CA2181547A1 - Hematopoietic cell expansion and transplantation methods - Google Patents

Abstract

The application concerns a method for the ex vivo expansion of hematopoietic cells, including hematopoietic stem and progenitor cells, using endothelial support cells in an artificial capillary system (ACS). The invention also concerns improved bone marrow transplantation methods. Also, the application concerns a method for enhancing the ex vivo expansion of hematopoietic cells by coating the capillaries of an ACS with a suitable coating reagent. A method for transducing ex vivo expanding hematopoietic cells, including hematopoietic stem and progenitor cells, with packaged recombinant retrovirus vectors is also provided.

Description

W095119793 ~ 1 8 1 $4 ~ =
~t ~ r - Cell F, and Tr , ' ' ' ~ Methods This inYention was made with gU._.lllll.~.ll support. The ~u..
has certain rights in the invention.
Field of the lnven~ion The invention relates to the ex viw expansion Of l~ cells, including l l stem and progenitor cells. The invention further relates to improved bone marrow i . ' methods. The invention also relates to enhancing ex vivo expansion of ' l cells by coating the capillaries of an artificial capillary system with a suitable coating reagent.
Finally, the invention relates to methods for 1l,.,~l" ;,.~ the I
cells with retrovirus vectors.
B~ckground of ~he Invention TT.., ~ -:~, the production of mature blood cells, is a complex scheme of l,...ll;lil,~ .~,~. Jirf~,..,l..i..,iull. Mature blood cells are derived from pluripotent I I stem cells (HSC). The defining, ~ of HSC are the capacity for extensive self-renewal and retention of Itiiin.~agt~:
I;rf~ - ;-.,. potential (i.e., the ability to ICLUll~ U~ the l-system). HSC proliferate and dirLl, to produce progenitor cells, which in turn form precursor cells, which dir~., to form mature b~ood cells.
During ontogeny, I I moves from yolk sac to li~
and then to the bone marrow (Tavassoli, M., Blood Cells 17:269 (1991)).
During early fetal life, l l occurs within the liver and spleen. In the latter part of gestation, bone marrow spaces begin to develop and expand.
HSC then migrate from li~ to the bone marrow occupying "niches"
in the developing marrow (Zanjani et al., J. Clin. Invest. 89:1178 (1992)).
TT~ F ~:~ ' . 'y primarily occurs in the bone marrow (Gordon et aL, Bone Marrow Transplant 4:335 (1989)).

W095/19793 r~l/L.,,~

2~8~ 547 HSC a}e contained in a ~"l.~ ,"l ~ of ! ' I ' '- cells ,Lyl,;,"lly . 1. -.,., ,~ . i,. .1 by the presence of the CD34 and absence of the CD38 cell surface antigens. Thus, ulldirr~l, ' pluripotent HSC capable of long term l . ~ ;-J,~ are CD34+CD38-. In vivo, the bone marrow stroma (comprised of adipocytes, Ill~,lU~llI,.t,~,i~, fibroblasts, endothelial cells, and the associated extra-cellular matrix) provides the ;.,lU.,ll~ for constitutive h... ,,. l..I..~if ~; ~ (Gordon et al., Bone Marrow Transplant 4:335 (198g)).
Bone marrow ~ i. ,. . (BMT) has become an imporLant therapeutic option for a number of conditions. For example, BMT is used in attempts to restore I I - function following ablative ~
" ~ regimens. Moreover, BMT has bcen used successfully to treat a number of congenital 'l~,.llaLu~ok,iic and metabolic disorders (Sullivan, K.M., 7ransplant Proc. 21 (Suppl. 1):41 (1989)).
However, wll.~ iulldl BMT has significant limitations. Currently, HSC uscd for clinical L~ JlcllLllLiull in the treatment of ~ if l.----- C are usually contained in harvested adult bone marrow or peripheral blood. Most transplants done presently utilize a matched bone marrow donor (allogeneic BMT). U '( 'y, only about 10% of candidates for allogeneic BMT will actually have a human leukocyte antigen (HLA)-identical family member.
This precludes an optimal donor for the majority of patients (Flake et al., Exp.~er~at. 19:1061 (1991)). Moreover, results using HLA-",i- r h (l donors have been di~"l,u;llLil.~, (O'Reilly et al., 1mmunod~. Rev. 1:23 (1990);
Anasetti et al., N. Engl. J. Med 320:197 (1989); Ferrara et al., N. Engl. J.
Med. 324:667 (1991)).
In an attempt to overcome the necessity of finding a matched donor, autologous BMT has been developed in which the patients own marrow is harvested and then reinfused back into the patient after the marrow ablating event. However, harvesting the bone marrow still requires inpatient l . ' and a surgical proccdure. Moreover, the patients marrow is frequently damaged from prior anti-cancer treatment or ~ ' with wo 95/19793 r~l,L.,,~. /

3 2I~ 7 malignant cells (Gale a al., Bone Marrow Transplant 7:153 (1991)). This shortage of autologous marrow is even more l~ ul ~ when multiple cycles of, h..,..,lh..~l.y are required.
Thus, there has been much interest in the expansion of bone marrow cells ex vivo prior to l~ (Edgington S.M., ~7~i~7~P~,701~7gy 10 1099 (1992)). Successful ex vivo expansion of HSC would allow i , ' in situations where, using currently available technology, adequate amounts of bone marrow cannot be harvested from the patient.
Two types of 1- r ' " culture systems have been developed:
stromal/l r cell co-culture systems (e.g., Dexter-type cultures), and liquid cultures which include 1~ cells and cytokines without stromal support cells. Dexter-type long terln bone marrow cultures (LTBMCs) were developed in the 1970s. LTBMCs provided stable cx vivo 1- r ' systems for several months (Dexter et al., J. Cell Physiol. 91:335 (1977);
Dexter et al., in: Wright, D.G., rlr~ . h .~.. , J.S. (Eds.): Long-term Bone Marrow Culture. New York, NY, Liss, p. 57 (1984)). However, LTBMCs exhibit PYronPnti~ly decreasing numbers of total and progenitor cells with time, rendering the cultures unsuitable for cell expansion for clinical use (Eaves et al., J. T~ssue Cult. hlethods 13:55 (1991)). I n c o n t r a s t, 1 . cells grown in liquid culture result in a large degree of llu.~l~ cell expansion (Haylock a al., Blood 80:1405 (1992); Brandt ct al., Blood 79:634 (1992)). However, cellular .I;r~ ;u,l and depletion of primitive cells (e.g., HSC) invariably occurs in these systems. For example, after culture of enriched primitive I . cells" ". -~. I . I ., ,. . ~t~of long-term culture-initiating cells (LTC-IC) were reported as being below the input value (Sutherland et al., Blood 78:666 (1991); Verfaillie, C.M., Blood 79:2821 (1992)).
Attempts to overcome these problems using a continuous perfusion culture of ' cell (MNC) PUr ' obtained from adult marrow without enrichment for CD34~ cells resulted in expansion of progenitor cells (Koller a al., Blood 82:378 (1993); Koller etal., niv~ ~- 71~j,y 11:358 w095119793 ~8~
~1-(1993); Palsson et al., Ai~/ff ' ~ y 11:368 (1993)). However, these studies are limited because the cells were ~ i~ only by the LTC-IC assay, and not by phenotype analysis or an in vivo model of f~ - Il The LTC-IC, high ~lUli~ iv~ potential-colony-forming cells (HPP-CFC), and blast colony-forming cells (CFU-B1) assays identify a primitive 1 - ~ cell (Williams, D.A., Blood 81(12):3169 (1993)). However, the primitive cells identified by these assays include not only HSC but also more dir~
progenitor cells. Therefore, the extent of HSC i,l. .. ;ri. ,i.,.. may be overstated when these assays are used for ' It is difficult to analyze factors and conditions affecting l in these co-culture systems due to the ~l~,~lU~ y of both the I
cells (when MNC are used) and the supporting stromal cell layer. The successful use of a l-~ ,..,..u~ cell population to support the ex vivo expansion of HSC would greatly facilitate the study of l,....-l..l..:.:.-:~
However, to date, an ex vivo system utilizing 1.. ",.. ~ .. ~ support cells capable of achieving significant HSC expansion (without HSC depletion) has not appeared in the literature.
S ~y of the Inven~on Bone marrow ~ , (BMT) therapies have been used for treating patients suffering from a variety of disorders. However, for allogeneic BMT, only about 10% of candidates for BMT have a human leukocyte antigen (HLA)-identical family member. This precludes an optimal donor for the majority of patients. Moreover, the difficulty in obtaining sufficient amounts of a patient's own marrow often precludes the use of autologous BMT.
These limitations have been overcome, at least in part, by the present invention, which provides a method for expanding I r ' '' cells, including l l stem and progenitor cells, eA~ vivo in an artificial capillary system (ACS) cartridge. By the invention, a ~ub~i~ulLidlly wo 95~19793 r~.,.
5 2181~4'7 population of endothelial cells is used to support 1.. .I~ J~
cellular expansion. The method involves inoculating endothelial cells capable of supporting expansion of 1. ~ ;r cells into an ACS cartridge, inoculating CD34+ cells into the ACS cartridge, perfusing the ACS cartridge with culture medium containing at least one I , growth factor capable of stimulating expansion of '- . cells, and culturing the CD34+ cells in the ACS cartridge for a sufficient amount of time to achieve h. .., ~ i. cell expansion, including expansion of I . stem and progenitor cells. After culture, or at intervals during culture, " CIIL
I~ O ~; ;I cells can be harvested from the ACS cartridge. I
stem cells (HiSC) and committed progenitor cell ~ ' can be detected in the harvested " cells using flow cytometry and colony-forming assays.
The invention is also directed to improved bone marrow l, A l . ~l ,lA,: - ~ ;I I,, methods. The invention involves inoculating endothelial cells capable of supporting expansion of I . cells into an ACS cartridge, inoculating CD34+ cells into the ACS cartridge, perfusing the ACS cartridge with culture medium containing at least one I "u;.,l;.. growth factor capable of stimulating expansion of I , cells, culturing the CD34+ cells in the ACS cartridge for a sufficient amount of time to achieve expansion of a ~1.. .AI~.Ili. Ally effective number of I l,o;.,Li-. cells, including expansion of 1,. . -~ ;i, stem and progenitor cells, harvesting the cultured cells from the ACS cartridge, and I ' ,, the I . cells to a patient in need of a transplant.
The IIAII~III -1~1;~1ll methods of the present invention are useful for autologous and allogeneic bone marrûw i r) ' The invention is I~ Y useful for autologous transplants to patients suffering from 'i" Autologous marrow obtained from patients with 1~
- are sometimes ' with tumor cells. Agents used to purge the autologous marrow are known to deplete llr- ~ ;- stem and progenitor cells which results in delayed c.llAn~ ~l upon reinfusion. The present woss/ls7s3 r~,l,- 9' 5~ -6-invention overcomes this problem, at least in part, by Ir~ h`l,~ and S,~llirl~ullly expanaing the I , stem and progeni~or cell pul~u,~lLiu of purged marrow by e~ viw culture.
The invention further provides a method for enhancing the ex vivo expansion of I , - cells by culturing the cells in an ACS carLridge having capillaries coated with a suitable coating reagent such as gelatin, collagen, rlh.~ or preferably, the adhesion protein described herein.
The invention also provides a method for L~ Ju~,;1.6 ex vivo expanding cells, including I r ' '' stem and progenitor cells, with a packaged ,~.. "l,;,. ---~ retrovirus vector. The method involves inoculating an ACS cartridge with endothelial cells, CD34+ cells, and a suspension containing packaged retroviral vectors, perfusing the cartridge with at least one ' L ' '' growth factor, and culturing the CD34+ cells in the presence of the packaged retrovirus Yectors for a sufficient amount of time to achieve expansion and ~ , of ' . cells, including I ~, stem and progenitor cells. The retroviral vector can contain a 1, ~ ..1~.,,.. -gene encoding a Ih ,-l., ~ ly effective product. After expansion and harvesting, the transduced I . cells can be - ' ~ to a patient using the i . ' meLhods of the invention.
Brief D~s.,,~ of ~he Dra~nngs Figure 1~ mr~nU~n of Flask vs ACS culture of I
cells. Purified CD34+ cells were co-cultured with PMVEC in either tissue culture flasks or the ECS of an ACS cartridge. After 7 days of expansion, Iwl~~ cells from th~e flask and ACS cultures were harvested and subjected to , ' ~ lg with ' I antibodies against CD34 and CD38 cell surface antigens. The number of input CD34+ cells, and the number of cells staining CD34+, CD34+CD38, and CD34+CD38+ afLer 7 days of either flask or ACS culture are shown graphically.

WO95/19793 r~.,u ~7~ ~81~
Figure 2: 1 x 108 PMVEC were inoculated into the ECS of an ACS cartridge. After one week, 4 x 106 CD34+ cells were also inoculated into the ECS. The culture was CU~ UUU~ly maintained for 78 days. Total IIUIUIdII~ IL cell production was ' weekly using a 1- ~ Ull.~
Cumulative " cell yield generated in the ACS cartridge over 78 days is shown graphically.
Figure 3: I x 108 PMVEC were inoculated into the ECS of an ACS cartridge. After one week, 4 x 106 CD34+ cells were also inoculated into the ECS. The culture was ~ J~ y maintained for 35 days. Total CD34+ cell production was ~~ ' weekly by flow cytometry.
Cumulative CD34+ cell yield in the ACS cartridge over 35 days is shown graphically.
Figure 4: I x 108 PMVEC were inoculated into the ECS of an ACS cartridge. After one week, 4 x 106 CD34+ cells were also inoculated into the ECS. The culture was ~ ly maintained for 35 days. Total CFU-GM cell production was, ' weekly by a methylcellulose colony forming cell (CFC) assay. Cumulative CFU-GM cell yield in the ACS
cartridge over 35 days is shown graphically.
Figure 5: 3 x 107 PMVEC were inoculated into the lumen of ACS
capillaries and allowed to adhere tightly to the lumenal surface. I x 106 CD34+ cells were then inoculated into the ECS of the ACS cartridge. The culture was culllilluv.loly maintained for 14 days. Total " ~, cell production was; ' weekly using a ~ lIG~ V~ l. Cumulative ~W~ ll ' cell yield in the ACS cartridge over 14 days is shown graphically.
Total CFC number and lactate production over 14 days of culture are provided in Figures 6 and 7 IC~L;~IY-Figure 6: Aliquots of the CD34+ cells taken prior to culture and of the 1~-- --'h ~1 cells taken after 14 days of culture were assayed for CFC
- number. Total CFC number over 14 days of culture is shown graphically.

WO g5/19793 ~ 7 ~,t~ 8-Figure 7: The lactate production by the cell culture determined by sampling the perfusate during the course of the culture using an automated analyzer is shown graphically.
Figure 8: 33 x 106 ' cells from bone marrow were inoculated into the ECS of cartridges containing capillaries either with or without a 1~...,..l.;,.-: adhesion protein coating. ~r - cells were harr~ested after 12 days of culture. CFC assays were performed to determine the number of CFU-GM + BFU-E i . progenitor cell subtypes per 200,000 har~rested ' cells. A comr~ncnn between cell expansions achieved using coated and uncoated capillaries is shown graphically. Results from a glucose utilization assay are provided in Figure 9.
Figure 9: After 4 and 6 days of culture, aliquots from the ACS
reservoir medium were taken and assayed for glucose ~ i.... (grams/24 hr). The results are shown graphically.
Figure 10: The amino acid sequence (SEQ ID NO. 1) of a ,~ ~,.. ,1.:. ,,. ,.1 adhesion protein is pro rided. The adhesion protein was designed using two ,~ blocks, one providing the structural properties of silk fibroin protein and the other providing the cell attachment activity of human Detoiled Descnption of the Invention The invention provides a method for the ex vivo expansion of cells, including l ~ :i~ stem and progenitor cells. The method involves inoculating endothelial cells capable of supporting expansion of l , ~ cells into an artificial capillary system (ACS) cartridge, 2s inoculating CD34+ cells into the ACS cartridge, perfusing the ACS cartridge with culture medium containing at least one ~ , growth factor, and culturing tile CD34~ cells for a sufficient amount of time to achieve WO95/19793 r~ l/L ~ 7 9 23 815~7 r r cell expansion, including expansion of r- . stem and progenitor cells.
Previously reported culture systems utilizing bone marrow cells enriched for CD34+ cells reported cellular dirF~ t;,~iol. and depletion of the more primitive (stem and progenitor) cell ~, ' (Sutherland ef al., Blood 78:666 (1991); Verfaillie, C.M., Blood 79:2821 (1992)). Thus, during expansion, the CD34+ cells dirf~,l, ' into more mature cells. Avempts by others to overcome this problem involved culturing bone marrow , ",.. 1 -l cell (MNC) r~ on ' ~ of irradiated marrow stroma (a II~L~U~ UU~ cell mixture including adipocytes, UIJll.. ~,_.~, fibroblasts, and endothelial cells) without prior enrichment for CD34+ cells.
This resulted in the expansion of progenitor cells. (Koller et al., Blood 82:378(1993); Koller et al., R;~ v~,y 11:358 (1993); Palsson et al., Ri~ IV~r 11:368 (1993)). These studies suggest that a l~ lu~ )u~ cell mixture ~I.e., the ~ I~JL~ marrow stroma) is necessary to support ex vivo expansion of l . stem and progenitor cells.
In contrast to previous studies, the present inventors have discovered that co-culturing CD34+ cells and a substantially l~ population of endothelial cells in an ACS cartridge achieves significant expansion of l . stem and progenitor cells. Moreover, in addition to stem and progenitor cell expansion, the present ex viw culturing system supports the expansion and long-term of the entire system (stem, progenitor, precursor, and mature cells).
The invention . .,. ~ co-culturing CD34+ cells and endothelial cells in an ACS cartridge. The CD34+ cells can be inoculated into the extra-capillary space (ECS) of an ACS cartridge as a bl ~ ' of cells included within a mixed cell population. Alternatively, the CD34+ cells can be inoculated into the ECS of an ACS cartridge as an enriched population of CD34+ cells.
Umbilical cord blood cells, peripheral blo~Jd cells, amd bone marrow cells of mammals, including humans, nonhuman primates, and mice, are W095/19793 r~J/~
547 -lo-mixed ceil pul~uldLiùl~s which include CD34+ cells and can be ûbtained according to U(Jll.~ iUII-II techniques (Kennedy et al., J Natl Cancer Inst 83 (13):921 (1991); Koller et al., Rj~ 358 (1993)). ~' ' cells (MNC) (which include CD34+ cells) can be prepared from umbilical cord blood cells, peripherai blood cells, and bone marrow cells using Ficoll-Hypaque density gradient c ,l . i r,~ as described in Example 3. Preparing MNC from cord blood and bone marrow using Ficoll-Hypaque density gradient ~,GIl.lirur~diull is aiso described in Koller et al., Blood 82:378 (1993) and Koller et al., .r~iu~ "7l~ 11:358 (1993), I.,~Li~ y. A~
0 105-107 of the above MNC can be inoculated into the E CS of an ACS cartridge for ex viw expansion of l . cells.
An enriched population of CD34+ cells can be prepared from umbilical cord blood cells, peripheral blood cells, and bone marrow cells from the above-described mammals according to Cull~ iiul~i techniques. For example, the anti-CD34+ mn-nrlnnRl antibody cell sorting techniques described in Brandt et al., J Clin Invest 86:932 (1990); Edgington, S.M., R~ J
10:1099 (1992); and Srour et al., Blood 81(3):661 (1993) can be used to obtain an enriched population of CD34+ cells. Simiiarly, the avidin-biotin '' ~J process described in Berenson et al., J Immunol Meth 91: 11 (1986); Berenson et al., Blood 67 (2):509 (1986); and Berenson et aL, Blood 69 (5):1363 (1987) can also be used for enrichment of CD34+ cells. In a preferred ..l,~i;....l CD34+ cells are enriched from bone marrow cells according to the positive ~ selection technique described in Example 1.
The CD34+ cells, as either an emiched or mixed cell population, are inoculated into tbe ECS of an ACS cartridge or ~yu~ l,;i and stored under liquid nitrogen for future use. Prior to inoculation into an ACS
cartridge, it is preferable to resuspend the CD34+ cells in a suit~ble culture medium. However, if frozen, ~Iyu~ CD34+ cells silould first be thawed using standard techniques. For example, the cells can be thawed wo 95119793 A ~
-11- 21815~7 rapidly at 37C and diluted in a suitable prewarmed (37C) culture medium.
Suitable culture mediums are describe,d below.
The cells are ,, ~ A.~ in a suitable culture medium at an appropriate ~.. .~l;.. " For example, a 1~11.: .,I~.. I;r~.l of I x lo6 CD34+
cells/ml can be used. Other suitable can be determined empirically. The CD34+ cells are then ready for inoculation into the ECS of an ACS cartridge. If an enriched population of CD34+ cells is used, as few as 102 - 103 CD34+ cells can be inoculated into the ECS for ex vivo expansion.
Preferably, however, 10~-10' CD34+ cells are inoculated.
As indicated, by the invention, CD34+ cells are co-cultured with endothelial cells in an ACS cartridge. Fn~i.7thPIi~l cells which, in ç~-nju rir~n with at least one ~ , growth factor (described below), are capable of supporting expansion of I . - stem and progenitor cells are suitable for use in the invention. For example, endothelial cells derived from the central nervous system (including the brain) of mammals such as humans, nonhuman primates, pigs and mice can be used to support I , cell expansion. r. endothelial cells derived from other organs (such as bone marrow or fetal cells) may also support I
cell expansion. Preferably, the endothelial cells are derived from the central nervous system of pigs. More preferably, the endothelial cells are porcine brain ~ uv~uL endothelial cells (PMVEC). Thus, by the invention, the cells used to support expansion of the 1~ r '- cells constitute a substantially 1~ cell population.
Suitable endothelial cells can be isolated from mammals according to ~ iollGI techniques. For example, PMVEC can be isolated from the brains of pigs using the procedure described in Example I. After isolation, the cells can be grown to confluency on culture plates to provide an accessible source of substantially 1~ endothelial support cells.
As discussed above, in the present invention, the endothelial cells, in ~ ~ with at least one I , growth factor, support expansion of 1 ~ ;- cells, including 1~ ;- stem and progenitor cells.

21~ 1~47 -12-Thus, a sufficient number of endothelial cells must be inoculated into the ACS
cartridge to support expansion. The number of endothelial cells that are "sufficient" to support expansion can be determined empirically. The inventors have discovered that inoculating a~ 106-lC8 endothelia'i cells into the ACS cartridge is sufficient to support expansion of the cells. Preferably, 107- 108 endothelial cells are inoculated. The endothelial cells can be inoculated into the ACS cartridge before, after, or ' I~ with the CD34+ cells. Preferably, however, the endothelial cells are inoculated prior to CD34+ cell inrir~ tir~n To support h~ ~t~ ,~"~
cell expansion, the endothelial cells are ;.. ,.. ,1,:!;,. 'i on the outer capillary wail. In an alternative ~ the endothelial cells are ;.. "~ on the inner capillary wail.
T.~ of endothelial cells on the outer capillary wail can be achieved simply by injecting the endothelial cells into the ECS and dispersing them over the hollow capiliaries by flushing culture medium back and forth through the two sampling side-ports using syringes. After culturing the cells for a sufficient amount of time (~,u.~ l~, 1-3 days), nu.~ill.,lc.l~
endothelial cells which have not settied onto the outer capillary wall can be removed by flushing the ECS with culture medium. This process leaves endothelial cells which are ' li7r-~i on the outer capillary wall and purges " Cll~ endotbelia'i cells from the ECS.
T".",. .l,;l;,-l;. ." of endothelial cells onto the inner capiilary wall can be achieved by injecting the endothelial cells into the capillary lumen via the ACSendport. This is followed by culturing the endothelial cells in the capillary lumen for a sufficient amount of time (~1~l,ll 'y 1-3 days) to a'ilow the cells to adhere onto the inner capillary wall. The cartridge can then be perfused with culture medium to remove ~ -II,.., .l cells leaving only endothelial cells which are ' ' ' to the inner capillary wail.
TI. ~ . :;. growth factors capable of stimulating expansion of ' . cells, including 1~ stem and progenitor cells, are described in the literature (Moore et al., Proc. Natl. Acad. Sci. USA 84:7134 W095~19793 r~ s: l/
-13- 2181~
(1987); Lcary etal., Blood 71:1759 (1988); Brandt etal" J. Clin. Invest.
86:932 (1990); Kobayashi et al., Blood 78:1947 (1991); Meunch et aL, Blood 81:3463 (1993); Bernstein er a~ Blood~ 77:2316 (1991); and Bodine et al., Blood 79:913 (1992)). In particular, the following growth factors can be used to stimulate expansion of l r cells: interleukin-l (IL-I), interleukin-l~ (IL-Iv^~), interleukin-l,B (IL-I,B), v.d.lulu."yu,colony-stimulating factor(G-CSF),v ' ~ .' v cnlony-stimulatingfactor(GM-CSE~), ill~l' - 3 (IL,3), interleukin-6 (IL-6), interleukin-ll (IL-11), ~lyLlllu~u;~ leukemic inhibitory factor (LIF), PIXY-321, and stem cell factor (SCF). These ~ r '- growth factors are readily available and can be used alone or in .~ of two or more. Preferably, the growth factors used for stimulating expansion of the l r cells are GM-CSF, IL-3, SCF, and IL-6.
Any culture medium recognized in the art as d,UlJlU~I ' can be used to perfuse the ACS cartridge. In addition to one or more L ., .-growth factors, the culture medium can be ~ P~ , .1 with serums such as fetal calf serum (FCS) and antibiotics such as Penicillin, SLlclJtullly~ and B. A l,~l-Livul~lly suitable medium is Isocove's Modified Dulbecco's Medium (IMDM). IMDM can be rr ' I with 10% fetal bovine serum (FBS), 100 ug/mL L-glutamine, and 100 U/mL
penicillin/~L~ ill. This is referred to herein as complete culture medium. IMDM is readily available as are other tissue culture media.
As discussed above, the culture medium will also contain at least one h. - ~~ growth factor. ~ , growth factors should be included in the culture medium at of d~U~ y 0.1-500 ng/ml, preferably at of ~ -150 ng/ml. However, as the skilled artisan will recogni~e, other can be used as required.
After culture, or at periodic intervals during culture, cells can be harvested from the ACS cartridge simply by flushing the cartridge's extra-capillary space (ECS) with fresh medium or by gently shaking the cells from the cartridge. A small number of cells remain W095rl9793 .~,I/U.J S 17 ~81~47 _14_ behind which re-seed the ACS for further culture. By "extra-capillary space"
(ECS) is intended the space wherein the cells grow within the shell of the ACS
that is external to the semi-permeable capillaries. After harvesting, the suspension containing expanded cells can be pelleted by c~ LIiru~:,aLiull (400-5 600 8) and the cells .. ~ at desired . .",. . .,1."1;~.,.~ in culture medium for further use.
After culture, a small number of primitive I , cells (e.g., HSC and progenitor cells) may adhere to the endothelial support cells. These o~ . cells can be recovered by ~ LJD;lfl~iull and separated from oLher adherent cells using positive selection with anti-CD34+ antibodies as described above.
The inoculated CD34+ cells should be cultured for a sufficient amount of time to achieve I . cell expansion, including expansion of I ~ stem and progenitor cells. The amount of time that is "sufficient" to achieve expansion can easily be determined empirically. For example, the phenotype analysis techniques described in Example I are useful for ~l~ .";..;"~ the amount of culturing time required to achieve cellular expansion. The inventors have discovered that culturing for 5 days achieves significant primitive ' . cell expansion. Moreover, the inventors achieved a 15-fold expansion of CD34+ cells and a 70-fold expansion of CD34+CD38- HSC after only 7 days of culture. If ".,....h .. cells are harvested periodically (for example, weekly), then culturing can occur for an extended period of time. For example, the inventors have achieved long-term and steady I , during 78 days of culture. Thus, it will be recognized that different culture durations can be used depending on the exigencies of each P~rrPrimPnt An ACS cartridge consists of an outer shell casing that is l-;-~
with the growth of ' cells, a plurality of semi-permeable hollow capillaries encased within the shell that are also 1.~ .LJ - ~ ;I ,i~ with the growth of ' cells on or near them, and the ECS, which contains the cells and the ECS cell WO 95/19793 P~, I / ~1 .. ,~ ( /
-15- ~I 815~
Tissue culture mediu~n floq~s ,within the capillary lumens and is aiso included within the shell ~U~-u....J;I~o the capillaries. The tissue culture medium, which may differ in these two l,UIII~ , contains diffusible that are capable of expanding I r ceils. The medium is provided in a reservoir from which it is pumped through the capillaries.
The flow raoe can be controlled by Yarying the rpm of the pump head.
ACS are described in Knazek etal., U.s. Patent Nos. 4,220,725,

4,206,015, 4,200,689, 3,883,393, and 3,821,087. A typical ACS consists of a standard glass media bottle, which serves as the reservoir, a pump, a hollow fiber bioreactor, which consists of the capillaries and shell casing in which cells are cultured, and medical grade silicone rubber tubing, or other connecting means, which serves as a gas exchanger to maintain the l,U~
pH and PO2 of the culture medium. The reservoir can also be a piastic bag.
All r ' are secured to a tray of sufficiently small dimensions to fit within a standard tissue culture incubator chamber. The pump speed is determined by an electronic control unit which is placed outside of the incubator and is connected to the pump motor via a cable which pasæs through the gasket of the incubator door. The pump motor can be ~Iy coupled to the pump, being lifted from the system prior to steam ~u~u-,lav;llO. The pump motor can also drive a cam which moves a pin means which, in turn, compresses tubing and causes Ulli iil1~,~iul41l flow through a series of one-way vaives.
Tissue culture medium is drawn from the reservoir and pumped through the gas exchange tubing in which it is ~cu7~O ' and its pH
readjusted and then through the lumen of the hollow capillaries prior to returning to the reservoir for subsequent ~ r~ The order of sequences may be altered without substantially changing the filnrtir~n~lity.
The entire system is sterilized prior to operation and is designed for operation in a standard air-CO2 tissue culture incubator. The flow rate can be 3û increased as the number of cells increases with time. Typically the initiai flow rate of the medium is adjusted to about 4 mllmin. Upon inoculation through WO9~/19793 1~.1/l)~. 11 .~`'. J,~ i ~
._ -16-~8~47 the ACS side ports, the cells settle onto the surface of the hollow capillaries,through the walls of which nutrients pass to feed the cells and through which metabolic waste products pass and are diluted into the large volume of the Ic. ;~ perfusate. The selected capillaries should be semi-permeable or Illi~,lU~ll)lUUi~ to permit the passage of nutrients into the ECS by diffusion or bulk transfer and should be of a material on which or in the vicinity of which the cells are able to grow. The capillaries are made of material, such as cellulose diacetate or PUIYIJIU~YI~ or other suitable material, that is semi-permeable or porous and suitable for the growth of ' cells. It may be necessary to treat the surface of certain types of capillaries with reagents to enable some cells to adhere to the surface. For example, IJUly~Jlu~yL,l, capillaries 15 cm in length, having 0.5 ~ pores are suitable for use in practicing the invention.
As discussed above, after culture, or at periodic intervals during culture, " cells can be harvested from the ACS cartridge for and analysis. The harvested IIUI~U~-It;IIL cells can be;
and .' ~ using a l~ y~ull~.,tl,l and '' ~,~.,., staining according to cu..~ ul~l techniques. For example, flow cytometric arlalysis of ~ of cells labeled with ' ' antibodies specific for cluster ,l~ (CD) antigens can be used. These CD antigens can be labeled using ( 'ly aYailable mr,nnrlrm~l antibodies conjugated with either fluorescein ' ;. (FITC) or ~JIly~u~,.y.lllill (PEi). ~A~nnrin-~
antibodies specific for the CD34, CD38, CD20, CD14, CD3, CD4, CD16, CD15, HLA-DR, CD33, CDllb and CD8 antigens can be obtained from Becton Dickinson Ml~n~rlr,n l~. San Jose, CA. After labelling the harvested llu.~ cells with the above ' I antibodies, flow cytometric analysis can then be performed to determine whether ~ l;-. of cells bearing the CD antigens are present in the sample. Thus, CD34+ cells, CD34+CD38+ cells and CD34+CD38- HSC are determined in the harvested " cells by labelling the cells with anti-CD34 and anti-CD38 '( l antibodies and performing flow cytometry.

-17- 2 ~ 8 1~ 7 The presence of I , progenitor ~ ,v~ (mlll~ir~tl-n~
colony forming units [CFU-MIX]; colony forming unit-g ' ~i~./llld~ . ' ,, [CFU-GM]; erythroid burst-forming units [BFU-E];
blast-colony forming units [CFU-Blast]; and I~ ~dlyu~ . colonies [CFU-S Mk]) in the harvested IIUI~L._I~ cells can be determined by l,U~ Liulldl techniques (~I_;a~ et al., Blood 7g:2267 (1992)). For example, methylcellulose CFC (colony-forming cell) assays can be used.
The ex vivo culture system of the present invention pl.,fi l~ ;dlly supports expansion (from inoculated CD34+ cells) of primitive l stem cells (HSC) haYing the phenotypic markers CD34+CD38 . CD34+CD38-HSC include primitive pluripotent cells capable of self-renewal, mllltilin~
(l;rrt~ and rr~ ll ofthel l system. Thus,contrary to previously reported attempta where ex vivo culture of CD34+ cells resulted in depletion of stem cells, the present invention provides an ex vivo method forexpanding CD34+CD38 HSC to substantial numbers.
For example, the results provided in Example 1 (displayed graphically in Figure 1) show that after only 7 days of culture in the ex vivo system of thepresent invention, there is a 15-fold expansion of CD34+ cells. The purity of the starting CD34+ cell population was 85% CD34+CD38+ and 15%
CD34+CD38-. After 7 days of culture, the absolute number of CD34+CD38+
and CD34+CD38- cells incredsed 6.2-fold and 70.5-fold, ~ ,.,Li~,ly. Thus, by the invenLion, substantial expansion of ~ ' and ~
stem cells (CD34+CD38- HSC) occurs after only 7 days of culture. The inventors also co-cultured the CD34+ cells and the endothelial cells in flask culture. However, in flask culLure, only a 11-fold expansion of CD34+ cells occurred. Moreover, the absolute number of CD34+CD38+ and CD34+CD38- cells increased 6.7-fold and 35.7-fold, I~,a~Li~.,'y.
Thus, these data ' that less .l;rF....ll;-li.,.. and depletion of - primitive CD34+CD38- HSC occur during ex vivo culture using the ACS/cll.lu~l~,lidl cell system of the present invention as compared to the lldak/~ duLl~,lidl cell system.

WO 95/19793 r~
2 1~3iti~ -18-The e1~ vivo expansion system of the present invention has a Yariety of uses. These include providing a rich source of IIA~ Ir 1.. .
stem and progenitor cells, facilitating retroviral ~ ;.... of 1..
stem and progenitor cells, ex vivo ~ ` - c- of l,~,. y.l- ,l-l,lr cells during which time cells can be assayed for pathogenic . and facilitating the study of factors and conditions affecting I
Bone marrow 1,~ ;.- (BMT) has become standard therapy for a number of conditions. These include intrinsic marrow defects such as congenital I .. " . ! ~1,~'.. .; ;~ and metabolic disorders and bone marrow injury due to ablative and IlUll~l~ , I ,, regimens consequent to I ~ )"
and non-lir l ~.I.,r,i, Irl~li~r ~ C (Sullivan, K.M., Transp/ant Proc. 21 (Suppl. 1):41 (1989)).
The invention improves on th~ese Al.l.li,-:;..,.~ of BMT therapy by providing a readily accessible source of ex vivo expanded 1- , cells, including I I stem and progenitor cells. Thus, the invention is furth~er directed to a method for ~ "l;.,,, ex vivo expanded I
cells, including I , stem and progenitor cells, to a patient. The method involves inoculating endothelial cells capable of supporting expansion of I , cells into an ACS cartridge, inoculating CD34+ cells into the ACS cartridge, perfusing the ACS cartridge with culture medium containing at least one I , growth factor capable of stimulating expansion of k. ., ~ : :; cells, culturing the CD34+ cells for a sufficient amount of time to achieve expansion of a Ih. ,~ ly effective number of I
cells, including 11. ' '1"' :;r stem and progenitor cells, harvesting cùltured cells from the ACS cartridge, an~ i , ' ,, the h- ~ cells to a patient.
Methods for expanding, harvesting, and, optionally storing (by ~,lyu~ lliu..) I I cells using an ACS are discussed above.
After harvesting (or thawing after storage), the ~ , cells, including stem and progenitor cells, can be i 1l ' to a patient according to L.U~ iUll~l techniques (Kennedy ef aL, J Natl Cancer Insl wo ss/ls7s3 r~ ,s.
-19- 21815~L~
83(13):920 (1991); Touraine et al., 77Lymu s 10:75 (1987)) . For example, the cells can be ~ i by illLla~ u~D infusion.
Short-term r, of the l r system is necessary to successfully treat patients suffering from cytopenia following non-ablative S . I,.. ,.III,.. l.y A~ 'y 2 x 105 CFU-GM progenitor cells per Kg patient body weight are required for short term of the system. Thus, for a 70 Kg adult patient, ~ 1.4 x 107 CFU-GM are needed. By the invention, ay~ / 107 CFU-GM can be generated ex vivo in only two weeks of CUltuR from an inoculum of about 106 CD34+ cells. This number of CD34+ cells can be obtained from one 15 ml bone marrow aspirate taken on an outpatient basis. Thus, the invention provides a method for treating patients in need of short-term lC~ A~ of the l . system. As indicated, the amount of culture time that is "sufficient" to achieved a Ih..,,l...`;.,.lly effective number of cells is ~1"~ ~Y two weeks. Of course, longer culture periods to achieve even greater expansions of committed progenitor cells and post-progenitor cells can also be used if needed.
Long-term IG "' '' of a patient's l l system is required, for example, following high dose n.~.ludl~la~ , ,h . ~Ih~
Since l r progenitor cells are ~committed", 11 -. ~ .l of progenitor cells alone will not achieve long-term ~ of the system. Instead, patients must be infused with pluripotent HSC
(CD34+CD38- cells) in order to achieve long-term Preferably, the pluripotent CD34+CD38- HSC will be co-i , ' ' with CFU-GM cells in order both to avoid early aplasia and to provide long-term .. ,,, ,. r~ .. - - By the invention, a Ih ~ lly effective number of CD34+CD38- HSC can be generated in only 7 days of culture. Preferably, the cells are cultured for at least 10-14 days to ensure that a i' ~ "y effective number of CD34+CD38- HSC have been generated. Different culture durations can be used arD needed.

2~815a7 -20-ln the e~c vivo culturing system of the present invention, ~
of both CD34+CD38- HSC and CFU-GM progenitors are present in " cells harvested from the ACS cartridge. In fact, after only two weeks of culture, a 11,. .,.I,~..:;,-lly effective number of both CD34+CD38-HSC and CFU-GM progenitors are present in the llu~lc.lll.,.cll~ cells. Thus, by the invention, " Cll~ cells harvested from an ACS cartridge can be ~' ' into a patient in need of either short-term or long-term ,,. " . :i~ ;""
The present invention is useful for the e1~ vivo expansion of ~ ~ cells for use in autologous and allogeneic bone marrow transplants. In the latter, of course, graft vs host disease (GVHD) must be avoided and i ,' of HLA-compatible bone marrow is preferred.
However, only about 10% of candidates for BMT have a human leukocyte antigen (HLA)-identical family member. This precludes an optimal donor for the majority of patients (Flake a al., Exp. Herna~. 19:1061 (1991)).
Autologous marrow is frequently either damaged from prior anti-cancer treatment or ' with malignant cells (Gale et al., Bone Marrow Transplanf 7:153 (1991)). This shortage of autologous marrow is even more ~,,~1. ., -:;~ when multiple cycles of ~ h- ~Ih. ~ y are required.
Thus, the present invention meets a ~clLi~,ulclly pressing need in the art by providing a method for achieving L~ - -T- " lly effective numbers of autologous 'i ~ stem and progenitor cells that are useful in BMT.
For example, CD34+ cells for use in the present invention can be obt2ined from bone marrow cells harvested by aspiration from patients suffering from a number of ,--~ irlcluding leukemias, Iymphomas, Hodgkin's disease, myeloma, ~loGb~uD;D, and malignant breast cancers.
However, bone marrow cells harvested from patients suffering from a l~ cli~ ,y sometimes are ' with tumor cells (Kenmedy et a~., J
Natl Cancerlnst 83(13): 920 (1991); Thomas E.D., J Clin Oncology lf9):517 (1983)). C ' '' concern exists about possible reinfusion of viable cancer cells. Thus, after harvesting, if the bone marrow cells are W095119793 P` 11'~''5~ 17 ~i81~7 ~"": -,, h 1 it is preferable that the cells are subjected to purging with a suitable tumor purging agent. One such agent is 4-llydlu~ u~.y~,y~ ,' ' (4-HC). HoweYer, incubation with 4-HC is known to reduce the frequency of pluripotent HSC and committed progenitor cells in vitro (Gordon et al., Leuk Res 9:1017 (1985)). This has been reported to cause a delay in the ,~,IAn" ,l of reinfused autologous marrow (Kaiær e~ al., Blood 65:1504 (1985)). Bone marrow cells harvested from a patient suffering from a malignancy may also be purged by positive selection for CD34+ cells using anti-CD34+ antibody imm~hili7~d to a column matrix or magnetic beads.
As discussed above, culturing CD34+ cells by the method of the present invention results in significant expansion of pluripotent I
stem and committed progenitor cells. Therefore, the delayed ~..r,,.,r~
which occurs when purged autologous bone marrow is reinfused into a patient can be overcome by first culturing the purged cells according to the present invention prior to reinfusion.
Accordingly, the present invention also provides a method for U._l~,Ulll;llg the delay in I .,,,lAr,.". ..l caused by tumor purging agents which deplete pluripotent HSC and committed progenitor cells in autologous marrow.
The method involves obtaining bone marrow from a patient suffering from a malignant tumor, purging the harvested marrow with a suitable tumor purging agent, andlor purifying CD34+ cells, inoculating endothelial cells capable of supporting expansion of I r ' " cells into an ACS cartridge, inoculating the CD34+ cells into the ACS cartridge, perfusing the ACS cartridge wjth culture medium containing at least one ! , ' growth factor, and culturing the CD34+ cells for a sufficient amount of time to achieve expansion of a I~ lly effective number of I , cells, harvesting cultured cells from the ACS cartridge, and i r~ ' ~, the cells into the - patient~
As discussed above, the order of inoculating the CD34+ and endothelial cells can be reversed or performed ~ Moreover, the purging WO95/19793 r~.~u_ s~ 7 ~ 8~ ~7 -22-step with a suitable tumor purging agent can also occur after harvesting expanded l , cells from the ACS cartridge. This will depend on design.
The invention further provides a method for enhancing the ex v~vo expansion of l ~ ~ cells by coating the ACS capillaries with a suitable coating reagent. Suitable coating reagents include gelatin, collagen, fibronectin and, preferably, a ~vly~ idc having an amino acid sequence idlly identical to that shown in Figure 10 (SEQ ID NO. 1). A
poly,u~.!JLi~ having an amino acid sequence substantially identical to that shown in Figure 10 is herein referred to as "the adhesion protein."
Coating reagents such as gelatin, collagen, and fibronectin are readily available to the skilled artisan and can be applied to the ACS capillaries using.,u..~, ' techniques. The adhesion protein, which is the preferred coating reagent for use in the present invention, was designed using two olig(lrPrti-lP
blocks and is a highly active and stable substrate for receptor-specific cell ~tt~ ~Pnt The first "li~"~ . block (16 amino acids in length) provides the cell attachment activity of human fibronectin (Cappello et al. Polymer Reprints 31:193 (1990)) and has the amino acid sequence Gly Ala Ala Val Thr Gly Arg Gly Asp Ser Pro Ala Ser Ala Ala Gly (S~Q ID NO. 2). The second ~ ;rlr- block (6 amino acids in length) provides the structural properties of the silk fibroin protein and has the amino acid sequence Gly Ala Gly Ala Gly Ser (SEQ ID NO. 3). These two blocks are configured in a string where one "biological" block occurs after every nine "structural" blocks. This string is repeated 13 times to yield a ~ly~ i~ having 980 amino acids with a predicted molecular weight of 72,738 daltons (Figure 10). Thus, the adhesion protein r ' thirteen Arg Gly Asp ligands modeled after the Arg Gly Asp sequence from human fibronectin , ' between crystalline regions derived from natural silk. The adhesion protein can be produced l~, as described in Cappello J., Materials Researc7~ Society Bulleti~
17flO):48(1992). Moreover,theadhesionproteinissold 'Iyunder the trademark PRONECTINn' F (Protein Polymer T~ Inc. San WO 95/19793 r~ ~, I / 1 ,'I 1 /
2 ~ 7 -23- . ~ r Diego CA 92121)). Accordingly, the adhesion protein is readily available to the skilled artisan.
The adhesion protein is applied to the ACS capillaries simply by filling the ECS and capillary lumen of an ACS cartridge with a diluted adhesion protein solution. For example, a 1%-25 % dilution of "stock" adhesion protein solution in phosphate buffered saline (PBS) is suitable for coating the ACS
capillaries. (A ~stock" solution of adhesion protein contains a, of ~ , 1 mg/ml adhesion protein in a 4.5 molar lithium perchlorate solution (LiCI04).) After one hour, the ACS cartridge should be thoroughly washed with deionized water to remove adhesion protein not adhered to the capillary surface. The adhesion protein-coated capillaries are then ready for use in the e~ vivo culturing system of the present invention. In addition to expanding l , cells from a CD34+ and endotheliai cell co-inoculum as described above, an ACS cartridge having adhesion protein-coated capillaries is also useful for the e~ vivo expansion of l ~ cells from an inoculum of ' cells obtained from bone marrow, peripheral blood, or umbilical cord blood without enrichment for CD34+ cells.
M~ ' cells (MNC) from bone marrow, peripheral blood, or umbilical cord blood can be prepared using Ficoll-Hypaque density gradient r. :-ir"r,rl;.. as described above. The MNC are inoculated into the ECS of an ACS cartridge and cultured using the reagents and conditions described above. Example 3 provides a direct ~ of culturing MNC using capillaries with and without the adhesion protein coating. The results that adhesion protein-coated capillaries provide an a~ y 2.8-fold increase in i . progenitor cell growth (CFU-GM + BFU-E) and an ~ / 1.8-fold increase in stromal cell activity as compared to capillaries without the adhesion protein coating. Thus, the invention further provides a method for enhancing the ~ vivo expansion of r , cells by coating ACS capillaries with a suitable coating reagent such as gelatin, collagen, r~ and preferably, the adhesion protein described herein.

WO95/19793 P~l/L.. S.C 1/

Aetive target cell eyeling is }equired for retroviral integration (Nolta et al., E~p. Hematol. 20:1065 (1992)). Thus, the inYention further provides a method for transdueing eA~ ~nvo expanded l~ cells, ineluding stem and progenitor eells, with retrovirus Yeetors. The method involves inoculating an ACS cartridge with endothelial eells capable of supporting expansion of ~ . eells, inoeulating the ACS cartridge with CD34+ cells, perfusing the ACS eartridge with eulture medium containing at least one l , growth faetor capable of stimulating expansion of the l r ' " eells, eulturing the CD34+ cells in the presence of the retrovirus veetors in the ACS cartridge for a sufficient amount of time to achieve l~ cell expansion, and harvesting the cultured cells whieh have been transdueed with the retrovirus vector.
Retrovirus veetors are the preferred veetors for genetie therapy (Anderson et al., Saence 226:401(1984)). This is because retrovirus infection is highly effieient and retrovirus veetors modified to be replication; ~
stably integrate into the host eell's genome. Paekaging cell lines are eapable of ~packaging~ the replication i~ - ' retrovirus vectors thereby rendering them infeetious and therefore eapable of i ' ,, target eells.
Sueh retrovirus veetors ean stably integrate into the host eell genome upon l. ~ into a target eell.
U.S. Patent No. 4,861,719 (Miller, D.) deseribes the CUII~IUI,LiUII of various paekaging eell lines ineluding PA317 (ATCC Aeeession No. CRL
9078). PA317 is capable of paekaging high c-- - .,I.AI;.,"~ of Ir~..",l.;",...:
retrovirus veetors. Hoek et al., Blood 74:876 (1989) paekaged high , of LASN (a retrovirus vector eontaining the ADA and Neo resistance genes) in a eell line derived from PA3 17. Morec)ver, Kna~ek et al., (abstraet from l~ at BioEiast 91 in ~V.~ ;LUII~ DC, January 1991) showed that even more cu~ of paekaged LASN are produced if the LASN-produeing PA317 is grown to near solid tissue density with the CELLMAX~5 100 (Celleo, Ine.) artifieial capillary system. This is important since highly l~ rd, ~ of retroviral vectors are wo 95/19793 r~
-25- Z 1 81~4 7 necessary to efficiently transduce target cells. Thus, from the above, it is clear that several packaging systems are available that can be used to package ,~, .. 1, ,l retrovirus vectors to yield highly ' ~
The retrovirus vector can be modified by inserting l.~lulu~;uu~ genes S encoding t; r '' 'Iy effective products. For example, LASN contains tbe ADA gene whose product is useful for treating a type of severe combined ' ~ y disease (SCID). Other retrovirus vectors which can be modified by insertion of a ll~.41UIU~J.~ gene encoding a II...,.~ lly effectiveproductarepN2(Kelleretal., Nafure318:149(1985));pLHL(Miller lû et al., Cold Spring Harbor Symp. on Quant. Bio., Vol. Ll, Cold Spring Harbor Laboratory, p. 1013 (1986)); pSDHT (Mille} et al., Somat. Cell. Mol.
Genet. 12:175 (1986)); pLPL (Proc. Natl. Acad. Sci. USA 80:4709). These vectors are known and available to the skilled artisan.
In particular, genes, which encode the following ~ lly effective products, can be inserted as L.~lulot,.,~ genes into the .~.. ",l.;,.. ,.. ~
retrovirus vectors using ~UIlv~ iU~ l techniques: ADA, Factor VIII, and Factor IX. These genes are known and available to the skilled artisan.
Whenl, ' retrovirusvector-producingpackagingcellslinesare grown in culture as described above, high of packaged 2û Ir," l, -1.l retrovirusparticlesareproducedinthecell~u~J~ CD34+
cells can be added to the vector-containing ~ The Sll~rl-nci~n, containingpackaged ' retrovirusvectorandtargetCD34+,canthen be inoculated into the ECS for expansion. The CD34+ cells are then cultured in the ACS cartridge, in the presence of the packaged lr".".l,;.. retrovirus vectors and endothelial cells, for a sufficient amount of time to achieve expansion of l , cells. Appropriate culturing time and conditions are described above. After culture, ~' transduced 1- r cells, including transduced l . stem and progenitor cells, are harvested from the ACS cartridge by flushing the cartridge with culture 3û medium or by gently shaking the cells from the cartridge. After culture, asmall number of transduced l . cells may also be bound to the WO 95/19793 ~ J.. ,S.'c 17 ;, ~ . v . !
2~ 47 endothelial support cells on the capillary surfaee. These I . cells can be recovered by IIYl and separated from other adherent cells by positive seleetion with anti-CD34+ antibodies as deseribed above.
Alternatively, the endothelial cells and CD34+ cells can be inoculated into the ACS cartridge (as described above) prior to addition of the packaged retrovirus vectors which are then added either before or after culture has been ~.ct~hlj.l.~rl Also, the retrovirus vector-containing r can be added to the ACS cartridge prior to inoculation of endothelial cells and CD34+ cells.
The order will depend on ~ 1 design.
For effieient viral insertion into primitive 1,. ~ cells, the eells must be actively dividing with limited .I;rf~ ,.", An inoeulum of ~ U~.il.._~ly 4 x 106 CD34+ cells includes GtJ,U~ / 6 x 10~
CD34+CD38 HSC. The inventors have discovered that, after only 7 days of eulture using the ACS system of the present invention, an li). 'Y 70-fold expansion of these CD34+CD38- HSC oecurs. Thus, the present invention provides the conditions necessary for efficient viral insertion into primitive I , cells.
To increase the ~ ~ of I r ' ' ' cells that are transdueed with retrovirus vector, supernatant containing packaged retrovirus vector can be added at intervals during culture. For example, the vector-containing supernatant ean be added to the cartridge every two days. The eulture ean be terminated after eight days. Of course, different intervals and volumes of can be used as needed.
The presenee of the Ir. ~ - retrovirus vector in the expanded 1 , eells can be eonfirmed using the IJvlyll~ r, chain reaction (PCR). For example, for detection of a particular retrovirus vector, DNA
primers flanking sequences specific to the vector (or ' '~ "1~ gene insert) and not contained in the host cell genome can be used to amplify the retrovirus vector sequence (or III~ JIU~J~ gene sequence). The ~."I,Iiri- -~;.,., product can then be loaded and run on a gel and probed with a labeled ~.u~ y DNA probe.

wo 95/19793 r~-~L
-27- 2181~7 . . .
The transduced l , - cells, including transduced l ~
stem and progenitor cells, can then be I ,' ' into a patient using the . ' methods described above.
Having generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration and are not intended to be limiting.
, i E~r~
Example I
Ex Vivo ~, .. of F~: ~r- '! (' Cells in an ACS
Materials and Methods CD34~ Bor.e Ma~vw CeUs Human vertebral body bone marrow was procured from cadavers as described in the Naval Medical Research Institute publication no. 90--62 (available from the Defense Technical l r ' Center, AD# A226 538).
Briefly, marrow was obtained from the bone matrix by sterile techniques and placed in sterile culture support media. Low density cells were separated over ficoll-Hypaque (specific gravity 1.077g/mL: Pharmacia Fine Chemicals, Piscataway, NJ) density gradients at 400 g for 30 min at 220C. Low density cells at the interfaces were harvested, washed twice by ,:- l i r,~ (400 g for 10 min) and I~UD~ d~ i in Iscove's modified Dulbecco's medium (IMDM) rr ' ~ with 10% heat-inactivated FBS (Hyclone, Logan, UT) 100 ug/mL L,glutamine (Gibco, Grand Island, NY) and 100 U/mL penicillin/sLI~tv...~ (Gibco, Grand Island, NY). This culture medium is herein referred to as complete culture medium.

WO 95119793 I ~ I I 1 ,,. 1 / --.~ ~

~1547 CD34+ bone marrow progenitor cells were further purified by positive selection using a mr-~rlr~n~l antibody specific for the CD34 antigen (K6.1).
The monoclonal antibody K6. I was produced by fusing SP-2/0-AG14 ~ ;vll~a cells (American Type Culture Collection (ATCC), Rockville, MD) with splenocytes from a BALB/cByJ mouse (Jackson Laboratory, Bar Harbor, ME) which had been lly~..il..,..; ~ with viable KG-la cells (ATCC, Rockville, MD). Injections containing 10 to 20 million KG-la cells washed in saline were performed ~,LJI~ 1S, monthly for a period of 6 months; the first and last were illL~a~ vu~ and the other "~ were illLI-llJ, ' The last injection was performed 3 days prior to fusion. Cell h~v ' and selection in HAT medium were performed according to previously described techniques (Kohler et al., Nature 2~6:495 (1975); Fazekas de St. Groth e~ al., J. Im~nunol. Methods 35:1 (1980); and Lane e~ al., J. Immunol. Methods n 71 (1984)).
Culture ~ collected ~,., l~, 2 weeks after fusion were screened for antibody activity against MY-10/CD34 antigen in KG-la cell Iysates by ' ' (Western blot) analysis. Initially, pools of about 10 growth positive hybridoma wells were screened, and individual wells of antibody positive pools were then screened. Antibody positive wells and were subcloned by limiting dilution (Oi and 11.,l LL.,.-b~ ;, in Selected Methods in Cellular ~ ;y, (1980) Mishell and Shigii, eds, p. 351), and clones were screened the same way.
KG-la cells were solubilized at I x 108 cells /ml in Laemmli sample buffer (0.0625 M Tris-HCI, pH 6.8) containing 0.5 % Triton X-100 and 2mM
PMSF, and centrifuged (30,000 x g, 30 min), and the r ' were reduced in 50mM DTT, 4% SDS, and 10% glycerol (60 min, 37C).
EI~LI~ I ' ' was performed on 8-16% pore-gradient, SDS ~VI~Iy' gels according to the method of Laemmli (Nature 227:680, (1970)), as modified by Jones (in Selected Methods in Cellular ~ ,y, (1980) Mishell and Shigii, eds., pp. 398440). Proteins were then transferred to wo 95/19793 r~
-29- ~ ~ 8 ~
I iL~u~ L!uac, membranes for ;."~ analysis (Towbin et al., Proc. Natl.
Acad. Sci. USA 76:4350 (1979) and Burnette, Anal. Bloche~n 112:195 (1981)), using alkaline r~ conjugated goat anti-mouse IgG antibody (BioRad labs, Richmond, CA) for detection with BCIP/NBT as substrate (~irkPg~

5 & Perly I ~hl , ~ h. .~1.. ,~,, MD).
The hybridoma clone K6. I was identified as producing a amtibody of the IgG2a isotype, as determined with an isotype screening ELISA
kit (Zymed T: ' . S. San Francisco, CA) on il."....l,;l;,. ;I KG-la cells (Cobbold and Waldmann, J. Imrnunol. Methods 44:125 (1981)). The hybridoma was expanded in roller bottles in IMDM containing fetal calf serum (Hyclone). After y~rPrr ~r~r harvesting, the K6. 1 antibody was purified by I,~dlUAyl~ Cllll ' o . ' ,y (Stanker et al., ~. Irnmunol. Methods 76:157 (1985)), followed by pH-gradient elution from protein A-Sepharose (Ey et al., r - ' ,y 15:429 (1978)). The yield of antibody was 40-45 ~g/liter of C~lrPrn--~nt This was ' on -Ill,.ri~ ;"., (Amicon YM-10, Danvers, MA), and dialyzed into normal saline. Analysis of antibody purity was performed on 30-40 ,ILg reduced and unreduced samples by SDS-I~ ' ' gel c~LIu~llulc~;~ under Laemmli conditions, followed by Coomassie blue staining.
For positive ' of CD34+ cells, all cell washing, incubation and selection steps were performed at 4C (unless noted otherwise) in 0.2 ~m sterile filtered " ' washing buffer." The washing buffer consisted of Hanks's balanced salt solution containing 12.5 mM HEPES buffer, 1000 units/ml DNAse 1 (~:llhinrh~Pm), and 5% heat-inactivated pooled human AS scrum (#34004-1, Pel, Frcez Clinical Systems, Brown Deer, Wl). The human serum was previously dialyzed extensively (40 volumes x 5 changes) against PBS to remove traces of biotin. This was included as a source of human IgG to saturate Fc receptors and minimize cytophilic binding of the cell specific antibody (i.e., K6.1); for therapeutic It purposes, it was assumed that WO 95119793 . ~. I/L ~
2181~:7 30 substitutes such as dialyzed serum from the marrow donor or ~ Li~lly approved gamma globulins for injection would be used.
Bone marrow ' cells were washed and adjusted to a of 50 x 106/ml. BiuLill~' ' K6.1 antibody was prepared by mixing purified K6.1 with NaHCO3 to give a solution containing 3 mg 'y/l.~l in 0.1 M NaHCO3. Biotin-N-l,ydlu~ ester hirlrh.~r^ La Jolla, CA) was dissolved in di.l.~ ulru,dde (DMSO) at a ~o~ ;.. of 12 mg/ml, and 5.0 ~1 of this was added to each ml of antibody solution. After I hr at room t~"..,.,~,.~"u.c, NH~HCO3 was added to lû 5û mM final r.. ,.. :,,.I;r,.. to stop the reaction. The mixture was then passed through a Sephadex PD-10 column (Pharmacia) eq~il' ' in phosphate-buffered saline (PBS, 6.7 mM Na phosphate, pH 7.2, 137 mM NaCl) to desalt and exchange the buffer. The b;v~ ' ' K6. 1 antibody was added at a ratio of 6-lO~g/ml of cell suspension and incubated with occasional mixing for 30 15min at 4C. The cells were then washed by ~ c l . i r, ". ;. .. , 3-4 times, and set to a of 25 x 106/ml.
DYNABEADS M~50 (Dynal l~,ul~l ~, Great Neck, NY) were activated with goat anti-biotin antibody. The number of DYNABEADS used was~lu~ulLio~ltothetotalnumberofbonemarrow~ ...................... lr~ cells,using a ratio of 1 bead/10 cells. Anti-goat IgG DYNABEADS were washed magnetically 4-5 times with a rare-earth magnet. The beads were then suspended at a of 1 x 108/ml in washing buffer containing 2.5 ~g/ml affinity purified goat anti-mouse biotin antibody (#SP-3000, Vector lrling~me, CA), mixed vigorously for 30 min at room ~ - c-, and then washed magnetically twice, and l. ~ lfrl to 1 x 10~/ml. This r-- ~ ;.... of anti-biotin was optimized in ~l~lilll;ll~Uy titration studies using as an endpoint the kinetics of cell 1~ - from the magnetic beads. Tbe binding of anti-goat anti-biotin does not reach r~qllilihrillm under these conditions; varying the anti-biotin provided a convenient way to r ' indirectly for different cell surface antigen densities, by controlling the amount of biotin-anti-biotin, ",~I;, l ;.,~, WO 95/19793 . .~
-31- ~ 8 1~
The bone marrow l -.. "~ l ~ cells, containing i,;uLi~.~' ' K6.1 antibody coated target ceils;~vere incubated with the anti-biotin DYNABEADS
for 30 min on a rotator (approx. 30 rpm). The magnetic CD34+ cells were - then selected by attraction to a samarium-cobalt magnet, and removal of non-target cells free in suspension. Finaily, the magnetic CD34+ cells were suspended in medium (e.g, IMDM) containing 2.5 mg/ml biotin, put on a rotator for 1-2 hr, and free CD34+ cells were recovered from ~ lly ,;i DYNABEADS. The magnetic separation can be using the magnetic separation device described in U.S. Patent No. 4,710,472 issued December 1, 1987 to Saur, Reynolds and Black.
Cells isolated by this procedure showed > 99 % positive reactivity with a second CD34-specific ' ' antibody, MYI0 (HPCA-2) (Becton Dickinson I~ ;u~ y Systems, San Jose, CA), by flow cytometric analysis indicating that a highly purified population of cells expressing the CD34 surface membrane antigen was obtained which contained highly enriched l . stem cells, progenitor cells and essentially no mature blood cells.
Isolated CD34+ bone marrow cells were Cl.yU~ , i (1-5 x 106 cells/1 ml viai) and stored under liquid nitrogen prior to l~
Before use the CD34+ cells were thawed using standard techniques.
Processing of CD34+ Cells for Cul~ure Cr~,ul,..,~.~Ai CD34+ cells were thawed rapidly at 37C, diluted in a 10 X volume of prewarmed (37C) complete culture medium. The thawed CD34+ bone marrow cells were washed twice in complete cuiture medium, amd . ' ' at l x 106 cells/ml. Cell viability was > 99% as determined by trypan blue dye exclusion (Coligan e~ al., Current Protocols in r ~,y (1992), Greene Publishing and Wiley-l"~ , New York).
At the start of ~ a sample of CD34+ cells was cultured to determine the number and type of l , colony forming cells WO 95119793 r~ J..,s .

21~547 (CFC) using a methylcellulose colony forming assay (r ' ' " et al., Blood 79:Z267 (1992)) . Briefly, purified CD34~ bone marrow cells and ". . -- 'h .. I . .:
;. cells from harvested cultures were cultured in 35 mm Lux suspension culture dishes (Miles T ~hnr t~riPc, Naperville, IL) using a .. l;r~ i.. " of the technique previously described (MPicPnhPr~ et al., Blood 79:æ67 (1992)). One milliliter of culture consisted of 5-500 x 102 bone marrow cells, IMDM medium (Quality Ri.~l~jr~lc, Rockville, MD), 1%
, 30% heat-inactivated fetal calf serum (FCS), 2 U/ml tissue culture grade .,lyilllu~ l (Amgen, Thousand Oaks, CA), 2 nglml GM-CSF, 10 ng/ml IL-3 (R&D Systems, r~f i ~ , MN) and 5 % ~ ' medium from the bladder carcinoma cell line 5637 (ATCC, Rockville, MD). The ' ' medium from cell line 5637 was used as a source of colony stimulating activity. Cultures were incubated at 37C in a humidified atmosphere of 5% CO2 in air. On day 14 of incubation, cultures were evaluated to determine the number of colonies (>50 cells) which had developed. At day 14, aggregates of l.. .". gl.)~.;l, containing cells were recognized as BFU-E; aggregates of ~ululu~,~o and/or uL~ .O and/or ~ ,ga]~ll,yuu~ o as CFU-MIX; and aggregates containing only granulocytes and IIILUI~ , as CFU-GM. ~cr,~lyul,~ colonies (CFU-Mk) were confirmed based upon established l ~ æ ~ criteria (Williams and Levin, Br. J. Hernatol. 52:173 (1982)).
F~ ' Cell Culture Condihons Porcine brain uv_ ' endothelial cells (PMVEC) were isolated and grown as previously described (Robinson et al., In Vitro Cell. Dev. Biol.
26:169 (1990)). The phenotypic and growth properLies of these cells have been extensively ,1~ ; 1 (Robinson et al., In Vitro Cell. Dev. Biol.
26:169 (1990) and Robinson a al., Blood 77:294 (1991)).
Briefly, PMVECs were isolated from the brains of 4 to 6 month old Yucatan minipigs. The brains were collected aseptically, immersed in 10%

~ WO 9~/19793 r~
33 2~81~47 povidone-iodine (Sherwood r co. Rahway, NJ) for 2 min and washed 5-6 times with Hank's balanced salt solution (HBSS) (Gibco, Grand Island, NY) to remove the residual iodine. Gray matter of the cortices was - aspirated through a Pasteur pipette, centrifuged for 10 min at 500 g (room t~ cd in HBSS and I O ' in a 40 ml dounce 1~",~ . Thel~ O was~ dand~ ly sieved through sterile nylon fabric of 149, 76, and 20 micro mesh size. The retained u._.,.,~.l~ were ~ u~ d in 6 ml HBSS and spun through ri:- .- li,,,~.~ - Ficoll-Paque gradients (33%-67% and 67%-75%) (Pharmacia Inc., Piscataway, NJ). The pelleted ~ ,IU._.. ~.15 were 1~ . ' ' in 2 ml HBSS and 2 ml cr~ c^~ (l mg/ml) (Worthington B ~mf~riir~l, Freehold, NJ) was added. After 2 mins, the Ill;.,lu._...lb were washed with HBSS and plated in 1 6-mm wells coated with fibronectin (Pierce Chemical, Rockport, IL) in M199 media (Quality Biological Inc., (~ MD) ~ d with 10% feta'i calf serum, 500 IllI.,lUol~ lll sodium heparin (Sigma Chemicals, St. Louis, MO), and 2-10 uL/ml retina'i-derived growth factor (see Robinson et al., In ~rltro Cell. Dev. Biol. 26:169 (1990)). The cultures were then grown at 37CC in air with 5% CO2. After 7 days the cells were subcultured and subcloned. After ~llhrirnin~, the PMVEC cell lines were grown in complete culture medium.
PMVEC were fed weekly with compleoe medium. When confluent, PMVEC were washed with PBS, trypsinized (0.25 mg trypsin/mL, 5mM
EDTA, 37C, 10 minutes, Sigma, St. Louis, MO) and ~ cl in a ratio of 1:5 into either 75 cm2 flasks or a cellular . .. ~ of 1 x 105 cells/well in gelatin-coated 6-well, tissue culture plates (Costar, (~ ,, MA) containing 3 mL of complete culture medium ~ l' i with an additional 10% FCS. After 48-72 hr, the adherent PMVEC IlI~ lb (70-80%
confluent) were washed twice with complete culture medium to remove "" --ll,. .~...l PMVEC and the culture medium was replaced with 5 mL of complete cell culture medium.

WO95~19793 I~l/l,.. / ~

Long-Terrn Marrow Cultures in Tissue Culture Flasks Purified CD34+ bone marrow cells (5 x 105 cells/flask) were inoculated in 75 cm2 flasks containing confluent PMVEC l~lu..~Lly~ and 15 mL of complete culture medium ~ .".. ~ with GM-CSF (2 ng/mL), IL-3 (10 ng/mL), SCF (100 ng/mL) and IL-6 (10 ng/mL). All cultures were maintained at 37C in a humidified atmosphere at 5% CO2 in air. After 7 days, and: ~, 'y at weekly intervals, all ~lul~lll.,lcllL cells were removed and counted, and 2 x 10~ cells were reseeded onto fresh PMVEC monolayer cultures containing fresh medium ,. ' ' with growth factors. ~' " cells were i 1, ~ - -, l .l ~l~l l. .Iyl,.,d for the CD34 and CD38 cell surface antigens (see below).
Ar~ficial Capillary Sys~enz The artificial capillary system (CELLMAX Quad, Cellco, Inc., I' ...1, MD) used in this study consisted of a 2 x 13 cm cylindrical cartridge containing hollow capillary fibers made of poly~,.u~ylcl.c, silicone rubber tubing which serves as a gas exchanger to maintain the proper pH and PO2. a 125 ml medium bottle which serves as a reservoir, and an external pump. Prior to inoculating the ACS cartridge with endothelial and purified CD34+ bone marrow cells (see below), the poly~,.ul,y~cl.c capillaries were coated with a l~ h -- ll adhesion protein having the amino acid sequence shown in Figure 10 (sold under the trademark PRONECTII~'Y F, Protein Polymer T~. l.. l~.r,;. ~, Inc., San Diego, CA.), as described below.
The ACS cartridge was filled with 95% ethanol for 30 mins, rinsed with deionized water and the procedure repeated. The cartridge was then autoclaved for 45 mins at 250F. After cooling, either a 1% or 25 % solution of the ' adhesion protein (in phosphate buffered saline (PBS) at 37C) was added, filling the extra capillary space (ECS) and fiber lumen to coat the ~Jolyt~lu~yll,~lc fibers. After one hour, the cartridge was thoroughly W095~19793 r~.,o _35 ~ 2~81~
washed for /I~ 30 mins jw~th 0.3 liters of deionized water at a flow rate of 10 mL/min followed by l.u~l~vi~,~ for 45 mins at 250F. The cartridge was then inserted into sterile flow paths and mounted into pump stations on the CELLMAX Quad (Cellco, Inc., G~ ..Il, MD.). The cartridge was then flushed thrice with 120 mL of complete culture medium over a 48 hour period before replacing the growth medium reservoir bottle with fresh pre-warmed (37C) complete culture medium. All operation were performed using sterile technique under a laminar flow hood.
During culture (see below), complete culture medium was drawn from the reservoir, pumped through the gas exchange tubing and lumen of the capillaries, and then returned to the reservoir for subsequent Ir. ;" .,l-l;.~,,Nutrients and oxygen in the medium diffused through the capillary walls into the 7 ml ECS, and cell metabolites diffused back from the ECS into the perfusate. The flow rate of the pump was maintained at ~ 'y 50 ml/min over the duration of the culture and the system was kept at 37C in 5% CO2 in a humidified incubator. The pùl~u~ .,.,e capillary modules had a surface area of ~ , 0.04 m~ and had a pore size of 0.5 ~ in the capillary walls.
Large-Scale ACS cell culture of punfied CD34+ bone marrow cells PMVEC (1 x 108 cells) were injected into the ECS and dispersed over the hollow capillaries by flushing culture medium back and forth through the two sampling side-ports using one 10 ml syringe filled with complete culture medium plus cells and another empty 10 ml syringe. After 72 hrs of culture, L PMVEC which had not seKled onto the outside of the hollow capillaries were harvested from the ECS by purging with pre-warmed complete culture medium through the two sample side-ports.
- Purified CD34+ bone marrow cells (1-4 x 106 cells/cartridge) were injected into the ECS through the two side sampling ports and the spent cultu}e medium replaced with 120 mL of l . cell growth medium WO 95119793 P~
2181~7 consisting of Iscoves (IMDM) ~ ' J with 10% FCS, 2 mM L-glutamine, 100 U/mL penicillin/~l~Lu,~. , 2 ng/mL GM-CSF, 10 ng/mL
IL-3, 120 ng/mL SCF, and 10 ng/mL IL-6.
After 7 days of culture, and ~"l.,~.l.... lly at weekly intervals, all the " cells were harvested by flushing from the ECS. 75% of the harvested cells were pelleted during a 400 g ~ILlir~ . iu~l for 10 min at 18C, ~ i in complete culture medium, and; ' using a k.,.l~,~ ul~ and trypan blue dye. 25 % of the harvested cells were returned to the ACS for further expansion. Nonadherent cells were . ' ~"~,..1 for the CD34 and CD38 cell surface antigens (see below).
Cell harvest and media exchange procedures required ..~ y 5 min to complete during which time the cartridge system was not perfugd.
The growth medium (--pH 7.3) was monitored for changes in pH and was changed ~ , every 2-3 days when its pH decreagd to pH 7Ø
~ of Cl~ltured Bone Marrow Cells hy r J~
Staining !~ ' two-color cytometric analysis of cultured "
cells were performed at selected intervals of culture to measure the expression of CD34 and CD38 cell surface antigens. Briefly, " cells which were cultured in flask culture and using the ACS (as described above) were harvested, washed twice in complete culture medium, and . ' ' in PBS
.;1 with 2% (wt/vol) bovine serum albumin (BSA) and 0.1%
sodium azide (staining medium). N " cells were first incubated for 30 mins with saturating ~ of anti-CD34 ' ' antibody (K6.1 MoAb). After two washes with staining medium, cells were incubated for an additional 30 minutes with biuLillg' ' goat anti-mouse (IgG1). After a second series of two washes with staining medium, FlTC-conJugated CD38 (OKTIO MoAB) and APC_~L-C~.IV ;dillc were added together and incubated for an additional 30 minutes. Finally, cells were washed twice with staining ~ WO95/19793 2~81~ r~ S- ' medium and fixed with 1% ~ ' ' y~i~. Each incubation step was done in the dark, at 4C, and cells stained with the a~ . conjugated isotype control antibodies. At least 10,000 events were collected in listmode on a Coulter Elite (Coulter, Hialieah, FL) flow cytometer.
~ " ' Assay for Coi~ony Porming Unit-Ci ~ J~ L
(CFU-GM) i~urified CD34+ bone marrow cells and cultured ~
' r ' '' cells harvesied from the ACS cartridge were cultured in 35 mm Lux suspension culture dishes (Miles 1 7l.rr7t~1riPc, Naperville, IL) usiiig a , .. ~ ;.". of ti'ie technique as previously described (1~ , et al., Blood 79:2267 (1992). One milliliter of culture consisted of 5-500 x 102 bone marrow cells, Iscoves IMDM medium (Quality Riologir7lC Rockville, MD), 1% ill~,LIily' " ' , 30% FCS, 2 U/mL tissue culture grade ~,IyL'iiluj~u;.,Lill (Amgen, Thousand Oaks, CA), 2 ng/mL GM-CSF, 10 ng/mL IL-3, 5 ng/mL
IL-6 (R&D Systems, Minn~rrlic, MN) and 5 %, ' ' medium from tiLie bladder carcinoma cell line 5637 (5 X ) as a source of colony stimulating activity. Cultures were incubated at 37C in a humidified r .' 1: of 5% CO2 in air. On day 14 of incubâtion, cultures were evaluated to deterinine the number of colonies (>50 cells) developed in methylcellulose. At day 14, aggregates of l ,~r.~ l ;., containing cells were recognized as BFU-E, ~ IIulU~yL~- u~ D_ colonies as CFU-GM and aggregates of l.- ~ JI-;~ cells containing at least granulocytes and/or . D~ and/or Ill~D~ilyu.,y~J as CFU-Mix. ~_~;~aiyu~"~ colonies (CFU-MK) were confirmed based upon established ~ ,rl ~ criteria (Williams and Levin, Br JHematol 52:173 (1982)). Three dishes were set up for each individual data point per PYrPrimPnt W0 9S/19793 ~ 5.'~ 17 4~
Results of Flask YS. ACS Cul~ure of r~ l'C Cells Purified human bone marrow CD34+ cells were cultured on confluent PMVEC monolayers in 75 cm2 tissue culture flasks and on PMVEC
i" ~ onto the surface of capillaries within the ECS of an ACS
cartridge. A total of 1 x 106 CD34+ cells (5 x 105 cells/flask) were inoculated into two flask cultures and a total of 3 x 106 CD34+ cells were inoculated into the ECS. Each flask and the ECS were inoculated with 5 x 105 and I x 105 PMVEC ~ ,ly, one week prior to the CD34+ int-r~ til7n The details of the flasks and ACS cultures are discussed above in the Materials and Methods sction.
After seven days of culture, non-adherent cells from the flasks and ACS cultures were harvested and subject to I' ~y~; with I antibodies against CD34 and CD38 cell surface antigens. The results are shown in F!igure 1. The purity of the starting CD34+ cell population was ~~ , 85% CD34+CD38+ and rr ' ' ~ 15%
CD34+CD38-. After 7 days of culture in the ACS, there was a 15-fold expansion of CD34+ cells. Moreover, after 7 days of culture in the ACS, the absolute nurnber of CD34+CD38+ cells and CD34+CD38- cells increased 6.2-fold and 70.5-fold, I~ .. y. However, in flask culture, only a 11-fold expansion of CD34+ cells occurred after 7 days of expansion. Moreover, after 7 days of flask culture, the absolute number of CD34+CD38+ and CD34+CD38- cells increased 6.7-fold and 35.7-fold, ~D~ ..Li~.ly.
These data indicate that (I) the ACS is capable of subst~mtial expansion 2~ of CD34+ cells; (2) this expansion is greater tban that achieved using the same system (i.e., culture on PMVEC support cells) in tissue culture flasks; and (3) the ACS is superior to the flask culture in expanding the primitive CD34+CD38- HSC. Thus, the ACS system is better able to support primitive HSC expansion without dirf~ iu~l and depletion.

V W0 95/19~93 FU~
39 ~181~7 L~ng Term ~' 'o~ ~ Ce~l Production in ACS Cul~ure 1 x 108 PMVEC were inoculated into the ECS of an ACS cartridge.
After one week, 4 x 106 human bone marrow CD34+ cells were inoculated into the ECS. The details of the ACS culture are described above in the Materials and Methods section. The culture was O~ y maintained for 8 days. The total number of l~u~ ,... cells produced within the ACS was ' at weekly intervals where ~I~J,ulU~ ,ly 75% of cells contained in the ECS were harvested. Manual h.,llla~.y~u~ cell counts were performed using trypan blue exclusion dye. Cumulative llulladll.,~
1 ~ cell yield is shown in Figure 2. These data show that a total of 8 x 10'21 ~' ' ' cells can be generated over 78 days from a starting population of 4 x 106 CD34+ cells, a 2 million-fold expansion of I r ' "
cells. These results ~' that the ACS/PMVEC culture system supports long-term ' Long Ter~n CD34t HSC Produc~ion in ACS Culture 1 x 10~ PMVEC were inoculated into the ECS of an ACS cartridge.
After one week, 4 x 106 human bone marrow CD34+ cells were inoculated into the ECS. The details of the ACS culture are described above in the Materials and Methods section. The culture was ~ y maintained for 35 days. The total number of CD34+ cells produced was i ' weekly using the anti-CD34 MoAb K6.1 and flow cytometry techniques as described above in the Materials and Methods section. Cumulative CD34+ cell yield is shown in Figure 3.
These data ~'~ a 150-fold expansion of CD34t cells over 35 days of ACS culture. Thus, the ACS/PMVEC system supports the ulifwLiu.. and expansion of the CD34+ bone marrow stem cell pool for at least five weeks.

W095/19?93 l~ll~J_ _. 17 ~
'~181547 40 Long Term CFU-GM Produc~on in ACS Culture 1 x 108 PMVEC were inoculated into the ECS of an ACS cartridge.
Afte} one week, 4 x 106 human bone marrow CD34+ cells were inoculated into the ECS. The details of the ACS culture are described above in the Materials and Methods section. The culture was ~ lS, maintained for 35 days. The total number of ~ '- y~ ~ u~ ,c colony-forming units (CFU-GM) was enumerated weekly using the Ill~,llyl~ " ' assay described above. Cumulative CFU-GM yield is shown in Flgure 4.
These data ' a 1609-fold expansion of CFU-GM over 28 days of culture. More illlLJU~ ly, 1.0 x 107 CFU-GM's, the number necessary to clinically transplant a patient, can be generated from a single ACS/PMVEC system within 14 days of culture.
Moreover, after 28 days of ACS/PMVEC culture, the methylcellulose clonogenic cell assays revealed 77-fold expansion of CFU-Blast, 4222-fold expansion of CFU-Mix, 388-fold expansion of CFU-Mk, and 454-fold expansion of BFU-~ when compared to pre-expansion levels.
Example 2 Co~ . . of PMVEC inl~ '1y with CD34+ Cells in the ECS
~. - ~ H , - Cell Production Prior to inoculating the ACS cartridge with endothelial and CD34+
bone maw cells (see below), the ACS pulyl~lu~yl~ , capillaries were coated with the ,~..",.1.;~ ..1 adhesion protein (PRONECTIN'Y F, Protein Polymer T ' ' g Inc., San Diego, CA.) as described in Example 1.
3 x 10' PMV~C (prepared as described in Example 1) were inoculated into the lumen of the l~oly~ capillaries via the endport. The cartridge ~) WO 19793 1 ~
ssl 21gl547 !' '' "' ''~' containing the capillaries was then incubated at 37C and rotated every 15-20 mins for 2 hours to ailow the PMVEC to adhere to the inner wall of the capillaries. This was followed by incubation at 37C for ~~ 'y 13 hours. The cartridge was then perfused with Iscove's Modified Dulbecco's Medium (IMDM) ~ I with 5 % FBS, 1% penicillin/a~ vl.,~ and 2mM L-glutaunine at a flow rate of 0.40 ml/min.
CD34+ cells were enriched from a 10 ml iliac CRst bone marrow aspirate from a human patient using the Cellpro Ceprate LC34 Cell Separation System (Cellpro, Inc.). Enriched CD34+ cells (I x 106 cells/cartridge) were injected into the ECS of the cartridge and the cartridge was perfused with IMDM ~ .1 with 5% FBS, 1% penicillinl'~LI~tulll~ 2 mM L-glutamine, 1 ng/ml GM-CSF, 5 ng/ml IL-3, 5 ng/ml IL-6, and 120 ng/ml SCF. The volume of medium in the reservoir bottle was 100 ml.
Periodically during ACS culture (at days 5, 7, 8, 10, 12, and 13), spent medium was removed from the reservoir bottle and replace with a CV~ a~,Ul,~iill?~ amount of fresh medium.
After 7 days of co-culturing the PMVEC (imml7hili7~d in the capiilary lumen) and enriched CD34+ HSC (located in the ECS), the ~
' A ' '' cell population was harvested from the ECS by vigorous flushing from the two sideports. A totai of 6.1 x 106 viable ~IO~ladl~ ill?L cells were counted using a l~ V~.~t~. and trypan blue viability dye. 2.8 x 106 of the IlU~ . cells were l, ' ' into the ECS and the culture continued. After an additional 7 days of culture, "
cells were again harvested from the ECS by vigorous flushing from the two sideports. 1.05 x lOT harvested " cells were i ' and cumulative " cell yield is shown in Figu?re 5. These data ~' thata22.8-foldexpansionof~ , rlll ? , cellscan be generated in the ECS within 14 days of co-culture with the PMVEC
i ' 1i7~d in the capillary lumen.

wo 95119793 P~ 7 218~ ~7 Colony Fonning Cell (CFC) Production Enriched CD34+ cells taken prior to culture and ~ 1 cells harvested after 14 days of culture were assayed for the total number of colony-forming cells (CFC) using a clonogenic assay medium supplied by Terry Fox Labs (Vancouver, Canada, Kit No. HCC4330). At days 0 and 14 of culture, the total number of CFC per 10,000 ,.. ~ cells plated in the Terry Fox medium was scored. The cumulative total CFC yield is shown in Fignre 6.
These data ~' that PMVEC cultured int~l Ily support a 80.6-fold e~pansion of CFC progenitor cells when the CD34+ cells were co-cultured within the ECS for 14 days.
Lactate Pmduction The lactic acid ~ o", r 1 ~n ;~ in the ECS during culture was determined using a YSI glucose/lactaoe automated arlalyzer (Yellow Springs Instrument Co., Inc.). In particular, the daily lactate production was calculated by dividing the change in total lactate content by the days between plotting the rate of lactate production, and ~' ~, the doubling time of lactate production based on logarithmic growth rate. The results are shown in Figure 7.

~J wo 9~19793 r~"~l~ 7 43 ~18~47 . . ., ~ ~ .
Examp~e 3 The Beneficial Effects of Coat~ng the ACS Capillaries with an A~": .. Protein r~, ~ Protocol Human iliac crest bone marrow cells were harvested from a patient after informed consent. The cells were washed from marrow filtration screens and subject to Ficoll-Hypaque (specific gravity 1.077 g/ml; Pha~macia Fine Chemicals, Piscataway7 NJ) density gradient SPr~r~ti~nc 1~ .".. l;~ cells from the interface band were collected after l r ~, " at 300g for 25 min at 25C. The cells were then ~ d~i in Iscove's modified Dulbecco's medium ~ ;1 with 12.5% FCS + 12.5% horse serum + 2 mM L-glutamine + 100 U/ml Penicillin/S~Ic~llly~
ACS pUly~ capillaries were coated with the , '' adhesion protein (PRONECTINn' F, Protein Polymer T~ ln~, San Diego, Ca. 92121) as described above in Example 1. Briefly, the capillaries were washed with ethanoi and then with deionized water and the process repeated. The capillaries were then autoclaved twice for 45 min at 250F and then treated with the adhesion protein (1% dilution of stock adhesion protein in phosphate buffered saiine (PBS)) under sterile conditions or treated with PBS only. ACS cartridges containing the capillaries (with and without the adhesion protein coating) were inserted into sterile flow paths and mounted into pump stations on the CELLMAX Quad (Cellco, Inc., C~ IIL~J..II, MD.). The cartridge was then perfused with Iscove's medium containing 10 mg/ml bovine serum aibumin (BSA), 1% penicillin/~Llc~ ly~ solution for ' 25 two days. The perfusion medium was replaced with 50 ml of l r "
growth medium containing fresh Iscove's medium ,.' ' with glutamine (I %), penicillin/~LIc~ ~l,ly~ (I %), fetai calf serum (12.5 %), horse WO 95/19793 = T~ L 7 2~8~
serum (12.5%), IL-3 (4 ng/ml), IL-6 (5 ng/ml), GM-CSF (1 ng/ml) and stem cell factor (2 ng/ml).
33 x 106 bone marrow ' cells were injected into the ECS
of cartridges containing capillaries either with or witbout the adhesion proteincoating. After days 4, 6, 8, 9, 10 and 11 of culture, 25 ml aliquots of fresh r- . growth medium were added to the reservoir bottle. After 12 days of culture, l~ullad~ lL cells were harvested from the ECS and the number of colony-forming cells (CFU-GM and BFU-E) was determined using a methylcellulose clonogenic cell assay kit (Terry Fox Labs, Vancouver, Canada).
Glucose utilization was measured by taking 2 ml aliquots of medium from the ACS reservoir on days 4 and 6 and performing utilization analysis on a YSI glucose/lactate analyzer (Yellow Springs Instrument Co., Inc.).
Resul~s After 12 days of cultnre, the number of CFU-GM + BFU-E clongenic progenitor cells per 20û,000 harvested ~ cells was measured using a methylcellulose clonogenic cell assay that supports m~ inP:l~.o colony-formation. The results are shown in Figure 8. These data ~ that the adhesion protein-coated capillaries enhance ' . progenitor cell growth 2.8-fold in rnmp~ricnn to capillaries without the adhesion protein coating.
After days 4 and 6 of culture, aliquots of culture medium (2 ml) were removed from the ACS reservoir and analyzed on a YSI glucose/lactate analyzer (Yellow Springs Instrument Co., Inc.) for glucose utilization. Under the culture conditions, the glucose utilization assay is primarily a measure of stromal cell activity. Glucose values were measured on day 4 and day 6 and the amount of glucose consumed per 2 days was calculated and divided by 2 to give the glucose, . per 24 hr. Glucose ~f~ ;..., (gm/24 hours) is shown in Figure 9. These data ~' that adhesion protein-WO 95119793 r~l~u~3~
45 2~gl~47 coated capillaries provide an a~lu~d~ ~ly 1.8-fold increase in strûmal cell activity as compared to capi~laries without the adhesion protein coating.
Example 4 CL 1;~ Tlzerapy w~t~ Al.~log~. Ex Vivo Frr~ d N~ he Cells Outpat~ent r~ r of ~alignant Breast Cancer Patients Outpatient induction .1,., --lh .~y is performed using the multidrug, dose-intense, 16-week regimen described in KeMedy et e~., JNatl Cancerlnst 83 (13):921 (1991); Abeloff et al., ~ Natl Cancer Inst 82:570 (1990); and Beveridge et al., Proc ASCO 7:13 (1988). Briefly, malignant breast cancer patients receive 100 mg/m2 1y~ orally on days 1 through 7, 40 mg/m'du~ ubl~ LI.Iv~llo~jly (IV) onday 1, 100mg/m ~ uLl~ IV
on day 1 with 10 mg/m2 leucovorin rescue orally every 6 hours for six doses beginning on day 2, 1 mg vincristine IV on day 1, and 600 mg/m2 lluul- - l (S-FU) IV fûr 2 hours at hour 20. On days 8 and 9, patients receive 300 mg/m' 5-FI~ 1~ daily by wntinuous infusion through an indwel~ing venous access device. Patients receive a maximum of eight 2-week cycles.
After compleLion of outpatient th~erapy, patients showing a complete or partial response by standard ECOG criteria are candidates for further therapy.
These patients are then subject to bone marrow harvest and high-dose ,~h. .11~ Y 4-6 weeks after the outpatient treatment as described below.
Harvest and Ex-Vivo Expansion of A~ , Bone Marrow Bone marrow is harvested from the posterior iliac crest from the patients as described in Kennedy et al., JNatl Cancerlnst 83 (13):921 (1991).
. . _ . . . _ . . . _ W095119793 r~.,. l , ~
k7 -46-After harvesting, the bone marrow cells are subject to purging with 4-;lydlu~ u~y~y~ r (4-HC) at a dose of 100 uglmL at 37C for 30 min to remove ~ iable tumor cells. After purging, the cells are rapidly cooled to 4C and .~ . ' ' in 85% Tissue Culture 199 (GIBCO
T ' Grand Island, NY), 5% autologous plasma, and 10% dimethyl sulfoxide.
CD34+ cells are purifled from the marrow cells and co-cultured with PMVEC in an ACS cartridge as described in Example 1. After t~vo weeks of ACS culture, " ~ r ' '' cells (including at least 107 CD34L
cells and 107 CFU-GM) are harvested from the ECS by flushing with culnure medium as described in Example 1.
After the marrow harvest, the patients are again subject to ,:.. Ih. '~'I'Y as described in Kennedy et al., J Natl Cancer Inst 83 (13):921 (1991). Briefly, patients receive continuous infusion of 1.5 g/m2 ~,yl k, '. ~ and 200 mg/m2 thiotepa daily for 4 days. Four days after completion of . h .".~lh. '"I'Y~ the harvested autologous r I ' cells recovered from ACS culture are reinfused into the patients.
Example ~
lh ~ 'io. of ~e ~ Cells Tvith r~v~d Retroviral Vectors r,, of Packaged LASN
LASN is a retrovirus vector containing the ADA and Neo resistance genes. High r,.... .~io..~ of packaged LASN retrovirus particles are produced in the ''~.pPrl~t~`~t of LASN-producing PA-317 packaging cells (ATCC Accession No. CRL 9078) as described in Hock et al.. Blood 74:876--WO95/19793 ~I/~J.. ~t J/
~i ~181547 , 1~ =
881 (1989). 5 ml of supernatant from the packaging cells is filtered through a POLYDISCTM AS filter (Whatman Ltd., Maidstone, England) and collected for ~
T, of ~' , ' '~ CeUs with Packaged LASN
Bone marrow is harvested from the posterior iliac crest from a human subject using the technique described in Kennedy et al., J Natl Cancer Inst 83 (13):921 (1991). After harvesting, the CD34+ HSC are purified from the marrow cells and co-cultured with PMVEC in an ACS cartridge as described in Example 1. After one week of culture, non-adherent cells are removed by gently shaking (or flushing) tbe ACS cartridge. About 20% of the cells are separated to serve as non-transduced controls. The remaining cells are pelleted and . ' ' in 5 ml of the LASN filtrate described above. The rc_ --r . containingpackaged LASN and " Cl" l- . cells, is ICill~l~UIdt~ into the ACS cartridge and the culture continued. After two days, the ' procedure is repeated with a second volume of L,ASN
filtrate. After two more days, the i ' procedure is again repeated.
Before each ' procedure, samples of expanded I , - cells are removed from the ACS for analysis. The culture is terminated after about eight days. Transduced l . stem cells may be recovered both in the " cell population and bound to the endothelial layer.
Detection of LASN in ~. ~' ....~ and ~ound r~ , Cells The presence of LASN in " and bound (to the endothelial layer) ' ~ cells is confirmed by the pVlyll.~,laDe chain reaction (PCR). PCR arlalysis is carried out using GeneAmp~ reagents and DNA
Thermal Cycler (Perkin Elmer Cetus, Emeryville, CA). DNA is isolated from the transduced and non-transduced l ~ cells according to ~..~."ILi~,l al techniques. PCR is initiated with 1-2 ILg of genomic DNA using W095119793 at81~ r_l,L: A , `~
~8-primers ~à~klng the Neo resistance gene which is contained in LASN. The DNA sequences of the primers are as follows:
CAAGATGGATTGCACGCAGG
CCCGCTCAGAAGAACTCGTC
The reaction mixture is heated at 94C for 2 min, annealed at 56C for 2 min, and extended at 72C for 3 min in the DNA Thermal Cycler for 30 cycles.
The products of the reaction are loaded and run on a gel and probed with a Neo-resistance gene specific probe.
It will be appreciated to those skilled in the art that the invention can be performed within a wide range of equivalent parameters of ~
modes of -' and conditions without departing from the spirit or scope of the invention or any ~ ',o.l;".. ,1 thereof.
The disclosure of all references, patent ,.I.~ and patents recited herein are hereby . ' by reference.

~ WO 95119793 F ~. I / U _ S l /
2~81~7 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPlICANT: United State3 of America as repre3ented by the Secretary of the Navy and Cellco, Inc.
ii) INVENTORS: Davis, Thoma3 A.
I,ee, ~elvin P.
~Cidwell, William R.
(iii) TITLE OF INVENTION: iT~ nro;~-~;c Cell Expan3ion and Tr:ln~:rl ~n~r; nn ~ethod3 ( iv) N[~MSER OF SEQUENCES: 3 ~V) UUhl~ UNlJ41~ ADDRESS:
A ADDRESSEE: Sterre, ~e331er, Gold6tein & Fox B STREET: 1100 New York Avenue, Suite 600 C CITY ~1~ qh t n ~t nn E COUNTRY: USA
F ZIP: 20005 (vi ) CQMPUTER READASI.E FORM:
(A) MEDIUM TYPE Floppy disk (B) COMPI~TER: IBM PC ~;hl..
(C) OPERATING SYSTEM: PC DOS/MS-DOS
(D) SOFTWARE: PatentIII Release #1.0, Version #1.25 (vii) CURRENT APPLICATION DATA:
(A) APPDICATION NUMSER: (to be as3igned) (B) FILING DATE: 20 ,Tanuary 1995 (C) CL~SSIFICATIONN:
(viii) PRIORITY APPLICATION DATA
(A) APPl,ICATION N~MBER: US 08/194,140 (B) FII.ING DATE: 21 ,TANUARy 1994 (C) C~ASSIFICATIONi ( ix) ATTORNEY/AGENT INFORMATION:
(A) NAME: Gold3tei~, ~To~ge A.
(B) REGISTRATION NUMBER: 29, 021 (C) REFBRENOE/DOC~ET NOMBER: 1444. 015PC00 (X) TRT,~ NI~ TION INFORMATION:
(A) TELEPHONE: (202) 371-2600 (B) TEI,EFAX: (202) 371-2540 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE rTl~R~-'TRRTCTICS:
(A) LENGT~}: 9B0 amino acid3 (B) TYPE: amino acid (D) TOPO~OGY: both (xi) SEQ~ENCE 114~ 1CLl'llUN: SEQ ID NO:1:
Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Ala Val Thr Gly Arg Gly A3p Ser Pro Ala S Ala Ala Gly Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser WO 95/19793 PCT/US95/00817 ~
~ S ~! 7r r 5O
Ber Ala Ala Gly Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ber So SS 60 Gly Al~ Gly Ala Gly Ber Gly Ala Gly Al~ qly Ber Gly Ala Gly Ala ly Ser Gly Ala Gly Ala Gly Ber Gly Ala OEly Ala Gly Ser Gly Ala 85 90 gs ly Ala Gly Ber Gly Ala Gly Ala Gly 8cr Gly Ala Ala Val Thr Gl Arg Gly Aup Ser Pro Ala 6er Ala Ala Gly Gly Ala Gly Ala llS 120 125 Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ber Gly Ala Gly Ala Gly 6~r Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly ser Gly Ala ly Ala Gly ser Gly Ala Gly Ala Gly ser Gly Ala Gl Ala l ser 165 17~ Y Gl7y5 ly Ala Ala Val Thr Gly Arg Gly Asp Ser Pro Ala Ser Ala Ala Gly 180 185 l9o Gly Ala Gly Ala Gly ser Gly Ala Gly Al~ Gly Ser Gly Ala Gly Ala l9S 200 205 Gly s~r Gly Al~ Gly Ala Gly ser Gly Ala Gly Ala Gly ser Gly Al~
210 ZlS 220 Gly Ala Gly Ser Gly Al-- Gly Al~ Gly ser Gly Ala Gly Ala Gly Ala Gly Ala Gly Ser Gly Ala Ala Val Thr Gly Arg Gly A p ser Pro Ala Ser Ala Ala Gly Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly ser Gly Ala Gly Ala Gly ser Gly Ala Gly Ala Gly Ser Gly Ala Ala 7al hr Gly Arg Gly Asp ser Pro Ala Ser Ala Ala Gly Gly Ala Gly Ala ly ser Gly Ala Gly Ala Gly ser Gly Ala Gly Ala Gly 5er Gly Ala 340 34s 3so Gly Ala Gly ser Gly Ala Gly Ala Gly Ber Gly Ala Gly Ala Gly ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Scr Gly Ala Gly Ala Gly Ser Gly Ala Ala Val Thr Gly Arg Gly A~p Ser Pro Ala Ber Ala la Gly Gly Ala Gly Ala qly Ser Gly Ala Gly Ala Gly Ser Gly Ala ly Ala Gly s~r Gly Ala Gly Ala Gly ser Gly Ala Gl Ala G
420 425 Y ly S~r O W095119793 .~_liU.~ S_ 7 -51- ~1547j -Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly ser Gly Ala Ala 7al Thr Gly Arg Gly Asp Ser Pro Al~ 9er Ala Ala Gly Gly Ala Gly Ala Gly ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Al~ Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Alil Gly Ala Gly Ser Gly Ala Gly Ali~ Gly Ser Gly Al~ Gly Al;~ Gly Ser Gly Ala Ala V 1 Thr Gly Arg Gly A p ser Pro Ala Ser Ala Ala Gly Gly Ala Gly Ala Gly 9er Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly ser Gly Al~ Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Ala Val Thr Gly Arg Gly A p ser Pro Ala Ser Ala Ala Gly Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 9er Gly Ala Gly Ala Gly 6er Gly Ala Gly Al~ Gly 9er Gly Ala Gly Ala Gly 9er Gly Ala Gly Ala Gly 5er Gly Ala Gly Ala Gly Ser Gly Ala Ala Val Thr Gl Arg Gly Asp 9er Pro Alil 9er Ala Ala Gly Gly Ala Gly Al~ Gly 9er Gly Ala Gly Al~ Gly 9er Gly Al~ Gly Ali~ Gly Ser Gly Ala Gly Al;l Gly 9er Gly Ala Gly Ala Gly 9~r Gly Ala Gly Al~ Gly 9er Gly Ala Gly Ala Gly 9er Gly Ala Gly Al~ Gly 9er Gly Ala Gly Ala Gly 9er Gly Ala Ala Val Thr Gly Arg Gly Asp 9er Pro Ali~ Ber Ala Ala Gl Gly Al~ Gly Ala Gly 9er Gly Ala Gly Ala Gly 9er Gly Alil Gly Ala Gly 9er Gly Ala Gly Ala Gly 9er Gly Ala Gly Ali Gly 9er Gly Ala Gly Ala Gly 9er Gly Al Gly Ala Gly 9er Gly Ala Gly Ala Gly Ser Gly Ala Gly Alil Gly 9er Gly Ala Ala Val Thr Gly Arg Gly Asp 9er WO 95119793 P_1/ù_ S.'C ~
~?~8/ 5~ ~ -52-Pro Ala ger Ala Al~ Gly Gly Ala Gly Ala Gly 9er Gly Ala Gly Ala Gly 8er Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 8er Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly ser Gly A616a0 Gly Al~ y S
Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala Ala Val Thr Gly Arg Gly Aup Ser Pro Ala Ser Ala Ala Gly Gly Ala Gly Ala 885 890 8sS
Gly 8er Gly Ala Gly Ala Gly Ser Gly Al~ Gly Ala Gly 8er Gly Ala Gly Ala Gly Ser Gly Ala Gly Al~ Gly Ser Gly Ala Gly Ala Gly Ser 9lS 920 925 Gly Ala Gly Ala Gly Ser Gly Ala Gly Ala Gly 8er Gly A1R Gly Al~
Gly Ser Gly Al~ Al~ Val Thr Gly Arg Gly ADp Ser Pro Ala Ser Ala Al~ Gly Gly Al:a Gly Ala Gly Ser Gly Ala Gly Ala Gly Ser Gly Ala 965 g70 975 - Gl Ala Gly Ser (2) lNb1 FOR ShQ ID NO:2:
(i) ShQDENOE r~DD~TPDTCTIC8:
(P) TYPh: ~minoaminid ~cidD
(D) TOPO~OGY: both (xi) SE:Q1~3NCB ~a: OU:~l: 1lUN: S13Q ID NO: 2:
G~y Ala Ala Val Thr Gly Arçj Gly ADp Ser Pro Ala Ser Ala Ala Gly (2) lNr~ POR ShQ ID NO:3:
(i) ShQT9ENOENGTH 6 il~ino acidu (D) TYPh: ~mino ~id (D) TOPOLOGY: both (xi) ShQUENOE ~h~~ lUN: 8hQ ID NO:3: .
Gly Alil Gly Al~ Gly 8er

Claims (54)

We Claim:

1. A method for transplanting ex vivo expanded hemotopoietic cells, including hematopoietic stem and progenitor cells, into a patient comprising:
(a) inoculating endothelial cells capable of supporting expansion of the hematopoietic cells into an artificial capillary system (ACS) cartridge;
(b) inoculating CD34+ cells into said ACS cartridge;
(c) perfusing said ACS cartridge with culture medium containing at least one hematopoietic growth factor capable of stimulating expansion of the hematopoietic cells;
(d) culturing said CD34+ cells in said ACS cartridge for a sufficient amount of time to achieve expansion of a therapeutically effective number of hematopoietic cells;
(e) harvesting cultured cells from said ACS cartridge; and (f) transplanting said cells into the patient.

2. The method of claim 1 wherein said harvested cells include a sufficient number of CD34+CD38- hematopoietic stem cells (HSC) to achieve long-term reconstitution of the hematopoietic system.

3. The method of claim 1 wherein said harvested cells include a sufficient number of committed hematopoietic progenitor cells to achieve short-term reconstitution of the hematopoietic system.

4. The method of claim 1 wherein said endothelial cells are immobilized on the outer capillary wall of said ACS cartridge.

5. The method of claim 1 wherein said endothelial cells are immobilized on the inner capillary wall of said ACS cartridge.

6. The method of claim 1 wherein said CD34+ cells are inoculated into said ACS cartridge as an enriched population of CD34+ cells.

7. The method of claim 1 wherein said CD34 + cells are inoculated into said ACS cartridge as a subpopulation of CD34+ cells included within a mixed cell population.

8. The method of claim 1 wherein the patient is suffering from a malignancy.

9. The method of claim 8 wherein the CD34+ cells are enriched from the patient's bone marrow cells.

10. The method of claim 8 wherein said CD34+ cells are purged of contaminating tumor cells prior to inoculation.

11. A method for the ex vivo expansion of hematopoietic cells, including hematopoietic stem and progenitor cells, comprising:
(a) inoculating endothelial cells capable of supporting expansion of the hematopoietic cells into an artificial capillary system (ACS) cartridge;
(b) inoculating CD34+ cells into said ACS cartridge;
(c) perfusing said ACS cartridge with culture medium containing at least one hematopoietic growth factor capable of stimulating expansion of the hematopoietic cells;
(d) culturing said CD34+ cells in said ACS cartridge for a sufficient amount of time to achieve hematopoietic cell expansion.

12. The method of claim 11 further comprising:
(e) harvesting cultured cells from said ACS cartridge.

13. The method of claim 12 further comprising:
(f) detecting the presence of expanded CD34+ cells.

14. The method of claim 12 further comprising:
(f) detecting the presence of expanded CD34+CD38 hematopoietic stem cells (HSC).

15. The method of claim 12 further comprising:
(f) detecting the presence of expanded CFU-GM hematopoietic progenitor cells.

16. The method of claim 13 wherein said cells are detected by phenotype analysis.

17. The method of claim 14 wherein said cells are detected by phenotype analysis.

18. The method of claim 15 wherein said cells are detected by a colony forming assay.

19. The method of claim 11 wherein culturing occurs for a sufficient amount of time to achieve long term hematopoiesis.

20. The method of claim 11 wherein said endothelial cells are immobilized on the outer capillary wall of said ACS cartridge.

21. The method of claim 11 wherein said endothelial cells are immobilized on the inner capillary wall of said ACS cartridge.

22. The method of claim 11 wherein said endothelial cells are porcine.

23. The method of claim 22 wherein said endothelial cells are PMVEC.

24. The method of claim 11 wherein said CD34+ cells are inoculated into said ACS cartridge as an enriched population of CD34+ cells.

25. The method of claim 11 wherein said CD34+ cells are inoculated into said ACS cartridge as a subpopulation of CD34+ cells included within a mixed cell population.

26. The method of claim 24 wherein said cells are enriched using an antibody specific for the CD34 cell surface antigen.

27. The method of claim 11 wherein said hematopoietic growth factor is selected from the group consisting of IL-1, IL-1.alpha., IL-1.beta., G-CSF, GM-CSF, IL-3, IL-6, IL-11, erythropoietin, LIF, PIXY-321 and SCF.

28. The method of claim 27 wherein said growth factors are GM-CSF, IL-3, SCF and IL-6.

29. The method of claim 24 wherein said CD34+ cells are enriched from a source of cells selected from the group consisting of bone marrow cells, peripheral blood cells, and umbilical cord blood cells.

30. The method of claim 25 wherein said subpopulation of CD34+
cells are included within a mixed cell population selected from the group consisting of bone marrow cells, peripheral blood cells, and umbilical cord blood cells.

31. The method of claim 11 wherein the capillaries of said ACS
cartridge are coated with a suitable coating reagent.

32. The method of claim 31 wherein said coating reagent is an adhesion protein having an amino acid sequence substantially identical to that shown in Figure 10 (SEQ ID NO. 1).

33. An artificial capillary system (ACS) comprising:
(a) an ACS cartridge;
(b) culture medium containing at least one hematopoietic growth factor;
(c) CD34+ cells; and (d) endothelial cells capable of supporting expansion of hematopoietic cells, including hematopoietic stem and progenitor cells;
wherein said culture medium, said CD34+ cells, and said endothelial cells are contained within said cartridge.

34. The ACS of claim 33 wherein said endothelial cells are immobilized on the outer capillary wall within said cartridge.

35. The ACS of claim 33 wherein said endothelial cells are immobilized on the inner capillary wall within said cartridge.

36. The ACS of claim 33 wherein said hematopoietic growth factor is selected from the group consisting of IL-1, IL-1.alpha., IL-1.beta., G-CSF, GM-CSF, IL-3, IL-6, IL-11, erythropoietin, LIF, PIXY-321 and SCF.

37. The ACS of claim 33 wherein said CD34+ cells are inoculated into said ACS cartridge as an enriched population of CD34t cells.

38. The ACS of claim 33 wherein said CD34+ cells are inoculated into said ACS cartridge as a subpopulation of CD34+ cells contained within a mixed cell population.

39. The ACS of claim 37 wherein said CD34+ cells are enriched using an antibody specific for the CD34 cell surface antigen.

40. The ACS of claim 37 wherein said CD34+ cells are enriched from a source of cells selected from the group consisting of bone marrow cells, peripheral blood cells, umbilical cord blood cells.

41. The ACS of claim 38 wherein said subpopulation of CD34+
cells are included within a mixed cell population selected from the group consisting of bone marrow cells, peripheral blood cells, and umbilical cord blood cells.

42. The ACS of claim 33 wherein the capillaries of said ACS
cartridge are coated with a suitable coating reagent.

43. The ACS of claim 42 wherein said coating reagent is an adhesion protein having an amino acid sequence substantially identical to that shown in Figure 10 (SEQ ID NO. 1).

44. A method for the ex vivo expansion of hematopoietic cells comprising:
(a) coating the capillaries of an artificial capillary system (ACS) cartridge with an adhesion protein having an amino acid sequence substantially identical to that shown in Figure 10 (SEQ ID NO. 1);
(b) inoculating CD34+ cells into said ACS cartridge (c) perfusing said ACS cartridge with culture medium containing at least one hematopoietic growth factor capable of stimulating expansion of hematopoietic cells;
(d) culturing said CD34+ cells in said ACS cartridge for a sufficient amount of time to achieve hematopoietic cell expansion.

45. The method of claim 44 wherein said CD34+ cells are inoculated into said ACS cartridge as an enriched population of CD34+ cells.

46. The method of claim 44 wherein said CD34+ cells are inoculated into said ACS cartridge as a subpopulation of CD34+ cells contained within a mixed cell population.

47. The method of claim 46 wherein said subpopulation of CD34+
cells are contained within a population of mononuclear cells selected from the group consisting of bone marrow mononuclear cells, peripheral blood cells, and umbilical cord blood mononuclear cells.

48. A method for transducing ex vivo expanding hematopoietic cells, including hematopoietic stem and progenitor cells, with packaged retrovirus vectors comprising:
(a) inoculating endothelial cells capable of supporting expansion of the hematopoietic cells into an artificial capillary system (ACS) cartridge;
(b) inoculating CD34+ cells into said ACS cartridge;
(c) perfusing said ACS cartridge with culture medium containing at least one hematopoietic growth factor capable of stimulating expansion of the hematopoietic cells;
(d) culturing said CD34+ cells in the presence of the packaged retrovirus vectors in said ACS cartridge for a sufficient amount of time to achieve expansion and transduction of the hematopoietic cells.

49. The method of claim 48 further comprising:
(e) harvesting cultured cells which have been transduced with the retrovirus vector from said ACS cartridge.

50. The method of claim 49 further (f) detecting expanded CD34+ cells which are transduced with the retrovirus vector.

51. The method of claim 49 further (f) detecting expanded CD34+CD38 hematopoietic stem cells which are transduced with the retrovirus vector.

52. The method of claim 49 further comprising:
(f) detecting expanded CFU-GM hematopoietic progenitor cells which are transduced with the retrovirus vector.

53. The method of claim 48 wherein said retrovirus vector contains a heterologous gene encoding a therapeutically effective product.

54. The method of claim 49 further comprising:
transplanting a therapeutically effective amount of said transduced hematopoietic cells to a patient.