CA2265519A1 - Dna-constructs comprising intergenic ribosomal dna and methods to produce proteins using these dna-constructs - Google Patents

Abstract

Provided are a DNA-construct, comprising the following fragments: ribosomal DNA, promoter region and heterologous coding region, a method for the production of proteins and for enhancing copy number or expression using these DNA-constructs, as well as host-organisms, particularly plants, comprising these constructs.

Description

?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217-1-DNA-CONSTRUCTS COMPRISING INTERGENIC RIBOSOMAL DNA AND METHODS T0 PRODUCEPROTEINS USING THESE DNA-CONSTRUCTSThe present invention provides DNA—constructs comprising DNA fragments of theintergenic spacer between ribosomal rRNA gene repeats, as well as methods to produceproteins and methods for enhancing copy number or expression using these DNA-constructs, in eukaryotic cells, particularly in plant cells.BACKGROUNDAn important part of the genome of higher eukaryotic organisms consists in ribosomalDNA. Numerous transcription units (about 600 in the case of Arabidopsis thaliana) arearranged one directly after the other, in tandem. Cytogenetically these units form thenucleolus—organizing region and they are located near a telomere of a restricted numberof chromosomes (e.g. chromosomes 2 and 4 from Arabidopsis thaliana). The RNA-polymerase I is speci?cally responsible for the transcription of ribosomal RNA (rRNA)-genes. Due to their high copy number, the ribosomal RNA-genes were the first genes to beanalysed molecularly. The repetitive nature of these genes has hampered considerablytheir further analysis.Progress in the understanding of the transcription of ribosomal DNA was principallyobtained using in vitro systems obtained from animal cells. In plants, the (intergenic)region between transcriptional units from many genera has been investigated, butfunctional interpretations are largely based on sequence comparisons.The control elements for transcription are located in the intergcnic region (IGR), alsocalled intergenic spacer (IGS). The IGR is the DNA region located between the 25S RNAencoding region of the preceding rRNA gene unit and the 18S RNA encoding region of thefollowing rRNA gene unit. It consists in general of a 3' external transcribed spacerextending from the end of the region encoding the mature 25S RNA up to the transcriptiontermination site of the preceding rRNA gene unit, and a 5' external transcribed spacerextending from the transcription initiation site up to the beginning of the regionencoding the mature 18S RNA of the next rRNA gene unit, with in between these tworegions a non-transcribed spacer. In higher plants, the IGR contains repetitive sequencemotifs in the majority of the cases. The exact base sequence of these motifs is probablyunder low selective pressure, since there is mostly little or no sequence similaritybetween related species. This is in contrast with the good conservation of another partof the IGR, namely the region surrounding the transcription start.CONFIRMATION COPY?CA 02265519 l999-03- 17W0 98/ 13505 PCT/EP97/05217_ 2 _Considerable progress in the understanding of ribosomal transcription was recently made,using a transient expression system in Arabidopsis thaliana (Doellling, J .H. and Pikaard,C.S. (1995) "The minimal ribosomal RNA gene promoter of Arabidopsis thaliana includesa critical element at the transcription initiation site, Plant J. 8, 683-692; Doellling,J Gaudino, R.J. and Pikaard, C.S. (1993) "Functional analysis of Arabidopsis thalianaribosomal RNA gene and spacer promoters in vivo and by transient expression", Proc.Natl. Acad. Sci. USA, 90, 7528-7532). Further, in vitro transcription systems areavailable for beans and tobacco (Yarnashita, J., Nakajima, T., Tanifuji, 5. and Kato, A..(1993) "Accurate transcription initiation of Vicia faba rDNA in a whole cell extract fromembryonic axes", Plant J. 3, 187-190; Fan, H. Yakura, K., Miyanishi, M., Sugita, M.and Sugiura, M. (1995) "In vitro transcription of plant RNA polymeraseI—dependent rRNAgenes is species-speci?c" Plant J ., 8, 295-298).SUMMARY OF THE INVENTIONIn accordance with the invention, DNA constructs are provided, comprising the followingoperably linked DNA fragments:- a DNA fragment comprising a ribosomal DNA sequence preferably derived from aplant, preferably derived from the intergenic region of the ribosomal DNA of a plant;particularly comprising the upstream SalI repeats from the intergenic region from theribosomal DNA of Arabidopsis thaliana or a similar region from another plant;- a fragment comprising an expressible promoter region, especially a plant-expressiblepromoter region, preferably a promoter recognized by RNA polymerase II;- a heterologous coding region; and optionally— a transcription termination and polyadenylation region, preferably a region which isactive in plant cells.Particularly preferred ribosomal DNA sequences comprise a DNA sequence selected fromthe DNA sequence of SEQ ID N° 1 from nucleotide position 486 to 5212, the DNAsequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position 3003, theDNA sequence of SEQ ID N° 1 from nucleotide position 569 to nucleotide position 2862,the DNA sequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position2862, the DNA sequence of SEQ ID N° 1 from nucleotide position 486 to 5212, the DNAsequence of SEQ ID N° 1 from nucleotide position or 596 to 5373.Also provided are a method to produce proteins, comprising the following steps:- introducing a DNA-construct according to the invention in a suitable host organism;— cultivating the host-organism under conditions which allow expression of the proteinencoded by the structural gene; and?CA 02265519 l999-03- 17W0 98/ 13505 PCT/EP97/05217— harvesting the expressed protein.In addition, a method for enhancing the stability, the copy number or the expression of atransgene in a plant is provided comprising the following steps:— introducing a DNA construct according to the invention in a plant cell; and— regenerating a plant from the transformed plant cell.Also in accordance with the invention, host-organisms, particularly plants and plantcells comprising the DNA—constructs according to the invention, integrated in theirnuclear genome, are provided.BRIEF DESCRIPTION OF THE FIGURESFig 1: the restriction map of the ribosomal DNA from Arabidopsisthaliana;Fig 2: (A) the sequence of the V1 region of A. thaliana 25S rRNAbefore (left) and after (right) introduction of the insertionsequence(B) the sequence of the oligonucleotide used for the detection of25S rRNA;Fig 3: Analysis of the integration of the transgene;Fig 4: Primer extension analysis to detect the transgenic rRNA;Fig 5: determination of the 5’end of A. thaliana 25S rRNA;Fig 6: serial silver-stained sections through cells with trangene R4Fig 7: analysis of transcription of the ectopic ribosomal gene;Fig 8(a)-(e): binary vectors R4 to R8.Fig 9-A/B: schematic representation of the binary vectors comprisingrespectively lacking the upstream SaH repeats in front of achimeric CaMV35S-gus geneDETAILED DESCRIPTIONIn one aspect of the present invention, a DNA-construct is provided which allowsimproved expression of foreign proteins in eukaryotic cells, particularly in plant cells.A DNA-construct according to the invention comprises in reading direction, the followingoperably linked DNA fragments:— a DNA fragment comprising a ribosomal DNA sequence, preferably derived from aplant- a fragment comprising an expressible promoter region, especially a plant-expressible.-.,,....m........t.........«...»...m....,...m.....«..................,..,_ . .. . i..................a..................................... , ,. . , .. .._,. ...?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217promoter region,— a heterologous coding region; and optionally- a transcription termination and polyadenylation region, preferably a region which isactive in plant cells.Surprisingly with such a construct a higher number of transformants, a higher copynumber of the transgene, as well as an enhanced stability of the transgene and enhancedexpression can be obtained. This is even more unexpected since the skilled artisan wouldnot have expected to obtain a more efficient expression system by combining a DNAfragment with a role in the recognition and/or transcription initiation by RNA—po1ymeraseI (the ribosomal DNA) with a DNA-fragment which is normally transcribed by RN A-polymerase II.Although the promoter region in the recombinant DNA according to the invention ispreferably a promoter recognized by RNA polymerase II, the promoter may also becomprised within the ribosomal DNA, which could make the construction of therecombinant DNA according to the invention easier. As used herein, the term "plant-expressible promoter region" means a promoter which is capable of driving transcriptionin a plant cell. This includes any promoter of plant origin, but also any promoter ofnon-plant origin which is capable of directing transcription in a plant cell, i.e. ,certain promoters of viral or bacterial origin such as the CaMV35S or the T-DNA genepromoters, as well as promoter regions derived from bacteriophages and recognized by thespecific single subunit RNA polymerases, such as T7 or T3 RNA polymerase speci?cpromoters. In the latter case, it is imperative that the host cells comprise functionalRNA polymerase recognizing the speci?c promoters.It goes without saying that when it is mentioned that the ribosomal DNA should be derivedfrom a plant, it is meant that the sequence of that ribosomal DNA fragment should beidentical or similar to the sequence as it is found in a plant. Of course, the DNAfragment can have been cloned in an intermediate organism, such as E. coli or becompletely or partially synthetic.Ribosomal DNA fragments suitable for the invention are capable to direct the chromatinstructure in such a way that the DNA constructs according to the invention, integrated inthe nuclear genome are located in the neighbourhood of the nucleolus or that the genomicregion wherein the transgene is integrated, adopts a similar chromatin structure as foundin the nucleolus. Methods to determine the spatial location of a DNA fragment in a cellare known to the person skilled in the art, and one such method is set forth in detail inthe Examples. Mehods to determine the structural characteristics of chromatin,?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217- 5 -particularly the degree of accessibility of the DNA for interacting molecules, are alsoknow in the art (e.g. by determining the accesibility to micrococcal nuclease or bycrosslinkage of chromosomal proteins (Ausubel et al. (1994) see below, Dammann et al.(1995) "Transcription in yeast rRNA gene locus: Distribution of the active ?ankingregulatory sequences", Mol. Cell. Biol. 15, 5294-5303).In a preferred embodiment, the ribosomal DNA is speci?cally adapted to the host-organism wherein the recombinant DNA according to the invention will be introduced; eg.a ribosomal DNA derived from that host organism or from a closely related species.The ribosomal DNA is preferentially derived from the intergenic region of the ribosomalDNA. In the case of Arabidopsis thaliana (where the intergenic region from variety Col0has the DNA sequence of SEQ ID N° 1 from nucleotide position 486 to 5212), especiallypreferred are DNA fragments comprising the "upstream Sall repeats" from the intergenicregion of Arabidopsis thaliana ribosomal DNA. These upstream Sall repeats are organizedin three blocks [the so-called Sall box 1 (SEQ ID N° 1 from nucleotide position 1263 to1557) Sall box 2 (SEQ ID N° 1 from nucleotide position 1883 to 2177) and Sall box 3(SEQ ID N° 1 from nucleotide position 2503 to 3003)] and it is thought that inclusion ofa DNA fragment comprising these Sall repeats (such as a fragment having the DNAsequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position 3003) issufficient to obtain the effects according to the invention. In fact, the presence of acomplete third Sall repeat is not required, since a fragment comprising only the part ofSall box 3 up to the EcoRI site (having the DNA sequence of SEQ ID N° 1 fromnucleotide position 569 to nucleotide position 2862) can be used to similar effect. Thus,in a preferred embodiment, the ribosomal DNA comprises a fragment having the DNAsequence of SEQ ID N ° 1 from nucleotide position 1263 to nucleotide position 2862.Furthermore, larger fragments comprising the upstream Sall repeats can be used, such as afragment comprising the complete intergenic region (having the DNA sequence of SEQ IDN° 1 from nucleotide position 486 to 5212) or even a fragment comprising parts of theregions coding for the rRN A transcripts, particularly the 18S transcript ( such as afragment having the DNA sequence of SEQ ID N° 1 from nucleotide position 596 to5373). In addition it is possible to use a fragment comprising a complete ribosomal geneunit (the DNA sequence of which can be obtained by merging the overlapping DNAsequences available from the EMBL database under the Accession numbers X16077,X52320 and X15550) although when using such DNA constructs, the effects as describedin this invention might be less pronounced, possibly due to shielding effects.For other host plants, particularly suited DNA fragments comprise those domains of theribosomal DNA which correspond to these domains in Arabidopsis, particularly those?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217- 6 -which are derived therefrom. Preferred are DNA fragments comprising the intergenicspacers, located between the DNA regions coding for the 25S and 18S regions, particularlyDNA fragments comprising the non—transcribed intergenic spacers located between thetranscription termination site of the previous rRNA gene unit and the transcriptioninitiation site of the following rRNA gene unit. Other rRN A intergenic spacers are knownin the art at least for corn [McMullen et al., Nucl. Acids Res. 14: 4953-4968(1986)Toloczyki and Feix, Nucl. Acids Res 14:4969-4986 ( 1986)] rye [Appels et al, Can JGenet Cytol 28:673-685 (l986)], wheat [Barker et al, J. Mol. Biol. 201: 1-17 (1988)],radish [Delcasso-Tremousaygue et al., Eur. J. Biochem 172: 767-776 ( 1988)], rice[Takaiwa et al. , Plant Mol. Biol. 15: 933-935(l990)], mung bean [Gerstner et al, Genome30: 723-733 (1988), Schiebel et al., Mol Gen Genet 218: 302-307 (1989)], potato[Borisjuk and Hemleben,Plant Mol Biol. 21; 381-384 (l993)], tomato [Schmidt-Puchta etal., Plant Mol Biol 13: 251-253 (1989)], Vicia faba [Kato et al, Plant Mol. Biol. 14:983-993 (1990)] , Pisum sativum [Kato et a1., supra (1990)] and Hordeum bulbosum[Procunier et al. , Plant Mol Biol. 15: 661-663 (1990)]. Moreover intergenic spacers froma plant can be straightforwardly ampli?ed in a PCR reaction using oligonucleotidescorresponding to the 3' end of the conserved 25S mature rRNA encoding region and the 5'end of the conserved 18S mature rRN A encoding region.It has been reported (Gruendler et al. , 1991, J. Mol. Biol. 221, 1209-1222) that thenumber of upstream Sall repeats may differ in different varieties or isolates of the samespecies (in casu A. thaliana ) . Such variants are also encompassed by the invention.It is also possible to use a modified ribosomal DNA, which is derived from the originalribosomal DNA by mutation, insertion or deletion, as long as the essential functional,particularly related (e. g. with DNA-binding proteins such as polymerases) or at least theessential topological characteristics from the ribosomal DNA are not lost by themodi?cation.As used herein "coding region" or "coding sequence" refers to a DNA region which whenprovided with appropriate regulatory regions, particularly a promoter region, istranscribed into an RNA which is biologically active i.e. , which is either capable ofinteraction with another nucleic acid such as e.g. an antisense RNA or a ribozyme orwhich is capable of being translated into a biologically active polypeptide or protein.As used herein, the term "heterologous" with regard to a coding region refers to anycoding region which is different from the rRNA coding region naturally associated withribosomal DNA fragment used in the chimeric DNA according to the invention.?CA 02265519 l999-03- 17W0 98/ 13505 PCT/EP97/05217_ 7 _As coding region, all known natural or modi?ed coding regions can be used, which arecompatible with the host-organism, in other words that the expressed product is expressedin such a way that the product is not too toxic for the host, particularly that it leadsto a signi?cant expression, before the product is collected, if collected at all.Particularly, the coding region might encode a vaccine, an antibody, a therapeuticalprotein, an insecticidal protein such as a Bt toxin or the minimal toxic fragmentthereof, a protein used in food technology, an antisense-RNA or a ribozyme.The DNA-construct can be made in such a way that it is adapted to a particular host ortransformation system. In a preferred embodiment, the DNA construct according to theinvention is in the form of a vector. Particularly, the DNA construct is a T-DN A vector.Although the ribosomal DNA fragment preferably precedes the promoter region and theheterologous coding region in the DNA-constructs according to the invention, it isexpected that similar effects will be achieved when the ribosomal DNA fragment is placeddownstream of the operably linked promoter region and coding region.In another aspect, the present invention also provides a process for the production ofproteins comprising the following steps:- introducing a DNA-construct according to the invention in a suitable host organism,- cultivating the host-organism under conditions which allow expression of the proteinencoded by the structural gene- optionally, harvesting the expressed protein.In yet another aspect, the present invention provides a process for enhancing thestability, the copy number and/or the expression of a transgene, especially in a plant,comprising the following steps:— introducing a DNA construct according to the invention in a cell, preferably in aplant cell— regenerating an organism, preferably a plant, from the transformed cellThe method of the invention is particularly suited to enhance the stability andexpression of recombinant genes which have at least partially homology to a sequencepresent in the host cell, particularly the plant cell, such as transgenes in multiplecopies or different transgenes comprising similar sequences such as e.g. the samepromoter. It is known that such transgenes are frequently prone to homologousrecombination, as well as to reduction in expression by e.g. methylation, or co-suppression events. Although not intending to limit the invention to a mode of action, itis thought that the localization of the transgenes resulting from the transformation of?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217_ 3 _the DNA constructs according to the invention, in or in the neighbourhood of thenucleolus or the enforcement of a nucleolus-like chromatin structure on the chromosomalregion wherein the transgene is integrated, reduces the recombination between homologoussequences (thus increasing stability), the methylation and any other events resulting ina reduction in expression of such transgenes.Introduction of the DNA can be done using any method or manner and different teclmiques— dependent upon the host-organism used - are available to the skilled artisan.Particularly preferred ways of introduction of DNA are T-DNA transformation,electroporation or particle -bombardment as well as plasmid— or virus-transformation.The optimal cultivation conditions depend on the used host-organism and on the nature of Vthe expressed protein. These conditions are again known to the person skilled in the art(for well-known host-organism) and/or can be easily determined or optimised using knownbiotechnological protocols.The harvest of the proteins is also preferably performed according to standard methodsfor the concerned host-organism and depends also on the way the protein is expressed(e.g. whether it is secreted or excreted in the culture medium, or accumulates inside thehost-organism, or is included in specific compartments, ...). As with the cultivationstep, also here the person skilled in the art can without undue experimentation determineand or optimize the harvesting conditions for a particular hostl structural proteinsystem.Preferred host-organisms, particularly plants are well-known and well defined systems,such as Arabidopsis thaliana, or economically important crops such as tobacco, corn,wheat, potato, rice, soy beans, barley, rye, a brassica vegetable, a Beta species ormanioc.Also provided by the present invention is a host—organism comprising the DNA-constructof the invention. Preferably, this host-organism is a eukaryotic cell, particularly aplant cell, as well as an organism comprising these cells or generated from these cells.In yet another aspect the invention provides reproduction material, particularly plantreproduction material, comprising cells which comprise the DNA-construct according tothe invention.The invention and advantages thereof are further illustrated in the examples and Figureswhich are in no way limitative.?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217In the_examples and in the description of the invention, reference is made to thefollowing sequences of the Sequence Listing:SEQ ID No.1: DNA sequence of the intergenic region of rRNA gene repeats ofA. thalianaSEQ ID No.2: oligonucleotideSEQ ID No.3: oligonucleotideSEQ ID No.4: oligonucleotide ESEQ ID No.5: oligonucleotide QSEQ ID No.6: . DNA sequence of the A. thaliana region between the 3' end of5.8S rDNA and the 5' end of the 25S rDNAEXPERIMENTALUnless stated otherwise in the Examples, all recombinant DNA techniques are carried outaccording to standard protocols as described in Sambrook et al. (1989) Molecular Cloning:A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, NY and inVolumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, CurrentProtocols, USA. Standard materials and methods for plant molecular work are described inPlant Molecular Biology Labfax (1993) by R.D.D. Croy, jointly published by BIOSScientific Publications Ltd (UK) and Blackwell Scienti?c Publications, UK. Thesepublications also include lists explaining the current abbreviations.1. Vector constructionA Sall fragment from lambda-phage ATR3 (Grundler, P., Unfried, I., Pointner, R. andSchweizer, D. (1989) "Nucleotide sequence of the 258-183 ribosomal gene spacer fromArabidopsis thaliana", Nucleic Acids Res., 17, 6395-6396; Unfried, 1., Stocker, U. andGriindler, P. (1989) "Nucleotide sequence of the 18S rRNA gene from Arabidopsisthaliana Col-0", Nucleic Acids Res. , 17, 7513; Unfried, I. and Griindler, P. (1990)"Nucleotide sequence of the 5.8S and 25S rRNA genes and of the internal transcribedspacers from Arabidopsis thaliana" , Nucleic Acids Res. , 18, 4011), which extends fromthe vector-insert border ( nucleotide position 1400 from sequence X16077) to the Sall-restriction site in position 1263 of the sequence X15550, was inserted in the Sallrestriction site of the binary vector pBIB Hyg (Becker, D. (1990) "Binary vectors whichallow the exchange of plant selectable markers and reporter genes", Nucleic Acids Res. ,18, 203). The orientation of the insert was such that the l8S—gene is located near the?CA 02265519 l999-03- 17W0 93/13505 PCT/EP97/05217-10-Asp718 restriction site. The resulting vector, R2, is cleaved with Asp718, treated withKlenow-enzyme and cleaved partially with S?l. A fragment from ATR3, which extendsfrom the (blunted) Xhol-restriction site (position 569 in sequence X15550) to the S?lrestriction site (position 1490 in sequence X16077), is inserted and completes thesequence of a ribosomal transcription unit in vector R3.To insert an oligonucleotide, a fragment from the Sall-restriction site in position 305from sequence X 16077 to the Pstl restriction site in position 1425 from X52320,comprising the largest part of the 18S rDNA—sequence and the 5'—end of the 25S rDNAsequence was first cloned in pSK+ (plasmid pBlu/SP). After cleaving with XbaI and Srfl ,?lling in of the sticky ends with Klenow-enzyme and ligation, the ligation product istreated with XhoI and EcoNI, treated with Klenow enzyme and religated. The resultingvector now has a single Aatll restriction site. The oligonucleotideCCAAGGTAACCTTCGACGT (SEQ ID N° 2) and CGAAGGTTACCTTGGACGT (SEQID N ° 3) were allowed to anneal and were inserted in the AatII—restriction site. Afterchecking the sequence, a Ban1HI/BstBI fragment was transferred to the vector pBlu/SP(vector pBlu/ SP +E). An S?l/Srfl fragment from vector pBlu/SP+E was inserted in vectorR3 (vector R4; Fig. 8a).2. Plant transformationPlant transformation was performed as described by Valvekens, D. , van Montagu, M. andvan Lijsebettens, M. (1988) "Agrobacterium tumefaciens-mediated transformation ofArabidopsis thaliana root explants by using kanamycin selection", (Proc. Natl. Acad. Sci.USA, 85, 5536-5540), except that hygromycin selection was used. The selectable markerin the plasmids used in the examples 1 and 2 was indeed hygromycin phosphotransferase.3. DNA-isolationDNA-isolation was performed as described (Dellaporta, S.L. , Wood, J . and Hicks, LB.(1983) "A plant DNA minipreparation version 11'', Plant Mol. Biol. Rep., 1, 19-21), withthe following modifications: After phenol extraction, 1/10 of the volume ethidiumbromide(10g/1) is added to the DNA solution as well as CsCl (0.9 g/ml). The solution is kept onice for 30 min. After centrifugation (5 min 5000 RPM) the clear solution is adjusted withCsCl to a density of 1.6 g/ml and centrifuged for 3 hours at 80 000 rpm in a BeckmanNVT90 rotor. DNA is harvested using standard methods from the gradient (Ausubel,F.M., Brent, R., Kingston, R.F., Moore, D.O., Seidman, J.G., Smith, J.A. and Struhl,K. (Eds.) (1987) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NewYork).?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217_ 11 _4. DNA—analysis through gel-blotPuri?ed DNA from callus material was digested with restriction enzymes such as BstEIIand used for gel-blot-analysis (Ausubel et a1., 1987).5. RNA preparationRNA was prepared as described in Logemarm, J ., Schell, J and Willmitzer, L. ((1987)"Improved method for the isolation of RNA from plant tissues" Anal. Biochem. , 163, 16-20) with the following modifications: callus material was ground in liquid nitrogen andmixed with 2 ml extraction buffer (8M guanidium chloride, 20 mM MES, 20 mM EDTA,50 mM 2—mercaptoethano1, 0.5 % Sarcosyl pH about 3) per gram callus material. Afterthawing the suspension was transferred to a centrifuge tube, and extracted with onevolume phenol/chlorofomi/isoamyl alcohol (50:49: 1). After heavy vortexing, the mixtureis kept on ice for about 15 minutes and centrifuged at 1000Og for about 10 min. Theaqueous phase is transferred to a new tube, and 1/10 volume sodium acetate (1M) and 1volume of ethanol is added, to precipitate the nucleic acids. After mixing the solutionit was centrifuged at 10000g. The pellet was washed with 3M sodium acetate and 70 %ethanol. After evaporation of the residual alcohol, the pellet is dissolved in waterthrough incubation at 60 to 65 °C for about 3 hrs.6. Primer extension analysis25 ng of oligonucleotide E (GAAGACGTCGAAGGTTACCTTGG (SEQ ID N° 4); anoligonucleotide which exclusively binds to the rRNA with the 19 nucleotide insertion) orQ (CCCGGTTCGCTCGCCGTTACTAAG (SEQ ID N ° 5) ; nucleotide 950 to 927 of thenon-coding strand of sequence X52320, which can bind to all 25S RNA-molecules of A.thaliana ) were phosphorylated with 10 ;.tCi32 P-gamma-ATP in a volume of 10 pl for 90minutes, extracted with phenol/ chloroform after addition of 1 mg of tRNA and precipitatedwith sodium—acetate and ethanol. The oligonucleotide was incubated with 2.5 pg of totalRNA from A. thaliana in 11 pl water to allow hybridization, and cooled from 90°C to 63°C and then to 52°C in a time span of about one and a half hour. For the extensionreaction, 5 pl 5xRT buffer (provided by the enzyme manufacturer), Zpl dNTPs (2mM) and0.5 pl (12 units) AMV reverse transcriptase (Boehringer Mannheim) were added. Afterone hour incubation at 38°C, 1 pl DNAse free RNAse A (5 mg/ml; BoehringerMannheim) were added, and the mixture was incubated further for 30 min at 37°C. Thereaction mixture was separated on a denaturing polyacrylamide gel as used for DNA-sequencing.r,... _......................................._s_..... .. , , .. ...._.._.,..._......u.......m...........~..~.......-......~.....-.... . ?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97l052l7-12-7. Sectioning and staining of cellsCallus material was fixed with 2.5 % paraforrnaldehyde and 0.5 % glutaraldehyde in 0.1 Mphosphate buffer and embedded in LR White Harz. Serially following sections with athickness of 800 nm (resulting in about 5 to 6 sections per nucleus) were produced usinga Reichert Ultracut E Microtome. The sections were stained with Richardson's Dye andanalysed using a Leitz Dialux Microscope.EXAMPLESExample 1 Introduction of the DNA-constructs in A. thaliana and analysis oftransformed cells.Sequence comparison of the ribosomal RNA from different species revealed the presenceof several regions with high variability. In many instances, the variable region has ahairpin structure which may be either longer, shorter or even completely absent. One suchvariable region in the large rRN A, named VI, was used, to insert a specific nucleic acidsequence. This region is also close enough to the beginning of the mature 25S rRN A sothat extension experiments can be performed.A DNA fragment of the rDNA which comprises somewhat more than one repeat unit(transcription unit) was inserted into the binary vector pBIB Hyg (Becker, D. , 1990). Theconstruct contains the presumed signals for transcription termination on both ends of therepeat unit. The structure of this construct (named R4) and the restriction map of theribosomal repeat unit of A. thaliana are represented in Fig. 1 and Fig. 8(a).The open boxes indicated 18S, 5.8S and 25S represent the regions coding for the threeribosomal RNAs. "Upstream Sal repeats" indicates three blocks of repetitive DNA in theintergenic region, which comprise a lot of Sall restriction sites. Bold lines at bothends of the scheme indicate the vector DNA. The BstEII restriction site, introduced bythe nucleotide—insertion is indicated with "B". Vector R5 is different from vector R4 inthe absence of "the upstream Sall repeats", as well as in the presence of the Kpnlrestriction site at the border of the ribosomal unit (K). B, BstEII; E, EcoRI; F, Fspl;H, Hindlll; K, KpnI;P, Pstl; Pc, Pacl; S, Sall; Sc, Scal; Sf, S?l; Sr, Sr?; X, Xbal;Xh, Xhol.The nucleic acid sequence of the region is available in the EMBL—database under accession?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97l05217- 13 -number X16077, X52320 and X15550. Variants of a part of the ribosomal DNA areavailable in the EMBL—database under accession number X52631, X52637 and X52636(Griindler et al. , 1989; Unfried et al. , 1989; Unfried et al. , 1990; Griindler, P. , Unfrie,1., Pascher, K. and Schweizer, D. (1991) rDNA intergenic region from Arabidopsisthaliana: structural analysis, interspeci?c variation and functional implications. J.Mol. Biol., 221, 1209-1222).As mentioned above, a ribosomal gene—unit (Fig. 1) was marked with a small nucleotideinsertion in the large (25S) ribosomal RNA to be able to recognize it specifically anddiscriminate it from other ribosomal gene—units present in the genome. Fig. 2 shows thenucleotide insertion as well as an oligonucleotide which allows detection oftranscription of this (marked) ribosomal gene—unit. The insertion sequence has a BstEIIrestriction site, which can be used for the speci?c recognition of the gene—unit (a),sequence of the region VI of A. thaliana 25S rRNA before (left) and after (right)insertion of the oligonucleotide sequence. The secondary structure of the insertion ishypothetical and is only for the purpose of comparison with the structure withoutinsertion. The insertion has a BstEII-restriction site in the DNA. (b), Sequence of theoligonucleotide allowing detection and quanti?cation of 25S ribosomal RNA throughreverse transcription.A further construct, named R5 (see Fig. 8(b)), differs from R4 in that the "upstream Sallrepeats" have been removed.The constructs R4 and R5 were introduced in root explants of A. thaliana plants usingAgrobacterium tumefaciens. Adjacent to the ribosomal unit a gene is located which istranscribed by RNA-polymerase II and confers resistance to hygromycin B (hygromycin-phosphotranferase-gene; Becker, D. , 1990). Transformed cells/calli are selected by theirresistance to hygromycin. DNA from these calli is used for DNA-blot—experiments.Fig 3 shows that the ribosomal transgene-copies and the adjacent marker gene canintegrate in different places in the genome. For digestion of the genomic DNA the enzymeBstEII was used which does not cleave in the ribosomal genes of the A. thaliana ecotypeCol-O. Therefore, the ribosomal DNA is visible as a high-molecular weight band or is evenpartially retained in the gel-slot. On the contrary, ribosomal transgenes which have notintegrated between natural ribosomal DNA repeats can give rise to smaller bands, since inthe genomic region near the integration place, BstEII restriction sites should be presentin a statistically random way. Exactly the latter result can be seen in the analysedcalli.?CA 02265519 l999-03- 17WO 98/13505 PCT/EP97/05217_ 14 -The DNA-hybridization experiments shown in Fig. 3 demonstrate that integration of thetransgene at least in the majority of cases does not occur in the regions of theribosomal DNA. DNA from callus material was restricted with BstEII and transferred to anylon-membrane after size fractionation on an agarose gel. Lanes 1 and 2 contain DNAfrom non-transforrned callus material, and from callus material transformed by DNAconstruct R4 respectively. DNA from the hygromycin phosphotransferase gene was used asprobe. The detected fragments have one side the BstEII restriction site located in the25S rRN A transgene and on the other hand a BstEII restriction site in the DNA of theintegration place. Since the endogenous rDNA does not contain BstEII restriction sites,the presence of such restriction sites in the host-DNA in the immediate neighbourhood ofthe trangenes, constitutes proof for integration of the transgene outside of theribosomal DNA. Lanes 3 and 4 show the same digested DNA as in lanes 1 and 2, but hereribosomal DNA was used as probe. The DNA from the calli remains either in the gel-slot,or moves as high-molecular DNA at the limits of the separating power of the gel. Lanes 5-8 contain DNA from three further independently transformed calli, whereby lane 8 hasbeen hybridized with a ribosomal probe.From the transformed calli, RNA was prepared and used for the primer extension analysis.Therefore, an oligonucleotide was designed, which binds to the insertion in the variableregion V1, but not to RNA which does not contain such an insertion. The synthetic DNA-fragment indicated as oligonucleotide E in Fig 2 was particularly suited. A reversetranscript using this oligonucleotide as primer, was obtained in transformed calli, butnot in non—transformed calli. The activity of the ribosomal transgene can be detected inthe majority of cases (Fig. 4):With oligonucleotide E as primer, a reverse transcription reaction yields a product ofabout 150 bases (indicated by asterisk). Several calli were pooled to prepare RNA ((a)Lane 1: callus material not transformed with ribosomal transgene DNA; lane 2: callusmaterial transformed by the ribosomal transgene R4; (b) gel slot (indicated by arrow) andsize marker ; precursors with higher molecular weight (2 or 3 asterisks) can be seen in alot of experiments; lane 1: size marker; lane 2, as lane 1 in (a); lane 3: as lane 2 in(8))-As follows from the mode of selection, the adjacent hygromycin resistance gene is activein all cases.- The processing of ribosomal transgenes is comparable to the natural ribosomal gene, inthat the same 5 ‘end of the 25S rRN A could be determined (Fig 5): the 5 ‘end of the normalgenomic 25S rRN A was determined using oligonucleotide Q, the 5 ‘end of the transgenemarked with the inserted sequence was determined using oligonucleotide E. A comparisonNOT TO BE TAKEN INTO CONSIDERATION FORINTERNATIONAL PROCESSING?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217- 15 _with the sequencing ladder proves identical ends. Moreover, the end of the RNAs isdifferent than presumed up to now, in that the 25S rRN A is somewhat longer thanaccepted until now (Fig. 5). Also, processing intermediates of the 25S rRN A can bedetected, indicating again a similar processing of the unchanged rRNA and the rRNA withthe inserted sequence.The determination of the 5'end of the 25S rRNA from A. thaliana is presented in Fig. 5.Fig 5 (a) shows the primer extension analysis with oligonucleotide Q, which can bind all25S rRNA transcripts. On the right side a sequencing ladder obtained using the sameoligonucleotide as primer is represented. Fig 5(b) shows the reverse transcription witholigonucleotide E, which is specific for the transgenic ribosomal copy. On the left sidea sequencing ladder obtained using the same oligonucleotide as primer is represented. Theasterisk marks the final base of the reverse transcripts. Transgenic and endogenousribosomal 25S rRN A have an identical 5 '-end Fig 5(c) is analogous to lane 3 in Fig 4(b),but with sequencing ladder. Fig 5(d) ( and SEQ ID N° 6) shows the sequence of theribosomal DNA with indication of the 5‘ends of the 25S rRNA, as well from a precursor(one asterisk and two asterisks respectively). The dot represents the previously presumed5 ‘end. Bold font indicates the part present in 25S_, respectively 5.8S RNA.The identical processing of transgenic and natural ribosomal RNA indicates that thecomponents necessary for such a processing (which normally occur in the nucleolus) haveaccess to the ectopically integrated transgene. It was further analysed, whether the ‘latter one could be located in a nucleolus or in the neighbourhood of a nucleolus. Apositive result would correspond to the situation found in Drosophila (Karpen, G.H. ,Schaefer, J .E. and Laird, C. D. ( 1988) "A Drosophila rRNA gene located in euchromatinis active in transcription and nucleolus formation", Genes Dev. 2, 1745-1763), a negativeresult would be similar to the situation found in baker's yeast. Transgenic Arabidopsisnuclei were stained with silver and serial thin sections were made. Fig 6 and Table 1show that Arabidopsis cells with the mentioned transgene have on average one additionalnucleolus.Table 1: Average number of nucleoli in callus cells transformed with R4, and in non-transformed controlcells (in each case, 25 cells were analysed by serial sectioning asin Fig 6)Average number of nucleoliR4 transgenic cells 2.8 :1: 0.5Control cells 2.0 i 0.3..... , . M.............._..-...._...................m...m..........»............M.......,... , ................s.. ....................y..,...u...... ,, . .. ,,?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217‘ — 16 -These serial sections through cells with transgene R4 and silver staining show thepresence of additional nucleoli ((a) through (i): Sections through A. thaliana callus-cells without ectopic ribosomal DNA; (k) through (t), as (a) through (i), but with callusmaterial comprising ectopic rDN A (remarkable cells are indicated by asterisks); in (k)through (t) additional nucleoli can be seen.The selected callus-nuclei have on average three nucleoli, while this number in non-transformed callus material is around two; The size of the three nucleoli cannot bedistinguished in such a way as to state that one of them contains only the ectopiccopies. It can equally be assumed that the available active ribosomal genes are dividedbetween all three copies. Further experiments indicated that the gene coding forhygromycin resistance is located in a position at least in the neighbourhood of thenucleoli.In a further series of experiments, it was analysed whether the construct R5, lacking theupstream SalI repeats, was also transcribed, and whether the transcription level can bedistinguished from the transcription level of construct R4.Therefore, a reverse transcription and analysis was performed on plant material which waseither transformed only with vector sequences (lanes 1 in both panels of Fig 7), withribosomal copies lacking the upstream Sall repeats (lanes 2 in both panels) or with thecomplete ribosomal copies (Lanes 3 in both panels). In Fig 7 (a) the oligonucleotide E(speci?c for the transgenic copy) was used; in Fig 7(b) oligonucleotide Q binding to all25S rRNA molecules was used (as a control for similar amounts of RNA).Fig. 7 shows that no difference could be demonstrated. To exclude positional effects onsome of the integrated transgenes, a mixture of several independently transformed calliwere used as starting material. Also the processing of the rRN A does not seem to sufferfrom the loss of the upstream Sall repeats. Therefore, it seems that sequences from theso-called "upstream Sal repeats" (see Fig 1) have no significant in?uence on theexpression level of the ribosomal gene unit in freshly transformed callus material. Fig 7shows a quantitative evaluation of the gene expression of ribosomal gene-units.However, it was demonstrated that the DNA-fragment comprising the "upstream Salrepeats" has an in?uence on the stability of the introduced DNA. Fig. 8(a)-(e) showsconstructs which were compared with each other (R4-R8 are E. coli-Agrobacterium shuttlevectors with RK2 origin of replication, whereby "Br" and "B1" indicate the right,respectively left T-DNA border; (a) binary vector R4: comprises the complete ribosomalunit from A. thaliana next to a hygromycin resistance gene (HPT); (b) binary vector R5:?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217-17-is similar to R4, without the "upstream Sal repeats" (lacks the DNA sequence of SEQ IDN° 1 from nucleotide 1269 to 3002); (c) binary vector R6: comprises only the intergenicregion (IGR) of the ribosomal DNA next to the hygromycin resistance gene (wasconstructed by insertion of the DNA fragment having the sequence of SEQ ID N° 1 from596 to 537 3 into pBIB Hyg); (d) binary vector R7: is similar to R6 but lacks the"upstream Sal repeats " (deletion of the DNA sequence of SEQ ID N° 1 from nucleotideposition 1269 to 3002); (e) binary vector R8: comprises only the RNA encoding part of theribosomal DNA adjacent to a resistance gene (similar to R1 but without the sequence ofSEQ ID N° 1 from nucleotide position 1269 to 5075)). The sizes of the plasmids are about(in base pairs) 23810 (R4), 21810 (R5), 16010 (R6), 14010 (R7) and 19960 (R8).All constructs according to the invention cause a stabilization of the transgene, whichcan be observed as the presence of a higher copy number and/ or higher transformationefficiency, particularly as a more stable expression of the structural gene, particularlya marker gene such as the hygromycin phosphotransferase genes).A hypothesis to explain this effect, is that this sequence shields the ribosomal repeatsfrom recombination and/or methylation. This sequence could also be responsible for thelocalization of the ribosomal DNA in a special subregion of the nucleus (the nucleolus).Since the experiments show that adjacent genes which are transcribed by RNA polymeraseII tolerate the localization in the neighbourhood of a nucleolus, as well as demonstrateactivity, it is concluded that the stabilizing effect is extended to this kind of genes.Example 2: Comparison of constructs according to the invention (with"upstream Sal repeats", USR) with a traditional construct(without "upstream Sal repeats", USR) particularly concerningtransgene copy number and expression level.2.1. As described in the Experimental section, DNA was prepared from transformed callusmaterial and digested with the restriction enzymes BamHI and HindIII. Both enzymes cutwithin the transferred DNA, thus all copies integrated in the genome will run as a singleband upon size separation by gel electrophoresis. By Southern blotting using thehygromycin resistance gene as probe, the relative number of the transgene copies wasdetermined in different calli by comparison of the intensity of the hybridizing bandswith the help of a Phospho imager. As a control, the DNA blot was hybridized using asprobe, at DNA known to be present in two copies in the genome (chlorata 42). The relativeintensity of the bands determined as described above, was used to estimate the amount ofDNA in the different lanes. From the comparison of the intensity of the bands of bothprobes, it was determined that the analysed transgenes were present in the following copy?CA 02265519 l999-03- l7wo 98/13505 PCT/EP97/05217_ 13 -number:Comparison of construct Fig.8—A (with USR; according to the invention; for the timebeing, this construct is regarded by the applicant as the best mode for carrying out theinvention) with a construct Fig. 8—B (without USR; state of the art):construct with USR: copy number per haploid genome in 6 instances7; 5.5; 0.5; 3.5; 3; 0.5 leading to an average of3.3 :1: 2.7 copies.Construct without USR: copy number per haploid genome in 5 cases2; 1; 2; 1.5; 1.5 leading to an average of 1.6 ;l; 0.5 copies.Comparison of construct Fig.8-C (with USR; according to the invention) with a constructFig. 8-D (without USR; state of the art):construct with USR: copy number per haploid genome in 4 instances1.5; 1; 2.5; 2; leading to an average of 1.8 :t 1.2 copies.Construct without USR: copy number per haploid genome in 5 cases2; 1; 1; 1.5; 0.5 leading to an average of 1.2 :1; 0.5 copies.It should also be remarked that the dispersion in constructs with USR is signi?cantlyhigher. This allows the interpretation that the expression of trangenes is guaranteed tooccur in a sufficient manner in a broader spectrum of transgene-con?gurations, e. g. alsoin quite high or quite low copy-number.It was also demonstrated that with the constructs according to the invention,particularly when they are integrated in the genome in a good position, an augmentationof the copy number can be achieved (see results with construct 8-A).2.2 Two DNA constructs were built, that express the reporter gene beta-glucuronidase(gus) under control of the we11—characterized CaMV35S promoter. Adjacent to this geneagain the USR sequence is either present or absent (see Fig. 9A and B).The vector represented in Fig. 9B was constructed by introduction of a DNA fragmentcomprising the chimeric CaMV35S-gus gene from pRTgus (Topfer et al. (1993)"Expression vectors for high-level gene expression in dicotyledonous andmonocotyledonous plants" Meth.Enzymo1. 217, 66-78") in the polynucleotidelinkerbetween the nos terminator and the hyg gene of pBIB Hyg (Becker et al. 1990). The vectorrepresented in Fig. 9A was constructed by introduction of an EcoRI-SalI DNA fragment?CA 02265519 l999-03- 17W0 93/13505 PCTIEP97/05217_ 19 _having the DNA sequence of SEQ ID N° 1 from nucleotide position 596 to 2862, in thevector of Fig. 9B in such a way that the end of the ribosomal DNA fragment locatedoriginally adjacent to the Poll promoter is now located adjacent to the CaMV35Spromoter.The activity of the enzyme encoded by the transgene was estimated for transgenic callusmaterial (2 to 25 mg) homogenized in 200 M extraction buffer (50 mM sodium phosphatepH 7, 10 mM 2-mercapto—ethanol, 10 mM EDTA, 0.1 % SDS, 0.1 % Triton X-100).After centrifugation (10 min, 4°C, 18 000 rpm) the activity was measured. Therefore,para—nitrophenyl-beta-glucuronide (pNPG; 2mM) was added and incubated from 10 to 30min at 37°C. The reaction was stopped by addition of 0.2 M sodium-carbonate (modifiedafter Gallagher, ed., GUS protocols, Academic Press, 1992).Comparison of construct with, respectively without USR (indicated are relative enzymeunits per gram fresh weight transformed calli):construct with USR: measured activities 2.3; 6.9; 11.2; 0.3; 1.2; 0.3; 1.0; 2.3; 2.0;average 3.1 i 2.8.Construct without USR: measured activities 0.1; 1.6; 0.0; 1.1; 0.6; 0.2; 0.6; 1.5; 0.8;average 0.7 :1; 0.4.It is remarkable that both the average level of activities is considerably higher withUSR (difference factor 4) , and the dispersion of the activities is larger . Further withthe constructs with USR no callus occurred which exhibited an extremely low level ofactivity (e. g. 0.0 or 0.1). This allows to conclude that a larger range of activitylevels from the transgenes can be obtained in a stable way.Also here was demonstrated that with integration of the constructs according to theinvention on a certain place a higher expression level can be reached (see activitiesfrom 6.9 to 11.2 with a USR -construct according to Fig. 9A). This strongly enhancedactivity could be due to the fact that the r—DNA creates a favourable chromatin-environment for transcription.A further reason that a broader spectrum of trangene —configurations is stable and allowsgene-expression, is apparently the fact that the r-DNA circumvents the normal controlmechanisms for euchromatin, eg. by suppressing pairing of homologous region,suppression of homologous recombination, suppression of the methylation occurring ineuchromatin.?CA 02265519 l999-03- 17W0 98/13505 PCT/EP97/05217-20-Also the activity from transgenes in the presence of certain sequences from the ribosomalDNA is guaranteed when several units are present in tandem repeat or on several places inthe genome so that a higher copy number leads to higher expression.Example 3: Analysis of corn plants transformed with DNA constructsaccording to the invention.The rRNA intergenic region of corn is ampli?ed by PCR using oligonucleotidescorresponding to the 3' end of the conserved 25S mature rRNA encoding region and the 5'end of the conserved 18S rRNA mature rRNA encoding region (using the sequenceavailable from EMBL database under the accession number EMBL X03990). The ‘oligonucleotides are designed to include suitable restriction sites at the extremities ofthe ampli?ed fragment.The fragment is cloned upstream of a CaMV35S promoter region operably linked to aregion encoding phospinotricinacetyl transferase (PAT encoded by bar) as described in WO92/09696 in such orientation that the intergenic region sequence proximal to the mature18S rRNA coding region is now proximal to the chimeric bar gene. The DNA constructcomprising the intergenic rDNA and the chimeric bar gene are inserted between theborders of the T-DNA vector pGSV5 (described in WO97/ 13865).The DNA—construct is then integrated into the nuclear genome of corn according to themethods described in W092/09696 or EP 0469273.Transgenic corn lines are analysed for expression level (by determination of the level ofPAT activity) and the copy number of transgenes (by Southern hybridizations). Both theaverage copy number and average expression level of the chimeric bar gene are higher inthe lines transformed by the DNA constructs comprising the intergenic repeat, than incontrol lines transformed by DNA constructs without intergenic repeat.Example 4: Analysis of oilseed rape plants transformed with DNA constructsaccording to the invention.The rRNA intergenic region of oilseed rape is ampli?ed by PCR using oligonucleotidescorresponding to the 3' end of the conserved 25S mature rRNA encoding region and the 5 ‘end of the conserved 18S rRN A mature rRNA encoding region (using the sequence of arelated species such as the one available from EMBL database under the accession number?CA 02265519 l999-03- 17W0 98/13505 PCT./EP97/05217-21-X60324). The oligonucleotides are designed to include suitable restriction sites at theextremities of the ampli?ed fragment.The fragment is cloned upstream of a CaMV35S promoter region operably linked to aregion encoding phospinotricinacetyl transferase (PAT encoded by bar) as described in WO92/09696 in such orientation that the intergenic region sequence proximal to the mature18S rRNA coding region is now proximal to the chimeric bar gene. The DNA constructcomprising the intergenic rDNA and the chimeric bar gene are inserted between theborders of the T-DNA vector pGSV5 (described in WO97/ 13865).I The DNA-construct is then integrated into the nuclear genome of oilseed rape according tothe methods described in WO97/ 13865 .Transgenic oilseed rape lines are analysed for expression level (by determination of thelevel of PAT activity) and the copy number of transgenes (by Southern hybridizations).Both the average copy number and average expression level of the chimeric bar gene arehigher in the lines transformed by the DNA constructs comprising the intergenic repeat,than in control lines transformed by DNA constructs without intergenic repeat.?CA 02265519 1999-03-17W0 98/13505 PCT/EP97/05217-22-SEQUENCE LISTING(1) GENERAL INFORMATION:(i) APPLICANT:(A) NAME: Plant Genetic Systems N.V.(B) STREET: Jozef Plateaustraat 22(C) CITY: Gent(E) COUNTRY: Belgium(F) POSTAL CODE (ZIP): B—9000(G) TELEPHONE: 32-9-2358454(H) TELEFAX: 32—9—2231923(ii) TITLE OF INVENTION: DNA—constructs and methods to produceproteins using these DNA—constructs(iii) NUMBER OF SEQUENCES: 6(iv) COMPUTER READABLE FORM:(A) MEDIUM TYPE: Floppy disk(B) COMPUTER: IBM PC compatible(C) OPERATING SYSTEM: PC-DOS/MS-DOS(D) SOFTWARE: Patentln Release #1.0, Version #1.30 (EPO)(2) INFORMATION FOR SEQ ID NO: 1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 5373 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO?CAW0 98/13505(iv) ANTI—SENSE: NO(vi) ORIGINAL SOURCE:02265519 1999-03-17PCT/EP97/0521 7_ 23 _(A) ORGANISM: Arabidopsis thaliana(ix) FEATURE:(A) NAME/KEY: —(B) LOCATION:1..485(D) OTHER INFORMATION:/note:(ix) FEATURE:(A) NAME/KEY: -(13) LOCATION:486..52l1(D) OTHER INFORMATION: /note:(ix) FEATURE:(A) NAME/KEY: -(B) LOCATION:1263..1557(D) OTHER INFORMATION:/note:(ix) FEATURE:(A) NAME/KEY: -(B) LOCATION:l833..2l77(D) OTHER INFORMATION:/note:(ix) FEATURE:(A) NAME/KEY: -(B) LOCATION:2503..3003(D) OTHER INFORMATION:/note=(ix) FEATURE:(A) NAME/KEY: —(B) LOCATION:5212..5373(D) OTHER INFORMATION: /note:(xi)GAATTCACCA AGTGTTGGAT TGTTCACCCA CCAATAGGGA ACGTGAGCTG GGTTTAGACC"25S rDNA 3'end"" intergenic region""SalI box 1 ""SalI box 2""SalI box 3''‘'18s rDNA 5' end"SEQUENCE DESCRIPTION: SEQ ID NO: 1:60( ,,‘...._....»..........»..........—..................(,_. ,.?W0 98/13505GTCGTGAGACGTACGAGAGGCGCGAAGCTAAGCGACGCATCACGTGTCGTTTACCACCGATAAGTGGCAGTTCGACCCTCACACTAACAAGGTTAAATGTCGCTCGCAAAACCACGAAGGGAAGAGAAAGCAGACTTGTTGTGAGAAGAGGAGATAGAAGCAAATGATGGCAAACGTTCAGCGGAAATCGTCCGAGGAATAGGTTAGTTTAACCGTTGATCCGTGCGCTGGCGCCCGCCGTGGCTAAGTCGCGGCGGGTAAGTGGCCTTGCCCTAAATCAAGCAACAGCTTATTACTTGGGGTGGATAGTTGCATAGTGACGTGGGGAGACGAAAAGAAATAAGTCAAGATGTGAGATAGATGAAACACAATATGACAAATCCAGGATTCCGTCGATCCGCATACCCTACTGTCGCACAATTGATTATGACTCCCGATTGCCCGTTCGGCGGGAATCCTTTGCTGCCACGATCTCCAAAAAACCTTAACGAATAAGATTCCGGAGAATAATAGAAGAGTAAGCGCTCACGAACAGAAGAGAAGACAGACTTGTTCTCAAGCTAGGTAGTTGTCCCATGCCAACTCGACCAGGGACTTGGAAT-24-ATGCCCGCGTGGTCATCGCGGAACGCCTCTGACCCTCAGTAACGGTCGTTCAGACGACTTCCACTGAGATAACAATCCCCTTCCCAACTTGACCTCGCCAAGTGAAGAGATCAAGAGATAGGTGCATAGTTGCTTGGGGTTTCGAAAAGAAAGAAAGTTGTGAAAAGTCAGTAAAGAGAAACTTGAAATCCGTCGAGAAA02265519 1999-03-17CGCGATAGTACTTGGTTGAAAAGTCAGAATAGGAGCTTAGCGGACCGCCTAAATACGCGATCAGCCCTTTAATTCTACACTACACGAGCTAGTGTTTTGACAGACTTGTCGACTTGTCCAGAGAAGAGTATACACTCACGAACAAAAGAGTAAAAGCTAAAACACTTGGTAATGAAAACTGTCGAGGGGAAGTTTACCGGPCT/EP97/052 1 7ATTCAACCTA 120AAGCCAGTGG 180CCGGGCTAGA 240GCTCCAAAGG 300TGAATTATAA 360CGGGGTATTG 420GTCGCTAAGA 480AAGTGTTTCT 540CGTCTCTCGA 600AAACCCGCAA 660CAAAACGCCC 720AAAAGAAACG 780AGTCAAGAGA 840AAGGTGCATA 900AATGCTTGGG 960GAACTAGCAT 1020GATATGAACA 1080GGTGATTGTT 1140AAAAATCGGT 1200GTCCGAGGAT 1260?WO 98113505TTGTCGACCAAGGACGAGGACAGGTCCGAGAGAAAAATCTGAGGATTTGTTCCGAGACTTAGACATTTCAGGTGTGTGTAATAAGAATAAGAGTTGTTTTAGTTTACCGGGGTCCGAGGACAGGGGTTGAACCAGGAGTGAGGAATCGTCCCGAGGATTCTTTGGAACCGTATAAAGCTAATAAGAATAAACAAAAACAAGGAGTGGAAAATCGTCGACCACTTCATCGAATCGGGTCCGCGACCAGGTCCATCGACCGGATGTATGTTGGTGGGAATTTGAATAAGAAACTCAATCGGGGTCCGAAAATATCGTCGACCAATAGTCGACGAAATCGTCGGACCGGGTCCGTCGACCAGGGTGTCTCCTCTATAGGGGTGGAATAAGTAAAAACTCCATA CATCGTCGAGAAGGGTCCGAGGCCGGGTCCGAAGGAATCGTCCGAGACTTCAGTCCAAGTATGTGCCAAGAGTGCCCGCACGAAGAAAAAAATCCGAGGAATTTGTCGACCAAGGACGAGGACAGGTCCGAGAGAAAAATCTGAGGATTTGTTCCGAGACTTAGACATTTCAGGTGTGTGTATAAGAATAAGGAGTTGTTTT-25-AAATCTATCGATTTGTCGACGGATTCGTCGGACCAGGACGTCGACCGGGTTTGATTTTATGGAAAAGGGCCGCGCGCGCGAAAAAAAAAACGTCGATCTGGGAGTGGAAAATCGTCGACCACTTCATCGAATCGGGTCCGCGACCAGGTCCATCGACCGGATGTATGTTGGTGGGAATTTAATAAGAAAACTCAATCGGG02265519 1999-03-17GGTCCGAGGACAGGGGTTGAACCAGGAGTGAGGAATCGTCCCGAGGATTCTTTGGAACCGTATAAAGCTAAATAAGAATAAAAAAAACAAGACTTGGAATTCGTCGAGAAGGGTCCGAGGCCGGGTCCGAAGGAATCGTCCGAGACTTCAGTCCAAGTATGTGCCAAGAGTGCCCGCACGAGAAAAAAAATCCGAGGAATPCT/EP97/052 1 7ATCGTCGACC 1320AATCGTCGAC 1380GAAATCGTCG 1440GACCGGGTCC 1500GTCGACCAGG 1560GTGTCTCCTC 1620TATAGGGGTG 1680AGAATAAGTA 1740AAACTCCATA 1800CGTCGAGAAA 1860AAATCTATCG 1920ATTTGTCGAC 1980GGAATCGTCG 2040GACCAGGACG 2100TCGACCGGGT 2160TTGATTTTAT 2220GGAAAAGGGC 2280CGCGCGCGCG 2340AAAAAAAAAA 2400CGTCGATCTG 2460?CA 02265519 1999-03-17W0 98/13505 PCT/EP97/05217-26-GACTTGGAAT CGTCGAGAAA AGTTTACCGG GTCCGAAAAT TTGTCGACCA GGAGTGGAAA 2520TCGTCGAGAA AAATCTATCG GGTCCGAGGA ATCGTCGACC AGGACGAGGA ATCGTCGACC 2580GGGTCCGAGG ATTTGTCGAC CAGGGGTTGA AATCGTCGAC CAGGTCCGAG ACTTCATCGA 2640CCGGGTCCGA GGAATCGTCG ACCAGGACGA TGAATGGTCG ATGAAAATCT ATCGGGTTCG 2700AGGAATGGTC GACCAGGGGT TGAAATCGTC GACCAGGTCC GAGACTTCAT CGACCGTGTC 2760CGAGGAGTGG TCGAGGGTTT GTCGACCAGG ACGAGGAATC GTCGACCGGG TCCGAGGATT 2820TGTCGACCAG GGGTTGAAAT CGTCGACCAG GACCGAGAAT TCGTCGACCA GGACGGCGGA 2880ACCCTCGACC AGGACGATGA ATGGGCGATG AAAATCTATC GGGTTCGAGG AATGGTCGAC 2940CAGGGGTTGA AATCGTCGAC CAGGTCCGAG ACTTCATCGA CCGGGTCCGA GGATTCGTCG 3000ACCAGGACGG CCGGATGTCC GAGAAAAAAA AATGTTGCCG AATAACTTTC GAAAATCATT 3060GGATATGATG CAATGTTTTG TGATCGAATC TCTTAAAATA CATCAATAAA GAGTTTAGGA 3120TGTCAAGTTT GCATCAAATA TGCCCACGGA GCCCCAACTA GACCATGAAA ATCCGATGTT 3180GTATCAGGTC AAATGACCTA GCTAGAGGTG TCAAAAAATT ATGAAAATTT ACCAGAAAAT 3240AGGATTTAGT ATCCTTATGA TGCATGCCAA AAAGAATTTT CAAATTCCAA GTATTTCTTT 3300TTTCTTGGCA CCGGTGTCTC CTCAGACATT TCAATGTCTG TTGGTGCCAA GAGGGAAAAG 3360GGCTATTAAG CTATATAGGG GGGTGGGTGT TGAGGGAGTC TGGGCAGTCC GTGGGGAACC 3420CCCTTTTTCG GTTCGGACTT GGGTAGCGAT CGAGGGATGG TATCGGATAT CGGCACGAGG 3480AATGACCGAC CGTCCGGCCG CCGGGATTTT CGCCGGAAAA CTTTTCCGGG CACTTTTCCG 3540GCGATCGGTT TTGTTGCCTT TTTCCGAGTT TTCTCAGCAG TTCTCGGACA AAAACTGCTG 3600?W0 98/ 13505AATCGTCGAGGTGGCGGCGGTGGCCGAGAATGGCGGTATACTCGTCGCCGTTTGGGTGGCTTCCACCCGCTCCCGAGTGTCTGGAACGAGAACCTTCCGATGGCAACCATAATGTGAACCGCCTAGGCTGCGGCTAGGAAGGGTTTTTTAAAGATGTTCTTGATGAACGAGCATGGATCCCGTCCGTCTTTTTGAGTTAAGAGAATGGGCTATAAAAGTGGAATGGGCGTTAACTTGTTCAAGAGAATGGGGTATAGTCGCTAGGTTGGAGAGCGAGGTGACGGGTGGCAGTTTTGTTGACTTTTGATGGCTTGTCTCGCTCCCGAGTGTCTGGAACGAGAACCTTCCTATGGCAACCATAATGTGAACCGCCTAGGCTGCTTTCTTCTTTTGAACGTTCCATTGCTTGCGTTCGGAGTTTTGTCATGCGTGGCATGATATTGCGTGTCATGTCTTGCGCACTGGGCGTGCTTGAGTGTCGCAAGATTTCGATGTTATTCCGGAGTCCGGCTCTAGGTTGGAGAGCGAGGTGACGGGTAGCAGTTTTGTTGACTTTTGATGGCTTGTCTCGCTCCCGAAGTAAGCCGAGTACGGCGTATGAG-27-GGGCTGCCATTTCAGCAGTTGGCTGACATGACCGAGATGTGCATGGGCTGGAAATACCGATCGTCGGAAACCATGGGCATGTAGCACTTCAGAATTAGCAGTTCGATAGCTGGGCGTGCTTGAGTGTCGCAAGATTTCGATGTTATTCCGGAGTCCGGCTCTAGGTTGGATCTCGCGCTTTTCGGTAGATTGGTGATCGG02265519 1999-03-17TAGTTCTTCGCTCGGACAAAGATTCTTCGACCCCACGGGCACATGGATTCGATGTCCCCAGCATGGATCCCGACACCTTGATACTACCGTAACCGTAACGCGGCCAAGGGTCGTTGGAAACCATGGGCATGTAGCACTTCAGAATTAGCAGTTCGAAAGCTGGGCGTGCTGTACGGCTTTTAGTTGGAACATAGCTAGTGPCT/EP97/052 1 7AGGCGTTAGGAATTGCTGAGGGCCTAGGGGATCTTTTCACTCCTAGGCCGTGGGCATCGAGCCTAGGCTGCGGCTAGGAAGGGTTTTTTAAAGATGTTCTTGATGAACGAGCATGGATCCCGACACCTTGATACTACCGTAACCGTAACGCGGCCAAGGGTCGTTGGAAAGGCTCGGATTGATTGATGATTTCGTAGGCT36603720378038403900396040204080414042004260432043804440450045604620468047404800?CA 02265519 1999-03-17W0 93/13505 PCT/EP97/052 17-23-CCATGCTCGC GCATCGAACT ACCTACCACC TATCCTTCTC AGTTAATTCA CGGGCGATGT 4860TACGCTCGAT GATGAGTTCC GGGGCCTGTG TTTCGTACCT AATTTGAAGG AATTGTTGAG 4920TTTGGTTTAC ACCTTTGCCC GCGGCTTCTC CTTCGTGGGG AAGTCGTGGG CTCAAACATC 4980GGCGCTTGTT CACCTCTCGT CATCGCATTT GTTGCCTTGC TCGCATTGGT GAATGAGTTG 5040CGGGTTGAAA TCTCGGATGC GGAAAAGTTG TCGACGGTGA CTCGAAGTGA TTCAGTCCCG 5100CCAAAGCTCA TCCGTCCTTC GGGCAAAAGA TGACGGTCAA GACCTCGTCC TTTCTCTCTT 5160TCCATTGCGT TTGAGAGGAT GTGGCGGGGA ATTGCCGTGA TCGATGAATG CTACCTGGTT S220GATCCTGCCA GTAGTCATAT GCTTGTCTCA AAGATTAAGC CATGCATGTG TAAGTATGAA 5280CGAATTCAGA CTGTGAAACT GCGAATGGCT CATTAAATCA GTTATAGTTT GTTTGATGGT 5340AACTACTACT CGGATAACCG TAGTAATTCT AGA 5373(2) INFORMATION FOR SEQ ID NO: 2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(A) DESCRIPTION: /desc = "oligonuc1eotide"(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:CCAAGGTAAC CTTCGACGT 19(2)INFORMATION FOR SEQ ID NO:3:?CA 02265519 1999-03-17W0 98/13505 PCT/EP97/05217-29-(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(A) DESCRIPTION: /desc = "oligonucleotide"(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:CGAAGGTTAC CTTGGACGT 19(2) INFORMATION FOR SEQ ID NO: 4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(A) DESCRIPTION: /desc = "oligonucleotide E"(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:GAAGACGTCG AAGGTTACCT TGG 23(2) INFORMATION FOR SEQ ID NO: 5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid?CA 02265519 1999-03-17W0 98/13505-30-(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(A) DESCRIPTION: /desc = "oligonucleotide Q"(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:CCCGGTTCGC TCGCCGTTAC TAAG 24(2) INFORMATION FOR SEQ ID NO: 6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 236 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(A) DESCRIPTION: /desc = "5'end of the A. thaliana25S rDNA"(ix) FEATURE:(A)1numvKEY:-(B) LOCATION:l..10(D) OTHER INFORMATION:/note: "3' end of the 5SrDNA"(ix) FEATURE :(A)NmmnmY:—(B) LOCATION:198..236(D) OTHER INFORMATION:/note: "3' end Of the 25S rDNA"(ix) FEATURE:(A) NAME/KEY: -(B) LOCATION:220PCT/EP97/052 1 7(D) OTHER INFORMATION:/note: "previously assumed 5'end of?CA 02265519 1999-03-17W0 98/13505 PCT/EP97/05217- 31 _the 25S rDNA"(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:GGTGTCACAA ATCGTCGTCC CTCACCATCC TTTGCTGATG CGGGACGGAA GCTGGTCTCC 60CGTGTGTTAC CGCACGCGTT GGCCTAAATC CGAGCCAAGG ACGCCTGGAG CGTACCGACA 120TGCGGTGGTG AACTTGATCC ATTACATTTT ATCGGTCGCT CTTGTCCGGA AGCTGTAGAT 180GACCCAAAGT CCATATAGCG ACCCCAGGTC AGGCGGGATT ACCCGCTGAG TTTAAG 236

Claims (16)

Claims

1. A DNA construct, comprising the following operably linked DNA fragments:
- a DNA fragment comprising a ribosomal DNA sequence, preferably derived from a plant;
- a fragment comprising an expressible promoter region, especially a plant-expressible promoter region;
- a heterologous coding region; and optionally - a transcription termination and polyadenylation region, preferably a region which is active in plant cells.

2. A DNA-construct according to claim 1, wherein said plant-expressible promoter region is a promoter recognized by RNA polymerase II.

3. A DNA-construct according to claim 1, wherein said ribosomal DNA comprises the promoter.

4. A DNA-construct according to any one of claims 1 to 3, wherein said ribosomal DNA
sequence is derived from the plant comprising the DNA-construct.

5. A DNA-construct according to any one of claims 1 to 4, wherein said ribosomalDNA sequence is derived from the intergenic region of the ribosomal DNA.

6. A DNA construct according to claim 5, wherein said ribosomal DNA sequence comprises the upstream Sall repeats from the intergenic region from the ribosomal DNA of Arabidopsis thaliana or a similar region from another plant.

7. A DNA construct according to any one of claims 1 to 4, wherein said ribosomal DNA
sequence comprises a DNA sequence selected from the DNA sequence of SEQ ID N°
1 from nucleotide position 486 to 5212, the DNA sequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position 3003, the DNA sequence of SEQ IDN° 1 from nucleotide position 569 to nucleotide position 2862, the DNA sequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position 2862, the DNA
sequence of SEQ ID N° 1 from nucleotide position 486 to 5212, the DNA sequence of SEQ ID N° 1 from nucleotide position or 596 to 5373.

8. A DNA-construct according to any one of claims 1 to 7, wherein said heterologous coding region encodes a vaccine, an antibody, a therapeutical protein, an insecticidal protein such as a Bt toxin or the minimal toxic fragment thereof, aprotein used in food technology, an antisense-RNA or a ribozyme.

9. A DNA construct according to claim 1, wherein the DNA construct is comprised within a T-DNA transformation vector.

10. A method to produce proteins, comprising the following steps:
- introducing a DNA-construct of any one of claims 1 to 9 in a suitable host organism;
- cultivating the host-organism under conditions which allow expression of the protein encoded by the heterologous coding region; and - harvesting the expressed protein.

11. A method for enhancing the stability, the copy number or the expression of a transgene, especially in a plant, comprising the following steps:
- introducing a DNA construct of any one of claims 1 to 9 in a cell, preferably in a plant cell; and - regenerating an organism, preferably a plant, from the transformed cell.

12. A method according to claim 11, wherein said plant is selected from Arabidopsis thaliana, tobacco, corn, wheat, potato, rice, soy beans, barley, rye, a Brassicaspecies, a Beta species or manioc.

13. A cell, preferably a plant cell, comprising the DNA-constructs of any one of claims 1 to 9, integrated in the nuclear genome.

14. A plant cell according to claim 13, wherein said plant cell is derived from Arabidopsis thaliana, tobacco, corn, wheat, potato, rice, soy beans, barley, rye, a Brassica vegetable, a Beta species or manioc.

15. A plant comprising the plant cells of claim 13.

16. The use of a DNA fragment comprising the intergenic region of a ribosomal DNA of a plant, to enhance stability, the copy number or the expression of a transgene in a plant.