CA2263951A1 - Use of a mutated macrolide binding protein for the prevention of gvhd - Google Patents

Abstract

This invention is directed to a modified cyclosporin A and to a modified, genetically engineered version of its receptor, cyclophilin. This invention is further directed to a method for treating host versus graft disease following blood marrow transplantation by transfecting stem cells so that after introduction into a patient the stem cells will express the modified cyclophilin, and, as necessary, administer the modified cyclosporin A to the patient.

Description

?1015202530WO 98/08956CA 02263951 1999-02-22PCT/U S97/15153- 1 -USE OF MUTATED MACROLIDE BINDING PROTEIN FOR THE PREVENTION OF GUHDBACKGROUND OF THE INVENTIONTolerance to self major histocompatibility (MHC) antigens occurs during T cellmaturation in the thymus. During ontogeny, exposure of the immune system to MHCantigens results in the loss of reactivity to those antigens, thus leaving the animalspeci?cally tolerant into adult life. Inducing tolerance in adult animals has beenaccomplished by high-dose cytoreductive therapy and bone marrow transplantation.Bone marrow transplantation has been found to be effective in the control ofcertain malignant lymphohematopoietic diseases where conventional chemotherapy hasfailed or would be expected to fail. There are attendant disadvantages to bone marrowtransplantation. Often there is an allogeneic antitumor effect independent of thechemoradiotherapy of the preparative regimen. This adoptive immunotherapy effect is. inlarge measure, accompanied by graft-versus-host (GVH) disease.Historically, GVH disease has been a major cause of serious morbidity and deathafter bone marrow transplantation. Graft-versus-host disease and its treatment areaccompanied by profound immunode?ciency and immune dysregulation, which places thepatient at risk for life-threatening infections and other complications. GVH disease hasaccounted for approximately two thirds of the deaths after allogeneic bone marrowtransplantation.Removing T lymphocytes in allogeneic bone marrow inocula to prevent GVI-Idisease is associated with increased rates of engraftment failure. While these drawbacksare generally considered acceptable for the treatment of otherwise lethal malignantdiseases, they would severely limit the application of MHC mismatched bone marrowtransplantation as a preparative regimen for organ transplantation, in which nonspeci?cimmunosuppressive agents, while not without major complications, are effective.Since GVH disease is immunologically mediated, efforts to prevent itsdevelopment have involved the use of immunosuppressive therapy. Of the many agentsstudied, methotrexate, glucocorticoids. and cyclosporin have been found to be useful. It isa continuing goal to develop better treatments for patients in need of a bone marrowtransplant or other diseases that can be specifically cell targeted.SUMMARY OF THE INVENTION?101520253035CA 02263951 1999-02-22WO 98/08956 PCT/US97I15153- 2 _One one embodiment of the present invention provides a method for selectivelyinhibiting proliferation of a hematopoietic cell by contacting a cell which ectopicallyexpresses a mutated macrolide binding protein (MBP) with a macrolide which selectivelyinduces macrolide-dependent inhibition of proliferation of cells expressing the mutatedMBP compared to cells expressing a wild-type form of the MBP. In such embodiments,the mutated MBP has an altered macrolide—binding speci?city relative to the wild-typeform MBP, e.g., which provides the speci?city for macrolide-dependent inhibition.In another embodiment, the invention provides a method for selectively inhibitingproliferation of a hematopoietic cell comprising: (i) causing, in the cell, the ectopicexpression of an MBP gene encoding a mutated macrolide binding protein (MBP) havingan altered macrolide—binding speci?city relative to a wild-type form of the MBP, whichmutated MBP retains the ability to cause macrolide-dependent inhibition of proliferation;and (ii) contacting the cell with a macrolide which selectively binds to the altered MBPrelative to the wild-type MBP and selectively induces macrolide-dependent inhibition ofproliferation of cells expressing the mutated MBP relative to cells not expressing only thewild-type MBP.In yet another embodiment, there is provided a method for selectively inhibitingproliferation of a transplanted hematopoietic cell by the steps of (i) transplanting, into ananimal, hematopoietic cells which ectopically expresses a MBP gene encoding a mutatedmacrolide binding protein (MBP), the mutated MBP having an altered macrolide-bindingspeci?city relative to the wild-type form MBP; and (ii) administering to the animal anamount of a macrolide suf?cient to inhibit proliferation of the transplanted cells, whichmacrolide selectively induces macrolide-dependent inhibition of proliferation of cellsexpressing the mutated MBP compared to cells expressing a wild-type form of the MBP.In still another embodiment, the there is provides a method for treating graft-versus-host disease in an animal by selectively inhibiting proliferation of hematopoieticcells contained a transplanted tissue. Such methods are particularly useful in thetransplantation of bone marrow or hematopoeitic stem cells. The method generallycomprises transducing, e.g., before implantation, at least a sub-population ofhematopoietic cells of the transplanted tissue with a gene for ectopic expression of amutated macrolide binding protein (MBP), the mutated MBP having an altered macrolide-binding specificity relative to the wild-type form MBP. Prior to, concurrent with and/orsubsequent to transplanting the tissue, the animal (or cells in culture) are treate with anamount of a macrolide suf?cient to inhibit proliferation of the hematopoeitic transplantedcells, which macrolide selectively induces macrolide-dependent inhibition of proliferationof the transplanted cells expressing the mutated MBP compared to endogenous cells of theanimal.?’WO 98108956101520253035CA 02263951 1999-02-22PCT/US97I15153- 3 _In another embodiment, the invention provides a method for promotingengraftment and hematopoietic activity of a hematopoietic stem cell. comprising: (a)transducing the stem cells to be engrafted with a nucleic acid encoding a modifiedmacrolide binding protein speci?c for a modi?ed macrolide, e.g., to produce a transformedhematopoietic stem cell; (b) introducing the transformed hematopoietic stem cell into arecipient mammal, such that the modi?ed cellular receptor cyclophilin is expressed; and(c) administering to the animal an effective amount of the modi?ed cyclosporin.In the subject methods described herein, such as those enumerated above, the MBPcan be a FRAP, an FK506—binding protein, a cyclophilin or a calcineurin. Preferably, themutated MBP has a dissociation constant, Kd, for a modified macrolide which is at leastone order of magnitude less than the Kd of the wild—type MBP, though mutated MBP withdissociation constants at least two, three, four, five and even ten orders of magnitude lessthan the Kd of the wild—type MBP are contemplated.The the mutated MBP gene can be provided in a cell as part of an expressionvector, such as a viral expression construct. In certain embodiments, the mutated MBPgene is introduced into the genome of the cell by homologous recombination or otherintegration techniques.In preferred embodiments, the macrolide is an analog of rapamycin, FKSO6 orcyclosporin.Preferred cells for use in the subject methods are mammalian cells, more preferablyprimate cells, and even more preferably human cells.Preferred animals for treatemtn by the subject methods are mammals, morepreferably primates. and even more preferably humans.In those instances where the engineered cells are transplanted into an animal, thecells are preferably from an autologous source.For treatment, the subject method can be used where the treated animal is in animmunosuppressed state, e. g., as a result of radiation or chemotherapy.Another aspect of the present invention provides expression constructs encoding amutated macrolide binding protein (MBP) selected from the group consisting of FRAP,FKBP, cyclophilin and calcineurin, wherein the mutated MBP has an altered macrolide-binding specificity relative to the wild-type form MBP and, in the presence of a macrolidewhich binds the mutated MBP, induces macrolide-dependent inhibition of proliferation ofa cell expressing the mutated MBP.The present invention also provides hematopoeitic cells, particularly stem cellsand/or T cells, which have been engineered with such expression constructs?1015202530SW0 98/08956CA 02263951 1999-02-22PCT/US97/15153- 4 -Yet another aspect of the present invention relates to kits for for selectivelyinhibiting proliferation of a hematopoietic cell. The subject kits can include (i) anexpression construct for ectopically expressing an MBP gene encoding a mutatedmacrolide binding protein (MBP) having an altered macrolide—binding speci?city relativeto a wild-type form of the MBP, which mutated MBP retains the ability to causemacrolide-dependent inhibition of proliferation; and (ii) a macrolide which selectivelybinds to the altered MBP relative to the wild-type MBP and selectively induces macrolide-dependent inhibition of proliferation of cells expressing the mutated MBP relative to cellsnot expressing only the wild-type MBP.BRIEF DESCRIPTION OF THE FIGURESFigure 1 is a graph showing the cellular assay for calcineurin-mediated NFAT-signalling.Figure 2 is a shematic depiction of the interaction between cyclosporin A (CsA)and cyclophilin (Cph) and between a modi?ed CsA (CsAt-), containing an additionalmethyl group, and a modi?ed Cph (Cpht-) containing mutations of F l 13G, S99T whichcreate a "hole" to accommodate the methyl group of CsAt'.Figure 3 represents the amount of thymidine incorporated as a percent of maximalstimulation of normal peripheral lymphocytes after 48 hours incubation with anti CD3 plusCD28 and exposure to the indicated concentrations (nM) of CsA or CsAt'.Figure 4 represents the percent inhibition of NF-AT dependent transcription inJurkat cells transfected with Cpht' or Cph and treated with various concentrations of CsAt'DETAILED DESCRIPTION OF THE INVENTION1. GeneralThe invention pertains to methods for regulating a biological activity of a cell,preferably in a tissue—type or cell-type speci?c manner. In general, the present inventionprovides a method for rendering a cell selectively sensitive to a macrolide analog. Thepresent invention is based, inter alia, on the observation that, by compensatory mutation,macrolide-dependent protein-protein interactions, e.g., mediated by macrolides, can berecapitulated in systems where the macrolide has been altered (as a “modi?ed ligand”) tono longer interact ef?ciently with a ligand-binding domain (LBD) of one of the proteins(“target protein”) found in macrolide-dependent complexes. In particular, compensatorymutations can be made to the ligand binding domain of a target protein which is not?1015202530352 W0 98/118956CA 02263951 1999-02-22PCT/US97l15l53- 5 _otherwise able to ef?ciently bind to the modi?ed ligand, and in doing so render themodi?ed target protein able to bind to the modi?ed ligand.According to the invention, a biological activity of a cell which is contingent onthe presence or absence of macrolide—dependent protein complexes can be regulated bytreatment with the modi?ed ligand and concomitant expression of a target proteinengineered to bind to the modi?ed form of the ligand. Upon expression of the geneticallyengineered target protein, the modi?ed ligand can selectively bind to or otherwise interactwith the engineered protein so as to recruit and/or stabilize the formation of a macrolide-dependent protein complex. In preferred embodiments, the modified ligand will notsimilarly interact with or induce formation of similar complexes in wild-type cells. Thus,the invention provides the ability to selectively regulate biological events mediated by theprotein target. Treatment of wild-type cells (i.e., cells which do not express the modi?edprotein) with the modi?ed ligand will have essentially no impact on the biological activityin those cells, whereas treatment of cells expressing the modi?ed protein with themodi?ed ligand will induce the biological activity.To provide further guidance, the following three examples illustrate certain aspectsof the invention:(A) The macrolide rapamycin mediates the formation of complexes including anFK506-binding protein (FKBP), such as FKBPI2 (SEQ ID NO. 1), and aFRAP (torl) protein (SEQ ID No. 2).dependent complexes correlates with cell—cycle arrest in G1 phase, and isThe formation of the rapamycin-understood to be part of the mechanism by which rapamycin obtains itsimmunosuppressive, antiproliferative and antineoplastic activities. Asdescribed below, there are a variety of rapamycin analogs which bind F RAPand/or FKBPIZ with a much reduced af?nity (e.g., with Kd values which areorders of magnitude greater than rapamycin). By compensatory mutation to,for example, the ligand-binding domain of FRAP, formation of rapamycin-dependent FRAP/FKBP complexes by certain of those analogs can berestablished. Accordingly, a cell can be rendered sensitive to such rapamycinanalogs by ectopic expression of a gene encoding a compensatory mutant ofFRAP. Similarly, where the modi?cation of rapamycin results in loss ofef?cient interaction with an FKBP, compensatory mutations to that protein canbe used to provide FRAP/FKBP complexes dependent on the presence of themodi?ed rapamycin.(B) The macrolide FK506 can bring about certain biological events, like cell-cyclearrest, by a mechanism which apparently includes induction of FK506-?1015202530357 WO 98/08956CA 02263951 1999-02-22PCT/US97/ 15153- 6 -dependent complexes of an FKBP and the calcineurin protein (SEQ ID No. 3).Various analogs of FK506 can be made which disrupt the ability of the analogto interaction one or both of the FKBP and calcineurin proteins, or at leastdirsupt the formation of macrolide-dependent complexes. As above,compensatory mutants can be provided which restore the ability of the analogto induce such biological responses as inhibition of proliferation.(C) Yet another example of a macrolide-dependent system which can be usurpedfor use in the present invention involves the cyclosporin-dependent complexesincluding a cyclophilin and a calcineurin. As above, pairs of cyclosporinanalogs and compensatory mutants of one or both of the cyclophilin and/orcalcineurin proteins can be used to render cell populations selectively sensitiveto treatment with the analog.Thus, in a generic sense, the present invention provides a method for selectivelyinhibiting proliferation of a cell by (i) contacting the cell with a macrolide which does notefficiently bind to a native macrolide binding protein (MBP) of the cell, under conditionswherein (ii) the cell ectopically expresses a mutated form of the MBP which causesinhibition of proliferation in a manner dependent on the presence of the macrolide. Forexample, the MBP can be engineered with compensatory mutations sufficient to decreasethe dissociation constant (kd) for binding to the macrolide, e.g., relative to the nativeMBP, preferably by at least 1, 2, 3 or even 5 or more orders of magnitude.In a preferred embodiment of the invention, tissue specificity for controlling theeffect of treatment with the macrolide is achieved by selective transduction of a geneencoding the modi?ed MBP, and/or by operably linking that gene to a transcriptionalregulatory sequence having the desired cell-type or tissue—type speci?city for expression.In other embodiments, tissue speci?city is provided by tissue-speci?c delivery of themacrolide.Exemplary biological activity that can be regulated according to the method of theinvention can be cellular proliferation, differentiation, and/or cell death and/or regulationof gene expression, so long as the biological activity is regulated or otherwise mediated bythe ligand-crosslinked protein complex. In a preferred embodiment, the biological activityis T cell activation.Exemplary target proteins which can be engineered in the practice of the subjectinvention include those intracellular proteins which form protein complexes in amacrolide-dependent fashion, and include cyclophilins, calcineurins, FK506 bindingproteins (FKBPS) and FRAP (Torl), which have mutated ligand binding domains forinteracting with such macrolides as altered forms of cyclosporins, FK506 or rapamycin,?10152025307 WO 98/08956CA 02263951 1999-02-22PCT /US97/15153- 7 _e.g., which effect the formation of cyclophilin-calcineurin, FKBP-calcineurin and FKBP-FRAP complexes.II. De?nitionsFor convenience, the meaning of certain terms and phrases employed in thespecification, examples, and appended claims are provided below.As used herein, the term "cellular composition" refers to a preparation of cells.which preparation may include, in addition to the cells, non-cellular components such ascell culture media, e.g. proteins, amino acids, nucleic acids, nucleotides, co-enzyme, anti-oxidants, metals and the like. Furthermore, the cellular composition can have componentswhich do not affect the growth or viability of the cellular component, but which are usedto provide the cells in a particular format, e.g., as polymeric matrix for encapsulation or apharmaceutical preparation.The term "lineage committed cell" refers to a stem cell that is no longer pluripotentbut has become restricted to a speci?c lineage, e.g., a myeloid, lymphoid, erythroidlineage. the lineage committed cell subsequently differentiates to specialized cell types,e.g., erythrocytes, T and B lymphocytes.The term "stem cell" refers to an undifferentiated cell which is capable of self-renewal, i.e., proliferation to give rise to more stem cells, and may give rise to lineagecommitted progenitors which are capable of differentiation and expansion into a specificlineage. In a preferred embodiment, the term "stem cell" refers to a generalized mothercell whose descendants (progeny) specialize, often in different directions, bydifferentiation, e.g., by acquiring completely individual characters, as occurs inprogressive diversification of embryonic cells and tissues. As used herein, the term "stemcells" refers generally to both embryonic and hematopoietic stem cells from mammalianorigin, e.g., human.A stem cell composition is characterized by being able to be maintained in culturefor extended periods of time, being capable of selection and transfer to secondary andhigher order culture, and being capable of differentiating into various lymphoid or myeloidlineages, particularly B and T lymphocytes, monocytes, macrophages, neutrophils.erythrocytes and the like.As used herein, the term "embryonic stem cell" means a pluripotent, blastocyst-derived cell that retains the developmental potential to differentiate into all somatic and?1015202530357W0 98l08956CA 02263951 1999-02-22PCT/US97/15153_ 3 -germ cell lineages (for review, see Robertson, E. J. (1986) Trends in Genetics 2: 9-13).This cell type is also referred to as an "ES cell".As used herein, the term "hematopoietic stem cell" (I-ISC) means a population ofcells capable of both self-renewal and differentiation into all defined hematopoieticlineages, i.e., myeloid, lymphoid or erythroid lineages; and limiting number of cells arecapable of repopulating the hematopoietic system of a recipient who has undergonemyeloablative treatment. HSCs can ultimately differentiate into “hematopoietic cells”,including without limitation, common lymphoid progenitor cells, T cells (e.g., helper,cytotoxic, and suppressor cells), B cells, plasma cells, natural killer cells, commonmyeloid progenitor cells, monocytes, macrophages, mast cells, leukocytes, basophils,neutrophils, eosinophils, magakaryocytes, platelets, and erythroids. HSCs are identi?ableby the presence of cell surface antigens of primitive phenotypes, e.g., CD34+Thy-l+Lin‘sand negative staining for lineage—speci?c antigens.As used herein, the term "gene" or "recombinant gene" refers to a nucleic acidmolecule comprising an open reading frame and including at least one exon and(optionally) an intron .sequence. The term "intron" refers to a DNA sequence present in agiven gene which is not translated into protein and is generally found between exons.As used herein, the term "nucleic acid" refers to polynucleotides such asdeoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The termshould also be understood to include, as equivalents, derivatives, variants and analogs ofeither RNA or DNA made from nucleotide analogs, and, as applicable to the embodimentbeing described, single (sense or antisense) and double-stranded polynucleotides.The term “operably linked” when referring to a transcriptional regulatory sequenceand a coding sequence is intended to mean that the regulatory sequence is associated withthe coding sequence in such a manner as to facilitate transcription of the coding sequencein an activator-dependent fashion.As used herein, "heterologous DNA" or "heterologous nucleic acid" include DNAthat does not occur naturally as part of the genome in which it is present or which is foundin a location or locations in the genome that differs from that in which it occurs in nature.Heterologous DNA is not endogenous to the cell into which it is introduced, but has beenobtained from another cell. Generally, although not necessarily, such DNA encodes RNAand proteins that are not normally produced by the cell in which it is expressed.Heterologous DNA may also be referred to as foreign DNA. Any DNA that one of skill inthe art would recognize or consider as heterologous or foreign to the cell in which isexpressed is herein encompassed by heterologous DNA.?101520253035TWO 98/08956CA 02263951 1999-02-22PCT/US97ll5l53_ 9 _"Transcriptional regulatory sequence", also termed herein “regulatory element”.“regulatory sequence” or “regulatory element”, are generic terms used throughout thespeci?cation to refer to DNA sequences, such as initiation signals, enhancers, andpromoters, which induce or control transcription of protein coding sequences with whichthey are operably linked. The term “enhancer”, also referred to herein as “enhancerelement”, is intended to include regulatory elements capable of increasing, stimulating, orenhancing transcription from a basic promoter. The term “silencer”, also referred toherein as “silencer element” is intended to include regulatory elements capable ofdecreasing, inhibiting, or repressing transcription from a basic promoter. Regulatoryelements can also be present in genes other than in 5' ?anking sequences. Thus, it ispossible that regulatory elements of a gene are located in introns, exons, coding regions,and 3' ?anking sequences.The terms “basic promoter” or “minimal promoter”, as used herein, are intendedto refer to the minimal transcriptional regulatory sequence that is capable of initiatingtranscription of a selected DNA sequence to which it is operably linked. This term isintended to represent a promoter element providing basal transcription. A basic promoterfrequently consists of a TATA box or TATA-like box and is bound by an RNApolymerase and by numerous transcription factors, such as GTFS and TATA box BindingProteins (TBPs).The term "tissue speci?c regulatory element” refers to promoters and otherregulatory elements which effect expression of an operably linked DNA sequencepreferentially in specific cell—types or tissue-types. Gene expression occurs preferentiallyin a speci?c cell if expression in this cell type is signi?cantly higher than expression inother cell types.The tenns “promoter” and “regulatory element” also encompass so-called "leaky"promoters and “regulatory elements”, which regulate expression of a selected DNAprimarily in one tissue, but cause expression in other tissues as well. The terms“promoter” and “regulatory element” also encompass non-tissue speci?c promoters andregulatory elements, i.e., promoters and regulatory elements which are active in most celltypes. Furthermore, a promoter or regulatory element can be a constitutive promoter orregulatory element, i.e., a promoter or regulatory element which constitutively regulatestranscription, as opposed to a promoter or regulatory element which is inducible, i.e., apromoter or regulatory element which is active primarily in response to a stimulus. Astimulus can be, e.g., a molecule, such as a hormone, a cytokine, a heavy metal, phorbolesters, cyclic AMP (CAMP), or retinoic acid.?101520253035WO 98/08956CA 02263951 1999-02-22PCT/US97/15153- 10 _As used herein, the terms "transfection" and “transduction” mean the introductionof a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediatedgene transfer. The term “transduction” is generally used herein when the transfectionwith a nucleic acid is by viral delivery of the nucleic acid. "Transformation", as usedherein, refers to a process in which a cell's genotype is changed as a result of the cellularuptake of exogenous DNA or RNA, and, for example, the transformed cell expresses arecombinant fomt of a polypeptide or, in the case of anti-sense expression from thetransferred gene, the expression of a naturally-occurring form of the recombinant proteinis disrupted.As used herein, the term "transgene" refers to a nucleic acid sequence which hasbeen introduced into a cell. Daughter cells deriving from a cell in which a transgene hasbeen introduced are also said to contain the transgene (unless it has been deleted). Atransgene can encode, e.g., a polypeptide, partly or entirely heterologous, i.e., foreign, tothe transgenic animal or cell into which it is introduced, or, is homologous to anendogenous gene of the transgenic animal or cell into which it is introduced, but which isdesigned to be inserted, or is inserted, into the animal's genome in such a way as to alterthe genome of the cell into which it is inserted (e.g., it is inserted at a location whichdiffers from that of the natural gene). Alternatively, a transgene can also be present in anepisome. A transgene can include one or more transcriptional regulatory sequences andany other nucleic acid, (e.g. intron), that may be necessary for optimal expression of aselected coding sequence.By "gene product" it is meant a molecule that is produced as a result oftranscription of a gene. Gene products include RNA molecules transcribed from a gene, aswell as proteins translated from such transcripts.The terms "protein", "polypeptide" and "peptide" are used interchangeably hereinwhen referring to a gene product, e.g., as may be encoded by a coding sequence.The terms “mutated” and “non-native” are used interchangeably herein and refer togenes and genes products which are not native (do not naturally occur) in the particularcell in which they are present, e.g., the term refers to a state relative to the cell’s genotype.Thus, mutant (or non-native) MBPs are proteins which have altered sequences relative tothe host cell, and which may have been generated by, for example, mutagenesis, or whichcould be MBPs found naturally in other cells.The term "interact" as used herein is meant to include detectable interactionsbetween molecules, such as can be detected using, for example, a yeast two hybrid assayor by immunoprecipitation. The term interact is also meant to include "binding"?10152025309 W0 98/08956CA 02263951 1999-02-22PCT/US97Il5153-11-interactions between molecules. Interactions may be, for example. protein-protein,protein-nucleic acid, protein-small molecule or small molecule-nucleic acid in nature.The term “ligand binding domain” (or “LBD”) refers to any protein, thoughgenerally a fragment thereof or derivative thereof, which binds a preselected ligand.The term “wild-type ligand binding domain” refers to a ligand binding domain as itis naturally occurring in a normal cell.The term “modi?ed ligand binding domain” refers to any ligand binding domainwhich has been modi?ed, or altered to decrease binding of the naturally occurring ligandto the modi?ed LBD. The modi?ed LBD is preferably capable of interacting speci?callywith a modi?ed ligand, which is not capable of interacting signi?cantly with the naturallyoccurring ligand binding domain. A modi?cation of a ligand may consist of the addition,deletion or substitution of at least one atom or chemical moiety of the ligand. If the ligandis a proteinous compound, the modi?cation can be an addition, deletion, or substitution ofone or more amino acids or the modi?cation of at least one amino acid.The term “ligand” refers to any molecule which is capable of interacting with areceptor. A ligand can be naturally occurring, or the ligand can be partially or whollysynthetic. Preferred ligands include macrolides, e.g, cyclosporin A, FK506, andrapamycin and analogs thereof.The term “modi?ed ligand” refers to a ligand which has been modi?ed such that itdoes not signi?cantly interact with the naturally occurring receptor of the ligand in its nonmodi?ed form.As used herein, the term "vector" refers to a nucleic acid molecule capable oftransporting another nucleic acid to which it has been linked. One type of preferred vectoris an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferredvectors are those capable of autonomous replication and/or expression of nucleic acids towhich they are linked. Vectors capable of directing the expression of genes to which theyare operatively linked are referred to herein as "expression vectors". In general,expression vectors of utility in recombinant DNA techniques are often in the form of"plasmids" which refer generally to circular double stranded DNA loops which, in theirvector form are not bound to the chromosome. In the present speci?cation, "plasmid" and"vector" are used interchangeably as the plasmid is the most commonly used form ofvector. However, the invention is intended to include such other forms of expressionvectors which serve equivalent functions and which become known in the art subsequentlyhereto.?1015202530WO 98108956CA 02263951 1999-02-22PCT/US97/ 15153- 12 -“Derived from” as that phrase is used herein indicates a peptide or nucleotidesequence selected from within a given sequence. A peptide or nucleotide sequence derivedfrom a named sequence may contain a small number of modi?cations relative to the parentsequence, in most cases representing deletion, replacement or insertion of less than about15%, preferably less than about 10%, and in many cases less than about 5%, of aminoacid residues or base pairs present in the parent sequence. In the case of DNAs, one DNAmolecule is also considered to be derived from another if the two are capable of selectivelyhybridizing to one another.As used herein, the term "animal" refers to mammals, preferably mammals such ashumans. Likewise, a "patient" or "subject" to be treated by the method of the inventioncan mean either a human or non-human animal.A "disease of a hematopoietic cell" refers to any condition characterized byimpairment of any normal function of a hematopoietic cell. The diseases of hematopoieticcells that can be treated utilizing the cells of the present invention include, withoutlimitation, genetic disorders (e.g., Adenosine Deaminase De?ciency, Fanconis‘ Anemia,and hemoglobinopathies such as Sickle Cell Anemia, Thalassemias, and Hemogobin CDisease), as well as diseases acquired by infectious or non-infectious means (e.g.,Acquired Immune De?ciency Syndrome and leukemias).A “discordant species combination", as used herein, refers to two species in whichhyperacute rejection occurs when vascular organs are grafted. Generally, discordantspecies are from different orders, while non-discordant species are from the same order.III. Exemplary Modi?ed Macrolides and Macrolide-binding proteinsThe modi?ed target proteins are those forms of a protein which, relative to anaturally occuring form of the protein, have been altered at the amino acid level to increasethe binding af?nity of the target protein or a complex including the target protein for amodi?ed macrolide ligand. Generally, such alterations will be made to a ligand bindingdomain of the target protein.A wide range of techniques are known in the art for generating the modi?ed targetproteins of the present invention. In one embodiment, crystallographic or other structuraldata pertaining to the interaction of the normal ligand with the native protein can beconsulted to predict compensatory mutations to the protein to restore binding to themodi?ed ligand. In other embodiments, combinatorial mutagenisis can be used to isolatemutated forms of the target protein by their binding af?nity for the modi?ed ligand. The?101520253035[W0 98/08956CA 02263951 1999-02-22PCT/US97/15153_ 13 _mutations introduced into the target protein can involve changes in amino acid residuesknown to be at the binding site, or by random or semi—random mutagenesis.There are a host of methods available in the art for screening gene products ofvariegated gene libraries made by combinatorial mutagenesis, especially for identifyingindividual gene products having a certain binding property. Such techniques will begenerally adaptable for rapid screening of gene libraries generated by the combinatorialmutagenesis of, for example, the macrolide binding domain of any of an FKBP,cyclophilin, calcineurin and/or FRAP protein. The most widely used techniques forscreening large gene libraries typically comprises cloning the gene library into replicableexpression vectors, transforming appropriate cells with the resulting library of vectors, andexpressing the combinatorial genes under conditions in which detection of a desiredactivity facilitates relatively easy isolation of the vector encoding the gene whose productwas detected. Each of the illustrative assays described below are amenable to highthrough—put analysis as necessary to screen large numbers of degenerate ligand bindingdomain sequences created by combinatorial mutagenesis techniques.In one screening assay, the candidate ligand binding domains are displayed on thesurface of a cell or viral particle, preferably in truncated form, and the ability of particularcells or viral particles to bind as appropriate, e.g., FK506, cyclosporin or rapamycin (or aprotein complex thereof) via the displayed ligand binding domain is detected in a "panningassay". For instance, the degenerate LBD gene library can be cloned into the gene for asurface membrane protein of a bacterial cell, and the resulting fusion protein detected bypanning protocols (see, for example, Ladner et aI., WO 88/06630; Fuchs et al. (1991)Bio/Technology 911370-1371; and Goward et al. (1992) TIBS 182136-140). In a similarfashion, ?uorescently labeled molecules which bind the LBD, such as ?uorescentlylabeled forms of the altered macrolide alone or in preformed protein complexes, can beused to score for ligand binding domains which are capable of interacting with themodi?ed ligand. Cells can be visually inspected and separated under a ?uorescencemicroscope, or, where the morphology of the cell permits, separated by a ?uorescence-activated cell sorter.In an alternate embodiment, the gene library is expressed as a fusion protein on thesurface of a viral particle. For instance, in the ?lamentous phage system, foreign peptidesequences can be expressed on the surface of infectious phage, thereby conferring twosignificant benefits. First, since these phage can be applied to affinity matrices at veryhigh concentrations, a large number of phage can be screened at one time. Second, sinceeach infectious phage displays the combinatorial gene product on its surface, if a particularphage is recovered from an affinity matrix in low yield, the phage can be ampli?ed byanother round of infection. The group of almost identical E. coli ?lamentous phages M13,?1015202530357W0 98l08956CA 02263951 1999-02-22PCT/US97l15153_ 14 -fd, and fl are most often used in phage display libraries, as either of the phage glll orgVIIl coat proteins can be used to generate fusion proteins without disrupting the ultimatepackaging of the viral particle (Ladner et al. PCT publication WO 90/02909; Garrard etal., PCT publication WO 92/09690; Marks et al. (1992) J. Biol. Chem. 267:l6007-16010;Griffiths er al. (1993) EMBO J 122725-734; Clackson et al. (1991) Nature 352:624-628;and Barbas et al. (1992) PNAS 89:4457—4461).In an illustrative embodiment, the recombinant phage antibody system (RPAS,Pharmacia Catalog number 27-9400-01) can be easily modi?ed for use in expressing andscreening LBD combinatorial libraries. For instance, the pCANTAB 5 phagemid of theRPAS kit contains the gene which encodes the phage glll coat protein. A combinatoriallibrary of coding sequences for macrolide binding domains can be cloned into thephagemid adjacent to the glll signal sequence such that it will be expressed as a glll fusionprotein. After ligation, the phagemid is used to transform competent E. coli TG1 cells.Transformed cells are subsequently infected with M13KO7 helper phage to rescue thephagemid and its candidate LBD gene insert. The resulting recombinant phage containphagemid DNA encoding a speci?c candidate protein, and display one or more copies ofthe corresponding fusion coat protein. The phage-displayed candidate LBD which arecapable of binding to the modi?ed macrolide, or a complex thereof, are selected orenriched by panning. For instance, a phage library of mutant LBDs derived from FKBP12can be panned on a polymer-immobilized form of the modi?ed FK506, and unboundphage washed away from the insoluble matrix. The bound phage is then isolated, and ifthe recombinant phage express at least one copy of the wild type glll coat protein, theywill retain their ability to infect E. coli. Thus, successive rounds of reinfection of E. coli,and panning will greatly enrich for variant LBDs retaining the ability to bind to themodi?ed FK506 in each round.In light of the present disclosure, a variety of forms of mutagenesis generallyapplicable will be apparent to those skilled in the art, and most will be amenable to theaforementioned combinatorial mutagenesis approach. For example, modi?ed ligandbinding domains which can bind to the modi?ed ligand can be generated and screenedusing, for example, alanine scanning mutagenesis and the like (Ruf et al. (1994)Biochemistry 33:1565-1572; Wang et al. (1994) J Biol Chem 269:3095-3099; Balint et al.(1993) Gene 1372109-118; Grodberg et al. (1993) Eur JBiochem 2182597-601; Nagashimaet al. (1993) JBiol Chem 268:2888-2892; Lowman et al. (1991) Biochemistry 30110832-10838; and Cunningham et al. (1989) Science 244:l081-1085), by linker scanningmutagenesis (Gustin et al. (1993) Virology 1931653-660; Brown et al. (1992) Mol CellBiol 122644-2652; McKnight et al. (1982) Science 232:316); or by saturation mutagenesis(Meyers et al. (1986) Science 2322613).?101520253035Z WO 98/08956CA 02263951 1999-02-22PCT/US97/15153_ 15 -Where mutagenesis of a fragment of the full length target protein is carried out, thecoding sequence for an isolated modified form of that fragment is reengineered back intothe context of the full length gene, or a portion suf?cient to induce the desired biologicalactivity, such as by techniques used to generate fusion proteins.In preferred embodiments, the modi?ed ligand binding domain binds to themodi?ed ligand with a dissociation constant approaching that observed for interaction ofthe wild-type macrolide receptor and unmodi?ed ligand. In preferred embodiments, thetarget protein is modi?ed to contain ligand-binding domains which bind to a preselectedmodified macrolide with a Kd value below about 10‘°M, more preferably below about 10”M, even more preferably below about 1O'8M, and in some embodiments below about10‘9M. Other modi?ed macrolide binding domains useful in the present invention.including mutants thereof, are described in the art. See, for example, WO96/41865,W096/13613, W096/06111, W096/06110, W096/06097, W096/12796, W095/05389,W095/02684, W094/18317, each of which is expressly incorporated by reference herein.In selecting a modi?ed ligand, e.g., a modi?ed macrolide, for use in the subjectmethod, there are a number of readily observable or measurable criteria which can be(optionally) considered: (A) the ligand is physiologically acceptable (i.e., lacks unduetoxicity towards the cell or animal for which it is to be used), (B) it has a reasonabletherapeutic dosage range, (C) desirably (for applications in whole animals). it can be takenorally (is stable in the gastrointestinal system and absorbed into the vascular system), (D)it can cross the cellular and other membranes, as necessary, and (E) binds to a modifiedA ?rstdesirable criterion is that the compound is relatively physiologically inert, but for itsligand binding domain with reasonable af?nity for the desired application.activating capability with the modi?ed protein complexes. The less the ligand binds tonative macrolide binding proteins, and the lower the proportion of total ligand which bindsto such proteins, the better the response will normally be. Particularly, the ligand shouldnot have a strong biological effect on native proteins.Preferred ligands include modi?ed forms of cyclosporin A, FK506, FK520, orrapamycin.Illustrative of this situation, one can modify the groups at position 9 or 10 ofFK506 or FK520 (see Van Duyne et al (1991) Science 252, 839), so as to increase theirsteric requirement, by replacing the hydroxyl with a group having greater stericrequirements, or by modifying the carbonyl at position 10, replacing the carbonyl with agroup having greater steric requirements or functionalizing the carbonyl, e. g. forming anN-substituted Schiffs base or imine, to enhance the bulk at that position. Variousfunctionalities which can be conveniently introduced at those sites are alkyl groups to form?101520253035TWO 98/08956CA 02263951 1999-02-22PCT/US97I15153- 16 _ethers, acylamido groups, N-alkylated amines, where a 2-hydroxyethylimine can also forma 1,3-oxazoline, or the like. Generally, the substituents will be from about 1 to 6, usually 1to 4, and more usually 1 to 3 carbon atoms,‘ with from 1 to 3, usually 1 to 2 heteroatoms,which will usually be oxygen, sulfur, nitrogen, or the like. By using different derivativesof the basic structure, one can create different ligands with different conformationalrequirements for binding. By mutagenizing FK506 ligand binding domains, such as fromFKBPI2, one can have create a library of potential binding domains which will havedifferent af?nities for these modi?ed forms of FK506 or FK520.For instances, Substituents at C9 and C10 of FK506, which can be and have beenaccessed by synthesis, clash with a distinct set of FKBPl2 sidechain residues. Thus, oneclass of mutant receptors for such ligands should contain distinct modi?cations, onecreating a compensatory hole for the C10 substituent and one for the C9 substituent. Asdescribed in U.S. Patent Application Serial No. 08/388,653 by Crabtree et al., carbon 10was selectively modi?ed to have either an N-acetyl or N-formyl group projecting from thecarbon (vs. a hydroxyl group in FK506). The binding properties of these derivativesclearly reveal that these C10 bumps effectively abrogate binding to the native FKBPIZ.U.S. Patent Application Serial No. 08/388,653 by Crabtree et al. depicts schemes for thesynthesis of FK506-type moieties containing additional C9 bumps.This invention thus encompasses use of a class of FK-506-type compoundscomprising an FK-506-type moiety which contains, at one or both of C9 and C10, afunctional group comprising -OR, -R, —(CO)OR, -NH(CO)H or -NH(CO)R, where R issubstituted or unsubstituted, alkyl or arylalkyl which may be straightchain, branched orcyclic, including substituted or unsubstituted peroxides, and carbonates. “FK506-typemoieties” include FK506, FK520 and synthetic or naturally occurring variants. analogsand derivatives thereof (including rapamycin) which retain at least the (substituted orunsubstituted) C2 through C15 portion of the ring structure of FK—506 and are capable ofbinding with a natural or modi?ed FKBP, preferably with a Kd value below about l0'°M.Another preferred modi?ed ligand includes FK506 molecules having anelectrophilic addition “bump” at the C9 position of FK506, generating 9—S-methoxy-FK506 that does not bind endogenous FKBP, but does bind to FKBP12F36V.To accomodate a substituent at positions 9 or 10 of FK506 or FK520, one canmodify FKBP12’s Phe36 to Ala and/or Asp37 to Gly or Ala. In particular, mutantFKBPl2 moieties which contain Val, Ala, Gly, Met or other small amino acids in place ofone or more of Tyr26, Phe36, Asp37, Tyr82 and Phe99 are of particular interest asreceptor domains for F K506-type and FK-520-type ligands containing modi?cations at C9and/or C10.?101520253035TWO 98/08956CA 02263951 1999-02-22PCT/U S97/ 15153_ 17 -Site-directed mutagenesis may be conducted using the megaprimer mutagenesisprotocol (see e.g., Sakar and Sommer, BioTechniques 8 4 (1990): 404-407). cDNAsequencing is performed with the Sequenase kit. Expression of mutant FKBPl2s may becarried out in the plasmid pHN 1" in the E. coli strain XA90 since many F KBPI2 mutantshave been expressed in this system efficiently. Mutant proteins may be convenientlypurified by fractionation over DE52 anion exchange resin followed by size exclusion onSepharose as ‘described elsewhere. See e.g. Aldape et al, J Biol Chem 267 23 (1992):16029-32 and Park et al, J Biol Chem 267 5 (1992): 3316-3324. Binding constants may bereadily determined by one of two methods. If the mutant FKBPS maintain sufficientrotamase activity, the standard rotamase assay may be utilized. See e.g., Galat et al,Biochemistry 31 (1992): 2427-2434. Otherwise, the mutant F KBPl2s may be subjected toa binding assay using LH20 resin and radiolabeled T2—dihydroFK506 and T2-dihyroCsAthat we have used previously with F KBPS and cyclophilins. Bierer et al, Proc. Natl. Acad.Sci. U.S.A. 87 4 (1993): 555-69.The invention further provides modified cyclosporinA that cannot bind to itscellular receptor cyclophilin (CypA). As described in the Examples, this rationallymodified cyclosporin A is called alpha-cyclopentyl, sarcosinel 1-CsA (CpSarl 1-CsA). Inaddition, the inventors designed and synthesized a cellular receptor cyclophilin (Cyp) withcompensatory mutations in its cyclosporin A binding pocket that can form tight complexeswith CpSarl1-CsA. The rationally designed CpSar1 1-CsA and its genetically engineeredCyp receptor provide a method to inhibit calcineurin conditionally and tissue specificallythrough selective expression of this modi?ed cyclophilin receptor.In another embodiment, modi?ed CsA derivatives for use in the subject inventionare CsA analogs in which (a) NMeVal1l is replaced with NMePhe (which may besubstituted or unsubstituted) or NMeThr (which may be unsubstituted or substituted onthe threonine betahydroxyl group) or (b) the pro-S methyl group of NMeValll is replacedwith a bulky group of at least 2 carbon atoms, preferably three or more, which may bestraight, branched and/or contain a cyclic moiety, and may be alkyl (ethyl, or preferablypropyl, butyl, including t-butyl, and so forth), aryl, or arylalkyl. These compounds includethose CsA analogs which contain NMeLeu, NMeIle, NMePhe or speci?cally the unnaturalNMe[betaMePhe], in place of MeValll.where R represents a functional group as discussed above.The “(b)” CSA compounds are of formula 2A two step strategy may be used to prepare the modified [MeVal' ']CsA derivativesstarting from CsA. In the ?rst step the residue MeValll is removed from the macrocycle.In the second step a selected amino acid is introduced at the (fonner) MeValll site andthe linear peptide is cyclized. The synthesis of this compound is further described, e.g., inU.S. Applications Serial No. 08/388,653. Mutant cyclophilins that bind such CSA variants?101520253035‘W0 98/08956CA 02263951 1999-02-22PCT/U S97/ 15153- 13 -by accomodating the extra bulk on the ligand can be prepared and identi?ed, e..g., throughthe structure-based site-directed and random mutagenesis/screening protocols, e.g., asdescribed in the FK1012 studies.Similar considerations apply to the generation of mutant FRAP-derived domainswhich bind preferentially to rapamycin analogs (rapalogs) containing modi?cations (i.e.,are 'bumped') relative to rapamycin in the FRAP-binding effector domain. For example,one may obtain preferential binding using rapalogs bearing substituents other than -OMeat the C7 position with FRBS based on the human FRAP FRB peptide sequence butbearing amino acid substitutions for one of more of the residues Tyr2038, Phe2039,Thr2098, Gln2099, Trp2101 and Asp2lO2. Exemplary mutations include Y2038H,Y2038L, Y2038V, Y2038A, F2039H, F2039L, F2039A, F2039V, D2lO2A, T2098A,T2098N, and T2098S. Rapalogs bearing substituents other than -OH at C28 and/orsubstituents other than =0 at C30 may be used to obtain preferential binding to FRAPproteins bearing an amino acid substitution for Glu2032. Exemplary mutations includeE2032A and E20328. Proteins comprising an FRB containing one or more amino acidreplacements at the foregoing positions, libraries of proteins or peptides randomized atthose positions (i.e., containing various substituted amino acids at those residues), librariesrandomizing the entire protein domain, or combinations of these sets of mutants are madeusing the procedures described above to identify mutant FRAPS that bind preferentially tobumped rapalogs.Further guidance for identifying compensatory mutations to macrolide-bindingdomains are provided below:Selection of Compensatory Mutations in FKBP1 2 for Bump-FK506s Using the Yeast Two-Hybrid SystemOne approach to obtaining variants of receptor proteins or domains, including ofFKBPIZ, is the powerful yeast "two-hybrid" or "interaction trap" system. The two-hybridsystem has been used to detect proteins that interact with each other. A "bait" fusionprotein consisting of a target protein fused to a transcriptional activation domain is co-expressed with a CDNA library of potential "hooks" fused to a DNA-binding domain. Aprotein-protein (bait-hook) interaction is detected by the appearance of a reporter geneproduct whose synthesis requires the joining of the DNA-binding and activation domains.The yeast two-hybrid system mentioned here was originally developed by Elledge and co-workers. Durfee et al, Genes & Development 7 4 (1993): 555-69 and Harper et al, Cell 754 (1993): 805-816.?101520253035'WO 98/08956CA 02263951 1999-02-22PCT/US97/15153_ 19 _Since the two-hybrid system per se cannot provide insights into receptor—ligandinteractions involving small molecule, organic ligands, we have developed a new,FK1012-inducible transcriptional activation system (discussed below). Using that systemone may extend the two hybrid system so that small molecules (e.g., FK506s or FKlOl2sor FK506-type molecules of this invention) can be investigated. One ?rst generates aCDNA library of mutant FKBPS (the hooks) with mutations that are regionally localized tosites that surround C9 and C10 of FK506. For the bait, two different strategies may bepursued. The ?rst uses the ability of FK506 to bind to FKBPI2 and create a compositesurface that binds to calcineurin. The sequence-speci?c transcriptional activator is thuscomprised of: DNA-binding domain—mutant F KBPl2---bump-FK506---calcineurin A-activation domain (where --- refers to a noncovalent binding interaction). The secondstrategy uses the ability of F K1012s to bind two FKBPS simultaneously. A HED versionof an FKlO12 may be used to screen for the following ensemble: DNA-binding domain-mutant FKBP12---bump-FK506—normal FKSO6---wildtype FKBPl2—activation domain.1. Calcineurin-Gal4 activation domain fusion as a bait: A derivative of pSE1l07 thatcontains the Gal4 activation domain and calcineurin A subunit fusion construct has beenconstructed. Its ability to act as a bait in the proposed manner has been verified by studiesusing the two-hybrid system to map out calcineurin's FKBP-FK506 binding site.2. hFKBPl2-Gal4 activation domain fusion as a bait: hFKBPl2 CDNA may be excisedas an EcoRl-Hindlll fragment that covers the entire open reading frame, blunt-ended andligated to the blunt-ended Xho I site of pSEl 107 to generate the full-length hFKBP-Gal4activation domain protein fusion.3. Mutant hFKBPl2 CDNA libraries hFKBPl2 may be digested with EcoRI and Hindlll,blunted and cloned into pASl (Durfee et al, supra) that has been cut with Ncol andblunted. This plasmid is further digested with Ndel to eliminate the Ndel fragmentbetween the Ndel site in the polylinker sequence of pAS1 and the 5’ end of hFKBPl2 andThis generated the hFKBPl2-Gal4 DNA binding domain protein fusion.hFKBP was reampli?ed. Mutant hFKBPl2 CDNA fragments were then prepared using thereligated.primers listed below that contain randomized mutant sequences of hFKBP at de?nedpositions by the polymerase chain reaction, and were inserted into the Gal4 DNA bindingdomain-hFKBP(NdeI/BamHI) construct.?1015202530A WO 98/08956CA 02263951 1999-02-22PCT/US97l 15153- 20 _4. Yeast strain S. cerevisiae Y153 carries two selectable marker genes (his3/ -galctosidase) that are integrated into the genome and are driven by Gal4 promoters.(Durfee, supra.)Using Calcineurin—Gal4 Activation Domain as BaitThe FKBP12-FK506 complex binds with high af?nity to calcineurin, a type 2Bprotein phosphatase.Since we use C9- or C10-bumped ligands to serve as a bridge in thetwo-hybrid system, only those FKBPS from the CDNA library that contain a compensatorymutation generate a transcriptional activator. For convenience, one may prepare at leastthree distinct libraries (using primers 11207-11209, Primer Table) that will each contain8,000 mutant FKBP12s. Randomized sites were chosen by inspecting the FKBPl2-FK506structure, which suggested clusters of residues whose mutation might allow binding of theoffending C9 or C10 substituents on bumped FK506s. The libraries are then individuallyscreened using both C9- and C10-bumped FK506s. The interaction between a bumped-FK506 and a compensatory hFKBP12 mutant can be detected by the ability of host yeastto grow on his drop-out medium and by the expression of -galactosidase gene. Since thisselection is dependent on the presence of the bumped-FKSO6, false positives can beeliminated by substractive screening with replica plates that are supplemented with orwithout the bumped-FK506 ligands.Using hFKBP12-Gal4 Activation Domain as BaitUsing the calcineurin A-Gal4 activation domain to screen hFKBPl2 mutant cDNAlibraries is a simple way to identify compensatory mutations on FKBP12. However,mutations that allow bumped-FK506s to bind hFKBP12 may disrupt the interactionbetween the mutant FKBPl2---bumped-FK506 complex and calcineurin. If the initialscreening with calcineurin as a bait fails, the wildtype hFKBPl2—Gal4 activation domainwill instead be used. An FK1012 HED reagent consisting of: native-FK506—bumped-FK506 (Figure 16) may be synthesized and used as a book. The FKSO6 moiety of theFK1012 can bind the FKBPI2-Gal4 activation domain.bumped-FK506 moiety of the FK1012 and a compensatory mutant of FKBP12 will allowAn interaction between thehost yeast to grow on his drop-out medium and to express ~ga1actosidase. In this way,the selection is based solely on the ability of hFKBP12 mutant to interact with thebumped-FK506. The same substractive screening strategy can be used to eliminate falsepositives.?101520253035TWO 98108956CA 02263951 1999-02-22PCT/US97/ 15153_ 21 _In addition to the in vitro binding assays discussed earlier, an in vivo assay may beused to determine the binding af?nity of the bumped-FK506s to the compensatoryhFKBPl2 mutants. In the yeast two-hybrid system, -gal activity is determined by thedegree of interaction between the “bait” and the “prey”. Thus, the af?nity between thebumped-FK506 and the compensatory FKBP12 mutants can be estimated by thecorresponding -galactosidase activities produced by host yeasts at different HED (native-FK506—bumped—FK506) concentrations.Using the same strategy, additional randomized mutant FKBP12 cDNA librariesmay be created in other bump-contact residues with low—af?nity compensatory FKBP12mutants as templates and may be screened similarly.Phage Display Screeningfor High-A?inity Compensatory F KBP MutationsSome high-af?nity hFKBPl2 mutants for bump-FK506 may contain severalcombined point mutations at discrete regions of the protein. The size of the library thatcontains appropriate combined mutations can be too large for the yeast two-hybridsystem’s capacity (e.g., >108 mutations). The use of bacteriophage as a vehicle forexposing whole functional proteins should greatly enhance the capability for screening alarge numbers of mutations. See e.g. Bass et al, Proteins: Structure, Function & Genetics8 4 (1990): 309-14; McCafferty et al, Nature 348 6301 (1990): 552-4; and Hoogenboom,Nucl Acids Res 19 15 (1991): 4133-7. If the desired high-af?nity compensatory mutants isnot be identi?ed with the yeast two-hybrid system, a large number of combined mutationscan be created on hFKBPl2 with a phage vector as a carrier. The mutant hFKBPl2 fusionphages can be screened with bumped-FK506—Sepharose as an af?nity matrix, which canbe synthesized in analogy to our original FK506-based af?nity matrices. Fretz et al, J AmChem Soc 113 4 (1991): 1409-1411. Repeated rounds of binding and phage ampli?cationshould lead to the identi?cation of high-af?nity compensatory mutants.Illustrative publications providing additional information concerning synthetictechniques and modi?cations relevant to FK506 and related compounds include: GB 2 244991 A; EP 0 455 427 Al; WO 91/17754; EP 0 465 426 A1, US 5,023,263, W0 92/00278,and PCT/US93/01617.IV. Nucleic Acids Encoding Modi?ed Macrolide-binding proteinsThe invention provides nucleic acids encoding the modi?ed macrolide-bindingproteins. In general, nucleic acids encoding wild—type forms of the receptors can beobtained according to methods known in the art. For example, a nucleic acid encoding a?1015202530355 WO 98/08956CA 02263951 1999-02-22PCT/US97/15153- 22 _receptor can be obtained, e.g, by reverse transcription polymerase chain reaction (RT-PCR) ampli?cation of RNA or PCR ampli?cation of DNA using primers hybridizing tothe ends of the nucleic acid desired to be ampli?ed according to methods well known inthe art. The nucleotide sequence of the nucleic acids encoding receptors can be found inthe litterature or in GenBank, which is publicly accessible on the internet. The templateRNA for use in the RT-PCR can be obtained from any cell expressing the transcriptionfactor or DNA binding domain or ligand binding domain. Template DNA can be obtainedfrom any cell, even cells which do not express the desired factor. However, when usingDNA as a template, it is preferable to avoid including introns in the construct.The DNA can be ampli?ed from template RNA or DNA from any speciesincluding vertebrates, such as mammals. For gene therapy, the receptor is preferablyisolated from a species corresponding to the species of the recipient of the receptor. Forexample, for gene therapy in humans, the receptor is preferably of human origin. RNAand DNA can be extracted from cells according to methods known in the art.Further manipulation of the wild-type sequence, e.g., to produce the compensatorymutants, can be carried out by standard molecular biology techniques.In a preferred embodiment, a DNA encoding the modi?ed target protein isoperably linked to a promoter or regulatory element having the desired tissue speci?city.Various tissue speci?c promoters and regulatory elements are known in the art and theirnucleic acid sequences are publicly available in GenBank, freely accessible on the intemet.Examples of tissue-speci?c promoters which can be used include the albumin promoter(liver-speci?c; Pinkert et al. (1987) Genes Dev. 1:268-277), lymphoid-speci?c promoters(Calame and Eaton (1988) Adv. Immunol. 431235-275), in particular promoters of T cellreceptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins(Banerji et al. (1983) Cell 332729-740; Queen and Baltimore (1983) Cell 33:741-748),neuron-speci?c promoters (e.g., the neuro?lament promoter; Byrne and Ruddle (1989)Proc. Natl. Acad. Sci. U.S.A. 86:5473-5477), pancreas-speci?c promoters (Edlund et al.(1985) Science 230:912—916), and mammary gland-speci?c promoters (e.g., milk whey<=6> 4,873,316 and European Application Publication No.264,166). Developmentally-regulated promoters are also encompassed, for example themurine box promoters Kessel and Gruss (1990) Science 249:374-379) and the alpha-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546). Particularlypromoter; U.S. Pat. No.preferred promoters include T cell speci?c promoters, such as promoters of T cell receptorgenes, CD4 promoter (GenBank Accession No. U01066), and MHC class II promoters(e.g., GenBank Accession No. M81180).?101520253035‘W0 98/08956CA 02263951 1999-02-22PCT/U S97/ 15153- 23 _Other regulatory elements of interest for practicing the invention include induciblepromoters, which can also be tissue specific. For example, certain regulatory elements areresponsive to hormones, such as steroid hormones (e.g., glucocorticoid hormone, MMTVpromoter), metal ions (e.g., metallothionein promoter), phorbol esters (TRE elements), orcalcium ionophores. Yet other inducible promoters include the growth hormone promoter;promoters which would be inducible by the helper virus such as adenovirus early genepromoter inducible by adenovirus EIA protein, or the adenovirus major late promoter;herpesvirus promoter inducible by herpesvirus proteins such as VP16 or ICP4; promotersinducible by a vaccinia or pox virus RNA polymerases; or bacteriophage promoters suchas T7, T3 and SP6, which are inducible by T7, T3, or SP6 RNA polymeras, respectively.Other systems permitting an inducible expression of the target protein includetetracyclin-responsive promoters include. Tight control of gene expression in eucaryoticcells has been achieved by use of tetracycline-responsive promoters. Such systems includethe “off-switch” systems, in which the presence of tetracyclin inhibits expression. or the“reversible” Tet system, in which a mutant of the E. coli TetR is used, such that thepresence of tetracyclin induces expression. These systems are disclosed, e.g., in Gossenand Bujard (Proc. Natl. Acad. Sci. U.S.A. (1992) 89:5547) and in U.S. Patents 5,464,758;5,650,298; and 5,589,362 by Bujard et al. Accordingly, a gene encoding a target proteinof the invention can be operably linked to an element responsive to the tetracyclin receptoror mutant form thereof, such that expression of a target gene of the invention is eitherinduced or repressed in the presence of tetracyclin, depending on the system used.In other embodiments, constitutive promoters may be desirable. There are manystrong constitutive promoters that will be suitable for use in the invention, including theadenovirus major later promoter, the cytomegalovirus immediate early promoter, the betaactin promoter, or the beta globin promoter. Many others are known in the art.For expression of a modified target protein in a cell, a nucleic acid encoding themodified target protein which is operably linked to a promoter is preferably inserted into avector or plasmid, generally referred to herein as “construct”. The constructs can beprepared in conventional ways, where the genes and regulatory regions may be isolated, asappropriate, ligated, cloned in an appropriate cloning host, analyzed by restriction orsequencing, or other convenient means. Particularly, using PCR, individual fragmentsincluding all or portions of a functional unit may be isolated, where one or more mutationsmay be introduced using "primer repair", ligation, in vitro mutagensis, etc. as appropriate.The construct(s) once completed and demonstrated to have the appropriate sequences maythen be introduced into the host cell by any convenient means. The constructs may beintegrated and packaged into non-replicating, defective viral genomes like Adenovirus,Adeno-associated virus (AAV), or Herpes simplex virus (HSV) or others, including?101520V W0 98/08956CA 02263951 1999-02-22PCT/US97/15153_ 24 -retroviral vectors, for infection or transduction into cells. The constructs may include viralsequences for transfection, if desired. Alternatively, the construct may be introduced byfusion, electroporation, biolistics, transfection, lipofection, or the like. The host cells willusually be grown and expanded in culture before introduction of the construct(s), followedby the appropriate treatment for introduction of the construct(s) and integration of theconstruct(s). The cells will then be expanded and screened by virtue of a marker present inthe construct. Various markers which may be used successfully include hprt, neomycinresistance, thymidine kinase, hygromycin resistance, etc.In some instances, one may have a target site for homologous recombination,where it is desired that a an expression construct for the modi?ed target protein beintegrated at a particular locus. For example, it can knock-out an endogenous gene for thetarget protein and replace it (at the same locus or elswhere) with the gene encoded for bythe construct using materials and methods as are known in the art for homologousrecombination. Alternatively, instead of providing a gene encoding a modified targetprotein, one may modify the endogenous gene encoding the wild-type target protein by,e.g., homologous recombination, such that it encodes the modi?ed form of the protein.See, for example, Thomas and Capecchi, Cell (1987) 51, 503-512; Mansour, et al., Nature(1988) 336, 348-352; and Joyner, et al., Nature (1989) 338, 153-156.Vectors containing useful elements such as bacterial or yeast origins of replication,selectable and/or ampli?able markers, promoter/enhancer elements for expression inprocaryotes or eucaryotes, etc. which may be used to prepare stocks of construct DNASand for carrying out transfections are well known in the art, and many are commerciallyavailable.?1015202530359 WO 98/08956CA 02263951 1999-02-22PCTlUS97l15l53_ 25 -The expression constructs of the present invention may be provided in anybiologically effective carrier, e.g. any formulation or composition capable of effectivelytransfecting cells ex vivo or in vivo with the expression construct. Efficient DNA transfermethods have been developed for hematopoietic cells (see, for example, Keating et al.(1990) Exp Hematol 18299-102; and Dick et al. (1986) Trends Genet 2:165; and U.S.patents 5,654,185, 5,498,537 and 5,399,346). Approaches include insertion of the subjectgene in viral vectors including recombinant retroviruses, adenovirus, adeno-associatedvirus, and herpes simplex virus-1, or eukaryotic plasmids. Viral vectors can be used totransfect cells directly; plasmid DNA can be delivered with the help of, for example,cationic liposomes (lipofectin) or derivatized (e.g. antibody conjugated), polylysineconjugates, gramacidin S, arti?cial viral envelopes or other such intracellular carriers, aswell as direct injection of the gene construct or CaPO4 precipitation carried out. It will beappreciated that because transduction of appropriate target cells represents the critical firststep in gene therapy, choice of the particular gene delivery system will depend on suchfactors as the phenotype, e.g., the degree of commitment the stem cell has undergone, ifany. Another factor in the selection of the appropriate transfection formulation is theconsideration raised by ex vivo transfection versus in vivo transfection, with the latterrequiring consideration of the route of administration, e.g. locally or systemically.A preferred approach for both ex vivo or in vivo introduction of the subject targetprotein gene construct into a cell is by use of a viral vector containing the target proteingene. Infection of cells with a viral vector has the advantage that a large proportion of thetargeted cells can receive the nucleic acid. Additionally, molecules encoded within theviral vector, e.g., by a cDNA contained in the viral vector, are expressed ef?ciently in cellswhich have taken up viral vector nucleic acid.Retrovirus vectors are generally understood to be one of the recombinant genedelivery system of choice for the transfer of exogenous genes into stem cells, particularlyinto humans cells. (see e.g., Hawley R. G., et al (1994) Gene Therapy 1: 136-38)). Thesevectors provide efficient delivery of genes into cells, and the transferred nucleic acids arestably integrated into the chromosomal DNA of the host. A major prerequisite for the useof retroviruses is to ensure the safety of their use, particularly with regard to the possibilityof the spread of wild-type virus in the cell population. The development of specialized celllines (termed "packaging cells") which produce only replication-defective retroviruses hasincreased the utility of retroviruses as a gene delivery system, and defective retrovirusesare well characterized for use in gene transfer for gene therapy purposes (for a review, seeMiller, A.D. (1990) Blood 76:27]). Thus, recombinant retrovirus can be constructed inwhich part of the retroviral coding sequence (gag, pol, env) has been replaced by the target?101520253035TWO 98/08956CA 02263951 1999-02-22PCT/US97/ 15153- 26 _protein gene, rendering the retrovirus replication defective. The replication defectiveretrovirus is then packaged into virions which can be used to infect a target cell throughthe use of a helper virus by standard techniques. Protocols for producing recombinantretroviruses and for infecting cells ex vivo or in vivo with such viruses can be found inAusubel et al., supra, Sections 9.10-9.14 and other standard laboratory manuals.Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are well knownto those skilled in the art. Examples of suitable packaging virus lines for preparing bothecotropic and amphotropic retroviral systems include YCrip, YCre, Y2 and YAm.Retroviruses have been used to introduce a variety of genes into many differentcell types, including embryonic stem cells, bone marrow cells, lymphocytes, hepatocytes,and neuronal cells by both ex vivo and in vivo protocols (see for example Eglitis, et al.(1985) Science 230:l395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:30l4-3018; Armentanoet al. (1990) Proc. Natl. Acad. Sci. USA 8716141-6145; Huber et al. (1991) Proc. Natl.Acad. Sci. USA 8818039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 8818377-8381; Chowdhury et al. (1991) Science 25421802-1805; van Beusechem et al. ( 1992) Proc.Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647;Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:l0892-10895; I-lwu et al. (1993) J.Immunol. 15014104-4115; U.S. Patent No. 4,868,116; U.S. Patent No. 4,980,286; PCTApplication WO 89/07136; PCT Application WO 89/02468; PCT Application WO89/05345; and PCT Application WO 92/07573).Exemplary retroviral vectors have been described that yield a high titre viruscapable of efficiently transducing and expressing genes in undifferentiated embryonic andhematopoietic cells (Hawley et al (1994) Gene Therapy 1: 136-38). These vectors containa selectable marker (neo, hph or pac) under the transcriptional control of an internalmurine pgk promoter and unique restriction sites for insertion of genes downstream of avariant LTR from the retroviral mutant PCMV (PCC4 embryonal carcinoma cell-passagedmyeloproliferative sarcoma virus). A variant of the above-described retroviral vectors, theMurine Stem Cell Virus (MSCV), is illustrated in the examples set out below.In an exemplary embodiment, the target protein gene is inserted in to theMSCVneo vector (Hawley et al. supra) under the control of the viral LTR promoter andalso carrying the neomycin phosphotransferase gene as a selectable marker to conferresistance to G418. Helper-free MSCVneo-target protein virus producing packaging cells(Markowitz et al. (1988) J Virol 6221120-1124) can be made by infection of tunicamycin-treated cells with supernatant from transient transfectants according to the methods of?101520253035' WO 98/08956CA 02263951 1999-02-22PCTIUS97/15153_ 27 -Hawley et al. (1991) Leukemia Res 15:659-673. The cells are maintained in, e.g.,Dulbecco's modi?ed Eagle medium (DMEM) supplemented with G418.MSCVneo-target protein viral stocks can be produced by pooling populations ofHelper—freepackaging cells with high titre (e.g., >106 CFU/ml). The retroviral infection may beperformed by either including into the culture medium, supernatants (e.g., 5 to 20%vol/vol) produced by the pooled retroviral packaging cell lines, or by culturing the stemcells directly over the infected retroviral packaging lines themselves, or by both. See, forexample, U.S. Patents 5,399,493 and 5,399,346 and PCT publication WO 93/07281.Returning to the general discussion of retroviral Vectors, it is noted that the artdemonstrates that it is possible to limit the infective spectrum of retroviruses, andconsequently of retroviral-based vectors, by modifying the viral packaging proteins on thesurface of the viral particle (see, for example PCT publications W093/25234,W094/06920, and W094/l 1524).infection spectrum of retroviral vectors include: coupling antibodies speci?c for stem cellsurface antigens to the viral env protein (Roux et al. (1989) PNAS 86:9079-9083; Julan etal. (1992) J. Gen Virol 73:325l-3255; and Goud et al. (1983) Virology 1631251-254); orcoupling cell surface ligands to the viral env proteins (Neda et al. ( 1991) J Biol Chem266:l4l43-14146). Coupling can be in the form of the chemical cross-linking with aprotein or other variety (e.g. lactose to convert the env protein to an asialoglycoprotein), asFor instance, strategies for the modification of thewell as by generating fusion proteins (e.g. single-chain antibody/env fusion proteins). Thistechnique, while useful to limit or otherwise direct the infection to certain tissue types, andcan also be used to convert an ecotropic vector in to an amphotropic vector.To further illustrate, the target protein gene construct can be generated using aretroviral vector which further provides a fusion protein including the viral envelopeprotein and the vesicular stomatitis virus (VSV—G) glycoprotein (Burns et al. (1993) Proc.Natl. Acad. Sci. USA 9028033-37; PCT Patent Application WO 92/14829; and WO96/09400). Unlike typical amphotropic env proteins, the VSV-G protein is thought tomediate viral infection by fusing with a phospholipid component of cell membranes ratherthan by recognition of a cell surface protein. Since infection is not dependent on a specificreceptor, VSV-G pseudotyped vectors have a broad host range. CD34+/Thy-1+ mobilizedperipheral blood cells have previously been demonstrated to be transduced with highefficiency by a VSV-G pseudotyped retroviral vector (see Kerr et al. PCT publication WO96/09400). Genetic modification of the stem cells with a target protein gene construct canbe accomplished at any point during their maintenance by transduction with VSV-Gpseudotyped virion containing the expression construct.?101520253035' W0 98/08956CA 02263951 1999-02-22PCT/US97/15153_ 28 ..Moreover, use of retroviral gene delivery can be further enhanced by the use oftissue- or cell-speci?c transcriptional regulatory sequences which control expression of therecombinant target protein gene.Another viral gene delivery system useful in the present invention utilizesadenovirus-derived vectors. It has been reported, for example, that adenoviral vectors canbe used to tranduce human CD34+ hematopoietic cells with high efficiencies. See, forexample, Watanabe et al. (1996) Blood 87 5032; and Blood Weekly February 10, 1997.The genome of an adenovirus can be manipulated such that it encodes the modified targetprotein, but is inactivate in terms of its ability to replicate in a normal lytic viral life cycle(see, for example, Berkner et al. (1988) Bz'oTechniques 6:616; Rosenfeld et al. (1991)Science 2522431-434; and Rosenfeld et al. (1992) Cell 68:143-155). Suitable adenoviralvectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus(e.g.. Ad2, Ad3, Ad7 etc.) are well known to those skilled in the art. Recombinantadenoviruses are relatively stable and amenable to puri?cation and concentration. and asabove, can be modified so as to affect the spectrum of infectivity with respect to stem cellpopulations.Additionally, introduced adenoviral DNA (and foreign DNA contained therein) isnot integrated into the genome of a host cell but remains episomal, thereby avoidingpotential problems that can occur as a result of insertional mutagenesis in situations whereintroduced DNA becomes integrated into the host genome (e.g., retroviral DNA).Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmandand Graham (1986) J. Virol. 572267). Most replication—defective adenoviral vectorscurrently in use and therefore favored by the present invention are deleted for all or partsof the viral El and E3 genes but retain as much as 80% of the adenoviral genetic material(see, e.g., Jones et al. (1979) Cell l6:683; Berkner et al., supra; and Graham et al. inMethods in Molecular Biology, E.J. Murray, Ed. (Humane, Clifton, NJ, 1991) vol. 7. pp.109-127). Expression of the inserted target protein gene can be under control of, forexample, the EIA promoter, the major late promoter (MLP) and associated leadersequences, the E3 promoter, or exogenously added promoter sequences.Yet another viral vector system useful for delivery of the subject target proteingenes is the adeno-associated virus (AAV). Adeno-associated viral vectors have beenshown to be effective at transducing other genes into pluripotent hematopoietic stem cellsin vitro (see PCT Application WO 96/08560). Adeno-associated virus is a naturallyoccurring defective virus that requires another virus, such as an adenovirus or a herpesvirus, as a helper virus for efficient replication and a productive life cycle. (For a review?101520253035' WO 98/08956CA 02263951 1999-02-22PCT/U S97/ 15153- 39 _see Muzyczka et al. Curr. Topics in Micro and lmmunol. (1992) 158297-129). It is alsoone of the few viruses that may integrate its DNA into non—dividing cells, and exhibits ahigh frequency of stable integration (see for example Flotte et al. (1992) Am. J. Respir.Cell. Mol. Biol. 7:349-356; Samulski et al. (1989) J. Virol. 63:3822-3828; andMcLaughlin et al. (1989) J. Virol. 6221963-1973). Vectors containing as little as 300 basepairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited toabout 4.5 kb. An AAV vector such as that described in Tratschin et al. (1985) Mol. Cell.Biol. 5:3251-3260 can be used to a recombinant target protein gene into stem cells. Avariety of nucleic acids have been introduced into different cell types using AAV vectors(see for example Hermonat et al. (1984) Proc.. Natl. Acad. Sci. USA 81:6466-6470;Tratschin et al. (1985) Mol. Cell. Biol. 4:2072-2081, Wondisford et al. (1988) Mol.Endocrinol. 2:32-39, Tratschin et al. (1984) J Viral. 512611-619; and Flotte et al. (1993)J. Biol. Chem. 26813781-3790).In addition to viral transfer methods, such as those illustrated above, non-viralmethods can also be employed to cause expression of a heterologous target protein gene intransfected stem cells. Most nonviral methods of gene transfer rely on normal mechanismsused by mammalian cells for the uptake and intracellular transport of macromolecules. Inpreferred embodiments, non-viral gene delivery systems of the present invention rely onendocytic pathways for the uptake of the target protein gene construct by the targeted cell.Exemplary gene delivery systems of this type include liposomal derived systems,poly-lysine conjugates, and arti?cial viral envelopes.In a representative embodiment, an expression construct including a target proteingene can be entrapped in liposomes bearing positive charges on their surface (e.g.,lipofectins) and (optionally) which are tagged with antibodies against cell surface antigensof the targeted cell population (Mizuno et al. (1992) No Shinkei Geka 202547-551; PCTpublication W091/06309; Japanese patent application 1047381; and European patentpublication EP—A43075).In yet another illustrative embodiment, the gene delivery system comprises anantibody or cell surface ligand which is cross_linked with a gene binding agent Such aspolylysine (see, for example, PCT publications W093/04701, W092/22635, W092/20316,WO92/ 19749, and W092/06180). It will also be appreciated that effective delivery of thesubject nucleic acid constructs via receptor-mediated endocytosis can be improved usingagents which enhance escape of the gene from the endosomal structures. For instance,whole adenovirus or fusogenic peptides of the in?uenza HA gene product can be used aspart of the delivery system to induce efficient disruption of DNA—containing endosomes?1015202530355W0 98/08956CA 02263951 1999-02-22PCT/US97/15153_ 30 _(Mulligan et al. (1993) Science 260-926; Wagner et al. (1992) PNAS 8927934; andChristiano et al. (1993) PNAS 90:2122).For example, the target protein gene construct can be used to transfecthematopoietic stem cells using a soluble polynucleotide carrier comprising a ligand to astem cell receptor (e.g., steel factor) conjugated to a polycation, e.g. polylysine. To furtherillustrate, the gene delivery system can be targeted speci?cally to c-kit-expressing cells,e.g. human hematopoietic progenitor cells. The c-kit protein is a tyrosine kinase receptorfor steel factor and is expressed on pluripotential stem cells capable of reconstituting allhematopoietic lineages. Furthermore, c-kit expression is restricted to stem/progenitorcells, and is not expressed on their committed progeny except for expression in mast cells.In an illustrative embodiment, the expression vector for the target protein gene iscondensed by electrostatic forces with polylysine (PL) which has been covalently linked tostreptavidin and PL which has been covalently linked to adenovirus (in order to achieveendosomal lysis). To the vector-PL conjugate is added a biotinylated steel factor whichbecomes associated with the vector-PL conjugate through the streptavidin-biotininteraction. Using such constructs, hematopoietic stem cells can be targeted fortransfection with the target protein gene construct. See, for example, U.S. Patent5,166,320, and Schwarzenberger et al., Blood (1996) 87(2): 472-78). One advantage tothe PL-vector construct described above is the ability to carry out transient transfection ofstem cell populations, while committed hematopoietic cells will be refractory to thetransfection process because of a lack of c-kit. Another advantage to this approach derivesfrom the fact that DNA uptake relies on highly efficient receptor-mediated endocytosis, aphysiological pathway for macromolecular uptake not associated with cellular toxicity.However, in other embodiments, the carrier is conjugated with a ligand (or other bindingmolecule) speci?c for certain cell lineages, such as T-cells.The subject target protein gene constructs can be efficiently introduced into stemcells by DNA transfection or by virus—mediated transduction as extensively describedabove. In vitro culturing systems known in the art for stem cells provide an accessiblemodel for genetic manipulations. Possible method of transduction include, but are notlimited to, direct co-culture of cells with viral producer cells (see, e.g., Bregni et al. (1992)Blood 80: 1418-22). Alternatively, supematants from virally infected cells can be isolatedand applied to cultures of cells under conditions appropriate for infection of the stem cells.See e.g., Xu et al. (1994) Exp. Hemat. 22: 223-30; and Hughes et al. (1992). J. Clin.Invest. 89:l817. The resulting transduced cells may then be grown under conditionssimilar to those for umnodi?ed stem cells, whereby the modified stem cells may beexpanded and caused to differentiate.?10152025307 WO 98108956CA 02263951 1999-02-22PCT/US97l15153- 31 -The invention also encompasses genetically engineered cells containing and/orexpressing any of the constructs described herein, particularly a Construct encoding areceptor, including prokaryotic and eucaryotic cells and in particular, yeast, worm, insect.mouse or other rodent, and other mammalian cells, including human cells, of various typesand lineages, whether frozen or in active growth, whether in culture or in a wholeorganism containing them. Several examples of such engineered cells are provided in theExamples which follow.At present it is especially preferred that the cells be mammalian cells, particularlyprimate, more particularly human, but can be associated with any animal of interest,particularly domesticated animals, such as equine, bovine, murine, ovine, canine, feline,etc. Among these species, various types of cells can be involved, such as hematopoietic,neural, mesenchymal, cutaneous, mucosal, stromal, muscle, spleen, reticuloendothelial,epithelial, endothelial, hepatic, kidney, gastrointestinal, pulmonary, etc. Of particularinterest are hematopoietic cells, which include any of the nucleated cells which may beinvolved with the lymphoid or myelomonocytic lineages. Of particular interest aremembers of the T- and B-cell lineages, macrophages and monocytes, myoblasts andfibroblasts. Also of particular interest are stem and progenitor cells, such as hematopoieticneural, stromal, muscle, hepatic, pulmonary, gastrointestinal, etc.The cells can be autologous cells, syngeneic cells, allogenic cells and even in somecases, xenogeneic cells. The cells may be modified by changing the majorhistocompatibility complex ("MHC") pro?le, by inactivating bfmicroglobulin to preventthe formation of functional Class I MHC molecules, inactivation of Class II molecules,providing for expression of one or more MHC molecules, enhancing or inactivatingcytotoxic capabilities by enhancing or inhibiting the expression of genes associated withthe cytotoxic activity, or the like.In some instances speci?c clones or oligoclonal cells may be of interest, where thecells have a particular speci?city, such as T cells and B cells having a specific antigenspeci?city or homing target site speci?city.Likewise, this invention encompasses any non-human organism containing suchgenetically engineered cells. To illustrate this aspect of the invention, an example isprovided of a mouse containing engineered cells expressing, in a ligand-dependentmanner, an introduced target gene linked to a nucleotide sequence recognized by atranscriptional activator of the invention.?1015202530TWO 98/08956CA 02263951 1999-02-22PCT/US97/15153- 32 -IV. Sources of CellsThose skilled in the art will appreciate that the subject method can be carried outeither in in vivo or ex vivo (e.g., in cell culture) embodiments. The in viva delivery of ahematopoietic gene construct can be carried out using any of a variety of gene therapytechniques. For ex vivo applications, the stem cell to be genetically modified must first beisolated in cell culture. A variety of protocols for isolating embryonic and/orhematopoietic stem cells are well known in the art. Exemplary stem cell cultures for usein the subject method are described below.A. Isolation of Hematopoietic Stem CellsHematopoietic stem cells (HSCS) can be isolated from a mammalian sourceincluding, but not limited to, bone marrow (both adult and fetal), mobilized peripheralblood (MPB), umbilical cord blood and/or fetal liver.HSCS are obtained from the subject into which the stem cells are to be transplanted after inIn a preferred embodiment, thevitro culturing and transduction of the hematopoietic gene construct.The source of cells for the present invention can be, in addition to humans, non-human mammals. A variety of protocols are known in the art for isolating both embryonicstem cells and hematopoietic stem cells from non-human animals. See. for example, theWheeler U.S. Patent 5,523,226 entitled "Transgenic swine compositions and methods" andthe Emery et al. PCT publication W0 95/ 13363 entitled "Hematopoietic Stem Cells FromSwine Cord Blood And Uses Thereof‘.vertebrates such as rodents, non-human primates, sheep, dog, cow and pigs. The termThe preferred non-human animals include"non-human mammal" refers to all members of the class Mammalia except humans.Where the intended use of the resulting hematopoietic cell is for implantation inhuman patients, the cells derived from transgenic animals can be used as a source for"humanized" hematopoietic cells, e.g., for xenogenic grafting into human subjects. Forexample, as described by the Sachs et al. PCT publication WO 96/06165 entitled"Genetically Engineered Swine Cells", the art provides for implantation of swine donorcells which have been engineered to increase desirable interactions between the donor cellsand molecules and cells of a recipient, e.g., to promote the engraftment or function of thedonor stem cells in the recipient enviromnent. To illustrate, the cells can be engineered toexpress a human adhesion molecule, e.g., an adhesion molecule involved in engraftmentand/or maintenance of hematopoietic cells. Examples of human adhesion moleculesinclude VLA-4, c—l<it, LFA-l, CD11a, Mac-1, CR3, CD1lb, p150, p95, CD11c, CD493,?101520253035‘W0 98/08956CA 02263951 1999-02-22PCT/US97ll5l53- 33 _LPAM-l, CD49d, CD44, CD38, and CD34. The transgenic cells can also be engineered tominimize unwanted interactions between the donor cells and molecules and cells of therecipient which, e.g., promote the rejection of donor graft cells or which inhibit thefunction of the donor graft cells. For example, the donors cells can be derived from atransgenic animal expressing one or more human MHC polypeptides.Bone marrow cells can be obtained from a source of bone marrow, including butnot limited to, ilium (e.g. from the hip bone via the iliac crest), tibia, femora, spine, orother bone cavities. Other sources of stem cells include, but are not limited to, embryonicyolk sac, fetal liver, and fetal spleen.For isolation of bone marrow, an appropriate solution can be used to ?ush thebone, e.g., a salt solution supplemented with fetal calf serum (FCS) or other naturallyoccurring factors, in conjunction with an acceptable buffer at low concentration, generallyfrom about 5-25 mM. Convenient buffers include HEPES, phosphate buffers and lactatebuffers.conventional techniques.Otherwise bone marrow can be aspirated from the bone in accordance withMethods for mobilizing stem cells into the peripheral blood are known in the artand generally involve treatment with chemotherapeutic drugs, cytokines (e.g. GM—CSF, G-CSF or IL3), or combinations thereof. Typically, apheresis for total white cells beginswhen the total white cell count reaches 500-200 cells/1 and the platelet count reaches50,000/l.Various techniques can be employed to separate the cells by initially removinglineage committed cells. Monoclonal antibodies are particularly useful for identifyingTheantibodies can be attached to a solid support to allow for crude separation. The separationmarkers associated with particular cell lineages and/or stages of differentiation.techniques employed should maximize the retention of viability of the fraction to becollected. Various techniques of different efficacy can be employed to obtain "relativelycrude" separations. Such separations are where up to 10%, usually not more than about5%, preferably not more than about 1%, of the total cells present not having the markercan remain with the cell population to be retained. The particular technique employed willdepend upon efficiency of separation, associated cytotoxicity, ease and speed ofperformance, and necessity for sophisticated equipment and/or technical skill.The use of separation techniques include, but are not limited to, those based ondifferences in physical (density gradient centrifugation and counter-?ow centrifugalelutriation), cell surface (lectin and antibody af?nity), and vital staining properties(mitochondria-binding dye rhol23 and DNA-binding dye Hoechst 33342). Procedures for?101520253035' W0 98l08956CA 02263951 1999-02-22PCT/U S97/ 15153_ 34 _separation can include, but are not limited to, magnetic separation, using antibody-coatedmagnetic beads, affinity chromatography, cytotoxic agents joined to a monoclonalantibody or used in conjunction with a monoclonal antibody, including, but not limited to,complement and cytotoxins, and "panning" with antibody attached to a solid matrix, e.g.,plate, elutriation or any other convenient technique. Techniques providing accurateseparation include, but are not limited to, FACS, which can have varying degrees ofsophistication, e.g., a plurality of color channels, low angle and obtuse light scatteringdetecting channels, impedance channels, etc.A large proportion of the differentiated cells can be removed by initially using arelatively crude separation, where major cell population lineages of the hematopoieticsystem, such as lymphocytic and myelomonocytic, are removed, as well as minorpopulations, such as megakaryocytic, mast cells, eosinophils and basophils. Usually, atleast about 70 to 90 percent of the hematopoietic cells will be removed. If desired, a priorseparation can be employed to remove erythrocytes, by employing Ficoll-Hypaqueseparation.The gross separation can be achieved using methods known in the art including,but not limited to, magnetic beads, cytotoxic agents, affinity chromatography or panning.Antibodies which ?nd use include antibodies to lineage specific markers which allow forremoval of most, if not all, mature cells, while being absent on stem cells.Concomitantly or subsequent to a gross separation, which provides for positiveselection, a negative selection can be carried out, where antibodies to lineage-specificmarkers present on dedicated cells are employed. For the most part, these markersinclude, but are not limited to, CD2-, CD3-, CD7-, CD8-, CD10-, CDl4—, CD15-, CD16-,CDl9-, CD20-, CD33- and glycophorin A; preferably including, but not limited to, at leastCD2-, CD14—, CD15-, CD16-, CDl9- and glycophorin A; and normally including at leastCD14- and CD15-. As used herein, Lin refers to a cell population lacking at least onelineage-speci?c marker. The hematopoietic cell composition substantially depleted ofdedicated cells can then be further separated using a marker for Thy-1, whereby asubstantially homogeneous stem cell population is achieved. Exemplary of this stem cellpopulation is a population which is CD34+Thy-l+Lin—, which provides an enriched stemcell composition. Other markers that have been reported to subdivide CD34+ cells, furtherenriching for stem cells include, but are not limited to, CD38-, rhodamine lo, c-kitreceptor, HLA DR lo/-, CD71, and CD45 RA—. In fetal tissues and umbilical cord, stemcells are highly enriched in the CD34 hiLin- populations as described by Giusto et al.(1993) Blood 84: 421-32.?101520253035‘ WO 98108956CA 02263951 1999-02-22PCT/U S97/ 15153- 35 -The puri?ed stem cells have low side scatter and low to medium forward scatterpro?les by F ACS analysis. Cytospin preparations show the enriched stem cells to have asize between mature lymphoid cells and mature granulocytes. Cells can be selected basedon light-scatter properties as well as their expression of various cell surface antigens.While it is believed that the particular order of separation is not critical to thisinvention, the order indicated is preferred. Preferably, cells are initially separated by acoarse separation, followed by a ?ne separation, with positive selection of a markerassociated with stem cells and negative selection for markers associated with lineagecommitted cells.Compositions highly enriched in stem cells can be achieved in this manner. Thedesired stem cells are exempli?ed by a population with the CD34+Thy-l+Lin- phenotypeand being able to provide for cell regeneration and development of members of all of thevarious hematopoietic lineages.It should be noted that negative selection lineage selection for lineage specificmarkers provide a greater enrichment in stem cells obtained from bone marrow than fromMPB. The majority of CD34 cells that are mobilized into the peripheral blood do notexpress lineage-speci?c markers and, therefore, Lin selection does not signi?cantly enrichover CD34 selection in the peripheral blood as it does in bone marrow. Selection for Thy-1+ does enrich for stem cells in both mobilized peripheral blood and bone marrow.Fetal or neonatal blood are also sources for the hematopoietic stem and progenitorcells of the present invention.Fetal blood can be obtained by any method known in the art. For example, fetalblood can be taken from the fetal circulation at the placental root with the use of a needleguided by ultrasound (Daffos et al., (1985) Am. J. Obstet Gynecol 1532655-660; Daffos etal., (1983) Am. J. Obstet. Gynecol. 1461985), by placentocentesis (Valenti, C., (1973) Am..1. Obstet. Gynecol. l 15:85]; Cao et al., (1982) J. Med. Genet. 19:81), by fetoscopy(Rodeck, C.H., (1984) in Prenatal Diagnosis, Rodeck, C.H. and Nicolaides, K.H., eds.,Royal College of Obstetricians and Gynaecologists, London), etc.In a preferred embodiment of the invention, neonatal hematopoietic stem andprogenitor cells can be obtained from umbilical cord blood and/or placental blood. The useof cord or placental blood as a source of hematopoietic cells provides numerousadvantages. Cord blood can be obtained easily and without trauma to the donor. Incontrast, at present, the collection of bone marrow cells is a traumatic experience which iscostly in terms of time and money spent for hospitalization. Cord blood cells can be usedfor autologous transplantation, when and if needed, and the usual hematological and?' wo 98/08956101520253035CA 02263951 1999-02-22PCT/U S97/ 15153-36-immunological problems associated with the use of allogeneic cells, matched onlypartially at the major histocompatibility complex or matched fully at the major, but onlypartially at the minor complexes, are alleviated.Collections should be made under sterile conditions. Immediately upon collection,the neonatal or fetal blood should be mixed with an anticoagulent. Such an anticoagulentcan be any known in the art, including but not limited to CPD (citrate-phosphate-dextrose), ACD (acid citrate-dextrose), Alsever's solution, De Gowin's Solution ,Edglugate-Mg, ethylbiscoumacetate, etc. (See Hum, B.A.L., 1968, Storage of Blood, Academic Press, NewYork, pp. 26-160).Rous-Tumer Solution, other glucose mixtures, heparin,B. Isolation of Embryonic Stem CellsThe present system is based on the ability of ES cells to differentiate and generatehematopoietic cells in culture and in vivo. Previous studies have demonstrated that EScells will differentiate in culture and generate multiple hematopoietic lineages. However,in most of these studies, the extent of hematopoietic development has been limited andvariable, and the exact kinetics of hematopoietic differentiation has been unpredictable orpoorly de?ned. Utilizing the subject method, hematopoietic stem cells can be generatedby ectopic expression of a hematopoietic gene such as LH-2. The advantages of such asystem are several-fold. First, one has access to the cells at all stages of differentiation,making it possible to manipulate the system as it develops. Second, an in vitro systembased on ES cells will enable one to study the ?mction of a broad spectrum of genesthrough inactivation by homologous recombination without encountering the problemsinherent to an in viva system; namely, embryonic lethalities.Embryonic stem cells are generated and maintained using methods well known tothe skilled artisan such as those described by Doetschman et al. (1985) J. Embryo]. Exp.Morphol. 87:27-45). Any line of ES cells can be used, however, the line chosen istypically selected for the ability of the cells to differentiate into embryoid bodies (EB)followed by their commitment into hematopoietic lineages, e.g. erythroid, lymphoid,myeloid. Thus, any ES cell line from human or non-human origin that is believed to havethis capability is suitable for use herein. As an example of one mouse strain that istypically used for production of ES cells, is the 129} strain, e.g. cell line CCE utilized inthe Examples below. Still another preferred murine cell line is the cell line J1. Other EScell lines include D3 (American Type Culture Collection, catalog no. CKL 1934) and theWW6 cell line (see Ioffe et al. (1995) PNAS 92:7357-7361).?101520253035‘W0 98/08956CA 02263951 1999-02-22PCT/US97/15153_ 37 -ES cells are cultured using methods well known to the skilled artisan, such as thoseset forth by Robertson in: Teratocarcinomas and Embryonic Stem Cells: A PracticalApproach, E.J. Robertson, ed. IRL Press, Washington, D.C. [l987]); by Bradley et al.(1986) Current Topics in Devel. Biol. 20:357-371); and by Hogan et al. (Manipulating theMouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY [1986]). As an illustration, ES cells can be grown and passaged in vitro withor without feeder layers, e.g., embryonic fibroblasts, in the presence of growth factorsselected from steel factor (membrane -associated or soluble forms), leukemia inhibitoryfactor (LIF) and ?broblast growth factor (FGF). See e.g., US Pat No. 5,453,357. Growthand differentiation enhancing concentrations of these factors can range from 0.5-500ng/ml, preferably, 10-20 ng/ml. Differentiation of ES cells into embryoid bodies (EBS)and multiple cell-types, e.g., hematopoietic, endothelial, muscle and neuronal lineages, canbe achieved by a number of standard methods known in the art (reviewed in G. Keller,Current Opinion: 862-69; see also, G. Keller et al. MCB 13(1) 473-86).The technique most frequently used to differentiate ES cells is simply to removethe cells from contact with the feeder cells, or from the presence of LIF, and culture themin liquid or methyl cellulose containing media in bacterial grade petri dishes. Under theseconditions, ES cells are unable to adhere to the surface of the dish, and the formation ofEBs is enhanced. A modi?cation of this method to maximize ES cell differentiation intohematopoietic lineages involves the culturing of these cells on stromal cells, whichprovides a supportive environment for hematopoietic cells as they develop within the EBs.Stromal cell culturing methods are extensively described below in Expansion andDifferentiation of Genetically Modified Cells.dissociated into a single cell suspension. The generated EBs can be assayed at variousOnce EBs are fonned, they can bestages of development for the presence of specific cell populations. For example,hematopoietic lineages can be examined by plating EB-derived cells in methyl cellulose inthe presence of growth factors for determining hematopoietic precursor populations. Aspecific illustration of precursor cell assay is provided in the Examples below. In brief,single cell suspension of BBS can be assayed for precursor content in colony forming cell-culture (CFC-c) assay as described in Keller et al., supra. This procedure will behereinafter referred to as the precursor assays. Alternatively, EB-derived cells can beanalyzed for the presence of specific cell-surface antigens (e.g., immunoglobulin can beused to stain B lymphocytes) by immunocytochemical methods or by FACS analysis. Themost stringent test for the differentiation potential of these cells involves the ability ofdissociated EB cells to repopulate the hematopoietic system of a recipient animal.Detection of cell surface antigens and transplantation protocols are extensively described?101520253035'WO 98/08956CA 02263951 1999-02-22PCT /US97/15153_ 33 _below in the section entitled "Expansion and Differentiation of Genetically Modi?edCells".V. Methods of the inventionThe invention provides methods for inducing a speci?c biological activity in atissue speci?c manner. In a preferred embodiment, the invention provides a method formodulating cell growth, differentiation and/or survival. According to the method of theinvention, a cell is modified to express a modi?ed form of a target protein which mediatesthe desired biological activity, said target protein interacting speci?cally with a modi?edform of a ligand of the target protein, which essentially does not interact with the wild-type target protein.In a preferred embodiment of the invention, the target protein is a protein involvedin the Ca2+/calcineurin pathway, which is involved, in particular in activation oflymphocytes, e.g., T lymphocytes. In an even more preferred embodiment, the targetprotein is a protein which forms a ternary complex with calcineurin or FRB. Even morepreferably, the target protein is cyclophilin, FKBPI2, or FRB. Calcineurin is present inmost tissues, with the highest level of expression being present in the brain. Inlymphocytes, in particular in T cell, calcineurin is involved in activation of the T cells inthe presence of Ca2+.activation, e.g., inducing tolerance, without signi?cantly affecting biological activitiesThus, the invention provides a method for regulating T cellmediated by calcineurin in other cell types. For example, a population of cells can beengineered to express a modified cyclophilin selectively in T cells, such as by operablylinking the gene encoding the modi?ed cyclophilin molecule to a promoter that activatestranscription speci?cally in T cells, e.g, CD4 promoter. Only the T cells will express themodi?ed cyclophilin and therefore be responsive to the modi?ed ligand. Thus, uponcontact with the modi?ed ligand, activation of the T cells expressing the modi?edcyclophilin will be inhibited, without inducing toxic effects in the cells which do notexpress the modi?ed cyclophilin.Furthermore, it has been observed that a reduction in calcineurin activity by only50% signi?cantly impairs signaling by the antigen receptor on T cells. Similarly, patientstreated for transplant rejection have only a 50% reduction in calcineurin activity at thetherapeutic concentration of the drug, though they do not usually reject the transplant. Inaddition, cyclosporin appears to induce tolerance to transplanted tissue even after the drugis withdrawn. For example, in the case of bone marrow populated largely by the?9 WO 98/08956101520253035CA 02263951 1999-02-22PCTIUS97/15153-39-transplanted cells, while the lymphocyte population is derived largely or in part from therecipient.‘ Thus, this indicates that blockage of calcineurin action by only 50% for longperiods of time results in the development of tolerance to transplanted tissue. Parallelstudies in mice have also suggested that these drugs are capable of inducing long termtolerance of transplanted tissues.Accordingly, the invention is useful in any situation in which tolerance of Tlymphocytes is desired. The invention can be applied in vitro or in vivo. In a preferredembodiment, the method is used on cells, e.g, cells obtained from a subject, the cells aremodi?ed in vitro and then administered to the subject. In another embodiment, the cellsare modi?ed in vivo to express a modi?ed target protein. Conditions which can be treatedaccording to the method of the invention include those involving an immune reaction andare further described below.In one embodiment, this invention is directed to a method for preventing graftrejection or for treating host versus graft disease following blood marrow transplantation.In one embodiment, the invention, comprises the following steps: (a) inserting DNAencoding a modi?ed cellular target protein, e.g, cyclophilin specific for a modi?edcyclosporin into a hematopoietic stem cell to produce a transformed hematopoietic stemcell; (b) introducing the transformed hematopoietic stem cell into a recipient mammal,such that the modi?ed cellular target protein cyclophilin is expressed; and,(c) administering an effective amount of the modified cyclosporin to the recipientmammal. As used herein, the term "hematopoietic stem cell" refers to a cell that is capableof developing into mature myeloid and/or lymphoid cells. The method of this inventionavoids the undesirable side effect of broad spectrum immune suppressants which are oftenused in transplantation. The genetic engineering techniques for cloning a protein,transfecting a cell, and introducing the transfected cell into a patient in gene therapy areknown. One of skill in this art can determine through routine experimentation thepreferred cloning techniques, transfection methods and gene delivery protocol to be used.In a preferred embodiment, this invention is directed to the modified cyclosporindrug, CpSarl l-CsA, which can be administered to the patient receiving the transformedhematopoietic stem cells that are capable of expressing the modi?ed cellular target proteincyclophilin CypAgtm and directed to the modi?ed target protein cyclophilin with thealterations in its amino acid sequence making it speci?c for the modi?ed cyclosporinCpSarl l-CsA.In another embodiment, the invention is used for treating autoimmune disorders byinducing tolerance of autoimmune cells. Immunosuppressive drugs remain thecornerstone of therapy for autoimmune disorders, although their efficacy is limited and?7 WO 98/08956101520253035CA 02263951 1999-02-22PCT/US97/15153- 40 -their chronic use entails considerable risk. Immunosuppressive treatment is particularlyindicated for progressive neurologic disability without remission when the patient is on arapidly progressive course. The invention provides a method for treating autoimmunediseases without incurring such risks and toxic effects.The method according to this invention includes (a) inserting DNA encoding amodi?ed cellular target protein, for example a modi?ed cyclophilin target protein, speci?cfor a modi?ed ligand, cyclosporin, into a T cell to produce a transformed T cell;(b) introducing the transformed T cell into a patient suffering from an autoimmunedisorder, such that the modi?ed target protein is expressed, and then, (c) administering tothe patient an effective amount of a modi?ed immune agent whose target protein is themodified target protein. In this type of application, speci?c populations of T cells areIt ispreferable that a signi?cant amount of cells are transformed. This can be achieved, bytransfected and regulated by the modi?ed drug, for example, cyclosporin A.viral transformation, as further described herein. Alternatively, cells can be targeted andtransformed in vivo with a construct encoding the modi?ed target protein.One exemplary autoimmune disease which can be treated according to the methodof the invention is multiple sclerosis. Multiple sclerosis (MS) is characterized by chronicin?ammation, demyelination, and gliosis (scarring). MS affects 350,000 Americans andis, with the exception of trauma, the most frequent cause of neurologic disability in earlyto middle adulthood. Indirect evidence supports an autoimmune etiology for MS, perhapstriggered by a viral infection in a genetically susceptible host.T cells reactive against myelin proteins, either myelin basic protein (MBP) ormyelin proteolipid protein (PLP), mediate CNS in?ammation in experimental allergicencephalomyelitis (EAE), a laboratory model for demyelinating diseases. This has beenproven by adoptive transfer experiments in which sensitized T cells from an animal withEAE can transfer disease to a healthy syngeneic recipient.It is possible that tissue damage in MS is mediated by cytokine products ofactivated T cells, macrophages, or astrocytes.According to this invention, one method of treating MS, particularly in thosepatients where MS has become life-threatening, is to administer a genetically engineered Tcell that expresses a modi?ed target protein for a modi?ed immune agent, such asFK506, then the modi?edimmunosuppressive drug.cyclosporin, and rapamycin and administeringAnother exemplary autoimmune disease which can be treated according to themethod of the invention is Systemic Lupus Erythematosus (SLE). SLE is a disease ofunknown cause in which tissues and cells are damaged by pathogenic autoantibodies and?101520253035WO 98108956CA 02263951 1999-02-22PCT/US97/15153_ 41 _immune complexes. In the United States, the prevalence of SLE in urban areas variesfrom 15 to 50 per 100,00 population.SLE probably results from interactions between susceptibility genes and theenvironment. This interaction results in abnormal immune responses with T and Blymphocyte hyperactivity which is not suppressed by the usual immunoregulatory circuits.Life threatening, severely disabling manifestations of SLE that are responsive toimmunosuppression can be treated according to this invention by administering agenetically engineered T cell that expresses a modi?ed target protein for a modi?edimmune agent and then administering the modi?ed immunosuppressive drug, such ascyclosporin, FKSO6, or rapamycin.In addition to autoimmune diseases and graft versus host disease, undesired T cellactivation may give rise to a variety of other diseases or conditions, e.g., allograftrejection, hypersensitivity, delayed-type hypersensitivity mediated conditions, and allergicreactions, e.g. drug allergies. Yet other diseases or disorders that can be treated accordingto the method of the invention include asthma, allergic diseases that have manifestations ofin?ammations such as dermatitis or rhinitis, for example, atopic dermatitis, symptomssuch as bronchoconstriction accompanied by asthma, allergic diseases, rheumatoidarthritis, rheumatoid spondylitis. osteoarthritis, other arthritic conditions, septic shock,septis, and endotoxic shock, atrophic gastritis, thyroiditis, allergic encephalomyelitis,gastric mucosa, thyrotoxicosis, autoimmune hemolytic anemia, thyroidosis, scleroderma,diabetes mellitus, Graves’ disease, and sympathetic ophthalmia (Eisen, H. N., 1979,Immunology, Harper and Row, Hagerstown, Md., pp. 557-595).Another application according to this invention is the selective activation ofpathways in cells through receptor-ligand interactions. Thus, a therapeutic protein ofchoice can be selectively modified to bind with its mutant receptor, which will not bindwith other unmodi?ed receptors of "wild-type" or "normal" type, and thus activate thepathway .For example, the following proteins have known structures and may be modifiedaccording to this invention to selectively activate a mutant target protein: human insulin,used in treating diabetes mellitus; human growth hormone, used in treating growthhormone deficiency in children; interferon-alpha, used to treat hairy cell leukaemia andchronic hepatitus A and C; tissue-type plasminogen activator (tPA), used to treatmyocardial infarction; erythropoietin, used to treat anaemia in chromic renal failure;granulocyte colony-stimulating factor (G—CSF), used to treat neutropenia following cancerchemotherapy; granulocyte-macrophage colony-stimulating factor (GM-CSF), used for?1015202530357W0 98l08956CA 02263951 1999-02-22PCT/US97/15153_ 42 _myeloid reconstitution after bone marrow transplantation; and, Factor VIII used intreating haemophilia A.In another embodiment, the invention can be used to treat neurologic diseases orconditions. For example, in certain conditions, e.g., degenerative diseases, it is desirableto regenerate neurons or other cells of the nervous system, e.g, by implantation of suchcells. According to the method of the invention, the growth and/or differentiation of suchcells could be controlled, by genetically engineering the cells to express a modi?ed targetprotein involved in growth, differentiation of cell death control. Methods of geneticallymodifying donor cells by gene transfer for grafting into the central nervous system to treatdefective, diseased or damaged cells are disclosed in U.S. Pat. No. 5650148 by Gage et al.The modi?ed donor cells produce functional molecules that effect the recovery orimproved function of cells in the CNS. Methods and vectors for carrying out gene transferand grafting are also described in U.S. Pat. No. 5650148.Alternatively, this invention can be used to engineer ligand-inducable cell deathcharacteristics into cells. Such engineered cells can then be eliminated from a cell cultureafter they have served their intended purposed (e.g. production of a desired protein or otherproduct) by adding the ligand to the medium. Engineered cells of this invention can alsobe used in vivo, to modify whole organisms, preferably animals, including humans, e.g.such that the cells produce a desired protein or other result within the animal containingsuch cells. Such uses include gene therapy.In one embodiment of the invention, cells are modi?ed ex vivo and introduced intoa subject. Depending upon the nature of the cells, the cells may be introduced into a hostorganism, e.g. a mammal, in a wide variety of ways. Hematopoietic cells may beadministered by injection into the vascular system, there being usually at least about 104cells and generally not more than about 10"’, more usually not more than about 108 cells.The number of cells which are employed will depend upon a number of circumstances, thepurpose for the introduction, the lifetime of the cells, the protocol to be used, for example,the number of administrations, the ability of the cells to multiply, the stability of thetherapeutic agent, the physiologic need for the therapeutic agent, and the like.Alternatively, with skin cells which may be used as a graft, the number of cells woulddepend upon the size of the layer to be applied to the burn or other lesion. Generally, formyoblasts or ?broblasts, the number of cells will at least about 10“ and not more thanabout l08 and may be applied as a dispersion, generally being injected at or near the site ofinterest. The cells will usually be in a physiologically-acceptable medium.Instead of ex vivo modi?cation of the cells, in many situations one may wish tomodify cells in vivo. For this purpose, various techniques have been developed for?K WO 98108956101520253035CA 02263951 1999-02-22PCT/U S97/ 15153- 43 _modi?cation of target tissue and cells in vivo. A number of virus vectors have beendeveloped, such as adenovirus and retroviruses, which allow for transfection and randomintegration of the virus into the host. See, for example, Dubensky et al. (1984) Proc. Natl.Acad. Sci. USA 81, 7529-7533; Kaneda et al., (1989) Science 243,375-378; Hiebert et al.(1989) Proc. Natl. Acad. Sci. USA 86, 3594-3598; Hatzoglu et al. (1990) J. Biol. Chem.265, 17285-17293 and Ferry, et al. (1991) Proc. Natl. Acad. Sci. USA 88, 8377-8381. Thevector may be administered by injection, e.g. intravascularly or intramuscularly,inhalation, or other parenteral mode.In accordance with in vivo genetic modi?cation, the manner of the modi?cationwill depend on the nature of the tissue, the ef?ciency of cellular modi?cation required, thenumber of opportunities to modify the particular cells, the accessibility of the tissue to theDNA composition to be introduced, and the like. By employing an attenuated or modi?edretrovirus carrying a target transcriptional initiation region, if desired, one can activate thevirus using one of the subject transcription factor constructs, so that the virus may beproduced and transfect adjacent cells.The DNA introduction need not result in integration in every case. In somesituations, transient maintenance of the DNA introduced may be suf?cient. In this way,one could have a short term effect, where cells could be introduced into the host and thenturned on after a predetermined time, for example, after the cells have been able to hometo a particular site.Tissue speci?c expression of the modi?ed target protein of the invention can alsobe achieved by selectively introducing a vector encoding the modi?ed target protein in thedesired cell type. This can be achieved by various methods. For example, one can choosea viral vector which speci?cally infects the desired cell type. Alternatively, one can useliposomes, bacteria, or other form of delivery vehicle that can be targeted to the desiredcell type by linking to the delivery vehicle a ligand that interacts speci?cally with thedesired cell. The ligand can be a protein, e.g., a growth factor, which interacts with agrowth factor target protein on the target cells. In a preferred embodiment, the ligand isaltered such that it does not induce a biological activity, but only serves as a targetmolecule for the construct of the invention. The ligand can be an antibody, speci?callyrecognizing an epitope on the desired target cell. Numerous antibodies to surfacemolecules are available commercially. Alternatively, antibody molecules can also beprepared according to methods known in the art.The modi?ed ligand providing for activation of the modi?ed target protein may beadministered as desired. Depending upon the binding affinity of the modi?ed ligand, theresponse desired, the manner of administration, the half-life, the number of cells present.?1015202530357W0 98/08956CA 02263951 1999-02-22PCT/US97/15153- 44 -various protocols may be employed. The modi?ed ligand may be administeredparenterally or orally. The number of administrations will depend upon the factorsdescribed above. The modi?ed ligand may be taken orally as a pill, powder, or dispersion;bucally; sublingually; injected intravascularly, intraperitoneally, subcutaneously; byinhalation, or the like. The modified ligand (and monomeric compound) may beformulated using convenitonal methods and materials well known in the art for the variousroutes of administration. The precise dose and particular method of administration willdepend upon the above factors and be determined by the attending physician or human oranimal healthcare provider. For the most part, the manner of administration will bedetermined empirically.The particular dosage of the modi?ed ligand for any application may bedetermined in accordance with the procedures used for therapeutic dosage monitoring,where maintenance of a particular level of expression is desired over an extended period oftimes, for example, greater than about two weeks, or where there is repetitive therapy,with individual or repeated doses of ligand over short periods of time, with extendedA dose of the modi?ed ligand within apredetermined range would be given and monitored for response, so as to obtain a time-intervals, for example, two weeks or more.expression level relationship, as well as observing therapeutic response. Depending on thelevels observed during the time period and the therapeutic response, one could provide alarger or smaller dose the next time, following the response. This process would beiteratively repeated until one obtained a dosage within the therapeutic range. Where themodified ligand is chronically administered, once the maintenance dosage of the ligand isdetermined, one could then do assays at extended intervals to be assured that the cellularsystem is providing the appropriate response and level of the expression product.It should be appreciated that the system is subject to many variables, such as thecellular response to the ligand, the ef?ciency of expression and, as appropriate, the level ofsecretion, the activity of the expression product, the particular need of the patient, whichmay vary with time and circumstances, the rate of loss of the cellular activity as a result ofloss of cells or expression activity of individual cells, and the like. Therefore, it isexpected that for each individual patient, even if there were universal cells which could beadministered to the population at large, each patient would be monitored for the properdosage for the individual.The subject methodology and compositions may be used for the treatment of awide variety of conditions and indications. For example, B- and T—cells may be used inthe treatment of cancer, infectious diseases, metabolic de?ciencies, cardiovascular disease,hereditary coagulation de?ciencies, autoimmune diseases, joint degenerative diseases, e.g.arthritis, pulmonary disease, kidney disease, endocrine abnormalities, etc. Various cells?CA 02263951 1999-02-22'WO 98/08956 PCT/US97/15153- 45 _involved with structure, such as ?broblasts and myoblasts, may be used in the treatment ofgenetic de?ciencies, such as connective tissue de?ciencies, arthritis, hepatic disease, etc.?CA 02263951 1999-02-229 WO 98/08956 PCT/US97/15153- 46 -VI KitsThis invention further provides kits useful for the foregoing applications. Onesuch kit contains one or more nucleic acids encoding a modi?ed target protein thereof.The kit preferably also contains a modi?ed ligand for the target protein. Thus, in one5 embodiment, the kit comprises a vector containing a gene encoding a modified cyclophilin9 molecule operably linked to a promoter expressed speci?cally in T cells and a modifiedcyclophilin molecule.The contents of all cited references including literature references, issued patents,l0 published patent applications and co-pending patent applications, as cited throughout thisapplication are hereby expressly incorporated by reference.?CA 02263951 1999-02-22SW0 98/08956 PCT/US97/15153-47-EXAMPLESExample 1: Synthesis of a modi?ed Cyclosporin A, CgSar11—CsA5 This Example describes the synthesis of a modi?ed form of Cyclosporin A, termedCpSar1l-CsA, which does not signi?cantly interact with the wild-type receptor ofcyclosporin A, cyclophilin.As shown below in Scheme 1, the synthesis of CpSar1l-CsA first required theasymmetric synthesis of alpha-cyclopentyl sarcosine using a combination of the methods10 of Evans, et al. (J. Am. Chem. Soc. 112: 4011-4030 (1990)) and Dorow, et al. (J. Org.Chem. 60: 4986-7 (1995)) and the subsequent incorporation of this unnatural amino acidinto the CsA macrocycle. Scheme 1l 5O 1. (COCI) 2. DCMDMF(cal.) \)(J3\ 1. a) Me ,BBr lyle O. . N b EIOHon 2. L1thIo—(4S)~4-(phenyl« 3 5 OH ___)___, Fmoc’N : OHmethyl)-2-oxazolidinone ‘ 2 F _C‘ 53. a) KHMDS b) Trisyl-N 3 O ‘K3333 ' QMa 0 1.A|lyI Bromide, Cs 2C0;,g_ 2. TFABoc’ "' OH ——-——> Fmoc‘ HZN-nonapeptide3. Fmoc-Cpsar-OH if *""‘_“"'>HO Pyarom DIEA Me PyAOP, IuudineM9 4. Pd(PPh3)4, dimedone0 MeFmoc-CpSar-Ma8ml-Abu-Sar-MeLeu-Va!-MeLeu-Ala-D-A|a-MeLeu-MeLeu- /U\ o ’ N\A¢25 101. LIOH. LICI, THF2. PyAop, Lutidine Me \’—M9 \Me =hw[ Me Me Me Me0 EI‘. N ‘(NH Trx N NH3 0 Me 0Me MeMe Me Me Meoc—CyclopentylSarcosinel l-CsA (CpSar1l-CsA)?10V WO 98/08956CA 02263951 1999-02-22PCT/US97/15153-48-In the synthesis, HZN-nonapeptied (H2N-Abu-Sar-MeLeu-Val—MeLeu-Ala-DAla-Meleu-MeLeu-(Ac-N-MeVa1ino1 ester) was synthesized from CSA. The reagent abbreviationsinclude the following: DCM, dichloromethane; DMF, dimethylformamide; KHMDS,Trisyl-N3,tetrahydrofuran; Fmoc-CL. 9-?uorenylmethylchloroformate; Boc, t-butyloxycarbonyl;TFA,hexa?uorophosphate; DIEA,potassium hexamethyldisilazide; triisopropylbenzenesulfonylazide; THF,tri?ueroacetic acid; PyBrop, bromo—trispyrrolidinophosphoniumdiisopropylethylamine; dimedone, 5,5-dimethyl-1,4-cyclohexanedione; PyAop, 7-azabenzotriazo-1-yl-oxy(trispyro11idino)phosphoniumhexa?uorophosphate.The details of the synthesis are set forth below.?CA 02263951 1999-02-229 WO 98108956 PCT/US97/15153-49-N-on-cyclopentylacetyl-4S-benzyloxazolidinone (1)To a solution of cyclopentylacetic acid (4.94 g, 38.51 mmol) and DMF (one drop)in DCM (100 mL), oxalylchloride (23.1 mL, 2.0 M in DCM, 1.2 eq, 46.2 mmol) wasadded dropwise over one hour at room temperature. The reaction was stirredfor another two hours, evaporated under reduced pressure and dried undervacuum to afford crude cyclopentylacetyl chloride. This residue was dissolvedin THF (80 mL) and cooled to -78°C. To a solution of 4S-benzyloxazolidinone(6.79 g, 38.5 mmol) in THF (50 mL) at -78°C, nBuLi (26.2 ml.., 1.45 M, 38 mmol)was added dropwise by syringe and stirred for an additional 15 minutesproducing lithiated oxazolidinone. This solution was added over 30 minutes viacannula to the solution of cyclopentylacetyl chloride. The reaction mixture wasstirred 30 minutes at —78°C before quenching with 1 M NaH2SO4 (75 mL). TheTHF was removed under reduced pressure and the aqueous layer was extractedwith DCM (3 x 75 mL). The combined organics were washed with 10% NaHCO3aq.(5O mL), brine (50 mL), dried over Na2SO4, filtered and evaporated onto silica(15 g). The product was purified by chromatography (silica gel, 5-20% EtOAc inhexanes) to give 7.97g (70 %) of a white solid: [0t]20D = +52.0° (c 1, CHCL3); IR(film) 2948, 2835, 1779, 1696, 1455, 1383, 1352, 1210, 1099, 700 cm'1; 1H NMR (400MHz, CDCL3) 6 7.2-7.4 (m, 5H), 4.67 (m, 1H), 4.16, (M, 2H), 3.30 (dd, J: 3.3, 13.3,1H), 3.02 (dd, I = 6.9, 16.6, 1H), 2.90 (dd,] = 7.4, 16.6, 1H), 2.77 (dd,] = 9.7, 13.3,1H), 2.33 (m, 1H), 1.89 (m. 2H’), 1.62 (m, 4H), 1.22 (m, 2H); 13C NMR (100 MHz,CDCL3) 8 172.9, 153.4, 135.3, 127.2, 66.0, 55.1, 41.3, 37.9, 35.7, 32.44, 32.38, 24.9;HRMS (CI+, NH3) calc'd for C17H21NO3: 305.1865, found 305.1870.?CA 02263951 1999-02-22’WO 98108956 PCT/US97/15153_ 50 _2S-0t-azido-on-cyclopentylacetyl-4S-oxalolidinone (2)To THF (40 mL) at -78°C, potassium hexamethyldisilazide (16.6 mL, 0.91 M intoluene, 1.1 eq. 15.1 mmol) was added and stirred for 10 minutes. A pre-cooled (-78°C) solution of N-oz-cyclopentylacetyl—4S-benzyloxazolidinone 1 (3.94 g, 13.7mmol) in THF (40 mL) was added and stirred for 30 minutes and followed by apre—cooled (-78°C) solution of Trisyl azide (5.09 g, 16.45 mmol, 1.2 eq) in THF (40mL). After 5 minutes the reaction was quenched with glacial acetic acid (3.65mL) and warmed to room temperature. The mixture was evaporated to ~20 mLunder reduced pressure, diluted with brine (300 mL) and extracted with DCM (3x 300 mL). The combined organics were washed with 10% NaHCO3 aq, driedover MgSO4, filtered, evaporated and purified by chromatography (silica gel, 60-100% DCM in hexanes) to give 3.81 g (80 %) of a clear oil: [(X]20D = +84.0° (c 1,CDCL3); IR (film) 2957, 2870, 2105, 1781, 1701, 1455, 1387, 1211, 1109, 702 cm'1;1H NMR (400 MHz, CDCI3) 5 7.2-7.4 (m, 5H), 4.99 (d, J = 8.7, 1H), 4.70 (m, 1H),4.24, (M, 2H), 3.32 (dd, J: 3.3, 13.6, 1H), 2.87 (dd, J = 9.4, 13.5, 1H), 2.47 (m, 1H),1.8-1.9 (m. 1H), 1.5-1.8 (m, 6H), 1.25-1.33 (m, 2H); 13C NMR (100 MHz, CDCL3) 8170.4, 152.9, 134.7, 129.4, 127.4, 66.4, 63.2, 55.4, 41.3, 37.5, 29.2, 28.8, 25.3, 25.1;HRMS (CI+, NH3) calc'd for C17H2oN4O3: 346.1879, found 346.1879.2S-azido-0L-cyclopentylacetic acid (3)To an ice cold solution of the oxazolidinone 2 (3.74 g, 11.4 mmol) in THF/H20(3/1, 120 mL) was added solid LiOH-H20 (0.955 g, 22.8 mmol, 2 eq). Afterstirring for 1 hour at 0°C, NaHCO3 aq. (0.5 M, 120 mL) was added and the THFwas evaporated under reduced pressure. The aqueous mixture was washed withDCM (4 x 100 mL), acidified to pH 2 with 3M HC1 and extracted with EtOAc (3 x150 mL). The combined EtOAc layers were dried over Na2SO4, filtered and?CA 02263951 1999-02-22"W0 98/08956 _ 51 __ PCT/US97/15153evaporated to give 1.85 g (87 %) of a clear oil: [O£]20D = -38.40 (C 0.5, CDCL3); IR(film) 2300-3500 br, 2953, 2103, 1717, 1233, 646, 631, 619 cm'1; 1H NMR (400MHZ, CDCI3) 5 10.1 (br S, 1H), 3.73 (d, ] = 7.9, 1H), 2.39 (In, 1H), 1.74-1.9 (m, 2H),1.54-1.73 (m, 4H), 1.4-1.5 (m, 2H),‘ 13C NMR (100 MHZ, CDCI3) 5 176.5, 65.7, 41.3,29.3, 28.8, 25.3, 25.1; HRMS (CI+, NH3) calc'd for C7H11N3O2: 187.1195, found187.1189.L-or-cyclopentylsarcosine (4)To a solution of the azide 3 (1.29 g, 7.6 mmol) in 1,2—dich1oroethane (20 mL) atroom temperature was added a solution of bromodimethylborane (1.34 g, 11.1mmol, 1.46 eq. in 35 mL 1,2 dichloroethane) dropwise over 1.5 hours. Afterstirring for 1 hour the reaction, EtOH (652 uL, 11.1 mmol, 1.46 eq.) was added,stirred for an additional 20 minutes and concentrated to ~20 mL under reducedpressure. This suspension was triturated with DCM (100 mL) and filtered to give1.66 g (92 %) of an off white solid after drying under vacuum: [oL]20D = +20.3° (c1, MeOH); IR (film) 2300-3250 br, 2955, 2350, 1736, 1557, 1460, 1208 cm“1; 1HNMR (400 MHz, CD3OD) 8 3.93 (d, J = 6.4, 1H), 2.74 (s, 3H), 2.38 (m, 1H), 1.75-1.93 (m, 2H), 1.53-1.73 (m, 5H), 1.39-1.5 (m, 1H); 13C NMR (100 MHz, CD3OD) 5170.6, 66.1, 41.6, 33.2, 30.2, 29.2, 26, 25.9; HRMS (CI+, NH3) ca1c'd for C31-I15NO2:158.1181, found 158.1185.9-fluorenylmethyloxycarbonyl-L-on-cyclopentylsarcosine (Fmoc-CpSar-OH) (5)To a solution of the aminoacid 4 (184 mg, 773 umol) in H20/dioxane (1 / 1, 20mL), solid Na2CO3 (287 mg, 2.7 mmol, 3.5 eq) and ' 9-?uorenylmethylchloroformate (300 mg, 1.16 mmol, 1.5 eq.) were added. Afterstirring overnight at room temperature, more Na2CO3 (100 mg) was added andthe reaction was complete after stirring for 1 hour. The reaction mixture was?CA 02263951 1999-02-22(W0 98/08956 _ 52 _ PCT/US97/15153diluted with H20 (30 mL), extracted with EtOAc (2 x 30 mL), acidified to pH 2with 3M HCl and extracted with EtOAc (3 x 30 mL). The combined organicswere washed with brine (30 mL), dried over Na2SO4, filtered and evaporated togive 190 mg (95 %) of a white solid: [0t]20D = -450 (c 1, CDCL3); IR (film) 2250-3400 br, 2953, 1740, 1701, 1451, 1402, 1319, 1138, 758, 741 cm'1; 1H NMR (400MHz, CDC13), 2 rotamers, 5 7.77-7.73 (m, 4H), 7 .5-7.65 (In, 4H), 7.24-7.43 (m, 8H),4.41-4.59 (m, 6H), 4.2-4.3 (m, 2H), 4.11-4.17 (m, 1H), 2.91, 2.89 (2s, 6H), 2.39, 2.23(2m, 2H), 1.94, 1.83 (2m, 2H), 1.35-1.74 (m, 12H), 1.25, 1.01 (2m, 3H); 13C NMR(100 MHz, CDCL3), 2 rotamers, 8 176.4, 176.3, 157.3, 156.2, 144.1, 144.0, 143.9,143.9,143.8, 141.5, 141.4, 141.4, 127.8, 127.7, 127.1, 125.0, 124.9, 120.0, 120.0, 67.9,67.6, 63.4, 63.0, 47.4, 39.1, 39.0, 31.2, 31.0, 30.6, 29.8, 29.7, 25.6, 25.5, 24.9, 24.8,-HRMS (c1+, NH3) calc'd for C23H25NO4: 380.1862, found 380.1866.N-tButyloxycarbonyl-(4R)-4-[(E)-2-butenyl]-4,N-dimethyl-L-threonine allylester (Boc-MeBmt-OA11) (6)To a solution of Boc-MeBmt—OH (97 mg, 322 umol) in EtOH/H20 (6/1, 3.5 mL),Cs2CO3 (110 mg, 338 umol, 1.05 eq) was added, stirred for 30 minutes,evaporated and azeotroped with benzene (3 x 5 mL). The cesium salt wasdissolved in DMF (1 mL) and allyl bromide (33.4 uL, 386 umol, 1.2 eq) was addedvia syringe and the reaction was stirred overnight at room temperature. Thereaction mixture was separated between H20 and diethyl ether (30 mL each),washed with H20 (30 mL), dried over Na2SO4, filtered, evaporated and purifiedby chromatography (silica gel, 10-25% EtOAc in hexanes) to give 107 mg (97 %)of a clear oil: [ot]29D +0.70 (c 1, CDCL3); IR (film) 3478 br, 2975, 2934, 1750, 1648,1482, 1451, 1393, 1368, 1323, 1252, 1152, 968, 934, cm'1; 1H NMR (400 MHz,CDCI3) 5 5.93 (m, 1H), 5.4-5.53 (In, 2H), 5.35 (d,] = 17.2, 1H), 5.25 (d,] = 10.4, 1H),4.5-4.85 (m, 3H), 3.75-4.0 (m, 2H), 2.99, 2.95 (2s, 3H), 2.28-2.46 (m, 1H), 1.88-2.03?CA 02263951 1999-02-22two 98/08956 _ 53 _ PCT/US97/15153(m, 1H), 1.67, (d,] = 5.0, 3H), 1.48, 1.45 (23, 9H), 0.87 (d, I = 6.7, 3H); 13C NMR(100 MHZ, CDCI3) 5 170.3, 157.2, 131.7, 129.1, 126.9, 118.3, 80.5, 75.5, 65.7, 63.3,36.1, 35.8, 28.2, 17.9, 15.6; HRMS (CI+, NH3) calc'd for C13H31NO5: 342.2280,found 342.2264.HNMeBmt-OA11 (7)To a solution of Boc-MeBmt-OAll 6 (76.6 mg, 0.22 mmol) in DCM (1 mL) at 0°C,tri?uoroacetic acid (0.5 mL) was added dropwise. After stirring for 2 hours, thereaction was quenched into 10% NaHCO3 aq. (30 mL), diluted with H20 (10 mL)and the pH was adjusted to 9.5 with 1N NaOH. This solution was extracted withEtOAc (4 x 40 mL) and the combined organics were dried over Na2SO4, filteredand evaporated to give 50.2 mg (90 %) of a crude oil.Fmoc-CpSar-MeBmt-OA1l (8)To a solution of acid 5 (19 mg, 50 umol, 0.97 eq) and the crude amine 7 (12.5 mg,52 umol) in DCM (300 pl), diisopropylethylamine (30 1.11..) was added followed byPyBrop (29 mg, 62.2 umol, 1.2 eq) and the reaction was stirred overnight undernitrogen. The reaction mixture was purified by chromatography (silica, 10-20%EtOAc in hexanes to give 10.5 mg (35 %) of an oil: IR (film) ? cm'1; 1H NMR (400MHZ, CDCI3), multiple rotamers, 5 7.2-7.8 (m, 8H), 5.83-6 (m, 1H), 5.2-5.5 (m,4H), 4.8-5.0 (m, 1H), 4.53-4.75 (m, 3H), 4.4-4.54 (m, 1H), 4.17-4.27 (m, 1H), 3.85-4.15 (m, 1.5H), 3.80 (d, J = 10.8, 0.5H), 3.15, 2.84, 2.67, 2.25 (43, 6H), 2.57-2.67 (m,0.5H), 2.26-2.4 (m, 1.5H), 1.73-2 (m, 2H), 1.4-1.7 (m, 7H), 1.15-1.35 (m, 3H), 0.72,0.81, 0.96 (3d, I = 6.8, 3H), 0.5, 0.22 (m, 1H); LRMS (FAB+, Nal) calc'd forC35H45N2O5: 602, found 603, 625 (M+H, M+Na).?CA 02263951 1999-02-22‘W0 98/08956 - 54 — PCT/US97/15153Allyl ester 8 (8.5 mg, 14.1 umol) and 3,3—dimethyl—1,5—cyclohexanedione (13.9 mg,99 umol, 5 eq) were dissolved in THF (1 mL). A crystal of tetral<is-triphenylphosphine palladium was added and the reaction was stirred undernitrogen at room temperature for 2 hours. The reaction mixture was evaporatedunder nitrogen and puri?ed by repeated chromatography (silica gel, 0 to 1%HOAC in 50% EtOAc/Hexanes to 1%HOAc in EtOAc) to give 4.3 mg (54 %) of anoil: 1H NMR (400 MHz, CDCI3), multiple rotamers, 8 7.27-7.8 (m, 8H), 5.3-5.55(m, 2H), 3.8-4.9 (m, 6.5H), 3.79 (d,] = 10.8, 0.5H), 3.15, 2.84, 2.67, 2.25 (4s, 6H), 2.5-2.67 (m, 0.5H), 225-24 (In, 1.5H), 1.35-2 (m, 7.5H), 1-1.35 (m, 65H), 0.72, 0.81, 0.96(3d, ]=6.8, 3H); LRMS (FAB+, Nal) calc'd for C33H42N2O5: 562, found 585(M+Na).Fmoc-CpSar-MeBmt-Abu-Sar-MeLeu-Val-MeLeu-A1a-D-Ala-MeLeu-Meleu-valinol ester (10)To a solution of acid 9 (4.2 mg, 7.5 umol) and amine (from deprotection of 4,chapter 4 part 1) (8.42 mg, umol, 1.0 eq.) and lutidine (10 uL) in DCM (200 uL),PyAop (5.7 mg, umol, 1.46 eq) was added and the reaction was stirredovernight under nitrogen. The mixture was purified by chromatography (silicagel, 0—20% acetone in EtOAc) to give 12.0 mg (99 %) of an oil: 1H NMR (500MHz, CDCI3) many rotamers, possible mixture of diastereomers, fingerprintspectra in appendix 1. LRMS (FAB+, Nal) calc'd for C37H14oN12O15: 1608, found1609, 1631 (M+H, M+Na).HNMe-CpSar-MeBmt-Abu-Sar-MeLeu-Val-MeLeu-Ala-D-Al3-MeLeu-Meleu-OH (11)The protected undecapeptide 10 (12 mg, 7.45 umol), DBU (12 1.1L) and LiBr (9 mg)were dissolved in THF/H20 (10/ 1, 330 uL) and stirred for 6 hours at room?CA 02263951 1999-02-22'WO 98/08956 PCT/US97/15153- 55 -temperature. More DBU (12 uL) and LiBr (9 mg) were added and the reactionwas stirred overnight. After evaporation of the THF under nitrogen, MeOH (500uL) and a drop of HOAC were added and the solution was filtered through a LH-20 column (6 cm x 1 cm). Product containing fractions were evaporated,dissolved in phosphate buffer (pH 7) and extracted with DCM (4 x 15 mL). Thecombined organics were dried over Na2SO4, filtered and evaporated to give 5.5mg (59 %) of a glassy solid: LRMS (FAB+) ca1c'd for C54H115N11O13: 1245, found1246 (M+H).CpSar11-CsA (12)A solution of the deprotected peptide 11 (5.5 mg, 4.4 umol), PyAop (23 mg, 44umol, 10 eq) and 2,6-lutidine (23 ill) in DCM (10 mL) was stirred for 48 h at RT.The reaction mixture was evaporated and the residue dissolved in MeCN andpurified by reverse phase HPLC (Beckman ODS ultrasphere 5 it 10 mm x 25 cm,0.1% TFA/MeCN 50:50-> 10:90 in 25 min., 70°C) to afford the pure cyclicpeptide (2.8 mg, 52 °/o) as a white solid: R; 0.3 (EtOAc); [oL]20D -2050 (c 0.1,CHCL3); IR (film) 3050-3580 br, 3320, 2957, 2850, 1636, 1558, 1506, 1456, 1412,1098 cm'1; 1H NMR (500 MHz, CDCI3) 8: 0.71 (d, I = 6.0 Hz, 3H, CH3-C(41)),0.80-1.10 (m, 33H, CH3-C(32), 2CH3-C(44), ZCH3-C(35), 2CH3-C(45), 2CH3-C(49),2C1-I3-C(410)), 1.25 (d, I = 6.0 Hz, 3H, CH3-C(25)), 1.35 (d, I = 7.2 Hz, 3H, CH3-C(27)), 1.10-1.80, 1.90-2.20 (m, 25H, H-C(41), H-C(51), 2H-C(32), 2H-C(34), H-C(44), 2H-C(35), H-C(45), 2H-C(39), H-C(49), 2H-C(31°), H-C(41°), I-I-C(311), 4H-C(411), 4H-C(511), 1.62 (m, 3H, H—C(81)), 2.42 (m, 2H, H-C(51), H—C (35)), 2.68 (s,3H, CH3-N10), 2.70 (s, 3H, CH3-N11), 3.10 (s, 3H, CH3-N4), 3.11 (s, 3H, CH3-N9),3.26 (s, 3H, CH3—N6), 3.40 (s, 3H, CH3-N'3), 3.52 (s, 3H, CH3-N1), 3.20, 4.72 (d,] =13.9 Hz, 2H, 2H-C(23)), 3.80 (m, 1H, I-I—C(31)), 4.52 (m, 1H, H-C(27)), 4.65 (rn, 1H,H-C(25)), 4.82 (m, 1H, H-C(23)), 4.95-5.1 (m, 3H, H-C(22), H-C(25), H-C(21°)), 5.17?1015202530CA 02263951 1999-02-22W0 .98/03956 PCT/US97/15153.56.(d, J = 11.2 HZ, 1H, H-C(211)), 5.33 (m, 3H, H-C(61), H-C(71), H-C(24)), 5.47 (d, I =6 2 Hz, 1H, H-C(21)), 5.69 (dd, I = 4.3, 10.9 Hz, 1H, H-C(29)), 7.18 (CI, ] = 7.9 HZ,1H, H-N8), 7.46 (cl, ] = 8.5 HZ, 1H, H-N5), 7.69 (d, I = 7.5 Hz, 1H, H-N7), 7.99 (d,]= 9.8 HZ, 1H, H-N2); LRMS (FAB+) calc‘d for C64H113N11O12: 1227, found 1228(M+H).Example 3: Interaction of a Modi?ed Cvclosporin A with a Modi?ed CvclonhilinInduces Gene Activation Selectively in Cells Expressing the Modi?ed CvclonhilinThis Example shows that the modi?ed cyclosporin A, CpSarll-CsA, interactsspeci?cally with a modi?ed cyclophilin, CypAgtm, to induce cyclophilin-dependent geneactivation.A modified cyclophilin having the capability to interact with CpSar1l-CsA wasdesigned based on the crystal structure of cyclophilin, CypA, and CsA. The crystalstructure of the CypA-CsA complex shows that residue 11 of CsA directly contacts Cyp,binding in a deep hydrophobic pocket in the active site of cyclophilin. (See Pflugl, G., etal, Nature 361291-4 (1993) and Ke, H., et al, Structure 2:33-44 (1994).) It was reasonedthat the addition o? atoms at atoms at that site should signi?cantly reduce the binding ofCpSarl 1-CsA to CypA, presumably through steric interaction between the side chain ofCpSarll and CypA. To select possible receptors capable of binding CpSarll—CsA,computer models of complexes were generated between CpSar11-CsA and several CypAmutants. Based on these models, three mutations were selected in residues lining thebinding pockets of CypA: one to remove the offending steric interaction (phenylalanine atamino acid position thirteen to glycine (F113G)), and two others (serine at amino acidposition 99 to threonine (S99T) and cysteine at amino acid position 115 to methionine(Cl 1 5M)) that improved the ?t between the new receptor and ligand.To determine CpSarll—CsA's-binding characteristics, both the unmodi?ed CypAand the modified CypA (S99T, Fll3G, CIISM) (CypAgtm) was overexpressed in E. coliand purified according to standard techniques. The binding constants for CpSarl l-CSAfor each receptor was determined with a direct ?uorescence binding assay according to the?1015202530WO 98/08956CA 02263951 1999-02-22PCT/US97/15153_ 57 _procedure described in Belshaw, P.J., Schoepher, J.G., Lui, K-Q., Morrison, K.L. &Schreiber, S.L., Angew Chem. Int. Ed. Engl. 34:2129-32 (1995).As shown in Table 1, CpSar1l-CsA has little affinity for wild type CypA, yetbinds CypAgtm with high af?nity. Kds were determined using a direct ?uorescencebiding assay as previously described in Belshaw et al., supra.Table ICyclophilin binding constants and NFAT—signaling inhibition for CpSar11-CsABinding Constant IC50 in CellularKd NFAT-SignallingAssayCypA wild type + NFAT-SEAP >5 M >400 nMCypAgtm + NFAT-SEAP 9 nM 25 nMSince it is the composite surface of Cyp-CsA that binds to and thereby inhibits thephosphatase activity of Cn and as the modifications to both the receptor and ligand wereexpected to be buried in the complex, it was expected that these new receptor-ligandcombinations would have the ability to inhibit calcineurin (Cn) and thus NFAT mediatedgene activation. This hypothesis was confirmed by using a cellular assay in which NFAT-signaling was measured on a reporter gene, as described below.CypA and mutants were sub-cloned from pGEX based expression vectors intopBJ5, a eukaryotic expression vector containing an N-terminal FLAG epitope tag. Thesignaling assay was performed as previously described in Belshaw, P.J., Spencer, D.M.,Crabtree, G.R. & Schreiber, S.L., Chemistry & Biology, submitted (1996). Brie?y 107?10152025“W0 98/08956CA 02263951 1999-02-22PCT/US97/15153Jurkat cells were electroporated with NFA5ll-SEAP reporter plasmid (l g) alone or incombination with a Cyp expression vector (5 g). After 20 hours, cells were stimulated in96 well plates with phorbol ester (PMA)(50 ng/mL) and ionomycin (l M) , which mimicsT cell activation and receptor signaling. Varying concentrations of CpSarl1-CsA or ofCsA were added to the cultures. Twenty-four hours later, cells were assayed for SEAPactivity. The data for each transfection are presented as percent SEAP activity relative tothe signal for [CpSar11—CsA]=O. Stimulation of these cells with phorbol ester (PMA) andionomycin, which mimics the T cell receptor signaling, resulted in activation of NFAT viaCn.The results of this assay, shown in Figure 1, indicate that CpSar1l-CsA had littleor no effect on reporter gene expression at concentrations up to 400 nM in cells expressingeither endogenous cyclophilins alone or coexpressing a wild type cyclophilin. Yet, in cellsexpressing CypAgtm, CpSarl l-CsA potently inhibited NFAT signaling as shown inFigure 1 and in Table 1, above. However, results were obtained with the followingmodi?ed receptor—ligand pairs: a modified cyclophilin A, CypA (S99T, F113A), referredto herein as CypAat and the modified cyclosporin A, Mellel l—CsA. In fact, in this NFAT-signaling assay, it was found that although Mellel l-CsA potently inhibited NFATsignaling in cells expressing CypAat, Mellel l-CsA still inhibited NFAT signaling in cellstransfected with the NFAT reporter gene alone (data not shown). Presumably this was dueto formation of endogenous Cyp-Mellel l-CsA complexes that inhibited Cn. In this assayCSA has an IC50 of l5nM in cells transfected with NFAT-SEAP alone.As can be seen from these results, the transfected cells were made conditionallysensitive to a drug, dependent on the expression of a dominant allele of its receptorprotein.Example 3: Other Exemplagy Modi?ed Cyclophilins and FK506 Molecules whichMediate Gene Activation by Selective Interaction with Modified Receptors?10152025CA 02263951 1999-02-22‘WO 98/08956 PCT /U S97/ 15153-59-This Example describes additional modi?ed cyclosporin and FK506 moleculeswhich selectively interact with a modi?ed cyclophilin and are capable of inducing NF-ATmediated gene transcription.Altered cyclosporin molecules unable to bind to cyclophilins by virtue of a methylgroup at the 11 position of the peptide ring or in another chemical strategy, a cyclopentylCsA, were prepared. These molecules, generically referred to as CsAt' after the fact thatthey are unable to combine with the wild-type cyclophilin to block the activity ofcalcineurin, are non-toxic and not immunosuppressive in normal cells or whole animals.An engineered cyclophilin molecule binding speci?cally to these modi?ed cyclosporinand FK506 molecules was prepared. This modi?ed cyclophilin contained mutations ofFl13G and S99T, which create a "hole" to accommodate the methyl or pentyl group ofCsA'‘‘ , thus permitting binding to the altered cyclosporins. We call the alteredcyclophilins Cpht‘ since they combine only with the non-toxic cyclosporin. A schematicof the binding of the CsAl?‘/Cphl' and the CsA/Cph complexes to the active site ofcalcineurin is shown in Figure 2.In parallel studies altered FK506 molecules were made that have electrophilicadditions "bumps" at the C9 position of FKSO6 generating 9—S—methoxy-FKSO6 (FK506t‘)that does not bind to endogenous FKBP, but does bind to FKBP12F36V (FKBPt').The affinity of the interaction between cyclosporin and the mutant cyclophilin wasmeasured by binding of labeled protein. These were found to be about 7 nM with nodetectable binding to the wildtype Cph. The half time of association and dissociation weresimilar for the bumped combinations and the wild type combinations. These experimentsindicate that the bumbed CsA should only be immunosuppressive in cells expressing thecompensatory mutant Cpht'. In parallel studies the binding of the 9—S-methoxy-FKSO6 toFKBP12 F36V was found to be 5 nM by Scatchard analysis of the binding of radiolabeledprotein to pure FKBP". On the other hand, FK506 binds to FKBP with a Kd of 0.3 nM inthe same assay indicating that some loss of af?nity is related to the "bump-hole"combination, which could be optimized by introducing speci?c mutations and selecting forFKBP molecules having a higher affinity for the bumped FK506.?10CA 02263951 1999-02-227 WO 98/08956 PCTfUS97/ 15153_ 60 _As illustrated in Figure 3, the bumped cyclosporin does not effect signaling by theantigen receptor. This was shown by incubaing human peripheral mononuclear cells fromblood donors with anti CD3 and CD28 in the presence of CSA and CsAt- from 0 to 1000nM. At 48 hours cells were assayed for DNA synthesis by 3[H] thymidine incorporation.To determine if the Cpht‘ would confer selective sensitivity to CsAt- to cellsexpressing it, Jurkat cells were transfected with the cyclophilin containing thecompensatory mutation and tested for NF—AT-dependent transcription. As shown inFigure 4, CSAt‘ produced a complete blockage of signaling in cells transfected with Cpht‘but not Cph. Similarly, the bumped FKSO6 (9-methoxy FK506)has no effect on signalingunless cells are transfected with a FKBP containing the compensatory mutation that allowsbinding of the bumped F K506.Example 4: Transgenic Mice Sensitive to the Immunosunnressive and TolerogenicEffects of Cvclosporin A and/or FK506, but Resistant to its Toxic Effects?1015202530CA 02263951 1999-02-22’WO 98/08956 PCT/US97/15153-51-One prediction of the theory that calcineurin is the sole target of the immunosuppressive aswell as the toxic side effects of both the cyclosporin A/CpH and FK506/FKBP complexesis that if the formation of these complexes could be directed solely to lymphoid tissue theywould be non-toxic for other organs. To do this transgenic mice that express Cpht‘ only inT cells and B cells. For expression in T cells, the gene encoding the modified cyclophilincan be operably linked to the CD4 promoter/enhancer. This will result in expression in allT cells from the double positive stage in the thymus to mature peripheral lymphocytes.For expression in B cells, the gene encoding the cyclophilin molecule can be operablylinked to the immunoglobulin Eu promoter/enhancer. Both of these promoters have beenused frequently in the art to obtain T or B cell speci?c expression, respectively. Thetransgenic mice can be prepared according to methods known in the art.To test the animals for sensitivity to CsAt', peripheral leukocytes can be isolatedfrom these animals and the ability of the transgenic lymphocytes to proliferate in responseto irradiated murine fibroblasts from a strain of mouse having an MHC background thatgives maximum stimulation with the FYB strain can be tested.If, as predicted, lymphocyte proliferation is completely inhibited by CsAt-, it canbe determined if CSA" can suppress rejection of tissue grafts. This can be done, e.g., bycomparing the ability of CSA and CsAt' to block the immune responses to transplantedskin graphs. Groups of 20 mice can be treated with doses of each drug ranging from thoserequired to inhibit 25 to 99% of calcineurin activity assayed by NF-AT dephosphorylationassay using extracts from peripheral blood lymphocytes. This is probably be in the rangeof 1 mg/kg/day to 10 mg/kg/day. No other immunosuppressive agent should be given andgraft rejection can be tested at intervals after initiation of treatment and grafting. Toxicside effects can be assessed by observation for the CNS toxicity which is manifested asataxia and excessive activity. Renal toxic effects can be assessed by determining theconcentration of BUN and creatinine. It is expected that this will show graft survival withfewer toxic side effects.To test for the ability of CsAt‘ to prevent the development of self tolerance one cantreat the pregnant Cph" mice with doses of CsAt‘ that lead to complete suppression ofgraft rejection and determine if the newborn animals have undergone positive selection asjudged by the development of single positive thymocytes and normal numbers ofperipheral lymphocytes. Negative selection will be tested by several criteria. The most?1015202530CA 02263951 1999-02-227 WO 98/08956 PCT/US97I15153- 52 -stringent is the development of autoimmune phenomena after withdrawal of CsAl‘. If, aspredicted, complete suppression of negative selection occurs, it is expected that theanimals respond to their own tissue when the signaling pathway is restored by theterminating treatment with the drug. This will be accessed by examination of tissues suchas the kidney, pancreas and others for in?ammatory in?ltrates, by the development ofclones of autoreactive T cells judged by the failure of super antigen reactive cells to bedeleted, and by the development of auto antibodies to classic self antigens such as DNA,and ribonuclear proteins.To show that CsAt' can suppress graft rejection, skin grafts from non-compatiblemice can be implanted into Cpht‘ transgenic mice, which can then be treated with CsAt'and rejection of the graft will be assessed using well de?ned criteria. As previously shownfor cyclosporin A, it is expected that CsAt' will suppress rejection. To determine if longterm total blockage of the antigen receptor signaling pathway will lead to tolerance to thetransplanted tissue the animals can be treated for various lengths of time aftertransplantation with CsAt'. It will then be tested if withdrawal of CsAt' will allowcontinued suppression of graft rejection implying that the animals were made tolerant tothe transplanted tissue.To show that CsAt‘ can prevent graft-vs-host disease, bone marrow can be takenfrom Cpht' mice and transferred to irradiated MHC-mismatched mice and the miceobserved for the development of graft-vs—host disease. Animals can be treated with CsAt‘for 1, 2, 4, or 8 weeks after transplantation with the dose necessary to inhibit: a) 50% or b)99% of calcineurin activity in lymphocytes. In other experiment, puri?ed stem cells fromthe Cphl' mice can be used to do the transplantation.The transgenic Cph“ mice can also be used to confirm that complete blockage ofthe calcineurin/NF-AT pathway will prevent the development of autoimmune diabetes inNOD mice.Cph“ transgenic mice can be made either directly in NOD mice or in the FYBstrain to facilitate breeding to the NOD mice as described above. Transgenic mice can becrossed with the NOD mice and followed for the expression of Cphl’ at levelsapproximating those of the endogenous Cph A gene. Once backcrossing is complete, theanimals will be tested for the development of diabetes.?101520CA 02263951 1999-02-227 WO 98/08956 PCT/U S97/ 15153- 63 -To test the effects of CsAt' on the development of diabetes in the NOD mice, thesecan be administered CsAl' at specific times during fetal life (p.c. day 14 to 21), after birth,0- 3 weeks, 4-8 weeks, 4-12 weeks, and 4- 16 weeks. It is expected, based at least in parton previous results obtained, that CsAt' will suppress the development of autoimmunediabetes. Animals will be monitored for the symptoms of diabetes as known in the art andincluding: 1) determining the presence of auto antibodies to GAD, HSP70, CPH; 2) T cellactivation and 3) islet in?ammation and lymphoid in?ltration.The transgenic mice can also be used to show that long term suppression of thecalcineurin/NF-AT pathway with CsAt' can lead to tolerance and the prevention ofdiabetes in the absence of continued CsAt‘ treatment. The ability of CsAt' to induce longterm tolerance and prevention of in?ammation in the islets of the NOD mice can be testedby withdrawing CsAl‘ at various times after the initiation of treatment The times until thedevelopment of symptoms will the be measured as defined above. In addition animals canbe monitored for the development of auto antibodies to GAD, CPH, and HSP70. If theanimals do not develop auto antibodies and do not develop disease after ceasingimmunosuppression with CsAt', this will be indicative that the suppression of the Ca2+/calcineurin pathway can lead to the development of tolerance and address the question ofthe underlying mechanism.Although the foregoing invention has been described in some detail by way ofillustration and example for purposes of clarity of understanding, it will be obvious to oneskilled in the art that certain changes and modifications may be practiced within the scopeof the appended claims.?10152025303540455055606570CA 02263951 1999-02-22'WO 98/08956_ 64 -(2) INFORMATION FOR SEQ ID N021:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 348 base pairs(8) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: CDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 14..325(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:GGAATTCCTA ATA ATG TCC GTA CAA GTA GAA ACC ATC TCC CCA GGA GACMet Ser Val Gln Val Glu Thr Ile Ser Pro Gly Asp1 5 10GGG CGC ACC TTC CCC AAG CGC GGC CAG ACC TGC GTG GTG CAC TAC ACCGly Arg Thr Phe Pro Lys Arg Gly Gln Thr Cys Val Val His Tyr Thr15 20 25GGG ATG CTT GAA GAT GGA AAG AAA TTT GAT TCC TCC CGT GAC CGT AACGly Met Leu Glu Asp Gly Lys Lys Phe Asp Ser Ser Arg Asp Arg Asn30 35 40AAG CCC TTT AAG TTT ATG CTA GGC AAG CAG GAG GTG ATC CGA GGC TGGLys Pro Phe Lys Phe Met Leu Gly Lys Gln Glu Val Ile Arg Gly Trp45 50 55 60GAA GAA GGG GTT GCC CAG ATG AGT GTG GGT CAG CGT GCC AAA CTG ACTGlu Glu Gly Val Ala Gln Met Ser Val Gly Gln Arg Ala Lys Leu Thr65 70 75ATA TCT CCA GAT TAT GCC TAT GGT GCC ACT GGG CAC CCA GGC ATC ATCIle Ser Pro Asp Tyr Ala Tyr Gly Ala Thr Gly His Pro Gly Ile Ile80 B5 90CCA CCA CAT GCC ACT CTC GTC TTC GAT GTG GAG CTT CTAAAACTGGPro Pro His Ala Thr Leu Val Phe Asp Val Glu Leu95 100AATGACGGGA TCC(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7943 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: linear(ii) MOLECULE TYPE: CDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 80..7726(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:ACGGGGCCTG AAGCGGCGGT ACCGGTGCTG GCGGCGGCAG CTGAGGCCTT GGCCGAAGCCPCT/US97/15153499714519324128933534860?10152025303540455055606570' W0 98l08956GCGCGAACCT CAGGGCAAG ATG CTT GGA ACC GGA CCT GCC GCC GCC ACC ACCMet Leu Gly Thr Gly Pro Ala Ala Ala Thr ThrGCTAlaGGCGlyCTCLeuTCTSer60TCCSerAGCSerGCCAlaGAAGluTTTPhe140CTGLeuCTCLeuCAAGlnGCCAlaACAThr220CACHisGAGGluCTTLeuGCCAlaCTALeuCAGGln45ACTThrAGCSerCTCLeuAACAsnATGMet125ACCThrGGTGlyCGTArgCCCProATCIle205ACCThrACAThrAAGLysAACAsnACCThrAAGLys30CACHisCGCArgTCASerATAIleTATTyr110GCAAlaGCTAlaGCTAlaGAGGluTTCPhe190CGTArgCAGGlnTTTPheGGCGlyGAGGlu270ACAThr15AGCSerTATTyrTTCPheGATAspGGAGly95CTTLeuTCCSerGAGGluGACAspCTGLeu175TTTPheGAGGluCGTArgGAAGluATGMet255CTGLeuTCTSerCGGArgGTCValTATTyrGCCAla80GTGValCGGArgAAGLysTACTyrCGCArg160GCCAlaGACAspGGAGlyGAGGluGAAGlu240AATAsnGTCValAGCSerAATAsnACCThrGACAsp65AATAsnGAAGluAACAsnGCCAlaGTGVal145AATAsnATCIleAACAsnGCTAlaCCGPro225GCAAlaCGGArgCGAArgAATAsnGAGGluATGMet50CAAGlnGAGGluGGTGlyCTCLeuATTIle130GAAGluGAGGluAGCSerATTIleGTAVal210AAGLysGAGGluGATAspATCIleCAGTGValGAAGlu35GAAGluCTGLeuAGGArgGGGGlyCTCLeu115GGCGlyTTTPheGGCGlyGTCValTTTPhe195GCCAlaGAGGluAAGLysGATAspAGCSer27502263951 1999-02-22AGCSer20ACCThrCTCLeuAACAsnLysAATAsn100CCCProCGTArgGAGGluCGGArgCCTPro180GTGValGCCAlaATGMetGGAGlyCGGArg260AGCSer-65-GTCValAGGArgCGAArgCATHisGGTGly85GCCAlaTCCSerCTTLeuGTGValAGAArg165ACCThrGCCAlaCTTLeuCAGGlnTTTPhe245ATCIleATGMetCTGLeuGCCAlaGAGGluCACHis70GGCGlyACCThrAATAsnGCCAlaAAGLys150CATHisTTCPheGTGValCGTArgAAGLys230GATAspCATHisGAGGluCAGGlnLysATGMetATTIleATCIleCGAArgGACAspATGMet135CGAArgGCAAlaTTCPheTGGTrpGCCAla215CCTPIOGAGGluGGAGlyGGAGlyCAGGlnGCCAla40AGTSerTTTPheTTGLeuATTIleCCAPro120GCAAlaGCCAlaGCTAlaTTCPheGACAsp200TGTCysCAGGlnACCThrGCCAlaGAGGlu280TTTPhe25GCCAlaCAAGlnGAAGluGCCAlaGGCGly105GTTValGGGGlyCTGLeuGTCValCAGGln185CCCProCTGLeuTGGTrpTTGLeuTTGLeu265CGTArg10GCCAlaAAGLysGAGGluTTGLeuATAIle90AGAArgGTCValGACAspGAAGluCTGLeu170CAAGlnLysATTIleTACTyrGCCAla250TTGLeuCTGLeuAGTSerGAGGluGAGGluGTTVal75GCTAlaTTTPheATGMetACTThrTGGTrp155GTTValGTGValCAGGlnCTCLeuAGGArg235LysATCIleAGAArgPCT/US97/15153ll2160208256304352400448496544592640688736784832880928?10152025303540455055606570’WO 98108956GAAGluTGCCys300TTCPheGGGGlyTCCSerGACAspTGCCys380TTGLeuTATTyrAAGLysGTGValCGAArg460ATGMetGCAAlaATGMetCTGLeuCTGLeu540GGCGlyGAAGlu285LysACCThrCTGLeuCCCProTTGLeu365AGGArgCCCProCTCLeuGAAGluAGGArg445GCGAlaCAGGlnATGMetCTGLeuAGCSer525LysATGMetATGMetGATAspAGTSerCTGLeuAGTSer350ATGMetAATAsnCGCArgCAAGlnCGTArg430TCTSerGCCAlaGTGValGGGGlyGCAAla510CGTArgATGMetCCCProGAAGluCTCLeuTTCPheGGGGly335CCAProGAGGluAGCSerTTGLeuGATAsp415ACAThrGAGGluCTGLeuGACAspCCAPro495GTGValCAGGlnCTGLeuAAGLysGAAGluATGMetCAGGln320TACTyrGCTAlaGAGGluAAGLysGCTAla400ACCThrGCGAlaTTTPheCCCProGCCAla480GGCGlyGGAGlyATTIleTCCSerGGCGlyATCIleGGCGly305GCTAlaAGCSerAAGLysLysAACAsn385GCAAlaATGMetGCCAlaAAGLysCCAPro465ACAThrATCIleCTALeuCCAProCTGLeu545CTGLeuACAThr290TTCPheGTAValTCTSerTCCSerTTTPhe370TCGSerTTCPheAACAsnTTCPheGTCVal450AAGLysGTCValCAGGlnAGCSerCAGGln530GTCValGCCAlaCACAGGlnGGAGlyCAGGlnCACHisACCThr355GATAspCTGLeuCGAArgCATHisCAAGln435TATTyrGACAspTTCPheCAGGlnCCTPro515CTALeuCTTLeuCATHis02263951 1999-02-22CAGGlnACAThrCCCProCAAGln340CTGLeuCAGGlnATCIleCCTProGTCVal420GCCAlaTTGLeuTTCPheACTThrGATAsp500GCCAlaAAGLysATGMetCAGGln-56-CAGGlnAAALysCAGGln325GGCGlyGTGValGTGValCAAGlnTCTSer405CTALeuCTGLeuCCTProGCCAlaTGCCys485ATCIleCTCLeuAAGLysCACHisCTGLeuCTGLeuCCTPro310CAGGlnCTCLeuGAGGluTGCCysATGMet390GCCAlaAGCSerGGGGlyCGCArgCATHis470ATCIleAAGLysACTThrGACAspAAALys550GCCAlaGTAVal295CGTArgTCASerATGMetAGCSerCAGGln375ACAThrTTCPheTGTCysCTALeuGTGVal455AAGLysAGCSerGAGGluGCAAlaATTIle535CCCProTCTSerCACHisCACHisAATAsnGGAGlyCGGArg360TGGTrpATCIleACAThrGTCValCTTLeu440CTGLeuAGGArgATGMetCTGLeuGTGVal520CAAGlnCTTLeuCCTProGACAspATTIleGCCAlaTTTPhe345TGTCysGTGValCTTLeuGATAspAAGLys425TCTSerGACAspCAGGlnCTGLeuCTGLeu505CTCLeuGATAspCGCArgGGCGlyAAGLysACCThrTTGLeu330GGGGlyTGCCysCTGLeuAATAsnACCThr410AAGLysGTGValATCIleAAGLysGCTAla490GAGGluTACTyrGGGGlyCACHisCTCLeuTACTyrCCCPro315GTGValACCThrAGAArgLysTTGLeu395CAGGlnGAGGluGCTAlaATCIleGCAAla475CGAArgCCCProGACAspCTALeuCCAPro555ACGThrPCT/US97/1515397610241072112011681216126413121360140814561504155216001648169617441792?10152025303540455055606570‘W0 98/08956ACCThrACGThrCGCArgATGMet620CTCLeuGTGValGACAspGATAspCTGLeu700GGCGlyAAGLysAGAArgGCCAlaATTIle780AATAsnGAAGluCTCLeuCTGCTCLeuCTTLeuCACHis605GAGGluATCIleGCAAlaCCTProGCAAla685AATAsnCGAArgATGMetATCIleCCCPro765TTGLeuAATAsnATGMetCAGGlnGGACCTProGGCGly590TGTCysGCTAlaAGTSerGATAspGACAsp670CACHisGACAspCTCLeuCTCLeuLys750CGAArgLysGTCValAGGArgGATAsp830CAGGAGGlu575AGCSerGCGAlaGCCAlaGGCGlyGTGVal655ATTIleCTGLeuCAGGlnAGTSerATCIle735GAGGluCTCLeuCTGLeuCTGLeuLys815TCCSerTTG560GCCAlaTTTPheGATAspCGCArgCATHis640CTTLeuCGCArgGCCAlaGTGValAGCSer720CAGGlnCAGGlnATCIleLysGCAAla800TGGTrpTCTSerGTGAGCSerGAAGluCATHisACCThr625GCTAlaAGCSerTACTyrCAGGlnTTTPhe705ATGMetATTIleAGTSerCGCArgGATAsp785ACAThrGTTValTTGLeuGCCGATAspTTTPheTTCPhe610TGCCysCATHisLysTGTCysGCGAla690GAGGluAACAsnTTGLeuGCCAlaCCCPro770CCAProATAIleGATAspTTGLeuAGCCAGTGValGAAGlu595CTGLeuTCCSerGTGValCTGLeuGTCVal675GAGGluATCIleCCTProACAThrCGCArg755TACTyrGACAspGGAGlyGAAGluGCCAla835ACT02263951 1999-02-22GGCGly580GGCGlyAACAsnCGCArgGTTValCTCLeu660TTGLeuAACAsnCGGArgGCCAlaGAGGlu740ATGMetATGMetCCTProGAAGluCTTLeu820LysGGC-57-565AGCSerCACHisAGTSerCTGLeuAGCSer645GTAValGCGAlaTTGLeuGAGGluTTTPhe725TTGLeuCTGLeuGAGGluGATAspTTGLeu805TTTPheAGGArgTATATCIleTCTSerGAGGluCTCLeu630CAGGlnGTTValTCCSerCAGGlnCTGLeu710GTCValGAGGluGGGGlyCCTProCCAPro790GCAAlaATTIleCAGGlnGTAACTThrCTGLeuCACHis615ACAThrACCThrGGGGlyCTGLeuGCCAla695GCCAlaATGMetCACHisCACHisATTIle775AACAsnCAGGlnATCIleGTGValGTACTTLeuACCThr600AAGLysCCCProGCAAlaATAIleGACAsp680TTGLeuATCIleCCTProAGTSerCTGLeu760CTGLeuCCAProGTTValATCIleGCTAla840GAGGCCAla585CAAGlnGAGGluTCCSerGTGValACAThr665GAGGluTTTPheTGCCysTTCPheGGGGly745GTCValAAGLysGGTGlyAGTSerATGMet825CTGLeuCCC570CTCLeuTTTPheATCIleATCIleCAAGln650GATAspCGCArgGTGValACTThrCTGLeu730ATTIleTCCSerGCAAlaGTGValGGCGly810GACAspTGGTrpTACCGAArgGTTValCGCArgCACHis635GTGValCCTProTTTPheGCTAlaGTGVal715CGCArgGGAGlyAATAsnTTALeuATCIle795CTGLeuATGMetACCThrAGGPCT/US97/151531840188819361984203220802128217622242272.23202368241624642512256026082656?10152025303540455055606570‘WO 98/08956LeuAAGLys860CAGGlnGGGGlyCAGGlnCAGGlnAACAsn940ATGMetGTCValCAGGlnTGTCysGTGVal1020ACCThrATCIleAAGLysCATHisATC CAG CTGIle Gln LeuGly845TACTyrAACAsnGCTAlaTCCSerGATAsp925TTGLeuCGGArgCAGGlnTTCPheGATAsp1005TCCSerCTCLeuATTIleCTCLeuGACAspGln LeuCCTProACTThrCAGGlnGGTGlyTTGLeuGATAsp895CGGArg910GATAspTCCSerTCTSerCCTProCTGLeuATCIleTTCPheGCCAlaATCIle975CTGLeu990CCCProGGGGlyGCCAlaTTTPheGTGValATGMetAGAArgCTTLeuCTCLeuValTTGLeuACAThr880CCTProGCCAlaGACAspGATAspCGAArg960ACCThrCAGGlnATCIleAAGLysGAAGluAlaCTTLeu865CGCArgTACTyrTCTSerTATTyrGAGGlu945GACAspTTCPheGTCValCGGArgAGC CAC ATCSerSer850GAGGluAGAArgAAGLysGCTAlaAGCSer930TTCPheCAGGlnATCIleATGMetGAAGluCAThr GlyGTGValCTALeuGCCAlaGAGGluCACHis Lys900GTCVal915AGCSerAGTSerACTThrTACTyrCCAProTCASerCTCLeuAAGLys980TTCPheACGThrCCCPro995TTGLeuTTTPhe1010His1025TTCPhe1040ATTIle1055TAC CTGTyr Leu1070AACAsnAGCSer10851100CCT CCT ATTPro Pro IleTTTPheGTTValCCCProCCAProGGCGlyGAGGluCAGGlnGGCGlyGCCAlaTGGTrpCAAGlnCTGLeuCGCArgAGAIle ArgATGMetGTCValGTGValATTIle-63-TyrCTGLeuATCIle885GTGValCTGLeuGAAGluGCTAlaTCTSer965TCCSerTTCPheTTCPheCCTProAACAsn1045GTAVal1060ATC CCAIle Pro1075GTCValATTIle1090AACAsn1105AAG TTG TTTLys Leu Phe1120GATAspCTGLeuGCCAlaGATAspCACHisTCTSerGACAspCCTValAATAsn870CGTArgAACAsnTCASerATGMetGTGVal950CATHisCTGLeuCTTLeuCAGGlnTATTyr1030ACCThrGCTAlaATGMetATCIleTACTyr02263951 1999-02-22Val855Glu ProTTTPheCTGLeuAAGLysGTGValTTALeuGGGGlyATTIleGGCGlyATGMet905GAAGluTCCSer920AAGLysCTGLeu935GTCValAACAsnTCCSerATGMetGTGValCATHisCACHisACCThrGGAGlyCTCLeu Lys985GTCVal1000AATAsnATTIleCAGGln1015CTGLeuGGAGlyATGMetGATAspGAAGluTCASerATTIleCAGGlnGGGGlyGGTGlyCTTLeu1065CGTArg1080CTGLeuGTCValAAG TTALys Leu1095CTGLeuCTG CATLeu HisTTALeu1110GAA GCT CCAPro Glu Ala Pro1125CTGLeuTyrACTThrCTTLeu890ATAIleTCASerATGMetGCCAlaATGMet970TGTCysCGAArgATGMetATAIleAGCSer1050GAAGluTTCPheGCTAlaCTGLeuCCAProArgGAGGlu875TTALeuGACAspAGTSerGGAGlyCTGLeu955GTTValGTGValGTCValTTGLeuGTCVal1035ACGThrTTTPheATGMetGCAAlaCTGLeu1115TCTSer1130PCT/US97/1515327042752280028482896294429923040308831363184323232803328337634243472?101520253035404550556065707W0 98/0895CGAArgAAGLysGCAAlaTTCPheACTThrGACAsp1150GACAspCAG AGCGln Ser1165CTT GTTLeu Val1180TTTPhe6GCG CTAAla Leu1135TATTyrGCCAlaCCAProGAAGluCAGGlnCTGLeuAATAsnCTCLeuGATAspAAALysATCIleCCTProGTTValTGCCysTTGLeuCTGLeuAGAArg1215ATTIleGTGVal1200ATTIleTACTyr1230GCAAlaTTGLeuGCTAlaAGTSerGGAGlyGTCVal1260TCCSerCTGLeuCAGGlnTCCSer1245AGCSerAAALysAAGLysGCCAlaTGCACCThrGATAspGACAspTACTyr1310TGGATCIleGACAspTCASer1295AACAsnTCTCys Trp Ser1325AGC ATC GAGSer Ile Glu1340ACCThrCTGLeuGCCAlaTTCPheCTCLeuCCAProAAGLysTTALeuCTGLeuTTGLeuAACAsnAGAAACAsnTGGTrp1280TCASerCCGProGAAGluGCCAlaTTGLeu1360GATGAGGluTCCSerCTGLeuGGGGly1185CGAArgGTCValCAGGlnCCAProCTCLeu1265CTGLeuTCGSerATGMetCTGLeuACTThrCGGArgCGCArg1170AAGLysCACHisAAGLysCATHisGTGVal1250CAAGlnGAAGluCCCProGCCAlaAATAsn Glu Asp1330CAGTGValATCIle1155TCCSerAAGLysCGAArgGGAGlyCGGArg1235GAAGluAAGLysTGGTrpTCCSerAGGArg1315GAACTC ACC TCALeu Thr Ser1345GCTAlaGACArg Asp Asp1375TGC CGA GCA TATCys Arg Ala Tyr1390CAG AAA GGC CCC ACCGln Lys Gly Pro Thr1405GAAGluAATAsnGCCAlaTTCPheGGCGlyAAALys139502263951 1999-02-22-69-GAC CGC CTGAsp Arg Leu1140CACHisCCTProATTIleGCCAlaATGMetACAThrCAAGlnATTIle1190TACTyrATCIleAAT CATAsn His1205ACAThrCTTLeuTACTyr1220CTTLeuAGGArgATGMetGGAGlyCCCProACAThrTGGTrpGGCGly1270GCCAlaAGA CGGArg Arg1285CTGLeuTCCSerCTG CGCLeu Arg1300CTCLeuTTCPheGATAspCAAGlnCAGGlnGATGACAspCAAGln1350GAA CACGlu His1365ATGMetATT GTT CTGIle Val Leu1380GCA CTA CACAla Leu HisCCT GCC ATT CTA GAAPro Ala Ile Leu Glu1410ACGThrGAGGluTCCSerCTGLeu1145ATTIleGTTVal1160ArgGAC ACG CTGAsp Thr Leu1175TTCPheATTIleCCAProCGA ACAThrTCTSerATGMetGATAspCTGLeuTCASerGTGVal1195CAGGlnGCTAlaAGTSerCGCArgGATAspTATTyrGAT GTGAsp Val1210GAA GAG GAGGlu Glu Glu1225GGC CAA GGGGly Gln Gly1240ATG AAG AAAMet Lys LysCTGLeuGATAspCACHis1255GCTAlaCTGLeuTGCCysAATAsnGATAsp Glu Leu1335AGTSerCTGLeuTACTyrGCCAlaAGCSerTGGTrpGCTAla1320GAGATC GCT GAAIle Ala GluGACAspGGTGlyAAALys1400AGGArgAGGArgGTCVal1275CTGLeuGAG CTGGlu Leu1290GCC CTG GCAAla Leu Ala1305GCA TTTAla PheGTGValCTC ATCIleAGAArgGTCValACAThrCAGGln1355AAGLysGGC CCCGly Pro1370GAG AGA GCTGlu Arg Ala1385GAA CTG GAGGlu Leu GluTCT CTC ATC AGC ATTSer Leu Ile Ser Ile1415PCTIUS97/15153352035683616366437123760380838563904395240004048409641444192424042884336?101520253040455055606570' W0 98I08956AAT AATAsn Asn1420AAGLysGCC ATGAla MetAAALysCTGLeuCACLys HisAACAsnGACAspACCThr1470CTCLeuGAG GCCGlu Ala1485AAG TGGLys Trp1500ACCThrGCTAlaGCTAlaGCAAlaTACTyrACCThrTGTCysGCTAlaGTGValCTGLeu1550ATTIleGAC AAGAsp Lys1565GGAGly1580GAGGluAGTSerCTGLeuGAGGluTCCSerCGAArgGAGGluATCIleCGT ATCIleGTACTALeuCAGGlnCACHisTTTPheCACAG CCGGln Pro1425GAGGluGGAGlyCTGLeuGAGGlu1440GAG TGGGlu Trp1455AAGLysGACAspTTGLeuGGGGlyCTGLeuGTTValGCTAlaGCAAla1520ATG ATCMet Ile1535GCAAlaCTGLeuGCCAlaAGGArgTACTyrAGTSerCTGLeuGAGGlu1600ATCIle1615CGCArgGAG GACGAGGluGATAspGCCAlaGACAspCCAProGAGGlu1475GAAGluTGG GGTTrp Gly1490AAT GATAsn Asp1505GAGGluTGGTrpGGTGlyTTALeuCCTProCGGArgGACAspCATHisCAGGlnGACAsp1555GACAspCTGLeu1570CTGLeuCGG GCAArg Ala1585TATTyrGTTValATCIleGAGGluCAGGlnATCIleTGGTrpTGG CAG AAAArgGTCValVal Glu1630AGC CCT CATSer Pro HisAsp Trp GlnGAAGluGAC ATGAsp MetLys1635AGAArg1645TGC GGC AAGCys Gly Lys1660CTC CTG GGALeu Leu GlyGTT CAC CCTVal His ProAGTSerGGCGlyGTTValGATAsp1650AGG CTG GCTArg Leu Ala1665CCG TCT CGGPro Ser Arg1680CAGGlnGTGValACC TAT GCCThr Tyr Ala02263951 1999-02-22-70-GCA GCGAla AlaGAG ATCGlu IleGCC GGAAla Gly1430GTGValGCTAlaCAGGlnACCThr1445CTT GTGLeu Val1460ATGMetCTGLeuCAAGlnCTCLeuCAAGlnACCThrGGTGlyCAGGln1525ACCThr1540CATHisCTCLeuTTCPheGCTAlaGATAspGGGGlyGCCAlaCAGGlnTACTyr1605GAGGluTGGTrp1620CTTLeuATCIleTGGTrpACCThrCTTLeuGCTAlaCAAGlnCTTLeuGCCAlaTATTyrGACAspCTGLeuGGCGlyCGCArg1480CACHisCAG CAGGln Gln1495GCC AAGAla Lys1510ATGMetGACAspTGGTrpAGCSerGATAspGGGGlyGCAAlaTCCSerTTGLeuGCAAla1560TTALeu1575GAAGluACTThrATGMet1590GTTValTCTSerAAA CTTLys LeuGTCValCTGLeuAGAArgCAGGlnGTGValATGMetCGGTTALeuGAA TATGlu Tyr1435TGGTrpTAT GAGTyr Glu1450AAG AAA ATGLys Lys Met1465ATGMetCGCArgTGCCysTGCCysTGTCysGAAGluGCCAlaCGGArgATGMet1515ATGMetGAA GAAGlu Glu1530TTTPhe1545TAT AGATyr ArgCAAGlnCAGGlnTGCCysGCAAlaGCAAlaATGMetTGCCysATGMet1595CACHisCCCProGAG CGAGlu Arg1610GGC TGC CAGGly Cys Gln1625TCCSerGTGValCTTLeuCTCLeuArg1640AAG TAT GCALys Tyr AlaAGCSerCTGLeu1655CAT AAA ACTHis Lys Thr1670GAC CAT CCTAsp His Pro1685TACTyrATGMet AAA AAC ATGLys Asn MetTTALeuGTGValTTGLeu1675CTGLeuCCA ACAPro Thr1690AAG AGTLys SerTGGTrpPCT/U S97/ 15153438444324480452845764624467247204768481648644912496050085056510451525200?10152025303540455055606570TWO 98/08956GCCAlaATGMetAAGLys1740GAGGluGTGValLysTACTyrGCCAla1820GCCAlaGAGGluAAGLysGCCAlaCTCLeu1900TGGTrpATTIleACGThrATTIleTCT1695CGC AAG ATCArg Lys Ile1710CAG CAAGln Gln1725CAGGlnCAGGlnGAAGluCTGLeuTGGTrpCAGGlnCTGLeuCTGLeuCAGGlnTACTyr1775GCCAlaTGGTrp1790CATHisAAA CATLys His1805CAGGlnAGCSerGGGGlyGCCAlaACTThrGCCAlaACCThrGCCAlaGAGGluAGCSer1855GTCValACTThr1870GAGGluGTC CAGVal Gln1885GGCGlyCAG GATGln AspACAThrCCAProGATAspGTCValGATAspACCThrTGGTrp1935CCCProAGAArg1950CCCProGGT CGG TACGly Arg Tyr1965AAG TCT ACCGATAspGCCAlaCACHisAATAsn1760TACTyrGCGAlaAACAsnAACAsnACCThr1840ACCThrGATAspTTCPheCTCLeuAATAsn Glu Ala1920CTALeuTTGLeuCACHisACGGCCAlaCAGGlnAAGLys1745CTALeuAGCSerTGGTrpCAAGlnATCIle1825ACTThrGAGGluCTGLeuTTCPheAGAArg1905GAGCAGGlnGTGValCCCProACACA-71-1700TTCPheCAG CACGln His1715ATGMetCATHis1730GCC ATCAla IleGCTAlaCGAArgCTCLeuATGMetGCCAlaAATAsn1765CAGGlnATCIleGGCGlyGCCAlaGCCAlaACA GAGThr Glu1780AACAsnGCAAlaGTG ATGVal Met1795GCC CGCAla Arg1810GATAspGAGGluACCThrAACAsnGCCAlaACCThrGCCAlaAGCSerACCThr1845AACAsnAGCSerCCC ACCPro Thr1860TCCSerAAA ACC CTCLys Thr Leu1875TCCSerCGT TCC ATCArg Ser Ile1890GTT CTCVal LeuACCThrTTALeuGCC TTALeuGTGValGAGGlu1925GTTValATAIleCCT CAGPro Gln1940GGAGlyCGT CTC ATTArg Leu Ile1955CAG GCC CTC ATCGln Ala Leu Ile1970GCC CGG CAC AATCAGGlnACTThrTGCCys1750GAGGluCACHisTTCPheAAGLysACTThr1830GAG GGC AGCGlu Gly SerCCAProCTGLeuTTGLeuTGGTrp1910GGGGlyCTCLeuCACHisTACTyrGCA02263951 1999-02-221705CATHisTTT GTCPhe Val1720GAGGlu1735GACAspCAGGlnTTCPheCTGLeuAAALysAGCSerACAThrATCIleGACAspCGCArgAGCSer1785GAAGluGCT GTGAla Val1800AAG AAA CTGLys Lys Leu1815GCC GCCAla AlaACCThrAACAsnAGTSerTCGSerCCGProCTGLeu1865ATGMetTAC ACGTyr Thr1880TCA CGA GGCSer Arg Gly1895TTT GATPhe AspTATTyrGTGValAAALysGCCAlaATTIleGCAAlaAGAArg1945CAGGlnCTTLeu1960CTCLeuCCA CTG ACAPro Leu Thr1975GCC AAC AAGCAGGlnACCThrCAGGlnCATHisCTTLeuGGAGly1755CCC AAAPro Lys1770TGGTrpTACTyrCTALeuCACHisCGTArgCATHisACGThrGCCAla1835GAG AGCGlu Ser1850CAG AAGGln LysGTGValCCTProAACASHAACAsnGGTGlyCACHis1915ATC CAGIle Gln1930ATTIleGATAspACAThrGACAspGTGValGCTAlaATT CTGPCT/US97/15153524852965344539254405488553655845632568057285776582458725920596860166064?10152025303540455055606570’WO 98/08956Ser Lys1980AACLys AsnGTGValAGCSerCATHisGAAGluGTGValAAALys2045CGG GGCArg Gly2060CGAArgGATAspGGGGlyAATAsnTTCPheCGAArgCAAGlnTATTyr2125GTG CCAVal Pro2140ATA GCAIle AlaTTGLeuACAThrGGCGlyCATHisCTGLeuGTTVal2205CTC AGCLeu Ser2220CTC ATTLeu IleGAC TACAsp TyrSerATGMetTGTCysGAGGluGAGGlu2015GGC CTGGly Leu2030GGCGlyATGMetCCCProCAGGlnTTALeuATGMetGTCValAAGLys2095CGA ATCArg Ile2110GTTValTCCSerGGAGlyACAThrCCGProTCTSerCTTLeuATGMet2175GAAGlu2190GATAspAAC ACCAsn ThrATCIleCAGGlnGGCGlyTGGTrpAGGArgGAGGlu2255Thr Thr Thr AlaCAArg1985GAG CACGlu His2000CTGLeuATCIleGAAGluGAGGluTTTPheGAGGluACTThrCTGLeu2065GAG GCCGlu Ala2080GAC CTCAsp LeuTCASerAAGLysCCAProAAALysTATTyrGACAsp2145TTG CAALeu Gln2160GGCGlyAGCSerCTGLeuCGCArgCTTLeuCTGLeuAGAArgTACTyrAGCSerAACAsnCGAArgGTGValGCAAlaTCTSer02263951 1999-02-22HisACCThrGCCAla2020CGTArg2035GTG CTGVal Leu2050AAGLysGAAGluCAAGlnGAGGluACCThrCAAGlnCAGGlnCTGLeu2115CTTLeu2130CTGLeuCCCProAACAsnATCIleGTCValAACAsnGGAGlyCAGGlnGATAspGAGGluACAThrTGGTrpGCCAla2100CCTProATGMetCAGGlnACAThrCATHis2180GAGGlu2195GCC AATAla Asn2210GCTAlaGTCVal2225GTTVal2240CCCProAAG AAGLys LysCACHisTGTCysAAGLysATCIleGACAspATCIleGACAspCTTLeu2260_ 72 _Asn Ala Ala1990CTG GTCLeu Val2005CAGGlnCTCLeuATCIleTGGTrpTACTyrTTGLeuTTTPheCCCProTTGLeuCATHisAsn Lys Ile Leu1995CAG GCC ATG ATGGln Ala Met Met2010CAT GAG ATG TGGHis Glu Met Trp2025GGG GAA AGGGly2040GCTAla2055TTTPhe2070TCCSerAATAsnAGGArgTGCCys2085AAGLysTGG GACTrp AspCTCLeuCAGGlnCTCLeuACAThrTGCCysCGGArgGACAspCAGGlnTACTyrTATTyrTCCSer2120CTTLeu2135CCAProATCIle2150ATTIleTCCSer2165AAG CAGLys GlnTTTPheGAGGluGTTValCGTArgGTGValATGMetCCAProACAThrTCTSerCGCArgAGGArgTTCPheCAGGln2200CTTLeu2215CCTProTTA TCGLeu Ser2230ACA CTG CACThr Leu His2245CTC AAC ATCLeu Asn IleACCThrGCCAlaGAGGluGluATGMetGCCAlaATGMetTATTyr2105TTALeuGAAGluATTIleCCCProCTTLeu2185CTCLeuCGGArgAACAsnCTCLeuCATHisAACArg AsnATGMetGAAGluTATTyrGGTGly2075AAALys2090TCASerCAT GTGHis ValGAGGluCTGLeuTTGLeuGCTAlaCAGGlnTCCSer2155CGG AAAArg Lys2170CTALeuAAALysTTCPheGGCGlyAAALysAACAsnTCGSerGGCGly2235ATC CGGIle Arg2250CGC ATCArg Ile2265PCT/US97/1515361126160620862566304635264006448649665446592664066886736678468326880?10152025303540455055606570‘WO 98/08956ATGMetTTG CGGLeu Arg2270GTGValGAG GTGGlu Val2285GCCAla2300AAGLysCTGLeuCGAArgAGAArgACCThrTATTyrATTIleTTALeuCGTArgCTGLeuAGTSer2350GTTValGCTAla2365ATGMetACAThr2380AGAArgATGMetTACTyrAGAArgATCIleGACAspAGTSerGTCValAACAsnTGGTrpAGGArg2430ACGThrAGGArg2445ACGThrGGTGly2460GTGValGAAGluCCAProGAAGluTCTSerGCCAlaCTALeuAATAsnCTCLeuACTThrGGTGly2510CAAGlnGTTVal2525GAGGluCAG TGC TATGln Cys Tyr2540ATGMetGCTAlaTTTPheGAGGluCTGLeuTGGTrpAATAsnTATTyr2320GGCGly2335CTGLeuGGGGlyAAGLysACCThrCGAArgTTGLeuACCThrACAThr2400ATGMet2415GCCAlaCTGLeuATGMetGATAspTCCSerCTTLeuGGAGlyATTIleCATHis2480AAG AAALys Lys2495CGG GACArg AspCTG CTCLeu LeuATT GGCIle GlyCCGProCATHisCTGLeuCAGAC TAT GACAsp Tyr Asp2275AATAsnGCC GTCAla Val2290CCCProAGCSerAAALys2305ACCThrGGAGlyATCIleGAGGluAATAsn2385TGC CAC ACACys His ThrGTGValGACAspTACTyrGAGGlu2465TCTSerGCTAlaTTCPheATCIleTTALeuCGTArgTCTSerGATAspAGAArgCACHis2340CTGLeuCAC ATTHis Ile2355CCAProAAGLys2370TTTPheGCTAlaATGMetGAGGluATGMetGTGValGCCAla2420CTGLeuGAAGluACAThrAATAsn2435ACCThrTCT GCTSer Ala2450GGCGlyGCCAlaCATHisCCAProATTIleGGAGlyTTCPheCAGGlnATTIle2500ATCIleTCTSerCAT GATHis Asp2515AAA CAA GCGLys Gln Ala2530-73-CAC TTG ACTHis Leu ThrAATAsnACA GCTThr Ala02263951 1999-02-22CTG ATGLeu Met2280GGGGlyGACAsp2295AGCSerTCC GAGSer Glu2310GCG GTC ATGAla Val Met2325CCAProTCCSerAACAsnGACAspTTTPheGGGGlyGAGGluAAGLysATTIle2375GTTValACA GGCThr Gly2390GAG GTG CTGGlu Val Leu2405TTTPheGTCValTATTyrAAALysGGCGlyAACAsnCAGGlnTCASerGTCVal2455AAGLysAAA ACGLys Thr2470GAC GGT TTGAsp Gly Leu2485ATT AACIle AsnAGGArgGAC ACTAsp ThrTTGLeuACA TCCThr SerCAT2535TGGTrpGTGValTCASerATGMetCTGLeuATGMet2345GAC TGCAsp Cys2360CCAProTTTPheCTGLeuGATAspCGAArgGAGGluGACAspCCCPro2425AAG CGALys Arg2440GAA ATTGlu IleGGGGlyACCThrGTGValAAALysGTTValCGAArg2505GAT GTTAsp Val2520GAA AACCAGGlnAAGLysGACAspCTGLeuTTTPheGACAsp2315GTT GGGVal Gly2330CTGLeuGACAspTTTPheGAGGluAGAArgCTALeuGGCGlyAACAsn2395CAC AAGHis Lys2410TTGLeuCTGLeuTCCSerCGAArgTTGLeuGACAspACAThrGTGVal2475CCA GAGPro Glu2490GAT AAGAsp LysCCA ACGPro ThrCTC TGCHis Glu Asn Leu CysTGG TGC CCT TTC TGG TAACTGGAGG CCCAGATGTGTrp Cys Pro Phe Trp2545PCTIUS97/15153692869767024707271207168721672647312736074087456750475527600764876967746?10152025303540455055606570CA' W0 98l08956CCCATCACGT TTTTTCTGAG GCTTTTGTAC TTTAGTAAAT GCTTCCACTA AACTGAAACCATGGTGAGAA AGTTTGACTT TGTTAAATAT TTTGAAATGT AAATGAAAAG AAGTACTGTATATTAAAAGT TGGTTTGAAC CAACTTTCTA GCTGCTGTTG AAGAATATAT TGTCAGAAACACAAGGCTTG ATTTGGT(2)GTGTACTATT AGCCGACAspGTCValGGAGly45ATGMetTCCSerACGThrGGTGlyLys125GCCAlaACCThrINFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 723 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: linear(ii) MOLECULE TYPE: CDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 15..509(xi) SEQUENCE DESCRIPTION:ATG GTC AAC CCC ACCMet Val Asn Pro Thr1 5GGCGlyGAGGlu15TCCSerCCCProTTGLeuGGCGlyCGCArgGTCVal20CCAPro30AAGLysACAThrGCAAlaGAAGluAATAsn35TTTPheCGTArgTTTPheTTTPheGGTGlyTATTyrAAGLysGGTGly50TCCSerTGCCysTGTCysCAGGlnCGCArgGGTGlyTTCPheACAThrGGTGly65GACAspATCIleTATTyrGGGGly80GAAGluGATAsp85GAGGluTTTLys PheGGTGlyCCTPro95GGCGlyTTGLeuTCCSerATGMet100GCAAlaATCIleTCCSer110CAGGlnGCCAlaTTTPheTTCPheATCIleTGCCys115ACTThrCATHisGTGValGTGValGTGValTTTPheGGCGly130Lys LysATGMetGAGGluCGCArgTTTPhe145TCCSerAGGArgAATAsnGGGGlyGAAGlu165ATTIleGCTAlaGACAsp160CAAGlnCTCLeuTGTCysGGAGly-74-GTGValTTTPheGCTAlaCACHisCATHis70GAGGluAATAsnAAGLysGAAGluGGCGly150SEQ ID NO:3:TTCPheGAGGluCTGLeuAGAArg55AATAsnAACAsnGCTAlaACTThrGGCGly135AAGLysTTCPheCTGLeuAGCSer40ATTIleGGCGlyTTCPheGGAGlyGAGGlu120ATGMetACCThrGACAspTTTPhe25ACTThrATTIleACTThrATCIleCCCPro105TGGTrpAATASHAGCSer02263951 1999-02-22ATTIle10GCAAlaGGAGlyCCAProGGTGlyCTALeu90AACASHTTGLeuATTIleAAGLysGCCAlaGACAspGAGGluGGGGlyGGCGly75AAGLysACAThrGATAspGTGValAAGLys155TAAGTTTGAC TTGTGTTTTAGTCValAAGLysLysTTTPhe60AAGLysCATHisAATAsnGGCGlyGAGGlu140ATCIlePCT/US97ll5l5378067866792679435098194242290338386434482529?CA 02263951 1999-02-227 WO 98/08956 PCT/US97/15153- 75 _TCTTAACCAC CAGATCATTC CTTCTGTAGC TCAGGAGAGC ACCCCTCCAC CCCATTTGCT . 589CGCAGTATCC TAGAATCTTT GTGCTCTCGC TGCAGTTCCC TTTGGGTTCC ATGTTTTCCT 649TGTTCCCTCC CATGCCTAGC TGGATTGCAG AGTTAAGTTT ATGATTATGA AATAAAAACT 709AAATAACAAT TGTC 723

Claims (36)

WHAT IS CLAIMED IS:

1. A method for selectively inhibiting proliferation of a hematopoietic cell comprising contacting a hematopoietic cell which ectopically expresses a gene encoding a mutated macrolide binding protein (MBP) with a macrolide which selectively induces macrolide-dependent inhibition of proliferation of cells expressing the mutated MBP compared to cells expressing a wild-type form of the MBP, the mutated MBP having an altered macrolide-binding specificity relative to the wild-type form MBP.

2. A method for selectively inhibiting proliferation of a hematopoietic cell comprising (i) causing, in the cell, the ectopic expression of an MBP gene encoding a mutated macrolide binding protein (MBP) having an altered macrolide-binding specificity relative to a wild-type form of the MBP, which mutated MBP
retains the ability to cause macrolide-dependent inhibition of proliferation; and (ii) contacting the cell with a macrolide which selectively binds to the altered MBP
relative to the wild-type MBP and selectively induces macrolide-dependent inhibition of proliferation of cells expressing the mutated MBP relative to cells not expressing only the wild-type MBP.

3. The method of claim 2, wherein the MBP is selected from the group consisting of a FRAP, an FK506-binding protein, a cyclophilin and a calcineurin.

4. The method of claim 2, wherein the mutated MBP has a dissociation constant, K d, at least one order of magnitude less than the K d of the wild-type MBP.

5. The method of claim 2, wherein the mutated MBP has a dissociation constant, K d, at least three orders of magnitude less than the K d of the wild-type MBP.

6. The method of claim 2, wherein the MBP gene is present on an expression vector in the cell.

7. The method of claim 2, wherein the MBP gene is present in the cell as part of a viral expression construct.

8. The method of claim 2, wherein the MBP gene is a homologous recombinant in the cells genomic DNA.

9. The method of claim 2, wherein the macrolide is an analog of rapamycin, FK506 or cyclosporin.

10. The method of claim 2, wherein the MBP gene encodes a FRAP protein, and the macrolide is an analog of rapamycin.

11. The method of claim 2, wherein the MBP gene encodes an FK506 binding protein, and the macrolide is an analog of FK506 or rapamycin.

12. The method of claim 2, wherein the MBP gene encodes a calcineurin protein, and the macrolide is an analog of FK506 or cyclosporin.

13. The method of claim 2, wherein the MBP gene encodes a cyclophilin protein, and the macrolide is an analog of cyclosporin.

14. The method of claim 2, wherein the cell is a mammalian cell.

15. The method of claim 2, wherein the cell is a human cell.

16. A method for selectively inhibiting proliferation of a transplanted hematopoietic cell comprising (i) transplanting, into an animal, hematopoietic cells which ectopically expresses a MBP gene encoding a mutated macrolide binding protein (MBP), the mutated MBP having an altered macrolide-binding specificity relative to the wild-type form MBP
(ii) administering to the animal an amount of a macrolide sufficient to inhibit proliferation of the transplanted cells, which macrolide selectively induces macrolide-dependent inhibition of proliferation of cells expressing the mutated MBP compared to cells expressing a wild-type form of the MBP.

17. The method of claim 16, wherein the MBP is selected from the group consisting of a FRAP, an FK506-binding protein, a cyclophilin and a calcineurin.

18. The method of claim 16, wherein the mutated MBP has a dissociation constant, K d, at least one order of magnitude less than the K d of the wild-type MBP.

19. The method of claim 16, wherein the mutated MBP has a dissociation constant, K d, at least three orders of magnitude less than the K d of the wild-type MBP.

20. The method of claim 16, wherein the MBP gene is present on an expression vector in the cell.

21. The method of claim 16, wherein the MBP gene is present in the cell as part of a viral expression construct.

22. The method of claim 16, wherein the MBP gene is a homologous recombinant in the cells genomic DNA.

23. The method of claim 16, wherein the macrolide is an analog of rapamycin, FK506 or cyclosporin.

24. The method of claim 16, wherein the animal is a mammal.

25. The method of claim 24, wherein the animal is a human.

26. The method of claim 16, wherein the transplanted cells are autologous to the animal.

27. The method of claim 16 or 26, wherein the transplanted cells comprise transplanted bone marrow.

28. The method of claim 16 or 26, wherein the transplanted cells comprise hematopoietic stem cells.

29. The method of claim 16, wherein the ectopic expression of the MBP gene is transcriptionally regulated by a T-cell specific transcriptional regulatory sequence.

30. The method of claim 16, wherein the animal is in an immunosuppressed state.

31. A method for treating graft-versus-host disease in an animal by selectively inhibiting proliferation of transplanted hematopoietic cells, comprising (i) prior to transplanting tissue containing hematopoietic cells, transducing at least a sub-population of hematopoietic cells of the tissue with a gene for ectopic expression of a mutated macrolide binding protein (MBP), the mutated MBP
having an altered macrolide-binding specificity relative to the wild-type form MBP, and (ii) subsequent to transplanting the hematopoeitic cells, administering to the animal an amount of a macrolide sufficient to inhibit proliferation of the hematopoeitic transplanted cells, which macrolide selectively induces macrolide-dependent inhibition of proliferation of the transplanted cells expressing the mutated MBPcompared to endogenous cells of the animal.

32. An expression construct encoding a mutated macrolide binding protein (MBP) selected from the group consisting of FRAP, FKBP, cyclophilin and calcineurin, wherein the mutated MBP has an altered macrolide-binding specificity relative to the wild-type form MBP and, in the presence of a macrolide which binds the mutated MBP, induces macrolide-dependent inhibition of proliferation of a cell expressing the mutated MBP.

33. A kit for for selectively inhibiting proliferation of a hematopoietic cell, comprising (i) an expression construct for ectopically expressing an MBP gene encoding a mutated macrolide binding protein (MBP) having an altered macrolide-binding specificity relative to a wild-type form of the MBP, which mutated MBP
retains the ability to cause macrolide-dependent inhibition of proliferation; and (ii) a macrolide which selectively binds to the altered MBP relative to the wild-type MBP and selectively induces macrolide-dependent inhibition of proliferation of cells expressing the mutated MBP relative to cells not expressing only the wild-type MBP.

34. A method of promoting engraftment and hematopoietic activity of a hematopoietic stem cell from a donor, comprising:
(a) inserting nucleic acid encoding a modified macrolide binding protein specific for a modified macrolide into a hematopoietic stem cell to produce a transformed hematopoietic stem cell;
(b) introducing the transformed hematopoietic stem cell into a recipient mammal, such that the modified cellular receptor cyclophilin is expressed; and, (c) administering an effective amount of the modified cyclosporin to said recipient mammal.

35. Hematopoietic stem cells transfected with the expression construct of claim 32.

36. A T cell transfected with an expression construct of claim 32.