), 73: 673-686) as well as in the differentiation of sclerotome within the somites (Pourquie eJ al. (1993) Proc. Natl. Acad. Sci. USA, 90: 5242-10 5246). In the limb bud, sonic hedgehog expression in the mesenchymal 'zone of polarizing activity' triggers anters-posterior p~tternin~ ofthe limb (Riddle et al. (1993) Cell, 75: 1401 -1416). Our data show that vertebrate PTC is ~xl~lessed in all major target tissues of sonic hedgehog, such as the ventral neural tube, somites and tissues surrounding the zone of polarizing activity of the limb bud. The striking spatial complementarity and temporal 15 coincidence of the sonic hedgehog and Ptc ~ ession patterns suggest that both genes might be members of a common ~ign~ling pathway.
The localization of PTC in the region cont~ining the nevoid basal cell carcinoma syndrome (NBCCS) gene is intriguing. NBCCS is an autosomal dominant disorder which predisposes affected individuals to basal cell carcinomas of the skin, 20 medulloblastomas and various other tumors (Gorlin (1987) Medicine (Baltimore) 66: 98-113). Recent genetic studies have placed the gene for the nevoid basal cell carcinoma syndrome to chromosome 9q22.3, between the markers Fanconi anaemia complementation group A (Farndon e~ al. (1994) Genomics, 23: 486-489) and D9S287 (Pericak-Vance (1995) Ann. Hum. Genet., 59: 347-365). Several lines of evidence suggest that PTC is a candidate 25 gene for the nevoid basal cell carcinoma syndrome. P~c e~,res~ion is compatible with the congenital defects commonly found in NBCCS patients. Frequent symptoms in newborns and infants are developmental anomalies of the spine and ribs (Gorlin (1987 supra.). These malformations could be due to a PTC deficiency, e~lession of which coincides spatially and temporally with the development of the neural tube and of the somites. In addition, Ptc 30 expression in the surface ectoderm surrounding the ZPA is conci.~tçnt with limb abnormalities often observed in the patients with NBCCS (Gorlin (1987 supra.). PTC
expression in all adult tissues points to a pleiotropic role of PTC in adult signal transduction WO 97/43414 PCT/US97tO8433 pathways. Defects in these si~n~ling pathways could account for the symptoms which develop postnatally.

Example 2 Mutations of the Human Homolo~ue of Drosophila Patched in Nevoid Basal Cell Carcinoma Syndrome The nevoid basal cell carcinoma syndrome ~NBCCS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), pits of the palms and soles, keratocysts of the jaw, and a variety of other tumors and developmental 10 abnorrnalities. NBCCS was mapped to chromosome 9q22.3 and both f~mili~l and sporadic BCCs display loss of heterozygosity for markers in this region, consistent with the gene being a tumor suppressor. Example I describes the isolation of a human sequence (PTC) with strong, homology to the Drosophila segment polarity gene. This example shows that human PTC is ~x~ ssed in many of the tissues affected in NBCCS patients. Single-stranded 15 conformation polymorphism analysis and sequencing revealed mutations of PTC in patients with the syndrome and in related tumors. The data indicate that human PTC is also an NBCCS gene and that a reduction in expression of this gene leads to the developmental abnormalities observed in the syndrome and that complete loss of patched function contributes to transformation of certain cell types.
Experimental Procedures Subjects and samples DNA samples were collected from 363 individuals in 128 NBCCS kindreds.
Patients were ex~mined by a clinical geneticist, and diagnosis of Gorlin syndrome was based 25 on at least two major features of the syndrome; e.g., jaw cysts, palmar pits, mu}tiple basal cell carcinomas, and a family history of typical Gorlin syndrome. Lymphoblastoid cell lines were made from at least one affected member of 82 kindreds. 252 basal cell carcinomas were collected as either fresh or paraffin-embedded specimens.

Short tandem repeat polymorph~sms For linkage analysis and tumor deletion studies, PCR reactions were performed in 50 ~lL volumes cont~ining 100 ng of template DNA, 200 M dNTPs, 1.5 MM

WO 97/43414 PCT~US97/08433 MgCl2, 0.25 mM spermidine, 10 pM of each primer, I Ci 32p dCTP (Amersharn, Arlington Heights, Illinois, USA), and 1.25 Units Taq polymerase (Promega, Madison, Wisconsin, USA) in Promega buffer (10 mM TrisHCI, pH 9, 50 mM KCI, 0.1% Triton X-100). An Ericomp Dual Block thermocyler was set with the following parameters for 25 cycles: 94~C, I min, 55~C, 30 sec, 72~C, 2 min. PCR products were analyzed on an 5% polyacrylamide gels. Autoradiography was carried out at -70~C with Kodak XAR film. Loci in the NBCCS
region that were typed are shown in Figure 1, and primer sequences are available from the Genome Data Base (http://gdbwww.gdb.org).

0 Pulsed-f eld gel electrophoresis (PFGE) Cultured Iymphoblastoid cells were embedded in LMP agarose (Bio Rad, Hercules California, USA) at a concentration of approximately 2 x 1 o6 /220- 1 block, and DNA was extracted according to standard methods (Sambrook e~ al. supra. ) Quarter blocks were digested with SacII, MluI, NotI, BssHI, NruI, and SfiI under conditions recommended 15 by the manufacturer (New England Biolabs, Beverly, M~ hll~ett~, USA). Electrophoresis was carried out with the Bio Rad CHEF DR 1 1 a~ dlus using, 1% agarose gels run for 20 hours at 200 volts with a pulse time of 75 sec. For higher resolution of fragments under 500 kb, a 25 second pulse time was used.
Transfer to nylon membranes (Du Pont Gene Screen Plus, Du Pont, Co., 20 Boston, Massachusetts, USA) was performed according to the m~nufaf~tllrer's instruction after exposure of the gel to W (6-7 mW/cm2) for two minutes. Probes were labeled to a specific activity of approximately 109 DPM/g, with dCT32P (Amersham) by the random primed synthesis method (Boehringer Mannheim Kit, Boehringer Mannheim Corp., Tn~ n~polis, In(li~n~, USA). Hybridization was carried out for 18 hours at 65~C in 0.5 M
25 sodium phosphate (pH 7.2), 7% SDS, 1% BSA, I mM EDTA and 200 ~g/ml herring sperm.
For probes co"l;.ini~g repetitive sequences, sheared, sonicated human placental DNA (Sigma Chemical Co., St. Louis, Missouri, USA) was added to the hybridization solution (500 ~Lg/ml) and preassociated with the probe at 65~C for 45 minutes prior to hybridization to the filter. Filters were washed in 0.1 X SSC with 1% SDS at 65~C and exposed to 30 autoradiographic film with an intensifying screen at -70~C from 12 hours to three days.
Probes that detected similar sized fragments on different blots were directly compared for comigrating fr~m~nt.c by hybridization to the sarne blot. Blots were stripped in 0.4N
NAOH for 30 min at room temperature between uses.

Fluor~cence in situ hybridization Cosmid clones were labeled by nick translation with biotin- 11 -dUTP, - dioxigenin- 11 -dUTP, or both, and hybridized to metaphase and interphase chromosomes under suppression conditions. Biotinylated probes were detected with 5 ~lg/ml of fluorescein isothiocyanate (FITC)-conjugated avidin DCS. Dioxigenin labeled probes were detected with 2 ~lg/ml anti-dioxigenin Fab conjugated to rhodamine. The chromosomes were 10 counterstained with 200 ng/ml of 4,6-diamidino-2-phenylindole-dihydrochloride (DAPI).
Images were obtained using, a microscope coupled to a cooled CCD camera. The digitalized images were processed, pseudocolored and merged and the distances between signals were measured.

Cosmid and BAC screening A gridded chromosome 9 cosmid library (LL09NCOI) was replicated onto nylon filters (Gene Screen Dupont Plus, Du Pont Co.) and screened according to the recornmendations of the Human Genome Center, Lawrence Livermore National Laboratory.
Positive coordinates were streaked out to single colonies and confilme(l to contain the ap~lol~l;ate markers by PCR or hybridization. Gridded BAC filters were screened by hybridization according to the manufacturer's recommendations (Research Genetics, Huntsville, ~l~h~ , USA). Because of the small chance of chimerism in cosmids and BACS, fragments from the ends of contigs were mapped with a panel of human-hamster somatic cell hybrids to conf~rm their localization on chromosome 9q22.
Isolation of cDNAs Four methods were used to isolate candidate cDNAs. Direct cDNA selection - (Parimoo et al. (1991) Proc. Natl. Acad. Sci., USA, 88: 9623-9627) was applied to pools of cosmids and BACs. Following two rounds of selection, the PCR products were size fractionated and cloned into PCRII (Invitrogen, Leek NV, Netherlands). Transformants were gridded into 96 well plates, and replica filters were probed with the genomic template DNA
to identify cDNAs that hybridized the correct genomic region.

. . .

CA 02266408 1998-ll-12 W O 97/43414 rCTrUS97/08433 Exon trapping, was perforrned using the method developed by Buckler et al.
(1991) Proc. Nafl. Acad. Sci. USA, 88: 4005-4009, and later modified by Church et al.
(1994) Nature Genetics, 6: 98. BamH1/GblII digests of pools of 5 or 6 cosmids were cloned into the BamHl site of the splicing vector pSPL3b (Burn et al. (1995) Gene, 161: 183-187).
5 Trapped DNAs were sequenced and mapped back to the NBCCS candidate region by hybridization to the cosmids from which they were derived.
For HTF island cloning, YACs were size fractionated by pulsed field gel electrophoresis, excised from the gel, and digested with BssHII. Subsequently vectorette linkers were added and PCR amplification was performed using a vectorette primer and a 5' Alu primer (Valdes et al. (1994) Proc. Natl. Acad. Sci., 91: 5377-5381). After an initial denaturation at 100~C for S min, 30 amplification cycles were performed with denaturation for 1 min at 98~C, ~nn~lin~ for 1 min at 60~C, and extension for 3 min at 72~C. Ten units of Taq polymerase were used in a total volume of 100 ~Ll con~i.cting of 50 mM KCI, 10 mM Tris pH 9, 2 mM MgCl2, 0.1% Triton and 200,uM dNTP. The PCR products were 15 electrophoresed on a 1 % agarose gel, in order to determine their size, and subsequently cloned into the PGEM T vector (Promega) by a shotgun procedure.
For sequence sampling, the ends of chromosome 9 specific cosmids or cosmid subclones were directly sequenced (Smith et al. (1994) Nature Genetics 7: 40-47.
Sequencing was pclrolllled on an ABI 373 DNA sequencer. The resulting, end sequences 20 were manually trimmed, ~ nine~l for simple sequence repeats, and used to search the DNA
sequence d~t~b~ses. Both nucleotide and arnino acid searches were pclrolllled. In addition sequences were e~c~mined for potential coding regions by GRAIL (Uberbacher and Mural (1991) Proc. Natl. Acad. Sci. USA 88: 11261-11265.
Short cDNA fr~ment~ obtained by the methods outlined above were 25 extended by screening brain or epidermal cDNA libraries and by rapid amplification of cDNA ends (Marathon kit, Clontech, Palo Alto, California, USA).

Intron/exon ~tru~ture of the human patched gene Oligonucleotides were chosen at approximately 150 bp intervals spanning the 30 cDNA of the human patched gene. PCR products were generated from cosmids 226G7, 42H11, 55A16, or 96F9. Reactions were performed in a 50 ~I volume Cont~ining 25 pmol of various oligonucleotide combinations, 200 ~mol dNTPs, 1.5 mM, or 1.g5 mM, or 2.2 mM

MgCI2, 5 U Taq polymerase, and amplified for 35 cycles of 94~C for 30 s, 55~C for 30 s and 72~ C for 2.5 min. Some samples were amplified by long range PCR using the Expand Long Template PCR system (Boehringer ~nnheim) according to the manufacturer's instructions.
PCR products were resolved on a 1% agarose gel and isolated by a DNA purification kit (Jetsorb, Genomed, Bad Oeynh~ çn, Germany). Sequencing of PCR fr~ements was performed with the Taq Dyedeoxy Terminator Cycle Sequencing, kit (Applied Biosystems, Foster City, California, USA). Sequencing, reactions were resolved on an ABI 373A
automated sequencer. Positions of introns have been deterrninrd by predicted splice donor or splice acceptor sites.
Mutafion d~t~( fi~n A combined SSCP (Orita et ~1. (1989) Ann. Hum. Genet. 59: 347-365) and heteroduplex analysis (White et al. (1992) Genomics, 12: 301-306) approach was used using optimized conditions (Glavac and Dean (1993) Hum. Mutation, 2: 404-414). DNA samples 15 (100 ng) were amplified in PCR buffer cont~inin~, 1.5 mM MgCl, and 32P-dCTP for 35 cycles of 94~C, 30 sec, 55~C, 30 sec, 72~C, 30 sec. Products were diluted 1 :3 in stop solution, denatured at 95~C for 2 min and 3 ,ul loaded directly on gels. Gel formulations used were 1) 6% acrylamide:Bis (2.6% cros.~linking,), 10% glycerol, room temp, 45W; 2) 6%
acrylamide:Bis (2.6% cro~linkin~), 4 60W; 3) 10 % acrylamide:Bis (1.3% crosclinking) 10% glycerol4, 60W; 4) 0.5X MDE (ATGC Corp, Malvern, PA), 10% glycerol4, 50W. Gels were run for 3-16 hours(3000Vh/100 bp), dried and exposed to X-ray film for 2-24 hrs.
Heteroduplexes were identified from the double-stranded DNA at the bottom of the gels, and SSCPs from the single-stranded region.
Samples showing, variation were compared to other family members to assess segregation of the alleles, or to normal DNA from the same patient, in the case of tumors.
PCR products with SSCP or heteroduplex variants were treated with shrimp ~lk~linlo phosphatase and exonuclease I (United States Biochemical) and cycle sequenced with AmplitaqFSTM (Perkin Elmer, Norwalk, Connecticut, USA). The products were analyzed on an Applied Biosystems model 373 DNA sequencer.

WO 97/43414 PCT~S97/08433 Results and Discussion Fine Mapping by Linkage and Tumor Deletion Sfudies Since the original mapping of the gene in 1992, linkage studies have narrowed the NBCCS region to a 4 cM interval between D95180 and D95196 (Goldstein et al. (1994) supra; Wicking et al. (19g4) Genomics, 22: 505-511). Farndon et al. (1994) supra, reported recombination involving an unaffected individual that tentatively placed the gene proximal to D95287.
The present ~ ents identified one recombination between D95287 and FACC in a three-generation family. The recombinant individual was a 1.5 year old female presumed to be affected on the basis of macrocephaly, strabismus, and frontal bossing.
Some of the key features of the syndrome such as basal cell carcinomas, jaw cysts, and palmar pits, were lacking; but these features have age-dependent expression, and their presence in a young, child would not be expected. With the assumption that she carried the gene, the recombination in this farnily placed NBCCS proximal to D9S287.
Allelic loss in BCCs was concordant with linkage mapping in placing, the gene between D9S196 and D9S180. Most hereditary tumors with allelic loss deleted the entire region between the fl~nking, markers. However, one hereditary cardiac fibroma showed loss at D9S287 but not D9S280 on the non-disease carrying, allele suggesting that the gene is located distal to n9s280. In sporadic BCCs four tumors were found that retained 20 D9S287 and lost more distal markers but also two tumors that lost the proximal marker D9S280, but not D9S287.
Several hypotheses can be proposed to explain this discrepancy in tumor deletion mapping, and between tumor deletions and linkage studies. A gene other than NBCCS could be responsible for the allelic loss in some sporadic tumors. NBCCS is almost 25 certainly the target of allelic loss in hereditary tumors because these turnors always lose the copy of the NBCCS gene from the unaffected parent and retain the inherited mutation (Bonifas et al. (1994) Hum. Mol. Genet., 3: 447-448). If a second locus were driving allelic loss, then the alleles from the affected parent and the unaffected parent would be lost with equal frequency. However, there may be two different tumor suppressors on cnromosome 30 9q that are both important in basal cell carcinomas. The APC gene and MCC gene, for exarnple, are both mutated in colon cancer and lie within 1 Mb of each other on chromosome 5q (Hampton et al. (1992) Proc. Natl. Acad. Sci. USA 89: 8249-8253). The observation of a W 0 97/43414 rCT~US97/08433 clearly distinct pattern of allelic loss, involving, D95180 but not D95287, in squamous cell carcinoma of the skin supports the presence of more than one tumor suppressor in the 9q22.3 region. Additionally a putative tumor ~u~ressor has been mapped to 9q21-3 1 in bladder cancers, and may be distinct from the NBCCS gene (Knowles et al. (1995) Br. ~ Urol. 75:
57-66).
- A second possibility is that regions on both sides of D9S287 are deleted in some tumors, but that the more proximal deletions are not always detected by available markers. In fact two tumors were observed that deleted markers both proximal and distal to D9S127, probably reflecting genetic instability in tumor cells. Finally, NBCCS could be a large gene that extends on both sides of the D9S287 locus. Taken together the data provided herein suggested that the most likely location of the NBCCS gene was between markers D95280 and D95287. Nevertheless, due to the discrepancies in tumor deletions, physical mapping and cDNA isolation from the entire region between D9S196 ~nd D9S180 wereundertaken.
Physical mapping Twenty-nine YACs cont~ining markers from this region were obtained from the CEPH megaYAC library. Eighteen formed an overlapping contig between D9S196 and D9S180 with at least 2-fold redlln~l~ncy. Based on this contig the minimum distance between the fl~nking markers was 1.5 Mb, but virtually all large YACs had internal deletions as judged by STS content. Additional YACs were obtained from the ICI library to provide redlln(l~ncy in areas apl~arelltly prone to deletion. Cosmid and BAC contigs were constructed around known STSs and genes, and additional cosmids from the region were isolated by hybridizing YACs to the Lawrence Livermore gridded cosmid library. In total over 800 cosmids specific to this region were gridded into 96-well grid plates and contigs of BACS, P l s and cosmids covering 1.5 Mb were constructed (Figure 1). Because of deletions in YACs and some gaps in the cosmid and BAC contig, pulsed field gel electrophoresis (PFGE) and FISH were used to integrate the cloned regions. Based on the sizes of restriction fragments in this region and FISH estim~te~, the physical distance from D95180 to D95196 was estim~t~d at not less than 2 Mb.

_ . .

Isolation of cDNAs Harshman et al. (1995), supra, showed that different methods of identifying cI)NAs from a genomic region result in a surprisingly different array of candidate genes.
Several methods were used to find genes that map to chromosome 9q22 including sample sequencing of cosmids, exon trapping, HTF island cloning, and direct selection of cDNAs from BACs and-cosmids. In addition, genes known to lie in this general area were more finely mapped by use of somatic cell hybrids made from two NBCCS patients with visible 9q22 deletions (submitted to NIGMS repository), YAC contigs, and FISH. Ten genes, ten ESTs with sequences in GENBANK, and 31 anonymous selected cDNA fragrnents, HTF
island clones, and trapped exons with no known homology were identified (Table 1).
Screening patients for germline deletions or rear, u,.gements Because chromosome 9q22 appeared to be very gene rich, an attempt was made to localize the NBCCS gene more precisely by searching for submicroscopic rearrangements in patients. Fifteen cosmids at approximately 100-200 kb intervals spanning the region between D9S196 and D9S180 were hybridized to PFGE blots of 82 unrelated NBCCS patients. In addition probes from genes known to map to the interval as well as those identified in the course of the study were included in this analysis. PFGE variants were identified in three patients with genomic probes from within the Fanconi's anemia complementation group C (FACC) gene. All three were heterozygous for SaclI bandsapproximately 30 kb shorter than normal (310 vs 280 kb). The limit of resolution of PFGE
was about 10 kb, so that it was not possible to deterrnine whether the ap~ lly identical variant SacII bands were exactly the same size. Other restriction enzymes including Notl, BssHII, MluI, Sfil, and NruI did not show variant bands. The variations were not consistent with germline deletions in these patients but could conceivably be caused by point mutations creating new restriction sites or other small alterations such as the recurrent inversions seen in the F8C gene of many hemophiliacs (Lakich et al. (1993) N~t. Genetics, 5: 236-241).
The nature of the DNA alterations causing these changes on PFGE has not yet been elucidated, but the data relating, them to the disease are compelling. The families of two of the patients with variations were not available for study. However the third patient was a sporadic case of NBCCS, and neither parent had the SacII alteration. The finding of this variant in a patient but not in her parents could be interpreted as the result of . ~. . ~ ... ... .

CA 02266408 1998-ll-12 W O 97/43414 rcTrusg7/o8433 hypermutability of some CG-rich region near F~CC, but no variation in this region was identified in PFGE blots of over 100 normal chromosomes.

Wo 97/43414 PCT/US97l08433 Table 1. cDNA clones from the NBCCS region on chromosome 9q22.3.
Clone Design~tiona Clone typeb cDNAs previously mapped to chromosome 9g and more finely mapped with somatic cell hybrids, PFGE, and YAC contigs.
FACC Gene NCBP Gene HSD 17B3 Gene TMOD Gene XPA Gene SYK Gene WI-11139 EST (R14225) WI-11414 EST (T88697) WI-8684 EST (R14413) D9S 1697 EST (R06574) D9S1145 EST (contains R17127 and Z38405) Novel clones or clones not previously mapped to chromosome 9q identified by sample sequencing, exon trapping, HTF island cloning or cDNA selection.
ZNF169 Gene FBPl Gene PTC Gene Coronin homologue Gene 2Fla EST (R39928) 2Fl b EST (T11435) llF21 EST (Z43835) 31F3 EST (R16281) yo20gO5.sl EST (Merck EST) plus 31 anonymous selected cDNA fragments, HTF island clones, and trapped exons from YACs and cosmidpoolsC
aFor known genes and anonymous cDNAs that have been submitted to the Genome DataBase (http://gdbwww.dgw.org/gdb), standard locus nomenclature is used. For ESTs without a GDB number, WI indicates a Whitehead Institute clone (http://www-genome.wi.mit;edu).

W O 97/43414 PCTrUS97/08433 bNCHR accession numbers, where available, are given in parenthPses for anonymous ESTs.
Additional information can be obtained at http://www.ncgr.orglgsdb.
CAdditional sequence data will be required to determine whether some of the anonymous cDNAs represent different portions of the same genes.

Evaluation of PTCas a ~nn~il(rt~gene Because variant PFGE bands were identified in the FACC region and one recombinant as well as tumor deletion studies suggested a possible location near this marker, 10 candidate cDNAs that mapped to this area were e?~rnine-l FACC, itself, was not considered as a candidate because heterozygous mutations in this gene do not cause NBCCS (Strathdee et al. (1992) Nature, 356: 763-767). FACC and PTC (a novel human gene with strong homology to Drosophila patched) hybridized to the same 650 kb Notl fragment and 675 kb and 1000 kb (partial) MluI fragments. Mouse interspecies backcross analysis determined 15 that there were no recombinants between the PTC and FACC genes out of 190 meioses.
PTC and D9S287 were both present on ICI YAC 2EF8 having, a size of 350 kb strongly suggesting, that PTC lies between D9S287 and FACC.
To screen for mutations in the PTC gene, the intron/exon boundaries of the gene were determined from genomic clones and long range PCR products. PTC consists of 20 21 exons and the gene spans approximately 34 kb (Figure 2). Panels of unrelated NBCCS
patients and BCCs were screened by single-stranded conformation polymorphism (SSCP) analysis (primers used for amplification of PTC exons are shown in Table 2). Patients displaying variations were compared to unaffected individuals of the same race, and variants found only in affected individuals were further characterized by DNA sequencing. Of the 25 mutations identified in unrelated patients, four were deletions or insertions resulting, in frameshifts and two were point mutations leading, to premature stops (Table 3, Figures 4 and 5). An additional finding, confirming the relationship between mutations in PTC and the disease was identification of a frameshift mutation in a sporadic NBCCS patient that was not present in either of her unaffected parents (Figure 5).
To analyze the role of PTC in neoplasia, tumors related to the syndrome were screened for mutations. Two sporadic basal cell carcinomas with allelic loss of the NBCCS
region had inactivating, mutations of the r~m~ining allele (Figures 6 and 7). A tumor removed from the cheek had a CC to TT alteration, typical of UVB mutagenesis. The WO 97/43414 PCTrUS97108433 second tumor from the nose had a 14 b~ deletion, a mutation that cannot be related to any specific enviromnental accent. Mutations have not yet been identified in any sporadic BCC
not showing allelic loss of chromosome 9q22, and alternative modes of pathogenesis may be operative in these neoplasms.
5 Table 2. Primers to arnplii~y PTC exons.
Exon PositionaExon Size Primer Primersb SEQ ID
(bp) Name NO

IA alternate fust >239 PTCF22 GCTAT GGAAA TGCGT CGG 12 exon PTCR22 CAGTC CTGCT CTGTC CATCA 13 643-734 92 PTCF21 GCAAA AAm CTCAG GAACACC 20 7 934-1055 122 11el8F GTGAC CTGCC TACTA ATTCCC 24 I l 1591 - 1835 245 PTCF24PT TCTGC CACGT ATCTG CTCAC 32 W O 97/43414 PCTrUS97/08433 Exon Positiona Exon Size Primer Primersb SEQ ID
(bp) Name NO

173157-3294 138 PTCF8 mGA TCTGA ACCGA GGACACC 46 213793_4330C 537 PTCFI0 TCTAA CCCAC CCTCA CCCTT 54 Positions of exons are shown in bp acco. d ..g tp the numbering of the human cDNA sequence (GENBANK #U43148). The size of the exon is known in all cases except for exon I a, for which the S' end is not yet defined.
b The sequence of the primers is 5'-3'. There is a 45 bp intron between exons 18 and 19, and both exons are amplified with primers FlI and 21R. Updated primer s~q., a~es and PCR con-lirionc are available by anonymous FTP (contact dean ~fcrfv2.ncifcrf.gov).
c Position of the last bp of the final colon.

W O 97/43414 rcTrusg7/o8433 Table 3. Mutations in the PTC gene.
Sample Type Inheritance Exon Typeof Designation Mutation NBCCS F 5 premature stop C1081T
NBCCS F 6 37bpdeletion del 804-840 NBCCS F 8 premature stop G1148A
NBCCS F 12 2 bp insertion 2047insCT
NBCCS S 12 1 bp insertion 2000insC
NBCCS S 14 1 bp deletion 2583delC
BCC S 5 premature stop CC1081TT
BCC S 15 14 bp deletion del 2704-2717 aNBCCS, germline mutations in a patient with the syndrome; BCC, somatic mutation in a basal cell carcinoma.
F, f~mili~l; S, sporadic.

Discussion These examples provide strong evidence that mutations of the NBCCS gene 0 (PTC), the human homologue of Drosophila patched cause the nevoid basal cell carcinoma syndrome. Alterations predicted to inactivate the Pl'C gene product were found in six unrelated NBCCS patients. Frameshift mutations were found in two sporadic patients but not in their parents, and somatic mutations were identified in two sporadic tumors of the types seen in the syndrome. No known human tumor suppressor has seque'nce similarity to PTC, and functionally PTC may represent a novel type of neoplasia-related gene.

The Drosophila patched gene in differentiation and development The patched gene is part of a ciEn~ling palhw~y that is conserved from flies to m~rnm?.l ~. The Drosophila gene (ptc) encodes a transmembrane glycoprotein that plays a role in segment polarity (Hooper and Scott (1989) Cell 59: 751-765; Nakano et al. (1989) Nature 341: 508-513). Many alleles of ptc produce an embryonic lethal phenotype with mirror-image duplication of segment boundaries and deletion of the remainder of the ~ ~ . , , segments (Nusslein-Volhard et al. (1980) Nature 287: 795-801), but hypomorphic alleles produce viable adults with overgrowth of the anterior compartment of the wing, loss of costal structures, and wing vein defects (Phillips et al. (1990) Development 110: 105-114).
Genetic and functional studies have shown that one of the wild type functions of ptc is 5 transcriptional ~el"es~ion of members of the Wnt and TGF-b gene families (Ingham et al.
(1991) Curr. Opinion Genet. Develop. 5: 492-498; Capdevila et al. (1994) EMBO J. 13: 71-82. The mechanism of this repression is not known, and many other downstream targets of ptc activity may exist.
The action of ptc is opposed by the action of members of the hedgehog gene 10 family. Studies in Drosophila have demonstrated that hedgehog (hh) is a secreted glyco~loteill which acts to transcriptionally activate both ptc-repressible genes andptc itself (Tabata and Kornbemc (1994) Cell, 76: 89-102; Basler and Struhl (1994) Nature, 368: 208-214). Thus, in a given cell type the activity of target genes results from a balance between hedgehog ~ign~ling, from adjacent cells andptc activation.
Mammnlin.t homologues of patc~ed The human homologue (PTC) of Drosophila ptc, of this invention, displays no more than 67% identity at the nucleotide level and 61% identity at the arnino acid level to the Drosophila gene. Thus identification of a human homolog would have been difficult 20 using either a hybridization approach or by screening, an e~ ssion library with antibodies to the fly protein. The present date strongly suggest that patched is a single copy gene in m~mm~
Analysis of fetal brain cDNA clones, and RACE e~t~;nlents with epidermal RNA revealed the presence of two different 5' ends for the human PTC gene (Figure 3). The 25 two human sequences diverge from the mouse PTC cDNA (from 8 dpc embryo RNA) at the same position, and the mouse N-temminus more closely m~t~ s the Drosophila and C.
elegans proteins. Analysis of the u,u~ n genomic sequence of the C. elegans gene failed to reveal any homology to the two altemate human ends. These data suggest that there are at least three different fomms of the PTC protein in m~mm~ n cells; the ancestral fomm 30 represented by the murine sequence, and the two human fomms. The first in-frame methionine codon for one of the human fomms is in the 3rd exon, suggesting, that this foml of the mRNA either encodes an N-t~nnin~lly tl ~,cal~d protein, or uses an altemate initiation codon. The second human form contains an open reading, frame that extends through to the 5' end, and may be initiated by upstream sequences that have not yet been isolated. The identification of several potential forms of the PTC protein provides a mech~nicm whereby a single PTC gene could feasibly play a role in different pathways. It will be important to determine the regulation of the different splice forms of Ptc mRNA as this may shed light on the ~palel1t role of the gene in both embryonic development and growth control of adult cells.
In adult hllm~n.~ PTC is expressed widely. Abundant transcript is found in the kidney, liver, lung, brain, heart, skeletal muscle, pancreas, and skin. During murine 10 development Ptc is expressed first at 8.0 dpc in ventral neuroepithelial tissue in two separate domains along the midline. By day 9.5, transcripts are detected in the mesenchyme surrounding the neural tube as well. Expression is seen in the developing somites in a rostral-caudal gradient. From day 10.0 to 12.5 the transcript is present in the posterior ectoderm of each limb bud. Other sites of expression during this period include the inner 15 surfaces of the pharyngeal arches, cells surrounding, the placodes of the vibrissae, and the genital emin~nre.
Several homologues of Drosophila hedgehog (hh) have been identified in vertebrates and, like the Drosophila gene, appear to be involved in pattern org~ni7~tion during development. The most extensively studied of these is Sonic hedgehog (Shh). In the 20 mouse, expression of Shh is normally detected in the notochord and the overlying floorplate region ofthe neural tube (Echelard et al. (1993) Cell 75: 1417-30). Apart from being, involved in midline signaling in vertebrates, Shh is also expressed in a number of other tissues, including the developing, limbs, where it appears that Shh normally mediates the activity of the zone of polarizing activity (ZPA).
The expression of murine Ptc is found in a variety of tissues known to be responsive to Shh sign~ling. A detailed e~ es~ion analysis has indicated that the pattern of expression closely follows changes in Shh expression such that the transcripts are found mostly in adjacent, non-overlapping tissues. Ptc may be required for Shh sign~ling, and hh~ptc interactions appear to have been conserved during evolution. As in flies, Ptc 30 transcription in mouse appears to be indicative of an adjacent hh signal. Accordingly, when interpreting the relationship between known sites of Ptc t;~lession and the NBCCS
phenotype, it may be of value to consider the expression pattern of hedgehog gene family members since they have been characterized in much more detail in vertebrates than ptc, especially in adult tissues.
While it is clear that genetically and functionally Ptc responds to hh sign~ling, its structure does not make it an obvious hh receptor. Rather, it has been proposed 5 that Ptc may be a transporter and the substrates are molecules which regulate the transcription of target genes.

The role of PTC in neoplasia The data presented in this study strongly suggest the NBCCS gene 10 functions as a tumor suppressor. These examples show that germline mutations underlying the NBCCS phenotype are inactivating, and therefore hereditary tumors have no functional copy of the gene. In addition, these examples provide the first direct evidence that sporadic basal cell carcinomas (BCCs) can arise with somatic loss of both copies of the gene. The role of PTC in other tumors related to the syndrome remains to be explored.
That two known targets of ptc repression in Drosophila represent gene farnilies involved in cell-cell communication and cell sign~ling provides a possible mech~ni~m by which ptc could function as a tumor suppressor. The ptc pathway hasrecently been implicated in tumorigenesis by the cloning, of the pancreatic tumor suppressor gene, DPC4 (Hahn et al. (1996) Science 271: 350-353), which shows sequence similarity to 20 Drosophila mad (mothers against dpp). The mad gene interacts with dpp, a Drosophila TGF-b homologue specifically repressed byptc.
The cell of origin of BCC has been greatly debated and current theory postulates a progenitor "stem cell" that is slow cycling, but of great proliferative potential (Miller (1991) J: ,4m. Acad. Dermatol. 24: 161-175). Through occasional cell division 25 "transient amplifying cells" are formed, which further multiply before committing to ~ rmin:~1 differentiation. The ek~iession of patched and hedgehog gene farnily members in skin is not known. In Drosopl1ila, ptc is found in membrane regions resembling cell adhesive junctions, and it colocalizes with PS2 integrins, suggesting that the human homolog may normally play a role in epidermal differentiation based upon cell/cell interactions. The 30 correct localisation of Drosophilaptc protein to these regions is also dependent upon the interaction of the cells in a polarized epithelial sheet, an observation also supporting a role forptc in cell adhesive structures (Capdevila et al. (1994) Development 120: 987-998). The CA 02266408 1998-ll-12 W O 97/43414 PCT~US97/08433 present finding suggest that BCCs lack intracellular PTC .~ign~ling leading to an overexpression of the proliferative and cell/cell communication genes associated with hedgehog sign~ling. Alternatively, if PTC has a direct role in cell/cell interactions, proliferation may result from disruption at this level.

The role of PTC in developmen~al anomalies By analogy to embryonic ~A~l~ession of Ptc in the mouse, many of the features of NBCCS can be correlated with the presumed sites of expression of PTC in the developing human embryo (Table 4). For example, the skeletal anomalies involving the ribs, 10 vertebrae and shoulders are most likely due to disruption of PTC exlJlession in the sclerotome. In the mouse embryo Ptc ex~l~ssion is detected in the ventral-medial cells of the somites, a region which subsequently forms sclerotome (Hahn et al. (1996) supra.;
Goodrich et al. (1996) Genes Dev. 10: 301-12). In addition, Shh has been implicated in the induction of sclerotome by long range sign~lin~ from the notochord (Fan et al. (1995) Cell 81: 457-465).

Table 4. Mouse Ptc expression and human NBCCS phenotype.
Site of expression in mouse NBCCS Phenotype Pharyngeal arches Facial malformations Jaw cysts (dental lamina derivative Neural tube Dysgenesis of the corpus callosum Eye anomalies Somites Spina bifida Vertebral fusion Rib anomalies Limb buds Short fourth metacarpals Polydactyly The polydactyly observed in a subset of NBCCS patients is likely to correlate with the ex~ 3sion of Ptc in the developing murine limb (Hahn et al. (1996) supra.;
Goodrich et al. (1996) supra.). While the actual mech~ni.cm~ remain unknown it seems clear that anterior posterior patterning of the limb is controlled by Shh ~ign~ling from the ZPA. In the early mouse limb bud Ptc ex,uression correlates with Shh while at later stages ~x~ession is detected in the periphery of the digital condensations in cells adjacent to those ex~lessh-g W O 97/43414 rCTrUS97/08433 Indian hedgehog (rhh) (Goodrich et al. (1996) supra. ) Therefore the polydactyly present in NBCCS may result from perturbation of limb pd~ ing due to modulation of PTC.
Similarly the occurrence of irnmobile thumbs in a small percentage of NBCCS patients is concicte~lt with an alteration to wild type PTC function.
Craniofacial dysmorphology correlates with expression of Ptc in the pharyngeal arches and derived structures. The jaw keratocysts and dental malformations, which are common features of NBCCS, are most likely explained by the observed ,ression of Ptc in the tooth bud and the enamel knot (Vaahtokari et al. (1996) MOD, 54:
39-43; Goodrich et al. (1996) supra). The pathogenesis of jaw cysts is almost certainly 10 related to the embryologic dental precursors. The epithelial lining of keratocysts is believed to arise from aberrant derivatives of the dental lamina, the precursor of tooth buds. The progenitor cells may have migrated abnormally during development of the lamina or failed to involute at the a~lopliate stage of development.
The neurological con,l)ollents of NBCCS such as agenesis of the corpus 15 collosum, retinal colobomas, and possibly strabismus and macrocephaly are consistent with the expression of Ptc in the developing brain and neural system. Mental retardation, seen occasionally in the syndrome, may be caused by contiguous gene deletions.
Under the classical two-hit model for the action of tumor suppressors (Knudson (1971) Proc. Natl. Acad. Sci. USA, 68: 820-823) the finding of developmental 20 defects in a syndrome caused by hemizygous inactivation of this type of gene constitutes a paradox because loss of just one copy is thought to have little or no effect on cell function. It is possible that some of the discrete defects in NBCCS (e.g., spina bifida occulta, bifid ribs, and jaw cysts) can be explained by a two-hit mech~ni~m Like the neoplasms in cancer predisposition syndromes many of these defects are multiple and appear in a random pattern, 25 but isolated defects of the same type are seen occasionally in the general population. These anomalies might result from homozygous inactivation of PTC in an early progenitor cell of the relevant tissue leading to abnormal migration or differentiation or perhaps failure to undergo programmed cell death. Allelic loss studies have in fact shown that keratocysts of the jaw are clonal abnormalities that arise with homozygous inactivation of the NBCCS gene 30 (Levanat et al. (1996) Nat. Genetics 12: 85-87). However, generalized or symmetric fealules such as overgrowth, macrocephaly, and facial dysmorphology almost certainly defy the two-hit paradigm and are probably due to haploinsufficiency. It appears that many of the .. . , .. ~_ ~, .

W O97/43414 PCTnUS97/08433 developmental defects seen in NBCCS patients result from perturbation of a dosage sensitive pathway during embryonic development. Based upon these observations one prediction would be that a heterozygous Ptc "knock-out" mouse would show relatively mild developmental anomalies and UV irradiation of the skin would result in multiple basal cell carcinomas.

Pheno.~ypic variation in NBCCS
NBCCS is a disorder with almost 100% penetrance, but many of the features show variable expression. An int~ Ling correlate in Drosophila is that flies homozygous 10 for non-lethal alleles show striking variability in expression of phenotypic features. Because these flies are isogenic, the phenotypic differences cannot be explained by different underlying, mutations or modifying genes (Phillips et al. (1990) supra.J. Presumably the variability is a stochastic effect.
That there is more similarity in the human NBCCS phenotype within families 15 than between families (Anderson et al. (1967) supra.) suggests that there may be some degree of genotype/phenotype correlation. At present there are no clearly defined patterns of mutation distribution in NBCCS and all mutations found so far are predicted to cause truncation of the PTC protein. In families with BRCA 1 termination mutations, ovarian cancer is more common in patients with 5' mutations, perhaps because mutant peptides may 20 retain some wild-type function in some cell types but not in others (Gayther et al. (1995) Nature Genetics 11: 428-433).
Example 3 Characterization of Ptc Germ Line Mutations in NBCCS
Materials and Methods DNA extraction Odontogenic keratocyst tissue was placed in 200 ~11 STE buffer (SOmM NaCl;
10mM Tris-HCI pH8.0; lmM EDTA) cont~ining 0.5% w/v SDS, 1~1g/ll1 proteinase K and incubated at 37~C for 24 hours. Following inactivation of the proteinase K at 95~C for 15 min~lt~s, a sample of 1-5 ~1 (approximately 25ng DNA) was used directly for PCR.30 Constitutional DNA was obtained from peripheral blood Iymphocytes or buccal epithelial cells using standard DNA extraction procedures. Approximately 25ng DNA was used directly for PCR.

CA 02266408 1998-ll-12 WO 97t43414 rC~nUsg7/08433 Genbank Acee~Cion Numbers DNA sequence data for the PTCH gene are available under accession numbers U43148 and U59464. The nucleotide numbering used in this Example corresponds to sequence U43148, whereas the amino acid residue numbering corresponds to U59464.

PCR-SSCP analysis of the PTCH gene Each of the 23 exons comprising the patched gene were amplified separately using the primers and ~nn~ling conditions described in Hahn et al. (1996), supra. In brief, approximately 25ng target DNA was amplified in 30 ~11 lxPCR reaction buffer co~-t~ g 50mM KCI; lOmM Tris-HCI (pH 9.0); 1.5mM MgCI2; 0.1% v/v Triton X-100; 200',1M each dATP, dGTP, dTTP, 20 ~lM dCTP; 10 picomoles of each primer; 1.0~1 Ci [a32P-dCTP~ and 1.0 unit Taq. DNA polymerase (Promega, UK). Following 35 cycles of amplification, 5~1 PCR product was added to 35~1 1 OmM EDTA, 0.1 % w/v SDS . 2111 of this was added to 2 ~11 loading buffer co"l;.ini~g 95% v/v deionised forrnamide/20mM EDTA/0.05% w/v bromophenol blue/0.05% w/v xylene cyanol, heated to 100~C for 5 minutes, quenched on ice and loaded onto a lxTBE/6% w/v non-denaturing polyacrylamide gel (5%C) cont~ining (5%C) cont~ining 5% v/v glycerol. Electrophoresis was at 350V for 18 hours. Gels were dried under vacuum and autoradiographed for 16 hours at room temperature with intensifying screens.

Restriction SSCP
PCR products obtained by amplification of exons 14 and 17 were restriction enzyme digested with Alul and Hinfl, respectively, prior to SSCP analysis.
An aliquot of 10 ~I PCR product was digested in a total volurne of 20 ~,11 1 X reaction buffer according to manufacturers' instructions. 2 ,ul of restriction enzyme digested PCR product was mixed with 2 ~l loading buffer and subjected to SSCP analysis as described above.

DNA sequencing of PTCH exons Exonic PCR products displaying altered mobilities by SSCP analysis were purified using commercially available columns (Wizard PCR columns, Promega). PCRproducts were eluted in 20 ~1 TE and 2~11 used for DNA Thermosequenase (Amersham W O97/43414 PCTnUS97/08433 Intern~tional plc) cycle sequencing according to m~nIlf~ctllrer's instructions. Sequencing primers were end-labelled with y32P-ATP(3000 Ci/mmol) using T4 polynucleotide kinase.
DNA sequencing reactions were fractionated in 6% w/v polyacrylamide/8M urea/lxTBE
gels for 2 hours at 2000V. Gels were dried under vacuum and autoradiographed for 8 hours at room temperature with intensifying screens.

Results Keratocyst DNA from a total of 16 NBCCS patients was screened by SSCP-PCR. 10 single exonic PCR products displaying altered electrophoretic mobilities 10 were cletectecl and analyzed further by DNA sequence analysis. In addition, variant bands in multiple samples (i.e. indicative of common polymorphisms) were also seen in PCRproducts encompassing 4 exons.
Four mutations were identified following direct DNA sequencing of PCR
amplified exons displaying SSCP variant bands. Mutations could not be detected in the 15 rem~ining 6 variant PCR products. Therefore, all 23 exons from the sarnples in which a mutation had not been identified initially were amplified and sequence in their entirety.
However, only one additional mutation was detected by this method.

Exon 5 693 insC
A single cytosine residue insertion at position 693 was detected in a 42 year old male NBCCS patient. This introduces a fr~meshift mutation by the creation of a premature stop codon at amino acid residue 252. This mutation also creates a BstN~
restriction enzyme site. DNA from the patient and 4 unaffected family members was amplified and restriction enzyme digested with BstNI. As predicted, only the product from 25 the NBCCS patient was cut by the restriction enzyme.

Exon 17 2988 del8bp Following Hin~I restriction enzyme digestion of exon 17 PCR products and SSCP analysis, 2 variant bands were seen. Direct DNA cycle seqlltoncing of these amplicons 30 revealed 2 mutations. An 8bp deletion was tletecte~ in DNA from a 12 year old male NBCCS patient. This frameshift mutation introduces a stop codon at amino acid residue 1141. The patient has macroephaly, hyper~elorism, supra-orbital ridges, pro~n~thi~m, ., , . .. ~ . .
.

plantar but not palmar pitting and an accessory nipple. In addition, at age 10 years, the patient had undergone surgical removal of 3 maxiallary and mandibular odontogenic keratocysts.

Exon 173014insA
A adenosine insertion at base 3014 was detected in an 18 year old female NBCCS patient. This results in a frarneshift mutation (tyrosine to STOP) codon at amino acid residue 1009. This patient was frontal bossing, hypertelorism, falx calcification, bifid 3rd, 4th, 5th and 6th ribs and has undergone enucleation of 5 m~xill~ry and mandibular odontogenic keratocysts.

Exon 213538 deIG
A guanosine base deletion at residue 3538 was identified in a 38 year old female NBCCS patient. This frameshift mutation introduces a stop codon at amino acid residue 1190. The causal nature of the mutation was confirmed by analysis of DNA from the proband's father, from whom she has inherited the disorder. Direct DNA sequencing of exon 21 from the father also revealed a guanosine base deletion at residue 3538.

Exon 22 G4302T
Direct DNA sequencing of 23 exons from a 30 year old female NBCCS
patient revealed a G-T substitution at nucleotide 4302. This cases a glutamic acid to aspartic acid (E - D) substitution at amino acid residue 1438. The patient has been confirmed as a case of NBCCS and has undergone removal of 11 basal cell carcinom~.

PTCH gene polymorphisms Using the SSCP conditions described, the inventors observed polymorphisms in PCR products amplified from exons 6, 11, 14 and 15. No DNA sequence alterations were detected following analysis of exonic sequences. Therefofe, it is likely that these lcprese intronic DNA sequence polymorphisms. Also, an exonic DNA sequence polymorphism (C306T) was disclosed in exon 2. This base substitution was observed in DNA from subject LDI-1, in which a "causative" 3538delG mutation had already been identified, as well as other unrelated NBCCS patients.

,, .. ~ ... .... ~.

In this example, the inventors identified 5 novel, germ line mutations from patients with the NBCC cell, consistent with the role of patched as a hurnan tumour suppressor gene. Four mutations cause frame-shift or none-sense mutations resulting in a truncated PTCH protein; the fifth mutation is a glutamic acid to aspartic acid substitution 5 close to the 3'-carboxyl terminus of the PTCH protein. This was the only base change ~letçcted following direct DNA sequencing of all 23 PTCH exons from patient #5. Although this represents a conservative amino acid substitution and, therefore, may be a polymorphism and not a mutation, this glutamic acid residue is conserved between human, mouse and chicken PTCH proteins and is likely to be functionally important.
Example 4 Mutations of the Ptc Gene in NBCCS Define Clinical Phenotyl)e Example 3 defined mutation in individuals with NBCC syndrome. lin this Example, further mutations are identified.
Materials and Methods The patients were diagnosed according to the clinical criteria of Shanley et al (1994). Seventy NBCCS patients were fully analyzed by single strand conformationpolymorphism (SSCP) and heteroduplex analysis as previously described (Hahn et al., 20 supra.) with primers for all coding exons except for exon lb (alternative first exon). Primer sequences were as hereinbefore described as well as Hahn et al (1996) with the exception of exons 12, 12b and 20. Exon 12b is an additional exon resulting from the discovery that exon 12 (Hahn et al. 1996) consists of two distinct exons. The PTC gene, therefore, consists of 23 coding exons. Where possible, DNA was also analyzed from the parents o~ cases in which 25 PTC mutations were found in order to determine at a molecular level whether the mutation was sporadic or f~mili~l Any samples showing SSCP variants were sequenced as previously described (Wicking et al. (1997) Am. J. Hum. Genet. 60: 21-26).
Paternity testing was carried out using microsatellite markers in the parents ofthe eight sporadic cases using fluorescent primers and Genescan.

... .

W O 97143414 rCTnUS97/08433 Results PTCH mutations were identified in a total of 32 NBCCS cases. Twenty-eight of these are described in Exarnple 3. This Example presents four novel mutations (Table 5).
Of these, three are fr~me~hiR mutations and one is a putative splice variant. The inventors S have, therefore, detected PTCH mutations in 32/70 (46%) NBCCS cases by analysis of all exons except exon Ib. The majority of these (27/32; 84%) are protein termin~tin~mutations. In addition, eight sporadic cases were identified by the absence of the relevant disease-associated mutation in either parent (Table 6). Paternity testing was performed in these eight cases, using four microsatellite markers and in none was any inconsistency 1 0 identified.
This Example ~uleselll~ eight individuals with NBCCS whom the inventors have shown to carry mutations in the PTCH gene. In all cases, the parent did not carry the disease-related mutation, and non-paternity was shown to be unlikely by analysis of highly informative microsatellite markers. In addition, the inventors report four NBCCSindividuals with germline PTCHmutations. l'hree out of four of these would result in premature protein truncation.
The ability to confirm the diagnostic status of relatives of NBCCS cause by DNA analysis allows further definition of the clinical and radiological criteria used to diagnose NBCCS. Of the eight NBCCS individuals shown to have new mutations in the PTCH gene in this study only two (JRN250, DD25) clearly represented sporadic cases based on clinical and radiological e~min~tion of both parents. In one case (JHK55 1 ) neither parent had been examined. In all other cases one parent showed at least one feature associated with NBCCS such as multiple BCCS, a high arched palate or macroephaly.

TABLE ~
PTCH MUTATIONS IN NBCCS INDIVIDUALS

Patient Exon Mutation Effecton coding JK211 12 171 linsC Frameshift, truncation MB229 12 1639insA Fr~me~hift, truncation CW424 16 2707delC Fr~meshift, truncation .. . .

NB88 Intron 17 3157-2A-> G Putative splice variant MUTATIONS OF PTCH IN NBCCS PATIENTS
Patient Mutation Effect Parentalphenotype DD25 C2050T Nonsense Parents both clinically and radiologically negative but multiple BCCs in history of grandmother.
JHG547 C391T Nonsense Father has had > 10 BCCs from 6th decade but radiologically negative. Mother clinically and radiologically negative.
BK273 244delCT Frameshift Father has high arched palate, macrocephaly and dense falcine calcification (age 53) but below maximum biparietal diameter. The Mother clinically and radiologically negative.
JHK551 271 insA Fr~nçshiR Negative family history but neither parent e~mine.l JRN250 929delC Fr~m~shift Both parents clinically and radiologically negative.
MP264 2183delTC Frameshift Father has high arched palate, macrocephaly and three "pits" on soles but radiologically negative.
Mother clinically and radiologically negative.
KS356 2583delC Frameshift Father has had three unconfirmed BCCs (age 65) but radiologically negative. Mother negative clinically. No radiological ex~min~tions.
JK211 1711 insC Frameshift Father has high arched palate and has had about 20 BCCs (from age 70) but also multiple solar keratoses, ker~to;~c~nthoma and squmous cell carcinomas. He is radiologically negative.
Mother clinically and radiologically negative.

Example 5 Medulloblastomas of the Desmoplastic Variant carry Mutation of the Human P~c Gene In this Example, the inventors detected non-conservative PTC mutations in three of 11 sporadic cases of desmoplastic medulloblastomas (Mbs) but none in 57 tumours with classical (non-desmoplastic) histology. In two of the tumours with mutations and in two additional desmoplastic cases, LOH was found at 9q22. These fintling~ suggest that PTC represents a tumour suppressor gene involved in the development of the desmoplastic .. . .... .

WO 97/43414 PCTtUS97/08433 variant of MB.

Materials and Methods Patient and tumours, ceU lines.
A total of 68 medulloblastoma samples were analyzed, 64 samples were obtained from MB turnors and 4 from the previously described medulloblastoma cell lines D283Med, D341Med, Daoy, and MHH-MED-l (Pietsch et al. (1994) Cancer Res. 54: 3278-3287). In two patients, the inventors were able to study both the primary and the recurrent tumors. Constitutional DNA from peripheral blood was available in 40 patients. DNA
samples from peripheral blood from healthy C~l1c~ n volunteers were used as controls. A
sample of normal cerebellurn was analyzed. This biopsy specimen was from an adult patient with a cerebellar vascular malforrnation and was found to be normal upon histopathological review. The patients' age ranged from 1 month to 59 years; there were 46 males and 20 females. None of the patients had clinical signs of NBCCS or had first degree relatives with NBCCS. All tumors were diagnosed according to the revised WHO classification of brain tumors using standard histological methods including HE and reticulin stains andimmunohistochemical reactions (Kleihues et al. (1993) Histological typing of tumours of the central nervous system, Springer Verlag, New York). Differentiation was assessed by irnmunosf~inin~ for embryonal neural cell adhesion molecule (NCAM), neuron-specific enolase, synaptophysin and glial acidic fibrillary protein. Frozen tumour samples were obtained at the time of surgical resection, snap frozen in liquid nitrogen and stored at -80~C.

DNA extraction, LOH analys-s.
Tumour fragments were selected for extraction of DNA after careful ~ tion of corresponding frozen sections to exclude co--~ tin~ necrotic debris ornormal cerebellar tissue and to det~nnine the histological characteristics of the tumors.
DNA was extracted by standard proteinase K digestion and phenol/chloroform extraction (Albrecht et al, 1994). Loss of heterozygosity was deterrnin~d by microsatellite analysis with the markers D9S287 and D9S197 which were tightly linked to the PTC gene and with two additional markers on 9q (D9S302, D9S303) essenti~lly as previously described (Albrecht et al. (1994) Neuropathol. Appl. Neurobiol. 20:74-81; Kraus et al. (1996) Int.
Cancer 67: 11 -15).

W O 97/43414 rCTnUS97/08433 SSCP analysis and DNA sequencing SSCP analysis of exons 2-22 was performed using 22 primer pairs (previous Examples and Hakin et al, 1996). PCR cont~ining 50 mM KCI, 1.0-2.5 mM MgCI2, 10mM
S Tris-HCl (pH 8.5), 0.01 % w/v gelatin and 200 mM of each dNTP, 2 ,uM of the primers and û.25 units Taq polymerase (Gibco-BRL) on a Uno Thermoblock cycler (Biometra). The products were analyzed on polyacrylamide gels with different acrylamide concentrations and acrylamide/bisacrylamide ratios. Gel composition and electrophoresis conditions were optimized for each individual primer pair. The single and double strands were vi~ li7. d by silver staining as previously described (Albrecht et al, 1994). PCR products which showed a gel mobility shift were excised from the wet gel, eluted (Koch et al, 1996) and reamplified by PCR with the same primers. The resulting products were purified using spin columns (Qiagen quick spin), and 20 ng used to cycle sequencing with a fluorescent dideoxy tçrmin~tor kit (ABI). The products were analyzed on an Applied Biosystems model 373A
DNA sequencer.

Isolation of RNA, q~ "l;ve RT-PCR for PTCH mRNA.
Total cellular RNA was extracted by lysis in guanidinium isothiocyanate and ultracentrifugation through a cesium chloride cushion (Koch et al, 1996) or by extraction with the TrizolTM reagent (Gibco-BRL) following the m~mlf~ctllrer's instructions. Again, individual samples were preex~mine(l by frozen section histology to document thehistopathological appearance of the specimen. Cont~min~tine residual genomic DNA was removed by digestion with RNAse free DNAse (Boehringer). RNA standards with internal deletions for human PTC and the housekeeping genes ~2-microglobulin and GAPDH were generated by in vitro mutagenesis and in vitro transcription (Horton and Pease (1991) in Direct Mutagenesis--,4 Practical Approach, McPerson, ed., pp. 217-247 (IRL Press, Oxford). In order to achieve a semi-quanlil~ e ~csec~,.,çnt, pre-evaluated amounts of the specific standards RNAs covering the equimolar range of the corresponding mRNA
transcripts were added to the MB sample RNAs which were then reverse transcribed using the SuperScriptTM Pre~mplification System (Gibco-BRL) with random hexamers as primers in a final volume of 10 ~1. 0.5 ~11 of the cDNA was used as a template in RT-PCR reactions for amplification of PTCH, and the housekeeping genes. The primers used were: PTCH, .. ~, . ... . .

5'ACATGTACAACAGGCAGTGG-3 [SEQ ID NO:61] and 5'-GCAAGGAGGTTTACCTAGG-3' [SEQ ID NO.62], product size, wild type 192bp, standard 182 bp; GAPDH, 5'-TGCCAAGGCTGTGGGCAAGG-3' [SEQ ID NO:63] and 5'-GCTTCACCACCTTCTTGATG-3' [SEQ ID NO:64] product size, wild type 152bp, 5 standard 142bp; ~2-microglobulin, 5'-GCTGTGACAAAGTCACATGG-3' [SEQ ID NO:65]
and 5'-GATGCTGCTTACATGTCTCG-3' [SEQ ID NO:66], product size, wild type 148bp, standard 130bp. One of the primers for each gene was labeled with a fluorescent dye. All primers were chosen from adjacent exons sp~nning intronic sequences in order to avoid signals of the cDNA product size caused by residual genomic DNA. The PCR products 10 were separated and analyzed on an Applied Biosystems model 373A DNA sequencer using the Gen-osc~n software (ABI). The exl.lession levels of the individual genes were calculated from the signal ratios of the samples to the standards. The relative expression of PTCH
mRNA to the housekeeping genes was defined as the ratio of the respective ~ ession levels (Figure 10).
The human PTCH gene spans 34 kB and has at least 23 exons. SSCP
screening of DNA samples from 68 sporadic MBs revealed band shifts in 6 samples (Table 7). Three of these were identified as silent polymorphisms. In three other tumors, the variants were not found in the corresponding germline DNA or in normal control DNA
samples. Two mutations in exons 6 and 10, respectively, resulted in a frame shift with premature truncation of the protein (Table 7 and Figure 9). The third mutation (D86) was a six base pair in frame deletion in exon 10 leading to the de~etion of two arnino acids in transmembrane region 3. This deletion may cause significant structural alterations of the PTCH protein and may result in loss of function. This was the case in tumours D86 and D322 which showed LOH as well as mutated PTC allele. In case D292 without detectable LOH at 9q, only a single SSCP band shift was found (in exon 10). Mutations of the other allele may be present but may not have been detected by SSCP s~ lh1g because of the limited sensitivity of SSCP. Only the coding exons were screened so that mutations in other regions such as regulatory domains would not have been identified with this approach. A
systematic sequencing analysis may uncover additional PTCH mutations in Mbs.
In this Example, mutations were detected in a distinct histopathological variant or medulloblastomas (MB), the so-called modular or "desmoplastic" MB. According to the WHO classification this variant is characterized by islands of lower cellularity surrounded by densely packed, highly proliferative cells which produce a dense intercellular reticulin fiber network. The more frequent "classical" MB lacks this nodular appearance and reticulin pattem.

MUTATIONAL ANALYSIS of the PTC~ GENE IN MEDULLOBLASTOMAS
a, Mutations Tumour MB variant Age/sex LOH on 9q Exon Nucleotide change Protein change D 86 desmoplastic 4y, maleyes 10 1444del6 del Gly-Leu D 292 desmoplastic Iy, female no 10 1393insTGCC frameshift, ~ truncation D 322 desmoplastic 51 y, male yes 6 887delG frameshift, truncation b, Polymor~
Tumour MB variant Age/sex LOH on 9q Exon Nucleotidechange Protein change 15 D 230 11 classical 13y, female no 13 C2037T no D 338 classical 13y, male n.a. 2 C306T no D 358 classical 10y, female n.a. 2 C306T no EXPRESSION OF THE PTCH GENE IN MEDULLOBLASTOMAS
Sample MB LOH on9q PTCH mRNA mRNA
subtype mutation ~A~ 7~ion ratio expression ratio detected by PTCH/C~PDH PTCHJ,~2-SSCP microglobulin D 338 classical n.a.* no 5.8 (3.9-7.4)** 10.3 (8.2-14.2) 30 D 230 II classical no no 1.7 n.a.
D 286 classical n.a. no 1.2 n.a.
D245 II classical no no 0.7 n.a.
D 446 classical no no 1.8 (0.8-2.8) 1.5 (1.0-1.8) D 447 classical no no 0.6 n.a.
D86 desmopl. yes yes, exon 10 3.6 (1.4-5.4) 2.6 (1.7-3.9) D 292 desmopl. no yes, exon 10 0.6 (0.6-0.6) 0.3 (0.3-0.4) D 322 desmopl. yes yes, exon 6 1. I n.a.
D448 desmopl. yes no 4.3 (3.3-5.5) 2.9(2.5-3-6) 40 D 398 desmopl. no no 26.5(22.4-30.0) 18.4 (12.0-24.4) D 444 desmopl. yes no 4.1 (3.7-4.7) 4.5 (3.3-5.5) D365*** desmopl. n.a. no 0.3(0.2-0.4) 0.1 (0.1-0.2) Cerebellum - n.a. n.a. 2.5 (1.55-3.64) 1.76 (1.42-2.09) ~n.a., not analyzed; ** mean and range of relative eA~Jressioll (analyzed by semi-~ e RT-PCR);
**~D365, cell line Daoy.

. ~ . . ~ , . .

wo 97/43~14 PCT/US97/08433 Example 6 Most Germ Line Mutations in the NBCCS Gene lead to a Premature Termination of the PATCHED Protein In this Example, the inventors screened DNA samples from 71 unrelated NBCCS
individuals for mutations in the PTCH exons using single strand conformational polymorphism (SSCP) analysis. ln total, 28 mutations were identified and characterised by direct sequencing of PCR products. The majority of these mutations (86%) lead to10 premature truncation of the PTCH protein. Analysis of phenotype in individuals with truncating mutations revealed no statistically significant correlation between genotype and phenotype in NBCCS.

Materials and Methods Subjects and samples The patients, most of whom were from Australia and New 7e~1~n~ were diagnosed according to the clinical criteria in Shanley et al. ( 1994) supra. Of the 71 NBCCS patients analyzed 25 show clear f~mili~l presentation and 46 are ~alenlly sporadic.

SSCP analysis A combined SSCP and heteroduplex analysis was performed as previously described (Hahn et al. (1996) supra). DNA from 71 unrelated NBCCS individuals was amplified with primers to all but exons lb (alternative first exon homologous to murine exon 1), 12 and 20 (for which acceptable primers are not yet available) of the human PTCH gene.
25 Primer sequences and conditions were as hereinbefore described as well as (Hahn et al.
(1996) supra.).

Seq~neing DNA from samples showing SSCP variants was reamplified and purified for 30 automated sequencing using PCR Spinclean Columns (Progen Industries). DNA
concentration was ascertained by agarose gel electrophoresis and 25-35ng of product was used for each automated sequencing run. Cycle sequencing was performed using Amplitaq WO 97/43414 PCT/US97tO8433 FS polymerase and dye labelled terrninator chemistry (Perkin Elmer Cetus), and sarnples were analyzed on an PEC 373A electrophoresis appaldlus. Where mutations were confirmed by manual sequencing the purified products were ligated into GEM-T vector (Promega) and the resulting clones were sequenced with a T7 Sequencing Kit (Pharmacia).

Southern analysis Southern blots were made as previously described (Chenevix-Trench et al. 1992), using EcoRI and HindIII restriction enzymes and hybridized with PTCH cDNA probes 13B
and 16C.
.~t~fi~ti(~l analysis Linear regression analysis was used to examine genotype-phenotype associations.

Results Iden~if cation of PTCHMutations DNA from 71 individuals with NBCCS was screened for mutations in the PTC
gene by a combined SSCP/lleteroduplex analysis. Based upon sequencing of sarnples showing SSCP variation, 28 putative disease-associated mutations have been fullycharacterised (Table 9). While one mutation, a CT deletion at nucleotide position 244, was seen in 3 a~pale~ y unrelated individuals, all other mutations were only detected in a single NBCCS farnily. No clustering of mutations has been observed, with mutations identified in most exons and in positions corresponding to all of the major domain types of the PTC
protein(Fig. 11).
The majority (24/28; 86%) of mutations detected are predicted to result in truncation of the PTCH protein either by introduction of a stop codon or by frameshift due to insertion or deletion (Table 9). Two of the mutations were predicted to be splice variants based on the fact that one altered a consensus 3' splice site, while the other involved an insertion of 21 bp in intron 10, 8bp upstream of the start of exon 11. This second mutation was presumed to cause aberrant splicing based on the fact that it moves the branch site from position 27 to 48bp upstream of the 3' splice site. This 7bp consensus sequence is generally located approximately 18 to 37bp u~3s~ ofthe splice site, and its location is considered to be important in the splicing reaction. The rem~ining two mutations are mi~s~ nce mutations wo 97t43414 PCT/US97/08433 which ~oth alter residues within tr~n~m~mbrane domains of the PTCH protein. One (PP) is a transversion of GAT to TAT at nucleotide 1525, substitllting a tyrosine for an aspartate in the fourth transmembrane domain, the other (RS) is a transversion of a GGC to CGC at nucleotide 3193, sub~ uling an arginine for a glycine in the ninth transmembrane domain of 5 the PTCH protein.
In addition to disease-associated mutations, several variants were designated polymorphisms based on their presence in unaffected individuals, or the finding that the underlying sequence changes did not alter the encoded amino acids. For samples in which no SSCP variation was found, the sequence of each exon of the PTC gene is currently being 10 determined. DNA from 38 patients in which a mutation was not found by SSCP was also examined by Southern analysis using probes which span the gene. Variants were detected in two patients. In each case, a single additional band (3 and 3.75 kb respectively) was seen on HindIII blots. No variants were present in these individuals on EcoRI, BamHI and Pst I
digests, therefore, those seen on HindIII blots are unlikely to represent gross rearrangements.
15 The probability of at least one of these variants being a disease-related point mutation is increased by its segregation with disease in a farnily. No family members were available for study in the case of the second variant. The underlying mutations in these individuals are yet to be determinffl Analys~s of genotype-pheno~ype associations Although most of the mutations found to date are predicted to truncate the protein, it remains to be determined whether all ablate its function. In order to address this, preliminary analysis of genotype-phenotype associations in this complex syndrome was performed, based on the 24 families with protein-truncating mutations. Several aspects of the NBCCS phenotype were used as approximate parameters of disease severity. Theinventors e~min~d the number of major features (BCCs, jaw cysts, pitting and falcine calcification) seen in individuals at the time of diagnosis, the age at which the individual manifested BCCs and the age at which jaw cysts were detected. Individuals under the age of 20 years were not included in this analysis due to the age-dependent ~xplession of these features. Similarly, analysis of age of BCC onset was restricted to Australasian patients to limit the influence of ultraviolet exposure in promoting BCC development. When a mutation was known to be present in a nurnber of individuals within a family, phenotypic data were averaged across all relevant family members. No correlations between the age of onset of BCCs (R2=0.001) or jaw cysts (R2=0.023), or the number of major features (R2=0.015), and nucleotide position of the mutation, were found, indicating that for these features at least, there is no clear correlation between phenotype and location of the truncating mutation.
5 Although it was not ~plo~liate to use statistical analyses to compare trunc~ting mutations with missense and splice variants due to the small number of the latter type of mutations, the individuals the inventors have analyzed with mi~sçn.~e and splice mutations show a classic NBCCS phenotype and would not be classed as mildly affected.
The phenotypes of individuals in the three families which share a common 10 mutation (244delCT) were evaluated, and shown to vary considerably. All five affected members of family CB have a cleft or very high arched palate but this was not observed in the HC or BK families, both of whom show the typical range of NBCCS features. This suggests that the molecular nature of the PTC mutation is not entirely responsible for the phenotype in NBCCS. Interestingly, BK carries a new mutation of PTC so this mutation 15 must have arisen at least twice.
The inventors have identified mutations in the PTC gene in 28 unrelated individuals with NBCCS and found no evidence of any association between genotype and phenotype. In 24 families with protein-truncating mutations, no significant correlation between phenotype and location of the truncating mutation was found. This differs from 20 breast and ovarian cancer where 3' mutations in the BRCAI gene are less likely to predispose to ovarian cancer than are 5' mutations presumably because of residual activity of proteins resulting from 3' mutations.

GERM-LINE MUTATIONS IN THE PTC GENE IN NBCCS INDIVIDUALS
EXON MUTATIONb EFFECT ON
CODINGC
PATIENT8 Missense PP(S) 11 G1525T D-Y at 513 RS (S) 18 G3193C G-Rat 1069 W O 97/43414 PCT~US97/08433 sçn~e JHG(S) 3 C391T R-X at 135 JM (F) 8 G1148Ad W-X at 387 TM (S) 10 G1368A W-X at 460 DD(S) 13 C2050T Q-X at 688 BH(S) 13 C2068T Q-X at 694 PB (F) 17 C3015a Y-X at 1009 Insertions, Deletions, and Duplications HC, CB(F); BK(S)C 2 244delCT Frameshift JHK (S) 2 271insA Frameshift GS (S) 3 464insAC Frarneshift MC (F) 6 804del37d Frameshift JRN (S) 6 929delC Frameshift DS (F) 10 1370del76 Frameshift CM (S) 11 1497dup8 Frameshift MP (F) 13 2183delTC Frameshift TH (F) 14 2320insA Frameshift LK (S) 14 2392delA Frameshift DC (S) 15 2574delA Frameshift KS (S) 15 2583delCd Frameshift WS (F) 15 2596complexf Frameshift DE (F) 16 2748insC Fr~mechift JRD (F) 16 2749dup7 Fr~m~chift JW (S) 19 3352delAT Fr~meshift Splicing AE (F) Intron 7 A1055-2C 3' splice site IMc (S) Intron 10 1493-8ins21 Putative splice variant W O 97143414 r~ 97/08433 Polymorphisms~
2 A or T at 312 No change I108 3 T or C at 417 No change T143 4 A or G at 588 No change E200 A or G at 723 No change T245 7 T or C at 1023 No change G345 Intron 10G or C at 1493-39 Intron 11A or T at 1591+29 Intron 18delTT at 3294+27 22 T or C at 3933 No change L1315 a S = sporadic mutation; F = f~mili~l mutation.
b As per Genbank entry U43148.
c As per Genbank entry U59464.
5 d As previously reported b Hahn et al., 1996.
' Sporadic cases in which parents were analyzed and no mutation was seen.
f Complex mech~ni~m involving insertion and deletion.
~ Polymorphisms in exons 3, 4, and 7 are rare.

It is understood that the examples and embo(1im~nt~ described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent 15 applications cited herein are hereby incorporated by reference for all purposes.

~, . . ~

CA 02266408 l998-ll-l2 W O g7/43414 ~equence ID NO: 1: NBCCS (PTC) cDNA

(2l INFORMATION FOR SEQ ID NO: 1 .
Ii) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6568 base pairs (P) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 442..4329 ~xi~ SEQUENCE DESCRIPTION: SEQ ID N0:1:

GCCGGGGAGC AGCATGCGCC GGCCTGAGCC ~llcCullla CACTCGGCTG TTTTTTACGT 120 TTAACCAGAA AGGAAGGGAG AGGAGGGAAA GATCCATGTG GCTGCCCTCT TCCGATCACA lB0 AGACTCTTAT TTAAACTGGG TTGTTACATT CAAAAAAACT GCGGCAAGTT Ul~ ~ 300 GGCCTCCTCA TA~l~aGGGC CTTCGCGGTG GGATTAAAAG CAGCGAACCT CGAGACCAAC 360 GTGGAGGAGC I~l~G~lGGA AGTTGGAGGA CGAGTAAGTC GTGAATTAAA TTATACTCGC 420 CAGAAGATTG GAGAAGAGGC T ATG TTT AAT CCT CAA CTC ATG ATA CAG ACC 471Met Phe Asn Pro Gln Leu Met Ile Gln Thr Pro Lys Glu Glu Gly Ala A9n Val Leu Thr Thr Glu Ala Leu Leu Gln His Leu Asp Ser Ala Leu Gln Ala Ser Arg Val His Val Tyr Met Tyr Asn Arg Gln Trp Lys Leu Glu His Leu Cys Tyr Lys Ser Gly Glu Leu Ile Thr Glu Thr Gly Tyr Met Asp Gln Ile Ile Glu Tyr Leu Tyr Pro Cys Leu Ile Ile Thr Pro Leu Asp Cys Phe Trp Glu Gly Ala Lys Leu 75 80 85 9o Gln Ser Gly Thr Ala Tyr Leu Leu Gly LYB Pro Pro Leu Arg Trp Thr Asn Phe Asp Pro Leu Glu Phe Leu Glu Glu Leu Lys Lys Ile A~n Tyr CAA GTG GAC AGC TGG GAG GAA ATG CTG AAT AAG GCT GAG GTT GGT CAT ~55 Gln Val Asp Ser Trp Glu Glu Met Leu Asn Lys Ala Glu Val Gly His Gly Tyr Met Asp Arg Pro Cys Leu Asn Pro Ala Asp Pro Asp Cys Pro Ala Thr Ala Pro Asn Lys Asn Ser Thr Lys Pro Leu Asp Met Ala Leu Val Leu Asn Gly Gly Cys His Gly Leu Ser Arg Ly9 Tyr Met His Tr~p 175 lB0 185 Gln Glu Glu Leu Ile Val Gly Gly Thr Val Lys Asn Ser Thr Gly Lys Leu Val Ser Ala His Ala Leu Gln Thr Met Phe Gln Leu Met Thr Pro Lys Gln Met Tyr Glu Hia Phe Lys Gly Tyr Glu Tyr Val Ser His Ile A~n Trp Asn Glu Asp Ly~ Ala Ala Ala Ile Leu Glu Ala Trp Gln Arg Thr Tyr Val Glu Val Val Hi9 Gln Ser Val Ala Gln Asn Ser Thr Gln Lys Val Leu Ser Phe Thr Thr Thr Thr Leu Asp Asp Ile Leu Lys Ser Phe Ser Asp Val Ser Val Ile Arg Val Ala Ser Gly Tyr Leu Leu Met Leu Ala Tyr Ala Cys Leu Thr Met Leu Arg Trp Asp Cya Ser Lys Ser Gln Gly Ala Val Gly Leu Ala Gly Val Leu Leu Val Ala Leu Ser Val Ala Ala Gly Leu Gly Leu Cys Ser Leu Ile Gly Ile Ser Phe Aan Ala Ala Thr Thr Gln Val Leu Pro Phe Leu Ala Leu Gly Val Gly Val Asp Asp Val Phe Leu Leu Ala His Ala Phe Ser Glu Thr Gly Gln Asn Lys .. , ~, . . . . ... . . .. .. .

Arg Ile Pro Phe Glu Asp Arg Thr Gly Glu Cys Leu Ly~ Arg Thr Gly Ala Ser Val Ala Leu Thr Ser Ile Ser Asn Val Thr Ala Phe Phe Met Ala Ala Leu Ile Pro Ile Pro Ala Leu Arg Ala Phe Ser Leu Gln Ala 415 g20 425 Ala Val Val Val Val Phe Asn Phe Ala Met Val Leu Leu Ile Phe Pro Ala Ile Leu Ser Met Asp Leu Tyr Arg Arg Glu Asp Arg Arg Leu Asp Ile Phe Cye Cy9 Phe Thr Ser Pro Cy8 Val Ser Arg Val Ile Gln Val Glu Pro Gln Ala Tyr Thr Asp Thr His Asp Asn Thr Arg Tyr Ser Pro Pro Pro Pro Tyr Ser Ser His Ser Phe Ala His Glu Thr Gln Ile Thr Met Gln Ser Thr Val Gln Leu Arg Thr Glu Tyr Asp Pro His Thr His Val Tyr Tyr Thr Thr Ala Glu Pro Arg Ser Glu Ile Ser Val Gln Pro Val Thr Val Thr Gl~ Asp Thr Leu Ser Cys Gln Ser Pro Glu Ser Thr Ser Ser Thr Arg Asp Leu Leu Ser Gln Phe Ser Asp Ser Ser Leu His Cys Leu Glu Pro Pro Cys Thr Lys Trp Thr Leu Ser Ser Phe Ala Glu Lys His Tyr Ala Pro Phe Leu Leu Lys Pro Lys Ala Lye Val Val Val Ile Phe Leu Phe Leu Gly Leu Leu Gly Val Ser Leu Tyr Gly Thr Thr Arg Val Arg Asp Gly Leu Asp Leu Thr Asp Ile Val Pro Arg Glu Thr 97/43414 rCT~US97/08433 AGA GAA TAT GAC TTS ATT GCT GCA CAA TTC AAA TAC TTT TCT TTC TAC 2391Arg Glu Tyr A~p Phe Ile Ala Ala Gln Phe Ly9 Tyr Phe Ser Phe Tyr Asn Met Tyr Ile Val Thr Gln Lys Ala A9p Tyr Pro Aqn Ile Gln His Leu Leu Tyr Asp Leu Hi9 Arg Ser Phe Ser A9n Val Lys Tyr Val Met Leu Glu Glu Asn Lys Gln Leu Pro Lys Met Trp Leu His Tyr Phe Arg A~p Trp Leu Gln Gly Leu Gln A9p Ala Phe Asp Ser A9p Trp Glu Thr Gly Lys Ile Met Pro Asn Asn Tyr Lys Asn Gly Ser Asp A~p Gly Val Leu Ala Tyr Lys Leu Leu Val Gln Thr Gly Ser Arg Asp Lys Pro Ile A~p Ile Ser Gln Leu Thr LYB Gln Arg Leu Val Asp Ala Asp Gly Ile Ile Asn Pro Ser Ala Phe Tyr Ile Tyr Leu Thr Ala Trp Val Ser A~n Asp Pro Val Ala Tyr Ala Ala Ser Gln Ala Asn Ile Arg Pro His Arg Pro Glu Trp Val His A9p Ly9 Ala A9p Tyr Met Pro Glu Thr Arg Leu AGA ATC CCG GCA GCA GAG CCC ATC GAG TAT GCC CAG TTC CCT TTC TAC' 2919 Arg Ile Pro Ala Ala Glu Pro Ile Glu Tyr Ala Gln Phe Pro Phe Tyr Leu A~n Gly Leu Arg A6p Thr Ser A~p Phe Val Glu Ala Ile Glu Ly~

Val Arg Thr Ile cy9 Ser Asn Tyr Thr Ser Leu Gly Leu Ser Ser Tyr Pro Asn Gly Tyr Pro Phe Leu Phe Trp Glu Gln Tyr Ile Gly Leu Arg His Trp Leu Leu Leu Phe Ile Ser Val Val Leu Ala Cys Thr Phe Leu e7s 880 985 890 W O 97/43414 rcTrusg7/o8433 Val Cys Ala Val Phe Leu Leu Asn Pro Trp Thr Ala Gly Ile Ile Val Met Val Leu Ala Leu Met Thr Val Glu Leu Phe Gly Met Met Gly Leu Ile Gly Ile Ly~ Leu Ser Ala Val Pro Val Val Ile Leu Ile Ala Ser Val Gly Ile Gly Val Glu Phe Thr Val Hi~ Val Ala Leu Ala Phe Leu Thr Ala Ile Ser A~p Ly~ A~n Arg Arg Ala Val Leu Ala Leu Glu Hi~

Met Phe Ala Pro Val Leu Asp Gly Ala Val Ser Thr Leu Leu Gly Val Leu Met Leu Ala Gly Ser Glu Phe Asp Phe Ile Val Arg Tyr Phe Phe Ala Val Leu Ala Ile Leu Thr Ile Leu Gly Val Leu A~n Gly Leu Val Leu Leu Pro Val Leu Leu Ser Phe Phe Gly Pro Tyr Pro Glu Val Ser Pro Ala Asn Gly Leu Asn Arg Leu Pro Thr Pro Ser Pro Glu Pro Pro Pro Ser Val Val Arg Phe Ala Met Pro Pro Gly His Thr His Ser Gly Ser A~p Ser Ser A~p Ser Glu Tyr Ser Ser Gln Thr Thr Val Ser Gly Leu Ser Glu Glu Leu Arg His Tyr Glu Ala Gln Gln Gly Ala Gly Gly Pro Ala Hi~ Gln Val Ile Val Glu Ala Thr Glu A~n Pro Val Phe Ala His Ser Thr Val Val Hi~ Pro Glu Ser Arg Hi~ Hi~ Pro Pro Ser A~n Pro Ly~ Gln Gln Pro His Leu A~p Ser Gly Ser Leu Pro Pro Gly Arg .. . . .. . . , .. _ W O 97/43414 PCTrUS97/08433 Gln Gly Gln Gln Pro Arg Arg Asp Pro Pro Arg Lys Gly Leu Trp Pro Pro Leu Tyr Arg Pro Arg Arg Asp Ala Phe Glu Ile Ser Thr Glu Gly His Ser Gly Pro Ser Asn Arg Ala Arg Trp Gly Pro Arg Gly Ala Arg 11~0 1185 1190 Ser His Asn Pro Arg Asn Pro Thr Ser Thr Ala Met Gly Ser Ser Val Pro Gly Tyr Cys Gln Pro Ile Thr Thr Val Thr Ala Ser Ala Ser Val Thr Val Ala Val His Pro Pro Pro Val Pro Gly Pro Gly Arg A~n Pro Arg Gly Gly Leu Cys Pro Gly Tyr Pro Glu Thr Asp His Gly Leu Phe Glu Asp Pro His Val Pro Phe His Val Arg Cys Glu Arg Arg Asp Ser Lys Val Glu Val Ile Glu Leu Gln Asp Val Glu Cys Glu Glu Arg Pro 1275 1280 12~5 1290 Arg Gly Ser Ser Ser Asn AGGAAGGATG TAAAGTGGTA TGATCTGGGC ~ CCACT CCTGCCCCAG AGTGTGGAGG 4599 CCACAGTGGG GCL~CC~ A~ ~CAT TGGGCTCCGT GCCACAACCA AGCTTCATTA 4659 CTATGCAAAT ATTGCTTATG TAATAGGATT ATTTTGTAAA G~ TAAAATATTT 4779 TAAATTTGCA TATCACAACC u.~G~IAGT ATGAAATGTT ACTGTTAACT TTCAAACACG 4839 CTATGCGTGA TAAI-~ - GTTTAATGAG CAGATATGAA GAAAGCACGT TAA5CC~ 4899 GGC~ A G~Y~IC~LG TGTGCGGTCC I~L~---GG CTGTGCGTGT GAACACGTGT 4959 GTGAGTTCAC CATGTACTGT ACTGTGATTT ~ ACAC 5019 ~ ~-AAC CTGTAGTAGG CTCTGACCTA TTCAGGCTGG AAAGCGTCAG GATATCTTTT 5079 ., . .... ... __._. .

AAAGCTAAAC TClC~C~lG TCTACGGGCA TCTGTTATGA TCATTGGCTG CCATCCAGGA Sl99 CCCCAATTTG TGCTTCAGGG GGATAATCTC L'l l~ CGG ATCATTGTGA TG3ATGCTGG 5259 MCCTCAGGG TATGGAGCTC ACATCAGTTC ATCATGGTGG GTGTTAGAGA AllC~lGAC 5319 CATGGTGCCC ~ GAC C MCACACAC AAGACCCCTC CCCCAACACC CCCA M TTCA 5439 AGAGTGGATG r~GCC~ C ACAGGTAGAA AAACCTATTT AGTTAATTCT TTCTTGGCCC 5499 ACA~CCC AGAAATGATG TTTTGAGTCC CTATAGTTTA AA~CC--~- CTTAAATGGA 5559 GCAGCTGGTT TGAG~l~L AAA~--~l-- GCAL~ TAAAATTAAG TGGTGAGCAT 5619 ACCAGTGTTT AGGGTACGTG CTTCCTAAGT MATCCAAAC Ar'l~---CCA TCCTCCCCGT 5739 ATGTAGGCAG GGGCAGGTCT CTCAACCAGG CATATTTTTA MA~ -l CTGTAcTGGT 5859 ~ - TGCTCTGAGG I~aGG~CC CTCATCTCGT AACCAGAGAC CAGCACATGT 5919 AGAAGTCAGA GGAAAGGGCG GG~CC~GC AGGGCTGAAG CCTAAGCTAC TGTGAGGTGC 6039 TCACAAGTGG CAG~CGI~ MTCC--~-- AAATTACGTG GG MTCTTAA CAGAAAGT M 6099 AAGATGCTGA TTGGGAGCCG ~~ GGCTG CTGGATGNGT ~ ~C 6219 ~C~LGC~ ~I~LG~ GTCTGNTGGG GACC-~GCC ACCCCCCTGC TG~ G 6279 CL~CA CCCACATGGT CTGCCATCCT AACACCCAGC T~G~L~AGA AAAC~C~G 6339 CGTGGAGGAG GGATGATGCA GAATTCTGAA GTCGACTTCC CTCTGGCTCC 'l~GC~GCCC 6399 ~ CC~ CCTGAGCCCA G~C~ G CGCCGGAGGC TGCGCGqCCC CTGATTTCTG 6459 CATGGTGTAG AA~..L~CC AATAGTCACA TTGGCAAAGG GAGAACTGGG GTGGGC~GGG 6519 GGTGGGGCTG GCAGGGAATT AGCATTTCTC l-~L~ L L L AATAGTTAA 6568 . ", .. ~ . . .. ~

CA 02266408 l998-ll-l2 WO97/43414 PCT~US97/08433 Se.~u.,.lcc ID NO: 58: Se-~u ~ ~5 of Exons lb and la SEQ ID N0:58:
a~ CcGcGAAcTGGATGTGGGcAGcGGcGGccAGcAgAGAccTcGGGAccccgcGcAA
~r~ ;;GcGcTTGAccTAcAcccGTcGccGccGGTcGTcTcTGgAGcccTGGGGcGcGTT
N N
o o t t I ~
TGTGGcAATGGAAGGcGcAg&GTcTGA~cccGGcAGcGGccGcGGccGcAGcGGcAGc 61 : ~ . I i 1 120 AcAccGTTAc~:LlccGcGTc:ccAGAcTGAGGGGccGLcGccGGcGccGGcGTcGccGTcG
AGCG"CCGCC~ GAGcAGcAGcAGcGGCTGGlC~G~rA~rCGGAGCCCGAGCCcr~c lZl I . ' ~ ' I 1 180 TCGCGGGCGGCACA-.;.CG1'~ L~G)CGCCGACCAGACAGTTGGCCTC&GGCTCGGGCTCG
AGCgAGCGGCCAGCAGCGTCcTCGCAAGCCGAGCGCCCAGGCGCGCC~r.r-~r~CGr~;C
181 1 , I l l 1 240 ~CGcTCGCCG~,lC~,LCGr~ r,rGTTCGGCTCGCGGGTCCGCGCGGTCCTCGGGCGTCG
AGCGGCAGCAGCGCGCCGGGCCGC,Crr-GGAAGCCT~ ,lCCCCGCGGCGGCGGCGGCGGC
241 1 1 1 1 l 1 300 TCGCCGTCGTCGCGCGGCCCGGCGGGCC~CGGAGGrAGGGGCGCCGCCGCCGCCGCCG ~ .
GGCGGCAAChTGGCCTCGGCTGGTAAC~;CCGCCGAGCr~r~1GACCGCGGCGGrG :;rGGC ~b 301 r I I _ I I 1 360 CCGCCcJLlGlAccGGAGrc~:~rr~TTGcGGcGGcTcGGGGTCcTGGCGCCGCCGCCGCCG
ACCGGCTGTATCGGTGCCCCGGr-~rGGCCGGCTGGAGGrGGG~ÇGCGr~r~CGr-~CGGGG
361 ~ 420 TCGrCG~t~PTPr-CCACGGGGCCCTgCCGGCCGACCTCCGCCCTCCGCGTqTGcCTGCCCC
GGGCTGCGCCGTGCTGCCGCGCCGGACCGGGACTATCTGCACCGGCCCAGCTACTGCGAC
421 1 1 1 ! - : i 480 CCCGACGCGGCACGACGGCGCGGCCTGGCCCTGATAG~CGTGGCCGGGTCGATGACGCTG
e~ ;~
GCCGCCTTCGCTCTGGAGCAgATTTCCAASbTGCATTTCAgAL~ C~;~C~;CACTTTC
48~ I I 1 540 CGGC ~ AAGCGA~A~J~lcT ~ GGTTCCACGTA~AGTcTGAGAGAGGAGGGTGAAAG
~ l c e., T~;~LCC-;lCCTCTAACl~;LllGGGATCGCCCCCgCCaCACACAAAcACAcAcA~lCl~L1 541 1 1 1 l l ; 600 A~-~ GG~GGAGATTGAGAAACCCTAGCGGGGr-CGGtGTGTG~ lGAGAGAA
CCTCTCTCTCTCACACaCACACACACATgCtCaCgCtGCTGCCTCcACG~AAAGCAgCAG
601 1 ~ 660 GGAGAGAGAGA~TG~GLGTGT~l~TGlAcGaGtGcGaCGACGGAGGTGCTTTTCGTcGTC

CA 02266408 l998-ll-l2 ~arAA~TGGGGATTGAAAAATTcAAAcccTcccTcTGGsccTGGGAGGAAAGGGcTGTc 661 ~ 720 l~L~llACCCCTAA~ LAA~ lGGGAGGGAGAccAGGAcccTccTTTcc~r-~r~G
TGAGGTCCGCAGGCi&GTGGAG~ G l ~ G l~GC~ t, L~, ~TACACACGCC
721 ~ ; 780 AcTccAGGcGTcccccAcc~ccAcAcAcAc~cAcGcArAr~r~c~cAc~TAlG~ cGG
TGGTGTGCCTTTTCCGGAGCPCTGG~ AGCCGTCr~rG:;cGGAccAccTr~Gr~G
781 ~ 840 r~ r~ccAcAcGG~ AAGGccTcGTGAcc~lLCGGCAGGTGCCGCCTGGTGGA~L~XC
o t cGGccGcGGcALl~ ccccGTGccccc~GcccTGAA~ c~lc~ rrrr-r~T
841 ! ~ I l 900 GCCGGCGCCGTG~rAGGACGGGGr~rG5C;GG~CGGGACTTGAAGAAGGAGGACGCGGG&A
GCCCCTATTTGCAGCCTAAA~ G~ACGG~TGCC~r~ Ll~ACATCTTGGAAG~G
901 ~ t 1 960 CCGCG-a-~A~ACGTCGGATTTr-~rr~Pr~TGCCGACG~L~AAGAATTG~AGa~C~l L C'' fi~rCGG~r-TGC~ rP,G~;CGGAGAGAGr-~rGGCGr~t;GG~?~r-CCGAA~GGTGGT
961 1 ~ 1020 CTCGCCTCACLlCL~.L~;GC~ CCC~;CC~CCCClCGGCTTTAT~rT~r~rr~, lc~L~ GcAeccA~~ L~l-LGAGcATGA~Al--~clGcTccAT~ ~A~ATTATq!N
1021 ~ 1 1080 I~r-G:~ ~ AAc~LLGc~cAAAAcAAcTcGTAc m AGAGAcGAGGTA2~ -L~AAT~
TrGG~A~AAr-P'rATCCL'CCCA~ ;CAG~ GAGCCGCCTCTCcTTAGGGCCTGGT
1081 ' ~ 1 1140 AgC-~T~ ;LP,TAGG&GGGTCAAAAgGTCCAAA~CTCGGCGGAr~ g2~TCCCGGACC~
CC~;:;GGG~rr~ ~ AGTTGTaAACAAATTGCCACATTAAATTcGCGGTGCGAGTcTGCGGAG
1141 ~ 1200 GCCCCCTC-L~ L-AAt'D.~ lAACGGTGTAATTTAAgCGCCACGCTCAgAC~GCCFT~ $.
CTGCCGGG$TcAL~ L,lr~TACGAGGCTCGcTGAAA L~L,'~,GAATCCAGG~AAGGC~iAG
1201 ~ 260 GACGGCCCAAgT~ACACA~lA-G~CCGAGC5~ACTTTAC2.~CCTTAG~lCC~lLL_CGCTC
CACCCAGACtGGGGCCCGCCG:iGGTCGCGGCCAGCGCCGGGGAAATGCCGCGCCGGGr-~
1261 ~ 1320 GTGGGTCTGCCrt-CGGGCGGCCCCAGCGCCGGTCGCGGCCC~ lACG&CGCGGCCr'~LI:
CAGCATGCGCCGGCCTGAGCCLTLCCCTTTGCACTCGGLlG'Ll'LllACGT~TAACCAG~
1321 ~ 1380 GTCGTACGCGG.CGGACTCGGGAAGGG~hCGTGAGCCGAC~AAAAATGCAAATTGGTCT
AAGGAAGGGAGAGGAGGr-~A~t;ATCCATGm~GGCTGCCLl--lcCGATt-~r~ TATTGTC/ '~
1381 ~ 1440 ~~L ~liCc~:lCTCl~ CC_LLL~ GGTACACCGACGGGAGAAGGCTAi~lG~ll~TA~CAG
GTA~GTTGCAGCTGGCTGCCCCACTTCC.AATTCAGCTCACAC~ CCCCAC~5~
1441 - ' ~ ; 1 1500 CATTcAAcGTcGp~ccGAcGGGGTr~AAG--r~TTA~GTcGAc~LL.LcGG~G~GG~i;GTGcGAT

CA 02266408 l998-ll-l2 WO97/43414 PCTrUS97/08433 N a o m t }~
~c A~lrGcGTcGG~;AGTGAAcTccGGcGGccGcGcTcAccAcGTGGATccccAcTTAcT
1501 - : I I I 1- 1 1560 ACC$TTACGCAGCCCTCACTTGAGGCCGCCGGCGCGAGTGGTGCACCTAGGGGTGAATGA
ACCAlL~-lCG7GCGGGGGTCCAGTTGGGGGAACCCGCAATAlG~lGllCCAAAGAGCGCTC
lS61 1 1 ~ : 1 1620 T6GTl~r-Ar7CcGccccCAGGTcAAcccccTTGGGcGTTATAcAACAAGGTTTCTCGCGAG
GCCCCTAGCGCCCGTCCCCGAGGGTGATG~-ArAr-AGcAGGAcTGGTTTGcTGGcTccTGA
1621 1 1 i ~l -I 1680 CGÇi~ TCGCG~;GCAGGGGCTCCd~CTAC~,L~L~;L~ LC~lGA ~A~Cr-ArCrAGr,~CT
. ~ ~c~5 AC ~TGGGCTCCATCGCTGGGATTACGCAGCCCCTCCL~ CAGCTCTGG ~- r 1681 : ~ 32 TGGAACCCGAGGTAGCGACCCTAATGCGTCGGGGAGG~7AA~TCGAGACCC c~ ~A

CA 02266408 l998-ll-l2 Seyur~rclD NO:59: S~u~,c~ofexon2a.

SEQ I~ NO:59:
r~
B
m I
GGALL'~ CP CG'rGACCCTGACA~ L L l ~;LGCTTAT~7GCr~CGerA~CrA ~r'rr~GCCG'~
t I I _ I 1 6 0 CCTAGG~NAGTGCACTGGGACTGTCAAGGACGAAT~CCGCGCC~ GGTGGGTGCGGCT
a G S ? H V T L T V P A Y G A A D H P R R
b D P ? T ~ P * Q F L L H A R Q T T H A E
c I ? S R D P D S S C L W R G R P P T P R -GGGCCATGGAACTGCTT~TAr,~A~'~r-GCTTGTAATTGTGAGTCCGCGCTGCALL'CCCC
61 1 . i ~ 120 CCCG~lACCTTr-ACr,~'rTA~ L~L':C~-a~r~T ~ CACTCAGGCGCGACGTGAGGCG
G P W N C L I E T G L ~ L ~ V R A A ~ R
- G H G T A ~ ~ K Q A C N C E S A .L H S A
c A M E L L N R N R L V I V S P R C T P P -R
i B
n s d s I H
I I
,- r~-'r~ r-cT~ccGGcGGccc~GcGcGccGGG~lLl~LAcALlli~c~ cLyL~ LA~AG
/121 ~ I 180 G~llrcGAAGGccGccGGGTcGcGcGGcr-rr~aAAATGTGAAAGGc~Gr~AA~TTTc a R X ~ P A A Q R A G V F T L s V P ~ V R
b E S F R R P S A P G F L H F P F L L t R
c X A S G G P A R R G F Y T F R S F C K D -Arr-r-~çG~r~G~Gr~ r-~r-2~r-~r-~c~r~AGr-~r-~G~aAr-p~cr-~r2~GGGG~G
181 1 1 ~ 240 TGCL~CLlCL;lCCTCTTCTT--l~ lLlllLGCCTCCTCTTL:llLl~G~ c::C
a T ~ E E E K K K X K T E E K K R T T G E
b R R R R R R R R R K R R R R K R R Q G R
G G G G E E E E E ~ G G ~ E R D D R G D -Ar~Ar-~r-Pr~CGCAGCG~CAAGGc~AGGGGr-~ACr~rGGA~GAcTGGr.~r~r.~rGr~
241 ~ 1 300 LlGGGcG~cGLIl~Ll~:c~.L-lcccc~ clGL~ GAccL~LL~lGccT

CA 02266408 l998-ll-l2 T K R P A A T R Q G G D ~: G R L G E D G
Q R D P Q R Q G K G E T R E D w E ~; T E
X E T R S D R A R G R R G K T G R R R R -~ Q~ aA ~C ~ f ~
GG~G~~GAGG~cGAGr-~A~çr~r~!~r~:;ccAGGGAAu~AATT~lrr-lrGAAATcc~AGcc~t-G
301 ~ 1 360 CCTCGCL~ GC-l-C-'Ll~'CrCCGr-TCC~ AACTACACTTTAG~l-lCGGGC
G A F D E E R G A R E X K L M ~ N P S P
E R R T R X G G P G K g N ~ C E I Q A R -S G G R G R G, G Q G ~ K I D V K S ~ P A -E

a _,~ o~

ÇG~TCCGAGCAGGGGTTGA_GGC~CGGCTAl~ L~AGTGcAGccAGcGcGGcNGccGccGA
361 ~ - I I . 1 ~20 ~cr ~ ~ CT~ C CAAC - ~CGG C~r~ rr ~NTC~CGTCGGTCG CG CCGNCGGCGGCT
~tc~
R S E Q G L T A G Y G ? c S Q R G ? R R
A P S R G t ~ p A M v S A A S A A A A D
L R A G V D G R L W ? V Q P A R ? P P T --CGCCACCTCGI:l.;LL-~CGCGccNTG~ CGGGcGGCGCGGGGACNCTGGGACNCGGGAC
421 ~ ~ I I I 1 480.
~:C6~-LGGAGrGC~r-~GCGCGr-N~r~ Gr-~r,CCCGCCGCGCCCCTGNGA~C'-~,NGCCCTG
R ~ ~ A S R A ? L ~ G R R G D ? G ~ R D
A T s P L A P c S S G G A G T L G ? G T
P P ~ L S R ? A P R A A R G ? W D ? G R -G~CCr~C~CGGCGGACGGANGAGCNAGCCCCGATCGCCGGGCNGGAGGGGCGGGCCNCCC
481 ~ 40 CGGGGNGNGCCGCCTGCCTNCTC~N1CGGG&CTAGCGGCCCGNC~LCCCCGCCCeGNGCG
A P ? G G R ? S ? P R S P G ? R G G P R
P ? ? A D G ? A S P D R R A G G A G ? A
P ? R R T ? E ? A P I A G ? E G R A ? R -B
m I

GCCNGGGCCGTGGATCCGGGTGGGCTGCGCCGCCTGGGCTCNGGANCNL~G~CGCTC
541 ~ . 600 CGG~CCCGGCACCTAGGCCCACCCGACGCGGCGGACCCGAGNCCTNGNGACCAGNGCGAG
A ? A V D P G G L R R L G S G ? L V ? ~ -P G P W I R V G C A A ~ A ? ? ? W S R S
? G ~ G S G W A A P P G L ? ? ? G ? A P -S
m a CTCCNCTCTCNCTCGCACNCCCGGG~CCCCGCCCCC~TGCNATCCCCTC~TGGCNGGGA
601 ~ 1 660 GAGGNG~GAGNG~GCGTGNGGGCCCGGGGGCGGGGGNTACGNTAGGGGAG~ACCGNCCCT

CA 02266408 l998-ll-l2 W O 97143414 rcTrusg7/o8433 SEQ ID NO: 60: Amino acid sequence of human NBCCS (PTC).
(2) INFORMATION FOR SEQ ID N0~60:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 1296 amino acids ~D) TYP-~: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SFQ ID NO:60:
Met Phe Asn Pro Gln Leu Met Ile Gln Thr Pro Lys Glu Glu Gly Ala Asn Val Leu Thr Thr Glu Ala Leu Leu Gln His Leu Asp Ser Ala Leu Gln Ala Ser Arg Val His Val Tyr Met Tyr Asn Arg Gln Trp Lys Leu Glu His Leu Cys Tyr Lys Ser Gly Glu Leu Ile Thr Glu Thr Gly Tyr Met Asp Gln Ile Ile Glu Tyr Leu Tyr Pro Cys Leu Ile Ile Thr Pro Leu Aap Cys Phe Trp Glu Gly Ala Lys Leu Gln Ser Gly Thr ~la Tyr Leu Leu Gly Lys Pro Pro Leu Arg Trp Thr Asn Phe Asp Pro Leu Glu Phe Leu Glu Glu Leu Lys Lys Ile Asn Tyr Gln Val Asp Ser Trp Glu Glu Met Leu Asn Lys Ala Glu Val Gly His Gly Tyr Met Asp Arg Pro Cys Leu Asn Pro Ala Asp Pro Asp Cys Pro Ala Thr Ala Pro Asn Lys Asn Ser Thr Lys Pro Leu Asp Met Ala Leu Val Leu Asn Gly Gly Cys 165 170 ~7S
His Gly Leu Ser Arg Lys Tyr Met His Trp Gln Glu Glu Leu Ile Val Gly Gly Thr Val Lys Asn Ser Thr Gly Lys Leu Val Ser Ala His Ala Leu Gln Thr Met Phe Gln Leu Met Thr Pro Lys Gln Met Tyr Glu His Phe Lys Gly Tyr Glu Tyr Val Ser His Ile Asn Trp Asn Glu A~p Lys Ala Ala Ala Ile Leu Glu Ala Trp Gln Arg Thr Tyr Val Glu Val Val Hi~ Gln Ser Val Ala Gln Asn Ser Thr Gln Ly~ Val Leu Ser Phe Thr Thr Thr Thr Leu Asp Asp Ile Leu Lys Ser Phe Ser Asp Val Ser Val Ile Arg Val Ala Ser Gly Tyr Leu Leu Met Leu Ala Tyr Ala Cys Leu Thr Met Leu Arg Trp Asp Cys Ser Lys Ser Gln Gly Ala Val Gly Leu ~la Gly Val Leu Leu Val Ala Leu Ser Val Ala Ala Gly Leu Gly Leu ~ys Ser Leu Ile Gly Ile Ser Phe Asn Ala Ala Thr Thr Gln Val Leu Pro Phe Leu Ala Leu Gly Val Gly Val Asp Asp Val Phe Leu Leu Ala His Ala Phe Ser Glu Thr Gly Gln Asn Lys Arg Ile Pro Phe Glu Asp 370 3~5 380 Arg Thr Gly Glu Cys Leu Ly~ Arg Thr Gly Ala Ser Val Ala Leu Thr ~er Ile Ser Asn Val Thr Ala Phe Phe Met Ala Ala Leu Ile Pro Ile ~ro Ala Leu Arg Ala Phe Ser Leu Gln Ala Ala Val Val Val Val Phe Asn Phe Ala Met Val Leu Leu Ile Phe Pro Ala Ile Leu Ser Met Asp Leu Tyr Arg Arg Glu Asp Arg Arg Leu Asp Ile Phe Cys Cys Phe Thr Ser Pro Cys Val Ser Arg Val Ile Gln Val Glu Pro Gln Ala Tyr Thr ~sp Thr His Asp Asn Thr Arg Tyr Ser Pro Pro Pro Pro Tyr Ser Ser ~is Ser Phe Ala His Glu Thr Gln Ile Thr Met Gln Ser Thr Val Gln Leu Arg Thr Glu Tyr Asp Pro Hi9 Thr His Val Tyr Tyr Thr Thr Ala Glu Pro Arg Ser Glu Ile Ser Val Gln Pro Val Thr Val Thr Gln Asp Thr Leu Ser Cy9 Gln Ser Pro Glu Ser Thr Ser Ser Thr Arg Asp Leu ~eu Ser Gln Phe Ser Asp Ser Ser Leu Hi s Cy8 Leu Glu Pro Pro Cys ~hr Lys Trp Thr Leu Ser Ser Phe Ala Glu LYB His Tyr Ala Pro Phe 580 5BS sgo Leu Leu Lys Pro LYB Ala Lys Val Val Val Ile Phe Leu Phe Leu Gly Leu Leu Gly Val Ser Leu Tyr Gly Thr Thr Arg Val Arg Asp Gly Leu W O 97/43414 rcTrusg7/o8433 Asp Leu Thr Asp Ile Val Pro Arg Glu Thr Arg Glu Tyr Asp Phe Ile ~la Ala Gln Phe Lys Tyr Phe Ser Phe Tyr A9n Met Tyr Ile Val Thr ~ln Lys Ala Asp Tyr Pro Asn Ile Gln Hi9 Leu Leu Tyr A3p Leu His Ar~ Ser Phe Ser Asn Val Ly9 Tyr Val Met Leu Glu Glu Asn Lys Gln Leu Pro Ly9 Met Trp Leu His Tyr Phe Arg Asp Trp Leu Gln Gly Leu Gln Asp Ala Phe Asp Ser Asp Trp Glu Thr Gly Lys Ile Met Pro Asn ~sn Tyr Lys Asn Gly Ser A9p Asp Gly Val Leu Ala Tyr Lys Leu Leu ~al Gln Thr Gly Ser Arg Asp Lys Pro Ile Asp Ile Ser Gln Leu Thr Lys Gln Arg Leu Val Asp Ala Asp Gly Ile Ile Asn Pro Ser Ala Phe Tyr Ile Tyr Leu Thr Ala Trp Val Ser Asn A9p Pro Val Ala Tyr Ala Ala Ser Gln Ala Asn Ile Arg Pro His Arg Pro Glu Trp Val His Asp ~ys Ala Asp Tyr Mee Pro Glu Thr Arg Leu Arg Ile Pro Ala Ala alu ~ro Ile Glu Tyr Ala Gln Phe Pro Phe Tyr Leu Asn Gly Leu Arg Asp Thr Ser Asp Phe Val Glu Ala Ile Glu Ly9 Val Arg Thr Ile Cys Ser Asn Tyr Thr Ser Leu Gly Leu Ser Ser Tyr Pro Asn Gly Tyr Pro Phe Leu Phe Trp Glu Gln Tyr Ile Gly Leu Arg His Trp Leu Leu Leu Phe 865 870 875 8~0 ~le Ser Val Val Leu Ala Cys Thr Phe Leu Val Cys Ala Val Phe Leu ~eu Asn Pro Trp Thr Ala Gly Ile Ile Val Met Val Leu Ala Leu Met Thr Val Glu Leu Phe Gly Met Met Gly Leu Ile Gly Ile Lys Leu Ser Ala Val Pro Val Val Ile Leu Ile Ala Ser Val Gly Ile Gly Val Glu Phe Thr Val His Val Ala Leu Ala Phe Leu Thr Ala Ile Ser Asp Lys Asn Arg Arg Ala Val Leu Ala Leu Glu His Met Phe Ala Pro Val Leu ~sp Gly Ala Val Ser Thr Leu Leu Gly Val Leu Met Leu Ala Gly Ser 980 985 ggo Glu Phe Asp Phe Ile Val Arg Tyr Phe Phe Ala Val Leu Ala Ile Leu Thr Ile Leu Gly Val Leu Asn Gly Leu Val Leu Leu Pro Val Leu Leu Ser Phe Phe Gly Pro Tyr Pro Glu Val Ser Pro Ala A9n Gly Leu Asn ~rg Leu Pro Thr Pro Ser Pro Glu Pro Pro Pro Ser Val Val Arg Phe ~la Met Pro Pro Gly His Thr Hi9 Ser Gly Ser Asp Ser Ser Asp Ser Glu Tyr Ser Ser Gln Thr Thr Val Ser Gly Leu Ser Glu Glu Leu Arg His Tyr Glu Ala Gln Gln Gly Ala Gly Gly Pro Ala Hig Gln Val Ile Val Glu Ala Thr Glu Asn Pro Val Phe Ala His Ser Thr Val Val His ~ro Glu Ser Arg His His Pro Pro Ser Asn Pro Lys Gln Gln Pro His ~eu Asp Ser Gly Ser Leu Pro Pro Gly Arg Gln Gly Gln Gln Pro Arg Arg Asp Pro Pro Arg Lys Gly Leu Trp Pro Pro Leu Tyr Arg Pro Arg Arg Asp Ala Phe Glu Ile Ser Thr Glu Gly His Ser Gly Pro Ser Asn Arg Ala Arg Trp Gly Pro Arg Gly Ala Arg Ser Hi~ Asn Pro Arg Asn ~ro Thr Ser Thr Ala Met Gly Ser Ser Val Pro Gly Tyr Cys Gln Pro ~le Thr Thr Val Thr Ala Ser Ala Ser Val Thr Val Ala Val His Pro Pro Pro Val Pro Gly Pro Gly Arg Asn Pro Arg Gly Gly Leu Cys Pro Gly Tyr Pro Glu Thr Asp His Gly Leu Phe Glu Asp Pro His Val Pro Phe His Val Ar~ Cys Glu Arg Arg Asp Ser Lys Val Glu Val Ile Glu Leu Gln A3p Val Glu Cy~ Glu Glu Arg Pro Arg Gly Ser Ser Ser Asn ~285 1290 1295

Claims

WHAT IS CLAIMED IS:

1. An isolated human nucleic acid encoding a nevoid basal cell carcinoma syndrome (NBCCS) (PTC) protein, wherein said nucleic acid specifically hybridizes, under stringent conditions, to a second nucleic acid consisting of a nucleic acid sequence selected from the group consisting of SEQ ID
NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, in the presence of a human genomic library under stringent conditions.

2. The isolated human nucleic acid of claim 1, wherein said isolated nucleic acid is at least 40 nucleotides in length.

3. The nucleic acid of claim 1, wherein said isolated nucleic acid is amplified from a genomic library using any of the primer pairs provided in Table 2.

4. The nucleic acid of claim 1, wherein said isolated nucleic acid is identified by specific hybridization with the nucleic acids of claim 3 under stringent conditions.

5. The nucleic acid of claim l, wherein said nucleic acid is a nucleic acid selected from the group consisting of SEQ ID NO: I, SEQ ID NO: 58, and SEQ. ID NO: 59.

6. The nucleic acid of claim I, wherein said nucleic acid includes one or more mutations compared to a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.

7. The nucleic acid of claim 6, wherein the mutation or mutations is selected from the group consisting of Exon 5 693 insC, Exon 17 2988del8bp, Exon 17 3014 insA, Exon 21 3538 delG, Exon 22 G4302T, Exon 12 1711insC, Exon 12 1639insA, Exon 16 2707delC, and Intron 17 3157-2A~G.

8. The nucleic acid of claim 6, wherein the mutation is a nonsense mutation.

9. The nucleic acid of claim 6, wherein the mutation is a frameshift mutation.

10. The nucleic acid of claim 9, wherein the mutation is selected from the group consisting of 244delCT, 271insA, 464insAC, 693insC, 804del37, 877delG, 929delC, 1370del76, 1393insTGCC, 1444del6, 1497dup8, 1639insA, 1711insC, 2183delTC, 2320insA, 2392delA, 2574delA, 2583delC, 2596complex, 2707delC, 2748insC, 2749dup7, 2988del8bp, 3014insA, 3352delAT, and 3538delG.

11. The nucleic acid of claim 6, wherein the mutation is a missense mutation.

12. The nucleic acid of claim 11, wherein the mutation is selected from the group consisting of C391T, G1148A, G1368A, G1525T, C2050T, C2050T, C2068T, C3015A, G3193C, and G4302T.

13. The nucleic acid of claim 6, wherein the mutation alters mRNA splicing.

14. The nucleic acid of claim 13, wherein the mutation is selected from the group consisting of A1055-2C, 3157-2A~G, and 1493-8ins21.

15. The nucleic acid of claim 1, wherein the nucleic acid further comprises a recombinant vector.

16. An isolated human nevoid basal cell carcinoma syndrome (NBCCS) (PTC) nucleic acid, wherein said nucleic acid encodes a polypeptide subsequence of at least 10 contiguous amino acid residues of a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID
NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, or conservative substitutions of said polypeptide subsequence.

17. The nucleic acid of claim 16, wherein said polypeptide subsequence is at least 50 amino acid residues in length.

18. The nucleic acid of claim 17, wherein said polypeptide is the polypeptide sequence encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.

19. The nucleic acid of claim 16, wherein the nucleic acid further comprises a recombinant vector.

20. An isolated nucleic acid encoding a human nevoid basal cell carcinoma (NBCCS) (PTC) polypeptide comprising at least 10 contiguous amino acids from a polypeptide sequence encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, wherein:
said polypeptide, when presented as an antigen, elicits the production of an antibody which specifically binds to a polypeptide sequence encoded by a nucleicacid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59; and said polypeptide does not bind to antisera raised against a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID
NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59 which has been fully immunosorbed with a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.

21. The nucleic acid of claim 20, wherein said nucleic acid hybridizes to a clone of the human PTC gene present in a human genomic library under stringent conditions.

22. The nucleic acid of claim 23, wherein the nucleic acid further comprises a recombinant vector.

24. An isolated NBCCS (PTC) polypeptide, said polypeptide comprising a subsequence of at least 10 contiguous amino acids of a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, or conservative substitutions of said polypeptide subsequence.

25. The polypeptide of claim 24, wherein said polypeptide comprises a subsequence of at least 50 contiguous amino acids encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59, or conservative substitutions of said polypeptide subsequence.

26. The polypeptide of claim 24, wherein said polypeptide is a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.

27. An isolated NBCCS (PTC) polypeptide, said polypeptide comprising at least 10 contiguous amino acids from a polypeptide sequence encoded by a nucleic acid selected from the group consisting of SEQ ID NO:1, SEQ ID NO: 58, and SEQ. ID NO: 59, wherein:
said polypeptide, when presented as an antigen, elicits the production of an antibody which specifically binds to a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ.
ID NO: 59; and said polypeptide does not bind to antisera raised against a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID
NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59 which has been fully immunosorbed with a polypeptide encoded by a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.

28. The isolated polypeptide of claim 27, wherein said polypeptide is encoded by a nucleic acid selected from the group consisting of SEQ
ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.

29. An antibody which specifically binds a polypeptide comprising at least 10 contiguous amino acids from a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59 wherein:
said polypeptide, when presented as an antigen, elicits the production of an antibody which specifically binds to a polypeptide encoded by a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ.
ID NO: 59; and said polypeptide does not bind to antisera raised against a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID
NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59 which has been fully immunosorbed with a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 58, and SEQ. ID NO: 59.

30. The antibody of claim 29, wherein said antibody is monoclonal.

31. A recombinant cell expressing the antibody of claim 29.

32. A method of detecting a predisposition to nevoid basal cell carcinoma syndrome (NBCCS) or to a basal cell carcinoma, said method comprising the steps of i) providing a biological sample of said organism; and ii) detecting a human NBCCS (PTC) gene or gene product in said sample.

33. The method of claim 32, wherein said detecting comprises detecting the presence or absence of a NBCCS nucleic acid.

34. The method of claim 33, wherein said detecting comprises a hybridization assay.

35. The method of claim 33, wherein said detecting comprises detecting an abnormal NBCCS nucleic acid.

36. The method of claim 35, wherein the abnormal NBCCS
nucleic acid includes one or more mutations compared to a nucleic acid selected from the group consisting of SEQ ID NO:1, SEQ ID NO: 58, and SEQ. ID NO:
59.

37. The method of claim 36, wherein the mutation is selected from the group consisting of a missense mutation, a nonsense mutation, a frameshift mutation, and a splice site mutation.

38. The method of claim 32, wherein said detecting comprises sequencing said human NBCCS gene or gene product.

39. The method of claim 32, wherein said detecting comprises detecting an NBCCS polypeptide.

40. The method of claim 39, wherein said detecting comprises an immunoassay.

41. A method of treating nevoid basal cell carcinoma syndrome (NBCCS) in a mammal, said method comprising transfecting cells of said mammal with vector expressing a nevoid basal cell carcinoma syndrome (NBCCS) polypeptide.

42. A method of mitigating a symptom of nevoid basal cell carcinoma syndrome or a basal cell carcinoma in an organism, said method comprising administering to said organism a therapeutically effective dose of a composition comprising a NBCCS (PTC) polypeptide and a pharmacological excipient.

43. A pharmacological composition comprising a pharmaceutically acceptable carrier and a molecule selected from the group consisting of consisting of a vector encoding an NBCCS polypeptide or subsequence thereof, an NBCCS polypeptide or subsequence thereof, and an anti-NBCCS antibody.

44. A kit for the detection of a NBCCS (PCT) gene or polypeptide, said kit comprising a container containing a molecule selected from the group consisting of an NBCCS polypeptide or subsequence thereof, and an anti-NBCCS antibody.