CA2265455A1 - Granulocyte chemotactic protein 2 variant - Google Patents

Abstract

The present invention provides a polynucleotide which identifies and encodes a novel human granulocyte chemotactic protein 2 variant (NGCP). The invention provides for genetically engineered expression vectors and host cells comprising the nucleic acid sequence encoding NGCP. The invention also provides for the production and use of substantially purified NGCP in pharmaceutical compositions to stop cell division in cancerous cells. The invention also describes diagnostic assays which utilize the polynucleotide to hybridize with the transcripts encoding NGCP and anti-NGCP antibodies which specifically bind to NGCP.

Description

?l015202530CA 02265455 1999-03-08W0 98/11227 PCTIUS97/ 16034GRANULOCYTE CHEMOTACTIC PROTEIN 2 VARIANTThe present invention relates to nucleic acid and amino acid sequences of a novelgranulocyte chemotactic protein 2 variant which shares features with alpha intercrines and to theuse of these sequences in the diagnosis, study, prevention and treatment of disease.BACKGROUND ARTChemokines are small polypeptides,‘generally about 70-100 amino acids in length, 6-11kD in molecular weight, and active over a 1-100 ng/ml concentration range. Initially, they wereisolated and puri?ed from in?amed tissues and characterized relative to their bioactivity. Morerecently, chemokines have been discovered and produced through molecular cloning techniquesand characterized by structural as well as ?mctional analysis.Chemokines participate in gradients of chemoattractant factors which are involved inleukocyte traf?cking in different in?ammatory situations. They mediate the expression ofparticular adhesion molecules on endothelial cells, stimulate proliferation of speci?c cell types,and regulate the activation of cells which bear speci?c receptors.The chemokines are related through cysteine motifs and generally fall into three families,CXC chemokines (at), CC chemokines (B) and C chemokines (g; Graves DT and Y J iang (1995)Crit Rev Oral Biol Med 6:109-118 and Kelner G et al (1994) Science 26621395-99). CXCchemokines include the well described platelet factor-4 as well as the nonplatelet chemokinesepithelial-derived neutrophil attractant-78 (ENA-78) and granulocyte chemotactic protein-2(GCP-2). Chemokines are generally expressed and secreted in response to proin?ammatorycytokines, such as interleukin-1B and tumor necrosis factor, endotoxin, mitogens, particulates,bacteria or viruses.ENA-78 consists of 76 amino acids and has a molecular weight of 8,357 (Walz A et al(1991) J Exp Med 174:1355—62). When endothelial cells express and secrete ENA-78, itstimulates neutrophils, chemotaxis, increased intracellular calcium, and exocytosis. The genomicDNA for ENA-78 was cloned by Corbett et al (1994; Biochem Biophys Res Commun 2052612-17) from human chromosome 4 as a 2.2 kb fragment containing four exons and three introns. Theopen reading frame of 342 nucleotides encodes a protein of 114 amino acids. The upstream?anking region is contains a promoter binding site for nuclear factor kappa B (Chang M et al(1994) J Biol Chem 269:41:25277-82).GCP-2 is a 6 kD protein isolated from the supematants of human MG63 osteosarcoma-1-?1015202530CA 02265455 1999-03-08WO 98/11227 PCTIUS97/16034cells. Proost et al (1993) J Immunol l50:lOO0-10) identi?ed this cxc chemokine by amino acidsequencing and report that using HPLC separation, GCP-2 appears to exists in» four different N-terminal forms. At concentrations of 3-10 nM, GCP-2 attracts and activates neutrophils m_v_itr_o_,causes granulocyte accumulation i_n y_iy_o_, and has no effect on monocytes.Chemokines and their chemoattractant activities are being studied to provide a betterunderstanding of and the means for intervening at the molecular level in various pathogenicprocesses. Hirose et al (1995; Br J Cancer 72:708—714) showed that the transfection ofchemokine genes into tumor cells of nude mice reduced tumorigenicity. This anti-tumor activitywas attributed to the recruitment and activity of neutrophilic granulocytes to the site of thecancer.Broxmeyer HE et al (1995; Ann Hematol 712235-24) evaluated the myelosuppressiveeffects of Chemokines on bone marrow and cord blood progenitor cell populations. Preincubationof the effective chemokines in acetonitril enhanced suppression of granulocyte-macrophage,erythroid and multipotential progenitor cells. These results suggested daily chemokine treatmentmay be useful for patients with acute or chronic leukemia.In contrast, the suppression of chemokine expression and secretion may be use?il inpreventing pathogenesis in myocardial tissues. Seino Y et al (1995; Cytokine 7:301-304) usedPCR to show the expression of leukocyte CC and CXC chemotactic cytokines in endomyocardialbiopsies from patients with idiopathic dilated cardiomyopathy. This suggests that cytotoxicaction of leukocytes recruited to the site might be contributing to in?ammatory heart muscledisorders.The discovery of a new CXC Chemokines provides the opportunity to extend theknowledge of the various steps in these pathologic processes and to develop effective therapies tointervene in various forms of cancer and heart disease.DISCLOSURE OF THE INVENTIONThe present invention discloses a novel granulocyte chemotactic protein 2 variant,hereinafter referred to as NGCP, which shares features with other alpha intercrines involved inthe chemoattraction and activation of leukocytes, particularly neutrophils and granulocytes.Accordingly, the invention features a substantially puri?ed NGCP, as shown in the amino acidsequence of SEQ ID NO:l.One aspect of the invention features isolated and substantially purified polynucleotideswhich encode NGCP. In a particular aspect, the polynucleotide is the nucleotide sequence of-2-?1015202530CA 02265455 1999-03-08W0 98/11227 PCT/US97/16034SEQ ID N012. In addition, the invention features polynucleotide sequences that hybridize understringent conditions to SEQ ID NO:2.The invention further relates to the nucleic acid sequence encoding NGCP,oligonucleotides, peptide nucleic acids, fragments, portions or antisense molecules thereof. Thepresent invention relates, in part, to the inclusion of the nucleic acid sequence encoding NGCP inan expression vector which can be used to transform host cells or organisms. The invention alsoprovides therapeutic transformation of cells or tissues involved in the cancers, particularlymelanomas and cytokine sensitive tumors, immune de?ciencies, or excessive immune responses.The present invention also relates to a method for producing NGCP or a fragment thereof.It contemplates the delivery of purified NGCP, alone or in a pharmaceutically acceptableexcipient, to cancerous cells or tissues. It also encompasses antibodies which bind specifically toNGCP and can be used to monitor testing of cytokine sensitive tumors and immune systemdisorders.BRIEF DESCRIPTION OF DRAWINGSFigures 1A and 1B shows the amino acid sequence (SEQ ID N021) and nucleic acidsequence (SEQ ID N0:2) of the novel granulocyte chemotactic protein 2 variant. The alignmentwas produced using MacDNAsisTM software (Hitachi Software Engineering Co Ltd, San BrunoCA).Figure 2 shows the amino acid sequence aligmnents among granulocyte chemotacticprotein 2 variant (SEQ ID N0:l),ENA-78 (GI 607031; SEQ ID NO:3; Walz et al, supra), GCP—2(GI 462170; SEQ ID N014; Proost et al, supra) and GCP—2 (GI 415589; SEQ ID NO:5; Proost etal (1993) Biochemistry 32:10} 70-77). These alignments were produced using the multisequencealignment program of DNAStarTM software (DNAStar Inc, Madison WI).Figure 3 shows the hydrophobicity plot for granulocyte chemotactic protein 2 variant,SEQ ID NO:1 (MacDNAsis software); the X axis re?ects amino acid position, and the negativeY axis, hydrophobicity.Figure 4 shows the hydrophobicity plot for ENA-78, SEQ ID N023.Figure 5 shows the isoelectric plot for granulocyte chemotactic protein 2 variant, SEQ IDN021 (MacDNAsis software).Figure 6 shows the isoelectric plot for ENA-78, SEQ ID N024.Figures 7A and 7B shows the alignment between the nucleic acid sequences ofgranulocyte chemotactic protein 2 variant and a human EST annotated as 5" similar to-3-?1015202530CA 02265455 1999-03-08WO 98111227 PCT/US97ll6034granulocyte chemotactic protein—2 (GI 973875; Hillier L et al (1995) Unpublished; DNAStarTMsoftware).MODES FOR CARRYING OUT THE INVENTIONDe?nitjggs“Nucleic acid sequence” as used herein refers to an oligonucleotide, nucleotide orpolynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or syntheticorigin which may be single- or double-stranded, and represent the sense or antisense strand.Similarly, amino acid sequence as used herein refers to peptide or protein sequence."Consensus" as used herein may refer to a nucleic acid sequence 1) which has beenresequenced to resolve uncalled bases, 2) which has been extended using XL-PCR (PerkinElmer) in the 5' or the 3' direction and resequenced, 3) which has been assembled from theoverlapping sequences of more than one Incyte clone GCG Fragment Assembly System, (GCG,Madison WI), or 4) which has been both extended and assembled.“Peptide nucleic acid” as used herein refers to a molecule which comprises an oligomer towhich an amino acid residue, such as lysine, and an amino group have been added. These smallmolecules, also designated anti-gene agents, stop transcript elongation by binding to theircomplementary (template) strand of nucleic acid (Nielsen PE et al (1993) Anticancer Drug Des8:53-63).A "deletion" is de?ned as a change in either nucleotide or amino acid sequence in whichone or more nucleotides or amino acid residues, respectively, are absent.An "insertion” or “addition" is that change in a nucleotide or amino acid sequence whichhas resulted in the addition of one or more nucleotides or amino acid residues, respectively, ascompared to the naturally occurring NGCP.A "substitution" results from the replacement of one or more nucleotides or amino acidsby different nucleotides or amino acids, respectively.As used herein, NGCP refers to the amino acid sequence of substantially puri?ed NGCPobtained from any species, particularly mammalian, including bovine, ovine, porcine, murine,equine, and preferably human, from any source whether natural, synthetic, semi-synthetic orrecombinant.A “variant” of NGCP is defined as an amino acid sequence differs by one or more aminoacids. The variant may have “conservative” changes, wherein a substituted amino acid hassimilar structural or chemical properties, eg, replacement of leucine with isoleucine. More rarely,?1015202530CA 02265455 1999-03-08W0 98/11227 PCT/US97/16034a variant may have “nonconservative” changes, eg, replacement of a glycine with a tryptophan.Similar minor variations may also include amino acid deletions or insertions, or both. Guidancein determining which and how many amino acid residues may be substituted, inserted or deletedwithout abolishing biological or immunological activity may be found using computer programswell known in the art, for example, DNAStar software.The term “biologically active” refers to NGCP having structural, regulatory orbiochemical functions of a naturally occurring NGCP. Likewise, "immunologically active"defines the capability of the natural, recombinant or synthetic NGCP, or any oligopeptide thereof,to induce a speci?c immune response in appropriate animals or cells and to bind with specificantibodies.The term "derivative" as used herein refers to the chemical modi?cation of a nucleic acidencoding NGCP or the encoded NGCP. Illustrative of such modifications would be replacementof hydrogen by an alkyl, acyl, or amino group. A nucleic acid derivative would encode apolypeptide which retains essential biological characteristics of natural NGCP.As used herein, the term “substantially purified” refers to molecules, either nucleic oramino acid sequences, that are removed from their natural environment, isolated or separated,and are at least 60% free, preferably 75% free, and most preferably 90% free from othercomponents with which they are naturally associated.The term "hybridization" as used herein shall include "any process by which a strand ofnucleic acid joins with a complementary strand through base pairing" (Coombs J (1994)Dictionary _o_f Biotechnology, Stockton Press, New York NY). Ampli?cation is defined as theproduction of additional copies of a nucleic acid sequence and is generally carried out usingpolymerase chain reaction technologies well known in the art (Dieffenbach CW and GS Dveksler(1995) E3 _P_rrmg, a Laboratory Marga, Cold Spring Harbor Press, Plainview NY).“Stringency” typically occurs in a range from about Tm—5°C (5°C below the Tm of theprobe)to about 20°C to 25°C below Tm. As will be understood by those of skill in the art, astringency hybridization can be used to identify or detect identical polynucleotide sequences or toidentify or detect similar or related polynucleotide sequences.DescriptionThe consensus nucleotide sequence, disclosed herein, encodes a novel granulocytechemotactic protein-2 variant of 114 amino acid residues (SEQ ID NO:1). The consensussequence is based on the extension and assembly of Incyte clones 949299 (PANCNOT05) and-5-?1015202530CA 02265455 1999-03-08‘W0 98/1 1227 PCT/U S97/ 160341321776 (BLADNOT04).The nucleotide and amino acid alignments of NGCP are shown in Figures 1A and 1B.Figure 2 presents the alignment and shows the conserved cysteine residues, C,9, C49, C5,, C75, andC9,, among NGCP and the related chemokines, ENA-78 (GI 607031; SEQ ID NO:3); and GCP-2(GI 462170; SEQ ID N024 and GI 415589; SEQ ID NO:5). The hydrophobicity plots of NGCP(Figure 3) and ENA-78 (Figure 4) are similar; however as shown in Figure 2, there are signi?cantdifferences between the actual residues that comprise the leader and mature protein sequences ofthese molecules. In addition the isoelectric points of NGCP and ENA-78 are 10.34 and 9.10,respectively. Figures 7A and 7B shows the alignment and 70% identity between the nucleic acidsequences of NGCP and the human EST (GI 973875; SEQ ID N016) annotated as 5" similar togranulocyte chemotactic protein-2. A three frame translation of the first 180 nucleotides of thissequence reveals several frame shifts and predicts the exact leader sequence for the publishedENA-78 peptide. NGCP displays the general has no obvious N-glycosylation sites.The NGCP Coding SequencesThe nucleic acid and deduced amino acid sequences of NGCP are shown in Figures 1Aand 1B. In accordance with the invention, any nucleic acid sequence which encodes NGCP canbe used to generate recombinant molecules which express NGCP. In a speci?c embodimentdescribed herein, a partial sequence encoding NGCP was ?rst isolated as Incyte Clone 949299from a pancreas CDNA library (PANCNOT05).It will be appreciated by those skilled in the art that as a result of the degeneracy of thegenetic code, a multitude of NGCP-encoding nucleotide sequences, some bearing minimalhomology to the nucleotide sequences of any known and naturally occurring gene may beproduced. The invention contemplates each and every possible variation of nucleotide sequencethat could be made by selecting combinations based on possible codon choices. Thesecombinations are made in accordance with the standard triplet genetic code as applied to thenucleotide sequence encoding naturally occurring NGCP, and all such variations are to beconsidered as being speci?cally disclosed.Although nucleotide sequences which encode NGCP and its variants are preferablycapable of hybridizing to the nucleotide sequence of the naturally occurring sequence underappropriately selected conditions of stringency, it may be advantageous to produce nucleotidesequences encoding NGCP or its derivatives possessing a substantially different codon usage.Codons may be selected to increase the rate at which expression of the peptide occurs in a-6-?10152025'30CA 02265455 1999-03-08WO 98111227 PCT/U S97/ 16034particular prokaryotic or eukaryotic expression host in accordance with the frequency with whichparticular codons are utilized by the host. Other reasons for substantially altering the nucleotidesequence encoding NGCP and its derivatives without altering the encoded amino acid sequencesinclude the production of RNA transcripts having more desirable properties, such as a greaterhalf-life, than transcripts produced from the naturally occurring sequence.It is now possible to produce a DNA sequence, or portions thereof, encoding NGCP andits derivatives entirely by synthetic chemistry, after which the synthetic gene may be inserted intoany of the many available DNA vectors and cell systems using reagents that are well known inthe art at the time of the ?ling of this application. Moreover, synthetic chemistry may be used tointroduce mutations into a sequence encoding NGCP or any portion thereof.Also included within the scope of the present invention are polynucleotide sequences thatare capable of hybridizing to the nucleotide sequence of Figure 1 under various conditions ofstringency. Hybridization conditions are based on the melting temperature (Tm) of the nucleicacid binding complex or probe, as taught in Berger and Kimmel (1987, gage to MolecularQl_o_r_1i_ng Techniques, Methods in Enzymolggy, Vol 152, Academic Press, San Diego CA)incorporated herein by reference, and may be used at a defined “stringency”.Altered nucleic acid sequences encoding NGCP which may be used in accordance withthe invention include deletions, insertions or substitutions of different nucleotides resulting in apolynucleotide that encodes the same or a functionally equivalent NGCP. The protein may alsoshow deletions, insertions or substitutions of amino acid residues which produce a silent changeand result in a functionally equivalent NGCP. Deliberate amino acid substitutions may be madeon the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or theamphipathic nature of the residues as long as the biological activity of NGCP is retained. Forexample, negatively charged amino acids include aspartic acid and glutamic acid; positivelycharged amino acids include lysine and arginine; and amino acids with uncharged polar headgroups having similar hydrophilicity values include leucine, isoleucine, valine; glycine, alanine;asparagine, glutamine; serine, threonine phenylalanine, and tyrosine.Included within the scope of the present invention are alleles encoding NGCP. As usedherein, an “allele” or “allelic sequence” is an alternative form of the nucleic acid sequenceencoding NGCP. Alleles result from a mutation, ie. a change in the nucleic acid sequence, andgenerally produce altered mRNAs or polypeptides whose structure or function may or may not bealtered. Any given gene may have none, one or many allelic forms. Common mutational-7-?1015202530CA 02265455 1999-03-08W0 98/11227 PCT/US97/16034changes which give rise to alleles are generally ascribed to natural deletions, additions orsubstitutions of amino acids. Each of these types of changes may occur alone, or in combinationwith the others, one or more times in a given sequence.Methods for DNA sequencing are well known in the art and employ such enzymes as theKlenow fragment of DNA polymerase I, Sequenase® (US Biochemical Corp, Cleveland OH)),Taq polymerase (Perkin Elmer, Norwalk CT), thermostable T7 polymerase (Amersham, ChicagoIL), or combinations of recombinant polymerases and proofreading exonucleases such as theELONGASE Ampli?cation System marketed by Gibco BRL (Gaithersburg MD). Preferably, theprocess is automated with machines such as the Hamilton Micro Lab 2200 (Hamilton, Reno NV),Peltier Thermal Cycler (PTC200; MJ Research, Watertown MA) and the ABI 377 DNAsequencers (Perkin Elmer).Extending the Polynucleotide SequenceThe polynucleotide sequence encoding NGCP may be extended utilizing partialnucleotide sequence and various methods known in the art to detect upstream sequences such aspromoters and regulatory elements. Gobinda et al (1993; PCR Methods Applic 2:318-22)disclose “restriction-site" polymerase chain reaction (PCR) as a direct method which usesuniversal primers to retrieve unknown sequence adjacent to a known locus. First, genomic DNAis ampli?ed in the presence of primer to a linker sequence and a primer speci?c to the knownregion. The ampli?ed sequences are subjected to a second round of PCR with the same linkerprimer and another specific primer internal to the ?rst one. Products of each round of PCR aretranscribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.Inverse PCR can be used to amplify or extend sequences using divergent primers basedon a known region (Triglia T et al (1988) Nucleic Acids Res 16:81 86). The primers may bedesigned using OLIGO® 4.06 Primer Analysis Software (1992; National Biosciences Inc,Plymouth MN), or another appropriate program, to be 22-30 nucleotides in length, to have a GCcontent of 50% or more, and to anneal to the target sequence at temperatures about 68°-72° C.The method uses several restriction enzymes to generate a suitable fragment in the known regionof a gene. The fragment is then circularized by intramolecular ligation and used as a PCRtemplate.Capture PCR (Lagerstrom M et al (1991) PCR Methods Applic 1:111-19) is a method forPCR ampli?cation of DNA fragments adjacent to a known sequence in human and yeast arti?cialchromosome DNA. Capture PCR also requires multiple restriction enzyme digestions and-3-?1015202530CA 02265455 1999-03-08W0 98/1 1227 PCT /US97/16034ligations to place an engineered double-stranded sequence into an unknown portion of the DNAmolecule before PCR.Another method which may be used to retrieve unknown sequence is walking PCR(Parker JD et al (1991) Nucleic Acids Res 1923055-60), a method for targeted gene walking.Alternatively, PCR, nested primers, PromoterFinderTM (Clontech, Palo Alto CA) andPromoterFinder libraries can be used to walk in genomic DNA. This process avoids the need toscreen libraries and is useful in ?nding intron/exon junctions.Preferred libraries for screening for full length cDNAs are ones that have beensize-selected to include larger cDNAs. Also, random primed libraries are preferred in that theywill contain more sequences which contain the 5' and upstream regions of genes. A randomlyprimed library may be particularly useful if an oligo d(T) library does not yield a full-lengthcDNA. Genomic libraries are useful for extension into the 5' nontranslated regulatory region.Capillary electrophoresis may be used to analyze either the size or confirm the nucleotidesequence in sequencing or PCR products. Systems for rapid sequencing are available fromPerkin Elmer, Beckman Instruments (Fullerton CA), and other companies. Capillary sequencingmay employ ?owable polymers for electrophoretic separation, four different ?uorescent dyes(one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by acharge coupled devise camera. Output/light intensity is converted to electrical signal usingappropriate software (eg. Genotyperm and Sequence Navigator” from Perkin Elmer) and theentire process from loading of samples to computer analysis and electronic data display iscomputer controlled. Capillary electrophoresis is particularly suited to the sequencing of smallpieces of DNA which might be present in limited amounts in a particular sample. Thereproducible sequencing of up to 350 bp of M13 phage DNA in 30 min has been reported(Ruiz-Martinez MC et al (1993) Anal Chem 6522851-8).Expression of the Nucleotide SequenceIn accordance with the present invention, polynucleotide sequences which encode NGCP,fragments of the polypeptide, fusion proteins or functional equivalents thereof may be used inrecombinant DNA molecules that direct the expression of NGCP in appropriate host cells. Dueto the inherent degeneracy of the genetic code, other DNA sequences which encode substantiallythe same or a functionally equivalent amino acid sequence, may be used to clone and expressNGCP. As will be understood by those of skill in the art, it may be advantageous to produceNGCP-encoding nucleotide sequences possessing non-naturally occurring codons. Codons-9-?1015202530CA 02265455 1999-03-08W0 98/11227 PCT/US97/ 16034preferred by a particular prokaryotic or eukaryotic host (Murray E et al (1989) Nuc Acids Res17:477-508) can be selected, for example, to increase the rate of NGCP expression or to producerecombinant RNA transcripts having desirable properties, such as a longer half-life, thantranscripts produced from naturally occurring sequence.The nucleotide sequences of the present invention can be engineered in order to alterNGCP-encoding sequence for a variety of reasons, including but not limited to, alterations whichmodify the cloning, processing and/or expression of the gene product. For example, mutationsmay be introduced using techniques which are well known in the art, eg, site-directedmutagenesis to insert new restriction sites, to alter glycosylation patterns, to change codonpreference, to produce splice variants, etc.In another embodiment of the invention, a natural, modified or recombinant NGCP-encoding sequence may be ligated to a heterologous sequence to encode a fusion protein. Forexample, for screening of peptide libraries for inhibitors of NGCP activity, it may be useful toencode a chimeric NGCP protein that is recognized by a commercially available antibody. Afusion protein may also be engineered to contain a cleavage site located between NGCP and theheterologous protein sequence, so that the NGCP may be cleaved and substantially puri?ed awayfrom the heterologous moiety.In an alternate embodiment of the invention, the sequence encoding NGCP may besynthesized, whole or in part, using chemical methods well known in the art (see Caruthers MHet al (1980) Nuc Acids Res Symp Ser 215-23, Horn T et al(1980) Nuc Acids Res Symp Ser225-32, etc). Alternatively, the protein itself could be produced using chemical methods tosynthesize an amino acid sequence for NGCP, whole or in part. For example, peptide synthesiscan be performed using various solid-phase techniques (Roberge J Y et al (1995) Science269:202-204) and automated synthesis may be achieved, for example, using the ABI 431APeptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by themanufacturer.The newly synthesized peptide can be substantially puri?ed by preparative highperformance liquid chromatography (eg, Creighton (1983) Proteins, Structures 2_1_n_d MolecularPrinciples, WH Freeman and Co, New York NY). The composition of the synthetic peptidesmay be con?rmed by amino acid analysis or sequencing (eg, the Edman degradation procedure;Creighton, supra). Additionally the amino acid sequence of NGCP, or any part thereof, may bealtered during direct synthesis and/or combined using chemical methods with sequences from-10-?1015202530CA 02265455 1999-03-08W0 98/ 11227 PCT/US97/16034other proteins, or any part thereof, to produce a variant polypeptide.Expression SystemsIn order to express a biologically active NGCP, the nucleotide sequence encoding NGCPor its functional equivalent, is inserted into an appropriate expression vector, ie, a vector whichcontains the necessary elements for the transcription and translation of the inserted codingsequence.Methods which are well known to those skilled in the art can be used to constructexpression vectors containing a sequence encoding NGCP and appropriate transcriptional ortranslational controls. These methods include in mm recombinant DNA techniques, synthetictechniques and i_n gm recombination or genetic recombination. Such techniques are described inSambrook et al (1989) Molecular Q19_rnr_1,g, A Laboratog Man?, Cold Spring Harbor Press,Plainview NY and Ausubel FM et al (1989) Current Protocols i_n Molecular Bplqgy, John Wiley& Sons, New York NY.A variety of expression vector/host systems may be utilized to contain and express asequence encoding NGCP. These include but are not limited to microorganisms such as bacteriatransformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors; yeasttransformed with yeast expression vectors; insect cell systems infected with virus expressionvectors (eg, baculovirus); plant cell systems transfected with virus expression vectors (eg,cauli?ower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with bacterialexpression vectors (eg, Ti or pBR322 plasmid); or animal cell systems.The “control elements” or “regulatory sequences” of these systems vary in their strengthand speci?cities and are those nontranslated regions of the vector, enhancers, promoters, and 3’untranslated regions, which interact with host cellular proteins to carry out transcription andtranslation. Depending on the vector system and host utilized, any number of suitabletranscription and translation elements, including constitutive and inducible promoters, may beused. For example, when cloning in bacterial systems, inducible promoters such as the hybridlacZ promoter of the B1uescript® phagemid (Stratagene, La.Iolla CA) or pSportl (Gibco BRL)and ptrp-lac hybrids and the like may be used. The baculovirus polyhedrin promoter may beused in insect cells. Promoters or enhancers derived from the genomes of plant cells (eg, heatshock, RUBISCO; and storage protein genes) or from plant viruses (eg, viral promoters or leadersequences) may be cloned into the vector. In mammalian cell systems, promoters from themammalian genes or from mammalian viruses are most appropriate. If it is necessary to generate-11-?1015202530CA 02265455 1999-03-08W0 98/ 11227 PCT/US97/16034a cell line that contains multiple copies of the sequence encoding NGCP, vectors based on SV4Oor EBV may be used with an appropriate selectable marker.In bacterial systems, a number of expression vectors may be selected depending upon theuse intended for NGCP. For example, when large quantities of NGCP are needed for theinduction of antibodies, vectors which direct high level expression of fusion proteins that arereadily puri?ed may be desirable. Such vectors include, but are not limited to, themultifunctional _E. go_l_i cloning and expression vectors such as Bluescript® (Stratagene), in whichthe sequence encoding NGCP may be ligated into the vector in frame with sequences for theamino-terminal Met and the subsequent 7 residues of B-galactosidase so that a hybrid protein isproduced; pIN vectors (Van Heeke & Schuster (1989) J Biol Chem 264:5503-5509); and the like.pGEX vectors (Promega, Madison WI) may also be used to express foreign polypeptides asfusion proteins with glutathione S—transferase (GST). In general, such fusion proteins are solubleand can easily be puri?ed from lysed cells by adsorption to glutathione-agarose beads followedby elution in the presence of free glutathione. Proteins made in such systems are designed toinclude heparin, thrombin or factor XA protease cleavage sites so that the cloned polypeptide ofinterest can be released from the GST moiety at will.In the yeast, Saccharomyces cerevisiae, a number of vectors containing constitutive orinducible promoters such as alpha factor, alcohol oxidase and PGH may be used. For reviews,see Ausubel et al (supra) and Grant et al (1987) Methods in Enzymology 1532516-544.In cases where plant expression vectors are used, the expression of a sequence encodingNGCP may be driven by any of a number of promoters. For example, viral promoters such as the35S and 19S promoters of CaMV (Brisson et al (1984) Nature 310251 1-514) may be used aloneor in combination with the omega leader sequence from TMV (Takamatsu et al (1987) EMBO J6:307-311). Alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al(1984) EMBO J 3:167l—l680; Broglie et al (1984) Science 224:838-843); or heat shockpromoters (Winter J and Sinibaldi RM (1991) Results Probl Cell Differ 17:85-105) may be used.These constructs can be introduced into plant cells by direct DNA transformation orpathogen-mediated transfection. For reviews of such techniques, see Hobbs S or Murry LE inMcGraw Hill Yearbook 9_f Science ad Technology (1992) McGraw Hill New York NY, pp191-196 or Weissbach and Weissbach (1988) Methods _?)_r Plant Molecular Biology, AcademicPress, New York NY, pp 421-463.An alternative expression system which could be used to express NGCP is an insect-12-?1015202530CA 02265455 1999-03-08W0 98/1 1227 PCT/U S97/ 16034system. In one such system, Aytogi galifgmica nuclear polyhedrosis virus (AcNPV) is usedas a vector to express foreign genes in S?gpteg frugiperda cells or in richo us'a larvae. Thesequence encoding NGCP may be cloned into a nonessential region of the virus, such as thepolyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion ofthe sequence encoding NGCP will render the polyhedrin gene inactive and produce recombinantvirus lacking coat protein coat. The recombinant viruses are then used to infect S. frugiperdacells or Tricho usia larvae in which NGCPis expressed (Smith et al (1983) J Virol 46:584;Engelhard EK et al (1994) Proc Nat Acad Sci 91 :3224-7).In mammalian host cells, a number of viral4based expression systems may be utilized. Incases where an adenovirus is used as an expression vector, a sequence encoding NGCP may beligated into an adenovirus transcription/ translation complex consisting of the late promoter andtripartite leader sequence. Insertion in a nonessential E1 or E3 region of the viral genome willresult in a viable virus capable of expressing in infected host cells (Logan and Shenk (1984) ProcNatl Acad Sci 8123655-59). In addition, transcription enhancers, such as the rous sarcoma virus(RSV) enhancer, may be used to increase expression in mammalian host cells.Specific initiation signals may also be required for efficient translation of a sequenceencoding NGCP. These signals include the ATG initiation codon and adjacent sequences. Incases where the sequence encoding NGCP, its initiation codon and upstream sequences areinserted into the most appropriate expression vector, no additional translational control signalsmay be needed. However, in cases where only coding sequence, or a portion thereof, is inserted.exogenous transcriptional control signals including the ATG initiation codon must be provided.F urtherrnore, the initiation codon must be in the correct reading frame to ensure transcription ofthe entire insert. Exogenous transcriptional elements and initiation codons can be of variousorigins, both natural and synthetic. The efficiency of expression may be enhanced by theinclusion of enhancers appropriate to the cell system in use (Scharf D et al (1994) Results ProblCell Differ 20: 125-62; Bittner et al (1987) Methods in Enzymol 153:5l6-544).In addition, a host cell strain may be chosen for its ability to modulate the expression ofthe inserted sequences or to process the expressed protein in the desired fashion. Suchmodifications of the polypeptide include, but are not limited to, acetylation, carboxylation,glycosylation, phosphorylation, lipidation and acylation. Post-translational processing whichcleaves a "prepro" form of the protein may also be important for correct insertion, folding and/orfunction. Different host cells such as CHO, HeLa, MDCK, 293, W13 8, etc have speci?c cellular-13-?10152025-30CA 02265455 1999-03-08W0 98l1l227 PCT/U S97/ 16034machinery and characteristic mechanisms for such post-translational activities and may be chosento ensure the correct modi?cation and processing of the introduced, foreign protein.For long-term, high-yield production of recombinant proteins, stable expression ispreferred. For example, cell lines which stably express NGCP may be transformed usingexpression vectors which contain viral origins of replication or endogenous expression elementsand a selectable marker gene. Following the introduction of the vector, cells may be allowed togrow for 1-2 days in an enriched media before they are switched to selective media. The purposeof the selectable marker is to confer resistance to selection, and its presence allows growth andrecovery of cells which successfully express the introduced sequences. Resistant clumps ofstably transformed cells can be proliferated using tissue culture techniques appropriate to the celltype.Any number of selection systems may be used to recover transformed cell lines. Theseinclude, but are not limited to, the herpes simplex virus thymidine kinase (Wigler M et al (1977)Cell 11:223-32) and adenine phosphoribosyltransferase (Lowy I et al (1980) Cell 22:817q-23)genes which can be employed in tk- or aprt- cells, respectively. Also, antimetabolite, antibioticor herbicide resistance can be used as the basis for selection; for example, dhfr which confersresistance to methotrexate (Wigler M et al (1980) Proc Natl Acad Sci 77:3567-70); npt, whichconfers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin F et al (1981) JMol Biol 150: 1-14) and als or pat, which confer resistance to chlorsulfuron and phosphinotricinacetyltransferase, respectively (Murry, supra). Additional selectable genes have been described,for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD. whichallows cells to utilize histinol in place of histidine (Hartman SC and RC Mulligan (1988) ProcNatl Acad Sci 8528047-51). Recently, the use of visible markers has gained popularity with suchmarkers as anthocyanins, B glucuronidase and its substrate, GUS, and luciferase and its substrate,luciferin, being widely used not only to identify transformants, but also to quantify the amount oftransient or stable protein expression attributable to a specific vector system (Rhodes CA et al(1995) Methods Mol Biol 55:121-131).Identi?cation of Transformants Containing the Polynucleotide SequenceAlthough the presence/absence of marker gene expression suggests that the gene ofinterest is also present, its presence and expression should be con?rmed. For example. if thesequence encoding NGCP is inserted within a marker gene sequence, recombinant cellscontaining the sequence encoding NGCP can be identi?ed by the absence of marker gene-14-?1015202530CA 02265455 1999-03-08W0 98/ 11227 PCT/US97/ 16034function. Alternatively, a marker gene can be placed in tandem with the sequence encodingNGCP under the control of a single promoter. Expression of the marker gene in response toinduction or selection usually indicates expression of the tandem sequence as well.Alternatively, host cells which contain the sequence encoding NGCP and expressingNGCP may be identi?ed by a variety of procedures known to those of skill in the art. Theseprocedures include, but are not limited to, DNA-DNA or DNA-RNA hybridization and proteinbioassay or immunoassay techniques which include membrane, solution, or chip basedtechnologies for the detection and/or quanti?cation of the nucleic acid or protein.The presence of the polynucleotide sequence encoding NGCP can be detected byDNA-DNA or DNA-RNA hybridization or ampli?cation using probes, portions or fragments ofthe sequence encoding NGCP. Nucleic acid ampli?cation based assays involve the use ofoligonucleotides or oligomers based on the nucleic acid sequence to detect transformantscontaining DNA or RNA encoding NGCP. As used herein “oligonucleotides” or “oligomers”refer to a nucleic acid sequence of at least about 10 nucleotides and as many as about 60nucleotides, preferably about 15 to 30 nucleotides, and more preferably about 20-25 nucleotideswhich can be used as a probe or amplimer.A variety of protocols for detecting and measuring the expression of NGCP, using eitherpolyclonal or monoclonal antibodies speci?c for the protein are known in the art. Examplesinclude enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and ?uorescentactivated cell sorting (FACS). A two-site, monoclonal-based immunoassay utilizing monoclonalantibodies reactive to two non-interfering epitopes on NGCP is preferred, but a competitivebinding assay may be employed. These and other assays are described, among other places, inHampton R et al (1990, Serological Methods, a Laboratory , APS Press, St Paul MN) andMaddox DE et al (1983, J Exp Med l58:l2l1).A wide variety of labels and conjugation techniques are known by those skilled in the artand can be used in various nucleic acid and amino acid assays. Means for producing labeledhybridization or PCR probes for detecting related sequences include oligolabeling, nicktranslation, end-labeling or PCR ampli?cation using a labeled nucleotide. Alternatively, theNGCP-encoding sequence, or any portion of it, may be cloned into a vector for the production ofan mRNA probe. Such vectors are known in the art, are commercially available, and may beused to synthesize RNA probes in _v_i1r_c_> by addition of an appropriate RNA polymerase such asT7, T3 or SP6 and labeled nucleotides.-15-?1015202530CA 02265455 1999-03-08W0 98/1 1227 PCT/US97l 16034A number of companies such as Pharmacia Biotech (Piscataway NJ), Promega (MadisonWI), and US Biochemical Corp (Cleveland OH) supply commercial kits and protocols for theseprocedures. Suitable reporter molecules or labels include those radionuclides, enzymes,?uorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors,magnetic particles and the like. Patents teaching the use of such labels include US Patents3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241. Also,recombinant immunoglobulins may be produced as shown in US Patent No. 4,816,567incorporated herein by reference.Purification of NGCPHost cells transformed with a nucleotide sequence encoding NGCP may be cultured underconditions suitable for the expression and recovery of the encoded protein from cell culture. Theprotein produced by a recombinant cell may be secreted or contained intracellularly depending onthe sequence and/or the vector used. As will be understood by those of skill in the art, expressionvectors containing sequence encoding NGCP can be designed with signal sequences which directsecretion of NGCP through a prokaryotic or eukaryotic cell membrane. Other recombinantconstructions may join the sequence encoding NGCP to nucleotide sequence encoding apolypeptide domain which will facilitate puri?cation of soluble proteins (Kroll DJ et al (1993)DNA Cell Biol l2:44l-53; cf discussion of vectors infra containing fusion proteins).NGCP may also be expressed as a recombinant protein with one or more additionalpolypeptide domains added to facilitate protein puri?cation. Such puri?cation facilitatingdomains include, but are not limited to, metal chelating peptides such as histidine-tryptophanmodules that allow puri?cation on immobilized metals, protein A domains that allow puri?cationon immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinitypuri?cation system (Immunex Corp, Seattle WA). The inclusion of a cleavable linker sequencessuch as Factor XA or enterokinase (Invitrogen, San Diego CA) between the puri?cation domainand NGCP is useful to facilitate puri?cation. One such expression vector provides for expressionof a fusion protein comprising the sequence encoding NGCP and nucleic acid sequence encoding6 histidine residues followed by thioredoxin and an enterokinase cleavage site. The histidineresidues facilitate puri?cation while the enterokinase cleavage site provides a means for purifyingNGCP from the fusion protein.In addition to recombinant production, fragments of NGCP may be produced by directpeptide synthesis using solid-phase techniques (cf Stewart et al (1969) ad-£1315; &;md_e_-16-?1015202530CA 02265455 1999-03-08W0 98/1 1227 PCT/US97Il6034Synthesis, WH Freeman Co, San Francisco; Merri?eld J (1963) J Am Chem Soc 8522149-2154).lr_1 }??_Q protein synthesis may be performed using manual techniques or by automation.Automated synthesis may be achieved, for example, using Applied Biosystems 431A PeptideSynthesizer (Perkin Elmer, Foster City CA) in accordance with the instructions provided by themanufacturer. Various fragments of NGCP may be chemically synthesized separately andcombined using chemical methods to produce the full length molecule.Uses of NGCPThe discovery of NGCP provides the opportunity to provide a better understanding of andthe means for intervening at the molecular level in various pathogenic processes. NGCP or itsderivatives may be used therapeutically in the treatment of disease states such as leukemia andother cancers, immune deficiencies, or excessive immune responses.Transfection of minute amounts of NGCP into tumor cells may reduce tumorigenicity.Puri?ed NGCP could be administered to induce proteolytic activity of neutrophilic granulocytesresulting in tumor regression.Since it appears that the expression of NGCP in mammals (Broxmeyer, supra) iscontrolled by a feedback mechanism, NGCP can be administered to a patient for itsmyelosuppressive effect on bone marrow progenitor cell populations. NGCP, with or withoutpreincubation in acetonitril, would be expected to suppress granulocyte-macrophage, erythroidand multipotential progenitor cells; therefore, daily chemokine treatment may be useful forpatients with acute or chronic leukemia.A therapeutic composition comprising NGCP may have application in the prevention andtreatment of individuals subject to disease conditions which compromise the immune system.Such conditions include, but are not limited to, HIV infection, Job—Buckley syndrome, lazyleukocyte syndrome, acquired agranulocytosis, and Chediak-Higashi syndrome. Although thepathologies of these diseases differ, common features include impairment of the immune systemwith subsequent predisposition to infections. Administration of minute amounts of NGCP mightbe expected to attract and activate leukocytes to the site for systemic defense.In contrast, suppression of NGCP expression via antisense technology or introduction ofantagonists, inhibitors or anti-NGCP antibodies may be useful in preventing pathogenesis. Inthose situations, it is useful to prevent the chemoattraction and activity of excessive leukocyteswhich cause cellular destruction. Such conditions include idiopathic dilated cardiomyopathy,emphysema, lupus, myasthenia gravis, pancreatitis, and rheumatoid arthritis.-17-?1015202530CA 02265455 1999-03-08W0 98/1 1227 PCTIUS97/16034NGCP AntibodiesNGCP-speci?c antibodies are useful for the diagnosis and treatment of conditions anddiseases associated with expression of NGCP. Such antibodies include, but are not limited to,polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by a Fabexpression library. Neutralizing antibodies, ie, those which inhibit dimer formation, areespecially preferred for diagnostics and therapeutics.NGCP for antibody induction does not require biological activity; however, the proteinfragment, or oligopeptide must be antigenic. Peptides used to induce speci?c antibodies mayhave an amino acid sequence consisting of at least ?ve amino acids, preferably at least 10 aminoacids. Preferably, they should mimic a portion of the amino acid sequence of the natural proteinand may contain the entire amino acid sequence of a small, naturally occurring molecule. Shortstretches of NGCP amino acids may be fused with those of another protein such as keyholelimpet hemocyanin and antibody produced against the chimeric molecule. Procedures wellknown in the art can be used for the production of antibodies to NGCP.For the production of antibodies, various hosts including goats, rabbits, rats, mice, etcmay be immunized by injection with NGCP or any portion, fragment or oligopeptide whichretains immunogenic properties. Depending on the host species, various adjuvants may be usedto increase immunological response. Such adjuvants include but are not limited to Freund's,mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin,pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, anddinitrophenol. BCG (bacilli Calmette-Guerin) and Corynebacterium gnarl are potentiallyuseful human adj uvants.Monoclonal antibodies to NGCP may be prepared using any technique which provides forthe production of antibody molecules by continuous cell lines in culture. These include but arenot limited to the hybridoma technique originally described by Koehler and Milstein (1975Nature 256:495-497), the human B-cell hybridoma technique (Kosbor et al (1983) lmmunolToday 4:72; Cote et al (1983) Proc Natl Acad Sci 80:2026-2030) and the EBV-hybridomatechnique (Cole et al (1985) Monoclonal Antibodies ad _C_2:_r1<:_e:_r _"l11_erapy, Alan R Liss Inc, NewYork NY, pp 77-96).In addition, techniques developed for the production of "chimeric antibodies", the splicingof mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigenspecificity and biological activity can be used (Morrison et al (1984) Proc Natl Acad Sci-13-?1015202530CA 02265455 1999-03-08W0 98lll227 PCT/US97/160348126851-6855; Neuberger et al (1984) Nature 312:604-608; Takeda et al (1985) Nature314:452-454). Alternatively, techniques described for the production of single chain antibodies(US Patent No. 4,946,778) can be adapted to produce NGCP-speci?c single chain antibodiesAntibodies may also be produced by inducing i_n mg production in the lymphocytepopulation or by screening recombinant immunoglobulin libraries or panels of highly speci?cbinding reagents as disclosed in Orlandi et al (1989, Proc Natl Acad Sci 86: 3833-3837), andWinter G and Milstein C (1991; Nature 3492293-299).Antibody fragments which contain speci?c binding sites for NGCP may also begenerated. For example, such fragments include, but are not limited to, the F(ab')2 fragmentswhich can be produced by pepsin digestion of the antibody molecule and the Fab fragmentswhich can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively,Fab expression libraries may be constructed to allow rapid and easy identi?cation of monoclonalFab fragments with the desired speci?city (Huse WD et al (1989) Science 256: 1275-1281).A variety of protocols for competitive binding or immunoradiometric assays using eitherpolyclonal or monoclonal antibodies with established speci?cities are well known in the art.Such immunoassays typically involve the formation of complexes between NGCP and itsspecific antibody and the measurement of complex formation. A two-site, monoclonal—basedimmunoassay utilizing monoclonal antibodies reactive to two noninterfering epitopes on aspeci?c NGCP protein is preferred, but a competitive binding assay may also be employed.These assays are described in Maddox DE et al (1983, J Exp Med 158: 121 1).Diagnostic Assays Using NGCP Speci?c AntibodiesParticular NGCP antibodies are useful for the diagnosis of conditions or diseasescharacterized by expression of NGCP or in assays to monitor patients being treated with NGCP,its fragments, agonists or inhibitors. Diagnostic assays for NGCP include methods utilizing theantibody and a label to detect NGCP in human body ?uids or extracts of cells or tissues. Thepolypeptides and antibodies of the present invention may be used with or without modification.Frequently, the polypeptides and antibodies will be labeled by joining them, either covalently ornoncovalently, with a reporter molecule. A wide variety of reporter molecules are known,several of which were described above.A variety of protocols for measuring NGCP, using either polyclonal or monoclonalantibodies speci?c for the respective protein are known in the art. Examples includeenzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and ?uorescent-19-?1015202530CA 02265455 1999-03-08WO 98111227 PCT/US97/16034activated cell sorting (FACS). A two—site, monoclonal-based immunoassay utilizing monoclonalantibodies reactive to two non-interfering epitopes on NGCP is preferred, but a competitivebinding assay may be employed. These assays are described, among other places, in Maddox,DE et al (1983, J Exp Med 15821211).In order to provide a basis for diagnosis, normal or standard values for NGCP expressionmust be established. This is accomplished by combining body ?uids or cell extracts taken fromnormal subjects, either animal or human, with antibody to NGCP under conditions suitable forcomplex formation which are well known in the art. The amount of standard complex formationmay be quantified by comparing various arti?cial membranes containing known quantities ofNGCP with both control and disease samples from biopsied tissues. Then, standard valuesobtained from normal samples may be compared with values obtained from samples fromsubjects potentially affected by disease. Deviation between standard and subject valuesestablishes the presence of disease state.Drug ScreeningNGCP, its catalytic or immunogenic fragments or oligopeptides thereof, can be used forscreening therapeutic compounds in any of a variety of drug screening techniques. The fragmentemployed in such a test may be free in solution, af?xed to a solid support, borne on a cell surface,or located intracellularly. The formation of binding complexes, between NGCP and the agentbeing tested, may be measured.Another technique for drug screening which may be used for high throughput screening ofcompounds having suitable binding af?nity to the NGCP is described in detail in “Determinationof Amino Acid Sequence Antigenicity” by Geysen HN, WO Application 84/03564, published onSeptember 13, 1984, and incorporated herein by reference. In summary, large numbers ofdifferent small peptide test compounds are synthesized on a solid substrate, such as plastic pins orsome other surface. The peptide test compounds are reacted with fragments of NGCP andwashed. Bound NGCP is then detected by methods well known in the art. Substantially purifiedNGCP can also be coated directly onto plates for use in the aforementioned drug screeningtechniques. Alternatively, non-neutralizing antibodies can be used to capture the peptide andimmobilize it on a solid support.This invention also contemplates the use of competitive drug screening assays in whichneutralizing antibodies capable of binding NGCP speci?cally compete with a test compound forbinding NGCP. In this manner, the antibodies can be used to detect the presence of any peptide-20-?1015202530CA 02265455 1999-03-08W0 98lll227 PCT/US97/16034which shares one or more antigenic determinants with NGCP.Uses of the Polynucleotide Encoding NGCPA polynucleotide sequence encoding NGCP or any part thereof may be used fordiagnostic and/or therapeutic purposes. For diagnostic purposes, the sequence encoding NGCPof this invention may be used to detect and quantitate gene expression in biopsied tissues inwhich NGCP may be expressed in response to oncogenes. The diagnostic assay is useful todistinguish between absence, presence, and excess expression of NGCP and to monitor regulationof NGCP levels during therapeutic intervention. Included in the scope of the invention areoligonucleotide sequences, antisense RNA and DNA molecules, and peptide nucleic acids,(PNA).Another aspect of the subject invention is to provide for hybridization or PCR probeswhich are capable of detecting polynucleotide sequences, including genomic sequences, encodingNGCP or closely related molecules. The speci?city of the probe, whether it is made from ahighly speci?c region, eg, 10 unique nucleotides in the 5' regulatory region, or a less speci?cregion, eg, especially in the 3’ region, and the stringency of the hybridization or ampli?cation(maximal, high, intermediate or low) will determine whether the probe identi?es only naturallyoccurring NGCP, alleles or related sequences.Probes may also be used for the detection of related sequences and should preferablycontain at least 50% of the nucleotides from any of these sequences encoding NGCP. Thehybridization probes of the subject invention may be derived from the nucleotide sequence ofSEQ ID N012 or from genomic sequence including promoter, enhancer elements and introns ofthe naturally occurring sequence encoding NGCP. Hybridization probes may be labeled by avariety of reporter groups, including radionuclides such as 32P or 35S, or enzymatic labels suchas alkaline phosphatase coupled to the probe via avidin/biotin coupling systems, and the like.Other means for producing speci?c hybridization probes for DNAs include the cloning ofnucleic acid sequences encoding NGCP or NGCP derivatives into vectors for the production ofmRNA probes. Such vectors are known in the art and are commercially available and may beused to synthesize RNA probes in yi_t_rQ by means of the addition of the appropriate RNApolymerase as T7 or SP6 RNA polymerase and the appropriate radioactively labeled nucleotides.Diagnostic UsePolynucleotide sequences encoding NGCP may be used for the diagnosis of conditions ordiseases with which the expression of NGCP is associated. For example, polynucleotide-2]-?1015202530CA 02265455 1999-03-08W0 98/ 1 1227 PCT/U S97l 16034sequences encoding NGCP may be used in hybridization or PCR assays of ?uids or tissues frombiopsies to detect NGCP expression. The form of such qualitative or quantitative methods mayinclude Southern or northern analysis, dot blot or other membrane-based technologies; PCRtechnologies; dip stick, pin, chip and ELISA technologies. All of these techniques are wellknown in the art and are the basis of many commercially available diagnostic kits.The NGCP-encoding nucleotide sequences disclosed herein provide the basis for assaysthat detect activation or induction associated with in?ammation or disease. The nucleotidesequence may be labeled by methods known in the art and added to a ?uid or tissue sample froma patient under conditions suitable for the formation of hybridization complexes. After anincubation period, the sample is washed with a compatible ?uid which optionally contains a dye(or other label requiring a developer) if the nucleotide has been labeled with an enzyme. Afterthe compatible ?uid is rinsed off, the dye is quantitated and compared with a standard. If theamount of dye in the biopsied or extracted sample is signi?cantly elevated over that of acomparable control sample, the nucleotide sequence has hybridized with nucleotide sequences inthe sample, and the presence of elevated levels of nucleotide sequences encoding NGCP in thesample indicates the presence of the associated in?ammation and/or disease.Such assays may also be used to evaluate the ef?cacy of a particular therapeutic treatmentregime in animal studies, in clinical trials, or in monitoring the treatment of an individual patient.In order to provide a basis for the diagnosis of disease, a normal or standard pro?le for NGCPexpression must be established. This is accomplished by combining body ?uids or cell extractstaken from normal subjects, either animal or human, with NGCP, or a portion thereof, underconditions suitable for hybridization or ampli?cation. Standard hybridization may be quanti?edby comparing the values obtained for normal subjects with a dilution series of NGCP run in thesame experiment where a known amount of substantially puri?ed NGCP is used. Standardvalues obtained from normal samples may be compared with values obtained from samples frompatients affected by NGCP-associated diseases. Deviation between standard and subject valuesestablishes the presence of disease.Once disease is established, a therapeutic agent is administered and a treatment pro?le isgenerated. Such assays may be repeated on a regular basis to evaluate whether the values in thepro?le progress toward or return to the normal or standard pattern. Successive treatment pro?lesmay be used to show the ef?cacy of treatment over a period of several days or several months.PCR, may be used as described in US Patent Nos. 4,683,195 and 4,965,188 provides-22-?1015202530CA 02265455 1999-03-08W0 98/11227 PCT/US97Il6034additional uses for oligonucleotides based upon the sequence encoding NGCP. Such oligomersare generally chemically synthesized, but they may be generated enzymatically or produced froma recombinant source. Oligomers generally comprise two nucleotide sequences, one with senseorientation (5’->3’) and one with antisense (3’<-5’), employed under optimized conditions foridenti?cation of a speci?c gene or condition. The same two oligomers, nested sets of oligomers,or even a degenerate pool of oligomers may be employed under less stringent conditions fordetection and/or quantitation of closely related DNA or RNA sequences.Additionally, methods which may be used to quantitate the expression of a particularmolecule include radiolabeling (Melby PC et al 1993 J Immunol Methods 159:23 5-44) orbiotinylating (Duplaa C et al 1993 Anal Biochem 229-36) nucleotides, coamplification of acontrol nucleic acid, and standard curves onto which the experimental results are interpolated.Quantitation of multiple samples may be speeded up by running the assay in an ELISA formatwhere the oligomer of interest is presented in various dilutions and a spectrophotometric orcolorimetric response gives rapid quantitation. A definitive diagnosis of this type may allowhealth professionals to begin aggressive treatment and prevent further worsening of the condition.Similarly, further assays can be used to monitor the progress of a patient during treatment.Furthermore, the nucleotide sequences disclosed herein may be used in molecular biologytechniques that have not yet been developed, provided the new techniques rely on properties ofnucleotide sequences that are currently known such as the triplet genetic code, speci?c base pairinteractions, and the like.Therapeutic UseBased upon its homology to EMAP-II and its expression profile, the polynucleotideencoding NGCP disclosed herein may be useful in the treatment of immune de?ciency diseases.Expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, orfrom various bacterial plasmids, may be used for delivery of nucleotide sequences to the targetedorgan, tissue or cell population. Methods which are well known to those skilled in the art can beused to construct recombinant vectors which will express antisense of the sequence encodingNGCP. See, for example, the techniques described in Sambrook et al (supra) and Ausubel et al(supra).The polynucleotides comprising full length cDNA sequence and/or its regulatoryelements enable researchers to use the sequence encoding NGCP as an investigative tool in sense(Youssoufian H and HF Lodish 1993 Mol Cell Biol 13:98-104) or antisense (Eguchi et al (1991)-23-?1015202530CA 02265455 1999-03-08W0 98/1 1227 PCT/US97/ 16034Annu Rev Biochem 60:631-652) regulation of gene function. Such technology is now wellknown in the art, and sense or antisense oligomers, or larger fragments, can be designed fromvarious locations along the coding or control regions.Genes encoding NGCP can be turned off by transfecting a cell or tissue with expressionvectors which express high levels of a desired NGCP fragment. Such constructs can ?ood cellswith untranslatable sense or antisense sequences. Even in the absence of integration into theDNA, such Vectors may continue to transcribe RNA molecules until all copies are disabled byendogenous nucleases. Transient expression may last for a month or more with a non—replicatingvector (Mettler I, personal communication) and even longer if appropriate replication elementsare part of the vector system.As mentioned above, modi?cations of gene expression can be obtained by designingantisense molecules, DNA, RNA or PNA, to the control regions of the sequence encoding NGCP,ie, the promoters, enhancers, and introns. Oligonucleotides derived from the transcriptioninitiation site, eg, between -10 and +10 regions of the leader sequence, are preferred. Theantisense molecules may also be designed to block translation of mRNA by preventing thetranscript from binding to ribosomes. Similarly, inhibition can be achieved using "triple helix"base-pairing methodology. Triple helix pairing compromises the ability of the double helix toopen sufficiently for the binding of polymerases, transcription factors, or regulatory molecules.Recent therapeutic advances using triplex DNA were reviewed by Gee I E et al (In: Huber BE andBI Carr (1994) Molecular _an_d Immunologic Approaches, Futura Publishing Co, Mt Kisco NY).Ribozymes are enzymatic RNA molecules capable of catalyzing the speci?c cleavage ofRNA. The mechanism of ribozyme action involves sequence-speci?c hybridization of theribozyme molecule to complementary target RNA, followed by endonucleolytic ‘cleavage.Within the scope of the invention are engineered hammerhead motif ribozyme molecules that canspeci?cally and ef?ciently catalyze endonucleolytic cleavage of the sequence encoding NGCP.Speci?c ribozyme cleavage sites within any potential RNA target are initially identi?edby scanning the target molecule for ribozyme cleavage sites which include the followingsequences, GUA, GUU and GUC. Once identi?ed, short RNA sequences of between 15 and 20ribonucleotides corresponding to the region of the target gene containing the cleavage site may beevaluated for secondary structural features which may render the oligonucleotide inoperable. Thesuitability of candidate targets may also be evaluated by testing accessibility to hybridizationwith complementary oligonucleotides using ribonuclease protection assays.-24-?1015202530CA 02265455 1999-03-08W0 98I11227 PCT/U S97! 16034Antisense molecules and ribozymes of the invention may be prepared by any methodknown in the art for the synthesis of RNA molecules. These include techniques for chemicallysynthesizing oligonucleotides such as solid phase phosphoramidite chemical synthesis.Alternatively, RNA molecules may be generated by i_n v_itr;)_ and i_n E transcription of DNAsequences encoding NGCP. Such DNA sequences may be incorporated into a wide variety ofvectors with suitable RNA polymerase promoters such as T7 or SP6. Alternatively, antisensecDNA constructs that synthesize antisense RNA constitutively or inducibly can be introducedinto cell lines, cells or tissues.RNA molecules may be modi?ed to increase intracellular stability and half-life. Possiblemodi?cations include, but are not limited to, the addition of ?anking sequences at the 5' and/or 3'ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesteraselinkages within the backbone of the molecule. This concept is inherent in the production ofPNAs and can be extended in all of these molecules by the inclusion of nontraditional bases suchas inosine, queosine and wybutosine as well as acetyl-, methyl-, thio- and similarly modi?edforms of adenine, cytidine, guanine, thymine, and uridine which are not as easily recognized byendogenous endonucleases.Methods for introducing vectors into cells or tissues include those methods discussedinfra and which are equally suitable for m vii, _i_r; v_itm and 9; yj_v_o therapy. For ;e_)g \_/ilgtherapy, vectors are introduced into stem cells taken from the patient and clonally propagated forautologous transplant back into that same patient is presented in US Patent Nos. 5,399,493 and5,437,994, disclosed herein by reference. Delivery by transfection and by liposome are quitewell known in the art.Furthermore, the nucleotide sequences encoding NGCP disclosed herein may be used inmolecular biology techniques that have not yet been developed, provided the new techniques relyon properties of nucleotide sequences that are currently known, including but not limited to suchproperties as the triplet genetic code and speci?c base pair interactions. -Detection and Mapping of Related Polynucleotide SequencesThe nucleic acid sequence encoding NGCP can also be used to generate hybridizationprobes for mapping the naturally occurring genomic sequence. The sequence may be mapped toa particular chromosome or to a speci?c region of the chromosome using well known techniques.These include in E hybridization to chromosomal spreads, ?ow-sorted chromosomalpreparations, or arti?cial chromosome constructions such as yeast arti?cial chromosomes,-25-?1015202530CA 02265455 1999-03-08W0 98/11227 PCT/US97Il6034bacterial arti?cial chromosomes, bacterial Pl constructions or single chromosome cDNAlibraries as reviewed in Price CM (1993; Blood Rev 7:127-34) and Trask BJ (1991; Trends Genet7: 149-54).The technique of ?uorescent in sit_u hybridization of chromosome spreads has beendescribed, among other places, in Verma et al (1988) ?mna_n Chromosomes: _A_ _]\1a_nua_l o_f_BL§gTechniques, Pergamon Press, New York NY. Fluorescent i_n si? hybridization of chromosomalpreparations and other physical chromosome mapping techniques may be correlated withadditional genetic map data. Examples of genetic map data can be found in the 1994 GenomeIssue of Science (265:1981i). Correlation between the location of a the sequence encodingNGCP on a physical chromosomal map and a speci?c disease (or predisposition to a speci?cdisease) may help delimit the region of DNA associated with that genetic disease. The nucleotidesequences of the subject invention may be used to detect differences in gene sequences betweennormal, carrier or affected individuals. 9Ln _sit_u hybridization of chromosomal preparations and physical mapping techniques suchas linkage analysis using established chromosomal markers are invaluable in extending geneticmaps. A recent example of an STS based map of the human genome was recently published bythe Whitehead-MIT Center for Genomic Research (Hudson TJ et al (1995) Science270: 1 945-1954). Often the placement of a gene on the chromosome of another mammalianspecies such as mouse (Whitehead Institute/MIT Center for Genome Research, Genetic Map ofthe Mouse, Database Release 10, April 28, 1995) may reveal associated markers even if thenumber or arm of a particular human chromosome is not known. New sequences can be assignedto chromosomal arms, or parts thereof, by physical mapping. This provides valuable informationto investigators searching for disease genes using positional cloning or other gene discoverytechniques. Once a disease or syndrome, such as ataxia telangiectasia (AT), has been crudelylocalized by genetic linkage to a particular genomic region, for example, AT to 11q22-23 (Gattiet al (1988) Nature 3362577-580), any sequences mapping to that area may represent associatedor regulatory genes for further investigation. The nucleotide sequence of the subject inventionmay also be used to detect differences in the chromosomal location due to translocation,inversion, etc. among normal, carrier or affected individuals.Pharmaceutical CompositionsThe present invention relates to pharmaceutical compositions which may comprisenucleotides, proteins, antibodies, agonists, antagonists, or inhibitors, alone or in combination-25-?1015202530CA 02265455 1999-03-08W0 98/11227 PCT/US97/16034with at least one other agent, such as stabilizing compound, which may be administered in anysterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline,dextrose, and water. Any of these molecules can be administered to a patient alone, or incombination with other agents, drugs or hormones, in pharmaceutical compositions where it ismixed with excipient(s) or pharmaceutically acceptable carriers. In one embodiment of thepresent invention, the pharmaceutically acceptable carrier is pharmaceutically inert.Administration of Pharmaceutical CompositionsAdministration of pharmaceutical compositions is accomplished orally or parenterally.Methods of parenteral delivery include topical, intra-arterial (directly to the tumor),intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous,intraperitoneal, or intranasal administration. In addition to the active ingredients, thesepharmaceutical compositions may contain suitable pharmaceutically acceptable carrierscomprising excipients and auxiliaries which facilitate processing of the active compounds intopreparations which can be used pharmaceutically. Further details on techniques for formulationand administration may be found in the latest edition of "Remington's Pharmaceutical Sciences"(Maack Publishing Co, Easton PA).Pharmaceutical compositions for oral administration can be formulated usingpharmaceutically acceptable carriers well known in the art in dosages suitable for oraladministration. Such carriers enable the pharmaceutical compositions to be formulated as tablets,pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for ingestion bythe patient.Pharmaceutical preparations for oral use can be obtained through combination of activecompounds with solid excipient, optionally grinding a resulting mixture, and processing themixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.Suitable excipients are carbohydrate or protein ?llers such as sugars, including lactose, sucrose,mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such asmethyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; and gumsincluding arabic and tragacanth; and proteins such as gelatin and collagen. If desired,disintegrating or solubilizing agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.Dragee cores are provided with suitable coatings such as concentrated sugar solutions,which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene-27-?1015202530CA 02265455 1999-03-08W0 98/11227 PCTlUS97l 16034glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solventmixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for productidenti?cation or to characterize the quantity of active compound, ie, dosage. ‘Pharmaceutical preparations which can be used orally include push-?t capsules made ofgelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol.Push-?t capsules can contain active ingredients mixed with a ?ller or binders such as lactose orstarches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In softcapsules, the active compounds may be dissolved or suspended in suitable liquids, such as fattyoils, liquid paraf?n, or liquid polyethylene glycol with or without stabilizers.Pharmaceutical formulations for parenteral administration include aqueous solutions ofactive compounds. For injection, the pharmaceutical compositions of the invention may beformulated in aqueous solutions, preferably in physiologically compatible buffers such asHanks’s solution, Ringer's solution, or physiologically buffered saline. Aqueous injectionsuspensions may contain substances which increase the viscosity of the suspension, such assodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the activecompounds may be prepared as appropriate oily injection suspensions. Suitable lipophilicsolvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such asethyl oleate or triglycerides, or liposomes. Optionally, the suspension may also contain suitablestabilizers or agents which increase the solubility of the compounds to allow for the preparationof highly concentrated solutions.For topical or nasal administration, penetrants appropriate to the particular barrier to bepermeated are used in the formulation. Such penetrants are generally known in the art.Manufacture and StorageThe pharmaceutical compositions of the present invention may be manufactured in amanner that known in the art, eg, by means of conventional mixing, dissolving, granulating,dragee—making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.The pharmaceutical composition may be provided as a salt and can be formed with manyacids, including but not limited to hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic,etc. Salts tend to be more soluble in aqueous or other protonic solvents that are thecorresponding free base forms. In other cases, the preferred preparation may be a lyophilizedpowder in lmM-50 mM histidine, 0.1%-2% sucrose, 2%-7% mannitol at a pH range of 4.5 to 5.5that is combined with buffer prior to use.-28-?1015202530CA 02265455 1999-03-08W0 98/ 1 1227 PCT/US97l16034After pharmaceutical compositions comprising a compound of the invention formulatedin a acceptable carrier have been prepared, they can be placed in an appropriate container andlabeled for treatment of an indicated condition. For administration of NGCP, such labelingwould include amount, frequency and method of administration.Thera euticall ffe tive DPharmaceutical compositions suitable for use in the present invention includecompositions wherein the active ingredients are contained in an effective amount to achieve theintended purpose. The determination of an effective dose is well within the capability of thoseskilled in the art.For any compound, the therapeutically effective dose can be estimated initially either incell culture assays, eg, of neoplastic cells, or in animal models, usually mice, rabbits, dogs, orpigs. The animal model is also used to achieve a desirable concentration range and route ofadministration. Such information can then be used to determine useful doses and routes foradministration in humans.A therapeutically effective dose refers to that amount of protein or its antibodies,antagonists, or inhibitors which ameliorate the symptoms or condition. Therapeutic ef?cacy andtoxicity of such compounds can be determined by standard pharmaceutical procedures in cellcultures or experimental animals, eg, ED50 (the dose therapeutically effective in 50% of thepopulation) and LD50 (the dose lethal to 50% of the population). The dose ratio betweentherapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio,LD50/ED50. Pharmaceutical compositions which exhibit large therapeutic indices are preferred.The data obtained from cell culture assays and animal studies is used in formulating a range ofdosage for human use. The dosage of such compounds lies preferably within a range ofcirculating concentrations that include the ED50 with little or no toxicity. The dosage varieswithin this range depending upon the dosage form employed, sensitivity of the patient, and theroute of administration.The exact dosage is chosen by the individual physician in view of the patient to betreated. Dosage and administration are adjusted to provide suf?cient levels of the active moietyor to maintain the desired effect. Additional factors which may be taken into account include theseverity of the disease state, eg, tumor size and location; age. weight and gender of the patient;diet, time and frequency of administration, drug combination(s), reaction sensitivities, andtolerance/response to therapy. Long acting pharmaceutical compositions might be administered-29-?1015202530CA 02265455 1999-03-08WO 98111227 PCT/US97/16034every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rateof the particular formulation.Normal dosage amounts may vary from 0.1 to 100,000 micrograms, up to a total dose ofabout 1 g, depending upon the route of administration. Guidance as to particular dosages andmethods of delivery is provided in the literature. See US Patent Nos. 4,657,760; 5,206,344; or5,225,212. Those skilled in the art will employ different formulations for nucleotides than forproteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will bespeci?c to particular cells, conditions, locations, etc.It is contemplated, for example, that NGCP can be used as a therapeutic molecule toattract granulocytes to cancers for the purpose of destroying the cancerous cells or tissues.The examples below are provided to illustrate the subject invention and are not includedfor the purpose of limiting the invention.INDUSTRIAL APPLICABILITYI PANCNOT05 cDNA Library ConstructionThe PANCNOT05 cDNA library was constructed from human pancreas tissue. Thedonor was a 2 year old Hispanic male who died from anoxia. The frozen tissue was homogenizedand lysed using a Brinkmann Homogenizer Polytron PT-3000 (Brinkmann Instruments,Westbury NJ) in guanidinium isothiocyanate solution. The lysate was centrifuged over a 5.7 MCsCl cushion using an Beckman SW28 rotor in a Beckman L8-70M Ultracentrifuge (BeckmanInstruments) for 18 hours at 25,000 rpm at ambient temperature. The RNA was extracted withacid phenol pH 4.0, precipitated using 0.3 M sodium acetate and 2.5 volumes of ethanol,resuspended in RNAse-free water and DNase treated at 37°C. The RNA extraction was repeatedwith acid phenol pH 4.0 and precipitated with sodium acetate and ethanol as before. The mRNAwas then isolated using the Qiagen Oligotex kit (QIAGEN Inc; Chatsworth CA) and used toconstruct the cDNA library.The mRNA was handled according to the recommended protocols in the SuperScriptPlasmid System for cDNA Synthesis and Plasmid Cloning (Catalog #18248-013; Gibco/BRL).cDNAs were fractionated on a Sepharose CL4B column (Catalog #275105-01; Pharmacia), andthose cDNAs exceeding 400 bp were ligated into pSport I. The plasmid pSport I wassubsequently transformed into DH5aTM competent cells (Catalog #18258-012; Gibco/BRL).II Isolation and Sequencing of cDNA ClonesPlasmid DNA was released from the cells and puri?ed using the REAL Prep 96 Plasmid-30-?1015202530CA 02265455 1999-03-08W0 98/ 11227 PCT/US97/ 16034Kit for Rapid Extraction Alkaline Lysis Plasmid Minipreps (Catalog #26173; QIAGEN, Inc).This kit enables the simultaneous puri?cation of 96 samples in a 96-well block using multi-channel reagent dispensers. The recommended protocol was employed except for the followingchanges: 1) the bacteria were cultured in 1 ml of sterile Terri?c Broth (Catalog #22711, LIFETECHNOLOGIESTM) with carbenicillin at 25 mg/L and glycerol at 0.4%; 2) after inoculation,the cultures were incubated for 19 hours and at the end of incubation, the cells were lysed with0.3 ml of lysis buffer; and 3) following isopropanol precipitation, the plasmid DNA pellet wasresuspended in 0.1 ml of distilled water. After the last step in the protocol, samples weretransferred to a 96-well block for storage at 4° C.The cDNAs were sequenced by the method of Sanger F and AR Coulson (1975; J MolBiol 94:441t), using a Hamilton Micro Lab 2200 (Hamilton, Reno NV) in combination withPeltier Thermal Cyclers (PTC200 from MJ Research, Watertown MA) and Applied Biosystems377 DNA Sequencing Systems; and the reading frame was determined. AIII Homology Searching of cDNA Clones and Their Deduced Proteins ‘Each cDNA was compared to sequences in GenBank using a Search algorithm developedby Applied Biosystems and incorporated into the INHERIT- 670 Sequence Analysis System. Inthis algorithm, Pattern Speci?cation Language (TRW Inc, Los Angeles CA) was used todetermine regions of homology. The three parameters that determine how the sequencecomparisons run were window size, window offset, and error tolerance. Using a combination ofthese three parameters, the DNA database was searched for sequences containing regions ofhomology to the query sequence, and the appropriate sequences were scored with an initial value.Subsequently, these homologous regions were examined using dot matrix homology plots todistinguish regions of homology from chance matches. Smith-Waterman alignments were usedto display the results of the homology search.Peptide and protein sequence homologies were ascertained using the INHERIT“ 670Sequence Analysis System in a way similar to that used in DNA sequence homologies. PatternSpeci?cation Language and parameter windows were used to search protein databases forsequences containing regions of homology which were scored with an initial value. Dot-matrixhomology plots were examined to distinguish regions of signi?cant homology from chancematches.BLAST, which stands for Basic Local Aligmnent Search Tool (Altschul SF (1993) J MolEvol 362290-300; Altschul, SF et al (1990) J Mol Biol 2152403-10), was used to search for local-31-?1015202530CA 02265455 1999-03-08W0 98/11227 PCT/US97/16034sequence alignments. BLAST produces alignments of both nucleotide and amino acid sequencesto determine sequence similarity. Because of the local nature of the alignments, BLAST isespecially useful in determining exact matches or in identifying homologs. BLAST is useful formatches which do not contain gaps. The fundamental unit of BLAST algorithm output is theHigh-scoring Segment Pair (HSP).An HSP consists of two sequence fragments of arbitrary but equal lengths whosealignment is locally maximal and for which the alignment score meets or exceeds a threshold orcutoff score set by the user. The BLAST approach is to look for HSPS between a query sequenceand a database sequence, to evaluate the statistical signi?cance of any matches found, and toreport only those matches which satisfy the user-selected threshold of signi?cance. Theparameter E establishes the statistically signi?cant threshold for reporting database sequencematches. E is interpreted as the upper bound of the expected frequency of chance occurrence ofan HSP (or set of HSPS) within the context of the entire database search. Any database sequencewhose match satis?es E is reported in the program output.IV Northern AnalysisNorthern analysis is a laboratory technique used to detect the presence of a transcript of agene and involves the hybridization of a labeled nucleotide sequence to a membrane on whichRN As from a particular cell type or tissue have been bound (Sambrook et al. supra).Analogous computer techniques using BLAST (Altschul SF 1993 and 1990, supra) areused to search for identical or related molecules in nucleotide databases such as GenBank or theLIFESEQTM database (Incyte, Palo Alto CA). This analysis is much faster than multiple,membrane-based hybridizations. In addition, the sensitivity of the computer search can bemodi?ed to determine whether any particular match is categorized as exact or homologous.The basis of the search is the product score which is de?ned as:% sequence identity x ‘V9 maximum BLAST score100and it takes into account both the degree of similarity between two sequences and the length ofthe sequence match. For example, with a product score of 40, the match will be exact within a 1-2% error; and at 70, the match will be exact. Homologous molecules are usually identi?ed byselecting those which show product scores between 15 and 40, although lower scores mayidentify related molecules.V Extension of the Sequence Encoding NGCPThe nucleic acid sequence of SEQ ID N012 is used to design oligo-nucleotide primers for?101520253035CA 02265455 1999-03-08W0 98Ill227 PCT/US97/16034extending a partial nucleotide sequence to full length or for obtaining 5'sequence from genomiclibraries. One primer is synthesized to initiate extension in the antisense direction (XLR) and theother is synthesized to extend sequence in the sense direction (XLF). Primers allow the extensionof the know sequence “outward” generating amplicons containing new, unknown nucleotidesequence for the region of interest (US Patent Application 08/487,112, ?led June 7, 1995,speci?cally incorporated by reference). The initial primers are designed from the cDNA usingOLIGO® 4.06 Primer Analysis Software (National Biosciences), or another appropriate program,to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to thetarget sequence at temperatures about 68 °-72° C. Any stretch of nucleotides which would resultin hairpin structures and primer-primer dimerizations is avoided.The original, selected cDNA libraries, or a human genomic library are used to extend thesequence; the latter is most useful to obtain 5' upstream regions. If more extension is necessaryor desired, additional sets of primers are designed to further extend the known region.By following the instructions for the XL-PCR kit (Perkin Elmer) and thoroughly mixingthe enzyme and reaction mix, high ?delity ampli?cation is obtained. Beginning with 40 pmol ofeach primer and the recommended concentrations of all other components of the kit, PCR isperformed using the Peltier Thermal Cycler (PTC200; MJ Research, Watertown MA) and thefollowing parameters:Step 1 94° C for l min (initial denaturation)Step 2 65° C for 1 minStep 3 68° C for 6 minStep 4 94° C for 15 secStep 5 65° C for 1 minStep 6 68° C for 7 minStep 7 Repeat step 4-6 for 15 additional cyclesStep 8 94° C for 15 secStep 9 65° C for 1 minStep 10 68° C for 7:15 minStep 11 Repeat step 8-10 for 12 cyclesStep 12 72° C for 8 minStep 13 4° C (and holding)A 5-10 /.¢l aliquot of the reaction mixture is analyzed by electrophoresis on a lowconcentration (about 0.6-0.8%) agarose mini—gel to determine which reactions were successful inextending the sequence. Bands thought to contain the largest products were selected and cutoutof the gel. Further puri?cation involves using a commercial gel extraction method such asQIAQuickTM (QIAGEN Inc). After recovery of the DNA, Klenow enzyme was used to trim-33-?1015202530CA 02265455 1999-03-08W0 98/11227 PCT /US97l 16034single-stranded, nucleotide overhangs creating blunt ends which facilitate religation and cloning.After ethanol precipitation, the products are redissolved in 13 ul of ligation buffer, 1,4141T4-DNA ligase (15 units) and 1 /A T4 polynucleotide kinase are added, and the mixture isincubated at room temperature for 2-3 hours or overnight at 16° C. Competent Q ggli cells (in40 ,ul of appropriate media) are transformed with 3 Ml of ligation mixture and cultured in 80 pl ofSOC medium (Sambrook J et al, supra). After incubation for one hour at 37° C, the wholetransformation mixture is plated on Luria Bertani (LB)-agar (Sambrook J et al, supra) containing2xCarb. The following day, several colonies are randomly picked from each plate and cultured in150 pl of liquid LB/2xCarb medium placed in an individual well of an appropriate,commercially-available, sterile 96-well microtiter plate. The following day, 5 ul of eachovernight culture is transferred into a non-sterile 96-well plate and after dilution 1:10 with water,5 pal of each sample is transferred into a PCR array.For PCR ampli?cation, 18 ul of concentrated PCR reaction mix (3.3x) containing 4 unitsof rTth DNA polymerase, a vector primer and one or both of the gene speci?c primers used forthe extension reaction are added to each well. Ampli?cation is performed using the followingconditions:Step l 94° C for 60 secStep 2 94° C for 20 secStep 3 55° C for 30 secStep 4 72° C for 90 secStep 5 Repeat steps 2-4 for an additional 29 cyclesStep 6 72° C for 180 secStep 7 4° C (and holding)Aliquots of the PCR reactions are run on agarose gels together with molecular weightmarkers. The sizes of the PCR products are compared to the original partial cDNAs, andappropriate clones are selected, ligated into plasmid and sequenced.VI Labeling and Use of Hybridization ProbesHybridization probes derived from SEQ ID N022 are employed to screen cDNAs,genomic DNAs or mRNAs. Although the labeling of oligonucleotides, consisting of about 20base-pairs, is speci?cally described, essentially the same procedure is used with larger CDNAfragments. Oligonucleotides are designed using state-of-the-art software such as OLIGO 4.06(National Biosciences), labeled by combining 50 pmol of each oligomer and 250 mCi of [Y-32P]adenosine triphosphate (Amersham, Chicago IL) and T4 polynucleotide kinase (DuPont NEN®,Boston MA). The labeled oligonucleotides are substantially purified with Sephadex G-25 super-34-?1015202530CA 02265455 1999-03-08W0 98/1 1227 PCT/U S97/ 16034?ne resin column (Pharmacia). A portion containing 107 counts per minute of each of the senseand antisense oligonucleotides is used in a typical membrane based hybridization analysis ofhuman genomic DNA digested with one of the following endonucleases (Ase I, Bgl II, Eco RI,Pst I, Xba I, or Pvu II; DuPont NEN®).The DNA from each digest is fractionated on a 0.7 percent agarose gel and transferred tonylon membranes (Nytran Plus, Schleicher & Schuell, Durham NH). Hybridization is carried outfor 16 hours at 40°C. To remove nonspeci?c signals, blots are sequentially washed at roomtemperature under increasingly stringent conditions up to 0.1 x saline sodium citrate and 0.5%sodium dodecyl sulfate. After XOMAT ARTM ?lm (Kodak, Rochester NY) is exposed to theblots in a Phosphoimager cassette (Molecular Dynamics, Sunnyvale CA) for several hours,hybridization patterns are compared visually.VII Antisense MoleculesThe sequence encoding NGCP, or any part thereof, is used to inhibit i_n yim or i_n yi_tr_oexpression of naturally occurring sequence. Although use of antisense oligonucleotides,comprising about 20 base-pairs, is speci?cally described, essentially the same procedure is usedwith larger cDNA fragments. An oligonucleotide complementary to the coding sequence ofNGCP as shown in Figures 1A and 1B is used to inhibit expression of naturally occurringsequence. The complementary oligonucleotide is designed from the most unique 5' sequence asshown in Figures 1A and 1B and used either to inhibit transcription by preventing promoterbinding to the upstream nontranslated sequence or translation of a transcript encoding NGCP bypreventing the ribosome from binding. Using an appropriate portion of the leader and 5’sequence of SEQ ID N022, an effective antisense oligonucleotide includes any 15-20 nucleotidesspaiming the region which translates into the signal or early coding sequence of the polypeptideas shown in Figures 1A and 1B.VIII Expression of NGCPExpression of NGCP is accomplished by subcloning the cDNAs into appropriate vectorsand transfecting the vectors into host cells. In this case, the cloning vector, pSport, previouslyused for the generation of the cDNA library is used to express NGCP in E. 99_l_i. Upstream of thecloning site, this vector contains a promoter for B-galactosidase, followed by sequence containingthe amino-terminal Met and the subsequent 7 residues of B-galactosidase. Immediately followingthese eight residues is a bacteriophage promoter useful for transcription and a linker containing anumber of unique restriction sites.-35-?1015202530CA 02265455 1999-03-08W0 98/1 1227 PCT/US97/ 16034Induction of an isolated, transfected bacterial strain with IPTG using standard methodsproduces a fusion protein which consists of the ?rst seven residues of B-galactosidase, about 5 to15 residues of linker, and the full length NGCP. The signal sequence directs the secretion ofNGCP into the bacterial growth media which can be used directly in the following assay foractivity.IX Assay for NGCP ActivityThe chemotactic activity of NGCP is measured under agarose according to the method ofNelson et al (1975; J Immunol 115: 1650). Mononuclear cells or granulocytes are exposed toserial dilutions of control media or media in which cells expressing recombinant NGCP weregrown. After 2 hours incubation at 37°C, cells are fixed and stained. Spontaneous migrationtoward the control sample is compared to migration toward the test sample for various cell types.The speci?city of the chemoattraction is determined by performing the agarose assay onspeci?c populations of cells. Blood cells obtained from venipuncture are fractionated by densitygradient centrifugation and the chemotactic activity of NGCP is tested on enriched populations ofneutrophils, peripheral blood mononuclear cells, granulocytes, monocytes and lymphocytes.Optionally, such enriched cell populations may be further fractionated using CD8* and CD4+speci?c antibodies for negative selection of CD4* and CD8* enriched T-cell populations,respectively.X Production of NGCP Speci?c AntibodiesNGCP is substantially puri?ed using PAGE electrophoresis (Sambrook, supra) is used toimmunize rabbits and to produce antibodies using standard protocols. The amino acid sequencetranslated from NGCP is analyzed using DNAStar software (DNAStar Inc) to determine regionsof high immunogenicity and a corresponding oligopeptide is synthesized and used to raiseantibodies by means known to those of skill in the art. Analysis to select appropriate epitopes,such as those near the C-terminus or in hydrophilic regions (shown in Figures 4 and 5) isdescribed by Ausubel FM et al (supra).Typically, the oligopeptides are 15 residues in length, synthesized using an AppliedBiosystems Peptide Synthesizer Model 431A using fmoc-chemistry, and coupled to keyholelimpet hemocyanin (KLH, Sigma) by reaction with M-maleimidobenzoyl-N-hydroxysuccinimideester (MBS; Ausubel FM et al, supra). Rabbits are immunized with the oligopeptide—KLHcomplex in complete Freund's adjuvant. The resulting antisera are tested for antipeptide activity,for example, by binding the peptide to plastic, blocking with 1% BSA, reacting with rabbit-36-?101520CA 02265455 1999-03-08W0 98/1 1227 PCT/US97/16034antisera, washing, and reacting with radioiodinated, goat anti—rabbit IgG.XI Puri?cation of Naturally Occurring NGCP Using Specific AntibodiesNaturally occurring or recombinant NGCP is substantially puri?ed by ‘immunoaf?nitychromatography using antibodies speci?c for NGCP. An immunoaf?nity column is constructedby covalently coupling NGCP antibody to an activated chromatographic resin such asCnBr-activated Sepharose (Pharmacia Biotech). After the coupling, the resin is blocked andwashed according to the manufacturer's instructions.Membrane fractions from cells expressing NGCP are prepared by methods well known inthe art. Alternatively, a recombinant NGCP fragment containing an appropriate signal sequencemay be secreted in useful quantity into the medium in which transfected cells are grown.The NGCP-containing preparation is passed over the immunoaf?nity column, and thecolumn is washed under conditions that allow the preferential absorbance of NGCP (eg, highionic strength buffers in the presence of detergent). The column is eluted under conditions thatdisrupt antibody/NGCP binding (eg, a buffer of pH 2-3 or a high concentration of a chaotropesuch as urea or thiocyanate ion), and NGCP is collected.All publications and patents mentioned in the above speci?cation are herein incorporatedby reference. Various modi?cations and variations of the described method and system of theinvention will be apparent to those skilled in the art without departing from the scope and spiritof the invention. Although the invention has been described in connection with specific preferredembodiments, it should be understood that the invention as claimed should not be unduly limitedto such speci?c embodiments. Indeed, various modi?cations of the described modes for carryingout the invention which are obvious to those skilled in molecular biology or related ?elds areintended to be within the scope of the following claims.-37-?CA 02265455 1999-03-08 9 7 I 1 58Ra:‘d:9€t7F'ro» 13 APR 1992PF-0121 PCTSEQUENCE LISTING(1) GENERAL INFORMATION(i) APPLICANT: INCYTE PHARMACEUTICALS, INC.(ii) TITLE OF THE INVENTION: NOVEL GRANULOCYTE CHEMOTACTIC PROTEIN 2VARIANT’(iii) NUMBER OF SEQUENCES: 6(iv) CORRESPONDENCE ADDRESS:(A) ADDRESSEE: Incyte Pharmaceuticals, Inc.B) STREET: 3174 Porter DriveC) CITY: Palo AltoD) STATE: CAE) COUNTRY: USA(F) ZIP: 94304(V) COMPUTER READABLE FORM:(A) MEDIUM TYPE: Diskette(B) COMPUTER: IBM Compatibl(C) OPERATING SYSTEM: DOS(D) SOFTWARE: Fast:SEQ for Windows Version 2.0(vi) CURRENT APPLICATION DATA:(A) PCT APPLICATION NUMBER: PCT/US97/16034(B) FILING DATE: 10-SEP-1997(C) CLASSIFICATION:(Vii) PRIOR APPLICATION DATA:(A) APPLICATION NUMBER: US 08/713,288(B) FILING DATE: l2-SEP—l996(viii) ATTORNEY/AGENT INFORMATION:(A) NAME: Billings, Lucy J.(B) REGISTRATION NUMBER: 36,749(C) REFERENCE/DOCKET NUMBER: PF-0121 PCT(ix) TELECOMMUNICATION INFORMATION:(A) TELEPHONE: 650-855-0555(B) TELEFAX: 650-845-4166(C) TELEX:(2) INFORMATION FOR SEQ ID NO:l:(i EQUENCE CHARACTERISTICS:LENGTH: 114 amino acidsTYPE: amino acidSTRANDEDNESS: single)(A(B(C(D TOPOLOGY: linearxgs/\/‘#0)(Vii) IMMEDIATE SOURCE:(A) LIBRARY: 949299(B) CLONE: PANCNOT0538-_'¢“:.v;-. “!‘g I‘: i§.H;\JJL;:;lUo-?‘ --2/'PF—Ol2l PCT(xi)Met Ser LeuSer Leu CysAla35CysPro LeuThr50LeuCysLys Gln65ValAla SerPro Phe LeuLys Asn(2(i)(A)(B)(C)(D)(vii)(A(B(xi)GAACCAAAGTACCCTCTCTTCGGGCTCCTTCCAGCGCTGGCGCTGAGAGTGCTCCAAGGTAAGCCCCTTTGAGTAACAAAGAGATCCCTG(2(i)(A(B)(C(D(B)(xi)SEQUENCEPro Ser5Ala Leu20Ser AlaLeu ArgVal PheLeu Lys85Lys Lys100SerLeuGlyValPro70AsnValCA 02265455 1999-03-08DESCRIPTION:Arg AlaAla LeuAla ArgLeuSEQ ID NO:Val10Leu Leu25Val40LeuProThr55Ala GlyGly LysIle GlnSerArgProGlnLysAla ValVal AsnGln Cys75Val Cys90Ile Leu105) INFORMATION FOR SEQ ID NO:2:LENGTH:TYPE: nucleic acidSTRANDEDNESS:TOPOLOGY:IMMEDIATE) LIBRARY:) CLONE:singlelinearSOURCE:949299PANCNOT05SEQUENCE DESCRIPTION:GCTCTGTATCGACCACTATGGTGCGCGCTGTCCTGTCTCTAAACCCCAAAGGAAGTGGTATCTAAAGAAAAAAGACCATGGACCCAGTAACTCCAGTCTCAGCCTCCCGTCTCGCGCTGCGCTGTGCTGAACGATTGGTAGCCTCCCTGAGTCATCCAGACATCATAAAASEQUENCE CHARACTERISTICS:500 base pairsPCT/U397/1603458 PCT/PTO 1 3 APR 1398SEQ ID NO:2:CGCGCCTCCACCAGCCGCGCTGCTCCTGCTCAGAGCTGCGAACTGCAGGTAGAACGGGAAAAATTTTGGATTGCCCAGTC) INFORMATION FOR SEQ ID N023:LENGTH:TYPE:TOPOLOGY:singlelinearIMMEDIATE SOURCE:LIBRARY:CLONE:GenBank607031SEQUENCE DESCRIPTION:SEQUENCE CHARACTERISTICS:114 amino acidsamino acidSTRANDEDNESS:Pro Gly Pro Ser Gly15Leu Thr Pro Pro Gly30Leu Thr Glu Leu Arg45Pro Lys Thr Ile Gly60Ser Lys Val Glu Val80Leu Asp Pro Glu Ala95Asp Ser Gly Asn Lys110CCCAGCTCAG GAACCCGCGA 60GGCCCGTGTC CCGGGTCCTT 120GACGCCGCCG GGGCCCCTCG 180TTGCACTTGT TTACGCGTTA 240GTTCCCCGCA GGCCCGCAGT 300GCAAGTTTGT CTGGACCCGG 360CAGTGGAAAC AAGAAAAACT 420TTCAGCGGAG CAGTTTTCTG 480500SEQ ID N023:Met Ser Leu Leu Ser Ser Arg Ala Ala Arg Val Pro Gly Pro Ser Ser15“\,,v__ _H.._..... (‘u1039‘ I.‘.—..._r C. 44.»:-...4-o15?CA 02265455 1999-03-08PCT/U897/1603453R€c’<fWIPTo* 13 A PR 1998PF-0121 PCTSer Leu Cys Ala Leu Leu Val Leu Leu Leu Leu Leu Thr Gln Pro Gly20 25 30Pro Ile Ala Ser Ala Gly Pro Ala Ala Ala Val Leu Arg Glu Leu Arg35 40 45Cys Val Cys Leu Gln Thr Thr Gln Gly Val His Pro Lys Met Ile Ser50 55 60Asn Leu Gln Val Phe Ala Ile Gly Pro Gln Cys Ser Lys Val Glu Val65 70 75 80Val Ala Ser Leu Lys Asn Gly Lys Glu Ile Cys Leu Asp Pro Glu Ala85 90 95Pro Phe Leu Lys Lys Val Ile Gln Lys Ile Leu Asp Gly Gly Asn Lys100 105 110Glu Asn(2) INFORMATION FOR SEQ ID NO:4:“” (i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 75 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(Vii) IMMEDIATE SOURCE:(A) LIBRARY: GenBank(B) CLONE: 462170(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:Gly Pro Val Ser Ala Val Leu Thr Glu Leu Arg Cys Thr Cys Leu Arg1 5 10 15Val Thr Leu Arg Val Asn Pro Lys Thr Ile Gly Lys Leu Gln Val Phe20 25 30Pro Ala Gly Pro Gln Cys Ser Lys Val Glu Val Val Ala Ser Leu Lys35 40 45Asn Gly Lys Gln Val Cys Leu Asp Pro Glu Ala Pro Phe Leu Lys Lys‘ 50 55 60H,» Val Ile Gln Lys Ile Leu Asp Ser Gly Asn Lys65 70 75(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 75 amino acids-(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(A) LIBRARY: GenBank(B) CLONE: 415589(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:Gly Pro Val Ala Ala Val Val Arg Glu Leu Arg Cys Val Cys Leu Thrl 5 10 15Thr Thr Pro Gly Ile His Pro Lys Thr Val Ser Asp Leu Gln Val Ile20 25 3040-- ».-.----~.-* 4 '."’-_.""V ‘ .-\J so-345‘ ?CA 02265455 1999-03-08PCT/U897/1503458Rwdf*0T/P7?> 2 3 APR1998PF-0121 PCTAla Ala Gly Pro Gln Cys Ser Lys Val Glu Val Ile Ala Thr Leu Lys35 40 45Asn Gly Arg Glu Val Cys Leu Asp Pro Glu Ala Pro Leu Ile Lys Lys50 55 60Ile Val Gln Lys Ile Leu Asp Ser Gly Lys Asn65 7O 75(2) INFORMATION FOR SEQ ID N026:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 477 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(Vii) IMMEDIATE SOURCE:(A) LIBRARY: GenBank(B) CLONE: 973875SEQ ID N026:(Xi) SEQUENCE DESCRIPTION:AATCTTCGCT CCTCCAATCT CCGCTCCTCC ACCCAGTTCA GGAACCCGCG ACCGCTCGCA 60GCCTCTCTTG ACCACTATGA GCCTCCTGTC CAGCCGCGCG CCCGTGTCCC CGGTCCTTCG 120AGCTCCTTGT GCGCGCTGTT GGTGCTGCTG CTGCTGCTGA CGTACCAGGG CCCATCGTCA 180GCGCTGGTCC TGCCGCTGCT GTGTTGAGAG AGCTGCGTTG CGTTTGTTTA CAGACCACGN 240‘ AGGGAGTTCA TCCCAAAATG ATCAGTAATC TGCAAGTGTT CGNCATAGGG CCACAGTTGT 300TNCAAGGTTG AAGTGGTAGC CTTNCTGAAG AACGGGAAGG AAATTTTGTT CTTGATTNCA 360GAAGACCNTT TTTTNTAAAG ANAGTCATTN CAGAAAATTT TTGGGACGGT NGGAAACAAG 420: GNATAATTGA TTAAGGAGAA ATGAGGCACG NATGGGAAAA GTTTTNCCAG TTTTTCA 47741,...,g.»-s.-~-Q» A “'?CA 02265455 1999-03-08PCTIUS97/1603458Rea'd PCT/PTO 1 3 APR 1998PF—0l21 PCT[THIS PAGE INTENTIONALLY LEFT BLANK]...._~mm ~, . . V» — ~-~——

Claims (12)

1. A substantially purified polypeptide comprising the amino acid sequence of SEQ ID
N 0:1, or fragments thereof.

2. An isolated and purified polynucleotide sequence encoding the polypeptide of claim 1.

3. An isolated polynucleotide sequence comprising the nucleic acid sequence of SEQ ID
N 0:2 or variants thereof.

4. An isolated polynucleotide sequence consisting of the complement of SEQ ID N 0:2.

5. An isolated polynucleotide sequence which hybridizes under stringent conditions to SEQ ID N 0:2.

6. A hybridization probe comprising SEQ ID N 0:2, or fragments thereof.

7. A recombinant expression vector containing the polynucleotide sequence of claim 3.

8. A recombinant host cell containing the expression vector of claim 7.

9. A method for producing the polypeptide of SEQ ID N 0:1, or fragments thereof, the method comprising the steps of:
a) culturing the host cell of claim 8 under conditions suitable for the expression of the polypeptide; and b) recovering the polypeptide from the host cell culture.

10. A pharmaceutical composition comprising the polypeptide of SEQ ID NO: 1 in conjunction with a pharmaceutically acceptable excipient.

11. A method for the treatment of cancer, the method comprising administering to a subject an amount of the pharmaceutical composition of claim 10 which is sufficient to treat the cancer.

12. A purified antibody which binds specifically to the polypeptide of claim 1.