CA2158933A1 - Methods of suppressing graft rejection - Google Patents

Abstract

Tissue cells of an animal transformed with a recombinant vector construct which (a) directs the expression of a protein or active portion thereof; (b) transcribes an antisense message; or (c) transcribes a ribozyme capable of inhibiting MHC antigen presentation are provided. In a related aspect, the cells are transformed with two or more of such proteins, antisense or ribozymes, or combinations thereof. The tissue cells are particularly useful within methods for suppressing graft rejection. Pharmaceutical compositions comprising such transformed tissue cells are also provided.

Description

21S89~3 Desc,;~lion METHODS OF SUPPRESSING GRAFT REJECTION

Technical Field The present invention relates generally to the field of tissue transplantation, and more specifically, to methods for preventing graft rejection mediated by T-cell recognition and activation.
Back~round of the Invention Effective and safe methods of ~u~l les~ g the immlme response have been a critical issue for clinical transplants from the beginning of the 1950's. Upon introduction of allograft tissue into an animal, an attack by the immlln~ system is 15 initiated consisting of both humoral and cell merli~te~l responses. In these responses, tissue cells are targeted for clearance by antibodies directed against the transplanted tissues or destroyed by killer cells. Allograft rejection consists of a series of complex T-cell dependent events triggered by donor histocompatibility molecules. One major event in T-cell activation is associated with the de novo ~ es~ion of the cell surface 20 protein, interleukin-2 receptor (IL-2R) which is essential for proliferation and continued viability of alloactivated T-cells upon binding to IL-2. (Cantrell et al., Science ~:1312, 1984). When IL-2R is not present, the immune response is ~u~pl~ssed.
One early attempt to suppress the rejection response utilized whole-body irradiation. However, such attempts were lln~uccec~ful due to a lack of specificity and 25 increased tumor production. This led to the utilization of either specific drugs or antibodies for the prevention and treatment of graft rejection. In this regard, a number of drugs (Carpenter et al., New Fn~l. J. Med. ~:1224, 1991) have been shown to be successfully imrnunosuppressive, but not without various side effects. These toxic effects generally include neurologic, dermal, gastrointestinal, endocrine, vascular, and 30 hematologic complications. One such established drug that induces specific tolerance to organ transplants is cyclosporine. This drug exerts its therapeutic affect by inhibiting T-cell-mediated alloimmune and autoimmune responses specifically by suppression of IL-2 production at the mRNA transcriptional level (Kronke et al., PNAS 81:5214, 1984). Although the exact mech~ni.~m is not yet known, reduction of IL-2 synthesis has 35 been demonstrated in vivo in bone marrow transplants (Hess et al., J. Immunol.
1~:355, 1983) and renal-transplant recipients (Azogui et al., J. Immunol. 131:12Q5, ?,~S~9~3~ 2 1983) by repetitive drug ~(1mini~tration. However, since cyclosporine is non-specifically a~mini~tered throughout the systemic circulation, the drug is known to have many toxic side-effects, for example hepatotoxicity and nephrotoxicity (Kahan et al., New F~l J. Med. ~1:1725, 1985 In addition, ~lmini~tration of cyclosporine 5 renders the patient more ~-lsceylible to general infection.
Antibodies directed to the lymphoid cells of the immune system have also been used in anti-rejection therapy, starting in the 1960's (Filo et al., Transpl~ntation ~Q:445, 1980). However, such anti-lymphocyte globulins, althoughgenerally useful, were of variable potency and had the potential disadvantage of10 collt~ g antibodies directed against a wide variety of nonlymphoid tissues, such as platelets and macrophages. The first clinical antibody to be used was anti-CD3~ also known as OKT3. OKT3 is directed only against mature T-lymphocytes, its precise target being the CD3 cluster that composes the antigen-receptor complex of T-cells.
The F(ab)2 fragment of the OKT3 monoclonal antibody retains the immunosuppressive 15 prope~ies of the whole antibody but is less active in eliciting T-cell activation and lymphokine release (Woodle et al., Transplantation 52:354, 1991). Bioengineered variants of the OKT3 molecule with high epitope specificity and high immune suppression potency have been produced. However, the antibody has the disadvantage of activating all accessible T-cells, sometimes resulting in severe febrile and circulatory 20 problems for the first day or two after ~tlmini~tration (Carpenter, ~m. J. Kidney Dis.
14:suppl 2:1, 1989). Monoclonal antibodies directed at surface receptors other than CD3 have yielded mixed results (Heffron et al., Transplant Sci. 1:64, 1991). Although anti-CD4 monoclonal antibodies have appeared more attractive in view of their low toxicity and propensity to induce longer-lasting immunologic non-responsiveness in 25 certain animal models, the depletion of CD4+ T-cells may lead to a possible AIDS
syndrome (Sablinski et al., Transplantation 52:579, 1991). Therefore, these systems do not provide suitable long-term effects and must be ~cycli~i~rely ~imini~tered.
Consequently, there is a need in the art for improved methods of ~uyylcssh1g the immune response, without the side effects or disadvantages of 30 previously described methods. The present invention fulfills these needs and further provides other related advantages.

Summarv of the Invention Briefly stated, the present invention provides methods for suyylcssillg 35 MHC antigen presentation in order to suppress the immune response of T-cells,including cytotoxic T-lymphocytes (CTL), thereby preventing graft rejection. Within WO 95/06717 ~ ~ ~ ,$~ ~ 3 PCTIIJS94/099S7 one aspect, a method is provided for suppressing graft rejection, compricing transforming tissue cells isolated from a donor animal with a recombinant vectorconstruct which directs the expression of a protein or active portion of a protein capable of inhibiting MHC antigen presentation, and transplanting the l~ srolllled tissue cells into a recipient animal such that an immune response against the tissue cells is~uypl~ssed. Within one embodiment of the invention, the recombinant vector construct directs the expression of a protein capable of binding ~2-microglobulin, such as H301.
With another embodiment, the recombinant vector construct directs the t;Aylession of a protein capable of binding the MHC class I heavy chain molecule intracellularly, such as E3/19K.
Within another aspect of the invention, a method is provided for suyyles~ g graft rejection, comprising transforming tissue cells isolated from a donor animal with a recombinant vector construct which transcribes an antisense message, the ~nti~en.~e message being capable of inhibiting MHC antigen presentation, and transplanting the transformed tissue cells into a recipient animal such that an immllne response against the tissue cells is ~uy~lessed. Within certain embodiments of the present invention, the recombinant vector construct transcribes an antisense message which binds to a conserved region of the MHC class I heavy chain transcripts, ~2-microglobulin transcript, or the PSFl transporter protein transcript.
Within still another aspect of the invention, a method is provided for suppressing graft rejection, comprising transforming tissue cells isolated from a donor animal with a recombinant vector construct which transcribes a ribozyme capable of inhibiting MHC antigen presentation, and transplanting the transformed tissue cells into a recipient animal such that an immune response against the tissue cells is suppressed.
Within certain embodiments of the invention, the recombinant vector construct transcribes a ribozyme that cleaves a conserved region of MHC class I heav,v chain transcripts, ~2-microglobulin transcript or the PSFl transporter protein transcript.
Within another aspect of the invention, a method is provided for suppressing graft rejection comprising transforming tissue cells isolated from a donor animal with a multivalent recombinant vector construct which directs the expression of a protein or active portion of a protein capable of inhibiting MHC antigen presentation, and an antisense or ribozyme capable of inhibiting MHC antigen presentation, andtransplanting the transformed tissue cells into a recipient animal such that an immune response against the tissue cells is suppressed. Within a related aspect, tissue cells 3~ isolated from a donor animal are transformed with a multivalent recombinant vector construct which directs the expression of an ~nti~en~e message and a ribozyme capable sl ~S933 4 of inhibiting MHC antigen presentation. Subsequently, the transformed tissue cells are transplanted into a recipient animal such that an immune response against the tissue cells is suppressed. Within another related aspect of the invention, tissue cells isolated from a donor animal are transformed with a multivalent recombinant vector construct which directs the ~ ,~s~ion of two or more proteins or active portions of proteins capable of inhibiting MHC antigen presentation, two or more ~ntisçn~e messages capable of inhibiting MHC antigen presentation, or two or more ribozymes capable o~
inhibiting MHC antigen presentation. Subsequently, the transformed tissue cells are transplanted into a recipient animal such that an immune response against the tissue cells is suppressed.
Within various embodiments of the invention, the multivalent recombinant vector construct expresses or transcribes at least two of the following in any combination: a protein or active portion of a protein selected from the group consisting of E3/19K and H301, an antisense message that binds to the transcript of a conserved region of MHC class I heavy chains, ~2-microglobulin or PSFl transporter protein, or a ribozyme that cleaves the transcript of a conserved region of MHC class I
heavy chains, ~2-microglobulin or PSF 1 l~alls~ol ler protein. Within another embodiment, the multivalent recombinant viral vector constructs express or transcribe two such proteins or active portions of the proteins, two antisense messages or two ribozymes.
Within preferred embodiments, the recombinant vector construct is a recombinant viral vector construct. Within a particularly preferred embodiment, the recombinant vector construct is a recombinant retroviral vector construct. Within other embodiments, the recombinant viral vector construct is carried by a recombinant virus selected from the group con.~i~ting of togaviridae, picornaviridae, poxviridae, adenoviridae, parvoviridae, herpesviridae, paramyxoviridae and coronaviridae viruses.
In the context of the present invention, suitable donor tissue cells include bone marrow cells, pancreatic islet cells, fibroblast cells, corneal cells and skin cells.
Such tissue cells may be transplanted into a recipient animal using a number of methods, including direct injection or catheter infusion.
Within still another related aspect of the present invention, ph~rrn~eutical compositions are is provided comprising tissue cells transformed with a recombinant vector construct or a multivalent recombinant vector construct as described herem.
Within various embodiments of the present invention methods are provided wherein the transformed tissue cells are implanted into an animal having the `8~3 same type MHC, into a different animal species from which the tissue cells were removed.
These and other aspects of the present invention will become evident upon reference to the following detailed description.
s Detailed Description of the Invention Prior to setting forth the invention, it may be helpful to an underst~n-ling thereof to set forth definitions of certain terms that will be used hereinafter."Tr~n~lant" refers to the insertion or grafting of tissue cells into a recipient animal such that at least a portion of the tissue cells are viable subsequent to implantation. The implanted tissue can be placed within tissue of similar function or of different function. For example, tissue cells from one animal may be removed andtransformed with recombinant vector constructs before being "implanted" into another animal. Transplantation of tissue between genetically (li~simil~r ~nim~l~ of the same species is termed allogeneic transplantation.
"Tramfonnin~" tissue cells refers to the transduction or transfection of tissue cells by any of a variety of means recognized by those skilled in the art, such that the transformed tissue cell e~lesses additional polynucleotides as compared to a tissue cell prior to the transforming event.
"Recombinant vector construct" or "vector construct" refers to an assembly which is capable of expressing sequences or genes of interest. In the context of protein expression, the vector construct must include promoter elements and may include a signal that directs polyadenylation. In addition, the vector constructpreferably includes a sequence which, when transcribed, is operably linked to the sequences or genes of interest and acts as a translation initiation sequence. Preferably, the vector construct includes a selectable marker such as neomycin, thymidine kinase, hygromycin, phleomycin, histidinol, or dihydrofolate reductase (DHFR), as well as one or more restriction sites and a translation tennin:~tion sequence. In addition, if the vector construct is used to make a retroviral particle, the vector construct must include a retroviral parl~ging signal and LTRs appropl;ate to the retrovirus used, provided these are not used already present. The vector construct can also be used in combination with other viral vectors or inserted physically into cells or tissues as described below. As noted above, the vector construct includes a sequence that encodes a protein or active portion of the protein, antisense or ribozyme. Such sequences are designed to inhibit 35 MHC antigen presentation in order to suppress the irn~nune response of cytotoxic T-lymphocytes against the transplanted tissue.

~5~933 In general, the recombinant vector constructs described herein are prepared by selecting a plasmid with a strong promoter, and a~lopliate restriction sites for insertion of DNA sequences of interest downstream from the promoter. As noted above, the vector construct may have a gene encoding antibiotic resi~t~nçe for selection S as well as termin~tion and polyadenylation signals. Additional elements may include enhancers and introns with functional spli~: donor and acceptor sites.
The construction of multivalent recombinant vector constructs may require h-;o promoters when two proteins are being expressed, because one promoter may not ensure adequate levels of gene ~l res~ion of the second gene. In particular, where the vector construct expresses an ~nti.~en~e message or ribozyme, a secondpromoter may not be necessary. Within certain embotliment~, an intçrn~l ribosomebinding site (IRBS) or herpes simplex virus thymidine kinase (HSVTK) promoter isplaced in conjunction with the second gene of interest in order to boost the levels of gene expression of the second gene. Briefly, with respect to IRBS, the u~ leallluntr~n~l~ted region of the immunoglobulin heavy chain binding protein has been shown t~ support the internal engagement of a bicistronic message (Jacejak et al., Nature 3 3:90, 1991). This sequence is small, approximately 300 base pairs, and may readily be incorporated into a vector in order to express multiple genes from a multi-cistronic message whose cistrons begin with this sequence.
Where the recombinant vector construct is carried by a virus, such constructs are prepared by inserting sequences of a virus cont~ining the promoter, splicing, and polyadenylation signals into plasmids cont~ining the desired gene of interest using methods well known in the art. The recombinant viral vector cont~ining the gene of interest can replicate to high copy number after transduction into the target tissue cells.
Subsequent to plepd~dLion of the recombinant vector construct, it may be preferable to assess the ability of vector transformed cells to down regulate MHC
antigen p. esentation. In general, such ~cses~ments may be performed by Western blot, FACS ana,ysis, or b other methods recognized by those skilled in the art.
Wit.~n preferred embodiments. the recombinant vector construct is carried by a retrovirus. Retroviruses are R~- viruses with a single positive strand genome which in general, are nonlytic. ~ pon infection, the retrovir~s reverse transcribes its RNA into DNA, forming a provirus which is inserted into the host cell genome. Preparation of retroviral constructs for use in the present invention isdescribed in greater detail in an application entitled "Recombinant Retroviruses"
(U.S.S.N. 07/586,603, filed September 21, 1990) herein incorporated by reference. The PCI`/US94/09957 WO 95/06717 ~ ;~L 5:89 33 retroviral genome can be divided conceptually into two parts. The "trans-acting"portion consists of the region coding for viral structural proteins, including the group specific antigen (gag) gene for synthesis of the core coat proteins; the pol gene for the synthesis of the reverse transcriptase and integrase enzymes; and the envelope (env) 5 gene for the synthesis of envelope glycoproteins. The "cis-acting" portion consists of regions of the genome that is finally packaged into the viral particle. These regions include the p~c~ing signal, long terrnin~l repeats (LTR) with promoters and polyadenylation sites, and two start sites for DNA replication. The internal or "trans-acting" part of the cloned provirus is replaced by the gene of interest to create a "vector 10 construct". When the vector construct is placed into a cell where viral packaging proteins are present (see U.S.S.N. 07/800,921), the transcribed RNA will be packaged as a viral particle which, in turn, will bud off from the cell. These particles are used to transduce tissue cells, allowing the vector construct to integrate into the cell genome.
Although the vector construct express its gene product, the virus carrying it is15 replication defective because the trans-acting portion of the viral genome is absent.
Various assays may be utilized in order to detect the presence of any replication competent infectious retrovirus. One preferred assay is the extended S+L- assay described in Example 9. Preferred retoviral vectors include murine leukemia amphotropic or xenotropic, or VsVg pseudotype vectors (see WO 92/14829; and 20 U.S.S.N. 08/ to be assi~ned bv PTO incorporated herein bv reference).
Recombinant vector constructs may also be developed and utilized with a variety of viral carriers including, for example, poliovirus (Evans et al., Nature 339:385, 1989, and Sabin et al., J. of Riol. Standardization 1:115, 1973) (ATCC VR-58); rhinovirus (Arnold et al., J. Cell. Biochem. L401, 1990) (ATCC VR-1110); pox 25 viruses, such as canary pox virus or vaccinia virus (Fisher-Hoch et al., PNAS 86:317, 1989; Flexner et al., Ann. N.Y. Acad. Sci. 569:86, 1989; Flexner et al., Vaccine 8:17, 1990; U.S. 4,603,112 and U.S. 4,769,330; WO 89101973) (ATCC VR-l l l; ATCC VR-2010); SV40 (Mulligan et al., ~ature ~:108, 1979) (ATCC VR-305), (Madzak et al.,J.Gen. Vir. 73:1533, 1992); influen~ virus (Luytjes et al., Cell 59:1107, 1989;
30 McMicheal et al., The New Fr~l~nd Journal of Medicine ~Q:13, 1983; and Yap et al., ~ature ~1~:238, 1978) (ATCC VR-797); adenovirus (Berkner et al., Biotechniques 6:616, 1988, and Rosenfeld et al., Science ~:431, 1991) (ATCC VR-l); parvovirus such as adeno-associated virus (Samulski et al., J. Vir. 63:3822, 1989, and Mendelson et al., V;rolo~,v 166:154, 1988) (ATCC VR-645); herpes simplex virus (Kit et al., 35 Exp. Med. Biol. ~1~:219, 1989) (ATCC VR-977; ATCC VR-260?; ~ature 277: 108, 1979); HIV (EPO 386,882, Buchschacher et al., L Vir. 66:2731, 1992); measles virus ~5a933 8 (EPO 440,219) (ATCC VR-24); Sindbis virus (Xiong etal., Science ~:1188, 1989) (ATCC VR-68); and coronavirus (Hamre et al., Proc. Soc. Fxp. Riol. Med. 121:190,1966) (ATCC VR-740). It will be evident to those in the art that the viral carriers noted above may need to be modified to express proteins, ~nti~n~e messages or ribozymes 5 capable of inhibiting MHC antigen presentation.
Once a vector construct has been prepared, it may be used to transform isolated tissue cells through a variety of routes. More specifically, naked DNA or a recombinant viral vector construct co~ -g a gene that codes for a protein or active portion of a protein, an ~nti~çn~e message or ribozyme capable of inhibiting MHC10 antigen pres~nt~tion, may be introduced into tissue cells removed from a donor using physical methods or through the use of viral or retroviral vectors as discussed herein.
Ex vivo procedures for physical and chemical methods of uptake include calcium phosphate plecil,italion, direct microinj~çtion of DNA into intact target cells, and electroporation wherebv ~ells suspended in a conducting solution are subjected to 15 an intense electric field in c r to transiently polarize the membrane, allowing entry of macromolecules. Other pro. dures include the use of DNA bound to ligand, DNA
linked to an inactive adenovirus (Cotton et al., PNAS 89: 6094, 1990), bombardment with DNA bound to particles, liposomes entrapping recombinant vector construct.
spheroplast fusion whereby E. coli COll~ g recombinant viral vector constructs are 20 stripped of their outer cell walls and fused to animal cells using polyethylene glycol and viral transduction, (Cline et al., Pharmac. Ther. ~:69, 1985; and Frie~im~nn et al., Science ~:1275, 1989). Alternatively, as noted above, the vector construct may be carried by a virus such as vaccinia, Sindbis or corona virus. Further, methods for ~tlmini~tering a vector construct via a retroviral vector are described in more detail in an 25 application entitled "Recombina... Retroviruses" (U.S.S.N. 07/586,603) herein incorporated by reference.
In an e.~- vivo context, the transformed cells are transplanted into the animal, and monitored for gene expression as described in Examples 15. Protocols vary depending on the tissue cells chosen. Briefly, a recombinant vector construct carrying a 30 sequence, the expression of which inhibits MHC class I presentation, is transformed into tissue cells. Preferable 105 to 109 tissue cells are transformed. The cells are cultured, and transformed cells may be selected by antibiotic resistance. Cells are assayed for gene expression by Western blot and FACS analysis, or other means. For example, as described in more detail below, bone marrow cells that have been 35 transformed are tr~splanted in an animal by intravenous ~-imin-~tration of 2 to 3 x 107 cells (see WO 93/00051).

2 1 ~ ~ 9 ~ 3 PCT/US94/09957 Cells that can be transformed include, but are not limited to, fibroblast cells, bone marrow cells, endothelial cells, keratinocytes, hepatocytes, and thyroid follicular cells. Tla~ led cells may be ~(lmini~tered to patients directly by intramuscular, intra~lçrm~l, subdermal, intravenous, or direct catheter infusion into 5 cavities of the body. In vivo gene ex~lession of tr~n~ ced bone marrow cells is detected by monitoring hematopoesis as a function of hematocrit and Iymphocyte production.
It will be evident to those skilled in the art that isolated pancreatic islet cells can also be transformed as described above. Such transformed cells may then be 10 transplanted into recipients by injection through the gastro-epiploic artery. In vivo gene expression of insulin is observed by monitoring blood glucose levels.
As discussed above, the present invention provides methods and compositions suitable for inhibiting MHC antigen presentation in order to suppress the immune response of the host. Briefly, CTL are specifically activated by the display of 15 processed peptides in the context of self MHC molecules along with accessory molecules such as CD8, intercellular adhesion molecule -1 (ICAM-1), ICAM-2, ICAM-

3, leukocyte functional antigen-1 (LFA-1) (Altmann et al., Nature 338:521, 1989), the B7/BB1 molecule (Freeman et al., J. Tmmunol 143:2714, 1989), LFA-3 (Singer, Science ~:1671, 1992; Rao, Crit. Rev. Tmmunol. 10:495, 1991), or other cell 20 adhesion molecules. Antigenic peptide presentation in association with MHC class I
molecules leads to CTL activation. Transfer and stable integration of specific sequences capable of ~x~le;,~ g products expected to inhibit MHC antigen presentation block activation of T-cells, such as CD8 CTL, and therefore suppress graft rejection.
A standard CTL assay is used to detect this response as described in more detail in 25 Example 13. Components of the antigen presentation pathway include the 45Kd MHC
class I heavy chain"B2-microglobulin, proces~ing enzymes such as proteases, accessory molecules, chaperones, and transporter proteins such as PSF 1.
Within one aspect of the present invention, vector constructs are provided which direct the expression of a protein or active portion of a protein capable 30 of inhibiting MHC class I antigen presentation. Within the present invention, an "active portion" of a protein is that fragment of the protein which must be retained for biological activitv. Such fragments or active domains can be readily identified by systematically removing nucleotide sequences from the protein sequence, transforming target cells with the resulting recombinant vector construct, and determining MHC class 35 I presentation on the surface of cells using FACS analysis or other immunological assays, such as a CTL assay. These fragments are particularly useful when the size of 9~3 the sequence encoding the entire protein exceeds the capacity of the viral carrier.
Alternatively, the active domain of the MHC antigen l"ese~ tion inhibitor protein can be enzymatically digested and the active portion purified by biochemical methods. For example, a monoclonal antibody that blocks the active portion of the protein can be used to isolate and purify the active portion of the cleaved protein (Harlow et al., .~ntibodies: A T.~horatory Manual, Cold Springs Harbor, 1988).
Within one embodiment, the recombinant vector construct directs the expression of a protein or active portion of a protein that binds to newly synthesized MHC class I molecules intracellularly. This binding prevents migration of the MHC
class I molecule from the endoplasmic reticulum, resulting in the inhibition of t~rmin~l glycosylation. This blocks transport of these molecules to the cell surface and prevents cell recognition and lysis by CTL. For instance, one of the products of the E3 gene may be used to inhibit transport of MHC class I molecules to the surface of the transformed cell. More specifically, E3 encodes a l9kD tr~ncmemhrane glycol~oteill, E3/19K, transcribed from the E3 region of the adenovirus 2 genome. Within the context of the present invention, tissue cells are transformed with a recombinant vector construct co.-t~inil-g the E3/19K sequence, which upon ~l"es~ion produces the E3/19K protein.
The E3/19K protein inhibits the surface exl"cssion of MHC class I surface molecules, and cells transformed by the vector construct evade an immune response. The construction of a representative recombinant vector construct in this regard is presented in Example 2. Consequently, donor cells can be transplanted with reduced risk of graft rejection and may require only a minim~l immlm~ul"es~ e regimen for the transplant patient. This allows an acceptable donor-recipient chimeric state to exist with fewer complications.
Within another embodiment of the present invention, the recombinant vector construct directs the expression of a protein or an active portion of a protein capable of binding ~-microglobulin. Transport of MHC class I molecules to the cell surface for antigen presentation requires associat:-~n with ~2-microglobulin. Thus, proteins that bind ~2-microglobulin and inhibit its association with MHC class Iindirectly inhibit MHC class I antigen presentation. Suitable proteins include the H301 gene product. Briefly, the H301 gene, obtained from the human cytomegalovirus (CMV) encodes a glycoprotein with sequence homology to the ,B2-microglobulin binding site on the heavy chain of the MHC class I molecule (Browne et al., Nature 347:770, 1990). H301 binds ~2-microglobulin, thereby preventing the maturation of MHC class I molecules, and renders transformed cells unrecognizable by cytotoxicT-cells, thus evading MHC class I restricted immune surveillance.

213~933 Other proteins, not discussed above, that function to inhibit or down-regulate MHC class I antigen plcsell~ation may also be identified and utilized ~vithin the context of the present invention. In order to identify such proteins, in particular those derived from m~mm~ n pathogens (and, in turn, active portions thereof), a 5 recombinant vector construct that eA~,esses a protein or an active portion thereof suspected of being capable of inhibiting MHC class I antigen presentation is transformed into a tester cell line, such as BC. The tester cell lines with and without the sequence encoding the candidate protein are comya~ed to stimulators and/or targets in the CTL assay. A decrease in cell Iysis corresponding to the transformed tester cell 10 indicates that the candidate protein is capable of inhibiting MHC presentation.
An alternative method to determine down-regulation of MHC class I
surface expression is by FACS analysis. More specifically, cell lines are transformed with a recombinant vector construct encoding the candidate protein. After drug selection and expansion, the cells are analyzed by FACS for MHC class I expression 15 and compared to that of non-transformed cells. A decrease in cell surface ~Al,r~ssion of MHC class I indicates that the c~n.lid~te protein is capable of inhibiting MHC
pres~ont~tion (see, for instance, Example 12).
Within another aspect of the present invention, methods are provided for suppressing graft rejection by transforming tissue cells with a recombinant vector 20 construct which transcribes an ~nticPnce message capable of inhibiting MHC class I
antigen presentation. Briefly, oligonucleotides with nucleotide sequences complement~ry to the protein coding or "sense" sequence are termed "antisense".
Antisense RNA sequences function as regulators of gene expression by hybridizing to complementary mRNA sequences and arresting translation (Mizuno et al., PNAS
25 81:1966, 1984; Heywood et al., Nucleic Acids Res. 14:6771, 1986). ~nticen~e molecules comprising the entire sequence of the target transcript or any part thereof can be syntht ci7ed (Ferretti et al., PNAS 83:599, 1986), placed into vector constructs, and effectively introduced into cells to inhibit gene ~ sion (Izant et al., Cell 36:1007, 1984). In addition, the synthesis of ~nticence RNA (asRNA) from DNA cloned in 30 inverted orientation offers stability over time while constitutive asRNA ~ies~ion does - not interfere with normal cell function.
Within one embodiment of the present invention, the recombinant viral vector construct transcribes an ~nticence message capable of binding to a conserved region of the MHC class I transcripts, thereby inhibiting cell surface expression and 35 MHC class I antigen presentation. One may identify such conserved regions through computer-assisted comparison of sequences representing different classes of MHC

?~, ~5~3 12 genes (for exarnple, HLA A, B and C), available within ~ sequence ~l~t~b~nk~ (e.g., Genbank). Conserved sequences are then identifi~ Irough computer-assisted ~lignment for homology of the nucleotide sequences. he conserved region is a sequence having less than 50% mi~m~tch, preferably less than 20% micm~tch, per 100 base pairs bet~veen MHC class I genotypes.
Within another embodiment of the present invention, the recombinant vector construct transcribes an antisense message ~ onsible for binding to ~2-microglobulin transcript. This binding prevents translation of the ~2-microglobulin protein and thereby inhibits proper assembly of the MHC class I molecule complexnecessary for cell surface expression. Within a preferred embodiment, the nucleotide sequence for ~2-microglobulin is cloned into a vector construct in the reverse orientation. The proper ~nti~n~e orientation may be determined by restriction enzvme analysis.
Within still another embodiment of the present invention, the recombinant vector construct transcribes an ~nti~n.ce message responsible for binding PSF1 transcript, a peptide tran~?orter protein. Since this protein is necessary for the efficient assembly of MHC clas; 3 ;nolecules, such an antisense blocks the transport of processed antigenic peptide fra~ments to the endoplasmic reticulum (ER) prior toassociation with the MHC class I molecular complex. Within a preferred embodiment, the nucleotide sequence for the ~nti~en~e PSF1 is prepared and inserted in reverse orientation into the vector construct and detPrrnin~-l by restriction enzyme analysis.
Ai discussed above, the sequences of other proteins involved in antigen presentation may also be identified, and used to design a recombinant vector construct capable of transcribing an antisense RNA message that inhibits MHC antigen presentation. More specifically, the nucleotide sequence of the gene encoding the protein is examined, and the identified sequence is used to synth~si7P an a~plop,iate ~nti.~ence message. It is preferable to use a sequence complimentary to a portion u~ e~ll or close to the start sequence of the target message. This allows the antisense sequence to bind to the mRNA preventing translation of a significant portion of the protein. Examples of such molecules are ICAM-1, ICAM-2, ICAM-3, LFA-1, LFA-3, and B7/BB1. Down-regulation of MHC class I e~l,lession or antigen presentation may be assayed by FACS analysis or CTL assay, respectively, as described in Exarnples 14 and 15 or by other means as described above for proteins capable of inhibiting MHC
class I presentation.
Within another aspect of the present invention, a method is provided for suppressing an imrnune response within an animal by transforrning selected cells of the ~13~9~

animal with a recombinant vector construct which transcribes a ribozyme responsible for the enzymatic cleavage of a component involved in the MHC antigen pl~,se~ Lion.
Briefly, ribozymes are RNA molecules with enzymatic cleaving activity which are used to digest other RNA molecules. They consist of short RNA molecules posses~ing 5 highly conserved sequence-specific cleavage domains flanked by regions which allow accurate positioning of the enzyme relative to the potential cleavage site in the desired target molecule. They provide highly flexible tools in inhibiting the expression and activation of specific genes (Haseloff et al., ~ature ~g:585, 1988). Custom ribozymes can easily be designed, provided that the transcribed sequences of the gene are known.
10 Specifically, a ribozyme may be designed by first choosing the particular target RNA
sequence and ~tt~r.hing complimentary sequences to the beginning and end of the ribozyme coding sequence. This ribozyme producing gene unit can then be insertedinto a recombinant vector construct and used to transform tissue cells. Upon expression, the target gene is neutralized by complimentary binding and cleavage, 15 guar~nteeing permanent inactivation. In addition, because of their enzymatic activity, ribozymes are capable of destroying more than one target.
Within one embodiment of the present invention, recombinant vector construct cont~ining specific ribozymes are used to cleave the transcript of a conserved region of the MHC class I molecule in order to inhibit antigen presentation. Within 20 another embodiment of the present invention, the recombinant vector constructtranscribes a ribozyme responsible for the enzymatic cleavage of the ~2-microglobulin transcript. Specifically. a ribozyme with fl~nking regions complimentary to a sequence of the ~2-microglobulin message cleaves the transcript, thereby preventing protein translation and proper assembly of the MHC class 1 molecule complex. This inhibits 25 transport of the MHC class I complex to the cell surface, thereby suppressing antigen pres~nt~tion.
Within still another embodiment of the present invention, the recombinant vector construct transcribes a ribozyme responsible for the enzymatic cleavage of the PSF1 transcript, thereby suppressing cell surface ~fession of MHC
30 class I molecules and preventing antigen presentation. Specifically, a ribozyme designed with fl~nking regions complimentary to a sequence of the PSF1 message cleaves the transcripts and inhibits transport of peptides to the ER, thereby preventing assembly of the MHC class I complex and antigen presentation.
It will be evident to those skilled in the art that the sequences of other 35 proteins involved in MHC antigen presentation (see above) can be identified and used to design a recombinant vector construct capable of transcribing a ribozyme that inhibits MHC antigen presentation. Down regulation of MHC class I ~lcssion or antigen prese~t~tion may be assayed by CTL analysis, respectively, or other means as described above for proteins capable of inhibiting MHC class I presentation.
Within another aspect of the invention, multivalent recombinant vector S constructs are provided. Briefly, the efficienc~ of ~u~ ssing an autoimmune response can be enhanced by tran~ro-l~ g cells with a multivalent recombinant vector construct.
Upon c;~lession~ the gene products increase the degree of interference with MHC
antigen presentation by ~tt~king a single component via two different routes or two different components via the same or different routes. The construction of multivalent 10 recombinant vector constructs may require two promoters because one promoter may not ensure adequate levels of gene ~lcssion of the second gene. A second promoter, such as an int~rn~l ribzome binding site (IRBS) promoter, or herpes simplex virus thymidine kinase (HSVTK) promoter placed in conjunction with the second gene of interest boosts the levels of gene expression of the second gene.
Within pl~r~ d embo~limentc, the vector construct expresses or transcribes at least two of the fc .~wing components in any combination: (a) a protein or ^ ve portion of the proteins E3/19K or H301; (b) an antisense message that binds th~ nscript of a conserved region of the MHC class I heavy chain, ~2-microglobulin or PSFl transporter protein; and (c) a ribozyme that cleaves the transcript of the 20 proteins listed in (b) above. In addition, multivalent recombinant vector constructs are provided which e~press two proteins or active portions of proteins as described herein, two antisense messages, or two ribozymes.
Within related embodirnents, a number of specific combinations may be utilized to form a multivalent recombinant vector construct. For example, a multivalent 25 recombinant vector construct may consist of a gene expressing E3/19K or H301 in combination with the antisense or ribozyme message for a conserved region of theMHC class I heavy chain, ~2-microglobulin, or PSF1 transporter protein.
Within another aspect of the present invention, pharmaceutical compositions are provided comprising one of the above described recombinant vector 30 constructs or a recombinant virus carrying the vector construct, such as a retrovirus, poliovirus, rhinovirus, vaccinia virus,- influenza virus, adenovirus, adeno-associated virus, herpes simplex virus, SV40, HIV, measles virus, coronavirus or Sindbis virus, in combination with a carrier or diluent. The composition may be prepared either as a liquid solution, or as a solid form (e.g., Iyophilized) which is suspended in a solution 35 prior to transforming tissue cells ex vivo.

W O 95/06717 21~ PCTrUS94/09957 In addition, the approach described herein may be used in vivo to arrest or ameliorate rejection of previously engrafted tissue. In this regard, the composition may be ~e~ ed with phztrm~ceutically acceptable suitable carriers or diluents for injection or other means al~pro~liate to the carrier. Generally, the recombinant virus 5 carrying the vector construct is purified to a concentration ranging from 0.25% to 25%, and preferably about 5% to 20%, before formulation. Subsequently, after ple~dlion of the composition, the recombinant vector will constitute about 10 ng to 1 ~g of material per dose, with about 10 times this amount of m~ten~l present as copurified co~ nt~ Preferably, the composition is prepared in 0.1-1.0 ml of aqueous 10 solution formulated as described below.
Ph~rm~ceutically acceptable carriers or diluents are those which are nontoxic to recipients at the dosages and concentrations employed. Representative examples of carriers or diluents for injectable solutions include water, isotonic solutions which are preferably buffered at a physiological pH (such as phosphate-buffered saline 15 or Tris-buffered saline) and co~ti.it~ing one or more of mannitol, lactose, trehalose, dextrose, glycerol and ethanol, as well as polypeptides or proteins such as human serum albumin (HSA). One suitable composition comprises a recombinant virus carrying avector construct in 10 mg/ml mannitol, 1 mg/ml HSA, 20mM Tris pH=7.2 and 150mM
NaCl. In this case, since the recombinant virus carrying the vector construct rel)lesel,L~
20 approximately 10 ng to 1 ~lg of material, it may be less than 1% of the total high molecular weight material, and less than 1/100,000 of the total material (including water). This composition is generally stable at -70C for at least six months. It will be evident that substantially equivalent dosages of the multivalent recombinant vector construct may be l~rc~d. In this regard, the vector construct will constitute 100 ng to 25 100 ug of material per dose, with about 10 times this amount of m~teri~l present as copurified collL;...~ nt~. For recombinant viruses carrying the vector construct, the individual doses normally used are 106 to 1010 c.u. (e.g., colony forming units of neomycin resistance titered on HT1080 cells). These compositions are ~rlmini~tered at one- to four-week intervals for three or four doses (at least initially). Subsequent 30 booster shots may be given as one or two doses after 6-12 months, and thereafter annually.
The following examples are offered by way of illustration and not by way of limitation.

Qi6?~3 16 (TRANSPLANTATION - GRAFT REJECTION) F.XA~MPT .F

Fxam~le 1 PREPARATION OF MURINE RETROVIRAL PROVECTOR DNA

A. PREPARATION OF RETROVIRAL BACKBONE KT-3B
The Moloney murine leukemia virus (MoMLV) 5' long tçrmin~l repeat (LTR) EcoR I-EcoR I fragment, including gag sequences, from N2 vector (Armentanoet al., J. Vir. 61:1647, 1987, Eglitas et al., Science 230:1395, 1985) in pUC31 plasmid is ligated into the plasmid SK+ (Stratagene, San Diego, CA). The resulting construct is 15 called N2R5. The N2R5 construct is mutated by site-directed in vi~ro mutagenesis to change the ATG start codon to An preventing gag ~ es~ion. This mutagenized fragment is 200 base pairs (bp) in length and flanked by Pst I restriction sites. The Pst I-Pst I mutated fragment is purified from the SK+ plasmid and inserted into the Pst I site of N2 MoMLV 5' LTR in plasmid pUC31 to replace the non-mutated 200 bp fr~gm~nt 20 The plasmid pUC31 is derived from pUCl9 (Stratagene, San Diego, CA) in ~ ich additional restriction sites Xho I, Bgl II, BssH II and Nco I are inserted betv~ ~n the EcoR I and Sac I sites of the polylinker. This construct is called pUC31/N2R5g~l.
The 1.0 kilobase (Kb) MoMLV 3' LTR EcoR I-EcoR I fragment from N2 was cloned into plasmid SK+ resulting in a construct called N2R3-. A 1.0 Kb Cla I-25 Hind III fragment is purified from this construct.
The Cla I-Cla I dominant selectable marker gene fragment from pAFVXM retroviral vector (Kriegler et al., ~11 ~483, 1984, St. Louis et al., PNAS
85:3150, 1988), comprising a SV40 early promoter driving expression of the neomycin phosphotransferase gene, is cloned into plasmid SK+. A 1.3 Kb Cla I-BstB I gene 30 fragment is purified from the SK+ plasmid. This fragment, with the 3' LTR Cla I-Hind III fragment and the 5' LTR in pUC31/N2RSgM make up the KT-3B backbone.
An alternative selectable marker, phleomycin resistance (Mulsant et al., Som. Cell and Mol. Gen. 14:243, 1988, available from Cayla, Cedex, FR) may be used to make the retroviral backbone KT-3C, for use in transforming genes to cells that are 35 already neomycin resistant. The plasmid pUT507 (Mulsant et al., Som. Cell and Mol.
~, l4:243, 1988, available from Cayla, Cedex, FR) is digested withNde I and the W O 95/06717 ~ 3 3 PCT~US94/099S7 ends blunted with Klenow polymerase I. The sample is then further digested with Hpa I, Cla I linkers ligated to the mix of fr~gm~ntc and the sample further digested with Cla I. The excess Cla I linkers are removed by digestion with Cla I and the 1.2 Kb Cla I
fragment carrying the RSV LTR and the phleomycin resistance gene isolated by 5 agarose gel electrophoresis followed by purification using Gene Clean (BiolO1, San Diego, CA). This fragment is used in place of the 1.3 Kb Cla I-BstB I neomycin resistance fragment to give the backbone KT-3C.
The ~Aplession vector is constructed by a three part ligation in which the Xho I-Cla I fragment cot~ g the gene of interest and the l.0 Kb MoMLV 3' LTR
10 Cla I-Hind III fragment are inserted into the Xho I-Hind III site of pUC31/N2R5gM
plasmid. The 1.3 Kb Cla I-BstB I neo gene, or 1.2 Kb Cla I phleomycin, fragment is then inserted into the Cla I site of this plasmid in the sense orientation.

Fxample '~
A. CLONING OF E3/19K GENE INTO KT-3B

i. ISOLATION AND PURIFICATION OF ADENOVIRUS

The isolation and purification of adenovirus is described by Green et al., Methods in Enzymolo~y 58: 425, 1979. Specifically, five liters of Hela cells (3-6 x 105 cells/ml) are infected with 100-500 plaque forrning units (pfu) per ml of adenovirus type 2 (Ad2) virions (ATCC VR-846). After incubation at 37C for 30-40 hours, the cells are placed on ice, harvested by centrifugation at 230g for 20 minutes at 4C, and resuspended in Tris-HCl buffer (pH 8.1). The pellets are mechanically disrupted by sonication and homogenized in trichlorotrifluoroethane prior to centrifugation at 1,000g for 10 min. The upper aqueous layer is removed and layered over 10 mls of CsCl (1.43 g/cm3 ) and centrifuged in a SW27 rotor for 1 hour at 20,000 rpm. The opalescent viral band is removed and adjusted to 1.34 g/cm3 with CsC1 and further centrifuged in a Ti 50 rotor for 16-20 hours at 30,000 rpm. The visible viral band in the middle of the gradient is removed and stored at 4C until purification of adenoviral DNA.

ii. ISOLATION AND PURIFICATION OF ADENOVIRUS DNA

The adenovirus band is incubated with protease for 1 hour at 37C to digest proteins. After centrifugation at 7,800g for 10 minutes at 4C, the particles are ~a933 18 solubilized in 5% sodium dodecyl sulfate (SDS) at room temperature for 30 .~ ".~es before being extracted with equal volumes of phenol. The upper aqueous phase is removed, re-extracted with phenol, extracted three times with ether, and dialyzed in Tris buffer for 24 hours. The viral Ad2 DNA is precipitated in ethanol, washed in ethanol, S and resuspended in Tris-EDTA buffer, pH 8.1. Approximately 0.5 mg of viral Ad2 DNA is isolated from virus produced in 1.0 liter of cells.
iii. ISOLATION OF E3/19K GENE

The viral Ad2 DNA is digested with EcoR I (New Fn~l~n~ Biolabs, Beverly, MA) and separated by electrophoresis on a 1% agarose gel. The resulting 2.7 Kb Ad2 EcoR I D fragments, located in the Ad2 coordinate region 75.9 to 83.4, cont~inin~ the E3/19K gene (Herisse et al., Nucleic Acids Research 8:2173, 1980,Cladaras et al., Virolo~v 140:28, 1985) are eluted by electrophoresis, phenol extracted, 15 ethanol precipitated, and dissolved in Tris-EDTA (pH 8.1).
iv. CLONING OF E3/19K GENE INTO KT-3B

The E3/19K gene is cloned into the EcoR I site of PUC 1813. PUC 1813 20 is p~e~ed as essenti~lly described by Kay et al., Nucleic Acids Research 15:2778, 1987 and Gray et al., pNAS 80:5842, 1983). The E3/19K is retrieved by EcoR I
digestion and the isolated fragIr 'lt is cloned into the EcoR I site of phosphatase-treated pSP73 plasmid, (Promega, Madison, Wl). This construct is ~lesign~tecl SP-E3/19K. The orientation of the SP-E3/19K cDNA is verified by using ~pl~.pliate restriction enzyme 25 digestion and DNA sequencing. In the sense orientation, the 5' end of the cDNA is adjacent to the Xho I site of the pSP73 polylinker and the 3' end adjacent to the Cla I
site. The Xho I-Cla I fra8ment cu.~ ing the E3/19K cDNA in either sense or antisense orientation is retrieved from the SP-E3/19K construct and cloned into the Xho I-Cla I site of the KT-3B retroviral backbone. This construct is called KT-3B/E3/19K.
B. CLONING OF PCR AMPLIFIED E3/19K GENE INTO KT-3B
i. PCR AMPLIFICATION OF E3/19K GENE

The Ad2 DNA E3/19K gene, including the amino termin~l signal sequence, followed by the intraluminal domain and carboxy terminal cytoplasmic tail WO 95/06717 21 ~ 2 ~ 3 ~ PCT/US94109957 which allow the E3/19K protein to embed itself in the endoplasmic reticulum (ER), is located between viral nucleotides 28,812 and 29,288. Isolation of the Ad2 E3/19K gene from the viral genomic DNA is accomplished by PCR amplification, with the primerpair shown below:
s The îol~d primer corresponds to the Ad2 nucleotide sequences 28,812 to 28,835.
(Sequence ID No.
5'-3': TATATCTCCAGATGAGGTACATGATTTTAGGCTTG

The reverse primer corresponds to the Ad2 nucleotide sequences 29,241 to 29,213.(Sequence ID No.
5'-3': TATATATCGATTCAAGGCATTTTC l-l-l TCATCAATAAAAC

S In addition to the Ad2 complementary sequences, both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCT amplicon products. This sequence in the forward primer is followed by the Xho I
recognition site and by the Cla I recognition site in the reverse primer. Thus, in the 5' to 3' direction, the E3/1 9K gene is flanked by Xho I and Cla I recognition sites.
Amplification of the E3/19K gene from Ad2 DNA is accomplished with the followingPCR cycle protocol:

TemperatureC Time (min) No. Cycles 94 0.5 0.17 5 72 3.5 9~ 0.5 30 3.5 ii. LIGATION OF PCR AMPLIFIED E3/19K GENE INTO KT-3B
The E3/19K gene from the SK-E3/19K construct, approximately 780 bp in length, is removed and isolated by 1% agarose/TBE gel electrophoresis as described in Example 2Bi. The Xho I-Cla I E3/19K fragment is then ligated into the KT-3B
retroviral backbone. This construct is ~esign~tP~ KT-3B/E3/19K . It is amplified by 20 tran~rolmillg DH5a bacterial strain with the KT-3B/E3/19K construct. Specifically, the bacteria is transformed with 1-100 ng of ligation reaction mixture DNA. The transformed bacterial cells are plated on LB plates cont~ining ampicillin. The plates are incubated overnight at 37C, bacterial colonies are selected and DNA prepared from them. The DNA is digested with Xho I and Cla I. The expected endonuclease 25 restriction cleavage fragment sizes for plasmids co~ g the E3/19K gene are 780 and 1300 bp.

21 j8~33 C. CLONING OF SYNTHESIZED E3tl9K GENE INTO KT-3B

i. SYNTHESIS OF E3/19K GENE DNA

Chemical synthesis of synthetic DNA has been previously described (Caruthers et al., Methods in Fn7ymolo~y 211 :3, 1992). Sequences which encode the E3/19K gene are synth~ci7~ by the phosphotriester method on an Applied Biosystems Inc. DNA synthesizer, model 392 (Foster City, CA) using the PCR primers as the 5' and 10 3' limits and keeping the same Xho I and Cla I on the ends. Short oligonucleotides of a~ o2~ ately 14~0 nucleotides in length are purified by polyacrylamide gel electrophoresis and ligated together to form the single-stranded DNA molecule (Ferretti et al., PNAS 83 :599, 1986).

15 ii. SEQUENCING OF E3/19K GENE DNA

Fragments are cloned into the bacteriophage vectors M13mpl8 and M13mpl9 (GIBCP, Gaithersburg, MD) for amplification of the DNA. The nucleotide sequence of each fragment is determined by the dideoxy method using the single-20 stranded M13mpl8 and M13mpl9 recombinant phage DNA as templates and selectedsynthetic oligonucleotides as primers. This confirms the identity and said structural integrity of the gene.

iii LIGATION OF SYNTHESIZED E3/19K GENE INTO KT-3B
The E3/19K gene is ligated into the KT-3B or KT-3C vector as previously described in Example 2B ii.

2~5893~ 22 Fx~mr~le 3 CLONING OF AN ANTISENSE SEQUENCE OF A CONSERVED REGION OF

A. CONSTRUCTION OF KT3CneoaMHC

The cDNA clone of the MHC class I allele CW3 (Zemmour et al., Tissue ~ntiyens 39:249, 1992) is used as a template in a PCR reaction for the amplification of 10 specific sequences conserved across dirr~ human MHC haplotypes to be inserted of the KT-3B backbone vector, into the untr~n.~l~tPd region of the neomycin resistance gene.
The MHC class I allele CW3 cDNA is amplified between nucleotide sequence 147 to 1,075 using the following primer pairs:
The fol ~d primer corresponds to MHC CW3 cDNA nucleotide sequence 147 to 166:
(Sequence ID No.
5'-3': TATATGTCGACGGGCTACGTGGACGACACGC

20 The reverse primer corresponds to MHC CW3 cDNA nucleotide sequence 1,075 to 1,056:
(Sequence ID No. ~
5'-3': TATATGTCGACCATCAGAGCCCTGGGCACTG

In addition to the MHC class I allele CW3 complementary sequences, both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCR amplicon products. The buffer sequence is followed by the Hinc II recognition sequence in both primers. Generation of the MHC ampliconwith the primers shown above is accomplished using the PCR protocol described in30 section 2BiThis protocol is modified by using Vent polymerase (New Fngl~n~l Biolabs, Beverly, MA) and further modified to include 1 minute extension times instead of 3.5 minutes. The Vent polymerase generates amplicons with blunt ends.
Alternatively, the forward and reverse primers may contain only the MHC CW3 complementary sequences.
The MHC CW3 cDNA 950 bp amplicon product digested is purified with Gene Clean (BiolO1, San Diego, CA) and digested with Hinc II. The fr~gment, 21~3~

938 bp, is isolated by 1% agarose/TBE gel electrophoresis and purified with GeneClean.
The MHC CW3 cDNA 938 bp fragment is inserted in the 3' untr~ncl~tecl region of the neomycin resistance gene in the antisense orientation. Specifically, the Hinc II recognition sequence at nucleotide sequence number 676 of the pBluescript II
SK+ (pSK+) (Stratagene, San Diego, CA) plasmid is removed by digestion with Hinc II
and Kpn I. The Kpn I 3' end is blunted with T4 DNA polymerase and the blunt endsare ligated. This plasmid is ~lesign~te~l as pSKdlHII. As described in Example lA, the 1.3 Kb Cla I- Cla I dominant selectable marker gene fragment from pAFVXM retroviral vector is cloned into the Cla I site of pSKdlHII. This plasmid is ~lesign~te~l as pSKdlHII/SVneo. The MHC CW3 cDNA 938 bp fragment is inserted in an antisense orientation into the Hinc II site of pSKdlHII/SVneo located in the 3' untr~ncl~ted region of the neomycin resistance gene. Confinn~tion that the MHC CW1 cDNA 938 bp fragment is present in the neomycin gene in an antisense orientation is detennine~l by restriction endonuclease digestion and sequence analysis. This clone is designated as pSKdlHII/SVneo/aMHC .
Construction of KT3B/SVneo/aMHC is accomplished by a three way ligation, in which the Cla I 2.2 Kb SVneoaMHC fragment, and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from N2R3-, are inserted between the Cla I and Hind III
sites of pUC3 1/N2RSgM plasmid as described in Example 1.

B. CONSTRUCTION OF KT3C/SVneo/VARNA/aMHC

High level MHC CW3 ~nticenc~ RNA expression is accomplished by insertion of this sequence downstream of the Ad2 VARNA1 promoter. The Ad2 VARNA promoter-MHC ~ntic~once cDNA is assembled as a RNA polymerase III (pol III) expression cassette then inserted into the KT-3B or C backbone. In this pol III
expression cassette, the Ad2 VARNAl promoter is followed by the antisense aMHC
cDNA, which in turn is followed by the pol III consensus tennin~tion signal.
The double stranded -30/+70 Ad2 VARNA1 promoter is chemically synthesized (Railey et al., ~ol. Cell. Biol. 8:1147, 1988) and includes Xho I and Bgl II
sites at the 5' and 3' ends, respectively.

PCT~S94/099~7 ~933 The VARNAl promoter, forward strand:
(Sequence ID No.
5'-3': TCGAGTCTAGACCGTGCAAAAGGAGAGCCTGTAAGCGGGCACTCTTCC
GTGGTCTGGTGGATAAATTCGCAAGGGTATCATGGCGGACGACCGGGGT
TCGAACCCCGGA

The VARNAl promoter, reverse strand:
(Sequence ID No.
5'-3': GATCTCCGGGGTTCGAACCCCGGTCGTCCGCCATGATACCCTTGCGAA
TTTATCCACCAGACCACGGAAGAGTGCCCGCTTACAGGCTCTCCl-l-l-l GCACGGTCTAGAC

In order to form .. double stranded VARNAl promoter with Xho I and Bgl II cohesive ends, equal amounts of the single strands are mixed together in 10 mM
15 MgCl2, heated at 95C for S min then cooled slowly to room te~ e.~ e to allow the strands to anneal.
The MHC class I allele CW3 fragment, nucleotide sequence 653 to 854, from the plasmid pSKdlHII/SVneo/aMHC is amplified using the following primer palr:
The forward primer corresponds to nucleotide sequence 653 to 680:

5'-3': TATATCCTAGGTCTCTGACCATGAGGCCACCCTGAGGTG

25 The reverse primer colles~onds to nucleotide sequence 854 to 827:

5'-3': TATATAGATCTACATGGCACGTGTATCTCTGCTCTTCTC

In addition to the MHC class I allele CW3 complementary sequences, both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCR amplicon products. The buffer sequence is followed by the Avr II recognition sequence in the forward primer and by the Bgl II recognition sequence in the reverse primer, which allows insertion in an ~nti~çn~e orientation, relative to the Ad2 VARNAl promoter in the pol III ~s~ion cassette. Generation of the MHC amplicon with the primers discussed above is accomplished with the PCR

WO 95/06717 2 1 ~7: 8 9 3 3 protocol described in Example 2Bi modified to include 0.5 minute extension timesinstead of 3.5 minutes The MHC CW3 cDNA 223 bp amplicon product is purified with Gene Clean (BiolO1, San Diego, CA), then digested with AvrII and BglII, and isolated by 2%
5 NuSeive-1% a~arose/TBE gel eleckophoresis. The 211 bp band is then excised from the gel and the DNA purified with Gene Clean.
The double stranded pol III consensus tPnnin~tion sequence is chemically synthesi7Pd (Geiduschek et al., Annu. Rev. Biochem. 57:873, 1988) andincludes Avr II and Cla I sites at the 5' and 3' ends, respectively.
The pol III termination sequence, forward primer:
(Sequence ID No.
5'-3': CTAGGGCG(~'l"l''l"l''l'GCGCAT

15 The pol III termination sequence, reverse primer:
(Sequence ID No.
5'-3': CGATGCGCAAAAAGCGCC

In order to form the double stranded pol III transcription tPrrnin~tion 20 sequence with Avr II and Cla I cohesive ends, equal amounts of the single strands are mixed together in lO mM MgCl2, heated at 95C for 5 min then cooled slowly to room temperature to allow the strands to anneal.
The pol III expression cassette for antisense aMHC class I allele CW3 is assembled in a four way ligation in which the Xho I-Bgl II Ad2 VARNA1 promoter 25 fragment, the Bgl II-Avr II aMHC CW3 fragment, and the Avr II-Cla I transcription Snrnin~Sion fragment, are cloned into pSKII+ between the Xho I and Cla I sites. This construct is clesign~te~l pSK/VARNA/aMHC.
Construction of KT3B/SVneo/VARNA/aMHC is accomplished in a two step ligation. The first step is a three way ligation in which the Xho I-Cla I
30 VARNA/aMHC fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from - N2R3-, are inserted between the Xho I and Hind III sites of pUC3 1/N2R5gM plasmid as described in Example 1. This construct is design~ted KT3B/VARNA/aMHC. In the second ligation step the 1.3 Kb Cla I-BstB I SVneo fragment into the Cla I site of KT3B/VARNA/aMHC. This construct is design~ted KT3B/SVneo/VARNA/aMHC.

93~ 26 F.xample 4 CLONING A RIBOZYME THAT WILL CLEAVE A CONSERVED REGION OF

s A. CONSTRUCTION OF pSK/VARNA~MHCHRBZ

In order to efficiently inhibit e~iession of MHC class I in tr~n~ ce~l cells, a hairpin ribozyme with target specificity for the MHC class I allele is inserted 10 into the KT3B/SVneo vector. The ribozyme is expressed at high levels from the Ad2 VARNA1 promoter. The MHC hairpin r ~ ~7vme (HRBZ) is inserted into the pol III
pSK/VARNA/aMHC e~l,.es~ion isette ed in E~-~mple 3.
The HRBZ and the MHC j I allt CW3 have the homologous sequence shown below:
15 (Sequence ID No.
5'-3': GATGAGTCTCTCA -CG

The HRBZ is designed to cleave after the A residue in the AGTC hairpin substrate motif contained in the target sequence. Following cleavage, the HRBZ is recycled and able to hybridize to, and cleave, other MHC class I RNA molecule.
Double-stranded HRBZ as defined previously (Hampel et al., Nucleic Acids Research 18:299, 1990), co~ g a four base "tetraloop" 3 and an extended helix 4, with specificity for the MHC class I homologous sequence shown above, is chemically synthesi7P~l and includes Bgl II and Avr II sites at the 5' and 3' ends, respectively.

The MHC HRBZ, sense strand:
(Sequence ID No.
5'-3': GATCTCGATGAGAAGAACATCACCAGAGAAACACACGGACT
TCGGTCCGTGGTATATTACCTGGTAC

The MHC HRBZ. antisense strand:
(Sequence ID No.
5'-3': CTAGGTACCAGGTAATATACCACGGACCGAAGTCCGTGTGTT
TCTCTGGTGATGTTCTTCTCATCGA

~ '? ?' 6? f~ ~ .G PCTIUS94/09957 WO 95/06717 ~ J ,~

In order to form the double stranded MHC class I specific HRBZ with Bgl II and Avr II cohesive ends, equal amounts of the single strands are mixed together in 10 mM MgCI2, heated at 95C for 5 min then cooled slowly to room lelllpeldlLIre to allow the strands to anneal.
The pol III e~lession cassette for the MHC HRBZ is assembled by ligation of the chemically synthesized double stranded MHC class I specific HRBZwith Bgl II and Avr II cohesive ends into Bgl II and Avr II digested and CIAP treated pSK/VARNA/MHC~ in which the aMHC sequence has been removed from the pol III
expression vector. This plasmid is design~ted pSK/VARNA/MHCHRBZ and contains the Ad2 VARNA1 promoter followed by the MHC HRBZ, which in turn is followed by the pol III consensus terrnination sequence. The pol III expression components is flanked by Xho I and Cla I recognition sites.

B. CONSTRUCTION OF KT3B/SVneo/VARNA/MHCHRBZ
Construction of KT3B/SVneo/VARNA/MHCHRBZ is accomplished in a two step ligation. The first step is a three way ligation in which the Xho I-Cla I
VARNA/MHCHRBZ fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from N2R3-, are inserted between the Xho I and Hind III sites of pUC3 1/N2RSgM plasmid described in Example 1. This construct is design~ted KT3B/VARNA/MHCHRBZ. In the second step, the 1.3 Kb Cla I-BstB I SVneo fragment is ligated into the Cla I site of KT3B/VARNA/MHCHRBZ. This construct is cle~ign~ted KT3B/SVneo/VARNA/~IHCHRBZ.

Fxample 5 CLONING OF PSF1 ANTISENSE cDNA

A. CONSTRUCTION OF KT3C/SVneo/aPSF1 The cDNA clone of PSF1 (Spies et al., Nature 351:323, 1991; Spies et al., Nature ~:744, 1990) is used as a template in a PCR reaction for the amplification of specific sequences to be inserted into the KT-3B backbone vector, into the 35 untr~n~l~ttocl region of the neomycin resistant gene. The PSF1 cDNA is amplified between nucleotide sequence 91 to 1,124 using the following primer pairs:

~5~93~

The forward primer corresponds to nucleotide sequence 91 to 111:
(Sequence ID No.
5'-3': TATATGTCGACGAGCCATGCGGCTCCCTGAC

The reverse primer corresponds to nucleotide sequence 1,124 to 1,105:
(Sequence ID No.
5'-3': TATATGTCGACCGAACGGTCTGCAGCCCTCC

In addition to the PSFl complelnent~ry sequences, both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCR amplicon products. The buffer sequence is followed by the Hinc II recognition sequence in both primers. Generation of the PSFl amplicon with the primers discussed above is accomplished with the PCR protocol described in Example 2Bi. This protocol 15 is modified by using Vent polymerase (New F.n~l~n-l Biolabs, Beverly, MA) andfurther modified to include 1 minute extension times instead of 3.5 minutes The Vent polymerase generates amplicons with blunt ends.

B. CONSTRUCTION OF KT3B/SVneo/VARNA/aPSF1 High level PSF1 ~nticence expression is accomplished by insertion of this sequence downstream of the Ad ~:'ARNAl promoter. The Ad2 VARNA
promoter-PSFl antisense cDNA is first assembled as a pol III expression cacsette then inserted into the KT-3B backbone. In this pol III e~ ession c~Csette~ the Ad2 25 VARNAl promoter is followed by the antisense PSFl cDNA, which in turn is followed by the pol T~' consensus termination signal.
The nucleotide sequence 91 to 309 ofthe PSF1 cDNA are amplified in a PCR reaction using the following primer pair:

30 The forward primer corresponds to nucleotide sequence 91 to 111:
(Sequence ID No.
5'-3': TATATCCTAGGGAGCCATGCGGCTCCCTGAC

The reverse primer corresponds to nucleotide sequence 309 to 288:
35 (Sequence ID No. ~
5'-3': TATATAGATCTCAGACAGAGCGGGAGCAGCAG

WO 95tO6717 21~ ~ g 3 3 PCT/US94/09957 In addition to the PSFl complement~ry sequences, both primers contain a five nucleotide "buffer sequence" at their 5' ends for efficient enzyme digestion of the PCR amplicon products. The buffer sequence is followed by the Avr II recognition5 sequence in the forward primer and by the Bgl II recognition sequence in the reverse primer, which allows insertion in an ~nti~n~e orientation, relative to the Ad2 VARNAI
promoter in the RNA polymerase III ~ cssion cassette. Generation of the PSF1 amplicon with the primers described above is accomplished with the PCR protocol described in Example 2Bi modified to include 0.5 minutes extension times instead of 10 3.5 mimlt~c The MHC CW3 cDNA 240 bp amplicon product is purified with Gene Clean (BiolO1, San Diego, CA), then digested with Avr II and Bgl II, and isolated by 2% NuSeive-1% agarose/TBE gel electrophoresis. The 211 bp band is then excised from the gel and purified with Gene Clean.
Construction of KT3B/SVneo/VARNA/aPSF1 is accomplished in two step ligation. The first step is a three-way ligation in which the Xho I-Cla I
VARNA/aPSF1 fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from N2R3-, are inserted between the Xho I and Hind III sites of pUC31/N2R5gM
plasmid as described in Example 1. This construct is ~le~ign~ted as 20 KT3B/VARNA/aPSF1. In the second ligation step, the 1.3 kb Cla I-BstB I SVneo fragment is ligated into the Cla I site of KT3B/VARNA/aPSF1. This construct is designated KT3B/SVneo/VARNA/aPSFl.

Fxample 6 CLONING A RIBOZYME THAT WILL CLEAVE A CONSERVED REGION

A. CONSTRUCTION OF pSK/VARNA/PSFlHRBZ
In order to efficiently inhibit expression of PSF1 in transduced cells, a hairpin ribozyme with target specificity for the PSF 1 RNA is inserted into the KT3B/SVneo vector. The ribozyme is expressed at high levels from the Ad2 VARNA1 promoter. The PSF 1 hairpin ribozyme (HRBZ) is inserted into the pol III
35 pSK/VARNA/aMHC expression cassette described in Example 3. The PSFl HRBZ-pol III ~ cssion cassette is then inserted into the KT3B/SVneo backbone vector.

3~

The HRBZ and the PSF1 RNA have the homologous sequence shown below:
(Sequence ID No.
5'-3': GCTCTGTCTGGCCAC

The HRBZ is designed to cleave after the T residue in the TGTC hairpin substrate motif contained in the target sequence. Following cleavage, the HRBZ is recycled and able to hybridize to, and cleave, other PSF1 RNA molecule.
Doub~-stranded HRBZ as defined previously (Hampel et al., Nucleic 10 Acids Research 18:~79, 1990), cont~ining a four base "tetraloop" 3 and an extended helix 4, with specificity for the PSF1 homologous sequence shown above, is chemically synth~si7e~ and includes Bgl II and Avr II sites at the 5' and 3' ends, respectively.

The PSFl HRBZ, sense strand:
15 (Sequence ID No.
5'-3': GATCTGTGGCCAGACAGAGCACCAGAGAAACACACGGACTTCGG
TCCGTGGTATATTACCTGGTAC

The PSF1 HRBZ, antisense strand:
20 (Sequence IDNo.
5'-3': CTAGGTACCAGGTAATATACCACGGACCGAAGTCCGTGTGTT
TCTCTGGTGCTCTGTCTGGCCACA

In order to form the double stranded PSF1 specific HRBZ with Bgl II
25 and Avr II cohesive ends, equal amounts of the single strands are mixed together in 10 mM MgC12 heated at 95C for S min then cooled slowly to room te~ e~ e to allow the strands to anneal.
The pol III expression cassette for the PSF1 HRBZ is assembled by ligation of the chemically synthesized double stranded PSF 1 specific HRBZ with Bgl II
30 and Avr II cohesive ends into Bgl II and Avr II digested and CIAP treated pSK/VARNA/aMHC, in which the aMHC sequence has been gel purified away from the pol III expression vector. This plasmid is design~ted pSK/VARNA/PSFlHRBZ
and contains the Ad2 VARNAl promoter followed by the PSFl HRBZ, which in turn is followed by the pol III consensus terrnination sequence. The pol III e~,ession 35 component is fla~ked by Xho I and Cla I recognition sites.

wo 95/06717 21 ~ ~i 9 ~ ~ PCT/US94/09957 B. CONSTRUCTION OF KT3BlSVneo/VARNAlPSFlHRBZ

Construction of KT3B/SVneolVARNA/MHCHRBZ is accomplished in a two step ligation. The first step is a three way ligation in which the Xho I-Cla I
5 VARNAlPSFlHRBZ fragment and the 1.0 Kb MoMLV 3' LTR Cla I-Hind III fragment from N2R3-, are inserted between the Xho I and Hind III sites of pUC3 1/N2RSgM plasmid as described in Example 1. This construct is ~le~ign~te(l KT3B/VARNA/PSFlHRBZ. In the second ligation step, the 1.3 Kb Cla I-BstB I SVneo fragment is ligated into the Cla I
site of KT3BlVARNAlPSFlHRBZ. This construct is designated 10 KT3BlSVneolVARNAlPSF 1 HRBZ.

Example 7 CONSTRUCTION OF THE MULTIVALENT RECOMBINANT RETROVIRAL

A variation of the retroviral vector KT3B-E311 9K can also be constructed con1~inin~ both the E3/1 9K sequences and anti-sense sequences specific for a conserved region between the three class I MHC alleles A2, CW3 and B27, Examples 2 and 3. This vector, known as KT3B-E3/19K/aMHC, is designed to incorporate the MHC class I anti-sense sequences at the 3' end of the E3/19K sequence which would be expressed as a chimeric molecule. The retroviral vector, KT3B-E3/1 9KlaMHC, can be constructed by lig~ting a Cla I digested PCR amplified product CO1~t~;"i-~g the MHC
anti-sense sequences into the Cla I site of the KT3B-E3119K vector. More specifically, the cDNA clone of the MHC class I allele CW3 (Zemrnour et al., Ti.~ nt~e~c 39:249, 1992) is amplified by PCR between nucleotides 653 and 854 using the following primer pair:

The forward primer of aMHC is:
(Sequence ID No.
5'-3': ATTATCGATTCTCTGACCATGAGGCCACCCTGAGGTG

The reverse primer of aMHC is:
(Sequence ID No.
5'-3': ATTAATCGATACATGGCACGTGTATCTCTGCTCTTCTC

~,~5~9~

The primer pairs are flanked b~- Cla I restriction enzyme sites in order to insert an amplified Cla I digested product into the partially pre-digested KT3B-E3/19K
vector in the anti-sense orientation. By placing the Cla I fragment in the reverse orientation the vector will express the negative anti-sense strand upon transcription.

Fxarnple 8 TRANSDUCTION OF PACKAGING CELL LINE DA WITH THE

A. PLASMID DNA TRANSFECTION

293 2-3 cells (a cel! ne derived from 293 cells A~''C No. CRL 157-WO 92/05'66) 5 x 105 cells are seeded at approxirnately 50% ec. fluence on a 6 ~15 tissue culture dish. The following day, the media is replaced w. n 4 ml fresh media 4 hours prior to transfection. A standard calcium phosphate-DNA coprecipitation isperformed by mixing 10.0 llg ~f KT3B-E3/19K plasmid and 10.0 ~lg MLP G plasmid with a 2M CG-I2 solution, adding a lx Hepes buffered saline solution, pH 6.9, and incubating for 15 minufPs at room t~ dlule. The calcium phosphate-DNA
20 coprecipitate is transferred to the 293 2-3 cells, which are then incubated overnight at 37C, 5% CO2. The following morning, the cells are rinsed three times in lx PBS, pH
7Ø Fresh media is added to the cells, fc'!owed by overnight incubation at 37C, 10%
CO2. The following day, the media is coliected ` the cells and passed through a 0.45 ~ filter. This supem~t~nt is used to tr~nc.l~lee p~ ing and tumor cell lines. Tran,ient 25 vector supern~t~nt for other vectors are generated in a similar fashion.

B. PACKAGING CELL LINE TRANSDUCTION

DA cells (an amphotropic cell line derived from D-17 cells ATCC No.
30 183, WO 92/05266) are seeded at 5 x 105 cells/10 cm dish. Approximately 0.5 ml of the freshly collected 293 2-3 supern~t~nt (or supernatant that has been stored at -70 C) is added to the DA cells. The following day, G418 is added to these cells and a drug resistant pool is generated over a period of a week. This pool of cells is dilution cloned by adding 0.8 -1.0 cell per well of 96 well plates. Twenty-four clones are expanded to 35 24 well plates, then to 6 well plates, at which time cell supern~t~nt~ are collected fGr titering. DA clones are selected for vector production and e~lled DA-E3/19K. Vector WO 95/06717 2 1 5 8 ~ ~ 3 sup~rn~t~nts are collected from 10cm confluent plates of DA-E3/1 9K clones cultured in normal media CO~ polybrene or pluLall~ine sulfate. Alternatively, vector sUpern~t~nt can be harvested from bioreactors or roller bottles, processed and purified further before use.
For those vectors without a drug resistance marker or with a marker already in the p~ck~ging cell line, selection of stably tr~n~uced clones must beperformed by dilution cloning the DA tr~n.e(lucecl cells one to two days after transducing the cells with 293 2-3 generated supe~t~nt The dilution clones are then screened for the presence of E3/19K e,~ies~ion by using reverse transcription of10 messenger RNA, followed by amplification of the cDNA message by the polymerase chain reaction~ a procedure known as the RT-PCR A commercial kit for RT-PCR is available through Invitrogen Corp. (San Diego, CA). RT-PCR should be performed on clones which have been prop~g~tecl for at least 10 days and approximately 50 to 100 clones will need to be screened in order to find a reasonable number of stably 15 transformed clones. In order to perform RT-PCR, specific primers will be required for each message to be amplified. Primers designed to amplify a 401 bp product for E3/19K message screening are as follows:

Screening primers for E3/19K are:
20 (Sequence ID No.
5'-3': ATGAGGTACATGATTTTAGGCTTG

(Sequence ID No.
5'-3': TCAAGGCATTTTCTTTTCATCAATAAAAC
E~xam.ple 9 DETECTION OF REPLICATION COMPETENT RETROVIRUSES

The extended S+L- assay deterrnines whether replication competent, infectious virus is present in the supen ~t~nt of the cell line of interest. The assay is based on the empirical observation that infectious retroviruses generate foci on the indicator cell line MiCII (ATCC CCL 64.1). The MiCII cell line is derived from the MvlLu mink cell line (ATCC CCL 64) by transduction with Murine Sarcoma Virus 35 (MSV). It is a non-producer, non-transformed, revertant clone contz~ining a murine sarcoma provirus that forms sarcoma (S+) indicating the presence of the MSV genome PCT/US94/099~7 WO 9~/06717 ag ~!

but does not cause leukemia (L-) indicating the absence of replication competent virus.
Infection of MiCll cells with replication co.l.pele..t retrovirus "activates" the MSV
genome to trigger "transfolmation" which results in foci formation.
S~e.~ t is removed from the cell line to be tested ~resence of 5 replication col..pe~e..~ retrovirus and passed through a 0.45 ~ filter to re . ~ ~ e any cells.
On day 1, MvlLu cells are seeded at 1 x 105 cells per well (one well per sample to be tested) of a 6 well plate in 2 ml DMEM, 10% FBS and 8 llg/ml polybrene. MvlLu cells are plated in the same manner for positive and negative controls on separate 6 well plates. The cells are incubated overnight at 37C, 10% CO2. On day 2, 1.0 ml of test 10 supern~t~nt is added to the MvlLu cells. The negative control plates are incubated with 1.0 ml of media. The positive control consists of three dilutions (200 focus forming units (ffu), 20 ffu and 2 ffu each in 1.0 ml media) of MA virus (Miller et al., ~olec. and Cell Piol. 5:431, 1985) which is added to the cells in the positive control wells. The cells are incubated overnight. On day 3, the media is aspirated and 3.0 ml of fresh 15 DMEM and 10% FBS is added to the cells. The c~.ls are allowed to grow to confluency and are split 1:10 on day 6 and day 10, amplify` ag any replication competent retrovirus. On day 13, the media on the MvlLu cells is aspirated and 2.0 ml DMEM and 10% FBS is added to the cells. In addition, t~ MiCII cells are seeded at 1 x 105 cells per well in 2.0 ml DMEM, 10/~ FBS and 8 ~ ml polybrene. On day 14, 20 the supernatant from the MvlLu cells i- - asferred to the corresponding well of the MiCII cells and incubated overnight at 37~C, 10% CO2. On day 15, the media is aspirated and 3.0 ml of fresh DMEM and 10% FBS is added to the cells. On day 21,the cells are examined for focus formation (appearing as clustered, refractile cells that overgrow the monolayer and remain attached) on the monolayer of cells. The test 25 article is determined to be cont~min~ted with replication competent retrovirus if foci appear on the MiCII cells.

Fx~mple 10 The following adherent human and mur i ~ cell lines are seeded at 5 x 105 cells/10 cm dish with 4 llg/ml polybrene: HT 1~80 (ATCC No. CCL 121), Hela (ATCC No. CCL 2), and BClOME (Patek et al., Cell. Immuno. ~2: 113, 1982, 35 ATCC No. TIB 85). The following day, 1.0 ml of filtered supernatant from the DA
E3/19K pool is added to each of the cell culture plates. The following day, 800 ug/ml G418 is added to the media of all cell cultures. The cultures are m~int~in~1 until selection is complete and sufficient cell numbers are generated to test for genee~ ion. The tr~n~d~1ce~l cell lines are design~ted HT 1080-E3/19K, Hela-E3/19K
and BClOME-E3/19K, respectively.
EBV transformed cell lines (BLCL), and other suspension cell lines, are tr~n~cluced by co-cultivation with irradiated producer cell line, DA-E3/19K.
Specifically, irradiated (10,000 rads) producer line cells are plated at 5 x 105 cells/6 cm dish in growth media containing 4 ~g/ml polybrene. After the cells have been allowed to attach for 2-24 hours, 106 ~u~ellsion cells are added. After 2-3 days, the suspension cells are removed, pelleted by centrifugation, lcsu~l,ended in growth media Co~
lmg/ml G418, and seeded in 10 wells of a round bottom 96 well plate. The cultures were expanded to 24 well plates, then to T-25 flasks.

Fxample 11 A. WESTERN BLOT ANALYSIS FOR E3/19K
Radio-immuno precipitation assay (RIPA) Iysates are made from selected cultures for analysis of E3/19K expression. RIPA lysates are ple~aled from confluent plates of cells. Specifically, the media is first aspirated off the cells.
Depending upon the size of the culture plate cont~inin~ the cells, a volume of 100 to 500 ~1 ice cold RIPA lysis buffer (10 mM Tris, pH 7.4; 1%Nonidet P40 (Calbiochem, San Diego, CA), 0.1% SDS; 150 mM NaCl) is added to the cells. Cells are removed from plates using a micropipet and the mixture is transferred to a microfuge tube. The tube is centrifuged for S minl~te~ to precipitate cellular debris and the supernatant is transferred to another tube. The supen ~t~rlt.~ are electrophoresed on a 10% SDS-PAGE
gel and the protein bands are transferred to an Immobilon membrane in CAPS buffer (Aldrich, Milwaukee, WI) (10 mM CAPS, pH 11.0; 10% methanol) at 10 to 60 volts for 2 to 18 hours. The membrane is transferred from the CAPS buffer to 5% Blotto (5%nonfat dry milk; 50 mM Tris, pH 7.4; 150 mM NaCI; 0.02% sodium azide, and 0.05%
Tween 20) and probed with a mouse monoclonal antibody to E3/19K (Severinsson et al., J. Cell. Riol. 101 :540-547, 1985). Antibody binding to the membrane is detected by the use of 125I-Protein A.

~ a~33 F.x~ le 12 TO NON-TRANSDUCED CELLS.

Cell lines tr~ncduced with the E3/19K-vector are examined for MHC
class I molecule expression by FACS analysis. Non-tr~n~d~ced cells are also analyzed 10 for MHC class I molecule t;~lession and collll aled with E3/19K tr~ncdnced cells to determine the effect of transduction on MHC class I molecule ~ ssion.
Murine cell lines, BClOME, BClOME-E3/19K, P815 (ATCC No. TIB
64), and P815-E3/19K, are tested for expression of the H-2Dd molecule on the cell surface. Cells grown to subconfluent density are removed from culture dishes by 15 tre~trnent with Versene and washed two times with cold (4C) PBS plus 1% BSA and 0.02% Na-azide (wash buffer) by centrifugation at 200g. Two million cells are placed in microfuge tubes and pelleted in a microfuge at 200g before removing the supernatant. Cell pellets are resuspended with the H-2Dd-specific Mab 34-2-12s (50~11 of a 1: 100 dilution of purified antibodv, ATCC No. HB 87) and incubated for 30 min at 20 4C with occasional mixing. Antibody labeled cells are washed two times with 1 ml of wash buffer (4C) prior to removing the supern~t~nt Cells are resuspended with abiotinylated goat anti-mouse kappa light chain Mab (50~11, of a 1:100 dilution of purified antibody) (Arnersham, Arlington Height, IL) and incubated for 30 min at 4C.
Cells are washed, resuspended with 50~11 of avidin conju~ated FITC (Pierce, Rockford, 25 IL), and incubated for 30 rnin at 4C. The cells are washed once more, resuspended in 1 ml of wash buffer, and held on ice prior to analysis on a FACStar Analyzer (Becton Dickinson, Los Angeles, CA). The mean fluorescen~e intensity of tr~n~ ce~l cells is compared with that of non-tr~nc~uced cells to determine the effect E3/19K protein has on surface MHC class I molecule ~plession.
Fx~nlI?le 13 MURINE ALLOGENEIC CTL ASSAYS

H-2d turnor cells (P815 or BCilOME) irradiated with 10,000 rads are cultured with splenocytes isolated from six to eight week old female C57BL/6 (H-2b) PCTtUS94/09957 WO 95/06717 2 1 ~ ~ ~ 3 ~

mice (Harlan Sprague-Dawley, Tntli~n~polis, IN) inducing allogeneic CTL.
Specifically, 3 x 106 splenocytes/ml are cultured in vitro with 1.5-6.0 x 104 irradiated tumor cells/ml for 4-5 days at 37C in T-25 flasks. Culture medium consists of RPMI
1640; 5% FBS, heat-inactivated; 1 mM pyruvate; 50 ~g/ml gentamicin and 10-5 M 2-5 mercaptoethanol. Effector cells are harvested 5 days later and tested using variouseffecto~ g~ cell ratios in 96 well microtiter plates in a standard 4-6 hour assay. The assay employs Na2slCrO4-labeled, 100~Ci, 1 hr at 37C, (Amersham, Arlington Heights, IL) target cells at 4-10 x 103 cells/well with the final total volume per well of 200 ~11. Following 4-6 hour incubation at 37C, 100 ~11 of culture medium is removed 10 and analyzed in a WALLAC gamma ~lue~;Llullleter (Gaithersburg, MD). Spontaneous release (SR) is determin~cl as CPM from targets plus medium and maximum release (MR) is determined as counts per minute (CPM) from targets plus lM HCl. Percent target cell lysis is calculated as: [[(effector cell + target CPM) - (SR)]/[(MR) - (SR)]] x 100. Spontaneous release values of targets are typically 10%-20% of the MR. Tumor 15 cells that have been tr~n~dl~ced with the gene of interest (ribozyme, E3/19K, ~nti~en~e, etc.) are used as ~tim~ tor and/or target cells in this assay to demonstrate the reduction of allogeneic CTL induction and detection.

F~rr~le 14 DEMONSTRATE DECREASED LEVELS OF MHC CLASS I EXPRESSION
COMPARED TO NON-TRANSDUCED CELLS

Cell lines tr~n.~dllced with the E3tl9K vector are eY~mine~l for class I
molecule expression by FACS analysis. Non-tr~ncduced cells are also be analyzed for class I molecule expression to compare with E3/19K tr~nc~ ce~l cells and to determine the effect that transduction has on class I molecule exples~ion.
Two human cell lines JY-E3/19K and JY (ATCC No. ) are used to test for expression of the HLA-A2 molecule on the cell surface. Suspension cellsgrown to 106 cells/ml are removed from culture flasks by pipet and washed two times with cold (4C) PBS plus 1% BSA and 0.02% Na-azide (wash buffer) by centrifugation at 200g. Two million (2 x 106) cells are placed in microfuge tubes, pelleted in at 200g, and the supernatant is removed. Cell pellets are resuspended with the HLA-A2-specific Mab BB7.2 (50~1 of a 1:100 dilution of purified antibody, ATCC No. HB 82) and incubated with antibody for 30 min at 4C with occasional mixing. Antibody labeled ~,~,5~93~ 38 cells are washed two times with 1 ml of wash buffer (4C). Prior to removing thesupern~t~nt, the cells are resuspended with a biotinylated rat anti-mouse kappa light chain Mab (50~1, of a 1:100 dilution of purified antibody) and incubated for 30 min at 4C. Cells are washed, l~u~l~e~ded with 50111 of avidin conjugated FITC (Pierce,5 Rockford, IL), and incllb~t~cl for 30 n~in at 4C. The cells are washed once more, and resuspended in 1 ml of wash buffer, and held on ice prior to analysis on a FACStar Analyzer. The mean fluorescence illlell~ily of tr~nc~ ce~l cells is compared with that of non-tr~n~cluced cells to determine the effect E3/19K protein has on surface MHC class I
molecule ex~res~ion.
Fxan~le 15 MEASUREMENT OF THE IM~IUNE RESPONSE TO E3/1 9K-TRANSDUCED
AND NONTRANSDUCED EBV-TRANSFORMED HUMAN JY CELLS BY
ALLOGENEIC HUMAN CTL LINES

Human CTL lines can be prop~g~tecl from donor blood samples using allog~-eic EBV-transformed cell lines as stimulators. These CTL lines are propagated with JY cells which possess the A2 molecule and can lyse JY target cells. A chromium 20 release assay can be performed wi~h these ~TL lines and JY target cells that have been transformed with the E3/19K gene or non-~ransformed JY target cells. The E3/19K
tr~nsformed JY target cells are used to demonstrate decreased recognition and lysis of this cell when compared to nontransforrned JY target cells. These results indicate that cell transformation with agents that decrease MHC class I surface expression also 25 decreases MHC class I restricted cell mt~ tecl immune responses in an in vitro human cell model system.
An allogeneic CTL reaction is inrl~lce~l by culturing 1 o6 irradiated (10,000 rad) JY cells with 107 PB~fC from a non-HLA-A2 person in 10 mls of culture medium at 37C 5% CO2 for 7-10 days. The culture medium con.~i~tc of RPMI 1640 30 supplemented with 5% heat inactivated fetal bovine serurn preselected for CTL growth, 1 mM sodium pyruvate and non~ssPntial amino acids. After the 7-10 day incubation the effector cells are harvested and tested in a standard 4-6 hour chromium release assay using 5 I Cr labeled JY cells as the positive control and S I Cr labeled JY-E3/1 9K. JY and JY-E3/19K cells are labeled with 300 IlCi of Na25lCrO4 for 1 hour at 37C, then 35 washed, counted, and used in the assay at 4 x 103 cells/well with the final total volume per well of 200 ~1. Following incubation, 100 ~11 of culture medium is removed and 2~ 33 analyzed in a WALLAC gamma spectrometer (Gaithersburg, MD). Spontaneous release (SR) is detennin~d as counts per minute (CPM) from targets plus medium and maximum release (MR) is detenninetl as CPM from targets plus lM HCl. Percent target cell lysis is calculated as: [[(effector cell + target CPM) - (SR)]/~(MR) - (SR)]] x 5 100. Spontaneous release values of targets are typically 10%-30% of the MR. Tumor cells that have been tr~ncd~lced with the gene of interest (ribozyme, E3/19K, ~nti.c~nce, etc.) are used ac stiml]l~tor and/or target cells in this assay to demonstrate the reduction of allogeneic CTL induction and detection as compared to the non-tr~ncdnce-l line which is the positive control.
Fxam~le 16 ALLOGENEIC MARROW GRAFTS

15 i. REMOVE 4L OF BONE MARROW FROM C3H (H-2k) AND BALB/C (H-2d) Mouse femurs are dissected and exposed. The bone marrow plugs are removed using a number 23 gauge needle and syringe. The marrow is collected and 20 resuspended marrow in Hank's balanced salt solution (Mauch et al., PNAS 77:2927, 1980) ii. TRANSDUCTION OF MARROW CELLS WITH El9 RETROVIRAL
VECTOR
Marrow cells are prepared by centrifugation and resuspension in 1.0 ml DMEM and 10% FBS cont~inin~ E3/19K vector. The marrow cells and F3/19K
retroviral vector is incubated for 4 hours at 33C then 9 mls of Fischer's medium supplemental with 25% donor horse serurn and 0.1 mM hydrocortisone sodium 30 succinate. After 24 hours the marrow cells were washed and resuspended in HBSS at 2 x 106 cells/ ml for injection.
iii. INJECTION OF MARROW CELLS INTO MICE

The C57BL/6 (B6, H-2b) mice are irradiated with 700 rads of gamma irradiation just prior to injection. Two groups of B6 mice are injected intravenously WO95/06717 ~33 with 0.5 ml of C3H marrow cells. After 5 days the mice are again irradiated with 700 rads and injected intravenously with 0.5 ml of either vector-tr~n~d~lcecl C3H marrow cells or untreated C3H marrow cells. Lethally irradiated naive B6, mice are injected intravenously with 0.5ml (1 x 106) of C3H bone marrow cells for the positive control 5 and 0.5ml (1 x 106) of Balb/c bone marrow cells for the negative control.
iv. EVALUATION OF GRAFT REJECTIONS

The bone marrow graft rejections are evaluated 5 days following 10 injection by either ofthe two methods:

a. After sacrificing the mice, the spleens are removed and placed into 10%
formalin. Spleen colonies are counted and recorded.

b. Mice are injected with FUdR (Sigma, St. Louis, MO) and 30 minutçs later with 125I-IUdR (Amersham, Arlington Height, IL). After 18 hours of incubation, the spleens are removed and l25I-IUdR incorporation determined in the spleens of with replicating bone marrow cells.

c. The value o incorporated radioactivity determined in the syngeneic growth control is ~I,iLIdl;ly set at 100 U, and all values in the experimental groups are norm~li7e(1 relative to this control. Animals with ~10 U show no visible spleen colonies, whereas ~nim~l~ with 50 to 100 U have greater than 200 spleen colonies. Animals that show less than 10 U are considered to express strong rejection, those with 10 to 30 U are considered to express weak rejection, and those with greater than 30 U show no significant rejection.

RECIPIENT 1 2 RESULT (MARROWGROWTH) B6 (H-2b) Balb/c (H-2d) B6 (H-2b) C3H (H-2k) +
B6 (H-2b) C3H C3H
B6 (H-2b) C3H C3H-E3/19K +

WO 95/06717 ~ 3 3 PCT/US94/099S7 Fxam~le 17 A. ISOLATION AND TRANSDUCTION OF BONE MARROW CELLS

Pluripotent hematopoeitic stem cells, CD34+ are collected from the bone marrow of a patient by a syringe evacuation p~.rol,lled by known techniques.
Alternatively, CD34+ cells may also be obtained from the cord blood of an infant if the patient is diagnosed before birth. Generally, 20 bone-marrow aspirations are obtained by puncturing femoral shafts or from the posterior iliac crest under local or general anesthesia. Bone marrow aspirations are then pooled and suspended in Hepes-buffered Hanks' balanced salt solution collt~ ;llg heparin sulfate at 100 Units/ml and deoxyribonuclease I at 100 ~lg/ml and then subjected to a Ficoll gradient separation.
The buffy coated marrow cells are then collected and washed according to CEPRATETM LC (CD34) Separation system (Cellpro, Bothell, WA). The washed buffy coated cells are then stained sequentially with anti-CD34 monoclonal antibody, washed, then stained with biotinylated secondary antibody supplied with the CEPRATETM system. The cell ll~L~e iS then loaded onto the CEPRATETM avidin column. The biotin-labeled cells are adsorbed onto the colurnn while unlabeled cells pass through. The column is then rinsed according to the CEPRATETM system directions and CD34+ cells eluted by agitation of the column by m~nll~lly sq~le~in~ the gel bed. Once the CD34+ cells are purified, the purified stem cells are counted and plated at a concentration of 1 x 105 cells/ml in Iscove's modified Dulbecco's medium, IMDM (Irvine Scientific, Santa Ana, CA), cont~ining 20% pooled non-heat inactivated human AB serurn (hAB serum).
After purification of CD34+ cells, several methods of transducing purified stem cells may be performed. One approach involves transduction of the purified stem cell population with vector cont~ining supernatant cultures derived from vector producing cells. A second approach involves co-cultivation of an irradiated monolayer of vector producing cells with the purified population of non-adherentCD34+ cells. A third and pl~f~lled approach involves a similar co-cultivation approach, however the purified CD34+ cells are pre-stimulated with various cytokines and cultured 48 hours prior to the co-cultivation with the irradiated vector producing cells. Pre-stimulation prior to transduction increases effective gene transfer (Nolta et al., Exp. Hem~tol. 20:1065; 1992). The increased level of transduction is attributed 3 5 to increased proliferation of the stem cells necessar,v for efficient retroviral WO 95/06717 ~,3 PCT/US94/09957 transduction. Stimulation of these cultures to proliferate also provides increased cell populations for re-infusion into the patient.
Pre-stimulation of the CD34+ cells is performed by incubating the cells with a combination of cytokines and growth factors which include IL-l, IL-3, IL-6 and 5 mast cell growth factor (MGF). Pre-stimulation is performed by culturing 1-2 x 105 CD34+ cells / ml of medium in T25 tissue culture flasks co~ g bone marrow stimulation medium for 48 hours. The bone marrow stim~ tion medium consists of IMDM cont~ining 30% non-heat inactivated hAB serum, 2mM L-ghlt~minP, 0.1 mM 2-mercaptoethanol, lllM hydrocortisone, and 1% deionized bovine serum albumin. All10 reagents used in the bone marrow cultures should be screened for their ability to support maximal numbers of granulocyte erythrocyte macrophage meg~k~ryocyte colony-forming units from normal marrow. Purified recombinant human cytokines and growth factors (Immunex Corp., Seattle, WA) for pre-stimulation should be used at the following concentrations: E. coli-der.ved IL-la (100 U/ml), yeast-derived IL-3 (5 15 ng/ml), IL-6 (50 U/ml), and MGF (50 ng/ml) [Anderson et al., Cell Growth D;ffer.
2:373, 1991]
After ple~ ,.ulation of the CD34+ cells, the cells are then tr~n~ ce~l by co-cultivating on to the irradiated DA-based producer cell line (expressing the E3/19K
vector) in the contimled presence of the stimulation medium. The DA vector producing 20 cell line is first tryp~ini7Pd irradiated using 10,000 rad and replated at 1-2 x 105/ml of bone marrow stimulation medium. The following day, 1-2 x 105 prestimulated CD34+cells /ml were added onto the DA vector producing cell line monolayer followed by polybrene (Sigma, St. Louis, MO) to a final concentration of 4ug/ml. Co-cultivation of the cells should be performed for 48 hours. After co-cultivation, the CD34+ cells are 25 collected from the adherent DA vector producing cell monolayer by vigorous flushing with medium and plated for 2 hours to allow adherence of any dislodged vector producing cells. The cells are then collected and exr~ntled for an additional 72 hours.
The cells are collected and frozen in liquid nitrogen using a cryo-protectant in aliquots of 1 x 107 cells per vial. Once the transformed CD34+ cells have been tested for the 30 presence of adventitious agents, frozen transforr~ d CD34+ cells may be thawed, plated to a concentration of 1 x 105 cells/rnl and cultured for an additional 48 hours in bone marrow stimulation medium. Transformed cells are then collected, washed twice and resuspended in normal saline. The number of transduced cells used to infuse back into the patient per infusion is projected to be at a minimum of 107 x 108 cells per patient 35 per injection. The site of infusion may be directly into the patients bone marrow or i.v.
into the peripheral blood stream.

B. ISOLATION OF PANCREATIC ISLET CELLS

Procedures for the isolation of human pancreatic islet cells have been 5 previously described (Warnock et al., Diabetologi~ ~:85 1992; Warnock et al., Tran.~l~nt~tion 45:957, 1988). The pancreas is obtained from adult human cadaverorgan donors at the National Disease Research Interchange in Philadelphia, PA. It is removed by laparotomy by dividing the gastrocolic omentum and splenic lig~mPntc The neck of the pancreas is freed from the portal vein and the rem~in-l~r of the gland is 10 detached from the retroperitoneum. The pancreas is weighed and immersed into 4C
Hanks' b~l~nced salt solution (HBSS). The pal~c~e~lic duct at the head is ç~nn~ ted with a 16 gauge c~nn~ and then HBSS-cont~ining collagenase type XI (Sigma Chemicals, St. Louis, MO) is injected. Upon transfer to a cooling tray, the pancreatic duct is exposed at the middle of the gland and two additional 16 gauge c~nn~ c are 15 inserted into this portion of the duct. Each pancreatic duct is perfused with a collagenase solution at 4C and then gradually warmed to 38~C. Digestion of the pancreas is judged complete when the islets dissociate freely from the exocrine tissue as determined microscopically. The digested tissue is transferred to HBSS cont~ining 2%
(v/v) newborn calf serum (Gibco, Burlington, Ontario, Canada) at 4C and gently teased 20 apart. The tissue is washed, passed through needles of progressively smaller sizes and suspended in tissue culture medium 199 (Gibco, Burlington, Ontario, Canada) at 4C
using 0.6 g of tissue per 3.4 ml of medium. Aliquots of tissue suspension are mixed with media and Ficoll (Density 1.125, Sigma, St. Louis, MO) and centrifuged in adiscontinuous Ficoll gradient at 550g for 25 minutes at 22C. Interfaces are collected, 25 washed, and resuspended in culture mediu~n. The cells are then transformed in one of the several ways outlined in the specification. Since pancreatic cells do not replicate efficiently in culture it may be useful to transform with DNA or vector systems capable of infecting non-replicating cells, for example sindbis virus or adeno-associated virus.
The genes introduced are those described for the retroviral vector system.
Example 18 REPLACEMENT OF TRANSPLANTABLE PANCREATIC ISLET CELLS

Replacement of pancreatic islet cells can be accomplished by using the epiploic flap method as previously described (Altman et al., Horn~one and Metabolic ~.15~33 44 Res. Suppl. ~:136, 1990). After transduction of islets as described above, cells are pelleted and resuspended in 10 mls of a hep~rini7Pd solution of HBSS. The vascular circle of the greater curve tied to the epiploon was cut in its middle part, released from the stomach and mobilized with its epiploic flap. A retrograde injection of the cell 5 solution was embolized into the right ~L~clllil~r of the gastro-epiploic artery. This evenly distributed the islet ~lcp~dLion into the epiploic flap which was set subcutaneously in the paraumbilical area.
Islet encapsulation, or the development of a bioartificial pancreas can also be used. Microe~r-~ps~ tion using an arginate poly-L-lysine membrane has been 10 demonstrated by several groups (Fritschy et al., Diabetes 40:37, 1991; Krestow et al., Trans.pl~ntation 51:651, 1991, Mazaheri et al., Tr~n~plant~tion 51:750, 1991) This technique is applicable to both xenogeneic and allogeneic islets and can sustainprolonged normoglycemia.

From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the scope of the invention.
`s- Accordingly, the invention is not limited except as by the appended claims.

Claims (44)

Claims

1. Tissue cells of an animal transformed with a recombinant vector construct which directs the expression of a protein or active portion of a protein capable of inhibiting MHC antigen presentation, for use in a method of suppressing graft rejection.

2. The cells of claim 1 wherein the protein is capable of binding .beta.2-microglobulin.

3. The cells of claim I wherein the protein is capable of binding the MHC
class I heavy chain molecule intracellularly.

4. The cells of claim 1 wherein the protein is E3/19K or H301.

5. Tissue cells transformed with a recombinant vector construct which transcribes an antisense message, the antisense message capable of inhibiting MHC antigen presentation, for use in a method of suppressing graft rejection.

6. The cells of claim 5 wherein said recombinant vector construct transcribes an antisense message which binds to a conserved region of MHC class I heavy chain transcripts.

7. The cells of claim 5 wherein said recombinant vector construct transcribes an antisense message which binds the .beta.2-microglobulin transcript.

8. The cells of claim 5 wherein said recombinant vector construct transcribes an antisense message which binds the PSF1 transporter protein transcript.

9. Tissue cells transformed with a recombinant vector construct which transcribes a ribozyme, said ribozyme capable of inhibiting MHC antigen presentation, for use in a method of suppressing graft rejection.

10. The cells of claim 9 wherein said recombinant vector construct transcribes a ribozyme that cleaves a conserved region of MHC class I heavy chain transcripts.

11. The cells of claim 9 wherein said recombinant vector construct transcribes a ribozyme that cleaves the .beta.2-microglobulin transcript.

12. The cells of claim 9 wherein said recombinant vector construct transcribes a ribozyme that cleaves the PSF1 transporter protein transcript.

13. The cells of any one of claims 1, 5 or 9 wherein said recombinant vector construct is carried by a recombinant virus selected from the group consisting of togaviridae, picornaviridae, poxviridae, adenoviridae, parvoviridae, herpesviridae and paramyxoviridae viruses.

14. The cells of any one of claims 1, 5 or 9 wherein said recombinant vector construct is carried by a recombinant virus selected from the group consisting of poliovirus, rhinovirus, vaccinia virus, influenza virus, adenovirus, adeno-associated virus, herpes simplex virus and measles virus.

15. The cells of any one of claims 1, 5 or 9 wherein said recombinant vector construct is carried by ?.

16. The cells of any one of claims 1, 5 or 9 wherein said recombinant vector construct is carried by Sindbis virus.

17. The cells of any one of claims 1, 5 or 9 wherein said recombinant vector construct is a recombinant viral vector construct.

18. The cells of any one of claims 1, 5 or 9 wherein said recombinant vector construct is a recombinant retroviral vector construct.

19. The cells of any one of claims 1, 5 or 9 wherein said tissue cells are transformed ex vivo with the recombinant vector construct .

20. Tissue cells transformed with a multivalent recombinant vector construct which directs the expression of a protein or active portion of a protein capable of inhibiting MHC antigen presentation, and an antisense or ribozyme capable of inhibiting MHC antigen presentation, for use in a method of suppressing graft rejection.

21. Tissue cells transformed with a multivalent recombinant vector construct which directs the expression of an antisense message and ribozyme capable of inhibiting MHC antigen presentation, for use in a method of suppressing graft rejection.

22. Tissue cells transformed with a multivalent recombinant vector construct which directs the expression two or more proteins or active portions of said proteins capable of inhibiting MHC antigen presentation, or two or more antisense messages capable of inhibiting MHC antigen presentation, or two or more ribozymes capable of inhibiting MHC antigen presentation, for use in a method of suppressing graft rejection.

23. The cells of claim 22 wherein said multivalent recombinant vector construct directs the expression of the E3/19K or H301 proteins or an active portion of the E3/19K or H301 proteins, and a second protein or active portion of said second protein selected from the group consisting of E3/19K and H301.

24. The cells of claim 20 or 21 wherein said multivalent recombinant vector construct transcribes an antisense message which binds to the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, .beta.2-microglobulin and PSF1 transporter protein.

25. The cells of claim 22 wherein said multivalent recombinant vector construct transcribes two antisense messages, the first transcribed antisense message binding to a conserved region of MHC class I heavy chain transcripts and the second transcribed antisense message binding to the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, .beta.2-microglobulin and PSF1 transporter protein.

26. The cells of claim 22 wherein said multivalent recombinant vector construct transcribes two antisense messages, the first transcribed antisense message binding to the .beta.2-microglobulin moleeule and the second transcribed antisense message binding to the transcript of a protein selected from the group consisting of a conserved region of MHC
class I heavy chains, .beta.2-microglobulin and PSF1 transporter protein.

27. The cells of claim 22 wherein said multivalent recombinant vector construct transcribes two antisense messages, the first transcribed antisense message binding to the PSF1 molecule and the second transcribed antisense message binding to the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, .beta.2-microglobulin and PSF1 transporter protein.

28. The cells of claim 20 or 21 wherein said multivalent recombinant vector construct transcribes a ribozyme that cleaves the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, .beta.2-microglobulin and PSF1 transporter protein.

29. The cells of claim 22 wherein said multivalent recombinant vector construct transcribes two ribozymes, the first transcribed ribozyme cleaving a conserved region of MHC class I heavy chains and the second transcribed ribozyme cleaving the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, .beta.2-microglobulin and PSF1 transporter protein.

30. The cells of claim 22 wherein said multivalent recombinant vector construct transcribes two ribozymes, the first transcribed ribozyme cleaving the .beta.2-microglobulin molecule and the second transcribed ribozyme cleaving the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, .beta.2-microglobulin and PSF1 transporter protein.

31. The cells of claim 22 wherein said multivalent recombinant vector construct transcribes two ribozymes, the first transcribed ribozyme cleaving the PSF1 molecule and the second transcribed ribozyme cleaving the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, .beta.2-microglobulin and PSF1 transporter protein.

32. The cells of any one of claims 20, 21, or 22 wherein said multivalent recombinant vector construct is carried by a recombinant virus selected from the group consisting of togaviridae, picornaviridae, poxviridae, adenoviridae, parvoviridae, herpesviridae and paramyxoviridae viruses.

33. The cells of any one of claims 1, 5, 9, 20, 21, or 22 wherein the tissue cells are selected from the group consisting of bone marrow cells, pancreatic islet cells, fibroblast cells, corneal cells and skin cells.

34. A recombinant vector construct which directs the expression of E3/19K or H301.

35. A recombinant vector construct which transcribes an antisense message which binds the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, the .beta.2-microglobulin and the PSF1 transporter protein.

36. A recombinant vector construct which transcribes a ribozyme that cleaves the transcript of a protein selected from the group consisting of a conserved region of MHC class I heavy chains, the .beta.2-microglobulin and the PSF1 transporter protein.

37. The recombinant vector construct carried by a recombinant virus selected from the group consisting of poliovirus, rhinovirus, vaccinia virus, influenza virus, adenovirus, adeno-associated virus, herpes simplex virus and measles virus.

38. The recombinant vector construct carried by a recombinant virus selected from the group consisting of togaviridae, picornaviridae, poxviridae, adenoviridae, parvoviridae, herpesviridae, and paramyxoviridae.

39. The recombinant viral vector construct of any one of claims 34-38 wherein said vector construct is a recombinant viral vector construct.

40. The recombinant viral vector construct of any one of claims 34-38 wherein said vector construct is a recombinant retroviral vector construct.

41. A tissue cell transformed with a recombinant vector construct according to any one of claims 34-38.

42. A tissue cell transformed with a recombinant viral vector construct according to claim 39.

43. A tissue cell transformed with a recombinant retroviral vector construct according to claim 40.

44. A pharmaceutical composition comprising the transformed tissue cells of any one of claims 41-43 and a physiologically acceptable carrier or diluent.