CA2254819A1 - Inhibition of hiv-1 replication by antisense rna expression - Google Patents

Abstract

Novel antisense sequences to the unspliced or single spliced portions of mRNA
transcript from HIV-1 provirus, optionally co-expressed with an inhibitory transdominant mutant HIV-1 protein, are found to be useful in the treatment of HIV-1 infection.

Description

CA 022~4819 1998-11-12 W 097/46673 PCT~P97/02952 INHIBlTlON OF HIV-I REPLICAl'lON BY ANTIS~NSE RNA ~CPRESSION

NEW VECTORS

This invention relates to inhibition of HIV- I replication using antisense RNA
expression.

HrV- 1 infection is believed to be the primary cause of Acquired lmmunodeficiency Syndrome (AlDS). HIV-I is a retrovirus having a genome comprised of two copies of full length RNA. Without intending to be bound by a particular theory, it is hypothesized that the replication of the virus in the CD4+ host cell occurs as follows. When the host cell is infected, the viral genomic RNA is transcribed by reverse transcriptase into double stranded DNA. This double stranded DNA is then integrated into the host cell's chromosome(s).
When this double stranded DNA is integrated into the genetic material of the host cell, it is called a provirus. Following activation of the host cell, the provirus is transcribed into RNA
in two distinct phases. In the early phase of infection, RNA transcripts of the provirus produced in the nucleus are converted into multiple copies of short sequences by cellular splicing enzymes. These short RNA transcripts encode genes for proteins, e.g., tat, which regulate the further transcription, and rev, which is thought to mediate the transition into the late phase transcription. This early phase dominates for about 24 hours. About 24 hours after activation of the cell, the transcription moves into the late phase. In late phase transcription, long unspliced RNA transcripts of about 9,200 bases and medium-length single-spliced transcripts of about 4,500 bases move out of the nucleus and into the cytoplasm. These unspliced and single spliced transcripts encode the structural and enzymatic proteins of the virus. These unspliced and single-spliced transcripts include, inter alia, the following regions: gag, which encodes the viral core proteins; pol, which encodes various enzymes; and env, which encodes the two envelope proteins. Figure I depicts the HTV-I genomic structure. It will be noted that there is some overlap in the genes, because certain genes share some base sequences.

CONFlRMATiON COPY

CA 022~4819 1998-11-12 W O 97/46673 PCT~P97102952 The unspliced and single-spliced transcripts are then further spliced, and the resulting mRNA is translated to produce the proteins necessary to make a new virus. The ga,~ and pol regions are translated to produce the polyproteins gag and gag-pol, which are then cleaved by protease to forrn the mature proteins found in the virus. The env is spliced to generate a subgenomic messenger which encodes for the env polyproteins, which is likewise cleaved to produce the mature envelope proteins. Two strands of the viral RNA are then packaged into a core and surrounded with capsid protein, and the resulting virus is released from the cell together with a portion of the cell membrane.

Various antisense strategies to inhibit HIV- 1 infection have been tried, including the use of trans-dominant proteins (Bevec, D., et al. 1992. Inhibition of human immunodeficiency virus type I replication in human T cells by retroviral-mediated gene transfer of a dominant-negative rev trans-activator. Proc. Natl. Acad. Sci. USA 89:9870-9874 and Trono, D., et al. 1989. HIV- 1 gag mutants can dominantly interfere with the replication of the wild-type virus. Cell 59: 113- 120), single chain antibodies (Levy-Mintz, P., et al. 1996. Intracellular expression of single-chain variable fragments to inhibit early stages of the viral life cycle by targeting human immunodeficiency virus type 1 integrase.
J. Virol. 70:8821-8832.), antisense RNAs ( Chatter3ee, S., et al. 1992. Dual-target inhibition of HIV-l in vitro by means of adeno-associated virus antisense vector. Science 258: 1485-1488., Choli, H., et al. 1994. Inhibition of HIV- 1 multiplication in a human CD4+ Iymphocytic cell line expressing antisense and sense RNA molecules containing HIV-I packaging signal and rev response element(s). Antisense Res. and Dev. 4:19-29, Joshi, S., et al. 1991. Inhibition of human immunodeficiency virus type 1 multiplication by antisense and sense RNA expression. J. Virol. 65:5524-5530, Kim, J.H., et al., 1996.
Inhibition of HIV replication by sense and antisense Rev Response Elements in HIV-., based retroviral vectors. J. Acquir. Immune Defic. Syndr. 12:343-351, Meyer, J., et al., 1993. Inhibition of HIV-l replication by high-copy-number vector expressing antisense RNA for reverse transcriptase. Gene 129:263-268, Renneisen, K., et al 1990. Inhibition CA 022~4819 1998-11-12 WO 97/46673 PCT~P97/02952 of expression of human immunodeficiency virus- 1 in vitro by antibody-targeted liposomes containing antisense RNA to the env region. J. Biol. Chem. 26~:16337-16342 and Rhodes, A., et al. 1990. Inhibition of human immunodeficiency virus replication in cell culture by endogenously synthesized antisense RNA. J. Gen. Virol. 71:1965-1974), RNA decoys (Lee, T., et al. 1994. Inhibition of human immunodeficiency virus type I in human T cells by a potent Rev-response element decoy consisting of the 13-nucleotide minimal Rev-binding domain. J. Virol. 68:8254-8264 and Sullenger, B.A., et al 1990.
Overexpression of TAR sequences renders cells resistant to human immunodeficiency virus replication. Cell 63: 601-608), and ribozymes (Ojwang, J.O., et al 1992. Inhibition of human immunodeficiency virus type 1 expression by a hairpin ribozyme. Proc. Natl.
Acad. Sci. USA. 89: 10802-10806 and Zhou C., I. Bahner, et al 1994. Inhibition of HIV- 1 in human T Iymphocytes by retrovirally transduced anti-tat and rev hammerhead ribozymes. Gene. 149:33-39).
The trans-dominant HIV-l protein RevM10 was first evaluated in a clinical trial using genetically modified peripheral blood Iymphocytes (Woffendin, C et al. 1996. Expression of a protective gene prolongs survival of T cells in human immunodeficiency virus infected patients. Proc. Natl. Acad. Sci. USA. 93:2889-2894), although recently a ribozyme (Leavitt, M.C., et al 1996. Ex vivo transduction and expansion of CD4+
Iymphocytes from HIV+ donors: prelude to a ribozyme gene therapy trial. Gene Ther.
3:599-606) and a transdominant Rev and antisense TAR based (Morgan R.A et al 1996.
Clinical protocol: Gene therapy for AIDS using retroviral mediated gene transfer to deliver HIV-l antisense TAR and transdominant Rev protein genes to syngeneic Iymphocytes in HIV-I infected identical twins. Hum. Gene Ther. 7:1281-1306.) approach have received RAC and FDA approval.
Intracellular expression of antisense RNAs offers an attractive, alternative gene therapy approach to inhibit HIV- 1 replication. Antisense RNAs have been described as very specific and efficient inhibitors in both prokaryotic and eukaryotic systems . Viral replication has been successfully inhibited by addition of in vitro synthesized antisense , , CA 022~4819 1998-11-12 W 097/46673 PCT~EP97102952 oligonucleotides or intracellularly expressed antisense RNAs . Inhibition of HIV- 1 replication has been shown previously using antisense RNAs targeted against several viral regulatory (Chatterjee et al 1992, Joshi et al 1991, Kim et al 1996, Sr7:~ki~1, G. et al 1991.
lnhibition of human immunodeficiency virus type I replication in human T cells stably expressing antisense RNA. J.Virol. 65: 468-472 and S~7~kiel, G et al 1992. Tat- and Rev-directed antisense RNA expression inhibits and abolishes replication of human immunodeficiency virus type 1: a temporal analyses. J. Virol. 66: 5576-5581) andstructural gene products (Choli et al 1994, Gyotoky, et al 1991, Meyer et al 1993 and Rhodes et al 1990). A few reports described long antisense sequences expressed either intracellularly using retroviral vectors (Choli et al 1994, Gyotoky, et al 1991 and Rhodes et al 1990) or using antibody-targeted liposomal delivery (Renneisen et al). The different inhibition levels observed in these reports may reflect variation in antisense RNA
expression levels, or secondary and tertiary RNA structures, which can influence the hybridization kinetics between two complementary RNAs (Sczakiel, G., M. Homann, and K. Rittner. 1993 Computer-aided search for effective antisense RNA target sequences of the human immunodeficiency virus type 1. Antisense Res. and Dev. 3:45-52), influencing the biological activity.
Generally, these efforts have targeted the early phase transcription (e.g., tat or rev genes) or have targeted RNA processing or initiation of translation in the late phase. Shorter antisense sequences have been favored due to the perceived risk of the antisense sequence folding to forrn a secondary structure with itself. To date, these efforts have not met with significant success.
It is now surprisingly discovered that the best target for antisense therapy is the full length or single-spliced RNA transcript. Antisense sequences which bind to multiple-spliced transcripts for a gene are less effective, probably because binding to the smaller , transcripts results in fewer antisense molecules being available for the binding to the full length or single spliced transcripts. Moreover, longer sequences directed to the full length transcript (e.g., sequences greater than 600 base pairs, preferably greater than 1000 base CA 022~4819 1998-11-12 pairs~ are surprisingly effective and, contrary to the suggestion in the art, do not appear to form undesirable secondary structures.
Hereinafter we present the results of the antiviral activity of sequences complementary to the pol, vif, env genes and 3 'LTR in HIV- I infection experiments using a human CD4+ T
cell line (CEM-SS) and peripheral CD4+ T Iymphocytes (PBLs). Retroviral vectors are constructed expressing chimeric RNAs containing 1,100 - 1,400 nt long complementary HIV-I sequences. The most efficient inhibition of HIV-I replication is observed with an antisense sequence complementary to the HIV-I env gene both in the CEM-SS cell line and in PBLs. This strong antiviral effect is further demonstrated in high inoculation dose infection experiments where reduction of the HIV-1 rnRNAs correlates with low level of Gag and Tat protein production indicating that antisense RNA acts early during HIV- I
replication. Comparing the anti-HIV- I efficacy of the antisense RNAs to the well documented (Bevec, D.,et al . 1992. Inhibition of human immunodeficiency virus type l replication in human T cells by retroviral-mediated gene transfer of a dominant-negative rev trans-activator. Proc. Natl. Acad. Sci. USA 89:9870-9874, Escaich, S., et al 1995.
RevM10-mediated inhibition of HIV-I replication in chronically infected T cells. Hum.
Gene Ther. 6:625-634, Malim, M.H., et al. 1992. Stable expression of transdominant rev protein in human T cells inhibits human immunodefficiency virus replication. J. Exp.
Med. 176: 1197- 1201 and Nabel, G.J., et al. 1995. A molecular genetic intervention for AIDS - effects of a transdominant negative form of Rev. Hum. Gene Ther. 5:79-92) trans-dominant RevM10 protein demonstrates the potency of the antisense mefliAted inhibition of HIV-I replication.

. ..... . .. ...

CA 022=,4819 1998-11-12 It has further been discovered that antisense sequences to the gag, env, and pol, especially the env and pol portions of the full length transcript are particularly effective.
The above mentioned antisense constructs are particularly useful for providing gene therapy to patients suffering from HIV-I infection, e.g., by transducing the HIV-I-susceptable cells of such patients, e.g., CD4+ cells or cells which are progenitors of CD4+
cells, e.g., hematopoietic stem cells (for example CD34+/Thy-l+ cells), with the antisense constructs of the invention, so that the tr~n.~dllced cells and their progeny are resistant to HIV-I infection.
The antisense constructs of the invention are suitably prepared by incorporating a wild-type HIV- 1 gene or gene fragment into a vector in reverse orientation with respect to its promotor so that when the gene is incorporated into the genome of the host cell and transcribed, the opposite strand of the DNA is transcribed, producing a messenger RNA
transcript which is complementary to the mRNA from the wild-type gene or gene fragment and will anneal with it to form an inactive RNA-RNA duplex, which is subject to degredation by cellular RNases.
Transduction of the HIV- I susceptable cells using the antisense vectors can be carried out in vivo or ex vivo, but is suitably carried out ex vivo, by removing blood from the patient, selecting the target cells, inoculating them with a vector containing the antisense construct of the invention, and reintroducing the transd~lced cells into the body. By natural selection, the tr~n~dnced HIV-1 resistant cells will replace the native HIV-I susceptible cells, thereby enabling the patient to overcome the infection and regain immunocompetence.
Alternatively, the patient receives non-autologous CD4+ cells or progenitors of CD4+ cells from a compatable donor which cells have been transduced with the antisense construct of the inventlon.
The invention thus provides:

CA 022~4819 1998-11-12 W O 97/46673 PCTrEP97/02952 1. A nucleic acid sequence which, when stably integrated into a human cell, is capable of generating mRNA which anneals e.g., under in vivo conditions, with a mRNA transcript from an HIV-I provirus encoding env, env and pol or env, pol and gag and which is at least 0.6 kb, preferably at least I kb in length, most preferably 1-2 kb, e.g. from I.1 to 1.5 kb; and which is selected from:
(i) a sequence which is antisense to the 1.4 kb fragment from the Apal cleavage site at ca. base 2004 of an HIV-l provirus to the Pflml cleavage site ca. base 3400 of an HIV- I
provirus, e.g. which is antisense to the sequence in figure I (SEQ. ID. NO. I );(ii) a sequence which is antisense to the 1.2 kb fragment from the Pflim I cleavage site ca. base 3400 of an HIV-I provirus to the EcoRl cleavage site ca. base 4646 of an HIV-I
provirus, e.g. which is antisense to the sequence in figure 2 (SEQ. ID. NO. 2);
(iii) a sequence which is antisense to the 1.3 kb fragment from the ApaLI cleavage site ca. base 6615 of an HIV-I provirus to the Bsml cleavage site ca. base 8053 of an HIV-I
provirus, e.g., which is antisense to the sequence in figure 3 (SEQ. ID. NO.3); and (iv) a sequence which is at least 80%, preferably at least 90%, more preferably at least 9~%, most preferably at least 99%, homologous to a sequence according to (i), (ii), or (iii) and which is capable of generating mRNA which annealss to the same mRNA transcript as that hybridizing to mRNA generated by (i), (ii), or (iii).

It is understood that the nucleic acid described in 1 above will be in RNA for when in a retroviral vector and will be converted to DNA upon incorporation of the provirus into the target cell. It is intended that both the RNA and DNA forms of the constructs are included within the scope of the invention.

The invention further provides 2. A vector comprising an antisense sequence according to I above.

CA 022~4819 1998-11-12 W O 97/46673 PCT~EP97/02952 The vector may be any vector capable of transducing a human hematopoietic cell, for example, an ecotropic, xenotropic, amphotropic or pseudotyped retroviral vector, an adeno-associated virus (AAV) vector, or an adenovirus (AV) vector. Preferably, the vector is a retroviral vector, preferably a vector characterized in that it has a long terminal repeat sequence (LTR), e.g., a retroviral vector derived from the Moloney murine leukemia virus (MoMLV), myeloproliferative sarcoma virus (MPSV), or murine embryonic stem cell virus (MESV), or for example, a vector from the pLN series described in Miller and Rosman (1989) BioTechniques 7, pp. 980-986. The antisense sequence replaces the retroviral gag, pol and/or env sequences. The promotor controlling expression of the antisense may be a strong viral promoter, for example MoMLV LTR.
The range of host cells that may be infected by a retrovirus or retroviral vector is generally determined by the viral env protein. The recombinant virus gene,dl~d from a pack~ging cell can be used to infect virtually any cell type recognized by the env protein provided by the p~k:lging cell. Infection results in the integration of the viral genome into the transduced cell and the consequent stable expression of the foreign gene product. The efficiency of infection is also related to the level of expression of the receptor on the target cell. In general, murine ecotropic env of MoMLV allows infection of rodent cells, whereas amphotropic env allows infection of rodent, avian and some primate cells, including human cells. Xenotropic vector systems utilize murine xenotropic env, and also allow infection of human cells. The host range of retroviral vectors may be altered by substituting the env protein of the base virus with that of a second virus. The resulting, "pseudotyped" virus has the host range of the virus donating the envelope protein and expressed by the p~k~ging cell line. For example, the G-glycoprotein from vesicular stomatitis virus (VSV-G) may be substituted for the MMLV env protein, thereby broadening the host range. Preferably the vector and packaging cell line of the present invention are adapted to be suitable for transduction of human cells. Preferably, the vector is an amphotropic retroviral vector, for example, a vector as described in the examples below.

CA 022~4819 1998-11-12 W 097/46673 PCT~P97/02952 Optionally, the vector may contain more than one antisense sequence according to 1 above, e.g., two different antisense sequences, for example to pol and env, as described in the examples below.
Preferably, the construct lacks the retroviral gag, pol and/or env sequences, so that the gag, pol and env functions must be provided in trans by a p~ ging cell line. Thus, when the vector construct is introduced into the packaging cell, the gag-pol and env proteins produced by the cell assemble with the vector RNA to produce replication-defective or transducing virions that are secreted into the culture medium. The virus thus produced can infect and integrate into the DNA of the target cell, but generally will not produce infectious viral particles since it is lacking essential viral sequences. The packaging cell line is preferably transfected with separate plasmids encoding gag-pol and env, so that multiple recombination events are necessary before a replication-competent retrovirus (RCR) can be produced. Suitable retroviral vector packaging cell lines include those based on the murine NIH/3T3 cell line and include PA317 (Miller & Buttimore (1986) Mol. Cell Biol. 6:2895;
Miller & Rosman (1989) BioTechniques 7:980), CRIP (Danos & Mulligan (1988) Proc.Natl Acad Sci USA 85:6460), and gp + arn12 (Markowitz et al. (1988) Virology 167:400);
and also cell lines based on human 293 cells or monkey COS cells, for example ProPak A
pack~ging cells, e.g., as described in Pear et al. (1993) Proc. Natl. Acad. Sci. USA 90: 8392-8396; Rigg et al., (1996) Virology 218; Finer, et al. (1994) Blood 83: 43-50; Landau, et al.
(1992) J. Virol. 66: 5110-5113. Retroviral vector DNA can be introduced into packaging cells either by stable or transient transfection to produce retroviral vector particles.
The antisense constructs of the invention have the further advantage that they will not interfere with expression of HIV inhibitory proteins, e.g., transdominant mutant proteins corresponding to the early phase short mRNA transcripts, for example mutants of tat or rev.
Expression of such transdominant mutant proteins is useful in treating HIV infection bècause the mutant proteins interfere with the function of the wild-type HIV proteins and so inhibit HIV replication. A transdominant mutant protein of particular interest is RevM 10, the use of which is described e.g., in Escaich, et al. Hum. Gene Ther. (1995) 6: 625-634, and CA 022~4819 1998-11-12 W O 97/46673 PCT~EP97102952 in WO 90/14427. Previously, co-expression of HIV antisense and transdominant mutant proteins was considered impractical because it was expected that the antisense would interfere with expression of the mutant protein. Using the antisense constructs of the invention, co-expression of the antisense with the transdominant mutant protein is not only feasible but provides a synergistic inhibition of the HIV by interfering with the virus at different stages of its replication cycle.
Thus the invention provides in a further embodiment:

3. A retroviral vector according to 2 above (i.e., comprising an antisense sequence according to 1 above) and further comprising a gene for an HIV- 1 inhibitory protein, e.g., a gene for a transdominant mutant form of tat or rev, especially the gene for RevM10.
p~ ing cell lines comprising the vectors according to 2 or 3 above, e.g, as described above, are also within the scope of the invention.
The invention also provides in a further embodiment:

4. A cellular composition comprising at least one human hematopoietic cell (e.g. CD4+
cell or progenitor of CD4+ cells, e.g., a stem cell, e.g., a CD34+/Thy- 1 + cell) stably transduced with an antisense sequence according to 1 above and optionally additionally tr~ns~ e-l with a gene for a transdominant mutant form of tat or rev, especially RevM10, e.g., transduced with a vector according to 2 or 3, supra, e.g., for use in a method according to S below;
The invention also provides in a further embodiment:

5. A method for treatment of HIV- I infection in a subject in need thereof comprising isolating hematopoietic cells (e.g. CD4+ cells or progenitors of CD4+ cells, e.g., stem cells, e.g., CD34+/Thy-l+ cells) from said patient;
transducing said cells with an antisense sequence according to 1 above, and optionally additionally or simultaneously transducing said cells with a gene for an H~V-1 inhibiting transdominant mutant forrn of tat or rev, especially RevM10, e.g., transducing said cells with a vector according to 2 or 3, supra; and reintroducing the tr~nsthlced cells into the patient.

CA 022~4819 1998-11-12 W O 97t46673 PCTAEP97/02952 The invention also provides in a further embodiment:

6. The use of an antisense sequence according to I above or a vector according to 2 or 3 above in the manufacture of a cellular composition according to 4 above or in a method of treatment according to 5 above.

Figure I depicts the sequence of HIV-I HXB2 strain polymerase gene region 1 (2004-3400 bp) in sense orientation.
Figure 2 depicts the sequence of HIV- I HXB2 strain polymerase gene region 2 (3400-4650 bp) in sense orientation.
Figure 3 depicts the sequence of the HIV-l HXB2 strain envelope gene region (6615-8053) in sense orientation.
Figure 4 depict the HIV- I genomic structure. The position of antisense fragment used for vector construction is also shown. The position of the restriction endonuclease cleavage sites is indicated for each fragment.
Figure 5 depicts the schematic structure of antisense vectors of the examples. The parental vector pLN- I is described in the publication of A. Dusty Miller and Guy J. Rosman (1989) BioTechniques 7. 980-986. The multicloning site 3' from the Neo gene is used to insert the antisense fragments. The parental vector for the combination vectors pLMTNL is described in: Escaich, S. Kalfoglu, C.; Plavec, I.; et al. Human Gene Therapy 1995. 6. 625-634.
Figure 6 depicts serial deletion of HIV gag sequence. Construction of the deletion fragments is described below. The 1.5 kb Sac I - Bgl II psi-gag fragment (~-gag) is used to generate the deletion construct either by PCR amplification or by restriction digest.

Figure 7 depicts HIV challenge of deletion constructs. The pLN-gag (S) and pLN-gag (AS) construct correspond to the full length 1.5 kb psi-gag fragment in sense or antisense orientation respectively. The pLN-gag-500 is the 5' end of the above fragment CA 022~4819 1998-11-12 W O 97/46673 PCT~EP97tO2952 corresponding mostly to the psi (packaging signal) sequence of the HIV- 1. The pLN-gag-1000 construct corresponds to the gag region of the 1.5 kb fragment.
Figure 8 depicts the anti-HlV- 1 activity of antisense gag deletion fragments as a function of their length; correlation between size and anti-HIV- I activity is shown on the graph. The p24 production (pg/lOE6 cells) versus the length of the fragments in base pairs is plotted on the graph.
Figure 9 depicts HIV-I challenge of antisense gag and Vif constructs. The full length, 1.5 kb antisense gag (pLNI Psi-sense and antisense) and the similar size Vif fragment (pLNl Vif/sense and antisense) are compared.
Figure 10 depicts HIV-I challenge of gag-pol/AS constructs with high dose of virus (40000 TCID50): The 1.5 kb psi-gag fragment (pLN-gag/AS and S) was compared with the pol-1 fragment (pLM-pol/AS and S).
Figure 11 depicts HIV-l challenge of antisense pol, env and LTR constructs. CEMSS
cells carrying the pol-l fragment (pLN-pol (AS)/I and (S)/l) the second antisense pol-2 ~pLN Dpol (AS)/2) the envelope (pLN D Env (AS)) and the 3'LTR) pLN D LTR (AS)) fr~gm~nts are challenged with 400 TCID HIV- 1.
Figure 12 depicts the pLN poll/env antisense vectors, and the effectiveness of poll(S), poll(AS), poll(AS)/env(S)~ pol(AS)/env(AS) against HrV-I challenge, the double antisense construct being the most effective.
Figure 13 depicts HIV- I challenge of combination vectors. The two parental vectors LMTNL with the RevM10 gene and the LAMTNL with ATG less RevM10 gene as a control and the corresponding combination vectors LMTNL-Y and LAMTNL-Y with the full length, 1.5 kb psi-gag sequence in antisense orientation are challenged with 400 TCID50 HIV- 1.

Figuré 14 depicts pol antisense mef~ ed inhibition of HIV replication in peripheral blood Iymphocytes.

CA 022~4819 1998-11-12 Figure 15. A. Structure of the retroviral vectors encoding the antisense sequences. Neo and Lyt2 are used as a selectable marker genes. The antisense sequence together with the marker gene is expressed from the MoMLV LTR promoter. The arrow indicates the antisense orientation of the inserted HIV- I sequences. B. Northern blot analyses of the antisense RNA expression in transduced CEM-SS cells. The recombinant transcriptscarrying the antisense sequences are detected using a Neo specific probe. The lower panel indicates the same blot hybridized with a GAPDH specific probe as a internal standard.
Lane 1: pLN vector, lane 2: pLN-poll/AS, lane 3: pLN-pol2/AS, lane 4:pLN-vif/AS, lane 5:pLN-env/AS, lane 6:pLN-3'LT~/AS, lane 7 pLN-poll2/AS vector respectively.
Figure 16. Inhibition of HIV- I replication in tr~n.cduced CEM-SS cells. A: CEM-SS
cell populations (Ix106 cells/ml) are inoculated with 4X102 TCIDs~/ml of HIV-I HXB3 strain. B: lncreasing HIV-I dose, 4x104 TCIDso/ml infection of transduced CEM-SS cell populations. The culture supernatants are tested for p24 antigen production by ELISA.
experiments are done in duplicates.
Figure 17 . Evaluation of anti-HIV- I efficacy of vectors encoding different length complementary pol sequences. A. Anti-HIV- I efficacy of pol l_deletion constructs. CEM-SS cells expressing the 1,400 nt pol I and 790 nt pol antisense and the sense pol I constructs are infected with 4x103 TCIDsO/ml of HIV-I HXB3 strain. B. CEM-SS cells expressing the 1,400 nt poll and the 2,600 nt poll2 antisense sequences are infected with 4xl03TCIDs0/rnl HIV- 1 HXB3 strain. The corresponding sense constructs are used as a control.
Figure 18. Antisense RNA expression and inhibition of HIV- I replication in tr~n.c~ ced PBLs. A. Total cellular RNA is isolated from activated, CD4+ enriched PBLs transduced with pL-Lyt-poll/AS, pL-Lyt2/poll/S, pL-Lyt-env/AS, pL-Lyt2/env/S vectors and selected for Lyt2 expression. The antisense transcripts are analyzed on Northern blot using a radiolabeled Lyt2 specific probe. A GAPDH specific probe is used to monitor the amount of RNA loaded. Lane I :pL-Lyt2-pol 1/AS, Lane 2:pL-Lyt2-pol 1/S, Lane 3: pL-Lyt2-env/AS, Lane 4: pL-Lyt-env/S, Lane 5:pL-Lyt2-pol l/AS. B. Transduced and CD4+, Lyt2+ selected CA 022~4819 1998-11-12 PBLs are activated with allogenic feeder cells and infected with the clinical HIV-1 isolate JR-CSF. Sx 104 cells are inoculated in triplicate, and p24 antigen production is determined.
Figure 19. Comparison of trans-dominant RevM10 and intracellularly expressed vif, pol I and env antisense RNAs in high inoculation dose HIV- 1 infection experiments. CEM-SS cells (1xlO6/ml) are inoculated with 1x105 TcIDsolml of HIV-I HXB3 and viral replication is monitored by measuring p24 antigen production in the culture supernatant.
Figure 20. Detection of HIV-I, antisense and RevM10 transcripts in CEM-SS cells inoculated with lxlOs TCID5~/ml H~V-I, HXB3 strain. Total cellular RNA is isolated from CEM-SS cells at day 4, day 6 and day 8 post infection. The HIV specific transcripts are analyzed on Northern blot using a radiolabeled TAR specific oligonucleotide probe.
Expression of the antisense or RevM 10 transcripts is determined using a Neo or a Rev specific probe respectively. A GAPDH specific probe is used to monitor the amount of RNA loaded. Lane 1: RevM10, Lane 2: DRevM10, Lane 3: pLN(vector control), Lane 4:
pLN-vif/AS, Lane 5:pLN-poll/AS, Lane 6:pLN- env/AS. Panel A: Day 4., Panel B: day 6, Panel C: Day 8.
Figure 21. Analyses of intracellular p24 and Tat expression in HIV- 1 infected CEM-SS cells. A. Intracellular p24 expression is measured at day 8 post infection. The mean fluorescence intensity reflects the relative intracellular p24 expression level. B. Detection of Tat protein in tr:~n.sduced and HIV-I infected CEM-SS cells. Aliquots of infected CEM-SS
cells at day 8 post infection are fixed in methanol, stained with Tat specific antibody and analyzed by FACScan.

, .

... .

CA 022~4819 1998-11-12 W 097t46673 PCTAEP97/02952 EXAMPLE 1:
Construction of r~r~ l vectors carrying ~ rc HIV-l sequences Retroviral vector constructs with different antisense HIV- I sequences are generated as follows using as parental vector pLN, described in A. Dusty Miller and Guy J. Rosman (1989) BioTechniques 7. 980-986.

a) pLN-ga~/AS vector: The 1420 bp Sac I-Bgl II (675 bp-2095 bp) fragment is isolated from the HXB-2 strain of HIV- 1 and inserted as a blunt end fragment in antisense orientation into the blunt ended Hind m site of the pLN- I vector. Orientation of the fragment is determined by restriction digest with Cla I.

b) 3' Deletion pLN-~ea~/AS vectors: Serial deletion fragments from the 1420 bp Sac I-Bgl Il (675 bp-2095 bp) fragment are generated by PCR amplification. The 5' end of the fragments are fixed using the GAGCTCTCTCGACGCAGGACT (SEQ. ID. NO. 4) primer at position 675 bp-695 bp). The primers at the 3' end were the following; primer 3.6: position 1897-GTAGGATCCGTTACTTGGCTCATTGCTTCA (SEQ. ID. NO. 5); primer 3.5: position 1677-1700.
CACGGATCCGAGTmATAGAACCGGTCTAC (SEQ. ID. NO. 6); primer 3.4: position GTAGGATCCACTGCTATGTCACTTCCCCTTGG (SEQ. ID. NO. 7); primer 3.3 position 1280-1300, GTAGGATCCACATGGGTATCACTTCTGGGCTG (SEQ. lD. NO. 8); primer 3.2 position 1079- 1100, CA 022~4819 1998-11-12 W 097/46673 PCT~EP97/02952 GTAGGATCCTCTATCTTGTCTAAAGCTTCCTTG (SEQ. ID. NO. 9); primer 3.1 position 884-904, GTAGGATCCCCTGCTTGCCCATACTATATG (SEQ. II). NO. 10). The PCR fragments with Bam HI and blunt end are cloned into the Bam HI - Hpa I site of the pLN vector. The generated fragments are approximately 1200 bp, 1000 bp, 800 bp, 600 bp, 400 bp 200 bp in length.

c) Removal of the psi sequence from the ~a~ fra~ment: The 1420 bp SAC I-Bgl II(675 bp-2095 bp) fragment is digested with Pvu n resctriction endonuclease which removes 494 bp corresponding to the psi p~rk~ging signal form the 5' end of the fragment. The resulting fragment (gag 500/AS and gag I000/AS) is cloned as a blunt end fragment into the Hind II
of pLN vector.

d) pLN-Vif/AS vector: The 1100 bp Eco RI-Eco Ri fragment (4646-5742) from the HXB-2 strain of HIV- I corresponding Vif-Vpr gene of the virus is inserted into the Hind II site of pLN vector in antisense orientation.

e) pLN-pol 1/AS vector: The 1480 bp Apa I-Pflm I fragment (2005-3485) from the HXB-2 strain of HIV- 1 corresponding to the 5' end of the Pol gene of the virus is inserted into the Hind II site of pLN vector in antisense orientation.

f) pLN-pol2/AS vector: The 1250 bp Pflm I - Eco RI fragment (3485-4646) from the HXB-2 strain of HIV- 1 corresponding to the 3' end of the Pol gene of the virus is inserted into the Hind II site of pLN vector in antisense orientation.

g) pLN-env/AS vector: The 1440 bp Apa LI - Bsm I fragment (6615-8053) from the HXB-2 strain of HIV- I corresponding to intronic region of the Env gene of the virus is inserted into the Hind II site of pLN vector in antisense orientation.

~ , . .

CA 022~4819 1998-11-12 h) pLN-poll(AS)-env(AS) vector: The poll fragment of e) is inserted 5' to the env construct of g), both in antisense orientation in the HindIl site of the pLN vector (fig. 12).

i) pLN3' LTR/AS vector: the 1260 bp Bam HI-Hind m fragment (8474-9615) from the HXB-2 strain of HIV- I corresponding to the 3' LTR of the virus is inserted into the Xho I
site of pLN vector in antisense orientation.

j) The retroviral vector pLN-pol 12/AS with the full length pol sequence is constructed by inserting the 2,642 bp ApaI-EcoRI fragment into the pLN vector in reverse orientation. For the sense control vectors pLN-poll/S and pLN-poll2/S the 1,400 bp ApaI-PflmI and 2,642 bp ApaI-EcoRI pol fragments are cloned in the sense orientation into the pLN vector. The pLN-790pol/AS vector is constructed by inserting the 790 bp BglII-NsiI subfragment of the pol gene into the XhoI site of the pLN vector. Retroviral vectors (pLLyt2-poll/AS, pLLyt2-pol l/S, pLLyt2-env/AS and pLLyt2-env/S) are constructed by replacing the Neo gene with the truncated mouse CD8 (Lyt2) cell surface marker (Forestell, S.P., et al 1997. Novel retroviral packaging cell lines: complementary tropism and improved vector production for efficient gene transfer. Gene Ther. 4: 19-28) and used for the primary T cell HIV-infection experiments.

k) Combination vectors: The LMTNL and the L~MTNL vectors carrying the transdominant RevM10 gene and its ATG-less form (~M) (Escaich~ S.; Kalfoglou, C.; Lavec, I.;et. al.
Human Gene Therapy 1995. 6 625-634) are digested with Cla I and the 1200 bp Cla I-Bgl II
fragment from HXB-2 strain of HIV- 1, corresponding to the Gag gene region, is inserted as an antisense fragment.

I) Retroviral vector production: 10 ug of retroviral DNA is transfected into the ecotropic BOSC packaging line using the CaPO4 transfection protocol. The transient ecotropic viral .

CA 022~4819 1998-11-12 W O 97/46673 PCTrEP97/02952 supernatant is used to tr~n~cluce the amphotropic PA 317 packaging cell line. Since the pLN
vectors carry the Neo gene, the cells are selected on G418. After selection the stable cells pools are analysed by Northern blot for the antisense RNA expression. Viral supernatants from the selected PA317 cell lines carrying the a~pr(lpliate retroviral constructs are collected, analysed for transducing viral titer, and used to transduce the human CD4+ T cells line CEMSS. GP47 could be used instead of BOSC as the packaging line (Rigg, R.J., et al 1996. A novel human amphotropic packaging cell line: high titer, complement resistance, and improved safety.Virology. 218: 290-295). Supernatant from the GP47 pafk~ging cell lines is used to tr:~n.sdl-ce the amphotropic ProPakA cell line (Rigg, R.J., et al . 1996) by spinoculation as described previously (Forestell, S.P et al . 1997. Novel retroviral packaging cell lines: complementary tropism and improved vector production for efficient gene transfer. Gene Ther. 4: 19-28). Retroviral end-point titers are determined on NIH3T3 cells after drug selection (800 mg/ml G418) and transduction efficacy of the Lyt2 vectors (Forestell, S.P et al . 1997) is measured by FACS analysis.

m) Tar~et cell transduction: The human CD4+ T cell line CEM SS cells (2x 106 cells) are transduced with the amphotropic viral supernatants carrying the antisense vector constructs in 5 ml DMEM + 10 FCS + 8 ug/ml polybrene for 4-6 hours. 48 hours later the cells are selected on 400 ug/ml G418. After G418 selection (7-10 days) the resistant cell are expanded, the antisense RNA expression is analysed by Northern blot. The selected CEM
SS cell pools are also analysed for the presence of the CD4 cell surface marker.

EXAMPLE 2:
HIV-1 challenge of CEM clones or pools The resistance of transduced CEM cells to HIV replication and to cytopathic effects of the virus is determined as follows:

CA 022~4819 1998-11-12 W 097/46673 PC~EP97/02952 _19_ Cells are subjected to HIV- 1 infection (HXB3) in vitro. Antiviral effect is measured by cell viability, levels of p24 Ag produced in the supernatant, and levels of CD4 expression at the cell surface. Infection is measured by PCR for HIV sequences. In addition to the clones to be challenged, CEMss containing a vector control are submitted to infection by HIV- 1.

Day -1: Prior to challenge the clones are tested for CD4 expression by FACS analysis.

DayO:
l. Count the cell 2. Spin down 2x1 o6 CEM cells 5 min at 1200 rpm 3. Pour off the supernatant from the cells 4. Dilute virus stock in culture medium to 4000 or 400 TCIDso,,~" (medium: RPMI
1640,10% CCS, Peni 100 U/ml, Strepto 100 mg/ml) 5. Resuspend the cell pellet (2x106 cells) in 2 ml of the virus dilution, (or 2 ml of media for the non infected control) 6. Incubate on rotator (low speed 18 rpm) for 2 hours at RT

7. Spin down the cells 8. Aspirate carefully the virus suspension 9. Wash the cells twice in 7 ml medium, by centifugation at 1200 rpm for 10 min 10. Resuspend the cells in 10 ml media (CEM at 2xlOs/ml final concentration) 11. Incubate at 37~c, 5% CO2 for 4 days Day 4:

12. Analysis: - cell count - 1 ml of centrifuged supernatant for p24 titration, freeze at -70~C

13. Passage the cells: dilution to 2x105/ml final in fresh medium Day 8:

CA 022~4819 1998-11-12 W 097/46673 PCT~P97/02952 14. Analysis at day 8:
- cell count - I ml of centrifuged supernatant for p24 titration, freeze at -70~C
- take 106 cells for CD4 staining (optional) - lyse 2x 1 o6 cells in 400 ul for DNA PCR, store at -20~C (optional) - RNA extraction from 4x 106 cells using RNazol, store at -70~C
(optional) 15. Passage the cells: dilution to 2xlOs/ml final in fresh medium 16. Cells are passaged every 4-5 days to be m~int~ined in log phase growth until day 16 or until the controls are dead. For each passage, cells are counted and supernatant is frozen.

EXAMPLE 3: Detection of intracellular Tat and p24 Tr~n~duce-l CEM-SS cells expressing RevMlO and antisense HIV-I sequences are inoculated with lxlOs TCIDs~/106 cells/ml of HIV-I. At day 4, day 6 and day 8, cells are removed from the culture, washed and resuspended in cold PBS and fixed in ice cold methanol for 30 min. The fixed cells are stained with a FlTC-conjugated anti-p24monoclonal antibody (Coulter KC57) for intracellular p24 detection, include p24, with mouse anti-Tat IgG1 antibody (Repligen) for intracellular Tat detection as described earlier (Rigg, R.J., et al 1995. Detection of intracellular HIV- l Rev protein by flow cytometry. J.
Immun. Methods. 188:187-195). The samples are analyzed using a Becton-Dickinson FACScan.

EXAMPLE 4: Detection of antisense RNA in cells.
--Total cellular RNA from CEM-SS cells and from activated PBLs is extracted with RNAzol (Cinna/Biotecx). 10 mg RNA is fractionated on 1.2% agarose/formaldehyde gels, transferred to Hybond N membrane (Amersham), and hybridized in Rapid-hyb buffer CA 022~4819 1998-11-12 W 097/46673 PCTrEP97/02952 (Amersham). Oligonucleotides ( 100 ng) are radiolabeled with terminal transferase (Boehringer MA), using a-32P-dATP to a specific activity of 3xlo8 cpm/mg. DNA fragments are labeled by random priming (Boehringer MA). The membranes are hybridized with the labeled probe (5 x lo6 cpm/ml) at 65 ~C for 1 hour and ished with lxSSC, 0.1% SDS at 65~C, and exposed on X-ray film or analyzed on a PhosphorImager (Molecular Dynamics).

EXAMPLE 5:
Pol Anlis~l-sc~ t~tl inhibition of HIV-l rep'i ~ n in PBLs Transduction and HIV-I infection of human PBLs: PBLs are isolated from healthy donors buffy coats by gradient centrifugation. Enriched CD4+ cells are obtained by labeling bulk PBL with biotinylated aCD8+ and aCDI9+ antibodies followed by depletion with streptavidin conjugated m~netic beads (Dynabeads M-280, Dynal A.S., Norway). Theenriched CD4+ PBLs are s~imul~t~ with phytohemagglutinin (PHA, 5 llg/ml) on ~-irradiated allogenic feeder cells for 72 hours in Iscove's modified DMEM medium. PBLs (2x 1 o6) are transduced by spinoculation in the presence of Polybrene (8 ,ug/ml). After 48 hours, cells are analysed for CD4+ and Lyt2+ expression by flow cytometry using anti-CD4-FITC and anti-CD8-PE conjugated monoclonal antibodies. Lyt2+ expressing PBLs areagain enriched by magnetic bead selection. After the first enrichment, PBLs are expanded, and the CD4+/Lyt2+ cells are isolated using fluorescence-activated cell sorting (FACS, Beckton-Dickinson, Vantage). After the second enrichment, greater than 90% of the cell population is CD4+ and Lyt2+. Primary CD4+ T-cells (5x 104) are inoculated with 600 TCIDsO/ml HIV-I JR-CSF (5) in quadruplicate 4 days after the last restimulation of the cells. Half of the culture supernatant is exchanged daily for 9 days supernatants are stored at -7()~C, and ~24 Ag is determined by ELISA. Viable cells are counted by trypan blue exclusion 7 days after inoculation.

CA 022~4819 1998-11-12 W O 97/46673 PCT~EP97/02952 EXAMPLE 6:
Inhibition of HIV-1 rep!i~tion in _CEM-SS cells To compare the efficacy of the antisense sequences, transduced CEM-SS cells expressing complementary transcripts are infected with 4X102 TCIDsO/ml of the HIV-1 HXB3 virus.
HIV- I replication is monitored by measuring p24 antigen levels in the culture supernatant by ELISA. As negative control, a vector encoding the pol sequence in sense orientation (pLN-pol/S) is used. Fig. 16.A shows the relative efficacy of the different antisense sequences at low HIV-I inoculation dose. CEM-SS cells expressing the env antisense RNA
showed almost complete suppression of HIV-I replication, releasing 50 pg of p24/106 cells at day 18 post-inoculation. We have observed 3.0 log10 reduction of p24 antigen production with the pol 1 and pol2 antisense sequences and 1.0 log~0 reduction with the vif antisense sequence. The 3'LTR antisense construct is indistinguishable from the control vector, which correlates with the low expression level of antisense transcript observed by Northern blot (Fig. 15 B.). ln the following experiment, we increased the HIV-l inoculation dose 100-fold to 4x 104 TCIDs0lml and tested only the pol I, pol2, vif and env antisense constructs (Fig. 16B.). Overall, the onset of HIV- replication is much earlier and the replication kinetics are much faster than in the low MOI experiment. At day 10, the control CEM-SS
cells(pLN-poll/S) released high levels of p24 antigen in the culture supernatants (2x106 pg p24/106 cells). However, at this time point HIV-l virus replication is still substantially inhibited in all antisense CEM-SS cultures relative to control, Although, HIV replication levels are higher than in the previous experiment, intracellular env expression is again the most potent inhibitor ( 3.0 logl0 reduction) followed by pol 1 and pol2 (2.0 logl0 reduction) and the antisense vif sequence is the least potent antiviral inhibitor ( 1.0 log~0 reduction).
Similar results are observed when antisense RNA expressing CEM-SS cells are infected with the less cytopathic SF2 HIV- I strain (data not shown).

EXAMPLE 7:
Effect of antisense RNA length on HIV inhibition.

CA 022~4819 1998-11-12 W O 97/46673 PCT~EP97/02952 To confirm that our observation is not specific to the Y-gag antisense RNA, a vector encoding a shorter pol antisense fragments as described in Materials and Methods is constructed. The antiviral potency of the 790 nt long antisense pol fragment and the 1,400 nt pol I fragment is compared at 4x 103 TcIDso/ml of HIV- I HXB3 . An approximately 50%
decrease in anti-HIV- 1 efficacy with the shorter pol I sequence relative to the 1,400 nt pol 1 fragment is observed as shown in Fig. 17.A. This experiment provide further evidence that the length of the retrovirally expressed antisense RNA is an important factor for antiviral efficacy.
A vector encoding an antisense transcript of the complete pol gene reading frame is also generated to address the question whether increasing the antisense RNA length beyond 1,400 nt results in increased antiviral efficacy. Figure 17.B demonstrates that the 1,400 nt pol I antisense sequence is as efficient in blocking HIV- I replication as the 2,600 nt pol 12 antisense RNA. Since both pol 1 and pol2 antisense RNA yield comparable levels of inhibition, this experiment suggests that other factors in addition to expression level and transcript length may influence the efficacy of antisense RNA.

EXAMPLE 8:
Comparison of anti-HIV-l ef~lcacy of RevM10 and antisense RNAs.
The antiviral potency of antisense vif, poll, and env sequences at a high HIV-1 inoculation dose with RevM10, the trans-dominant form of the HIV-1 Rev protein is compared.
RevM 10 acts post-transcriptionally, preventing the transport of full length HIV- I transcripts from the nucleus to the cytoplasm. In order to test at which step the antisense RNA
interferes with the HIV-I life cycle, the effect of RevM10 and antisense RNA on HIV-I
RNA steady-state levels as well as on structural (p24 gag) and regulatory (Tat) protein expression ls analyzed. Polyclonal CEM-SS cell populations expressing RevM10, DRevM10 (Plavec, I., et al 1997. High transdominant RevM10 protein levels are required to inhibit HIV- l replication in cell lines and primary T cells: implication for gene therapy of AIDS. Gene Ther. 4:12~-139) and antisense vif, pol and env sequences are inoculated . . .. _ . "

CA 022~4819 1998-11-12 W 097/46673 PCT~P97/02952 with lx105 TCIDsollo6 cells HIV- l HXB3 (MOI: 0.1). The analyses of secreted p24antigen release into the cell supernatant indicate the rapid progression of viral replication in the control cultures (pLN and DRevM10), as well as in the RevMl0 and vif/AS cellpopulations (Fig. l9.). In contrast, 2.0 orders of magnitude lower p24 production is observed with the pol/AS and env/AS RNA expressing cells lines. Total RNA samples isolated from HIV- I infected cells at day 4, day 6 and day 8 post infection are analyzed. Northern blot analyses of day 4 samples shows low levels of HIV-l transcripts in all cultures (Fig.20.A.).
At this time point, the steady-state expression levels of all recombinant transcripts are comparable. At day 6 post infection (Fig. 20.E~.), the control vector (lane 3) and DRevM10 (lane 2) transduced cells express high steady-state levels of HIV- I transcripts. The RevM 10 (lane 1) and vif/AS (lane 4) vector transduced cells express 3-to 5-fold less than the respective control cell populations, and the pol/AS (lane 5) and env/AS (lane 6) vector transduced cells still express very low HIV-I RNA levels (Fig.20.B.). At this time point there are still comparable amount of recombinant transcript present in all cultures (lower panel). Analyses of the day 8 RNA samples (Fig.20.C.) demonstrated degradation and decreased amounts of all 3 RNA transcripts analyzed (HIV- I, vector transcripts and GAPDH) in the control cell populations, probably due to the massive HIV- I
induced cell death in these cultures. High levels of HIV-1 RNA are detected in the RevM10 and vif/AS expressing cells, increased about 5-fold in the pol/AS expressing cells, but is still very low in the env/AS RNA expressing cells. At the same time point, we also analyzed the intracellular p24 Gag and Tat protein levels in the infected cell population. FACS analysis of day 8 samples demonstrate that 27 % of the pol/AS and only 5 % of the env/AS RNA
expressing cells express de.tect~ble amount of p24 Gag protein (Fig.21.A.), which correlates with the observed low HIV transcript levels. At this time point, almost 100 % of the CEM-SS cells expressing the RevM10 gene or vif/AS RNA are positive for intracellular p24 Gag protein, although the vif/AS population produced lower p24 antigen levels (mean fluorescence intensity 135).

CA 022~4819 1998-11-12 W O 97/46673 PCTrEP97/02952 Measuring the intracellular Tat protein levels gave similar results, although the sensitivity of this assay is lower than for the p24 Gag protein detection. Fig.2 1 .B demonstrates that only 3-5 % of antisense pol and env RNA expressing cells produce detcct~hle Tat protein, which can explain the observed low overall HrV transcript levels.
The HIV-inhibitory effects of the vectors are depicted in figures 7 through 21. Vectors containing longer antisense fragments are more effective inhibitors, as are vectors containing antisense to the gag, pol, and/or the env regions. Combination vectors containing revM10 plus an antisense construct are more effective than vectors containing revM10 or antisense alone.

. .

CA 022~4819 1998-11-12 W O 97/46673 PCT~EP97/02952 SEQUENCE LISTING

(1) GENERAL INFORMATION:
ti) APPLICANT:
(A) NAME: Novartis AG
(B) STREET: Schwarzwaldallee 215 (C) CITY: Basel ~E) COUNTRY: Switzerland ~F) POSTAL CODE ~ZIP): 4058 ~G) TELEPHONE: +41 61 696 11 11 (H) TELEFAX: +41 61 696 79 79 ~I) TELEX: 962 991 (ii) TITLE OF INVENTION: Organic Compounds ~iii) NUMBER OF SEQUENCES: 10 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1396 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

~Xi) s~QU~N~'~ DESCRIPTION: SEQ ID NO: 1:

CA 022~4819 1998-11-12 W 097/46673 PCTrEP97/02952 ACCTACACCT GTCAACATAA TTGGAAGAAA ~ ~ACT CAGATTGGTT GCACTTTAAA 540 (2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1250 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

CA 022~4819 1998-11-12 W 097/46673 PCT~EP97/02952 TATTGGCAAG CCACCTGGAT TCCTGAGTGG GA~lL~ A ATACCCCTCC CTTAGTGAAA 420 (2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1391 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

CA 022~4819 1998-11-12 W O 97/46673 PCT~P97/02952 AGAATATGCA lllllllATA AACTTGATAT AATACCAATA GATAATGATA CTACCAGCTA 180 GCCAATTCCC ATACATTATT GTGCCCCGGC lG~llllGCG ATTCTAAAAT GTAATAATAA 300 TGTAACGCAC AGTTTTAATT GTGGAGGGGA AT~ AC TGTAATTCAA CACAACTGTT 780 AGCAGTGGGA ATAGGAGCTT TGTTCCTTGG ~~ GGGA GCAGCAGGAA GCACTATGGG 1200 CGCAGCCTCA ATGACGCTGA CGGTACAGGC CAGACAATTA ~ ~l~l~GTA TAGTGCAGCA 1260 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

CA 022~4819 1998-11-12 W 097/46673 PCT~P97/02952 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

(2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANnFnNF~5 single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

(2) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) sTR~NnEnNF~s: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

CA 022~4819 1998-11-12 W 097/46673 PCT~EP97/02952 (2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

(2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STR~NnF.nNF..sS single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

~xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

(2) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

Claims (10)

1. A nucleic acid sequence which, when stably integrated into a human cell, is capable of generating mRNA which anneals with a mRNA transcript from an HIV-1 provirus encoding env, env and pol or env, pol and gag and which is selected from:
(i) a sequence which is antisense to the 1.4 kb fragment from the Apa1 cleavage site at ca. base 2004 of an HIV-1 provirus to the Pflm 1 cleavage site ca. base 3400 of an HIV-1 provirus;
(ii) a sequence which is antisense to the 1.2 kb fragment from the Pflim1 cleavage site ca. base 3400 of an HIV-1 provirus to the EcoR1 cleavage site ca. base 4646 of an HIV-1 provirus;
(iii) a sequence which is antisense to the 1.3 kb fragment from the ApaL1 cleavage site ca. base 6615 of an HIV-1 provirus to the Bsm1 cleavage site ca. base 8053 of an HIV-1 provirus; and (iv) a sequence which is at least 80% homologous to a sequence according to (i), (ii). or (iii) and which is capable of generating mRNA which anneals to the same mRNA transcript as that annealing to mRNA generated by (i), (ii), or (iii).

2. A nucleic acid squence according to claim 1 which is antisense to the sequence depicted in Figure 1, 2, or 3.

3. A retroviral vector comprising at least one nucleic acid sequence according to claim 1 or 2.

4. A retroviral vector according to claim 3 further comprising at least one gene for an HIV
inhibitory protein.

5. A retroviral vector according to claim 4 wherein the HIV inhibitory protein is RevM10.

6. A cellular composition comprising at least one human hematopoietic cell stably transduced with an antisense sequence according to claim 1 or 2 above and optionally additionally stably transduced with a gene for an HIV inhibitory protein.

7. The cellular composition according to claim 6 wherein the human hematopoietic cell is a hematopoietic stem cell, and the HIV inhibitory protein is RevM10.

8. A method for treatment of HIV-1 infection in a subject in need thereof comprising isolating hematopoietic cells from said patient;
transducing said cells using a vector according to any of claims 3, 4 or 5; and reintroducing the transduced cells into the patient.

9. The use of an antisense sequence according to claim 1 or 2 or a vector according to claim 3, 4 or 5 in the manufacture of a cellular composition according to claim 6 or 7 or in a method of treatment according to claim 8.

10. All novel compounds, processes and utilities substantially as described herein, particularly with reference to the examples.