CA2212992A1 - Fibroblast growth factor-14 - Google Patents

Abstract

Disclosed is a human Fibroblast growth factor-14 polypeptide, and DNA (RNA) encoding such polypeptide. Also provided is a procedure for producing such polypeptide, by recombinant techniques. Also disclosed are methods for utilizing such polypeptide for promoting wound healing, for example as a result of burns and ulcers, to prevent neuronal damage due to/associated with stroke and promote neuronal growth, and to prevent skin aging and hair loss, to stimulate angiogenises, mesodermal induction in early embryos and limb regeneration. Antagonists against such polypeptides and their use as a therapeutic to prevent abnormal cellular proliferation, hyper-vascular diseases and epithelial lens cell proliferation are also disclosed. Diagnostic methods for detecting mutations in the coding sequence and alterations in the concentration of the polypeptides in a sample derived from a host are also disclosed.

Description

FTR~ORT~-~T GROW~ FACTOR 14 This invention relates to newly identi~ied polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention have been putatively identi~ied as ~ibroblast growth ~actor/heparin b~n~ng growth factor, hereinafter re~erred to as "FGF-14". The invention also relates to inhibiting the action of such polypeptides.
Fibroblast growth factors are a ~amily o~ proteins characteristic of binding to heparin and are, there~ore, also called heparin binding growth ~actors (B GF). Expression of dif~erent members o~ these protein~ are found in various tissues and are under particular temporal and spatial control. These proteins are potent mitogens ~or a variety o~
cells of mesodermal, ectodermal, and endodermal origin, including fibroblasts, corneal and vascular endothelial cells, granulocytes, adrenal cortical cells, chnn~ocytes~
myoblasts, vascular smooth muscle cells, lens epithelial cells, melanocytes, keratinocytes, oligodendrocytes, astrocytes, osteoblasts, and hematopoietic cells.
Each member has ~unctions overlapping with others and also has its uni~ue spectrum of ~unctions. In addition to the ability to stimulate proli~eration of vascular endothelial cells, both FGF-1 and 2 are chemotactic ~or endothelial cells and FGF-2 has been shown to enable endothelial cells to penetrate the basement membrane.
Consistent with these properties, both FGF-1 and 2 have the capacity to stimulate angiogenesis. Another important ~eature o~ these growth ~actors is their ability to promote wound healing. Many other members o~ the FGF ~amily share similar activities with FGF-1 and 2 such as promoting angiogenesis and wound healing. Several members o~ the FGF
~amily have been shown to induce mesoderm ~ormation and to modulate di~erentiation o~ neuronal cells, adipocytes and skeletal muscle cells.
Other than these biological activities in normal tissues, FGF proteins have been implicated in promoting tumorigenesis in carcinom~ and sarcomas by promoting tumor vascularization and as transforming proteins when their expression is deregulated.
The FGF ~amily presently consists o~ eight structurally-related polypeptides: basic FGF, acidic FGF, int 2, hst 1/k-FGF, FGF-5, FGF-6, keratinocyte growth ~actor, AIGF (FGF-8) and recently a glia-activating ~actor has been shown to be a novel heparin-h;nning growth ~actor which was puri~ied ~rom the culture supernatant of a human glioma cell line (Miyamoto, M. et al., Mol. and Cell. Biol., 13(7):4251-4259 (1993). The genes ~or each have been cloned and sequenced.
Two G- the members, FGF-1 and FGF-2, have been characterized under many names, but most o~ten as acidic and basic ~ibroblast growth ~actor, respectively. The normal gene products in~luence the general proli~eration capacity o~ the majority o~ mesoderm and neuroectoderm-derived cells. They are ~p~hle o~ inducing angiogenesis in vivo and may play important roles in early development (Burgess, W.~. and Maciag, T., Annu. Rev. Biochem., 58:575-606, (1989)).

W O 96/39506 PCT~US95/06730 Many of the above-identified members of the FGF family also bind to the same receptors and elicit a second message through binding to these receptors.
A eukaryotic expression vector encoding a secreted form of FGF-l has been introduced by gene transfer into porcine arteries. This model defines gene function in the arterial wall in vivo. FGF-l expression induced intimal thickening ln porcine arteries 21 days after gene transfer (Nabel, E.G., et al., Nature, 362:844-6 (1993)). It has further been ~m~n~trated that basic fibroblast growth factor may regulate glioma growth and progression independent of its role in tumor angiogenesis and that basic fibroblast growth factor release or secretion may be required for these actions (Morrison, R.S., et al., J. Neurosci. Res., 34:502-9 (1993)).
Fibroblast growth factors, such as basic FGF, have further been implicated in the growth of Kaposi's sarcoma cells in vitro (Huang, Y.Q., et al., J. Clin. Invest., 91:1191-7 (1~93)). Also, the cDNA sequence encoding hllm~n basic fibroblast growth factor has been cloned downstream of a transcription promoter recognized by the bacteriophage T7 RNA polymerase. Basic fibroblast growth factors so obtained have been shown to have biological activity indistinguishable from hllm~n placental fibroblast growth factor in mitogenicity, synthesis of pl~fim;nogen activator and angiogenesis assays (Squires, C.H., et: al., J. Biol. Chem., 263:16297-302 (1988)).
U.S. Patent No. 5,155,214 discloses substantially pure m-mm~l ian basic fibroblast growth factors and their production. The amino acid sequences of bovine and hllm~n basic fibroblast growth factor are disclosed, as well as the DNA sequence encoding the polypeptide of the bovine species.
Newly discovered FGF-9 has around 30~ sequence similarity to other mem.bers of the FGF family. Two cysteine residues and other consensus sequences in family members were also well conserved in the FGF-9 sequence. FGF-9 was found .

to have no typical signal sequence in its N terminus like those in acidic and basic FGF. However, FGF-9 was found to be secreted from cells after synthesis despite its lack of a typical signal sequence FGF (Miyamoto, M. et al., Mol. and Cell Biol., 13(7):4251-4259 (1993~. Further, FGF-9 was found to stimulate the cell growth of oligodendrocyte type 2 astrocyte progenitor cells, BALB/c3T3, and PC-12 cells but not that of human umbilical vein endothelial cells (Naruo, K., et al., J. Biol. Chem., 268:2857-2864 (1993).
Basic FGF and acidic FGF are potent modulators of cell proliferation, cell motility, di~ferentiation, and survival and act on cell types from ectoderm, mesoderm and endoderm.
These two FGFs, along with KGF and AIGF, were identified by protein purification. However, the other four members were isolated as oncogenes., expression of which was restricted to em~ryogenesis and certian types o~ cancers. FGF-9 was ~mnnctrated to be a mitogen against glial cells. Members of the FGF fa~nily are reported to have oncogenic potency. FGF-9 has shown transforming potency when transformed into BALB/c3T3 cells (Miyamoto, M., et al., Mol. Cell. Biol., 13(7):4251-4259 (1993).
Androgen induced growth factor (AIGF), also known as FGF-8, was puri~ied ~rom a conditioned medium o~ mouse m~mmi~t-y carr;nom~ cells (SC-3) simulated with testosterone.
AIGF is a distinctive FGF-like growth factor, having a putative signal peptide and sharing 30-40~ homology with known mem~ers o~ the FGF family. M~mm~lian cells trans~ormed with AIGF shows a remarkable st;m~ tory effect on the growth of SC-3 cells in the absence of androgen. Therefore, AIGF
mediates and~e~-induced growth o~ SC-3 cells, and perhaps other cells, since it is secreted by the tumor cells themselves.
The polypeptide of the present invention has been putatively identified as a member of the FGF ~amily as a W O 96/39506 PCTrUS95/06730 result of amino acid sequence homology with other members of the FGF family.
In accordance with one aspect o~ the present invention, there are provided novel mature polypeptides as well as biologically active and diagnostica]ly or therapeutically useful fragments, analogs and derivatives thereof. The polypeptides of the present invention are of hllm~n origin.
In accordance with another aspect of the pre _nt invention, there are provided isolated nucleic acid molecules encoding the polypeptides of the present invention, including mRNAs, DNAs, cDNAs, genomic DNA, as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.
In accordance with still another aspect of the present invention, there are provided processes for producing such polypeptides by recombinant techniques through the use of recombinant vectors, such as cloning and expression plasmids useful as reagents in the recombinant production of the polypeptides of the present invention, as well as recombinant prokar,votic and/or eukaryotic host cells comprising a nucleic acid sequence ~nco~i ng a polypept:ide of the present invention.
In accordance with a further aspect of the present inventiorl, there is provided a process for utilizing such polypeptides, or polynucleotides ~nCo~;ng such polypeptides, for screening for agonists and antagonists thereto and for therapeutic purposes, for example, promoting wound healing for example as a result of burns and ulcers, to prevent neu~onal damage due to associated with stroke and promote neuronal growth, and to prevent skin aging and hair loss, to stimulate angiogenesis, mesodermal induction in early embryos and limb regeneration.
In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.

wo96/39so6 PCT~S95/06730 In accordance with yet another aspect o~ the present invention, there are provided antagonists against such polypeptides and processes for their use to inhibit the action of such polypeptides, $or example, in the treatment o~
cellular trans~ormation, ~or example, tumors, to reduce scarring and treat hyper-vascular diseases.
In accordance with another aspect of the present invention, there are provided nucleic acid probes comprising nucleic acid molecules o~ suf~icient length to speci~ically hybridize to a polynucleotide encoding a polypeptide of the present invention In accordance with yet another aspect of the present invention, there are provided diagnostic assays for detecting diseases or susceptibility to diseases related to mutations in a nucleic acid sequence of the present invention and for detecting over-expression of the polypeptides encoded by such sequences.
In accordance with another aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis o~ DNA and manufacture of DNA vectors.
These and other aspects o~ the present invention should be apparent to those skilled in the art from the teachings herein.
The ~ollowing drawings are meant only as illustrations of specific embodiments of the present invention and are not meant as limitations in any m~nn~r, Figure 1 depicts the cDNA sequence and corresponding deduced amino acid sequence o~ FGF-14. The initial 26 amino acid residues represent a putative leader sequence.

wos6/3sso6 PCT~S95/06730 In accordance with one aspect of the present invention, there are provided isolated nucleic acids molecules (polynucleotides) which encode for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID
NOS:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as A~CC Deposit No. 97148 on May 12, 1995.
The polynucleotide encoding FGF 14 of this invention was discovered initially in a cDNA library derived from human cerebellum tissue. It is structurally related to all members of the fibroblast growth factor family and contains an open reading frame encoding a polypeptide of 225 amino acids of which the first 26 amino acids represent a putative signal sequence such that the mature polypeptide comprises 199 amino acids. Among the top matches are: 1) 40 ~ identity and 61 sequence similarity to hllm~n FGF-9 over a stretch of 126 amino acidsi 2) 40 % identity and 61 ~ similarity to rat FGF-9 over a ;egion of 126 amino acids; 3) 36 ~ identity and 57 ~ similarity with human KGF over a stretch of 148 amino acids.
The FGF/B GF family signature, GXLX(S,T,A,G)X6(D,B)CXFXE
is conserved in the polypeptide of the present invention, (X
means any amino acid residue; (D,E) means either D or E
residue; X6 means any 6 amino acid residues).
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NOS:1) or that of the deposited clone or may be a different coding sequence, as a result of the redlln~ncy or degeneracy of the genetic code, encodes the same, mature polypeptide as the DNA of Figure 1, (SEQ ID NOS:1) or the deposited cDNA.

The polynucleotides which encodes ~or the mature polypeptide of Figure 1 (SEQ ID NOS:2) or for the mature polypeptides encoded by the deposited cDNA(s) may include:
only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence ~or the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode ~or fragments, analogs and derivatives of the polypeptides having the deduced amino acid sequence of Figure 1 (SEQ ID NOS:2) or the polypeptides encoded by the cDNA(s) of the deposited clone(s). The variants of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NOS:2) or the same mature polypeptides ~ncoAeA by the cDNA(s) of the deposited clone(s) as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID
NOS:2) or the polypeptides encoded by the cDNA(s) of the deposited clone(s). Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As her~in~hove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic W096/39506 PCT~S95/06730 variant of the coding sequence shown in Figure 1 (SEQ ID
NOS:1) or of the coding sequence of the deposited clone(s).
As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptides.
The present invention also includes polynucleotides, wherein the coding sequence for the mature ?olypeptides may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form o~ the protein. Once the prosequence is cleaved an active mature protein r~m~; n.c, Thus, for example, the polynucleotides of the present invention may encode ~or a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also have the coding ~equence fused in ~rame to a marker sequence which allows for purification of the polypeptide o~ the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker ~ sequence may be a hemagylutinin (HA) tag when a ~mm~lian host, e.g. COS-7 cells, is used. The HA tag corresponds to _g _ WO 96/39506 PCTrUS95/06730 an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
Fragments of the full length FGF-14 gene may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete FGF-14 gene including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the coding region of the FGF-14 gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
The present invention further relates to polynucleotides which hybridize to the hereinabove-described se~l~nce~ if there is at least 70~, preferably at least 90~, and more preferably at least 95~ identity be~ween the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the her~;n~hove-described polynucleotides. As herein used, the term "stringent conditionsl' means hybridization will occur only if there is at least 95% and preferably at least 97~ identity between the se~l~nc~s. The polynucleotides which hybridize to the hereinabove described polynucleotides ~

.

in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SBQ ID NO:1) or the deposited cDNA(s).
Alternatively, the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes ~or the polynucleotide of SEQ ID NO:1, for example, ~or recovery of the polynucleotide or as a diagnostic probe or as a PCR
primer.
Thus, the present invention is directed to polynucleotides having at least a 70~ identity, preferably at least 90% and more preferably at least a 95~ identity to a polynucleotide which ~nco~ the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.
The deposit(s) referred to herein will be maintained under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of Patent Procedure. These deposits are provided merely as a convenience and are not an admission that a deposit is required under 35 U.S.C. 112. The sequence of the polynucleotides cont~;n~A in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with the description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
The present invention further relates to an FGF
polypeptide which has the deduced amino acid sequence of W O 96/39506 PCT~US9S/06730 Figure 1 (SEQ ID NOS:2) or which has the amino acid sequence encoded by the deposited cDNA(s), as well as ~ragments, analogs and derivatives o~ such polypeptides.
The terms ~ragment,~ "derivative~ and ~analog~ when re~erring to the polypeptide o~ Figure 1 (SEQ ID NOS:2) or those encoded by the deposited cDNA(s), means polypeptides which retains essentially the same biological ~unction or activity as such polypeptides. Thus, an analog includes a proprotein which can be activated by cleavage o~ the proprotein portion to produce an active mature polypeptide.
The polypeptides o~ the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, pre~erably recombinant polypeptides.
The fragment, derivative or analog o~ the polypeptide o~
Figure 1 (SEQ ID NOS:2) or that encoded by the deposited cDNA(s) may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (pre~erably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more o~ the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is ~used with another compound, such as a compound to increase the hal~-life o~ the polypeptide (~or example, polyethylene glycol), or (iv) one in which the additional amino acids are ~used to ~he mature polypeptide, such as a leader or secretory se~uence or a sequence which is employed for puri~ication o~ the mature polypeptide or a proprotein sequence. Such ~ragments, derivatives and analogs are deemed to be within the scope of those skilled in the art ~rom the teachings herein.
The polypeptides and polynucleotides o~ the present invention are pre~erably provided in an isolated ~orm, and pre~erably are puri~ied to homogeneity.

The term "isolated" means that the material is removed from its original environment (e.g., the natural enviroL---Lel-t if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living ~n~mAl is not isolated, but the same polynucleotide or DNA or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotide could be part of a vector and/or such polynucleotide or polypeptide could be part of a composition, and still be isolated in that such vector or composition is not part of its natural envilon...e~.t.
The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in par cular the mature polypeptide) as well as polypeptides which have at least 70%
similarity (preferably at least a 70~ identity) to the polypeptide of SEQ ID NO:2 and more preferably at least a 90~
similarity (more preferably at least a 90~ identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least a 95~ similarity (still more preferably at least a 95~
identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally cont~in~ng at least 30 amino acids and more preferably at least 50 amino acids.
As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the ~ra~n~s may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
--.

W096/39506 PCT~S95/06730 The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production o~ polypeptides of the invention by recombinant techniques.
Host cells may be genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, ~or example, a cloning vector or an expression vector. The vector may be, ~or example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate ~or activating promoters, selecting transformants or ampli~ying the FGF
genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected ~or expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotide of the present invention may be employed for producing a polypeptide by recombinant techniques. Thus, for example, the polynucleotide sequence may be included in any one of a variety of expression vehicles, in particular vectors or plasmids ~or expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; yeast plasmids; vectors derived ~rom combinations o~ plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector or plasmid may be used as long as they are replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction endonuclease sites by procedures known in the art. Such W096/39s06 PCT~S95/06730 procedures and others are-deemed to be within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda PL
promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
The vector may also include appropriate sequences ~or amplifying expression.
In addition, the expression vectors pre~erably contain a gene to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic ce].l culture, or such as tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as herein above described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein. As representative examples o~ appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Salmonella tvphimurium, StrePtOmyCes; fungal cells, such as yeast;
insect cells, such as Drosophila ~2 and S~odo~tera S~9;
~n; m~ 1 cells such as CHO, COS or Bowes melanoma;
adenoviruses; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a WO 96/39506 P~TrUS95/06730 forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, phagescript, psiX174, pBluescript SK, pBsKS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene); pTRC99A, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLneo, pSV2cat, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pM,SG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PRI PL and trp.
Eukaryotic promoters include CMV ; mm~; ate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a further embodiment, the present invention relates to host cells containing the above-described construct. The host cell can be a higher eukaryotic cell, such as a m~mm~l ian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be e~fected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, 1986)).

W O 96/39506 PCT~US95/06730 The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides o~
the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in m~mm~ 1 ian cells, yeast, bacteria, or other cells under the control of appropriate promoters. ~ell-free translation systems can also be employed to produce such proteins using RNAs derived ~rom the DNA constructs o~ the present invention.
Appropriate cloning and expression vectors ~or use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (Cold Spring Harbor, N.Y., 19~9), the disclosure o~
which is hereby incorporated by re~erence.
Transcription of a DNA encoding the polypeptides o~ the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements o~ DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription.
Examples include the SV40 enhancer on the late side of the replication origin (bp 100 to 270), a cytomegalovirus early promoter enhancer, a polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting trans~ormation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived ~rom operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ~ factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation, initiation and termination sequences, .

W096/39S06 PCT~S95/06730 and pre~erably, a leader sequence capable o~ directing secretion o~ translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a ~usion protein including an N-terminal identi~ication peptide imparting desired characteristics, e.g., stabilization or simpli~ied puri~ication o~ expressed recombinant ~roduct.
Use~ul xpression vectors ~or bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation, initiation and termination signals in operable reading phase with a ~unctional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance o~ the vector and to, i~
desirable, provide ampli~ication within the host. Suitable prokaryotic hosts ~or transformation include E. coli, Bacillus subtilis, Salmonella tyPhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter o~ choice.
As a representative but nonlimiting example, use~ul expression vectors ~or bacterial use can comprise a selectable marker and bacterial origin o~ replication derived ~rom commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, ~or example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the structural sequence to be expressed.
Following trans~ormation o~ a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is derepressed by appropriate means (e.g., temperature shi~t or chemical induction) and cells are cultured ~or an additional period.

W O 96/39506 PCT~US95/06730 Cells are typically= harvested by centri~ugation, disrupted by physical or chemical means, and the resulting crude extract retained for further puri~ication.
Microbial cells employed in expression of proteins can be disrupted by any convenient method, including ~reeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
Various m~mm~lian cell culture systems can also be employed to express recombinant protein. Examples of m~mm~lian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:'75 (1981), and other cell lines capable of expressing a compatible vector, ~or example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived ~rom the SV40 viral genome, for example, SV40 origin, early promoter, enhancer, splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
The polypeptide o~ the present invention may be recovered and puri~ied ~rom recombinant cell cultures by methods used hereto~ore, including Ammon;um sul~ate or ethanol precipitation, acid extraction, anion or cation ~ch~nge chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography. Protein re~olding steps can be used, as necessary, in completing con~iguration o~ the mature protein.
Finally, high per~ormance liquid chromatography (HPLC) can be employed ~or ~inal puri~ication steps.
The polypeptide o~ the present invention may be a naturally purified product, or a product of chemical W096/39506 PCT~S95/06730 synthetic procedures, or produced by recombinant techniques ~rom a prokaryotic or eukaryotic host (~or example, by bacterial, yeast, higher plant, insect and m~mm~l ian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides o~ the present invention may be glycosylated with mammalian or other eukaryotic carbohydrates or may be non-glycosylated.
Polypeptides o~ the invention may also include an initial methionine amino acid residue.
The polypeptide o~ the present invention, as a result o~
the ability to stimulate vascular endothelial cell growth, may be employed in treatment for stimulating re-vascularization o~ ischemic tissues due to various disease conditions such as thrombosis, arteriosclerosis, and other cardiovascular conditions. These polypeptide may also be employed to stimulate angiogenesis and limb regeneration.
The polypeptide may also be employed ~or treating wounds due to injuries, burns, post-operative tissue repair, and ulcers since they are mitogenic to various cells o~ di~ferent origins, such as ~ibroblast cells and skeletal muscle cells, and therefore, ~acilitate the repair or replacement o~
damaged or diseased tissue.
The polypeptide o~ the present invention may also be employed stimulate neuronal growth and to treat and prevent neuronal damage associated with stroke and which occurs in certain neuronal disorders or neuro-degenerative conditions such as Alzheimer's disease, Parkinson's disease, and AIDS-related complex. FGF-14 has the ability to stimulate chondrocyte growth, there~ore, they may be employed to enhance bone and periodontal regeneration and aid in tissue transplants or bone gra~ts.
The polypeptide o~ the present invention may be also be employed to prevent skin aging due to sunburn by stimulating keratinocyte growth.

.

W096/39506 PCT~S95/06730 The FGF-14 polypeptide may also be employed ~or preventing hair loss, since FGF ~amily members activate hair-~orming cells and promotes melanocyte growth. Along the same lines, the polypeptides o~ the present invention may be employed to stimulate growth and di~erentiation o~
hematopoietic cells and bone marrow cells when used in combination with other cytokines.
The FGF-14 polypeptide may also be employed to maintain organs be~ore transplantation or ~or supporting cell culture o~ primary tissues.
The polypeptide of the present invention may also be employed ~or inducing tissue o~ mesodermal origin to di~erentiate in early embryos.
In accordance with yet a ~urther aspect o~ the present invention, there is provided a process ~or utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scienti~ic research, synthesis o~ DNA, manu~acture o~ DNA vectors and ~or the purpose of providing diagnostics and therapeutics ~or the treatment o~ hl7m_7n disease.
This invention provides a method ~or identi~ication of the receptors ~or the polypeptides o~ the present invention.
The genes encoding the receptor can be identi~ied by numerous methods known to those o~ skill in the art, ~or example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)). Pre~erably, expression cloning is employed wherein polyadenylated RNA is prepared ~rom a cell responsive to the polypeptides, ~or example, NIH3T3 cells which are known to contain multiple receptors ~or the FGF ~amily proteins, and SC-3 cells, and a cDNA library created ~rom this RNA is divided into pools and used to trans~ect COS cells or other cells that are not responsive to the polypeptides. Trans~ected cells which are grown on glass slides are exposed to the the polypeptide o~
the present invention, a~ter they have been labelled. The W096/39506 PCT~S9~/06730 polypeptides can be labeled by a variety o~ means including iodination or inclusion of a recognition site for a site-speci~ic protein kinase.
Following ~ixation and incubation, the slides are subjected to auto-radiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an iterative sub-pooling and re-screening process, eventually yielding a single clones that encodes the putative receptor.
As an alternative approach for receptor identification, the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE
analysis and exposed to X-ray film. The labeled complex contA;n;ng the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
This invention provides a method of screening compounds to identify those which modulate the action of the polypeptide of the present invention. An example o~ such an assay comprises combining a mAmmAlian fibroblast cell, a the polypeptide of the present invention, the compound to be screened and 3 [H] thymidine under cell culture conditions where the ~ibroblast cell would normally proliferate. A
control assay may be performed in the absence o~ the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine i~
the compound stimulates proliferation by determining the uptake of 3 [H3 thymidine in each case. The amount of fibroblast cell proliferation is measured by liquid scintillation chromatography which measures the incorporation W096/39506 PCT~S95/06730 of 3[H] thymidine. Both agonist and antagonist compounds may be identi~ied by this procedure.
In another method, a m~ ian cell or membrane preparation expressing a receptor ~or a polypeptide o~ the present invention is incubated with a labeled polypeptide o~
the present invention in the presence o~ the compound. The ability o~ the compound to enhance or block this interaction could then be measured. Alternatively, the response o~ a known second messenger system ~ollowing interaction o~ a compound to be screened and the FGF-l~ receptor is measured and the ability o~ the compound to bind to the receptor and elicit a second messenger response is measured to determine i~ the compound is a potential agonist or antagonist. Such second messenger systems include but are not limited to, cAMP
guanylate cyclase, ion channels, tyrosine phosphorylation or phosphoinositide hydrolysis.
Examples of antagonist compounds include antibodies, or in some cases, oligonucleotides, which bind to the receptor ~or the polypeptide o~ the present invention but elicit no second messenger response or bind to the FGF-14 polypeptide itself. Alternatively, a potential antagonist may be a mutant form of the polypeptide which binds to the receptors, however, no second messenger response is elicited and, therefore, the action o~ the polypeptide is e~ectively blocked.
Another antagonist compound to the FGF-14 gene and gene product is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expression through triple-helix ~ormation or antisense DNA or RNA, both of which methods are based on binding o~ a polynucleotide to DNA or RNA. For example, the 5' coding portion o~ the polynucleotide sequence, which encodes ~or the mature polypeptides o~ the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligomlcleotide is designed W O 96/39506 PCT~US95/06730 to be complementary to a region o~ the gene involved in transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production o~ the polypeptides o~ the present invention. The antisense RNA
oligonucleotide hybridizes to the mRNA ln vivo and blocks translation o~ the mRNA molecule into the polypeptide (Antisense - Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the polypeptide.
Potential antagonist compounds also include small molecules which bind to and occupy the binding site o~ the receptors thereby making the receptor inaccessible to its polypeptide such that normal biological activity is prevented. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules.
Antagonist compounds may be employed to inhibit the cell growth and proliferation effects of the polypeptides of the present invention on neoplastic cells and tissues, i.e.
stimulation o~ angiogenesis o~ tumors, and, therefore, retard or prevent abnormal cellular growth and proliferation, for example, in tumor ~ormation or growth.
The antagonists may also be employed to prevent hyper-vascular diseases, and prevent the proli~eration of epithelial lens cells after extracapsular cataract surgery.
Prevention o~ the mitogenic activity o~ the polypeptides o~
the present invention may also be desirous in cases such as restenosis after balloon angioplasty.
The antagonists may also be employed to prevent the growth o~ scar tissue during wound healing.

W096/395~6 PCT~S95/06730 The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
The polypeptides, agonists and antagonists o~ the present invention may be employed in combination with a suitable pharmaceutical carrier to comprise a pharmaceutical composition ~or parenteral administration. Such compositions comprise a therapeutically e~ective amount o~ the polypeptide, agonist or antagonist and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buf~ered saline, dextrose, water, glycerol, ethanol, and combinations thereo~. The formulation should suit the mode o~ ~m; n; stration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers ~illed with one or more of the ingredients of the pharmaceutica] compositions of the invention. Associated with such container(s) can be a notice in the ~orm prescribed by a governmental agency regulating the manu~acture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides, agonists and antagonists o~ the present invention may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in a convenient m~nn~r such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are ~m; n; stered in an amount which is e~ective for treating and/or prophylaxis of the speci~ic indication.
In general, they are administered in an amount o~ at least about 10 ~g/kg body weight and in most cases they will be ~m; n; stered in an amount not in excess o~ about 8 mg/Kg body weight per day. In most cases, the dosage is ~rom about 10 ~g/kg to about 1 mg/kg body weight daily, taking into account W096/39506 PCT~S95/06730 the routes o~ administration, symptoms, etc. In the speci~ic case o~ topical administration, dosages are pre~erably administered ~rom about 0.1 ~g to 9 mg per cm~.
The polypeptide o~ the invention and agonist and antagonist compounds which are polypeptides, may also be employed in accordance with the present invention by expression o~ such polypeptide in vivo, which is o~ten re~erred to as "gene therapy."
Thus, ~or example, cells may be engineered with a polynucleotide (DNA or RNA) encoding ~or the polypeptide ex vivo, the engineered cells are then provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use o~ a retroviral particle containing RNA encoding ~or the polypeptide o~ the present invention.
Similarly, cells may be engineered in vivo ~or expression o~ the polypeptide in vivo, ~or example, by procedures known in the art. As known in the art, a producer cell ~or producing a retroviral particle containing RNA
encoding the polypeptide o~ the present invention may be administered to a patient ~or engineering cells in vivo and expression o~ the polypeptide in vivo. These and other methods ~or ~m; n~ stering a polypeptide o~ the present invention by such methods should be apparent to those skilled in the art ~rom the teachings o~ the present invention. For example, the expression vehicle ~or engineering cells may be other than a retroviral particle, ~or example, an adenovirus, which may be used to engineer cells in vivo a~ter combination with a suitable delivery vehicle.
Retroviruses ~rom which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia =

W096/39506 PCT~S9S/06730 virus, human ;mmllnode~iciency virus, adenovirus, Myeloproli~erative Sarcoma Virus, and m~mm~y tumor virus.
In one embodiment, the retroviral plasmid vector is derived ~rom Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection o~ a suitable promoter will be apparent to those skilled in the art ~rom the teachings contained herein.
The nucleic acid sequence encoding the polypeptide o~
the present invention is under the control o~ a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modi~ied retroviral LTRs hereinabove described); the ~-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the gene encoding the polypeptide.
The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples o~ packaging cells which may be trans~ected include, but are W096/39506 PCT~S95/06730 not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X, VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by re~erence in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vi tro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hema~opoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratlnocytes, endothelial cells, and bronchial epithelial cells.
This invention is also related to the use of the genes o~ the present invention as part o~ a diagnostic assay ~or detecting diseases or susceptibility to diseases related to the presence of mutations in the nucleic acid sequences encoding the polypeptide o~ the present invention.
Individuals carrying mutations in a gene of the present invention may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient~s cells, such as ~rom blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used ~or the same purpose.

W096/39506 PCT~S95/06730 As an example, PCR primers comple~entary to the nucleic acid encoding a polypeptide o~ the present invention can be used to identify and analyze mutations. For example, deletions and insertions can be detected by a change in size o~ the amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively, radiolabeled antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexee by RNase A digestion ~r by differences in melting temperatures.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA
fragments of different se~uences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230:1242 (1985)).
Sequence changes at speci~ic locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment ~ength Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by in si tu analysis.
The present invention also relates to a diagnostic assay for detecting altered levels of FGF-14 proteins in various tissues since an over-expression o~ the proteins compared to normal control tissue samples may detect the presence of abnormal cellular proli~eration, ~or example, a tumor.
Assays used to detect levels o~ protein in a sample derived ~rom a host are well-known to those o~ skill in the art and include radioimmunoassays, competitive-binding assays, Western Blot analysis, ELISA assays and "sandwich" assay. An ELISA assay (Coligan, et al., Current Protocols in Immunology, 1(2), Chapter 6, (1991)) initially comprises preparing an antibody speci~ic to an antigen to the polypeptides o~ the present invention, pre~erably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, ~luorescence or, in this example, a horseradish peroxidase enzyme. A sample is removed ~rom a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any ~ree protein binding sites on the dish are then covered by incubating with a non-speci~ic protein lik bovine serum albumen. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any polypeptides o~ the present invention attached to the polystyrene dish. All unbound monoclonal antibody is washed out with bu~er. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding o~
the reporter antibody to any monoclonal antibody bound to the protein o~ interest.
Unattached reporter antibody is then washed out.
Peroxidase substrates are then added to the dish and the amount o~ color developed in a given time period is a measurement o~ the amount o~ a polypeptide o~ the present invention present in a given volume o~ patient sample when compared against a st ~n~ ~d curve.

W096/39506 PCT~S95/06730 A competition assay may be employed wherein antibodies speci~ic to a polypeptide o~ the present invention are attached to a solid support and labeled FGF-13 and a sample derived from the host are passed over the solid support and the amount o~ label detected, ~or example by liquid scintillation chromatography, can be correlated to a quantity of a polypeptide o~ the present invention in the sample.
A "sandwich" assay is similar to an ELISA assay. In a "sandwich" assay a polypeptide o~ the present invention is passed over a solid support and binds to antibody attached to a solid support. A second antibody is then bound to the polypeptide of interest. A third antibody which is labeled and specific to the second antibody is then passed over the solid support and binds to the second antibody and an amount can then be quantified.
The sequences of the present inven.tion are also valuable for chromosome identi~ication. The sequence is speci~ically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphism's) are presently available ~or marking chromosomal location. The mapping o~ DNAs to chromosomes according to the present invention is an important ~irst step in correlating those sequences with genes associated with disease.
Brie~ly, sequences can be mapped to chromosomes by preparing PCR primers (pre~erably 15-25 bp) ~rom the cDNA.
Computer analysis o~ the 3' untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the ampli~ication process.
These primers are then used ~or PCR screening o~ somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

W096/39506 PCT~S95/06730 PCR mapping o~ somatic cell hybrids is a rapid procedure ~or assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels o~
~ragments rom speci~ic chromosomes or pools o~ large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled ~low-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) o~ a cDNA
clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases.
For a review o~ this technique, see Verma et al., Human Chromosomes: a Manual o~ Basic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position o~ the sequence on the chromosome can be correlated with genetic map data. (Such data are found, ~or example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identi~ied through linkage analysis (coinheritance o~ physically adjacent genes).
Next, it is necessary to determine the di~erences in the cDNA or genomic sequence between a~ected and una~ected individuals. I~ a mutation is observed in some or all o~ the a~ected individuals but not in any normal individuals, then the mutation is likely to be the causative agent o~ the disease.
With current resolution o~ physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one ~ ~ - =
CA 022l2992 l997-08-l4 W 096/39506 PCT~US95/06730 of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an ~n; m~ 1 or by administering the polypeptides to an animal, preferably a nonhllm~n. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used -to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the h~lm~n B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce hllm~n monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to ;mmllnogenic polypeptide products of this invention. Also, transgenic mice may be used to W096/39s06 PCT~S95/06730 express hllm~n;zed antibodies to immunogenic polypeptide products o~ this invention.
The present invention will be ~urther described with re~erence to the ~ollowing examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise speci~ied, are by weight.
In order to ~acilitate understanding o~ the following examples, certain ~requently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceled and/or ~ollowed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed ~rom available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" o~ DNA re~ers to catalytic cleavage o~ the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, co~actors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 ~g o~ plasmid or DNA
~ragment is used with about 2 units o~ enzyme in about 20 ~1 o~ bu~er solution. For the purpose o~ isolating DNA
~ragments ~or plasmid construction, typically 5 to 50 ~g o~
DNA are digested with 20 to 250 units o~ enzyme in a larger volume. Appropriate bu~ers and substrate amounts for particular restriction enzymes are speci~ied by the manu~acturer. Incubation times o~ about 1 hour at 37~C are ordinarily used, but may vary in accordance with the supplier's instructions. A~ter digestion the reaction is W096/39506 PCT~S95/06730 electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation o~ the cleaved ~ragments is per~ormed using 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" re~ers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence o~ a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" re~ers to the process o~ ~orming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 ~g o~ approximately equimolar amounts of the DNA fragments to be ligated.
Unless otherwise stated, transformation was per~ormed as described by the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

ExamDle 1 Bacterial Ex~ression and ~uri~ication of FGF-14 Protein The DNA sequence encoding FGF-14 ATCC # 97148, is initially ampli~ied using PCR oligonucleotide primers corresponding to the 5' sequences of the processed protein (minus the signal peptide sequence) and the vector sequences 3' to the gene. Additional nucleotides corresponding to the gene are added to the 5' and 3' sequences. The 5' oligonucleotide primer has the sequence 5' GCCAGAGCATGCAGCGGCGCGTGTGTCCCCGC 3' (SEQ ID NO:3) and contains an SphI restriction enzyme site. The 3' sequence 5' W O 96/39506 PCTrUS95/06730 GCCAGAAGATCTGGGGGCAGGGGGACTGGAAGG 3' (SEQ ID NO:4) con~ains complementary sequences to a BglII site and is ~ollowed by 21 nucleotides o~ FGF-14 coding sequence.
The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE70 (Qiagen, Inc. Chatsworth, CA 91311). pQE-70 encodes antibiotic resistance (Ampr), a bacterial origin o~
replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-70 was then digested with NcoI
and BglII. The ampli~ied sequences are ligated into pQE-70 and are inserted in ~rame with the sequence encoding ~or the histidine tag and the ribosome binding site (RBS). The ligation mixture is then used to trans~orm E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies o~ the plasmid pREP4, which expresses the lacI repressor and also con~ers kanamycin resistance (Kanr).
Trans~ormants are identi~ied by their ability to grow on LB
plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA is isolated and con~irmed by restriction analysis. Clones containing the desired constructs are grown overnight (O/N) in liquid culturein LB
media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N -ulture is used to inoculate a large culture at a ratio o~ 1:100 to 1:250. The cells are grown to an optical density 600 (O.D.~) o~ between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside'~) is then added to a ~inal concentration o~ 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression. Cells are grown an extra 3 to 4 hours.
Cells are then harvested by centri~ugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl.
A~ter clari~ication, solubilized FGF-14 is puri~ied ~rom this W096/39506 PCT~S95/06730 solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). The proteins are eluted ~rom the column in 6 molar guanidine HCl pH 5.0 and for the purpose o~ renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). A~ter incubation in this solution ~or 12 hours the proteins are dialyzed to 10 mmolar sodium phosphate.

Example 2 Cloninq and expression o~ FGF-14 usinq the baculovirus ex~ression sYstem The DNA sequence encoding the ~ull length FGF-14 protein, ATCC # 97148, is ampli~ied using PCR oligonucleotide primers corresponding to the 5' and 3' sequences o~ the gene:
The FGF-14 5' primer has the sequence 5' CTAGTGGATCC
CATCATGGCGGCGCTGGCCAGT 3' (SEQ ID NO:5) ~or the pA2 vector and contains a BamHI restriction enzyme site (in bold) ~ollowed by 4 nucleotides resembling an e~icient signal for the initiation o~ translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is just behind the ~irst 18 nucleotides o~ the gene (the initiation codon ~or translation "ATG" is underlined). For the pA2gp vector the 5' primer has the sequence 5' CGACTGGATCCCCAGCGGCGCGTGTGTCCC

3' (SEQ ID NO:6).
The 3' primer has the sequence 5' CGA~llclAGAATCAGGGGG
CAGGGGGACTGGA 3' (SEQ ID NO:7) and contains the cleavage site ~or the restriction endonuclease XbaI (in bold) and 22 nucleotides complementary to the 3' non-translated sequence o~ the gene.
The ampli~ied sequences are isolated ~rom a 1~ agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The ~ragment is then digested with the W O 96/39506 PCT~US95/06730 respective endonucleases and puri~ied again on a 1~ agarose gel. This fragment is designated F2.
The vector pA2gp (and pA2) (modifications of pVL941 vector, discussed below) is used for the expression o~ the proteins using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A m~nl~l o~ methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555).
This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recogni~ion sites for the restriction endonucleases BamHI and XbaI. The polyadenylation site of the simian virus (SV)40 is used for e~ficient polyadenylation. For an easy selection of recombinant virus the beta-galactosidase gene ~rom E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences ~or the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pA2 such as pRG1, pAc373, pVL941 and pAcIM1 (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
The plasmid is digested with the restriction enzymes and dephosphorylated using calf intestinal phosFnatase by procedures known in the art. The DNA is then isolated ~rom a 1~ agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA
is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase. E.coli DH5~ cells are then transformed and bacteria identified that contained the plasmid (pBacFGF-14) using the respective restriction enzymes. The sequence of the cloned fragment are confirmed by DNA sequencing.

.

WO9G/39S06 PCT~S9S/06730 5 ~g of the plasmid pBacFGF-14 is co-transfected with 1.0 ~g of a commercially available linearized baculovirus ("BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid is mixed in a sterile well of microtiter plates containing 50 ~l of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l Lipofectin plus 90 ~l Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to the Sf9 insect cells (ATCC CRL 1711) seeded in 35 mm tissue culture plates with 1 ml Grace's medium without serum. The plates are rocked back and forth to mix the newly added solution. The plates are then incubated for 5 hours at 27~C. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10~ fetal cal~ serum is added. The plates are put back into an incubator and cultivation continued at 27~C for ~our days.
After four days the supernatant is collected and plaque assays performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal"
(Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Li~e Technologies Inc., Gaithersburg, page 9-10) .
Four days after the serial dilution the virus is addedto the cells and blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuspended in an Eppendorf tube cont~;n;ng 200 ~1 of Grace's medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant W096/39506 PCT~S95/06730 baculovirus is used to in~ect S~9 cells seeded in 35 mm dishes. Four days later the supernatants o~ these culture dishes are harvested and then stored at 4~C.
S~9 cells are grown in Grace's medium supplemented with 10~ heat-inactivated FBS. The cells are in~ected with the recombinant baculovirus V-FGF-14 at a multiplicity o~
in~ection (MOI) o~ 2. Six hours later the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Li~e Technologies Inc., Gaithersburg). 42 hours later 5 ~Ci o~ 35S-methionine and 5 ~Ci 35S cysteine (Amersham) are added. The cells are ~urther incubated ~or 16 hours be~ore they are harvested by centri~ugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Example 3 Expression of Recombinant FGF-14 in COS cells The expression o~ plasmids, FGF-14-HA derived ~rom a vector pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin o~
replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter ~ollowed by a polylinker region, an SV40 intron and polyadenylation site. DNA
~ragments encoding the entire FGF-14 precursor and an HA tag ~used in ~rame to the 3' end is cloned into the polylinker region o~ the vector, there~ore, the recombinant protein expression is directed under the CMV promoter. The HA tag corresponds to an epitope derived ~rom the in~luenza hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37:767, (1984)). The in~usion of HA tag to the target protein allows easy detection o~ the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as ~ollows:
The DNA sequence encoding FGF-14, ATCC # 97148, is constructed by PCR using two primers: the 5' primer 5' CTAG

W096/39506 PCT~S95/06730 TGGATCCCATCATGGCGGCGCTGGCCAGT 3' (SEQ ID NO:8) contains a BamHI site ~ollowed by 18 nucleotides of coding sequence starting ~rom the initiation codon; the 3' sequence 5' GATTTACTCGAGGGGGGCAGGGGGACTGGA 3' (SEQ ID NO:9) contains complementary sequences to an XhoI site, translation stop codon, HA tag and the last 18 nucleotides o~ the FGF-14 coding sequence (not including the stop codon). There~ore, the PCR product contains a BamHI site, coding sequence followed by HA tag ~used in ~rame, a translation termination stop codon next to the HA tag, and an XhoI site.
The PCR amplified DNA ~ragments and the vector, pcDNA3/Amp, are digested with the respective restriction enzymes and ligated. The ligation mixture is transformed into E. coli strain SURE (available ~rom Stratagene Cloning Systems, La Jolla, CA 92037) the trans~ormed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated ~rom trans~ormants and ~m; ned by restriction analysis ~or the presence o~ the correct fragment. For expression of the recom-binant FGF-14 COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory ~n~ , Cold Spring Laboratory Press, (1989)). The expression of the FGF-14-HA
protein is detected by radiolabelling and lmml~noprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory M~n~
Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled ~or 8 hours with 35S-cysteine two days post trans~ection. Culture media is then collected and cells are lysed with detergent (RIPA bu~er (150 mM NaCl, 1~ NP-40, 0.1~ SDS, 1~ NP-40, 0.5~ DOC, 50mM Tris, pH 7.5) (Wilson, I.
et al., Id. 37:767 (1984)). Both cell lysate and culture media are precipitated with an HA speci~ic monoclonal antibody. Proteins precipitated are analyzed on 15~ SDS-PAGE
gels.

W O 96~9506 PCTrUS95/06730 Example 5 Expression via Gene Therapv Fibroblasts are obtained from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet sur~ace o~ a tissue culture flask, approximately ten pieces are placed in each ~lask. The ~lask is turned upside down, closed tight and le~t at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks o~ tissue remain ~ixed to the bottom of the ~lask and ~resh media (e.g., Ham's F12 media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C for approximately one week.
At this time, ~resh media is added and subsequently changed every several days. A~ter an additional two weeks in culture, a monolayer o~ ~ibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) ~lanked by the long terminal repeats o~ the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and puri~ied, using glass beads.
The cDNA encoding a polypeptide o~ the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer containing an EcoRI site and the 3' primer having contains a HindIII site.
Equal quantities o~ the Moloney murine sarcoma virus linear backbone and the EcoRI and HimdIII fragment are added together, in the presence o~ T4 DNA ligase. The resulting mixture is maintained under conditions appropriate ~or ligation o~ the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene o~ interest properly inserted.

W096/39506 PCT~S95/06730 The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco~s Modi~ied Eagles Medium (DMEM) with 10~ calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of con~luent producer cells. The spent media, containing the infectious viral particles, is ~iltered through a millipore filter to remove detached producer cells and this media is then used to in~ect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media ~rom the producer cells. This media is removed and replaced with ~resh media. I~ the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. I~ the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered ~ibroblasts are then injected into the host, either alone or after having been grown to con~luence on cytodex 3 microcarrier beads. The ~ibroblasts now produce the protein product.
Numerous modi~ications and variations o~ the present invention are possible in light o~ the above teachings and, therefore, within the scope o~ the appended claims, the invention may be practiced otherwise than as particularly described.

W O 96/39506 PCT~US95/06730 SEQUENCE LISTING
(1~ GENERAL INFORMATION:
(i) APPLICANT: HU, ET AL.
(ii) TITLE OF INVENTION: Fibroblast Growth Factor-14 (iii) NUMBER OF SEQUENCES: 8 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) CO UNlKY: USA
(F) ZIP: 07068 (v) COM~U1~K READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COM~Ul~: IBM PS/2 (C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Concurrently (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER: 08/207,412 (B) FILING DATE: 8 MAR 1994 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134 (C) REFERENCE/DOCKET NUMBER: 325800-402 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700 (B) TELEFAX: 201-994-1744 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQu~N~ CHARACTERISTICS
(A) LENGTH: 680 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR

W096/39506 PCT/U~,S,'~C730 (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NC):1:

CTCTACCGCC AGC~lC~llC TGGCCGGGCC TGGTACCTCG GCCTGGACAA GGAGGGCCAG 540 GTCATGAAGG GA~ACCGAGT TAAGAAGACC AAGGCAGCTG CCCACTTTCT GCCCAAGCTC 600 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 225 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Ala Ala Leu Ala Ser Ser Leu Ile Arg Gln Lys Arg Glu Val -25 -20 . -15 Arg Glu Pro Gly Gly Ser Arg Pro Val Ser Ala Gln Arg Arg Val Cys Pro Arg Gly Thr Lys Ser Leu Cys Gln Lys Gln Leu Leu Ile Leu Leu Ser Lys Val Arg Leu Cys Gly Gly Arg Pro Ala Arg Pro Asp Arg Gly Pro Glu Pro Gln Leu Lys Gly Ile Val Thr Lys Leu Phe Cys Arg Gln Gly Phe Tyr Leu Gln Ala Asn Pro Asp Gly Ser Ile Gln Gly Thr Pro Glu Asp Thr Ser Ser Phe Thr His Phe Asn Leu Ile Pro Val Gly Leu Arg Val Val Thr Ile Gln Ser Ala Lys Leu Gly His Tyr Met Ala Met Asn Ala Glu Gly Leu Leu Tyr Ser Ser Pro His Phe Thr Ala Glu Cys Arg Phe Lys Glu Cys Val Phe Glu Asn Tyr Tyr Val Leu Tyr Ala Ser Ala Leu Tyr Arg Gln Arg Arg Ser Gly Arg Ala Trp Tyr Leu Gly Leu Asp Lys Glu Gly Gln Val Met Lys Gly Asn Arg Val Lys Lys Thr Lys Ala Ala Ala His Phe Leu Pro Lys Leu Leu Glu Val Ala Met Tyr Gln Glu Pro Ser W096/39506 PCT~S95/06730 Leu His Ser Val Pro Glu Ala Ser Pro Ser Ser Pro Pro Ala Pro (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 32 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
GCCAGAGCAT GCAGCGGCGC ~l~'l'~'l'CCCC GC 32 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 33 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

(2) INFORMATION FOR SEQ ID NO:5 (i) SEQ~ CHARACTERISTICS
(A) L~N~l~: 33 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQu~N~ DESCRIPTION: SEQ ID NO:5:

(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS

W096/39506 PCT~S95/06730 (A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 33 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 33 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Claims (20)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide comprising amino acid -26 to amino acid 199 as set forth in SEQ ID NO:2;
(b) a polynucleotide encoding the polypeptide comprising amino acid 1 to amino acid 199 as set forth in SEQ ID NO:2;
(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a), (b) or (c).

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 comprising from nucleotide 1 to nucleotide 680 as set forth in SEQ ID NO:1.

4. The polynucleotide of Claim 1 comprising from nucleotide 79 to nucleotide 680 as set forth in SEQ ID
NO:1.

5. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding a mature polypeptide encoded by the DNA contained in ATCC Deposit No. 97148;
(b) a polynucleotide encoding the polypeptide expressed by the DNA contained in ATCC Deposit No. 97148;
(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a), (b) or (c).

6. A vector containing the DNA of Claim 2.

7. A host cell genetically engineered with the vector of Claim 6.

8. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 7 the polypeptide encoded by said DNA.

9. A process for producing cells capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 6.

10. A polypeptide comprising a member selected from the group consisting of (i) a polypeptide having the deduced amino acid sequence of SEQ ID NO:2 and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the cDNA of ATCC Deposit No. 97148 and fragments, analogs and derivatives of said polypeptide.

11. An antibody against the polypeptide of claim 10.

12. A compound which inhibits the biological actions of the polypeptide of claim 10.

13. A compound which activates a receptor to the polypeptide of claim 10.

14. A method for the treatment of a patient having need of an FGF-14 polypeptide comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 10.

15. A method for the treatment of a patient having need to inhibit an FGF-14 polypeptide comprising: administering to the patient a therapeutically effective amount of the compound of claim 12.

16. The method of claim 14 wherein said therapeutically effective amount of said polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

17. The method of claim 15 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA
encoding said antagonist and expressing said antagonist in vivo.

18. A process for identifying compounds active as agonists to the polypeptide of claim 10 comprising:
(a) combining a compound to be screened and a reaction mixture containing cells under conditions where the cells are normally stimulated by said polypeptide, said reaction mixture containing a label incorporated into the cells as they proliferate; and (b) determining the extent of proliferation of the cells to identify if the compound is an effective agonist.

19. A process for identifying compounds active as antagonists to the polypeptide of claim 10 comprising:
(a) combining a compound to be screened, the polypeptide and a reaction mixture containing cells under conditions where the cells are normally stimulated by said polypeptide, said reaction mixture containing a label incorporated into the cells as they proliferate; and (b) determining the extent of proliferation of the cells to identify if the compound is an effective antagonist.

20. A process for diagnosing a disease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 10 comprising:
determining a mutation in the nucleic acid sequence encoding said polypeptide.