CA2253245A1 - Fungus resistant transgenic plants - Google Patents

Abstract

A method of conferring fungal resistance on plants is described. In the method, a DNA construct which encodes a Stylosanthes humilis peroxidase isogene or the like is introduced into cells of the plant. The construct is stably incorporated into the plant genome.

Description

CA 022~324~ 1998-10-28 I

FUNGUS RESlSTANT TRANSGENIC PLANTS
TECHNICAL FIELD
This invention relates to transgenic plants with enhanced resistance to fungal pathogens.
According to the invention, a transgenic plant is prepared by the transfer of a DNA sequence into the 5 plant, which DNA sequence encodes a particular peroxidase enzyme. More specifically, the invention relates to the use of a Stylosanthes humilis peroxidase isogene in transgenic plants for the purpose of enhanced disease protection.
BACKGROUND ART
Diseases of crop plants have a considerable impact on the agricultural industries causing ] 0 millions of tons of crop losses every year. Consequently, breeding resistant plant varieties USillg genes ~;om compatible species has been the major objective of many plant breeding programs. With the advent of recombinant DNA techni~ues it has become possible to transfer genes between incompatible plant species to improve characteristics of a desired plant. One approacll to prot~cting plants aL~ainst microbes is to engineer the over-expression of plant genes that play a role in plant 15 defence.
Plants can resist attack by a pathogen via a of complex network of defence mechanisms (Dixon and Harrison, Adv. Genet. 28:165-234 [1990]). Plants defence systems may include t'ormation of physical barriers (cutin, lignin, callose), the expression of low molecular weight antibiotic compounds (phytoalexins) and anti-fungal proteins. Ectopic over-expression of anti-fullgal proteins 2() such as chitinases and ,B-1,3-glucanases and other plant proteins such as ribosome inactivating proteills have shown to mediate increased protection against phytopatl-ogens (Broglie ~t al.. 51aience 254:1194-] 197 [1991]; Jach et al., Plant J. 8:97-109 [1995]; Liu ~t al., Bio/T~cl7nolo~, 13:(~(-691 [1994]; l ogeman ~t al., Bio/Technology 10:305-308 [1992]). One class of defence-lelated enzymes frequently hypothesised to have a role in defence are the peroxidases but to our knowledge the ,genes 25 encodin~ these enzymes have not been successfully used in transgenic plants to engineer disease resistance.
Peroxidases (E.C. 1.11.1.7, donor:hydrogen-peroxidase oxidoreductase) have been implicated in a number of physiological functions that may be important in plant-pathogen interactiorls. These include lignification (Walter, M.H. in "Genes Involved in Plant Defense" T. Boller and F. Meins, 30 eds. Springer-Verlag" Wien, New York pp. 327-352 [1992]), cross-linking of cell wall components (Bradley et al., Cell 70:21 -30 [1992]), wound healing (Sherf et al., Plant Physiol. 1 () 1 :2() 1 -2()~
[1993]) and auxin oxidation (Grambow and Langenbeck-Schwich, Planta 157:131-137 [1983]).
Some isoforms of peroxidases are also shown to be inducible by pathogens (Svalhein and Robertson, Physi(ll. Pia71t Pl1ysiol. 78:261-267 [1990]; Kerby and Somrnerville, Plant Ph-v~siol 1()0:397-4()2 35 [1992]) and by wounding (Lagrimini and E~othstein, Plant Physiol. 84:438-442 [1987]). ln addition there is substantial correlative evidence suggesting that peroxidase has a role in disease resistance.

SIJ~3 111 ~lTE SHEET (RULE 26) CA 022~324~ 1998-10-28 Association of some peroxidase isoforms with systernic acquired resistance and hypersensitive responses have been demonstrated (Ye et al., Physiol. ~ol. Plant Pathol. 36:523-531 [1990]; lrwing and Kuc, P1~ysiol. Mol. Plant Pathol. 37:355-366 [1990]). A high level of constitutive peroxidase expression (as well as other defence-related enzymes) in a hybrid between Nicotiana ,~~ tin0.sa x N.
5 debnc~yi was also found to be associated with resistance to a number of tobacco pathogens including Phyto/711t11(7ra para~itica var. nicotiana (Goy et al., Physiol. Mol. Plant Pathol. 41:11-21 [1992]).
High levels of peroxidase activity has been used as a marker for resistance to downy mildew in muskmelon (Reuveni et al., Phytopthol. 4 82:749-753 [1992]). Peroxidase enzymes can generate toxic radicals which are ir~hibitory to the growth of fungal pathogens in vit~-o (Peng and Kuc, ]() Phytopathol. 82: 696-699 [1992]). In animal systems, peroxidases have also been implicated in defense against microbial and protozoan pathogens (Srnith et al., Science 268: 284-28( [19')5] and Odell and Segal, Biochi)7l. Biophys. Acta 971 :266-274 [1988]).
Several investigators have cloned and studied the regulation and function of particulal peroxidase isogenes fiom various species (Lagrirnini et al., Proc. Natl. Acad. Sci. U5A 84:7542-15 7546 [1983]; Buffard et al., Proc. Natl. Acad. Sci. USA 87:8874-8878 [1990]; Roberts and Kolattukudy, Mol. Ge11. Genet. 217:223-232 [1989]). Expression of particular peroxidase isogenes during the infection process has also been demonstrated. For instance, in tomato at least three different peroxidase genes are induced by infection (Mohan and Kolattukudy, Plant Phv.siol 92:276-280 [199()]; Sherf et al. [Supra]; Vera et al., Mol. Plan~. MicrobeInteract. 6:79()-794 [1993]).
2() Ery~ip11eg/ar7linisf: sp. ho)dei infection in barley differentially induces two distinct peroxidase isogenes (Thordal-Christensen et al., Physiol. Mol. Pla~tt Pathol. 40:395-409 [1992]).
Previous work at the Cooperative Research Centre for Tropical Plant Pathology has shown that infection of' the tropical forage legume Stylosanthe.s humilis by Colletot~ichu~n ~JI(lco.sl70~ loi(le~ also induces peroxidase activity. Several peroxidase cDNA clones were isolated from S. hlln1ili.s and a 25 peroxidase isogene corresponding to Sphx6 was found to be strongly induced by the pathogen 4 hours after inoculation (Harrison et al., Mol. Plant Mic. Inte~. 8:398-406 [1995]). This time point precedes the primary penetration event demonstrating that early recognition and signallin,, process are involved in peroxidase gene expression during fungal infection.
It is evident from these studies that only some of the isoforms of peroxidases may be involved 30 in plant pathogen interaction. Constitutive expression of such peroxidase isogenes in transgenic plants may lead to a disease resistant phenotype.
Several investigators have constitutively expressed peroxidase isogenes in transge1lic planls (Sherf and Kolattukudy, Plant J. 3:829-833 [1993]; Lagrirnini et al., J. An1er. ~c. Horl. 5'ci.
117: 1 ()12-1016 [1992]; Lagrirnini, Plant Physiol. 96:577-583 [1991]). However, there has been no 35 report regarding disease resistant phenotypes of such plants expressing high levels of peroxidases.
Australia Patent Application No AU-B-52183/90 discloses a cucumber basic peroxidase cDNA

SUBSTITUTE SHEET (RULE 26) CA 022~324~ 1998-10-28 clone and chimaeric genes constructed using this clone for possible expression in transgenic plants for enhanced disease resistant phenotype. However, the peroxidase gene described in this document does not have any close overall homology to the Shpx6 peroxidase gene. Additionally, inoculation data is not given in AU-B-52183/90 so there is no evidence of the successful application of cucumber basic 5 peroxidase in genetically engineering disease resistance in transgenic plants.- SUMMARY OF THE INVENTlON
One of the objects of the present invention is to provide a method of genetically engineering plants so as to provide plants having an enhanced disease resistance phenotype with respect to wild type plants.
Another object of the present invention is to provide transgenic plants capable of constitutive expression of a peroxidase activity thereby providing an enhanced disease resistance phellotype with respect to the wild type plants.
According to a first embodiment of the invention, there is provided a method of engineeling a plant to t'ungal resistance, the method comprising introducing into cells of the plant a DNA construct 1 5 comprising:
(a) a promoter constitutively operative in the plant cell; and (b) a DNA sequence encoding a peroxidase isozyme operatively linked to said prollloter, wherein said DNA sequence is selected from:
(i) Shpx6 herein defined;
(ii) a sequence which hybridises to Shpx6 under stringent conditions and which encodes a protein having peroxidase activity;
(iii) a fragment of a DNA sequence according to (i) or (ii), whicll fragment encodes a protein having essentially the same activity as the peroxidase isozyme encoded by Shpx6.
According to a second embodiment of the invention, there is provided a plant cell halbo~lring a DNA construct comprising:
(a) a promoter constitutively operative in the plant cell; and (b) a DNA sequence encoding a peroxidase isozyme operatively linked to said promoter, wherein said DNA sequence is selected from:
(i) Shpx6 herein defined;
(ii) a sequence which hybridises to Shpx6 under stringent conditions and which encodes a protein having peroxidase activity;
(iii) a fragment of a DNA sequence according to (i) or (ii), which f1-agment encodes a protein having essentially the same activity as the peroxidase isozyme encoded by Shpx6.
According to a third embodiment of the invention, there is provided a plant comprising cells SU~S 111 IJTE SHEET (RULE 26) CA 022~324~ 1998-10-28 WO 97/41237 ' PCT/AU97/00253 according to the second embodiment.
According to a fourth embodiment of the invention there is provided reproductive material, vegetative material or other regenerable tissue of the plant according to the third embodiment.
Other aspects of the invention will become apparent from a reading of the following detailed S description.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic representation of the relevant portion of the binary vector (pGA643) containing a promoter-Sphx6-terminator construct.
Figule 2 shows the level of total leaf peroxidase activity in transgenic Tl and T. tobacco 10 farnilies and in an untransforrned control family.
Figure 3 shows the level of total leaf peroxidase activity in transgenic T, and T. canola families and in an untransformed control family.
Figure 4 shows inoculation data of transgenic and control tobacco i'amilies with Phl)tl1~plllora para.sitica cv nicotiaMa.
Figule 5 shows inoculation data of transgenic and control canola families (Tl, T. and T,) with Lepto.spl1aeria maculan~.
Figule 6 shows glasshouse inoculations of adult plants of transgenic (~) and colltrol canola families with Lepto~pilaeria ~naculans.
Figule 7 shows inoculation data of transgenic (T, and T,) and control canola families with 2() Sclerotinia.sclerotorium.
BEST MODE AND OTHER MODES OF PERFORMING THE INVENTION
The following abbreviations are used hereafter:
PCR polymerase chain reaction BAP 6-benzylaminopurine MS Murashige-Skoog medium (Murashi~e and Skoog, Pl7y.siolo~,Jc~ Pla/7t(/l um 15:473-497 [1962], the entire contents of which are incorpol-ated helein by cross-reference) .
NAA napthalene acetic acid The present invention describes a process for the production of trans~enic plants which have 3() enhanced disease resistance. In this process, a chimaeric gene is constructed and transl'erred to plants using any of the well established methods of plant transformation which include ~grol)acteriu mediated transformation (Horsch et al., Scie~lce 227:1229-1231 [1985]), electroporation into protoplasts (Fromrn ~t al., Nature 319:791-793 [1986]) and biolistic bombardment witll DNA coated tungsten or gold particles (Klein et al., Proc. Natl. ~cad. Sci. US~ 85:8502-8505 [1')~8]).
35 Transgenic plant cells including the DNA construct of the invention can be propagated using conditions appropriate to the particular plant. Similarly, whole plants, or propagati]lC material of the 5~ JTE SHEET(RULE 26) CA 022~324~ 1998-10-28 WO 97t41237 PCT/AU97/00253 plant, can be prepared from the initial transgenic cells using known methods and conditions.
Chimaeric genes according to the invention have as a basis the peroxidase isogene whicll can be isolated from the tropical forage legume Stylosanthes humilis. This isogene has been desi~nated Sphx6 and is described in Harrison et al., Mol. Plant-Microbe Interact. X:398-406 (1~35), the entire 5 contents of which is incorporated herein by cross-reference.
The chimaeric gene constructs of the invention comprise:
I) a DNA sequence encoding the Shpx6 peroxidase (Genbank Accession # L3611();
Harrison et al., supra; SEQ ID NO:l herein) or a sequence encoding a peroxidase having essentially the same characteristics as the Shpx6 peroxidase;
102) a suitable promoter with or without other regulatory elements for constitutive or inducible expression in plants of the peroxidase encoded by (I); and optionally,3) a suitable sequence for terrnination of transcription in plants.
As indicated above and in the description of the first and second embodiments, chimaeric genes accordin~ to the invention comprise not only the Shpx6 peroxidase but also allelic variants and 15 homolo~ues of Shpx6. The homologue can be an alternative S. humilis gene or a gene of anotl1er plant species. The chimaeric genes can further include DNA sequences which hybridise with the Shpx6 peroxidase sequence under stringent conditions. Such stringent conditions can be defined as follows:
Wash solution 0.1 xSSPE/0. 1 % SDS
Wash temperature 65~C
Nunlber of washes two (lxSSPE is a solution consisting of 180 mM NaCI, I() mM NaH~PO4 and 1 mM EDTA~ and which has a pH oi' 7.4).
DNA sequences for inclusion in constructs according to the invention can be prepaled or 25 isolated using any of the methods known to those of skill in the art. Such methods are described in Sambrook et al., Molecular Cloning: a Laboratory Manual 2nd Ed., Cold Spring Harboul Laboratory Press, Cold Spring Harbour NY (1989) and Ausebel et al., Culrent Protoc~7l.s il7 Molecular Biology, John Wiley & Sons, Inc., USA (1987-1995), the entire contents of which are incorporated herein by cross-reference. For example, an Shpx6 homologue or allelic variallt can be 30 isolated f'rom a genomic or cDNA library using hybridisation probes derived f'rom the Sphx6 sequence. The Sphx6 sequence can also be used to derive oligonucleotide primers which can be used to amplify desired gene sequences by PCR. Harrison et al. (sup~a) describe a n ethod of isolatin~
Shpx6 from S. humili.s genomic DNA.
With reference to item (ii) above, the promoter can be selected to ensure strong constitutive 35 expression of the peroxidase protein in most or all plant cells, it can be a promoter whicl1 ensures expression in specific tissues or cells that are susceptible to fungal infestation, and it can also be a SUBSTITUTE SHEET(RULE 26) CA 022~324~ 1998-10-28 promoter which ensures strong induction of expression during the infection process. Examples of other regulatory sequences which can be included in constructs are enhancers, untranslated re~ions of some transcripts and intron sequences from eukaryotic genes which can be used in combination with the suitable promoter. It will be appreciated by those of skill in the art that a promoter is not 5 essential and the peroxidase encoded by the DNA sequence can be stably expressed in plant cells without ally promoter present in the construct provided that insertion of the DNA sequence into the ~enome is in such a position that the sequence is operatively linked to a native plant promotel or similar regulatory sequences.
Re~arding item (iii) above, transcription terminators operative in plant cells are well known in 1('7 the art and are described, for example, in Ingelbrecht et a~., The P~ant Cell I: fi71-68() (I 9~9), the entire contents of which is incorporated herein by cross-reference. A preferredtelminatolistlle Sphx6 terminator or the terrninator of a homologue or allelic variant. ~owever, depending on the site oi' inseltion of the construct into a plant genome, a terminator may not be requiled and terminatols naturally present in the genome of the transformed plant may be utilised.
The DNA constructs of the invention can be introduced into both monocotyledonous and dicotyledonous plants. The plant is typically from a family of plants of agricultural importance such as cereals, legumes, oilseed plants, sugar and fibre plants. ~lowever, plants that are not of agricultur~l importance can be transformed with the subject DNA constructs so that they exhibit a greater degree of resistance to fungal infestation. Specific examples of plants which Call be 2() genetically modified with DNA constructs according to the invention are maize, banana, peanul, field peas, sunflower, tomato, canola, tobacco, wheat, barley, oats, potato, soybeans~ cotton, carnations, and sorghum.
Plant cells can be transt'ormed with DNA constructs of the invention according to a variety of known methods (Agrobacterium, Ti plasmids, electroporation, micro-injections, micro-projectiie gUIl, 25 and the like) as has been briefly discussed above. Two such suitable methods will now be described.
Firstly, the DNA construct can be ligated into a binary vector carrying: i) left and right border sequences that flank the T-DNA of the Agrobacterium tumefaciens Ti plasmid; ii) a suitable selectable marker gene for the selection of antibiotic resistant plant cells; iii) origins of replication that function in either A. tumefaciens or Escherichia coli; and, iv) an antibiotic resistalIce gelle that 3() allows selection of plasmid-carrying cells of A. tumefàciens and E. coli. This binary vector carrying the chimaeric DNA construct can be introduced by either electroporation or triparental matin~ into A.
7umefacicll~s strains carrying disarmed Ti plasmids such as strains LBA44()4~ GV3101, and AGLlor into A. rltl~ogencs strains such as R4 or NCCP1885. These Agrobacteriu777 strains Call then be co-cultivated with suitable plant explants or intact plant tissue and the transformed plant cells and/or 35 regenerants selected by using antibiotic resistance.
A second method of gene transfer to plants can be achieved by direct insertion of the gene in S~J~S 1111 ITE SHEET (RULE 26) CA 0225324~ 1998-10-28 W O 97/41237 ' PCT/AU97/00253 target plant cells. For example, the DNA construct can be co-precipitated onto gold or tungsten particles along with a plasrnid encoding a chimaeric gene for antibiotic resistance in plants. The tungsten particles can be accelerated using a fast flow of helium gas and the particles allowed to bombard a suitable plant tissue. This can be an embryogenic cell culture~ a plant explant, a callus 5 tissue or cell suspension or an intact meristem. Plants can be recovered using the antibiotic resistance gene for selection and antibodies used to detect plant cells expressing the peroxidase protein .
As described above in the fourth embodiment, the invention provides reproductive material, vegetative material, or other regenerable tissue of a plant which includes a DNA construct according 10 to the invention. Seeds and pollen are included within the ambit of reproductive material and stem segments or cuttings within the arnbit of vegetative material.
The invention will now be illustrated by the following non-limiting examples.
General Methods M~mipulation of DNA and RNA was carried out using known methods such as those described 15 by Sambrook et al. (M~lecular Cloning: a Laboratory Manual, 2nd Ed., Cold Spring l-larbou Laboratory Press, Cold Spring Harbour NY [1989]).
Reagents and other material were obtained from commercial sources or as otherwise indicated.

Construction of a chimaeric gene 2() ll1 this example, we describe the construction of a chimaeric gene comprising a constitutive promoter and the coding region of Shpx6. The coding region of the Shpx6 cDNA (nucleotides 42 to 10()1 of the S~Q ID NO:l sequence - see SEQ ID NO:2 for the amino acid sequence) was amplified from plasmid pBluescript II SK+ ~Strategene) by the polymerase chain reaction (PCR) using the following oligonucleotide primers:
Primer 1 5' GGCTCTAGAAGTCGACATGGTTCG 3' l'rilller 2 ~' AACAGCTATGACCATG 3'.
The Primer 1 and 2 sequences were selected either wholly or at least partially lrom plasmid sequence either side of the Shpx6 insert. PCR primers were designed to incorporate restriction endonuclease sites to facilitate manipulation of the construct in general pulpose cloning (pBluescript) 30 and binary vectors for Agrobacterlum based plant transformation.
PCR products were digested with XbaI and ligated into pBluescript cut with the same en~yme.
Insertion of the Shpx6 cDNA was verified by DNA sequencing of the insert. DNA sequencin~ was perforn1ed on denatured double stranded DNA templates using automated methods on an Applied Biosystems (ABI) 373A instrument with the ABI PE~ISM Dye Deoxy Terminator Cycle Sequencing 35 Kit. Tl1e sequence was verified on both strands with overlap. Oligonucleotide primers used for DNA sequencing were synthesised on a Beckman Oligo 1000 DNA synthesiser Shpx6 insert was S~J~S ~11 IJTE SHEET (RULE 26) ... ..

CA 022~324~ 1998-10-28 later separated from the pBluescript DNA with XbaI and cloned into a binary vector - pGA643 (An et al., EMBO J. 4:227-288 [1985]). This created a transcriptional fusion between the constitutive expression promoter and the Shpx6 cDNA. Figure 1 schematically illustrates this fusion construct.
The binary vector carrying the chimaeric gene construct was then used to transform tobacco 5 and canola using an Agrobacterium tumefaciens mediated transformation system.

Preparation of transgenic plant cells ~ gl obacterium tu~ne,faciens was transformed with the vector carrying the chimaeric construct using electroporation (Nagel et al., FEMSMicrobiol. Let. 67:325-328 [1990]). Both tobacco and I () canola were transformed using A. tumefaciens strain LBA4404 (GibcoBRL). Tobacco (N. tal7acum) transformation was carried out essentially according to Horsch et al. (Sci~nce 227:122')-1231 ~1985]) using leaf discs and 1()0 mg/L kanarnycin as selective agent. For canola transformation, seeds of a double haploid canola line (141-227) derived from cv. Westar produced in the Crop Science Departlllent of the University of Guelph and Ontario Ministry of Agriculture were obtained from Dr.
15 W.D. Bewersdorf (Crop Science Department of the University of Guelph? Ontario, Callada). ~;eeds from this line were surface sterilised and germinated on MS salts (Murashige and Skoog~ .su/7la) complemented with 3% sucrose and 0.8~ agar under a regime of 16 h ligllt and 8 h dark at 24 ~C.
Hypocotyl segments (5-10 mm in length) were taken from 5 to 6 day-old sterile seedlings and preincubated for a day on callus-in-lueing medium including MS salts and vitamins, 3 "~, sucrose, I
2() mglL 2,4-D and 0.~% Difco Bacto-agar. ~g~obacteriu~ tw1qc,Jaci~ns harbouring peroxidase gene constructs was grown overnight in YEP medium (An et al., Pla/lt Phy.siolo~y Xl :30] -3()5 [19~]) with selective antibiotics. Before cocultivation, the absorbance at A6,", of the bacterial solution was determined and the number of bacteria was adjusted to lxl0~ per mL (A"(,~,=().03) in liquid callus inducing medium. Hypocotyl segments were incubated in bacterial solution with gentle shaking for 5 25 min, blotted on sterile filter papers placed on callus inducing medium for 2-3 days. Alter cocultivation, the segments were washed twice in liquid MS medium, blotted briefly on filter yaper and placed on MS medium solidified with Phytagar (Difco) or Phytagel (Sigma) and containing 150 mg/L timentin (Ticarcillin). After 5-7 days incubation on this medium, segments were transfe1 red on shoot receneration medium containing 3 mg/L BAP, 1 mg/L zeatin, 5 mg/L AgNOl, 25 mg/L
30 kanamycin and 150 mg/L timentin. Plates were sealed with Micropore taye (3M Health Care, MN, USA). The initial plating densities were 40-50 explants per plate. This was reduced to 2()-25 per plate in subsequent subcultures. Hypocotyl segments were subcultured onto fresh medium witllout AgNOl every two weeks. Differentiated shoots were transferred to jars. Elongation and root formation were established in a horrnone-free medium containing half strength MS and sucrose 25 35 mg/I kanamycin and 10() mg/L timentin. The transgenic status of the shoots was assessed by placing leaf discs on a medium containing 4 mg/L BAP, 0.5 mg/L NAA and 25-50 mg/L kanamycin St,~S 111 ~ITE SHEET (RULE 26) T-CA 022~324~ 1998-10-28 WO 97/41237 PCTlAU97/00253 for four weeks. Rooted transgenic shoots were transferred to soil and kept under a dome for a few weeks in controlled environment rooms before exposing the shoots to normal conditions.

Peroxidase assays for the analysis of transgenic plant tissue expressing Shpx6 Freshly harvested leaves from transgenic (T(" T" T, and T3) N. tabaccum cv. Xanthi and B.
napu~ cv. Westar (141-227) were frozen in liquid N2 for storage and subsequently homo~enised at 4~C in a microcentrifuge tube with a custom made tight-fitting stainless steel grinder attached to an electric drill using 3 volumes per unit fresh weight of buffer (10 mM sodium phosphate, 1 ~7O sodium 1() metabisulphite, pH 6.0). Homogenates were centrifuged at 14,000 rpm in a refrigerated microf'uge at 4~C tor 30 minutes and aliquots of supernatant frozen at -70~C. Peroxidase assays were carried out according to Rathmell and Sequeira (Plant Physiol 53:317-318 [1974]). Reactions contained 0.28 % guaiacol and 0.3 % H2O, in 50 mM sodium phosphate buffer (pH 6.0). The reaction rate was monitored at 470 mn. Reaction rates were linear and proportional to the enzyme concentratioll 15 added. Total protein was determined using the Bio-Rad protein assay adapted for microtitre plates.
Figures 2 and 3 show the total leaf peroxidase activities of the T, and T, transgenic tobacco and canola f'amilies, respectively. I)epending on the transgenic family, constitutive over-expression of Sphx6 resulted with 2-3 fold increases in the total leaf peroxidase activity over untransf'ormed control plants. In these figures, peroxidase activity in 10-20 plants from each transgenic and control 20 family was measured and values for t were calculated in pairwise comparison of the transgenic families with the control farnily. Standard deviations are indicated as arrows. I~amilies with diff'erent denoted letters show significant differences at P<0.05.

Development of transgenic Tl seed lines Genotype designations for transgenic plants used herein are in accordance with the f'ollowing convention: the initial plant resulting from a transforrnation event and having grown f'rolll tissue culture is designated a T" plant. Plants resulting from self pollination of the natural flowers of the T(, plant are Aesignated T,.
Transgenic plants (T") were grown to maturity. Flowers were allowed to self-pollinate and 3n seed pods collected after normal desiccation. Seeds from each individual plant were collected and stored separately. Each seed lot was tested by genetic segregation analysis to determine the number of Mendelian loci bearing the kanamycin resistant trait. Seeds collected from each T" plant were germinated on MS medium containing 400 mg/L kanamycin. The ratio of normal green (kan-r) versus bleached (kan-s) cotyledons was determined. Seedlings with green colour were transplallted to 35 soil for f'urther analyses.
To produce a f'urther generation, seeds were collected from Tl plants and the above pl-ocess SlJ~S ~ ITE SHEET (RULE 26) ... . . . . ~ . . ...

CA 022~324~ 1998-10-28 repeated to produce T. plants. T3 plants were sirnilarly produced.
E~AMPLE 5 Evaluation of transgenic plant tissue expressing Shpx6 for disease r~ t~nce S In this example. we describe the response of transgenic plants capable of expressing Shpx6 peroxidase to challenge from a variety of fungal pathogens.
Eight-week old transgenic tobacco plants from T~ and T~ transgenic families wele inoculated with the f'ungal pathogen Phytophthora parasitica var. nicotiana (black shank disease of tobacco) using the methods described by Robin and Guest (NZJ. Crop Hort. Sci. 22:159-166 [1994}). Ten I () plants were used for each farnily (transgenes and controls). Lesion lengths on the decapitated stems were measured daily for ~3 days postinoculation. Values for t were calculated in pairwise comparison of the transgenic f'amilies with control untransforrned plants.
The results of this experiment are presented in Figure 4 in which the filled bars represell~ Tl families and the vertically hatched bars represent T~ families. The error bars represent the standard 15 deviation for each family. Farnilies showing significant differences at P<().05 with respect to the controls are denoted by different letters above the error bars. Analysis of inoculation data f;-om this experiment showed that the transgenic families with higher peroxidase activity had sigllii;cantly better protectioll with respect to wild type plants.
l~or Leptt).spl7aef icl maculans (blackleg disease of canola) inoculations, cotyledons fi-om Tl, T~
2() and Tl canola seedlings were punctured and inoculated with the pycnidiospore suspension of 1()4 spores. Disease reaction, or index, was scored visually using a scale where "()" corresponded to complete resistance and "9" corresponded to complete susceptiblity to infectiom Based on thi~ scale, plants with an index of 0-3 were considered resistant, plants with an index of 4-( moderately resistant, and plants with an index of 7-9 susceptible. Thirty plants or more were used fol eacll 25 transgenic f'amily and untransforrned control families. Duncan's Multiple Range Test were used to statistically compare transgenic families with the untransformed controls.
Data from these inoculation experiments are presented in Figure 5. ln Figure 5, the horizontally hatched bars represent T~ families, the vertically hatched bars represent T, t'amilies, and the filled bars represent T3 families. Analysis of the data showed that some of the transgellic lines 3() had signif'icantly better protection against Leptosphaeria (P<0.05). To measure the response ol' adult plants to this pathogen, an inoculation experiment using 5-6 weeks old plants fiom Tl f'amilies were also done in the glasshouse. In this experiment, plant survival rate for each family was calculated as the percentage of plants that reached maturity and set seed. Data f'rom this inoculation experilllent are presented in Figure 6. Analysis of data showed that transgenic lines which per~'ormed 35 better in cotyledon inoculation tests displayed better survival rates.
For ~clerotinicl .sclerotorium inoculations, stems of 10 adult canola plants from each of Tl and SUBSTITUTE SHEET (RULE 26) CA 022~324~ 1998-10-28 T families were inoculated by securing a barley grain colonised by the l'ungus on the stem. Lesion extension was measured daily. Duncan s Multiple Range Test were used to statisticall!~ compare transgenic families with untransformed control plants. Data from the inoculation expeliment are presented in Figure 7 in which the filled bars represent T, families and the vertically hatched bars 5 represent T t'amilies. I~xperiments with Tl farnilies showed that some transgenic lines expressing Shpx6 had better protection against the fungus due to lower rates of lesion extension on their stems.
However next round inoculations done on T families did not show any signif'icant protection Peroxidase assays done on a subset of plants sampled before the inoculations also showed some reduction in the total peroxidase activity of these plants. This suggested that stable exp1ession of 1() transgene (Shpx6) is necessary for consistent disease resistance responce of canola agaillst S.
sclc~roloriu~n .

S~ ~S 111 ~JTE SHEET (RULE 26) .. .,. .... ... ~ . ~

CA 022~324~ 1998-10-28 SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:
(A) NAME: COOPERATIVE RESEARCH CENTRE FOR TROPICAL
PLANT PATHOLOGY
(B) STREET: The University of Queensland (C) CITY: St Lucia (D) STATE: Queensland (E) COUNTRY: Australia (F) POSTAL CODE (ZIP): 4067 (A) NAME: GRAINS RESEARCH & DEVELOPMENT CORPORATION
(B) STREET: National Circuit (C) CITY: Barton (D) STATE: ACT
(E) COUNTRY: Australia (F) POSTAL CODE (ZIP): 2600 (A) NAME: KAZAN, Kemal (US only) (B) STREET: l/24 Durham Street (C) CITY: St Lucia (D) STATE: Queensland (E) COUNTRY: Australia (F) POSTAL CODE (ZIP): 4067 (A) NAME: GOULTER, Kenneth C. (US only) (B) STREET: 26 Emblem Street (C) CITY: Jamboree Heights (D) STATE: Queensland (E) COUNTRY: Australia (F) POSTAL CODE (ZIP): 4074 (A) NAME: MANNERS, John M. (US only) (B) STREET: 28 Warmington Street (C) CITY: Paddington (D) STATE: Queensland (E) COUNTRY: Australia (F) POSTAL CODE (ZIP): 4064 (ii) TITLE OF INVENTION: Fungus Resistant Transgenic Plants (iii) NUMBER OF SEQUENCES: 2 (iv) COMPUTER READABLE FORM:

CA 022~324~ l998-l0-28 WO 97/41237 ' PCT/AU97/00253 ~A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO) s (2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1144 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Stylosanthes humilis (B) STRAIN: Paterson (F) TISSUE TYPE: stem (vii) IMMEDIATE SOURCE:
(B) CLONE: Shpx6 (ix) FEATURE:
3() (A) NAME/KEY: sig_peptide (B) LOCATION:42..113 (ix) FEATURE:
(A) NAME/KEY: mat peptide (B) LOCATION:114.. 1001 (x) PUBLICATION INFORMATION:
(A) AUTHORS: Harrison, S J
Curtis, M D
McIntyre, C L
Maclean, D J
Manners, J M
(B) TITLE: Differential expression of peroxidase isogenes during the early stages of infection of the tropical forage legume Stylosanthes humilis by Colletotrichum gloeosporioides (C) JOURNAL: Mol. Plant Microb. Interact.

. . . . .

CA 022~324~ l998-l0-28 (D) VOLUME: 8 (E) ISSUE: 3 (F) PAGES: 398-406 (G) DATE: 1995 (K) RELEVANT RESIDUES IN SEQ ID NO: 1: FROM l TO 1144 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

TAAAATCTCA AGTAGAGAGC TTGTGTCCTG ~l~l"l~lllC TTGTGCTGAT ATTCTTGCTG 420 CA 022~324~ l998-l0-28 (2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 320 amino acids (B) TYPE: amino acid (C) STRANDEDNESS:
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Stylosanthes humilis (B) STRAIN: Paterson (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Met Ala Ile Leu Ala Ile Ser Lys Val Cys Leu Ile Ile Leu Val Met Ser Leu Ile Gly Leu Gly Ser Gly Gln Leu Ser Ser Asn Phe Tyr Ala Thr Thr Cys Pro Asn Ala Leu Ser Thr Ile Arg Ser Gly Val Asn Ser 30 Ala Val Ser Lys Glu Ala Arg Met Gly Ala Ser Leu Leu Arg Leu His Phe His Asp Cys Phe Val Gln Gly Cys Asp Ala Ser Val Leu Leu Asp 65 70 75 ~0 Asp Thr Ser Asn Phe Thr Gly Glu Lys Thr Ala Arg Pro Asn Ala Asn Ser Ile Arg Gly Phe Glu Val Ile Asp Thr Ile Lys Ser Gln Val Glu Ser Leu Cys Pro Gly Val Val Ser Cys Ala Asp Ile Leu Ala Val Ala 45 Ala Arg Asp Ser Val Val Ala Leu Gly Gly Pro Ser Trp Thr Val Gln ... . ... . . : .

CA 022~324~ l998-l0-28 Leu Gly Arg Arg Asp Ser Thr Thr Ala Ser Leu Ser Leu Ala Asn Ser Asp Leu Ala Ala Pro Thr Leu Asp Leu Ser Gly Leu Ile Ser Ala Phe Ser Lys Lys Gly Leu Ser Thr Ser Glu Met Val Ala Leu Ser Gly Gly His Thr Ile Gly Gln Ala Arg Cys Thr Ser Phe Arg Thr Arg Ile Tyr Thr Glu Ser Asn Ile Asp Pro Asn Phe Ala Lys Ser Leu Gln Gly Asn Cys Pro Asn Thr Thr Gly Asn Gly Asp Asn Asn Leu Ala Pro Ile Asp Thr Thr Ser Pro Thr Arg Phe Asp Asn Gly Tyr Tyr Lys Asn Leu Leu Val Lys Lys Gly Leu Phe His Ser Asp Gln Gln Leu Phe Asn Gly Gly Ser Thr Asp Ser Gln Val Asn Gly Tyr Ala Ser Asn Pro Ser Ser Phe Cys Ser Asp Phe Gly Asn Ala Met Ile Lys Met Gly Asn Ile Ser Pro Leu Thr Gly Ser Ser Gly Gln Ile Arg Thr Asn Cys Arg Lys Thr Asn

Claims (18)

1. A method of engineering a plant to fungal resistance, the method comprising introducing into cells of the plant a DNA construct comprising:
(a) a promoter constitutively operative in the plant cell; and (b) a DNA sequence encoding a peroxidase isozyme operatively linked to said promoter, wherein said DNA sequence is selected from:
(i) Shpx6 herein defined;
(ii) a sequence which hybridises to Shpx6 under stringent conditions and which encodes a protein having peroxidase activity;
(iii) a fragment of a DNA sequence according to (i) or (ii), which fragment encodes a protein having essentially the same activity as the peroxidase isozyme encoded by Shpx6.

2. The method according to claim 1, wherein said promoter is the 35S promoter of Cauliflower Mosaic Virus.

3. The method according to claim 1, wherein said DNA sequence comprises SEQ ID NO: 1.

4. The method according to claim 1, wherein said peroxidase isozyme has an amino acid sequence substantially corresponding to SEQ ID NO: 2.

5. The method according to claim 1, wherein said fungal resistance is to Phytophthora parasitica, Leptosphaeria maculans, or Sclerotinia sclerotorium.

6. A plant cell harboring a DNA construct comprising:
(a) a promoter constitutively operative in the plant cell; and (b) a DNA sequence encoding a peroxidase isozyme operatively linked to said promoter, wherein said DNA sequence is selected from:
(i) Shpx6 herein defined;
(ii) a sequence which hybridises to Shpx6 under stringent conditions and which encodes a protein having peroxidase activity;
(iii) a fragment of a DNA sequence according to (i) or (ii), which fragment encodes a protein having essentially the same activity as the peroxidase isozyme encoded by Shpx6.

7. The plant cell according to claim 6, wherein said promoter is the 35S promoter of Cauliflower Mosaic Virus.

8. The plant cell according to claim 6, wherein said DNA sequence comprises SEQ ID NO: 1.

9. The plant cell according to claim 6, wherein said peroxidase isozyme has an arnino acid sequence substantially corresponding to SEQ ID NO: 2.

10. The plant cell according to claim 6, wherein said fungal resistance is to Phytophthora parasitica, Leptosphaeria maculans, or Sclerotinia sclerotorium.

11. The plant cell according to claim 6, wherein said DNA construct is incorporated into the genome of said plant cell.

12. A plant comprising cells according to claim 6.

13. The plant according to claim 12 which is a monocot or a dicot.

14. The plant according to claim 12 which is from a family of plants selected from cereals, legumes, oil seed plants, sugar or fibre plants.

15. The plant according to claim 12 which is selected from maize, banana, peanut, field peas?
sunflower, tomato, canola, tobacco, wheat, barley, oats, potato, soybeans, cotton, carnations, or sorghum.

16. Material of the plant according to claim 12, which material is selected from reproductive material, vegetative material, or other regenerable material.

17. Material according to claim 16, wherein said reproductive material is seed or pollen.

18. Material according to claim 16, wherein said vegetative material is a stem segment or a cutting.