CA2239259A1 - Matrix attachment regions - Google Patents

Abstract

Matrix attachment regions isolated from the 5' flanking region of endosperm-specific storage protein genes of monocotyledonous plants are provided. An exemplified matrix attachment region is derived from the 5' flanking region of the Bx7 gluten gene of Triticum aestivum. Recombinant nucleic acid molecules and plant vectors containing such recombinant nucleic acid molecules include DNA constructs having a promoter, a coding sequence, and a poly(A) addition site, the DNA constructs operably linked to at least one of the matrix attachment regions. Gene expression in transgenic plants, preferably monocotyledonous cereal crop species, is improved by transforming plants with such recombinant nucleic acid molecules.

Description

4 Field Of the Invention The invention relates to nucleic acid molecules isolated from the 5' flanking 6 region of endosperm-specific storage protein genes of monocotyledonous plants, 7 and which possess nuclear matrix binding activity.
8 Description of the Related Art 9 In the past fifteen years it has become possible to transfer genes from any organism into a wide range of crop plants including the major monocotyledonous 11 cereal crops wheat, rice, barley, oat and maize. However, even though the 12 introduced genes can be expressed in the transformed crops, the level of expression 13 can be very low. Indeed, Peach and Velten (1991 ) found that the majority of 14 detectable transformants exhibited very low expression. The variation in expression is due to the influence of the surrounding chromatin at the site of insertion of the 16 transgene (position effects). As a result, large numbers of transgenic plants must 17 be produced in order to be sure of producing a single high-expressing plant. This is 18 not trivial in cereal crops where the transformation efficiency is only 1 to 5%. In 19 addition to expression variability, there is also the possibility that transgene silencing will occur in subsequent generations.
21 For the purposes of crop improvement, it would be highly beneficial to reduce 22 the numbers of transgenic plants which need to be produced to find a high-23 expressing plant, and also to ensure that there will be no transgene silencing in 24 subsequent generations.
In eukaryotes, the DNA is folded into chromosomes in the form of loops.
26 These loops are anchored to a proteinaceous nucleoskeleton, known as the nuclear 27 matrix or scaffold, by segments of DNA known as matrix attachment regions 28 ("MAR"s). The DNA loop structure, which allows for the unwinding of DNA to permit 29 access by transcriptional regulatory proteins, has important implications for gene regulation and expression. One function of the loop structure and matrix attachment 31 regions is to insulate genes from the effects of surrounding chromatin, thereby 32 allowing copy number dependent, position independent expression of adjacent 33 genes. For this reason, various studies have investigated the hypothesis that MARs 1 may allow position independent expression of any introduced genes in transgenic 2 plants.
3 In several studies, the hypothesis was validated, and MARs were found to 4 increase transgene expression, decrease silencing, prevent silencing after crossing or backcrossing to non-transformed plants, normalize expression, and to provide 6 copy number independent expression (Allen et al. (1996); Allen et al.
(1993); Ulker 7 et al. (1997); Mlynarova et al. (1995); Breyne et al. (1992)). These studies utilized 8 MARs derived from either animal or tobacco sources.
9 Recently, MARs from other plant species such as maize and rice have been isolated (Avramova and Bennetzen (1993); Nomura et al.(1997)). The maize MAR
11 was derived from the promoter of an alcohol dehydrogenase gene. The rice MARs 12 were isolated on the basis of functional binding to the nuclear matrix, and their 13 association with any transcribed gene is unknown.
14 All of the MARs isolated to date have similar features in that they are AT
rich (greater than 60%) and contain motifs such as A-boxes, T-boxes, ATATTT boxes 16 and boxes showing homology to DNA topoisomerase II consensus cleavage sites 17 (Breyne et al. (1994). None of these motifs are universal, however, and different 18 MARs do not have extensive homology, nor are there strictly conserved DNA
19 elements. Specific MAR DNA sequences are therefore species specific and differ in their ability to bind the nuclear matrix. Each putative MAR must therefore be 21 investigated by functional assays.
22 Given the low transformation efficiency in cereal crop plants, MARs functional 23 in cereal crop plants to increase transgene expression, decrease silencing, prevent 24 silencing after crossing or backcrossing to non-transformed plants, normalize expression, and to provide copy number independent expression, would be very 26 useful. The species-specificity of MARs limits the utility of the known rice and maize 27 MARs for improving transgene expression in monocotyledonous cereal crops such 28 as wheat (Triticum aestivum). Thus, there is an ongoing need for MARs functional in 29 cereal crop plants.

2 The present invention provides a DNA sequence, designated "MAR Bx7", 3 isolated from a region adjacent to a wheat storage protein promoter. The DNA
4 sequence, which is depicted in SEQ ID NO: 1, has features characteristic of MARs in that it is AT rich (63%), and contains motifs homologous to the DNA
6 topoisomerase II consensus sequence (position 708), T-box (position 118) and 7 AATATATTT motif (position 437). Proof that this sequence acts as a matrix 8 attachment region was provided by a functional test of binding to the nuclear matrix.
9 The sequence binds the nuclear matrix and binds more strongly than a previously isolated MAR from maize. The sequence has also been demonstrated to have no 11 deleterious effect when placed adjacent to a heterologous promoter, indicating its 12 utility in enhancing and stabilizing transgene expression.
13 As stated above, MAR Bx7 was isolated from the 5' flanking region of a wheat 14 storage protein gene, specifically the Bx7 storage protein gene from T.
aestivum variety Glenlea. In the developing endosperm of cereals, storage proteins are 16 produced which are not found in any other plant part or at any other stage of 17 development. The genes encoding these proteins are very highly expressed, with 18 up to two percent of the seed protein attributable to each gene. The genes are 19 regulated at the transcriptional level, and are very tightly regulated in that they are only expressed in the developing endosperm. The tight regulation and high 21 expression of these endosperm-specific storage protein genes, including the Bx7 22 storage protein gene, indicates that MAR Bx7 is highly effective at allowing very high 23 expression rates, and would therefore be useful in enhancing the expression of 24 transgenes in transformed plants.
The present invention provides methods by which the exemplified MAR
26 sequence can be used to identify and isolate other MAR sequences from the 5' 27 flanking region of endosperm-specific storage protein genes of monocotyledonous 28 plants. The inventors have identified DNA sequences within the 5' flanking regions 29 of other endosperm-specific storage protein genes that are closely homologous to the nucleotide sequence of MAR Bx7. The invention provides methods whereby 31 these additional putative MAR sequences can be assayed for nuclear matrix binding 32 activity, and for their ability to enhance or stabilize transgene expression in 1 transgenic monocotyledonous plants. Therefore, broadly stated, the present 2 invention provides an isolated nucleic acid molecule comprising a portion of a 5' 3 flanking region of an endosperm-specific storage protein gene of a 4 monocotyledonous plant, the isolated nucleic acid molecule possessing nuclear matrix binding activity.

6 For use in transforming monocotyledonous plants with a transgene, the MAR

7 sequences of the invention are preferably operably linked to at least one DNA

8 construct which includes a plant promoter, a coding sequence for the gene to be 9 expressed in the plant, and a poly(A) addition signal. Preferably, an MAR
sequence of the invention is operably linked both upstream and downstream of the DNA
11 construct. However, a single MAR sequence either upstream or downstream of the 12 DNA construct is sufficient to confer the benefit of the presence of the MAR
13 sequence on expression of the transgene. The present invention therefore extends 14 to a recombinant nucleic acid molecule comprising the above-referenced isolated nucleic acid molecule operably linked to at least one DNA construct comprising, in 16 the 5' to 3' direction of transcription, a promoter functional in monocotyledonous 17 plants, a coding sequence expressible in monocotyledonous plants, and a poly(A) 18 addition signal, the isolated nucleic acid molecule being heterologous to at least one 19 of the promoter or the expressible coding sequence.
The invention extends to plant vectors containing such recombinant nucleic 21 acid molecules, the plant vectors being useful for transforming monocotyledonous 22 crop plants with a foreign gene.
23 MARs of the invention can be used to enhance transgene expression, provide 24 copy number independent expression and increase stability of transgenes over subsequent generations. The MARs of the invention can be used to flank any 26 promoter/gene combination and inserted into any plant species, preferably 27 monocotyledonous cereal species such as wheat, barley, oat, rice and maize.
The 28 invention therefore further extends to recombinant monocotyledonous plants 29 containing stably integrated into their genomes a recombinant nucleic acid molecule as described above.
31 The invention further extends to methods for improving gene expression in 32 monocotyledonous plants. Broadly stated, such a method includes the steps of:

1 (a) transforming monocotyledonous plant cells with a recombinant nucleic acid 2 molecule comprising an isolated nucleic acid molecule comprising a portion of 3 a 5' flanking region of an endosperm-specific storage protein gene of a 4 monocotyledonous plant, the isolated nucleic acid molecule possessing nuclear matrix binding activity, operably linked to at least one DNA construct 6 comprising, in the 5' to 3' direction of transcription, a promoter functional in 7 monocotyledonous plants, a coding sequence expressible in 8 monocotyledonous plants, and a poly(A) addition signal, the isolated nucleic 9 acid molecule being heterologous to at least one of the promoter or the expressible coding sequence;
11 (b) selecting those plant cells that have been transformed;
12 (c) regenerating transformed plant cells to provide differentiated transformed 13 plants; and 14 (d) selecting those transformed plants exhibiting improved expression of the coding sequence relative to a control plant.

18 In order to provide a clear and consistent understanding of the specification 19 and claims, including the scope to be given to such terms, the following definitions are provided.
21 "Coding sequence" means the part of a gene which codes for the amino acid 22 sequence of a protein, or for a functional RNA such as a tRNA or rRNA.
23 "Complement" or "complementary sequence" means a sequence of 24 nucleotides which forms a hydrogen-bonded duplex with another sequence of nucleotides according to Watson-Crick base-pairing rules. For example, the 26 complementary base sequence for 5'-AAGGCT-3' is 3'-TTCCGA-5'.
27 "Conditions of moderate stringency" means nucleotide sequence hybridization 28 conditions involving washing first in 2 x sodium phosphate-ethylenediaminetetracetic 29 acid ("SSPE"), 0.1 % sodium dodecyl sulfate ("SDS") at room temperature for minutes followed by washing in 1 x SSPE, 0.1 % SDS at 65 °C for 15 minutes using 31 Hybond N+ membranes (Amersham Pharmacia, Baie D'Urfe, Quebec, Canada).
32 A "control" or a "control plant" in an experiment to determine whether the 1 presence of a MAR improves the expression of a transgene, is a plant that has been 2 transformed with an expression cassette comprising a promoter, a coding sequence 3 of interest, and a poly(A) addition site, but which is not operably linked to a MAR.
4 Expression of the coding sequence by the control plant can be compared to that of a plant tranformed with the same expression cassette flanked by MARs, in order to 6 assess the effect of the presence of the MARs. For instance, in the transient 7 expression experiments described in Example 1 herein, the plants tranformed with 8 pAct1 d are control plants.
9 "Downstream" means on the 3' side of any site in DNA or RNA.
"Endosperm-specific storage protein" means a storage protein which is 11 deposited in the developing starchy endosperm of grains. Their biological role is to 12 provide a store of amino acids for germination. The major endosperm-specific 13 storage proteins in wheat are the gluten proteins. Wheat gluten proteins, and the 14 major endosperm-specific storage proteins of most other cereals, are characterized by their insolubility in water or aqueous solutions of salts, but solubility in mixtures of 16 alcohols and water.
17 "5' flanking region" means the sequences upstream of the coding part of a 18 eukaryotic gene. This region is not transcribed, but contains sequence elements 19 essential for the control of gene expression such as TATA-boxes, CAAT-boxes, enhancers, and specific binding sites for transcription factors.
21 Two nucleic acid sequences are "heterologous" to one another if the 22 sequences are derived from separate organisms, whether or not such organisms are 23 of different species, as long as the sequences do not naturally occur together in the 24 same arrangement in the same organism.
"Improved expression" of a transgene operably linked to a MAR relative to 26 that of a transgene not linked to a MAR includes, without limitation, such useful 27 properties as increased transgene expression, decreased silencing resulting from 28 position effects, decreased silencing after crossing or back-crossing to non-29 transformed plants, normalized expression, and increased copy number independent expression.
31 "Monocotyledonous plant" means the class of flowering plants characterized 32 by the presence of a single seed leaf (cotyledon) in the embryo.

1 "Nuclear matrix" means the filamentous mesh-work located between the inner 2 nuclear membrane and heterochromatin, which provides potential attachment sites 3 for chromatin and cytoplasmic intermediate filaments. The nuclei of eukaryotic cells 4 have a double-membrane. The outer membrane forms a continuum with some parts of the endoplasmic reticulum whereas the inner membrane functions in the 6 organization of chromatin. The nuclear matrix is made up of a family of interrelated 7 polypeptides known as the nuclear lamins. The nuclear lamins fall into three major 8 types: the neutral A- and C-lamins, and the acidic B-lamins (molecular weight range 9 from 62-69 kDa). Less frequently occurring lamins belong to the D and E
categories. The lamins are structurally related to the intermediary filaments, 11 assemble to 10 nm filaments in vivo, and possess the typical coiled coil-12 configuration of two intertwined a-helices.
13 "Nuclear matrix binding activity" means the property of a DNA sequence to 14 bind to isolated nuclear matrices in vitro such that it remains attached to the nuclear matrix after centrifugation and is found in the pellet fraction rather than in the 16 supernatant fraction under assay conditions in which a control sequence of 17 prokaryotic plasmid cloning vector DNA does not bind to the nuclear matrix and is 18 found associated exclusively with the supernatant fraction after centrifugation.
19 "Nucleic acid molecule" means a single- or double-stranded linear polynucleotide containing either deoxyribonucleotides or ribonucleotides that are 21 linked by 3'-5'-phosphodiester bonds.
22 Two DNA sequences are "operably linked" if the nature of the linkage does 23 not interfere with the ability of the sequences to effect their normal functions relative 24 to each other. For instance, a promoter region would be operably linked to a coding sequence if the promoter were capable of effecting transcription of that coding 26 sequence.
27 "Plant" means whole plants, plant parts, and plant cells.
28 A "plant vector" means a cloning vector that is designed to introduce foreign 29 DNA into a plant's genome and includes a plasmid cloning vehicle specifically constructed so as to achieve efficient transcription of the cloned DNA
fragments(s) 31 and translation of the corresponding transcripts) within a target plant cell. Such 32 vectors may be based on, for example, the Ti-plasmid of Agrobacterium 1 tumefaciens, or DNA plant viruses.
2 "Poly(A) addition signal" means a hexanucleotide consensus sequence close 3 to the 3'-end of most eukaryotic genes transcribed by RNA polymerase II, that 4 precedes the site where a poly(A) tail is added to the processed messenger RNA by some 10-30 bases, and is transcribed into mRNA.
6 "Promoter" means a cis-acting DNA sequence, generally 80-120 base pairs 7 long and located 5' upstream of the initiation site of a gene, to which RNA
8 polymerase may bind and initiate correct transcription. Eukaryotic promoters differ 9 for the different DNA-dependent RNA polymerases. RNA polymerase II, which transcribes structural genes, transcribes a multitude of genes from very different 11 promoters, which have specific sequences in common (e.g. the TATA box at about 12 position -25 and the CAAT box at about position -90).
13 A "recombinant nucleic acid molecule", for instance a recombinant DNA
14 molecule, is a novel nucleic acid sequence formed in vitro through the ligation of two or more nonhomologous DNA molecules (for example a recombinant plasmid 16 containing one or more inserts of foreign DNA cloned into its cloning site or its 17 polylinker).
18 "Upstream" means on the 5' side of any site in DNA or RNA.
19 The first step in obtaining an MAR of the present invention is to clone a cereal (wheat, barley, maize, oat, rice) storage gene promoter region. These species are 21 closely related, and all have similarly regulated endosperm specific storage protein 22 genes. The cloning can be accomplished by methods generally known in the art 23 including, for example: generating DNA primers for the polymerase chain reaction 24 ("PCR") using sequences in the Genbank database where many promoter sequences for storage protein genes are catalogued (for example accession 26 numbers X01130, X17637, X03103, X03042), or using the sequence of MAR Bx7;
27 isolation of a cDNA clone for a storage protein gene and using promoter walking (for 28 example using a commercially available kit such as Promoter Finder from Clontech 29 (Palo Alto, CA, USA)); or, probing a genomic library using a cDNA probe for a storage protein gene or a probe for a storage protein gene generated by PCR.
This 31 list is not exhaustive, and any method which allows the cloning of a promoter for a 32 gene could be used. The DNA sequence isolated is then cloned into a high copy 1 number cloning plasmid (such as pUCl9) and sequenced using sequencing 2 technology well known in the art, for example, as described by Sanger et al.
(1977).
3 The DNA sequence is examined, and any DNA sequences which have 4 greater than 60% AT content and contain at least one motif with homology to a DNA
topoisomerase II consensus site, A box, T box or ATATTT box (Breyne et al., 6 (1994)) are selected as candidates for MAR activity.
7 The DNA sequences must then be tested for their ability to bind the nuclear 8 matrix. Nuclear matrices (also known as nuclear scaffolds) can be isolated from 9 plant species using either a high salt buffer and Dnase I, or using a lithium diiodosalicylate (LIS) method as reviewed by Breyne et al. (1994). The nuclear 11 scaffolds are incubated with in vitro-labelled DNA fragments (for example, using 12 end-labelling with Klenow fragment and alpha-32P dCTP (Sambrook et al.
(1989)) of 13 the putative MAR as well as a non-MAR control fragment such as a piece of the 14 prokaryotic cloning vector. Appropriate incubation conditions include, for instance, incubating 2 A26o units of nuclear scaffolds for 1 hour at 37° C with 20 ng of in vitro-16 labelled DNA fragments and 10 ,ug control DNA in a total of 100 ,ul of 17 digestion/binding buffer (20 mM Hepes, pH7.4/20mM Kcl/70mM NaCI/lOmM
18 MgCh/1 % thiodoglycol/0.2 mM phenylmethylsulfonyl fluoride/aprotinin at 5 ~cg/ml) 19 (Hall et al. (1991 )). The mixture is centrifuged (for example at 2000 x g for 10 minutes (Hall et al. (1991 )) and the DNA is isolated from the pellet and supernatant 21 fractions (for example by incubation in 50 ~I of lysis buffer (1 %
SDS/proteinase K at 22 500 ,ug/ml/20mM ethylenediamine tetraacetic acid ("EDTA"), pH 8.0/20mM Tris-CI, 23 pH 8.0) for 16 hours at 37 degrees C)). The two fractions are separated by gel 24 electrophoresis on a 1 % agarose Tris/acetate/EDTA ("TAE") gel (Sambrook et al., (1989)), and the gel is then dried and subjected to autoradiography using standard 26 techniques as described by Sambrook et al. (1989).
27 The putative fragment is confirmed as an MAR if the labelled fragment is 28 found in the pellet fraction. Variations in this assay are possible and can be found 29 for example in Hall et al. (1991), Van der Geest (1994); and Avramova and Bennetzen (1993). Other variations still involving isolation of nuclear matrices and 31 evaluation of the ability of the putative MAR fragment to bind to the matrices may be 32 possible. Significant binding over that of appropriate control fragments indicates that 1 the fragment has MAR activity. Control fragments could include DNA sequences 2 which have been shown to not bind the nuclear matrix by previous assays, or could 3 be prokaryotic or prokaryotic cloning plasmid derived sequences which by nature do 4 not bind the nuclear matrix.
In an alternative method, MAR fragments can be obtained by the isolation of 6 nuclear matrices followed by digestion with one or more restriction enzymes.
For 7 instance, nuclear matrices equivalent to 20 Azso units of nuclei are incubated in 1 ml 8 of binding/digestion buffer (as described above) with 1000 units of restriction 9 enzymes) for 3 hours at 37 degrees C (Hall et al. (1991)). The endogenous DNA
fragments which remain attached to the nuclear matrices are recovered (for example 11 by centrifugation at 2000 x g for 10 minutes, washing once with digestion/binding 12 buffer, treatment of the pellet fraction with Rnase A at 200 ,ug/ml followed by 13 proteinase K at 500,ug/ml (Hall et al., (1991 )). The resulting DNA
fragments are then 14 extracted with phenol/chloroform and precipitated with ethanol, and then cloned into a plasmid cloning vector using standard techniques (Sambrook et al., (1989)).
16 Variations on this method are possible and can be found in, for example, Mirkovitch 17 et al. (1984) and Nomura et al. (1997).
18 In the exemplified case, MAR Bx7 was isolated from the 5' flanking region 19 (approximately the 2.2kb region upstream from the transcription initiation site) of the Triticum aestivum variety Glenlea Bx7 storage protein gene. The DNA sequence of 21 this MAR is depicted in SEQ ID NO: 1. MAR Bx7 contains features typical of MARs, 22 being AT rich (63%), and containing motifs homologous to the DNA
topoisomerase II
23 consensus sequence (position 709), T-box (position 119) and ATATTT motif 24 (position 437). As shown in Table 1, MAR Bx7 (EM820 fragment) had about 5.9 times the nuclear matrix binding activity of a prokaryotic cloning vector control 26 sequence, and about 2.3 times the nuclear matrix binding activity of the known 27 maize Adh1 gene MAR.
28 Given the variability exhibited in MAR sequences, it will be appreciated that if 29 any sequence changes were made to the exemplified MAR sequence, the sequence would remain functionally identical to the exemplified MAR as long as the sequence 31 still bound the nuclear matrix in an experiment designed to test the ability of a DNA
32 sequence to bind the nuclear matrix (for example by either of the above assays).

1 Changes to the exemplified MAR sequence, including, for example, insertions, 2 deletions or base changes, may be effected through the use of known techniques, 3 such as the use of commercially available mutagenesis kits from Stratagene, La 4 Jolla, CA, USA, or Clontech, Palo Alto, CA, USA). Naturally occurring sequence variations may also be identified. Therefore, all variants of MAR Bx7 which exhibit 6 greater nuclear matrix binding activity than a prokaryotic cloning vector control 7 fragment under equivalent assay conditions shall be understood to fall within the 8 scope and spirit of the invention.
g Example 2 herein provides methods for using MAR Bx7 to identify and isolate other MARs from the 5' flanking region of endosperm-specific storage protein genes 11 of monocotyledonous plants. Analysis of sequence homology between MAR Bx7 12 and the known MARs from cereal crops, being the maize- and rice-derived MARs 13 reported by Avramova et al. (1993) and Nomura et al. (1997) determined that these 14 MARs have at most 60% and 68% homology, respectively, to MAR Bx7 over the region of greatest similarity. This relatively low level of homology is not surprising, 16 as the known rice and maize MARs are not obtained from the 5' flanking regions of 17 endosperm-specific storage protein genes. As further discussed in Example 2 18 herein, the inventors have analysed the sequences of 5' flanking regions of various 19 endosperm-specific storage protein genes of wheat or Aegilops tauschii, a close relative of wheat. Levels of homology between 86-99% were observed over regions 21 of approximately 100-450 base pairs. Given this degree of sequence homology 22 (greater than about 80%), it is expected, based on the observed properties of MAR
23 Bx7, that these 5' flanking regions of endosperm-specific storage protein genes of 24 wheat or Aegilops tauschii contain sequences sufficiently similar to MAR
Bx7 that they would have similar functional properties, and would bind the nuclear matrix and 26 function as MARs.
27 As noted above, Aegilops tauschii is closely related to wheat. Bread wheat 28 (Triticum aestivum L.) is a hexaploid made up of three genomes, designated 29 genomes A, B and D. Each genome was contributed by a diploid progenitor species. Candidate diploid species include T. uartu, T. monococcum or T.
31 boeoticum for the A genome, Aegilops speltoides for the B genome, and T.
tauschii 32 (also known as Aegiiops squarrosa or Aegiiops tauschii~ for the D genome (Mujeeb-1 Kazi (1993)). There are also tetraploid species containing two of the above 2 genomes. These include Triticum turgidum and Triticum durum (genomes A and B).
3 All of these species are therefore inter-related and, as such, any MAR found on the 4 B genome of T. aestivum would also be found in the B genome of diploid and tetraploid species carrying that genome. The same principle would apply to the 6 other genomes.
7 There is also a high degree of homology between the genomes of other 8 monocotyledonous plant species and Triticum aestivum. This homology is known as 9 gene synteny and allows genes from easily manipulated cereal species having comparatively small genomes, such as rye or rice, to be used to clone genes from 11 wheat. Synteny has been observed between wheat, barley and oats (Hermann, 12 G.G. (1996)); wheat and rye (Langridge, P., et al. (1998)); and wheat, rice, and 13 maize (Ahn, S., et al. (1993)). Due to gene synteny, there is a high probability that 14 the 5' flanking regions of endosperm specific storage protein genes of barley, oats, rye, rice, and maize would contain MARs. Wheat, barley and rye are members of 16 the family Triticeae.
17 Using the methods disclosed in Examples 1 and 2 herein, fragments of the 5' 18 flanking regions of endosperm-specific storage protein genes of monocotyledonous 19 plant species such as wheat, barley, oats, rye, rice and maize can be identified, isolated, and tested for nuclear matrix binding activity and their effect on the 21 expression of coding sequences in plants. Those sequences which have at least 22 80% homology to MAR Bx7 are particularly preferred candidates form investigation.
23 Any such sequences which exhibit nuclear matrix binding activity, and which do not 24 have a deleterious effect when placed adjacent to a heterologous promoter, shall be understood to be MARs within the scope and spirit of the invention.
26 As discussed above, MARs are identified by their ability to bind the nuclear 27 matrix, and it is the very property of nuclear matrix binding activity that defines a 28 MAR, rather than any other feature or property. A helpful general discussion of 29 MARs is provided in Spiker et al. (1996). As noted therein, work with MAR
sequences is still in its early stages, particularly in plant systems, and much remains 31 to be learned about the mechanism by which MARs affect transgene expression.
32 Nevertheless, a number of studies have shown that MARs (animal, yeast, soybean 1 and tobacco MARs) are useful for increasing transgene expression in plants (Allen 2 et al. (1996); Allen et al.(1993); Mlynarova et al. (1995); Breyne et al.(1992); and 3 Schoffl et al. (1993)). Decreased silencing of transgenes through the use of MARs 4 has also been demonstrated (Ulker et al. (1997)). These studies have examined the utility of MARs in less than ideal conditions. For instance Mlynarova et al.
(1995) 6 achieved increased expression of the GUS (~3-glucuronidase) reporter gene in 7 tobacco plants using a chick lysozyme MAR. As discussed earlier, as different 8 MARs do not have extensive homology, nor are there strictly conserved DNA
9 elements, MARs are species specific and differ in their ability to bind the nuclear matrix. It is therefore to be expected that MARs will have greatest utility in 11 increasing transgene expression in organisms closely related to the source of the 12 MAR sequence. This is borne out in the results reported by Spiker et al.
(1996) of 13 their earlier work comparing expression of the GUS reporter gene in tobacco using 14 either a heterologous MAR derived from yeast, or a native tobacco MAR. Use of the yeast (heterologous) MAR resulted in a 12-fold increase in transgene expression, 16 whereas use of the tobacco (homologous) MAR resulted in a 60-fold increase in 17 expression of the transgene. As such, it is expected that while MARs of the present 18 invention, obtained from the 5' flanking region endosperm-specific storage protein 19 genes of monocotyledonous plants, may be used in any plant species, they will be particularly effective in increasing transgene expression in the economically 21 important monocotyledonous cereal species.
22 To employ MARs of the invention to increase or stabilize transgene 23 expression in plants, recombinant nucleic acid molecules are made wherein an 24 expression cassette or cassettes, each comprising a promoter, coding region and terminator (polyadenylation site), is cloned in such a way that it is adjacent to or 26 preferably flanked by an MAR of the invention. In a preferred embodiment, the 27 resulting recombinant nucleic acid molecule is cloned into a high copy number 28 plasmid or a binary plasmid for use in Agrobacterium. Suitable high copy number 29 cloning plasmids such as pUCl9 or pBluescript are well known in the art and are available commercially from such sources as Life Technologies (Gaithersburg, MD, 31 USA) and Stratagene (La Jolla, CA, USA). Agrobacterium binary plasmids include 32 pBINl9 and pB1101 and can also be obtained commercially from such sources as 1 the American Type Culture Collection (10801 University Boulevard, Manassas, 2 Virginia, 20110-2209, USA) and Clontech (Palo Alto, CA, USA). Methods for the 3 construction of such constructs are known in the art and are described in commonly 4 used laboratory manuals such as Sambrook et al. (1989).
The constructs containing the gene of interest are then stably inserted into 6 the genome of a plant using known genetic transformation protocols including, 7 without limitation, incorporation into protoplasts using polyethylene glycol ("PEG") or 8 electroporation (Datta et al. (1990)), using Agrobacterium as a delivery system 9 (Tingay et al. (1997)), or bombardment using a device such as described in U.S.
Patent No. 5,179,022. Using these methods, fertile regenerated plants can be 11 produced containing the gene of interest adjacent to or flanked by an MAR
of the 12 invention. Such plants will exhibit, on average, increased expression and stability of 13 the gene of interest.
14 The invention is further illustrated by the following non-limiting examples.

17 Isolation of a MAR adjacent to the Bx7 storage protein 18 gene from Triticum aestivum variety Glenlea 19 Primers for nested polymerase chain reaction ("PCR") amplification were synthesised by Life Technologies (Gaithersberg, MD, USA). Their sequence was 21 compiled from the coding region of the wheat storage protein gene Bx7*
(Genbank 22 Accession No. M22209) (Anderson et al. (1989)) and from sequence in the 23 untranslated upstream region of the related Bxl7gene from T. aestivum (wheat) 24 L86-69 (derived from cv. Olympic x cv. Gabo) (Reddy et al. (1993)). These were used to amplify the region upstream of Bx7 in T. aestivum cv. Glenlea by 26 polymerase chain reaction. The primer sequences were: (outer primers) 27 GAGCTCTCCCATCCAATTG (SEQ ID NO: 2) and AGAAGCTTGGCCTGGATAGT
28 (SEQ ID NO: 3); and (inner primers) GGGTCGATGGTATCAATCC (SEO ID NO: 4) 29 and GGCCTGGATAGTATGACCC (SEO ID NO: 5). The first round of PCR used 200 ng purified 'Glenlea' DNA as template and Taq DNA polymerase in 35 cycles of 31 30 sec at 92°C (denature), 30 sec at 52°C (anneal) and 2.5 min at 72°C (extend) in a 32 thermocycler (Thermolyne Temptronic) using the outer nested primer pair.
The 1 second round of PCR was identical to this, but used 0.2 pl of the first round reaction 2 product and the inner nested primers. The resulting 2.2 kb DNA fragment from the 3 second round of PCR was purified by ethanol precipitation and cloned into the 4 EcoRV site of pBluescript SK (obtained from Stratagene, La Jolla, CA, USA) using TA-cloning (Zhou et al. (1995)).
6 The cloned DNA insert was sequenced using the commercial sequencing 7 service of the National Research Council of Canada, Plant Biotechnology Institute 8 (Saskatoon, SK, Canada). The sequence was compared to the Bxl7 sequence and 9 to the Bx7 sequence. The plasmid carrying the 2.2 kb MAR insert, called pBx7-2.2, was digested separately with EcoRV & Mscl and with Mscl & Smal. The resulting 11 fragments, 0.8 and 0.9 kb respectively, were individually subcloned into pBluescript 12 SK using standard practice (Sambrook et al., (1989) and called pEM820 (containing 13 MAR Bx7) and pMSm900, respectively.
14 To prove that the cloned sequence functions as a MAR, nuclei were isolated from 7-day etiolated 'Glenlea' seedlings using the procedure described by 16 Steinmuller & Appel(1986) as modified by Cockerill & Garrard (1986).
'Glenlea' 17 wheat was grown in the dark on damp vermiculite for 5 days. Etiolated seedlings 18 were harvested, 100 g ground to a powder in liquid nitrogen and the powder 19 resuspended in 250 ml of isolation buffer (20 mM Tris.HCl pH 7.8, 250 mM
sucrose, 5 mM MgCl2, 5 mM KCI, 40% (v/v) glycerol, 0.25% (v/v) Triton X-100, 0.1 %
(v/v) 21 ,u-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride ("PMSF"), 1 ,ug/ml leupeptin 22 (Boehringer) and 1 ,ug/ml aprotinin (Boehringer)). The suspension was warmed to 23 10°C by stirring, and then filtered through nylon mesh (0.1 mm) and centrifuged at 24 0°C, 10,000 g for 15 minutes. All subsequent procedures were performed on ice using chilled buffers. The pellet was carefully resuspended in 150 ml isolation buffer, 26 washed and centrifuged as before but at 6000 x g. The pellet was washed again 27 with 100 ml isolation buffer and re-centrifuged as above. The final pellet was 28 resuspended in a minimal volume (approximately 5 ml) of 30 mM sodium phosphate 29 pH 7.8, 1.5 M sucrose, 5 mM MgCl2, 1 mM PMSF, and layered onto a 2.5 ml cushion of the same buffer with 2.3 M sucrose. The sample was centrifuged at 24000 rpm in 31 a Beckman SW27Ti rotor for 30 minutes at 4°C.
32 The supernatant was removed completely and the pellet resuspended in 2 ml 1 digestion buffer (10 mM Tris.HCl pH 7.8, 250 mM sucrose, 10 mM NaCI, 3 mM
2 MgCl2, 1 mM PMSF) washed and re-centrifuged (750 g, 10 minutes, 4°C).
The 3 pellet was resuspended in 2 ml digestion buffer supplemented with 1 mM CaCl2 and 4 0.1 mg/ml Dnase I (Pharmacia) and incubated at 23°C for 1 hour. After centrifugation (as above), pellets were resuspended in 5 ml digestion buffer and 6 mixed with an equal volume of ice-cold 4 M NaCI, 10 mM EDTA, 1 mM PMSF, 20 7 mM Tris.HCl, pH 7.8. After 10 minutes on ice, the sample was centrifuged at 8 g, 15 minutes at 4°C, and the pellet re-extracted twice with ice-cold 2 M NaCI, 10 9 mM EDTA, 10 mM Tris.HCl pH 7.4, 1 mM PMSF, 0.25 mg/ml BSA (Sigma Fraction V) and centrifugation at 4500 g, 15 minutes, 4°C. The pellet (of nuclear matrix) was 11 washed with digestion buffer supplemented with 0.25 mglml bovine serum albumin 12 ("BSA"). The final pellet was resuspended in the same buffer (1 ml) combined with 13 an equal volume of glycerol and stored at -20°C.
14 Binding assays were carried out using a modified procedure of Hall et al.
(1991 ). Crude minipreps of clones to be assayed for binding were digested with 16 Xbal/Xhol (pEM820 and pMSm900). A positive control, the MAR associated with 17 the Adh-1 gene of maize cloned into the BamHl/Hindlll site of pUCl9, was kindly 18 provided by Z. Avramova, Purdue University, IN, USA. This construct, referred to as 19 pBH1.3, was digested with BamHl/Hindlll for the binding experiment.
Digested plasmids were labelled with [a32P]dCTP using the Klenow fragment (Gibco/BRL) to 21 end-fill the digests, and incubated with nuclear matrices corresponding to 1.0 A 2so 22 unit of nuclei (as characterized on a spectrophotometer as per Hall et al., (1991 )), for 23 one hour in the presence of 20 ~g unlabelled competitor DNA (pUCl9) in a total 24 volume of 100 ,ul binding buffer (20 mM Tris.HCl pH 7.4, 20 mM KCI, 70 mM
NaCI, 5 mM EDTA, 1 mM dithiothreitol, 1 mM PMSF). After incubation, the suspension was 26 centrifuged and the supernatant transferred to a fresh tube. The pellet was washed 27 once with binding buffer and resuspended in extraction buffer (20 mM
Tris.HCl pH
28 7.4, 5 mM EDTA, 1 % (w/v) sodium dodecyl sulphate 100 ,ul (SDS) and 5 ,ug sheared 29 salmon sperm DNA (Boehringer)). This was vortexed briefly and heated to 80°C for 15 minutes. An equal volume of phenol was added to the sample which was again 31 vortexed and heated to 80°C briefly. The sample was then centrifuged at 13,000 x 32 g, at room temperature in a microfuge. The aqueous phase was aspirated and to it 1 was added 0.1 volume 1 M NaCI. The DNA was precipitated in ethanol (using 2 standard techniques (Sambrook et al., (1989)). The following was loaded onto a 1 3 Tris/acetate/edta agarose gel (Sambrook et al., (1989)): the entire final pellet of DNA
4 recovered from the nuclear matrices; 10 ~I of the unbound DNA (contained in the nuclear matrix supernatant) and 1 ,ul of the labelled DNA (used in the binding 6 experiment). These were separated for 1 hour at 65 V in TAE. The gel was fixed by 7 immersion in 1 % (w/v) hexadecyltrimethylammonium bromide, 50 mM sodium 8 acetate pH 5.5 for 1 hr. The gel was dried between paper towels and 9 autoradiographed using Biomax film (Kodak). The resulting autoradiogram was placed in a Bio-Rad (Hercules, CA, USA) visual densitometer and the area under the 11 peaks corresponding to the bands was integrated using a Bio-Rad integrator.
12 The results of the assay showed that 26.4% of the amount of sequence 13 pEM820 in the assay bound to the nuclear matrix and was found in the pellet 14 fraction as compared to 10.3% for pMSm900 and 11.4% for the previously described (Avramova and Bennetzen, (1993)) maize Adh-I MAR (Table 1 ). The prokaryotic 16 derived plasmid cloning vector control sequences did not bind the matrix (less than 17 5%) and were found exclusively in the supernatant. This shows that the sequence 18 of the invention does act as a MAR and binds the matrix more strongly (more than 19 twice) than the previously described maize MAR, making for superior utility.
For utility in enhancing and stabilizing expression for any transgene, it must 21 first be proven that MAR Bx7 does not have a deleterious effect when placed 22 adjacent to a heterologous promoter. As MAR Bx7 is derived from a promoter which 23 is active only in the cereal endosperm, it was necessary to prove that MAR
Bx7, 24 when placed adjacent to a constitutive promoter, did not alter the normal expression pattern of the promoter by making it endosperm specific. To prove this, a series of 26 transient expression experiments was conducted. Plasmid pACT1 d (Ray Wu, 27 Cornell University, NY, USA) carries the rice actin promoter fused to the uidA gene 28 (encoding the ~i-glucuronidase ("GUS") protein) and the nopaline synthase ("NOS") 29 polyadenylation signal. Two further plasmids were constructed for transient expression experiments. The actin::GUS::NOS cassette from pAct1 d was modified 31 by flanking it with either the EcoRV-Mscl (EM) (for plasmid pEM.Act) or the 32 Mscl-Smal (MSm) fragment (for plasmid pMSm.Act) of pBx7-2.2. This was done by 1 cloning the MAR fragments (EM or MSm) in tandem into the Pvull and EcoRV
sites 2 of pSP72 (obtained from Promega, Madison, WI, USA) and then inserting the 3 actin::GUS::NOS cassette into the Pstl/Xbal sites between the MARs. For 4 transformation, plasmids were grown in E. coli DHSa and purified using a Maxi-Prep kit (Promega). Plasmids were coated onto tungsten particles (1 ,um, BioRad, 6 Hercules, CA, USA) using the method described by Knudsen and Muller ((1991 ).
7 Tissue for bombardment was embryos and leaves. Embryos were dissected from 8 surface-sterilized wheat seeds ('Glenlea') harvested 15 to 25 days after anthesis.
9 These were placed on solid medium (Knudsen and Muller, (1991 ); Donovan and Lee (1977)); the composition of this medium is: Murashige and Skoog standard ("MS") 11 medium (Murashige and Skoog (1962)) supplemented with 4.038 g/I casein 12 hydrolysate (BDH), 3% (w/v) sucrose, 100 mg/ml inositol, 0.4 mg/ml thiamine and 13 1 % agarose (Gibco/BRL) pH 5.8), and bombarded with plasmid-coated tungsten 14 particles using a biolistic particle gun (Sanford et al. (1987)). The embryos were incubated in the dark for 24 hours before being assayed for GUS activity by the 16 colorimetric GUS assay (Klein et al. (1988)). Leaves were cut into 5 mm strips, 17 surface-sterilized with ethanol, and transferred to solid medium for bombardment 18 followed by GUS assay.
19 The results were that both the plasmid with the constitutive rice actin promoter only, and the plasmid with the rice actin promoter adjacent to MAR
Bx7 21 were active in both embryos and leaves (Table 2). This proves that MAR Bx7 is 22 independent from the promoter from which it was derived (which is not active in 23 embryos or leaves) and therefore is not deleterious to the expression pattern of 24 other promoters when placed adjacent to them to enhance expression and stability.

27 Use of MAR Bx7 to identify and isolate other MARS from the 5' flanking 28 regions of endosperm-specific storage protein genes 29 of monocotyledonous plants As discussed previously, other MAR sequences from cereal crops (maize and 31 rice) have been reported (Avramova et al., (1993); Nomura et al. (1997)).
However, 32 these MARs differ significantly from MAR Bx7. The computer software program 1 Align Plus (Scientific and Educational Software) was used to compare the maize and 2 rice sequences to MAR Bx7. The maize sequence is identified as Genbank 3 Accession number X00581 and the rice sequence is identified as Genbank 4 Accession number X95271. In their entirety, these sequences were, respectively, 2% and 1 % homologous to MAR Bx7. However, the maize sequence had a region 6 of 495 base pairs that was 60% homologous to a 527 base pair region of MAR
Bx7 7 and the rice MAR has a 225 base pair sequence which is 68% homologous to a 8 base pair region of MAR Bx7. The region of MAR Bx7 having homology to the 9 maize sequence is not the same region which is homologous to the rice sequence (Table 3). This illustrates the differences between MAR sequences even in related 11 plant species. MAR Bx7 has been shown to be a stronger MAR than the maize 12 sequence (Table 1 ).
13 Using MAR Bx7 to search other known DNA sequences (using the BLAST
14 algorithm of Altschul et al. (1990)), a number of sequences with stretches of over 100 base pairs with greater than 80% homology are found. These sequences (Table 16 4) are all of endosperm specific storage protein genes from wheat or close relatives 17 of wheat (Aegilops tauschir), where enough sequence data in the promoter region is 18 present to match that of MAR Bx7. Given the high degree of homology of these 19 promoter regions to MAR Bx7, it is likely that the other sequences contain regions capable of binding the nuclear matrix. Any sequence containing a stretch of over 21 100 base pairs with 80% or greater homology with MAR Bx7 and capable of binding 22 to the nuclear matrix would be considered to be functionally equivalent to MAR Bx7.
23 The primary source of such sequences would be the 5' flanking region of endosperm 24 specific storage protein genes from wheat or its close relatives. These could be cloned using methods generally known in the art including, for example, generating 26 DNA primers for the polymerase chain reaction (PCR) using sequences in the 27 Genbank database where many promoter sequences for storage protein genes are 28 catalogued (for example accession numbers in Table 4) or using the sequence of 29 MAR Bx7; isolation of a cDNA clone for a storage protein gene (using standard cDNA library techniques as in Sambrook et al. (1989) for example) and using 31 promoter walking (for example using a commercially available kit such as Promoter 32 Finder from Clontech, Palo Alto, CA, USA); or probing a genomic library using as a 1 probe a DNA sequence derived from the coding region or promoter of a storage 2 protein gene using moderate stringency washing techniques designed to identify 3 sequences having at least 80% homology to the probe (for example first washing in 4 2 x SSPE, 0.1 % SDS at room temperature for 10 minutes followed by washing in 1 x SSPE, 0.1 % SDS at 65 degrees C for 15 minutes (manufacturers protocol for 6 moderate stringency washing for Hybond N+ membranes (Amersham Pharmacia, 7 Baie D'Urfe, PQ, Canada). Other membrane types may require different conditions 8 however a high stringency wash should be omitted). These methods are not 9 exclusive and any method which allows the cloning of a promoter for a gene could be used.

13 Use of MAR Bx7 to enhance transgene expression 14 and stability in a monocotyledonous plant A plasmid such as pMAR.Act1 d.MAR is constructed so that the MAR Bx7 16 (EM820) sequence flanks both sides of the ~i-glucuronidase expression cassette 17 (rice actin promoter-GUS gene-NOS polyadenylation site - the expression cassette 18 contained in plasmid pACT1 d described in Example 1 herein ).
Alternatively, a 19 single MAR sequence could be used to flank one side of the expression cassette only. A construct with the expression cassette but lacking the MAR sequences) is 21 used as a control.
22 The plasmids are transformed into E. coli as described in Sambrook et al.
23 (1989), and purified using a Maxi-Prep kit (Promega, Madison, WI, USA).
Plasmids 24 are coated onto tungsten or gold particles (BioRad, Hercules, CA, USA) using the method described by Knudsen and Muller (1991 ).
26 Immature wheat embryos (1.0 to 1.5mm in length) are pre-cultured and 27 transformed with either the plasmid containing the ~i-glucuronidase expression 28 cassette flanked by the MAR, or the control plasmid, using a method such as that 29 described in US Patent No. 5,610,042 or US Patent No. 5,631,152.
The resulting transformed plants are characterized as to their expression 31 levels using, for example, the fluorometric assay for ~i-glucuronidase as described by 32 Jefferson (1987). Leaf tissue from each of the plants is ground in extraction buffer 1 (50mM NaP04 pH 7.0 buffer, lOmM ~3-mercaptoethanol, lOmM disodium EDTA, 2 pH8.0, 0.1 % sodium dodecyl sulphate and 0.1 % Triton X-100). An aliquot of 1 to 10 3 ,ul is added to 50 ,ul of extraction buffer plus 1 mM MUG (methyl umbeliferone 4 glucuronide) which is pre-warmed to 37 degrees C. The mixture is incubated at 37 degrees C for 30 to 60 minutes and then stopped by the addition of 25 ,ul of 1 M
6 sodium carbonate. The mixture is then quantified numerically using a fluorometer.
7 The protein content of the plant extract is determined using commercially available 8 protein assays such as those sold by Bio-Rad (Hercules, CA, USA). In this way, the 9 values for the level of gene expression per mg protein can be determined for each plant. The expression for the plants containing the MAR sequence is compared to 11 the plants lacking the sequence, and those plants exhibiting increased or stabilized 12 gene expression relative to the control plants are selected.
13 The transformed plants are also crossed to non-transformed plants. The 14 progeny are then analysed for expression as described above. The series of crossing is done over more than one generation. In this way, the degree of silencing 16 of gene expression for the non-MAR containing construct can be compared to the 17 MAR containing construct.

1 Table 1. Results of binding assay with the two subcloned fragments of the Bx7 2 2.2kb promoter fragment (EM820 and Msm900) and the Adhl MAR positive control.
3 Each fragment has its own internal negative control vector fragment. Data is 4 presented for the area under the peaks corresponding to the bands on the autoradiogram after densitometric analysis. Area units are assigned by the 6 integrator.
7 Area undervector Adhl vector EM820 vector Msm900 8 peak control- fragment control- fragment control- fragment Adhl EM820 (MAR Bx7) MSm900 9 supernatant59975328 78028861 7465160 3351453 60897560 1859769 pellet 2213018 8917389 64511520 17037888 57563920 5936224 11 % in pellet3.7 11.4 4.5 26.4 3.1 10.3 Table 2.
Results of transient GUS
expression in tissues transformed with pActld and MAR-flanked actin::GUS::NOS
constructs.

16 Construct Tissue Embryo Endosperm Callus Leaf 17 pAct 1 d +++ ++ N p +

18 pEM.Act +++ ++ +++ +

19 pMSm.Act +++ ++ ND +

Unshot _ -_ = not determined 23 +++
= 20%
of tissue had >10 spots per tissue piece and <20%
had no spots 24 ++
= approximately 50%
had no spots per tissue piece and <20%
had >10 spots +
= at teat one spot per construct per tissue 26 - = no spots 1 Table 3. Homology of MAR Bx7 with other disclosed cereal species MAR
2 regions.
3 Accession Number and regionRegion of Homology in % homology MAR

4 of homology (base pairs) Bx7 (base pairs) X00581 ( 169-664) 6-553 60 6 X95271 ( 18-243) 599-807 68 9 Table 4.
BLAST
similarity search using MAR
Bx7 as query sequence.
All accessions are wheat or Aegilops endosperm specific storage protein gene 11 promoter regions.

12 Accession Length of Homologous Region (Base % Homology pairs) 13 Number gg X13927 458 g2 3 Ahn, S., et al. Mol. Gen. Genet., 241, 483-490 (1993).
4 Allen et al., Plant Celt, 5, 603-613, (1993).
Allen et al., Plant Cell, 8, 899-913, (1996).
6 Altschul et al., J. Mol. Biol., 215, 403-410, (1990).
7 Anderson, O.D., Greene, F.C., Theor. Appl. Genet., 77, 689-700, (1989).
8 Avramova and Bennetzen, PI. Mol. Biol., 22, 1135-1143, (1993).
9 Breyne et al., Plant Cell, 4, 463-471, (1992).
Breyne et al., Transgenic Res., 3, 195-202, (1994).
11 Cockerill & Garrard, Cell, 4, 273-382, (1986).
12 Datta et al., Biotechnology, 8, 736-740, (1990).
13 Donovan and Lee, Plant Sci. Lett., 9, 107-113, (1977).
14 Jefferson, PI. Mol. Biol. Reporter, 5, 387-405, (1987).
Hall et al. PNAS, USA, 88, 9320-9324, (1991).
16 Hermann, G.G., et al., Symp. Soc. Exp. Biol., 50, 25-30, (1996).
17 Klein et al., PNAS, USA, 85, 4305-4309, (1988).
18 Knudsen and Muller, Planta, 185, 330-336, (1991 ).
19 Langridge, P., et al. Mol. Gen. Genet., 257, 568-575, (1998).
Mirkovitch et al., Cell, 39, 223-232, (1984).
21 Mlynarova et al., Plant Cell, 7, 599-609, (1995).
22 Mujeeb-Kazi, A. In Biodiversity and Wheat Improvement, A. B. Damania (editor).
23 1993. A Wiley-Sayce Publication, pp. 95-102.
24 Murashige and Skoog, Physiol. Plant., 15, 474-497, (1962).
Nomura et al., Plant Cell Physiol., 38, 1060-1068, (1997).
26 Peach and Velten, Plant Mol. Biol., 17, 49-60 (1991 ).
27 Reddy, P., Appels, R., Theor. Appl. Genet., 85, 616-624, (1993).
28 Sambrook et al., Molecular Cloning, Cold Spring Harbor Press, (1989).
29 Sanford et al., Particulate Sci. Technol., 5, 27-37, (1987).
Sanger, F., et al., Proc. Natl. Acad. Sci. USA, 74, 563-568, (1977).
31 Schoffl et al., Transgenic Res. 2, 93-100, (1993).
32 Spiker et al., Plant Physiol., 110, 15-21, (1996).

1 Steinmialler & Appel, Plant Molecular Biology, 7, 87-94 (1986).
2 Tingay et al., Plant J., 11, 1369-1376, (1997).
3 Ulker et al., Plant Physiol. 114, 306, (1997).
4 Van der Geest, Plant J., 6, 413-423, (1994).
Zhou et al., Biotechniques, 19, 34-35, (1995).
6 All publications mentioned in this specification are indicative of the level of 7 skill in the art to which this invention pertains. To the extent that they are consistent 8 herewith, all publications are herein incorporated by reference to the same extent as 9 if each individual publication was specifically and individually indicated to be incorporated by reference.
11 Although the foregoing invention has been described in some detail by way of 12 illustration and example, for purposes of clarity and understanding it will be 13 understood that certain changes and modifications may be made without departing 14 from the scope or spirit of the invention as defined by the following claims.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Jordan, Mark C.
Rampitsch, Christof Cloutier, Marie S. J.
(ii) TITLE OF INVENTION: Matrix Attachment Regions (iii) NUMBER OF SEQUENCES: 5 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: McKay-Caret' and Company (B) STREET: 10155 102nd Street (C) CITY: Edmonton (D) STATE: Alberta (E) COUNTRY: Canada (F) ZIP: T5J 4G8 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,239,259 (B) FILING DATE: 31-JUL-1998 (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: McKay-Caret', Mary Jane (C) REFERENCE/DOCKET NUMBER: 28002CA0 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (780) 424-0222 (B) TELEFAX: (780) 424-0290 (2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 819 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:

(A) ORGANISM: Triticum aestivum (B) STRAIN: Glenlea (xi) SEQUENCE DESCRIPTION:
SEQ ID NO:1:

(2) INFORMATION FOR SEQ ID
N0:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pai rs (B) TYPE: nucleic acid (C) STRANDEDNESS: singl e (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PCR
primer"

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Triticum aestivum (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:

(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PCR primer"
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Triticum aestivum (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:

(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PCR primer"
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Triticum aestivum (xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PCR Primer"
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Triticum aestivum (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

Claims (13)

1. An isolated nucleic acid molecule comprising a portion of a 5' flanking region of an endosperm-specific storage protein gene of a monocotyledonous plant, said isolated nucleic acid molecule possessing nuclear matrix binding activity.

2. An isolated nucleic acid molecule as set forth in claim 1 wherein said monocotyledonous plant is of the family Triticeae.

3. An isolated nucleic acid molecule as set forth in claim 2 wherein said monocotyledonous plant is of the genus Triticum.

4. An isolated nucleic acid molecule as set forth in claim 3 wherein said monocotyledonous plant is of the species Triticum aestivum.

5. An isolated nucleic acid molecule as set forth in claim 1 having a nucleic acid sequence, the complement of which hybridizes under conditions of moderate stringency with a nucleotide sequence comprising at least 100 continuous nucleotides of the sequence depicted in SEQ ID NO: 1.

6. An isolated nucleic acid molecule as set forth in claim 1 having the nucleic acid sequence depicted in SEQ ID NO: 1.

7. A recombinant nucleic acid molecule comprising an isolated nucleic acid molecule of any of claims 1-6 operably linked to at least one DNA construct comprising, in the 5' to 3' direction of transcription, a promoter functional in monocotyledonous plants, a coding sequence expressible in monocotyledonous plants, and a poly(A) addition signal, said isolated nucleic acid molecule being heterologous to at least one of said promoter or said expressible coding sequence.

8. A recombinant nucleic acid molecule as set forth in claim 7 wherein said isolated nucleic acid molecule is located upstream of said at least one DNA
construct.

9. A recombinant nucleic acid molecule as set forth in claim 7 wherein said isolated nucleic acid molecule is located downstream of said at least one DNA construct.

10. A recombinant nucleic acid molecule as set forth in claim 7 having said isolated nucleic acid molecule located both upstream and downstream of said at least one DNA construct.

11. A plant vector comprising a recombinant nucleic acid molecule of claim 7.

12. A transgenic monocotyledonous plant containing stably integrated into its genome a recombinant nucleic acid molecule of claim 7.

13. A method for providing improved gene expression in a transgenic monocotyledonous plant, comprising the steps of:
(a) transforming monocotyledonous plant cells with a recombinant nucleic acid molecule comprising an isolated nucleic acid molecule of any of claims 1-6 operably linked to at least one DNA construct comprising, in the 5' to 3' direction of transcription, a promoter functional in monocotyledonous plants, a coding sequence expressible in monocotyledonous plants, and a poly(A) addition signal, said isolated nucleic acid molecule being heterologous to at least one of said promoter or said expressible coding sequence;
(b) selecting those plant cells that have been transformed;
(c) regenerating transformed plant cells to provide differentiated transformed plants; and (d) selecting those transformed plants exhibiting improved expression of said coding sequence relative to a control plant.