AU713434B2 - Fungus resistant transgenic plants - Google Patents

Description

WO 97/41237 .PCT/AU97/00253 1 FUNGUS RESISTANT TRANSGENIC PLANTS TECHNICAL FIELD This invention relates to transgenic plants with enhanced resistance to fungal pathogens.

According to the invention, a transgenic plant is prepared by the transfer of a DNA sequence into the plant, which DNA sequence encodes a particular peroxidase enzyme. More specifically, the invention relates to the use of a Stylosanthes humilis peroxidase isogene in transgenic plants for the purpose of enhanced disease protection.

BACKGROUND ART Diseases of crop plants have a considerable impact on the agricultural industries causing millions of tons of crop losses every year. Consequently, breeding resistant plant varieties using genes from compatible species has been the major objective of many plant breeding programs. With the advent of recombinant DNA techniques it has become possible to transfer genes between incompatile plnnt nspciQe to impnrnve charcteristics of a desired nplnt. One annproah tn prntecting plants against microbes is to engineer the over-expression of plant genes that play a role in plant defence.

Plants can resist attack by a pathogen via a of complex network of defence mechanisms (Dixon and Harrison, Adv. Genet. 28:165-234 [1990]). Plants defence systems may include formation of physical barriers (cutin, lignin, callose), the expression of low molecular weight antibiotic compounds (phytoalexins) and anti-fungal proteins. Ectopic over-expression of anti-fungal proteins such as chitinases and 0-1,3-glucanases and other plant proteins such as ribosome inactivating proteins have shown to mediate increased protection against phytopathogens (Broglie et al., Science 254:1194-1197 [1991]; Jach et al., Plant J. 8:97-109 [1995]; Liu et al., Bio/Technology 13:686-691 [1994]; Logeman et al., Bio/Technology 10:305-308 [1992]). One class of defence-related enzymes frequently hypothesised to have a role in defence are the peroxidases but to our knowledge the genes encoding these enzymes have not been successfully used in transgenic plants to engineer disease resistance.

Peroxidases 1.11.1.7, donor:hydrogen-peroxidase oxidoreductase) have been implicated in a number of physiological functions that may be important in plant-pathogen interactions. These include lignification (Walter, M.H. in "Genes Involved in Plant Defense" T. Boller and F. Meins, eds. Springer-Verlag, Wien, New York pp. 327-352 [1992]), cross-linking of cell wall components (Bradley et al., Cell 70:21-30 [1992]), wound healing (Sherf et al., Plant Physiol. 101:201-208 [1993]) and auxin oxidation (Grambow and Langenbeck-Schwich, Planta 157:131-137 [1983]).

Some isoforms of peroxidases are also shown to be inducible by pathogens (Svalhein and Robertson, Physiol. Plant Physiol. 78:261-267 [1990]; Kerby and Sommerville, Plant Physiol. 100:397-402 [1992]) and by wounding (Lagrimini and Rothstein, Plant Physiol. 84:438-442 [1987]). In addition there is substantial correlative evidence suggesting that peroxidase has a role in disease resistance.

SUBSTITUTE SHEET (RULE 26) WO 97/41237 .PCT/AU97/00253 2 Association of some peroxidase isoforms with systemic acquired resistance and hypersensitive responses have been demonstrated (Ye et al., Physiol. Mol. Plant Pathol. 36:523-531 [1990]; Irwing and Kuc, Physiol. Mol. Plant Pathol. 37:355-366 [1990]). A high level of constitutive peroxidase expression (as well as other defence-related enzymes) in a hybrid between Nicotiana glutinosa x N.

debneyi was also found to be associated with resistance to a number of tobacco pathogens including Phytophthora parasitica var. nicotiana (Goy et al., Physiol. Mol. Plant Pathol. 41:11-21 [1992]).

High levels of peroxidase activity has been used as a marker for resistance to downy mildew in muskmelon (Reuveni et al., Phytopthol. 4 82:749-753 [1992]). Peroxidase enzymes can generate toxic radicals which are inhibitory to the growth of fungal pathogens in vitro (Peng and Kuc, Phytopathol. 82: 696-699 [1992]). In animal systems, peroxidases have also been implicated in defense against microbial and protozoan pathogens (Smith et al., Science 268: 284-286 [1995] and Odell and Segal, Biochim. Biophys. Acta 971:266-274 [1988]).

Several investigators have cloned and studied the regulation and function of particular peroxidase isogenes from various species (Lagrimini et al., Proc. Natl. Acad. Sci. USA 84:7542- 7546 [1983]; Buffard et al., Proc. Natl. Acad. Sci. USA 87:8874-8878 [1990]; Roberts and Kolattukudy, Mol. Gen. Genet. 217:223-232 [1989]). Expression of particular peroxidase isogenes during the infection process has also been demonstrated. For instance, in tomato at least three different peroxidase genes are induced by infection (Mohan and Kolattukudy, Plant Phvsiol 92:276- 280 [1990]; Sherf et al. [Supra]; Vera et al., Mol. Plant. Microbe Interact. 6:790-794 [1993]).

Erysiphe graminisf sp. hordei infection in barley differentially induces two distinct peroxidase isogenes (Thordal-Christensen et al., Physiol. Mol. Plant Pathol. 40:395-409 [1992]).

Previous work at the Cooperative Research Centre for Tropical Plant Pathology has shown that infection of the tropical forage legume Stylosanthes humilis by Colletotrichum gloeosporioides also induces peroxidase activity. Several peroxidase cDNA clones were isolated from S. humilis and a peroxidase isogene corresponding to Sphx6 was found to be strongly induced by the pathogen 4 hours after inoculation (Harrison et al., Mol. Plant Mic. Inter. 8:398-406 [1995]). This time point precedes the primary penetration event demonstrating that early recognition and signalling process are involved in peroxidase gene expression during fungal infection.

It is evident from these studies that only some of the isoforms of peroxidases may be involved in plant pathogen interaction. Constitutive expression of such peroxidase isogenes in transgenic plants may lead to a disease resistant phenotype.

Several investigators have constitutively expressed peroxidase isogenes in transgenic plants (Sherf and Kolattukudy, Plant J. 3:829-833 [1993]; Lagrimini et al., J. Amer. Soc. Hort. Sci.

117:1012-1016 [1992]; Lagrimini, Plant Physiol. 96:577-583 [1991]). However, there has been no report regarding disease resistant phenotypes of such plants expressing high levels of peroxidases.

Australia Patent Application No AU-B-52183/90 discloses a cucumber basic peroxidase cDNA SUBSTITUTE SHEET (RULE 26) WO 97/41237 PCT/AU97/00253 3 clone and chimaeric genes constructed using this clone for possible expression in transgenic plants for enhanced disease resistant phenotype. However, the peroxidase gene described in this document does not have any close overall homology to the Shpx6 peroxidase gene. Additionally, inoculation data is not given in AU-B-52183/90 so there is no evidence of the successful application of cucumber basic peroxidase in genetically engineering disease resistance in transgenic plants.

SUMMARY OF THE INVENTION One of the objects of the present invention is to provide a method of genetically engineering plants so as to provide plants having an enhanced disease resistance phenotype with respect to wild type plants.

Another object of the present invention is to provide transgenic plants capable of constitutive expression of a peroxidase activity thereby providing an enhanced disease resistance phenotype with respect to the wild type plants.

According to a first embodiment of the invention, there is provided a method of engineering a plant to fungal resistance, the method comprising introducing into cells of the plant a DNA construct comprising: a promoter constitutively operative in the plant cell; and a DNA sequence encoding a peroxidase isozyme operatively linked to said promoter, wherein said DNA sequence is selected from: Shpx6 herein defined; (ii) a sequence which hybridises to Shpx6 under stringent conditions and which encodes a protein having peroxidase activity; (iii) a fragment of a DNA sequence according to or which fragment encodes a protein having essentially the same activity as the peroxidase isozyme encoded by Shpx6.

According to a second embodiment of the invention, there is provided a plant cell harbouring a DNA construct comprising: a promoter constitutively operative in the plant cell; and a DNA sequence encoding a peroxidase isozyme operatively linked to said promoter, wherein said DNA sequence is selected from: Shpx6 herein defined; (ii) a sequence which hybridises to Shpx6 under stringent conditions and which encodes a protein having peroxidase activity; (iii) a fragment of a DNA sequence according to or which fragment encodes a protein having essentially the same activity as the peroxidase isozyme encoded by Shpx6.

According to a third embodiment of the invention, there is provided a plant comprising cells SUBSTITUTE SHEET (RULE 26) WO 97/41237 .PCT/AU97/00253 4 according to the second embodiment.

According to a fourth embodiment of the invention there is provided reproductive material, vegetative material or other regenerable tissue of the plant according to the third embodiment.

Other aspects of the invention will become apparent from a reading of the following detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic representation of the relevant portion of the binary vector (pGA643) containing a promoter-Sphx6-terminator construct.

Figure 2 shows the level of total leaf peroxidase activity in transgenic T| and T, tobacco families and in an untransformed control family.

Figure 3 shows the level of total leaf peroxidase activity in transgenic T, and T, canola families and in an untransformed control family.

Figure 4 shows inoculation data of transgenic and control tobacco families with Phytopnhora parasitica cv nicotiana.

Figure 5 shows inoculation data of transgenic and control canola families T, and T 3 with Leptosphaeria maculans.

Figure 6 shows glasshouse inoculations of adult plants of transgenic and control canola families with Leptosphaeria maculans.

Figure 7 shows inoculation data of transgenic and T 2 and control canola families with Sclerotinia sclerotorium.

BEST MODE AND OTHER MODES OF PERFORMING THE INVENTION The following abbreviations are used hereafter: PCR polymerase chain reaction BAP 6-benzylaminopurine MS Murashige-Skoog medium (Murashige and Skoog, Physiologea Plantarum 15:473-497 [1962], the entire contents of which are incorporated herein by cross-reference).

NAA napthalene acetic acid The present invention describes a process for the production of transgenic plants which have enhanced disease resistance. In this process, a chimaeric gene is constructed and transferred to plants using any of the well established methods of plant transformation which include Agrohacteriuni mediated transformation (Horsch et al., Science 227:1229-1231 [1985]), electroporation into protoplasts (Fromm et al., Nature 319:791-793 [1986]) and biolistic bombardment with DNA coated tungsten or gold particles (Klein et al., Proc. Natl. Acad. Sci. USA 85:8502-8505 [1988]).

Transgenic plant cells including the DNA construct of the invention can be propagated using conditions appropriate to the particular plant. Similarly, whole plants, or propagating material of the SUBSTITUTE SHEET (RULE 26) WO 97/41237 PCT/AU97/00253 plant, can be prepared from the initial transgenic cells using known methods and conditions.

Chimaeric genes according to the invention have as a basis the peroxidase isogene which can be isolated from the tropical forage legume Stylosanthes humilis. This isogene has been designated Sphx6 and is described in Harrison et al., Mol. Plant-Microbe Interact. 8:398-406 (1995), the entire contents of which is incorporated herein by cross-reference.

The chimaeric gene constructs of the invention comprise: 1) a DNA sequence encoding the Shpx6 peroxidase (Genbank Accession L36110; Harrison et al., supra; SEQ ID NO:1 herein) or a sequence encoding a peroxidase having essentially the same characteristics as the Shpx6 peroxidase; 2) a suitable promoter with or without other regulatory elements for constitutive or inducible expression in plants of the peroxidase encoded by and optionally, 3) a suitable sequence for termination of transcription in plants.

/As ndicated above andI in thle deLsriptionUII L1 1first aIn secondI embodiment, chim ric gen according to the invention comprise not only the Shpx6 peroxidase but also allelic variants and homologues of Shpx6. The homologue can be an alternative S. humilis gene or a gene of another plant species. The chimaeric genes can further include DNA sequences which hybridise with the Shpx6 peroxidase sequence under stringent conditions. Such stringent conditions can be defined as follows: Wash solution 0. lxSSPE/0.1% SDS Wash temperature 65 0

C

Number of washes two (IxSSPE is a solution consisting of 180 mM NaC1, 10 mM NaH,PO 4 and 1 mM EDTA, and which has a pH of 7.4).

DNA sequences for inclusion in constructs according to the invention can be prepared or isolated using any of the methods known to those of skill in the art. Such methods are described in Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed., Cold Spring Harbour Laboratory Press, Cold Spring Harbour NY (1989) and Ausebel et al., Current Protocols in Molecular Biology, John Wiley Sons, Inc., USA (1987-1995), the entire contents of which are incorporated herein by cross-reference. For example, an Shpx6 homologue or allelic variant can be isolated from a genomic or cDNA library using hybridisation probes derived from the Sphx6 sequence. The Sphx6 sequence can also be used to derive oligonucleotide primers which can be used to amplify desired gene sequences by PCR. Harrison et al. (supra) describe a method of isolating Shpx6 from S. humilis genomic DNA.

With reference to item (ii) above, the promoter can be selected to ensure strong constitutive expression of the peroxidase protein in most or all plant cells, it can be a promoter which ensures expression in specific tissues or cells that are susceptible to fungal infestation, and it can also be a SUBSTITUTE SHEET (RULE 26) WO 97/41237 'PCT/AU97/00253 6 promoter which ensures strong induction of expression during the infection process. Examples of other regulatory sequences which can be included in constructs are enhancers, untranslated regions of some transcripts and intron sequences from eukaryotic genes which can be used in combination with the suitable promoter. It will be appreciated by those of skill in the art that a promoter is not essential and the peroxidase encoded by the DNA sequence can be stably expressed in plant cells without any promoter present in the construct provided that insertion of the DNA sequence into the genome is in such a position that the sequence is operatively linked to a native plant promoter or similar regulatory sequences.

Regarding item (iii) above, transcription terminators operative in plant cells are well known in the art and are described, for example, in Ingelbrecht et al., The Plant Cell 1:671-680 (1989), the entire contents of which is incorporated herein by cross-reference. A preferred terminator is the Sphx6 terminator or the terminator of a homologue or allelic variant. However, depending on the site of insertion of the construct into a plant genome, a terminator may not be required and terminators naturally present in the genome of the transformed plant may be utilised.

The DNA constructs of the invention can be introduced into both monocotyledonous and dicotyledonous plants. The plant is typically from a family of plants of agricultural importance such as cereals, legumes, oilseed plants, sugar and fibre plants. However, plants that are not of agricultural importance can be transformed with the subject DNA constructs so that they exhibit a greater degree of resistance to fungal infestation. Specific examples of plants which can be genetically modified with DNA constructs according to the invention are maize, banana, peanut, field peas, sunflower, tomato, canola, tobacco, wheat, barley, oats, potato, soybeans, cotton, carnations, and sorghum.

Plant cells can be transformed with DNA constructs of the invention according to a variety of known methods (Agrobacterium, Ti plasmids, electroporation, micro-injections, micro-projectile gun, and the like) as has been briefly discussed above. Two such suitable methods will now be described.

Firstly, the DNA construct can be ligated into a binary vector carrying: i) left and right border sequences that flank the T-DNA of the Agrobacterium tumefaciens Ti plasmid; ii) a suitable selectable marker gene for the selection of antibiotic resistant plant cells; iii) origins of replication that function in either A. tumefaciens or Escherichia coli; and, iv) an antibiotic resistance gene that allows selection of plasmid-carrying cells of A. tumefaciens and E. coli. This binary vector carrying the chimaeric DNA construct can be introduced by either electroporation or triparental mating into A.

tumefaciens strains carrying disarmed Ti plasmids such as strains LBA4404. GV3101, and AGL1 or into A. rhizogenes strains such as R4 or NCCP1885. These Agrobacterium strains can then be cocultivated with suitable plant explants or intact plant tissue and the transformed plant cells and/or regenerants selected by using antibiotic resistance.

A second method of gene transfer to plants can be achieved by direct insertion of the gene in SUBSTITUTE SHEET (RULE 26)

I

WO 97/41237 PCT/AU97/00253 7 target plant cells. For example, the DNA construct can be co-precipitated onto gold or tungsten particles along with a plasmid encoding a chimaeric gene for antibiotic resistance in plants. The tungsten particles can be accelerated using a fast flow of helium gas and the particles allowed to bombard a suitable plant tissue. This can be an embryogenic cell culture, a plant explant, a callus tissue or cell suspension or an intact meristem. Plants can be recovered using the antibiotic resistance gene for selection and antibodies used to detect plant cells expressing the peroxidase protein.

As described above in the fourth embodiment, the invention provides reproductive material, vegetative material, or other regenerable tissue of a plant which includes a DNA construct according to the invention. Seeds and pollen are included within the ambit of reproductive material and stem segments or cuttings within the ambit of vegetative material.

The invention will now be illustrated by the following non-limiting examples.

General Methods Manipulation of DNA and RNA was carried out using known methods such as those described by Sambrook et al. (Molecular Cloning. a Laboratory Manual, 2nd Ed., Cold Spring Harbour Laboratory Press, Cold Spring Harbour NY [1989]).

Reagents and other material were obtained from commercial sources or as otherwise indicated.

EXAMPLE 1 Construction of a chimaeric gene In this example, we describe the construction of a chimaeric gene comprising a constitutive promoter and the coding region of Shpx6. The coding region of the Shpx6 cDNA (nucleotides 42 to 1001 of the SEQ ID NO:1 sequence see SEQ ID NO:2 for the amino acid sequence) was amplified from plasmid pBluescript II SK' (Strategene) by the polymerase chain reaction (PCR) using the following oligonucleotide primers: Primer 1 5' GGCTCTAGAAGTCGACATGGTTCG 3' Primer 2 5' AACAGCTATGACCATG 3'.

The Primer 1 and 2 sequences were selected either wholly or at least partially from plasmid sequence either side of the Shpx6 insert. PCR primers were designed to incorporate restriction endonuclease sites to facilitate manipulation of the construct in general purpose cloning (pBluescript) and binary vectors for Agrobacterium based plant transformation.

PCR products were digested with Xbal and ligated into pBluescript cut with the same enzyme.

Insertion of the Shpx6 cDNA was verified by DNA sequencing of the insert. DNA sequencing was performed on denatured double stranded DNA templates using automated methods on an Applied Biosystems (ABI) 373A instrument with the ABI PRISM Dye Deoxy Terminator Cycle Sequencing Kit. The sequence was verified on both strands with overlap. Oligonucleotide primers used for DNA sequencing were synthesised on a Beckman Oligo 1000 DNA synthesiser. Shpx6 insert was SUBSTITUTE SHEET (RULE 26)

I

WO 97/41237 PCTAU97/00253 8 later separated from the pBluescript DNA with XbaI and cloned into a binary vector pGA643 (An et al., EMBO J. 4:227-288 [1985]). This created a transcriptional fusion between the constitutive expression promoter and the Shpx6 cDNA. Figure 1 schematically illustrates this fusion construct.

The binary vector carrying the chimaeric gene construct was then used to transform tobacco and canola using an Agrobacterium tumefaciens mediated transformation system.

EXAMPLE 2 Preparation of transgenic plant cells Agrobacterium tumefaciens was transformed with the vector carrying the chimaeric construct using electroporation (Nagel et al., FEMS Microbiol. Let. 67:325-328 [1990]). Both tobacco and canola were transformed using A. tumefaciens strain LBA4404 (GibcoBRL). Tobacco tabacum) transformation was carried out essentially according to Horsch et al. (Science 227:1229-1231 [1985]) using leaf discs and 100 mg/L kanamycin as selective agent. For canola transformation, seeds of a double haploid canola line (141-227) derived from cv. Westar produced in the Crop Science Department of the University of Guelph and Ontario Ministry of Agriculture were obtained from Dr.

W.D. Bewersdorf (Crop Science Department of the University of Guelph, Ontario, Canada). Seeds from this line were surface sterilised and germinated on MS salts (Murashige and Skoog, supra) complemented with 3% sucrose and 0.8% agar under a regime of 16 h light and 8 h dark at 24 OC.

Hypocotyl segments (5-10 mm in length) were taken from 5 to 6 day-old sterile seedlings and preincubated for a day on callus-inducing medium including MS salts and vitamins, 3% sucrose, 1 mg/L 2,4-D and 0.8% Difco Bacto-agar. Agrobacterium tumefaciens harbouring peroxidase gene constructs was grown overnight in YEP medium (An et al., Plant Physiology 81:301-305 [1988]) with selective antibiotics. Before cocultivation, the absorbance at of the bacterial solution was determined and the number of bacteria was adjusted to lxlO per mL in liquid callus inducing medium. Hypocotyl segments were incubated in bacterial solution with gentle shaking for min, blotted on sterile filter papers placed on callus inducing medium for 2-3 days. After cocultivation, the segments were washed twice in liquid MS medium, blotted briefly on filter paper and placed on MS medium solidified with Phytagar (Difco) or Phytagel (Sigma) and containing 150 mg/L timentin (Ticarcillin). After 5-7 days incubation on this medium, segments were transferred on shoot regeneration medium containing 3 mg/L BAP, 1 mg/L zeatin, 5 mg/L AgNO,, 25 mg/L kanamycin and 150 mg/L timentin. Plates were sealed with Micropore tape (3M Health Care, MN, USA). The initial plating densities were 40-50 explants per plate. This was reduced to 20-25 per plate in subsequent subcultures. Hypocotyl segments were subcultured onto fresh medium without AgNO, every two weeks. Differentiated shoots were transferred to jars. Elongation and root formation were established in a hormone-free medium containing half strength MS and sucrose, mg/L kanamycin and 100 mg/L timentin. The transgenic status of the shoots was assessed by placing leaf discs on a medium containing 4 mg/L BAP, 0.5 mg/L NAA and 25-50 mg/L kanamycin SUBSTITUTE SHEET (RULE 26) I WO 97/41237 PCT/AU97/00253 9 for four weeks. Rooted transgenic shoots were transferred to soil and kept under a dome for a few weeks in controlled environment rooms before exposing the shoots to normal conditions.

EXAMPLE 3 Peroxidase assays for the analysis of transgenic plant tissue expressing Shpx6 Freshly harvested leaves from transgenic (To, T, and T 3 N. tabaccum cv. Xanthi and B.

napus cv. Westar (141-227) were frozen in liquid N 2 for storage and subsequently homogenised at 4°C in a microcentrifuge tube with a custom made tight-fitting stainless steel grinder attached to an electric drill using 3 volumes per unit fresh weight of buffer (10 mM sodium phosphate, 1 sodium metabisulphite, pH Homogenates were centrifuged at 14,000 rpm in a refrigerated microfuge at 4"C for 30 minutes and aliquots of supernatant frozen at -70°C. Peroxidase assays were carried out according to Rathmell and Sequeira (Plant Physiol 53:317-318 [1974]). Reactions contained 0.28 C _7 1 A 1 K 11N guaiacol uand 0.3 2 in J50 1 I soUdum pllhosphate bluffll (piH Ih Iraction rate wa monitored at 470 nm. Reaction rates were linear and proportional to the enzyme concentration added. Total protein was determined using the Bio-Rad protein assay adapted for microtitre plates.

Figures 2 and 3 show the total leaf peroxidase activities of the T, and T, transgenic tobacco and canola families, respectively. Depending on the transgenic family, constitutive over-expression of Sphx6 resulted with 2-3 fold increases in the total leaf peroxidase activity over untransformed control plants. In these figures, peroxidase activity in 10-20 plants from each transgenic and control family was measured and values for t were calculated in pairwise comparison of the transgenic families with the control family. Standard deviations are indicated as arrows. Families with different denoted letters show significant differences at P< 0.05.

EXAMPLE 4 Development of transgenic T1 seed lines Genotype designations for transgenic plants used herein are in accordance with the following convention: the initial plant resulting from a transformation event and having grown from tissue culture is designated a T 0 plant. Plants resulting from self pollination of the natural flowers of the T( plant are designated T,.

Transgenic plants (To) were grown to maturity. Flowers were allowed to self-pollinate and seed pods collected after normal desiccation. Seeds from each individual plant were collected and stored separately. Each seed lot was tested by genetic segregation analysis to determine the number of Mendelian loci bearing the kanamycin resistant trait. Seeds collected from each To plant were germinated on MS medium containing 400 mg/L kanamycin. The ratio of normal green (kan-r) versus bleached (kan-s) cotyledons was determined. Seedlings with green colour were transplanted to soil for further analyses.

To produce a further generation, seeds were collected from T, plants and the above process SUBSTITUTE SHEET (RULE 26) I WO 97/41237 PCT/AU97/00253 repeated to produce T, plants. T 3 plants were similarly produced.

EXAMPLE Evaluation of transgenic plant tissue expressing Shpx6 for disease resistance In this example, we describe the response of transgenic plants capable of expressing Shpx6 peroxidase to challenge from a variety of fungal pathogens.

Eight-week old transgenic tobacco plants from T, and T 2 transgenic families were inoculated with the fungal pathogen Phytophthora parasitica var. nicotiana (black shank disease of tobacco) using the methods described by Robin and Guest (NZ J. Crop Hort. Sci. 22:159-166 [1994]). Ten plants were used for each family (transgenes and controls). Lesion lengths on the decapitated stems were measured daily for 8 days postinoculation. Values for t were calculated in pairwise comparison of the transgenic families with control untransformed plants.

The results of this experiment are presented in Fig 1 ure 4 in which tIh filled bars represent T, families and the vertically hatched bars represent T 2 families. The error bars represent the standard deviation for each family. Families showing significant differences at P 0.05 with respect to the controls are denoted by different letters above the error bars. Analysis of inoculation data from this experiment showed that the transgenic families with higher peroxidase activity had significantly better protection with respect to wild type plants.

For Leptosphaeria maculans (blackleg disease of canola) inoculations, cotyledons from T, T 2 and T, canola seedlings were punctured and inoculated with the pycnidiospore suspension of spores. Disease reaction, or index, was scored visually using a scale where corresponded to complete resistance and corresponded to complete susceptiblity to infection. Based on this scale, plants with an index of 0-3 were considered resistant, plants with an index of 4-6 moderately resistant, and plants with an index of 7-9 susceptible. Thirty plants or more were used for each transgenic family and untransformed control families. Duncan's Multiple Range Test were used to statistically compare transgenic families with the untransformed controls.

Data from these inoculation experiments are presented in Figure 5. In Figure 5, the horizontally hatched bars represent T, families, the vertically hatched bars represent T, families, and the filled bars represent T 3 families. Analysis of the data showed that some of the transgenic lines had significantly better protection against Leptosphaeria (P To measure the response of adult plants to this pathogen, an inoculation experiment using 5-6 weeks old plants from T, families were also done in the glasshouse. In this experiment, plant survival rate for each family was calculated as the percentage of plants that reached maturity and set seed. Data from this inoculation experiment are presented in Figure 6. Analysis of data showed that transgenic lines which performed better in cotyledon inoculation tests displayed better survival rates.

For Sclerotinia sclerotorium inoculations, stems of 10 adult canola plants from each of T, and SUBSTITUTE SHEET (RULE 26) WO 97/41237 PCT/AU97/00253 11 T, families were inoculated by securing a barley grain colonised by the fungus on the stem. Lesion extension was measured daily. Duncan's Multiple Range Test were used to statistically compare transgenic families with untransformed control plants. Data from the inoculation experiment are presented in Figure 7 in which the filled bars represent T, families and the vertically hatched bars represent T, families. Experiments with T, families showed that some transgenic lines expressing Shpx6 had better protection against the fungus due to lower rates of lesion extension on their stems.

However, next round inoculations done on T, families did not show any significant protection.

Peroxidase assays done on a subset of plants sampled before the inoculations also showed some reduction in the total peroxidase activity of these plants. This suggested that stable expression of transgene (Shpx6) is necessary for consistent disease resistance responce of canola against S.

sclerotorium.

SUBSTITUTE SHEET (RULE 26) WO 97/41237 PCT/AU97/00253 12 SEQUENCE LISTING GENERAL INFORMATION:

APPLICANT:

NAME: COOPERATIVE RESEARCH CENTRE FOR TROPICAL PLANT PATHOLOGY STREET: The University of Queensland CITY: St Lucia STATE: Queensland COUNTRY: Australia POSTAL CODE (ZIP): 4067 NAME: GRAINS RESEARCH DEVELOPMENT CORPORATION STREET: National Circuit CITY: Barton STATE: ACT COUNTRY: Australia POSTAL CODE (ZIP): 2600 NAME: KAZAN, Kemal (US only) STREET: 1/24 Durham Street CITY: St Lucia STATE: Queensland COUNTRY: Australia POSTAL CODE (ZIP): 4067 NAME: GOULTER, Kenneth C. (US only) STREET: 26 Emblem Street CITY: Jamboree Heights STATE: Queensland COUNTRY: Australia POSTAL CODE (ZIP): 4074 NAME: MANNERS, John M. (US only) STREET: 28 Warmington Street CITY: Paddington STATE: Queensland COUNTRY: Australia POSTAL CODE (ZIP): 4064 (ii) TITLE OF INVENTION: Fungus Resistant Transgenic Plants (iii) NUMBER OF SEQUENCES: 2 (iv) COMPUTER READABLE FORM: WO 97/41237 PCT/AU97/00253 13 MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: PatentIn Release Version #1.30 (EPO) INFORMATION FOR SEQ ID NO: 1: SEQUENCE CHARACTERISTICS: LENGTH: 1144 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: ORGANISM: Stylosanthes humilis STRAIN: Paterson TISSUE TYPE: stem (vii) IMMEDIATE SOURCE: CLONE: Shpx6 (ix) FEATURE: NAME/KEY: sig_peptide LOCATION:42..113 (ix) FEATURE: NAME/KEY: mat peptide LOCATION:114..1001 PUBLICATION INFORMATION: AUTHORS: Harrison, S J Curtis, M D McIntyre, C L Maclean, D J Manners, J M TITLE: Differential expression of peroxidase isogenes during the early stages of infection of the tropical forage legume Stylosanthes humilis by Colletotrichum gloeosporioides JOURNAL: Mol. Plant Microb. Interact.

WO 97/41237 PCT/AU97/00253 14 VOLUME: 8 ISSUE: 3 PAGES: 398-406 DATE: 1995 RELEVANT RESIDUES IN SEQ ID NO: 1: FROM 1 TO 1144 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: TTTCGAATAA TTTCATTACT TTTATATATT ATTGCATTGC CATGGCAATT CTTGCAATTA.

GCAAAGTTTG TTTGATAATA.

CATCAAATTT TTATGCAACA ACTCTGCTGT GAGCAA~AGAA ATTGCTTTGT TCAAGGATGT GAGAAAAAAC AGCACGTCCT TAAAATCTCA AGTAGAGAGC TTGCTGCTAG AGATTCTGTT GAAGAGACTC AACTACAGCA TGGATCTCAG TGGTCTAATC TTGCCCTATC AGGAGGGCAT TATACACTGA GAGCAACATA ATACCACAGG CAATGGTGAC TTGACAATGG TTACTATAAG AACTCTTCAA TGGAGGATCC

TTGGTGATGA

ACATGTCCGA

GCTCGCATGG

GATGCATCAG

AATGCTAATT

TTGTGTCCTG

GTTGCTCTTG

AGTTTAAGCT

TCTGCTTTCT

ACAATTGGGC

GATCCCAATT

AACAACTTGG

AACTTGCTAG

ACAGATTCTC

GCCTTATAGG

ATGCACTTTC

GAGCTTCCCT

TGTTATTAGA

CAATTAGAGG

GTGTTGTTTC

GTGGACCCAG

TAGCTAACTC

CTAAGAAAGG

AAGCAAGATG

TTGCCAAATC

CCCCAATTGA

TGAAAAAGGG

AAGTGAATGG

ATTAGGATCA

AACGATTAGG

TCTTCGCCTT

TGATACATCA

TTTTGAAGTC

TTGTGCTGAT

TTGGACAGTG

AGATTTGGCT

TTTATCAACT

CACAAGCTTT

ATTGCAAGGA

CACAACTAGT

TCTCTTCCAC

TTATGCCTCC

TAACATTAGT

TTAGGATCAT

3GTCAATTGT

TCAGGAGTGA

CATTTCCATG

AATTTCACAG

ATAGACACCA

TTTCTTGCTG

CAACTGGGAA

GCTCCCACTT

AGTGAAATGG

AGAACAAGGA

AATTGCCCTA

CCAACAAGGT

TCTGATCAAC

AACCCTTCAA

CCACTCACTG

ATGATAAAAT

120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 GTTTCTGCTC TGATTTTGGC AATGCTATGA TTAAGATGGG

GATCCAGTGG

AATTAATAAT

CCAGATTAGG

ATAGATAAAA

ACCAATTGCA

AATATATATA

GGAAGACCAA

TATATATAAT AATAATAATA ATTAAATAAA CCGAATATAG TTTCTAGCTT ATAACTTTTG TTTTATTTTT TAATGTTGAA GAAATTAAAA

I

,PCT/AU97/00253 WO 97/41237 1144

GGGT

INFORMATION FOR SEQ ID NO: 2: SEQUENCE CHARACTERISTICS: LENGTH: 320 amino acids TYPE: amino acid

STRANDEDNESS:

TOPOLOGY: linear (ii) MOLECULE TYPE: protein (vi) ORIGINAL SOURCE: ORGANISM: Stylosanthes humilis STRAIN: Paterson (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Met Ala Ile Leu Ala Ile Ser Lys Val Cys Leu Ile Ile Leu Val Met 1 Ser Leu Ile Gly Leu Gly Ser Gly Gin 25 Ser Ser Asn Thr Thr Cvs Pro Ala Val Ser Lys Asn Ala Leu Ser 40 Giu Ala Arg Met 55 Phe Val Gin Gly Thr Ile Arg Ser Gly Leu Gly Ala Ser Leu Ser Phe Tyr Ala Val Asn Ser Arg Leu His Phe Asp His Asp Cys Thr Ser Asn Cys Asp Phe Phe 70 Thr Ala 75 Ala Val Leu Leu Asp Gly Giu Lys Thr 90 Thr Arg Pro Asn Val Glu Ser Ile Arg Gly 100 Pro Glu Vai Ile Asp 105 Cys Ile Lys Ser Gin 110 Ser Leu Cys 115 Gly Val Val Ser Ala Asp Ile Leu Ala Vai Ala 125 Aia Arq Asp Ser Vai Vai 130 Ala Leu Gly Gly Pro Ser Trp, Thr Val Gin 135 140 I WO 97/41237 .PCT/AU97/00253 Leu 145 Gly Arg Arg Asp Ser 150 Thr Thr Ala Ser Leu 155 Ser Leu Ala Asn Asp Leu Ala Ala Thr Leu Asp Leu Gly Leu Ile Ser Ala Phe 175 Ser Lys Lys Gly 180 Leu Ser Thr Ser Glu 185 Met Val Ala Leu Ser Gly Gly 190 His Thr Ile 195 Gly Gin Ala Arg Cys 200 Thr Ser Phe Arg Thr 205 Arg Ile Tyr Thr Glu 210 Ser Asn Ile Asp Asn Phe Ala Lys Ser 220 Leu Gin Gly Asn Pro Asn Thr Thr Gly 230 Asn Gly Asp Asn Asn 235 Leu Ala Pro Ile Thr Thr Ser Pro Thr 245 Arg Phe Asp Asn Gly 250 Tyr Tyr Lys Asn Leu Leu 255 Val Lys Lys Ser Thr Asp 275 Gly 260 Leu Phe His Ser Gin Gin Leu Phe Asn Gly Gly 270 Ser Gin Val Asn Gly 280 Tyr Ala Ser Asn Pro Ser Ser Phe 285 Cys Ser 290 Asp Phe Gly Asn Ala 295 Met Ile Lys Met Gly 300 Asn Ile Ser Pro Thr Gly Ser Ser Gly Gin Ile Arg Thr Asn Cys Arg Lys Thr 310 315 Asn 320

Claims (13)

1. A method of engineering a plant to fungal resistance, the method comprising introducing into cells of the plant a DNA construct comprising: a promoter constitutively operative in the plant cell; and a DNA sequence encoding a peroxidase isozyme operatively linked to said promoter, wherein said DNA sequence is selected from: Shpx6 herein defined; (ii) a sequence which hybridises to Shpx6 under stringent conditions and which encodes a protein having peroxidase activity; (iii) a fragment of a DNA sequence according to or which fragment encodes a protein having essentially the same activity as the peroxidase isozyme encoded by Shpx6. S 2. The method according to claim 1, wherein said promoter is the 35S promoter of Cauliflower S* Mosaic Virus. S 3. The method according to claim 1 or claim 2, wherein said DNA sequence comprises SEQ ID "15 NO: 1. S* 4. The method according to any one of claims 1 to 3, wherein said peroxidase isozyme has an amino acid sequence substantially corresponding to SEQ ID NO: 2. The method according to any one of claims 1 to 4, wherein said fungal resistance is to S* Phytophthora parasitica, Leptosphaeria maculans, or Sclerotinia sclerotorium.

6. A plant cell having an enhanced fungal resistance phenotype, wherein said cell harbours a DNA construct comprising: a promoter constitutively operative in the plant cell; and a DNA sequence encoding a peroxidase isozyme operatively linked to said promoter, wherein said DNA sequence is selected from: Shpx6 herein defined; (ii) a sequence which hybridises to Shpx6 under stringent conditions and which encodes a protein having peroxidase activity; (iii) a fragment of a DNA sequence according to or which fragment encodes a protein having essentially the same activity as the peroxidase isozyme encoded by Shpx6.

7. The plant cell according to claim 6, wherein said promoter is the 35S promoter of Cauliflower Mosaic Virus.

8. The plant cell according to claim 6 or claim 7, wherein said DNA sequence comprises SEQ ID NO: 1. The plant cell according to any one of claims 6 to 8, wherein said peroxidase isozyme has an amino acid sequence substantially corresponding to SEQ ID NO: 2. The plant cell according to any one of claims 6 to 9, wherein said fungal resistance is to Phytophthora parasitica, Leptosphaeria maculans, or Sclerotinia sclerotorium.

11. The plant cell according to any one of claims 6 to 10, wherein said DNA construct is incorporated into the genome of said plant cell.

12. A plant comprising cells according to any one of claims 6 to 11.

13. The plant according to claim 12 which is a monocot or a dicot.

14. The plant according to claim 12 which is from a family of plants selected from cereals, legumes, oilseed plants, sugar or fibre plants.

15. The plant according to claim 12 which is selected from maize, banana, peanut, field peas, sunflower, tomato, canola, tobacco, wheat, barley, oats, potato, soybeans, cotton, carnations, or sorghum.

16. Material of the plant according to any one of claims 12 to 15, which material is selected from reproductive material, vegetative material, or other regenerable material. 15 17. Material according to claim 16, wherein said reproductive material is seed or pollen. S 18. Material according to claim 16, wherein said vegetative material is a stem segment or a cutting.

19. A plant cell having an enhanced fungal resistance phentotype, wherein said cell harbours a DNA construct which is substantially as hereinbefore described with reference to Example 1.

20. A plant comprising cells according to claim 19.

21. A method of engineering a plant to fungal resistance, which method is substantially as hereinbefore described with reference to Example 2. Dated this 8 th day of October 1999 Commonwealth Scientific and Industrial Research Organisation* The State of Queensland through its Department of Primary Industries* The University of Queensland* Bureau of Sugar Experiment Stations* Queensland University of Technology* Grains Research Development Corporation *(as a participant in the Cooperative Research Centre for Tropical Plant Pathology) By their Patent Attorneys CULLEN CO. N T