CA2137799A1 - Therapeutic and diagnostic methods based on neurotrophin-4 expression - Google Patents

Abstract

The present invention relates to neurotrophin-4 (NT-4), a newly characterized member of the BDNF/NGF/NT-3 gene family. The present invention provides for nucleic acid molecules encoding NT-4. Such molecules may comprise a sequence sub-stantially as set forth for NT-4 in the figure [SEQ ID NO:1 (NT-4, viper)]. The present invention provides for therapeutic and di-agnostic methods based on human NT-4 expression, specifically the potential to treat motor neuron diseases and prostate local-ized diseases, immunological related neuromuscular disorders, and peripheral and central nervous system disorders including Alzheimer's disease, Parkinson's disease and Huntington's chorea and epilepsy.

Description

W 093/25684 PC~r/US93/05672 21~77g9 EX~

The present application is a continuation-in-part of copending United States application Serial No. 07t898,194, filed on June 12, 1992 which is a continuation in part of copending United States application Serial No.
791,924 filed on November 14, 1991.

1. INTRODUCTION

The present invention relates . to neurotrophin-4 (NT-4), a newly characterized member of the BDNF/NGF/NT-3 gene family and the therapeutic and diagnostic methods of utilizing neurotrophin-4 in the treatment of neurological disorders.

2. BACKGROUNDOFTHEINVENTION

The nerve growth factor family includes nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and neurotrophin-3 (NT-3), also known as hippocampus-derived neurotrophic factor (HDNF). This family of proteins plays an important role in both the developing and the adult verlel~,ale nervous system, where they support neuronal survival.
Based on the amino acid sequence of the mouse NGF protein (Angeletti, et al., 1973, Biochemistry 12:100-115) DNA sequences coding for mouse and human NGF have been isolated (Scott et al., 1983, Nature 302:538-540; Ullrich et al., 1983, Nature 303:821-825). Comparison of mouse and human NGF showed that the protein is conserved within mammals and in support of this, NGF-like activities have been isolated from several species (Harper and Thoenen, 1981, Ann. Rev. Pharmacol. Toxicol.

W O 93/25684~ PC~r/US93/05672 21:205-229~. SubserllJently, DNA sequences from bull (Meier et al., 198 EMBO J. 5:1489-1493); chick (Meier et al., 1986, EMBO J. 5:1489-1493;
Ebendal et al., 1986, EMBOJ. 5:1483-1487; Wion et al., 1986, FEBS ~tters 203:82-86; cobra (Selby et al., 1987, J. Neurosci. Res. 18:293-298); rat (Whittemore et al., 1988, J. Neurosci. Res. 20:403-410); and guinea pig (Schwarz et al., 1989, Neurochem. 52:1203-1209) NGFs were also determined. Brain-derived neurotrophic factor (BDNF) was first isolated from pig brain (Barde et al., 1982, EMBOJ. 1:549-553) and sub.se~uently cloned as a cDNA from this tissue (Leibrock et al., 1989 Nature 341:149-1 0 152). The gene for NT-3 has been isolated from mouse (Hohn et al., 1~90,Nature, 344: 339-341), rat (Maisonpierre et al., 1990, Science 247: 1446-1451; Ernfors et al., 1990, Proc. Natl. Acad. Sci. USA 87: 5454-5458), and human (Rosenthal et al., 1990, Neuron 4: 767-773), using degenerate oligonucleotides based on the sequence similarity between the other two 1 5 factors. The three factors show approximately 55% amino acid similarity to each other, and most sequence differsnces are present in five regions that contain amino acid motifs characteristic of each protein. The neurotrophic activity in vitro of two of these proteins have recently been shown to be acquired by specific combinations of these variable regions.
NGF supports the development and maintenance of peripheral sympathetic and neural crest-derived sensory neurons (reviewed in Thoenen and Barde, 1980, Physiol. Rev., 60: 1284-1325; Levi-Montalcini, 1987, Science, 237: 1154-1162). No activity has been seen for BDNF in peripheral sympathetic neurons, but this factor supports in vivo the survival of both placode and neural crest-derived sensory neurons (Hofer and Barde, 1988, Naturs, 331: 261-262). The neurons sensitive to NT-3 in vivo remain to be identified. However, in explanted chick ganglia or dissociated neuronal cultures in vitro, tha three factors support both ov~rlapping and unique sets of neuronal populations, suggesting that NT-3 exerts both specific and overlapping neurotrophic activities also in vivo (Hohn et al., 1990, Nature, WO 93/25684 ~ 7 9 9 PCI`/US93/05672 344: 339-341; Maisonpierr~ et al., 1990, Science, 247: 1446-1451; Ernfors et al., 1990, Proc. Natl. Acad. Sci. USA, 87: 5454-5458; Rosenthal et al., 1990, Neuron 4: 767-773). All three factors are ex~,ressed in specific sets of neurons in the brain, with the highest levels of mRNA for all three factors in the hippocampus (Ayer-LeLievre et al., 1988, Science 240: 1339-1341;
Ernfors et al., 1990, Proc. Natl. Acad. Sci. USA, 87: 5454-5458; Ernfors et al., 1990, Neuron 5: 511-526; Watmore et al., 1991, Neurol. 109: 141-152;
Hofer et al., 1990, EMBOJ.,9: 2459-2464; Phillips et al., 1990, Science, 250:
290-294). In th~ brain, NGF has been shown to support basal forebrain 1 0 cholinergic neurons (reviewed in Whittemore and Seiger, 1987, Brain Res., 434: 439-464; Thoenen et al., 1987, Rev. Physiol. Biochem. Pharmacol., 105:
145-178; Ebendal, 1989, Prog. Growth Factor Res. 1: 143-159) and BDNF
has been shown to stimulate the survival of these neurons in vitro (Alderson et al., 1990, Neuron 5: 297-306).
1 5 The effects of the three proteins are mediated by their interactionwith specific receptors present on sensitive cells. Molecular clones have been isolated for the rat, human, and chicken NGF receptor (NGF-R), and nucleotide sequence analysis of these clones has shown that the NGF-R
contains one plasma membrane-spanning domain, a cytoplasmic region, and an extr~cellul~r cysteine-rich amino-terminal domain (Johnson et al., 1986, Cell, 47: 545-554; Radeke et al., 1987, Nature, 325: 593-597; Large et al., 1989, Neuron 2: 1123-1134). The NGF-Rshows a low but significant sequence similarity to the receptor for a tumor necrosis factor (Schall et al., 1990, Cell, 61: 361-370) as well as to the Iymphocyte surface antigens 2 5 CD40 (Stamenkovic et al., 1989, EMBO J., 8: 1403-1410) and OX40 (Mallettet al., 1990, EMBO J., 9: 1063-1068). The NGF-R can occur in two apparent states, known as the low and high affinity states (Sutter, et al., 1979, J.
Biol. Chem., 254: 5972-5982; Landreth and Shooter, 1980, Proc. Natl. Acad.
Sci. USA, 77: 4751-4755; Schechter and Bothwell, 1991, Cell 24: 867-874).
The gene for the NGF-R appears to encode a prolein that forms part of WO 93/25684 ~ PCI/US93/05672 both the low and the high affinity states of the receptor (Hempstead et 1989, Science, 243: 373-375), though only the high affinity receptor has been proposed to mediate the biological activity of NGF. Both BDNF
(Rodriguez-Tebar et al., 1990, Neuron, 4: 487-492) and NT-3 (Ernfors et al., 1990, Proc. Natl. Acad. Sci. USA, 87: 5454-5458) can interact with the low affinity NGF-R, suggesting that the low affinity NGF-R may be, in an as yet unknown way, involved in mediating the biological effects of all three factors.
In the developing nervous system, N,GF and its receptor have been shown to be synthesized in the target area and in the responsive neurons, 1 0 respectively, at the time when the growing axon reaches its target (Davies et al., 1987, Nature, 326: 353-358). In agreement with this, the level of NGF
mRNA in the developing chick embryo reaches a maximum at embryonic day 8 (E8) (Ebendal and Persson, 1988, Development, 102: 101 -106), which coincides with the time of sensory innervation. However, in the chick, NGF-R
1 5 mRNA is maximally expressed at early embryonic stages prior to neuronal innervation (Ernfors et al., 1988, Neuron, 1, 983-996), and in the E8 chick embryo high levels of NGF-R mRNA have been detect~d in the mesenchyme, somites, and neural tube cells (Hallbook et al., 1990, Development, 108: 693-704; Heuer et al., 1990, Dev. Biol., 137: 287-304; Heuer 1990, Neuron, 5:
283-296). This observation, together with the fact that NGF mRNA is expressed in th~ E3 chick embryo at relatively high levels (Ebendal and Bersson, 1988, Development, 102: 101-106), indicates that NGFmay play a role in early devGlop",ent that is distinct from its function as a neurotrophic factor. In agreement with this possibility, NGF has rec~ntly been shown to 2 5 control prolif~ration and differentiation of E14 rat embryonic striatal precursor cells in culture (Cattaneo and McKay, 1990, Nature, 347: 762-765). In the chick embryo BDNF and NT-3 mRNA are maximally expressed at E4, 5, and BDNF has been shown to control the differentiation of avian neural crest cells in vitro (Kalcheim and Gendreau, 1988, Dev. Brain Res., 41:

3 0 79-86).

wo 93/25684 21 ~ 7 7 99 PCI`/US93/05672 Moreover, evidence for a non-neuronal function of NGF has also been presented. The stili unexplained high levels of NGF found in the male mouse submandibular gland may indicate other functions for NGF (Levi-Montalcini, 1987, Science, 237: 1154-1162). In the adult rat, NGF has been shown to 5 induce DNA synthesis and to stimulate IgM secretion in B-cells (Otten et al., 1989, Proc. Natl. Acad. Sci. USA 86: 10059-1006~). Additionally, NGF is present in sufficient quantity in guinea pig prostate such that Rubin and Bradshaw (1981, J. Neur. Res. 6: 451-464) were success~ul in isolating and characterizing substantially pure NGF from this exocrine tissue. The high 1 0 level of NGF in pig prostate support the hypothesis that this neurotrophic factor functions in a non-neuronal capacity not yet understood (Bradshaw, 1978, Ann. Rev. Biochem. 47:191-216; Harper, et al., 1979, Nature 279:160-162; Harper and Thoenen, 1980, J. Neurochem. 34:893-903).
Furthermore, NGF mRNA is expressed in spermatocytes and early 1 5 spermatids in the adult rat testis (Ayer-LeLievre et al., 1988, Proc. Natl.
Acad. Sci. USA, 85: 2628-2632), and the NGF protein is present in germ cells of all stages from spermatocytes to spermatozoa (Olson et al., 1987, Cel rlssue Res., 248: 275-286; Ayer-LeLievre et al., 1988a, Proc. Natl. Acad. Sci.
USA 85: 2628-2632). NGF-R mRNA has also bsen detected in the adult rat testis, where it is expressed in Sertoli cells under negative control of testosterone, and in the testis NGF has been suggested to control meiosis and spermiation (Persson et al., 1990, Science, 247: 704-707).

3. SUMMARYOFTHEINVENTION
The present invention relates to neurotrophin-4 (NT-4), a newly characterized member of the BDNF/NGF/NT-3 g2ne family.
The present invention provides for nucleic acid molecules encoding NT-4. Such molecules may comprise a sequence subslar,lially as set forth for 3 0 NT-4 in Figure 1 [SEQ ID NO:1 (NT-4, viper), SEQ ID NO:2 (NT-4, Xenopus)], WO 93/25684 7 t~7 ~ 9 ~ i PCI/US93/05672 Figure 4 (SEQ ID NO:43), Figure 8 (SEQ ID NO:49), Figure 14 (SEQ ID NO:~
Figure 15 (SEQ ID NO:63), Figure 17 (SEQ ID NO:69), Figure 18 (SEQ ID
NO:75), Figure 20 (SEQ ID NO:93) and Figure 21 (SEQ ID NO:116) or may comprise a sequence that is at least about seventy percent homologous to 5 such sequence.
The present invention also provides for protein or peptide molecules which comprise a sequence sut,st~,lially as set forth for NT-4 in Figure 2 [SEQ ID NO:22 (NT-4, viper), SEQ ID NO:23 (NT-4, Xenopus)], Figure 4 (SEQ
ID NO:44), Figure 8 (SEQ ID NO:50), Figure 14 (SEQ ID NO:62), Figure 15 1 0 (SEQID NO:64), Figure 17 (SEQ ID NO:70), Figure 18 (SEQ ID NO:76), Figure 20 (SEQ ID NO:94), or Figure 21 (SEQ ID NO:117) or may comprise a sequence that is at least about seventy percent homologous to such sequence.
The present invention further provides for expression of biologically 1 5 active NT-4 molecules in prokaryotic and eukaryotic systems.
The present invention further provides for the production of NT-4 in quantities sufficient for therapeutic and diagnostic applications. Likewise, anti-NT-4 antibodies may be utilized in therapeutic and diagnostic ar~plic~tions. For most purposes, it is pr~ferable to use NT-4 genes or gene 20 products from the sams species for therapeutic or diagnostic purposes, although cross-species utility of NT-4 may be useful in specific embodiments of the invention.
The present invention further provides for therapeutic and diagnostic applic~tions based on NT-4 expression by ~isc~osing detectable levels of NT-2 5 4 expression in human skeletal muscle, prostate, thymus and testes.Further therapeutic and diagnostic applications are based on the demonstration of binding of NT-4 to brain and retina, as well as retrograde transport of NT~ and on the ability of NT-4 to support the survival of various neuronal cell popul~tions.

W O 93/25684 . 2 1 3 77 ~ 9 PC~r/US93/05672 4. DESCRIPTION OF THE FIGURES

FIGURE 1. Alignments of DNA sequ~nces of the isolated fragments coding for NGF, BDNF, NT-3 and the novel neurotrophic factor 5 NT-4 from different species.
(A) Schematic representation of the mouse preproNGF molecule. The hatched box indicates the signal sequence (SS), black bars denote proteolytic cleavage sites and the shaded box represenls the mature NGF.
Regions used for the degenerate primers are indicated by arrows. The 1 0 upstream primer was from the region coding for Iysine 50 to threonine 56 and the downstream primer includes tryptophan 99 to aspartic acid 105.
The amplified region comprises DNA sequencss from base pair (bp) 168 t o 294 in the mature NGF molecules and in all members of the NGF family desc.ibed so far, this region is loc~ted in one exon.
1 5 (B) Alignment of nucleotide sequences for NGF, BDNF, NT-3 and NT-4isolated from different species. The fragments cGr,espond to amino acids 57 to 98 in the mature mouse NGF. Identical bases are indicated by dots.
The numbering refers to nucleotides in the sequences of mouse mature NGF
(Scott et al., 1983, Nature 300:538-540). SEQ ID NO:1 (NT-4, viper), SEQ
ID NO:2 (NT-4, Xenopus), SEQ ID NO:3 (NGF, human), SEQ ID NO:4 (NGF, rat), SEQ ID NO:5 (NGF, chicken), SEQ ID NO:6 (NGF, viper), SEQ ID NO:7 (NGF, Xenopus), SEQ ID NO:8 (NGF, salmon), SEQ ID NO:9 (BDNF, human), SEQ ID NO:10 (BDNF, rat), SEQ ID NO:11 (BDNF, chicken), SEQ ID NO:12 (BDNF, viper), SEQ ID NO:13 (8DNF, Xenopus), SEQ ID NO:14 (BDNF, 2 5 salmon), SEQ ID NO:15 (BDNF, ray), SEQ ID NO:16 (NT-3, human), SEQ ID
NO:17 (NT-3, rat), SEQ ID NO:18 (NT-3, chicken), SEQ ID NO:19 (NT-3, Xenopus), SEQ ID NO:20 (NT-3, salmon), SEQ ID NO:21 (NT-3, ray).
FIGURE2. Alignment of amino acid sequences deduced for NGF, BDNF, NT-3 and NT-4 from different sreciQs. The numbering of the amino 3 0 acids (single letter code) is taken from the mature mouse NGF (Scott et al., w0 s3/2s684~ Pcr/uss3/os672 1983, Nature 300:538-540). Identical amino acids are inJicaled with do~
Positions that show conservative amino acid replacements in all species variants of the same factor are underlined. The broken line in~ tes that the corresponding sequence was not isolated. Bars represent variable regions in the different molecules~(R59 to S67 and D93 to A98). SEQ ID
NO:22 (NT-4, viper), SEQ ID NO:23 (NT~, Xenopus), SEQ ID NO:24 (NGF, human), SEQ ID NO:25 (NGF, rat), SEQ ID NO:26 (NGF, chicken), SEQ ID
NO:27 (NGF, viper), SEQ ID NO:28 (NGF, Xenopus), SEQ ID NO:29 (NGF, salmon), SEQ ID NO:30 (BDNF, human), SEQ ID NO:31 (BDNF, rat), SEQ ID
1 0 NO:32 (BDNF, chicken), SEQ ID NO:33 (BDNF, viper), SEQ ID NO:34 (BDNF, Xenopus), SEQ ID NO:35 (BDNF, salmon), SEQ ID NO:36 (BDNF, ray), SEQ ID
NO:37 (NT-3, human), SEQ ID NO:38 (NT-3, rat), SEQ ID NO:39 (NT-3, chicken), SEQ ID NO:40 (NT-3, Xenopus), SEQ ID NO:41 (NT-3, salmon), ID NO:42 (NT-3, ray).
1 5 FIGURE 3. Deduced phylogeny of members of the NGF family.
Phylogenetic trees showing speciation of NGF (A), BDNF (B), and NT-3 (C) were constructed using analysis of nucleotide sequences. Human NT-3 was used as a reference point in (A) and (B), human NGF and human BDNF were used in (C). The scale bar in (A) represents a branch length corresponding to a relative difference score of 20. The same scale was used in (B) and (C). (D) shows a phylogram of the evolutionary rslationship between the diffarent members of the NGF family. The data ware compiled from deduced amino acid sequences. The scale bar represents a branch length of 20. All trses shown are unrooted so that the branches are measured 2 5 relative to one another with no outside reference. Abbreviations: chi, chicken; hum, human; sal, salmon; vip, viper; xen, Xenopus.
FIGURE 4. Sequence of Xenopus NT-4 and Comparison to NGF, BDNF, and NT-3.
(A) A potential translation start site is boxed. A putative signal cleavage site is indicated by the arrow labeled SC. Amino acids within the WO 93/25684 ~ 1 3 7 7 ~ 9 PCI/US93/05672 signal sequence that are identical between Xenopus NT~ and pig and rat BDNF are indicated with stars. A consensus sequence for N-glycosylation is underlined, and the arrow indicates the presumptive start of the mature NT-4 protein. (SEQ ID NO:43 and SEQ ID NO:44) (B) Amino acid (singie-letter code) sequence comparison of Xenopus NT-4 (SEQ ID NO:45) with mouse NGF (Scott et al., 1983, Nature 300: 538-540) (SEQ ID NO:46), mouse BDNF (Hofer et al., 1990, EMBOJ. 9: 2459-2464) (SEQ ID NO:47), and mouse NT-3 (Hohn et al., 1990, Nature 344:
339-341) (SEQ ID NO:48). Identical amino acid replacements compared 1 0 with the NT-4 amino acid sequence are shown by dots. Sequences that differ behr~ocn NGF, BDNF, and NT-3 also differ in the sequence of the NT-4 protein.
FIGURE5. Transient expression of the Xenopus NT-4 protein in COS
cells and its interaction with NGF-Rs on PC12 cells.
1 5 (A) SDS-PAGE of conditioned media from in vivo labeled COS cell cultures (3 x 104 cpm loaded in each lane) transfected with the rat NGF
gene, a control plasmid without insert, or the Xenopus NT~ gene. Shown is an autoradiograph of the dried gel after an overnight exposure to X-ray film.
(B) Serial dilutions of transfected COS cell medium containing equal amounts of NT-4 (open circles) or NGF (closed circles) protein were assayed for their ability to ~ispl^^e 1251-NGF from its receptor on PC12 cells.
Binding assays were performed at 37C using 1.5 x 109 M 1251-NGF and 1 x 104 cells per ml. Medium from mock-transfected cells failed to displace binding of 1251-NGF from PC12 cells. Each point represents the mean + SD
of triplicate determinations.
FK~URE6. Stimulation of neurite outgrowth from chicken embryonic ganglia.
(A, B, and C) Neurite oulgro~.ll, elicited in dorsal root ganglia with recombinant NT~ protein (A), recombinant NGF (B), and BDNF protein (C).

W0 93/25684 f~ PCI/US93/05672 (D) The response of dorsal root ganglia to conditioned medi~
from mock-transfected cells.
(E and F) Stimulation of neurite outgrowth from sympathetic ganglia in response to NT4 (E) or NGF (F).
(G, H, and 1) Nodose ganglia stimulated with recombinant NT-4 (G), NT-3 (H), and BDNF (I) proteins. All figures are bright-field micrographs of ganglia after 1.5 days in culture.
FIGURE 7. Detection of NT-4 mRNA in di~erent Xenopus tissues.
(A) Poly(A)+ RNA (10 9 per slot) from the indicated tissues of adult female Xenopus was electrophoresed in a formaldehyde-containing agarose gel, blotted onto a nitrocellulose filter, and hybridized to a 500 bp Hindl fragment from the 3' axon of the Xenopus NT-4 gene. For comparison, the filter was also hybridized to a 180 bp PCR fragment from the Xenopus NGF
gene (lane marked heart, NGF). Th~ filter hybridized to the NT-4 probe was exposed for 2 days; the filter hybridized to the NGF probe was exposed for 2 weeks. A prolonged 2 week exposure of the filter hybridized to the NT-4 probe did not reveal NT-4 mRNA in any tissues other than the ovary, which includes oocytes of different stages. The lane l~heled CNS includes brain and spinal cord.
(B) Poly(A)+ RNA (10 9) from Xenopus ovary was analyzed for the e~cpression of the four members of the NGF family. Each filter was hybridized with the indicated probes obtained by labeling of PCR fragments from their respective Xenopus genes. The location of the labeled I~R
fragments in the 3' axon of their genes is shown in Figure 1A. The filters were washed at high stringency and exposed to X-ray films for 5 days.
FIGURE8. Nucleotide sequenca of Xenopus NT-4 with restriction andonuclease cleavage sites (SEQ ID NO:49 and SEQ ID NO:50).
FIGURE9. NT-4 mRNA expression in the Xenopus laevis ovary. Ovar~
from adult Xenopus laevis was sectionad in a cryostat (14 m thick sections) and the scctions were then hybridized to the indicated 48-mer wo 93/25684 ~ ~ ~ 7 7 ~ ~ PCr/US93/05672 oli~onucleotides labeled with 35S-dATP using termina! deoxynucleotidyl transferase.
(A) Hybridization using a Xenopus NT-4 m RNA specific oligonucleotide with the sequence 5 CCCACM(~ I I G I I ~GCATCTATGGTCAGAGCCCTCACATMGA(; ~ G
C3'. (SEQ ID NO:95) (B) Hybridization using a control oligonucleotide of similar length and G+C content. After hybridization, sèctions were washed in 1x SSC at 55C followed by exposure to X-ray film for 10 days. Shown in the figure are photographs of the developed X-ray films. Note the intense labeling over many small cells with the NT-4 probe and the absence of labeling with the control probe. Arrows point at large (stage Vl) oocytes which are not labeled with either of the two probes. Scale bar, 2 mm.
FIGURE 10. Bright-field illumination of emulsionautoradiographs showing NT~ mRNA expressing oocytes in the Xenopus ovary. Sections hybridized to the Xenopus NT-4 mRNA specific (A,B) or control (C) probe as described in FIG. 9 were coated with Kodak NTB2 emulsion, exposed for 5 weeks, developed and lightly counlersldined with cresyl violet This figure shows bright-field photomicrographs of the developed sections. Note in panel A the i"lense NT-4 mRNA labeli.19 over small size oocytes (stages I
and ll) and the absence of labeling over large size (stages V and Vl) oocytes. Panel B shows a higher magnification of the boxed in area in panel A. Note the intense labeling of the c~iloplas", of the stage ll oocytes shown in the picture.
2 5 (C) No labeling can be seen using the control probe.
Abbreviations: n, nuc'~us; fc, follicle cells; pl, pigmented layer. Scale bar inA,50 m;inBandC,15 m.
FK3URE 11. Levels of NT-4 mRNA in oocytes at different stages of oogenesis. Emulsion autoradiographs (shown in figure 10) of sections hyLridi~ed with the Xenopus NT-4 mRNA specific probe were used to count e number of grains over an area unit. The area unit chosen was abo~
one hundredth of a stage I oocyte. Fifteen area units were analyzed in 1 0 different oocytes of the il~d;c~ted stages. Error bars show S.D.
FIGURE12. Northern blot analysis of NT~ mRNA expression during oogenesis in Xenopus laevis. Ovaries from two adult Xenopus laevis were dissected out and treated with coîlagenase to remove follicle cells and release the oocytes. The oocytes were then grouped in the indicated groups following the stages described by Dumont, 1972, J. Morphol. 136:
153-180. Total ovary and the released follicle cells were also included in the 1 0 analysis. Total cellular RNA was then prepared and a 40 g/slot of RNA
was electrophoresed in a formaldehyde-containing 1% agarose gel. This was blotted onto a nitrocellulose filter and hybridized to a 600bp Hincll fragment from the 3'exon of the Xenopus NT-4 gene. The filter was washed at high stringency and exposed for five days to a X-ray film. Note the 1 5 marked decreased in the level of NT-4 mRNA in stages V and Vl oocytes.
FIGURE 13. (A) The xNT-4 partial amino acid sequence (SEQ ID
NO:51) indicating positions where degenerate oligonucleotides were synthesized and utilized to prime the amplification of human and rat genomic DNA via the polymerase chain reaction. Arrows indicate 2 0 oligonucleotides representing sense and antisense degenerate oligonucleotides. A set of deganerate oligonucleotides to primer 2Z
represent amino acids 184-189 of rBDNF (SEQ ID NO:52). The partial Xenopus NT-4 amino acid sequence represenled is from amino acid 167 -amino acid 223, as desc~ibed in Figure 4, supra.
(B) Degenerate oligonucleotides used for cloning of human and rat NT~. Oligonucleotide 3Z in Figure 13 is comprised of a mixtura of 3Z and 3Z' in order to allow for the degeneracy of the sarin~ codon. 2Y (SEQ ID
NO:53), 2Z (SEQ ID NO:54), 3Y (SEQ ID NO:55), 3Z (SEQ ID NO:56), (SEQ ID
NO:57) and 4Z (SEQ ID NO:58). (C) Cloning tails for degenerate 3 0 oligonlJol~otides 3'(SEQ ID NO:59) and 5'(SEQ ID NO:60).

W O 93/25684 ~ 1 ~ 7~ ~ ~ PC~r/US93/05672 FIGURE 14. DNA sequence of the isolated fragment encoding a portion of rat NT-4(SEQ ID NO:61). The predicted open reading frame for the peptide encoded by the rNT-4 nucleic acid fragment is represented by the single letter code (SEQ ID NO:62). Sequence inside brackets is part of PCR primer.
FIGURE 15. DNA sequence of the isolated fragment encoding a portion of human NT-4 (SEQ ID NO:63). The predicted open reading frame for the peptide encoded by the hNT-4 nucleic acid fragment is represented by the single letter code. (SEQ ID NO:64) Sequence inside brackets is part 1 0 of PCR primer.
FIGURE 16. Alignment of amino acid sequences deduced from representative neurotrophins. Amino acids are indicated using the single letter code. Identical amino acids are indicated with dots. Dashed lines indicate a 7 amino acid insertion within the conserved region of both rNT-4 1 5 (SEQ ID NC):62) and hNT-4 (SEQ ID NO:64). xNT-4 (SEQ ID NO:65), rNGF
(SEQ ID NO:66), rBDNF (SEQ ID NO:67), rNT-3 (SEQ ID NO:68). x=Xenopus, r=rat, h=human. Sequence inside brackets is part of PCR primer.
Fl(~JRE 17. (A) DNA sequence of an isolated fragment encoding a portion of human NT~ (SEQ ID NO:69). The predicted peptide encoded by the 192 bp hNT-4 nucleic acid fragment is represented by the single letter code (SEQ ID NO:70). Sequence inside brackets is part of PCR primer.
(B) Oligonucleolide sequence of the 5'-end primer, termed hNT4-5"
containing a sequence (SEQ ID NO:71) encodi.-g ETRCKA (SEQ ID NO:72)], used in the primary amplification of human genomic DNA along with the 3'-end primer, termed 4Z (SEQ ID NO:58) [containing a nucleotide sequence encoding WIRIDTl.
(C) Oligonucleotide sequence of the 5'-end primer used to amplify the primary PCR reaction product. The primer, termed hNT4-5"' [containing a sequence (SEQ ID NO:73) encoding DNAEEG (SEQ ID NO:74)1 was utilized 3 0 with the 3' primer, 4Z (SEQ ID NO:58), to obtain a fragment of 162 bp (plus wog3/j~g~ ~ PCl[/US93/05672 bp of cloning tail). The 162 bp PCR fragment was then utilized in a patll PCR reaction using our previously utilized upstream PCR fragment (termed 2YZ3Z) to generate the single fragment of 192 bp plus cloning tail shown in (A). Additional 3' extended nucleic acid sequence information was obtained following the subcloning and sequencing of this fragment.
FIGURE 18. DNA sequence of the portion of the isolated human genomic phage clone 7-2 encoding human NT-4 (SEQ ID NO:75). The predicted hNT-4 protein encoded by the genomic clone 7-2 is represented by the one-letter symbols for amino acids (SEQ ID NO:76). The boxed region represents the predicted cleavage site of the hNT-4 preprotein.
Arrows indicate conserved residues in the presequence. The underlined region (N-R-S) represents a consensus sequence for n-glycosylation. The circled region represents the initiating methionine. The splice acceptor site isIocated at base pair 461-462 (AG) of SEQ ID NO:75, represenLing the 3'-end of the intron.
FIGURE 19. Alignment of amino acid sequences deduced from representative neurotrophins (SEQ ID NOS. 77-92) Amino acids are indicated using the single letter code. Amino acids identical to those encoded by the human genomic phage clone 7-2 (SEQ ID NO:77) are indicated with an asterisk. Dashed lines represent breaks in homologous amino acids as compared to the protein encoded by SEQ ID NO:77.
FIGURE20. DNA sequence of the isolated fragment encoding a portion of the human genomic phage clone, 2-1 (SEQ ID NO:93). The predicted open reading frame for the peptide encoded by the isolated nucleic acid fragment is represented by the single letter code (SEQ ID
NO:94). URE 21. DNA sequence of the isolated fragment encoding a portion of the human genomic phage clone, 4-2 (SEQ ID NO:116). The predicted open reading frame for the peptide encoded by the isolated nucleic acid fragment is represented by the single letter code (SEQ ID NO:117).

WO 93/25684 21377 Q g PCI'/US93/05672 FIGURE22. Northern blot analysis of human NT4 mRNA ex~.ression.Tissue specific mRNA from human was purchased from Clontech. RNA's (10 g) were fractionated by electrophoresis through a 1 % agarose-formaldehyde gel followed by capillary transfer to a nylon membrane 5 (MagnaGraph, Micron Separations Inc.) with 10X SSC (pH 7). RNAs were UV-cross-linked to the membranes by exposure to ultraviolet light (Stratlinker, Stratagene, Inc.) and hybridized at 6~C with the radiolabeled probe (a 680bp Xho1-Not1 fragment containing the complete coding region of HG7-2 NT-4 (see Example Section 9, infra) in the presence of 0.5 M
1 0 NaPO4 (pH 7), 1% bovine serum albumin (Fraction V, Sigma), 7% SDS, 1 mM
EDTA (Mahmoudi and Lin, 1989, Biotechniques 7:331-333), and 100 g/ml sonicated, denatured salmon sperm DNA. The filter was washed at 65C
with 2X SSC, 0.1% SDS and subjected to autoradiography overnight with one inlensi~ying screen (Cronex, DuPont) and X-ray film (XAR-5, Kodak) at 1 5 70C. Ethidium bromide staining of the gel demol,slraled that equivalent levels of total RNA were being assayed for the different samples (as in Maisonpierre et al., 1990, Science 247:1446-1451).
Lane 1: fetal liver poly(A)+ mRNA; Lane 2: fetal brain poly(A)+
mRNA; Lane 3: proslale poly A+ mRNA; Lane 4: muscle poly(A)+ mRNA;
20 Lane 5: inlesline poly(A)+ mRNA; Lane 6: kidney poly(A)+ mRNA; Lane 7:
liver poly(A)+ mRNA; Lane 8: spleen poly(A)+ mRNA; Lane 9: thymus poly(A)+ mRNA; Lane 10: ovary poly(A)+ mRNA; Lane 11: testes poly(A)+
mRNA; Lane 12: placenta poly(A)+ mRNA; Lane 13: brain poly(A)+ mRNA;
Lane 14: brain total RNA.
FIGURE23. COSsupernatants from transfected cell lines;Q1 (pCMX-HG7-2Q), N7 (pCMX-hNT3/hNT4) and X1 (pCMX-xNT4/hNT4) were tested in volumes of 10 I, 50 1 and 250 I for neurite promoting activity in DRG
ex~lanls. A supernatant from a mock transfected COS oell line was utilized as a control.

WO 93/25684 ,~ 9~ . ~ PCI/US93/05672 FIGURE 24. COS supernatants from Q1 (pCMX-HG7-2Q). and--(pCMX-HG7-2M) cell lines were tested for their survival-promoting activity on DRG associated cells. Volumes tested ranged from 5 I to 250 1 in a total volume of 2 ml.
FIGURE25. Motor neuron enriched cultures isolated from E14 rat embryos were treated with two dilutions of COS oell supernatants from the M cell line (pCMX-HG7-2M). Biological activity was measured by choline acetyltransferase (CAT) activity as described in Fonnum, 1975, J.
Neurochem. 24:407-409. Both a mock transfected COS cell line (MOC COS) and an untreated motor neuron (C-NT) are pressnted as controls.
FIGURE26. COS supernatants containing human, rat and xenopus NT-4 were tested for their ability to induce the tyrosine phosphorylation of trkA, trkB and trkC.
FIGURE27. (A) Tyrosins phosphorylations of trkB induced by varying conce"ltdlio,-s of human and xenopus NT-4.
(B) Growth response of NIH3T3 fibroblasts expresssing trkB to various concentrations of COS supernatants containing human or xenopus NT-4. A mock transfected COS cell line is presented as a control.
FIGURE28. Tyrosine phosphorylation of trk receptors induced by varying concenl,alions of purified preparations of NGF, BDNF, NT-3 and NT-4. (A)Phosphorylation of trkA; (B) Phosphorylation of trkB; (C) rhosphorylation of trkC.
The effect of varying concentrations of purified pleparalions of NGF, BDNF, NT-3 and NT-4 on cell growth of NIH3T3 cells expressing (D) trkA;
(E)trkB and (F)trkC.
F~GURE29. The effect of varying concentrations of purified preparations of NGF, BDNF, NT-3 and NT-4 on parental PC12 cells and PC12 cells expressing trkB. (A)Differentiation as demonstrated by neurite eAlensioil.
(B) Number of surviving cells; (C) Tyrosine pl,ospho~lation assays.

W O 93/25684 ~ ~ 3 7 7 9 ~ PC~r/US93/05672 FK3URE 30. (A) Crosslinking of iodinated NGF to PC12 c~lls and rat postnatal day 7 striatal homogenates and competition with cold neurotrophins.
(B) Crosslinking of iodinated BDNF to3T3 trkB cells and rat postnatal day 7 5 cortex and competition with cold neurotrophins. (C) Crosslinking of iodinated NT-4 to 3T3 trkB cells and rat postnatal day 7 cortex and hippocampus and competition with cold neurotrophins.
FIGURE 31. Cell survival of embryonic E14 rat DRG explants in response to increasing concentrations of human NT-4.
FIGURE 32. Expl~ssion of trkB and trkC mRNA in ganglionic neurons surviving in the presence of NT-4.
FIGURE33. (A) Induction of fos mRNA in hippocampi from D18 rat embryos by purified neurotrophins.
(B) rl,osphorylation of trk in hippocampi from D18 rat embryos by 1 5 purified neu,ultophins.
FIGURE34. (A) The effect of NT-4 on the number of calbindin-immunopositive cells in l-ippor~."pal cultures.
(B) The effect of NT-4 and BDNF on the number of acetylcholinesterase-positive cells in h;ppoc~npal cultures.
2 0 FIGURE 35. The dose related effect of purified human NT-4 on choline acetyltransferase activity in cultures of basal forebrain neurons.
FIGURE 36. The effect of increasing concantrations of purified human NT-4 on tyrosine hydroxylase positive dopaminergic neurons of the rat embryonic substantia nigra. (A) NT-4 added on day 1; (B) NT-4 added on days 1 4 and 7.
FIGURE37. Effect of NT-4 treatment on calbindin-immunoreactive neurons in D17 striatal cultures at 8 days in vitro.
FIGURE38. Effect of NT-4 on high-affinity GABA uptake in E17 striatal cultures at 8 days in vitro.

W O 93/25684 ~ ~ PC~r/US93/05672 F~URE39. Effect of in~ as;ng concentrations of purified human N--4 on choline acetyltransferase activity in E14 rat motor neurons.
FIGURE40. Effect of CNTF or NT-3 alone or in combination with NT-4 on choline acetyltransferase activity in E14 rat motor neurons.
FIGURE41. Immunocytochemical staining of GABAergic neurons.
Cells were prepared as described and plated at 50,000 cells/cm2 in 35 mm culture dishes. After 3, 6 and 10 days (41A, 41B and 41C), cultures were processed for immunocytochemical staining using a polyclonal antiserum directed against recombinant feline GAD (courtesty Dr. A. Tobin (UCLA, CA).
41 D: control indicating lack of staining in 7 day cultures in the absence of antibody. Scale bar, 10011M.
FIGURE42. Effect of neurotrophins on GAD activity in mesencephalic cultures. Cells were prepared as described above and plated at ~0,000 cells/cm2 in 35 mm dishes. Upon media change after the initial attachment period, cultures were exposed to increasing concer,l,dlions of either BDNF, NT-3, or NT-4 (n=5 per group). All cultures were maintained for 7 days in vitro, and were than processed for the measurement of GAD as described.
GAD activity is expressed as a percentaga of the control value determined in untreated cultures. The baseline GAD activity in untreated control samples was calculated as 6.23 +/-0.39 pmol/120 min/llg protein. ~, p~0.01; ~p<0.05 compared to control using students t test.
FIGURE43. Effect of neurotrophins on high affinity GABA uptake.
Cells were ~,fepared as described above and plated at 50,000 cells/cm2 in 35 mm dishes. After the initial attachment period, the culture media was changed to a serum-free formulation, and BDNF, NT-3 or NT-4 were added in incleasi,)g cGncenl,alions. After 7 days, cultures were processed for the measurement of high-affinity GABA uptake as described. 43A: dose response curves for BDNF, NT-3 and NT-4. The GABA uptake activities are expressed as a percentage of the GABA uptake determined in control cultures. 43B: GABA uptake activity detcrmined in cultures which were WO 93/25684 ~ I ~ 7 7 ~ ! p~/US93/05672 -mainlained in the presence of either 25 ng/ml BDNF, 10nglml NT-3, 2.5 ng/ml NT~, 50 ng/ml NGF, or combinations of BDNF and NT-3 or NT-4 at these same concentrations. The baseline GABA uptake activity in untreated control cultures was calculated as 41,3581/- 2161 cpm/15 min/dish.
FIGURE44. BDNF, NT-3 and NT-4 increase the GABA content of mesencephalic cultures. Cultures were prepared as describ~d, and plated at 50,000 cells/cm2 into 35 mm dishes. Upon change to serum-free media, BDNF(50 ng/ml), NT-3 (10 ng/ml), NT-4 (2.5 ng/ml) or NGF(50 ng/ml) were added (n=6 per group). Cultures were mainained for 7 days before 1 0 being p,ucessed for GABA determination as described. The GABA content isexpressed as pg/~Lg protein. Data are the mean +/- sem ~, p<0.05 compared to control in students t test.
FIGURE45 Localization of trkB and trkC mRNA in adult rat subsl~nlia nigra. Dark field photomicrographs of coronal sections of adult 1 5 rat brain showing the autoradiographic localization of hybridization signal to mRNA encoding trkB (45B, 45C) and trkC (45D, 45F). 45A: schematic illustration of a cross section of the area of midbrain which is representative of the brain sectiol)s in panels B-F. At low may~ c~lion (45B), trkB mRNA
is detected in the ventral tegmental area (VTA) and medial s. nigra (SN).
45C: higher magnification of the righth hemisphere, ventral aspect of the tissue section shown in B. 45D: corresponding tissue section to that in C, hybridized to trkC cRNA. 45E, 45F: high magnification pair of matching bright field/dark field photomicrographs of the tissue section in D, showing the autoradiographic localization of trkC hybridization to large perikarya, presumed to be neurons. Scale bar=3125 ~Lm for B, 2185 llm for C and D, and 546 llm for E and F.
FIGURE46. Northern blot analysis of TrkB and TrkC mRNA in cultures derived from E14 ventral mesencepl,alon. Cells were plated at 50,000 cells/cm2 into 60 mm dishes. After maintainence in serum-free conditions for 72 hours, BDNF (50 ng/ml) or NT-3 (25 ng/ml) was added wo 93,25684~q~1 g~ PCl/US93/05672 and cultures maintained for 5, 16, 24 or 29 hours. Northern blots prepar~
from the cultures were probed for TrkB or TrkC m RNA. 46A:
autoradiogram of a blot following hybridization with the TrkB probe;
C=control, B=BDNF, TB=total adult rat brain RNA; 46B: the corresponding (to 46A) ethidium bromide stained gel; 46C: autoradiogram of a blot folowing hybridization with the TrkC probe; C=control, N=NT-3, TB=total brain RNA; 46D corresponding (to 46C) ethidium bromide stained gel.

5. DErAILED DESCRIPTION OF lHE INVENTION

The present invention provides for NT~ genes and proteins. It is based, at least in part, on the cloning, characterization, and expression of the NT~ gene.
In particular, the present invention provides for recombinant nudeic 1 5 acid molecules that encode NT-4. Such molecules comprise a sequence su~st~ntially as sst forth in Figure 1 (SEQ ID NO:1) for viper, Figure 1 (SEQ
ID NO:2), Figure 4 (SEQ ID NO:43) or Figure 8 (SEQ ID NO:49) for Xenopus NT-4, Figure 14 (SEQ ID NO:61) for rat NT-4, Figure 15 (SEQ ID NO:63), Figure 17 (SEQ ID NO:69) or Figure 18 (SEQ ID NO:75) for human NT-4, 2 0 Figure 20 (SEQ ID NO:93) and Figure 21 (SEQ ID NO:116) for a human NT-4 like sequence, or a sequence that is at least about seventy percent homologous to any such sequence, in which homology refers to sequence identity (e.g. a sequence that is 70 percen~ homologous to a second sequence shares 70 percent of the same nucleotide residues with the secol,d sequence).
In a particular aspect the present invention detailed in Example Section 8 and Figure 15 (SEQ ID NO:63, SEQ ID NO:64) herein, the nucleotide and amino acid sequence for a portion of a human neurolloph;n molecule is determin~d. In another aspect of the present inv~ntion detailed in Example Section 9 and Figure 17 (SEQ ID NO:69, SEQ ID N 0:70) and Figure 18 (SEQ

wo 93/25684 2 ~ ~ 7 ~ ~ 9 PCr/USs3/05672 ID NO:7~, SEQ ID NO:76) herein, the nucleotide and amino acid sequence for the entire human neurotrophin molecule is determined. In another aspect of the present invention detailed in Example Section 9 and Figure 20 (SEQ ID
NO:93, SEQ ID NO:94) and Figure 21 (SEQ ID NO:116, SEQ ID NO:117) herein, the nucleotide and amino acid sequence for a portion of a human genomic phage clones, 2-1 and 4-2, respectively, which are similar but not identical to the nucleotide and amino acid sequence described in Figure 18 (SEQ ID NO:75), are detailed. While such human neurotrophin molecule is referred to herein as human neurotrophin-4, it should be understood that such a molecule may be the human homologue of the Xenopus neurotrophin-4 described herein, or alternatively, a distinct yet homologous neurotrophin molecule. Similarly, the molecula referred to herein as rat NT-4 may be the rat homologue of NT-4, or alternatively, a distinct yet homologous neurotrophin molecule. The methods and compositions of the present invention do not depend on any single nomenclature.
The present invention also providas for subsPntially purified NT-4 protein or peptide molecules Such molecules may comprise a sequence sui,~ ,lially as set forth in Figure 2, (SEQ ID NO:1 and SEQ ID NO:2), Figure 4 (SEQ ID NO:44) Figure 8 (SEQ ID NO:50), Figure 14 (SEQ ID NO:62), Figure 15 (SEQ ID NO:64) Figure 17 (SEQ ID NO:70), Figure 18 (SEQ ID NO:76), Figure 20 (SEQ ID NO:94) and Figure 21 (SEQ ID NO:117) for NT-4, or a sequence that is at least about seventy percent homologous to any such sequence. In Ad~lilional nonlimiting specific embodiments of the invention, a substantially purified protein or peptide comprises the sequence KCN~il IH (SEQ ID NO:96). In another embodiment of the invention, a subst~ntially purified peptide or protein comprises the sequence H~VD
(SEQ ID NO:97). In yet another embodiment of the invention, a substantially purified peptids or protein comprises the sequence KQWIS (SEQ ID NO:98).
In a further embodiment of the invention, a slJbslznlially purified peptide or 3 0 protein comprises the sequence KQSWR (SEQ ID NO:99). In yet another W0 93/25684 ~3~ 9 PCI/US93/05672 em iment of the invention, a substantially purified peptide or prote comprises the sequenceGK~(GGG (SEQID NO:100), where X represents one of the set of 20 amino acids. In a related embodiment of the invention, a subsPntially purified peptide or protein comprises the sequence GPGVGGG
(SEQ ID NO:101) orGPGAGGG (SEQ ID NO:102). In a further embodiment of the invention, a substantially purified peptide or protein comprises the sequence ESAGE(SEQ ID NO:103). In yet a further embodiment of the invention, a substantially purified peptide or protein comprises the sequence DNAEE(SEQID NO:104).
1 0 The proteins and peptides of the invention may be produced by chemical synthesis using standard techniques or may be produced using the NT~-encoding nucleic acid molecules of the invention, using prokaryotic or eukaryotic ex,uression systems known to one skilled in the art, such as those described in PCT application PCT/US90/04916, filed August 29, 1990, published as WO 91/03569, which is incorporated by reference in its entirety herein, or as exempiified infra (see Section 6.2.4., infra, and Figure 5) for transient e~cpression in COS cells.
The present invention also provides for the use of NT-4 in promoting the growth and/or survival of cells of the nervous system, in particular, but not limited to, dopaminergic neurons, cholinergic neurons, sensory neurons, striatal cells, cells of the cortex, striatum, hippocampus, cerebellum, olfactory bulbs, periaqueductal gray, raphe nucle, locus coeruleus, dorsal root ganglion, neural placode derivatives, sympathetic neurons and upper and lower motor neurons.
The presenl invention also provides for portions of NT-4 nucleic acid or amino acid sequence, suL:,lArllially as set forth for NT-4 in Figure 1, 2, 4,8, 14, 15, 17, 18, 20 or 21 (SEQ ID NO's listed, supra) that are not iden~ical to portions of BDNF, NGF, or NT-3 of sul~st~,lially th2 same size.
The prssent invention further provides for a eukaryotic or prokaryotic cell that contains r~combinant nucleic acid that encodes NT-4 WO 93/25684 ~1~3 1'19 9 PCr/US93/05672 and that expresses recombinant NT-4 protein. In a specific embodiment the cell is a eukaryotic cell, such as a COS cell. Accordingly, the present invention also provides for recombinant NT-4 protein or peptide that is produced by inserting recombinant nucleic acid encoding NT-4 into a cell (e.g., by transfection, transduction, electroporation, microinjection, etc.) under conditions which permit expression of NT-4 and then isolating NT-4 from the cell.
In addition, the present invention provides for molecules produced by PCR using, for example, the following oligonucleotides as primers:
5'CAGTAI I I I IACGAMCC(SEQ ID NO:105) and3~ilCI 1~31 1 IGGCI I IACA
(SEQ ID NO:106) for human NT-4 and 5'CAGTA I I I I I ACGAGACG (SEQ ID
NO:107)and3'CGATTGlllGGC~llACA(SEQlDNO:108) for rat NT-4, and using any suitable genomic or cDNA as template. In a specific embodiment of the invention, these primers may be used in conjunction with human cDNA
as template to produce fragments of the human NT-4 gene that are suitable for cloning.
The production and use of derivatives, analogues, and peptides related to NT-4 are also envisioned, and within the scope of the present invention. Such derivatives, analogues, or peptides which have the desired 2 0 neurotrophic activity, immunogenicity or antigenicity can be used, for example therapeutically, or in immunoassays, for immunization, etc.
Derivatives, analogues, or peptides related to NT-4 can be tested for the desired activity by procedures known in the art.
The NT-4 related derivatives, analogues, and peptides of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level. For example, the cloned NT-4 gene can be modified by any of numerous strategies known in the art (Maniatis, T., 1982, Molecul~r Cloning, A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The NT-4 sequence can be cleaved at appropriate sites with WO 93/25684 PCI`/US93/05672 re~tf~ e~ndonuclease(s), followed by further enzymatic modification desired, isolated, and ligated in vitro. In ths production of the gene ~ncG13ing a derivative, analogue, or peptide related to NT-4, care should be taken to ensure that the modified gene remains within the same 5 translational reading frame as NT-4, uninterrupted by translational stop signals, in the gene region where the desired NT-4-specific activity is encoded.
Additionally, the NT-4 gene can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, 10 or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site-directed mutagenesis (Hutchinson, C., et al., 1978, J. Biol. Chem. 253:6551), use of TAB~ linkers (Pharmacia), 1 5 etc.
As disa~ssed infra, the prepro or mature coding region of NT-4 may be utilized to construct neu,Gl,ophin based chimeric genes. For example, neurotrophin genes, including but not limited to NGF, BDNF and NT-3, can provide the prepro region for construction of neurotrophin prepro/NT-4 20 mature coding region chimeric genes.
Manir~ tions of the NT-4 sequence may also be made at the protein level. Any of numerous chemical modifications may be carried out by known techniques, including but not limited to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, 25 acetylation, formylation, oxidation, reduction, metabolic synthesis in the presenc~ of tunicamycin, etc.
In addition, analogues and peptides related to NT-4 can be chemically synthesi~ed. For 2xample, a peptide corresponding to a portion of NT-4 which me~i~tes ths desired neufol,ophic activity can be synthesized by use 3 0 of a peptide synthesizer.

W O 93/25684 ~ 1 ~ 7~ ~ ~ PC~r/US93/05672 O The present invention further provides for a method of treating fertility disorders related to ovarian/oocyte dysfunction. As shown in the examples infra, in particular, Section 7,NT-4is involved in the maturation of oocytss. The discussicn of Section 7.3 demonstrates that NT-4is produced by oocytes, is concentrated in immature rather than mature oocytes, and appears to play a roie in oogenesis. The putative function of NT-4 protein in the ovary appears to be coupled to events occurring in the pre-vitellogenic and early/mid vitellogenic oocyte.
It has been established that other members of the BDNF/NGF/NT-3 gene family, in particular NGF, are involved in meiotic maturation (Nebrada et al., 1991, Science, 252:558-563). Rec~lJsQ NT-4 has exhibited properties similar to NGF (see Section 6, infra) it may be used as a factor involved in the regulation of oocyte development. These properties of NT-4 can be exploited to provide a method for treating infartility disorders and/or other ovarian dysfunctions ~csocieted with oogenesis.
Therefore, in accordance with the invention a method of treating infertility disorders and/or other ovarian dysfunctions comprising administering a therapeutically effective amount of NT~ or an NT-4 related peptide in a pharmaceutically effective carrier is provided. A tharapeutically effective amount is one which induces proper maturation of an oocyte and/or ovulation. For example, a therapeutically effective dose may be one sufficient to maintain circulating serum levels of NT-4 at a concentration of from about 1 to 100 x 10-10M. Establishing additional effective doses is within the purview of one skilled in the art.
2 5 In various embodiments of the invention, NT-4 protein, peptide fragments or derivatives can be administersd to patiants in whom the nervous system has been damaged by trauma, surgery, ischemia, i"~ection, metabolic dise~-~e, nutritional dt:fic;G.-cy, malignancy, or toxic agents. The invention in particular can be used to treat conditions in which damage has 30 occurred to neurons in the basal forebrain, hippocampus or striatum. In WO 93/25684~ 9~ PCr/US93/05672 addition, it can be used to treat conditions in which damage degeneration has occurred to spinal sensory neurons, cranial sensory neurons involved in hearing, taste, vision, balance, etc., motor neurons or retinal cells, by administering effective~therapeutic amounts of NT~ protein or peptide fragments or derivatives. Such uses include, but are not limited to, treatment of retinal detachment, age related or other maculopathies, photic retinopathy, surgery-induced retinopathy, retinopathy of prematurity, viral retinopathy, uvetis, ischemic retinopathy due to venous or arterial occlusion or other vascular disorders, retinopathy due to trauma or penetrating lesions of the eye, peripheral vitreoretinopathy or inherited retinal degeneration.
In various specific embodiments of the invention, NT~ can be locally administered to sensory neurons which have been severed, including, but not limited to, neurons in dorsal root ganglia or in the retina. It may be desirable to administer the NT-4-related peptides or NT-4 protein by adsorption onto a membrane, e.g. a silastic membrane, that could be implanted in the proximity of the severed nerve. The present invention can also be used for example in hastening the recovery of patients suffering from peripheral neu-opall,ies.
In further embodiments of the invention, NT-4 protein or peptide fragments or derivatives derived therefrom, can be used to treat congenital conditions or neurodegenerative disorders, including, but not limited to, Alzheimer's dise~e, Parhil)son's ~ise~ce~ P~hi"son-Plus syndromes (in which P~klnsonian symptoms result from degeneration of dopaminergic neurons), such as Progressive Supranuclear Palsy (Steele-Richardson-Olszewski Syndrome), Olivoponto- cerebellar Atrophy (OPCA), Shy-Drager Syndrome (multiple systems atrophy), and Guamanian Pa"~ sonism dementia complex, and Huntington's chorea; in particular, the invention can be used to treat congenital or neurodegenerative disorders associated with sensory nerve dysfunction and degenerative dise~ces of the retina. For example, the NT-4 WO 93/25684 2 ~ PCI`/US93/05672 protein, or peptide fragments, or derivatives of the invention can be used in the treatment of hereditary spastic paraplegia with retinal degeneration (Kjellin and Barnard-Scholz syndromes), retinitis pigmentosa, Stargardt dise~-ce~ Usher syndrome (retinitis pigmentosa with congenital hearing loss), 5 and Refsum syndrome (retinitis pigmentosa, hereditary hearing loss, and polyneuropathy), to name but a few. It is possible that a defect in NT-4 synthesis or responsiveness may be the underlying etiology for syndromes characterized by a combination of retinal degeneration and other sensory dysfunction.
In a specific embodiment of the invention, administration of NT-4 protein, or peptide fragments or derivatives derived therefrom, can be used in conjunction with surgical implantation of tissue in the treatment of Alzheimer's ~lise~se and/or P~kinson's ~lise~e. As ~iscussed in Section 18 NT4 may be used to promote the survival of dopaminergic neurons 15 of the subst~ntia nigra in a dose-dependen~ manner, supporting the use of NT-4 in the treatment of disorders of CNS dopaminergic neurons, induding, but not limited to, P~,hil1son's dice~ce. In addition, NT-4 has been observed to sustain the survival of CNS cholinergic neurons (Section 17) and, in particular, basal forebrain cholinergic nsurons, indicating that NT-4 may be 20 useful in the treatment of disorders involving cholinergic neurons, induding, but not limited to Alzheimer's disease. It has been shown that approximately 35% of patients with Parkinson's disease suffer from Alzheimer-type dementia; NT-4 produced according to the invention may prove to be a useful single agent therapy for this disease complex.
2 5 Similarly, NT-4 produced according to tha invention may be used therapeutically to treat Alzheimer's dise~ce in conjunction with Down's Syndrome. NT-4 producsd accordin~ to the invention can be used in the treatment of a variety of dementias as well as congenital learning disorders.
In another specific embodiment of the invention, the administration of 30 NT-4 protein or peptide fragments or derivatives derived therefrom can be W 0 93/25684 ~ PC~r/US93/05672 used for the treatment of f~ise~es or disorders which involve striatal c~
which include, but are not limited to Huntington~s chorea, striatonigral degeneration and cerebral palsy. This is based on the disclosure herein (Section 19) indicating the ability of NT-4 to support striatal cultures, as 5 indicated by an increase in calbindin immunoreactivity and a high affinity uptake of GABA. A dramatic decrease in calbindin and calbindin mRNA has bsen detected in the striata of Huntington's chorea patients [Kiyama et al, Brain Res. 525:209-214 (1990); lacopino et al Proc. Natl. Acad. Sci.
87:4078-4082 (1990)].
1 0 In another embodiment of the invsntion, the administration of NT-4 protein or peptide fragments or derivatives derived therefrom can be used for the treatment of other diseases or disorders which are related to damage or degensration of striatal or hippocampal cells. Such dise~es or disorders may be caused by, for example, stroke, ischemia, hypoglycemia or 1 5 hypoxia.
In yet another embodiment of the invention, NT-4 may be admin;;,lered in the treatment of epilepsy-related or other seizures. Reduced Isvels of the inhibitory transmitter GABA are known to be associated with seizures. For example, high doses of penicillin, which reduce GABA levels, can 20 be used to induce Qxperimsntal focal epilepsy. Adminisration of the GABA
agonist muscimol into the area of the sul,~ rllia nigra has been shown to markedly suppress motor and limbic seizures (as measured electrographically) induced by electrical stimulation. McNamara, J. et al., 1984, J. Neurosci. 4:2410-2417. Accordingly, the present invention 25 contsmplates use of the neurotrophins, including NT-4, to enhance levels of GABA and thereby prevent the motor mani~e~lalions of seizures.
Effective doses of NT-4 or an NT-4 related peptide formulated ~
suitable pharmacological carriers may be administered by any appropriate route including but not limited to injection (e.g., intravenous, intraperitoneal, 3 0 intramuscular, subcutaneous, etc.), by absorption through epithelial o r WO 93/25684 2 1 3 7~ ~ PCI/US93/05672 mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.); etc.
In addition, NT-4 or NT-4 peptide may be used in any suitable pharmacological carrier, linked to a carrier or targeting molecule (e.g., 5 antibody, hormone, growth factor, etc.) and/or incorporated into liposomes, microcapsules, and controlled release preparation prior to adminislfalion in vivo.
Each respective mammalian NT-4 DNA sequence can be utilized as a 32P-labelled probe to isolate a respective genomic and cDNA clone via the 10 procedures outlined in the Materials and Methods portion Section 8, infra.
The rat NT-4 and human NT-4 gene fragments may be utilized directly (as 32P-labelled probes) or indirectly (to deduce a PCR strategy as described infra) to isolate other mammalian NT-4 genomic and cDNA clones, based on the unique nature of the 7 amino acid insertion in the rNT-4 and hNT-4 15 coding region, or other unique ~pects of the rat or human NT-4 coding region.
Any mammalian NT-4 gene isolated via the information disclosed by the rat and human NT~ sequence may be utilized in, although is not limited to, the various manipulations rliscussed for Xenopus NT-4. For example, the 20 proteins and peptides of mammalian NT-4, subse~uent to characterization of the full length gene as rliscussed in Example Section 9, may be produced using the respective mammalian NT-4 molecules in a prokaryotic or a eukaryotic ex~.ression system known to one skilled in the art, such as those described in PCT application PCT/US90/04916, filed August 29, 1990, published as W091/03569, or as exemplified infra (see Section 6.2.4., supra, and Figure 5) for transient ex~.ressiol) inCOS cells. Additional functions for mammalian NT-4, as described infra for Xenopus NT-4, include, but are not limited to: the promotion of growth and/or survival of cells of the nervous system, in particular, but not limited to, cells of dorsal root ganglion or neural placode derivatives (see Section 6.2.4., and Figure 6, for example), WO 93/25684 7~ PCI/US93/05672 treating fertility disorders related to ovarian/oocyte dysfunction (se--Section 7), the treatment of infertility disorders andtor other ovarian dysfunction associated with oogenesis (see Section 6), the treatment of motor neuron diseases (see Section 10), the treatment of an epitheliac hyperplasia such as benign prostatic hypertrophy (see Section 10), the treatment of impotence as related to prostate gland function (see Section 10) and, therefore, the therapeutically effective amounts of mammalian NT-4 for the treatment of said disorders as formulated in suitable pharmacological carriers to provide a pharmaceutical composition may be administered by any appropriate route including but not limited to injection (e.g., intravenous, intraperitoneal, intramusuJl~r, subcutaneous, etc.), by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and inles~inal mucosa, etc.); etc.
In addition, rat, human or other mammalian NT-4 or NT-4 peptide may be used in any suitable pharmacological carrier, linked to a carrier or targeting molecule (e.g., antibody, hormone, growth factor, etc.) and/or incorporated into liposomes, microcapsules, and controlled release preparation prior to administration in vivo.
In addition, the present invention, which relates to nucleic acids encoding NT~ and to proteins, peptide fragments, or derivatives produced therefrom, as well as antibodies directed against NT-4 protein, peptides, or derivatives, may be utilized to diagnose or monitor the progression of dise~ces and disorders of the nervous system which are associated with alterations in the pattern of NT-4 exl,-ession. Such alterations can be a decrease or increase relative to that in normal patients, preferably, or in other samples taken from the patient, or in samples from the same patient taken at an ~arlier time.
In various embodiments of the invention, NT-4 genes and related nucleic acid sequences and subsequences, including complementary sequences, may be used in diagnostic hybridization assays. The NT-4 W O 93/25684 ~ 7 ~ ~ PC~r/US93/05672 nucleic acid sequences, or subsequences thereof comprising about 15 nucleotides, can be used as hybridization probes. Hybridization assays can be used to detect, prognose, diagnose, or monitor conditions, disorders, or dise~-se states ~csoci~ted with changes in NT-4 levels. For example, the 5 data presented in Example Section 10 discloses tissue specific expression of human NT-4 in skeletal muscle as well as the prostate gland, thymus and testes. The level of expression of human NT4 in the muscle tissue may be indicative of the presence or absence of neuronal degradation. Therefore, poly(A)+ mRNA or total RNA from a tissue sample of a patient could be 10 assayed for the presence of human NT-4 mRNA in skeletal muscle tissue.
Additionally, the data presented in Example Section 10 discloses tissue specific ex,uression of NT-4 in the human proslale gland. DNA sequences encoding NT-4 or a portion thereof, as well as NT-4 protein or a peptide may be useful as a therapeutic agent to treat proslate ~lise~e.
In a similar method, diagnostic assays can bs immuno~cs~ys. Thus, antibodies can be used in immunoassays to quantitate the level of NT-4 in a sample from a patient, in order to detect, prognose, diagnose, or monitor conditions, disorders, or dise~ce states associated with changes in NT-4 levels.
The immunoassays which can be used include but are not limited to competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), ~sandwich~ immunoassays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-2 5 fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, and immunoelectrophoresis assays, to name but a few.
Anti NT-4 antibody fragments or derivatives containing the binding domain may also be used in such assays.

W093/25684 ?.,~ 9~ PCr/US93/05672 Antibody fragments which contain the idiotype of the molecule can b~
generated by known techniques. For example, such fragments include but are not limited to: the F(ab')2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of and the Fab fragments which can be generated by treating.the antibody molecule with papain and a reducing agent.
Diagnostic kits are also provided. For example, such a kit can comprise in a suitable container an NT-4 specific probe. In one embodiment, the probe is an antibody specific for NT-4. In another embodiment, the probe is a nucleic acid (molecular probe) capable of hybridizing to an NT-4 nucleic acid sequence. The probe can be detectably labeled; alternatively, the kit can further comprise a labeled specific binding partner for the probe.
The above-described hybridization assays and immunoassays can also be used to quantitate NT-4 levels as an indication of therapeutic efficacy, by comparing the levels in patient samples before and after treatment of a disorder, particularly, a motor neuron disease.
In an analogous fashion, tha expression of human NT-4 mRNA in muscle tissue leads to potential methods of treating motor neuron disorders comprising administering to a patient in need of such treatment an effective amount of an NT-4 factor to support the survival, growth, and/or differentiation of motor neurons. Expression of NT-4 mRNA in human muscle suggests further avenues for diagnosing and treating neuron disorder~. Retrograde axonal transport of NT-4 has been demonstrated in both the central and peripheral nervous system (see Section 14, ~f~.) The specific retrograde transport of NT-4 can be used to indicate whether neurons are responsive to NT~ in normal or diss~ed states. Therefore, the pressnt invention provides for a method of diagnosing NT-4 related motor neuron, central and peripheral nervous system disorders comprising injecting a detectably labeled NT-4 protein or peptida into a nerve and WO 93~25684 2 1 ~ ~ 7 ~ ~ PCI/US93/05672 determining whether the labeled NT-4 protein or peptide is retrogradely transported, in which a failure to be retrogradely transported positively correlates with lack of responsiveness to NT-4 and indicates the presence of a nervous system disorder that is NT-4 related. Evaluation of 5 retrograde transport may be performed by any method known in the art, including but not limited to MRI, CAT, or scintillation scanning. Such methods may be used to identify the location of a nervous system lesion, as retrograde transport should subsl~nlially diminish upon reaching the lesion.
The invention further provides kits for such retrograde evaluation 10 comprising in a container a detectably labeled NT-4 protein, derivative or fragment. Such a label can be a r~d;Q~r,tive isotope, or other label known in the art.
The present invention may be utilized to treat diseases and disorders of the nervous system which may be associated with alterations in the 15 pattern of NT-4 ex~.ression or which may benefit from exposure to NT-4 or anti-NT-4 antibodies (or fragments thereof containing the binding domain).
We show that human NT-4 is expressed in skeletal muscle (See Example Section 10, infra). Based on this discovery, the invention provides for the treatment of motor neuron diseases. A wide array of neurological 20 disorders may affect motor neurons. Upper motor neurons, for example, are predominantly affected by cerebrovascular accidents, neoplasms, infections and trauma. Lower motor neurons, or anterior horn cells, are secondarily affected by these processes, but in addition are subject to a number of d;sorders in which anterior horn cell loss is the primary feature, 25 including amyotrophic lateral sclerosis, infantile and juvenile spinal muscular atrophy, poliomyelitis and the post-polio syndrome, hereditary motor and sensory neuropathies, and toxic motor neuropathies (e.g. vincristine). The disorders of motor neurons which can be traated according to the present invention include but are not limited to the foregoing. Methods of 30 formulation and adminislfa~ion of NT-4 protein, derivatives, fragments, or W0 93/2568~'3 PCI/US93/05672 antibodies thereto which can be used include but are not limited to thos--disclosed supra or known in the art.
The invention may also be utilized to treat benign prostatic hypertrophy (BPH), a common yet poorly understood condition occurring mostly in males over 50 years of age. The proliferation of the prostrate during BPH may be induced by a growth factor such as NT-4 through an autocrine loop phenomenon. Synthesis and excretion of NT-4 would be followed by transport of NT-4 back into the prostate cell via a specific receptor on the proslale cell membrane. Autocrine loops have been defined for various growth factor molsculQs and tumor cell lines. In some cases, these autocrine loops have been experimentally defined by the use of antisense approaches for the disruption of the autocrine loop. Therefore, a therapeutic application of the present invention includes the use of a nucleic acid anti-sense to human NT-4 or a portion thereof to inhibit translation of NT-4 mRNA in the prostate, (for procedures which can be used, see copending U.S. Application Serial No. 07/728,784 filed July 3, 1991 and incorporated by reference herein in its entirety). For example, a patient suffering from a prostate localized disease characterized by increased transcription in prostate tissus of an NT-4 gene relative to that of transcription levels of the NT-4 gene in the prostate of normal patients could be administered an effective amount of an oligonucleotide to treat a prostate disease, preferably benign prostatic hypertrophy. The oligonlJc'eotide should be at least 6 nucleotides in length, complementary to a least a portion of the RNA transcript of the NT~ gene and, hence, being 2 5 capable of hybridizing to the NT-4 transcript. Additionally, anti-NT-4 antibod;Qs may be utilized to inhibit bindil)g of NT-4 to its specific receptor on the proslale cell membrane. A therapeutically effective amount of either an NT-4 anlisense nucleic acid or an anti-NT-4 antibody may be delivered in any fashion deso~ibed supra.

WO 93/25684 PCr/US93/05672 Th~ invention may also be u~iz7d to treat other prostate relateddysfunctions, specifically impotence. Such a malady may be the direct or indirect result of in~de~lu~te levels of NT~ in the prostate. Therefore, both the detection of the dysfunction as well as treating the patient for impotence via application of a therapeutically effective amount of NT-4 protein or a functional fragment or derivative of NT-4 may be delivered by any method desc,ibed supra.
The present invention discloses the detection of NT-4 expression in human thymus tissue. Therefore, the invention may also be utilized to treat immunological disorders affecting neuromuscular transmission, including but not limited to myasthenia gravis, an acquired autoimmune disorder associated with the acetylcholine receptor (AChR) within the postsynaptic folds at the neuromuscular junction. The disease manifests itself as weakness and muscular fatigue due to blockage of post-synaptic AChR or 1 5 muscle membranes by binding of antibodies specific to the AChR. (See, e.g., Drachman, 1983, Trends Neurosci. 6:446-451). Treatment of such immunological mediated neurological disorders may include therapeutic applications of the NT-4 protein or a functional fragment or derivative of NT-4, delivered by any of the methods desc,ibed supra.
The present invention provides for a method of treating motor neuron disorders comprising administering, to a patient in need of such treatment, an effective amount of an NT-4 protein, derivative or peptide fragment capable of supporting the survival, growth and/or differentiation of motor neurons as demonstrated in an in vitro culture system.
2 5 In in vitro embodiments, effective amounts of neurotrophic factor may desirably be determined on a case by case basis, as motor neurons from di~rerent tissue sources or from different species may exhibit different sensitivities to neurotrophic factor. For any particular culture, it may be desirable to construct a dose response curve that correlates neurotrophic 30 factor concentration and motor neuron response. To evaluate motor WO 93/25684~ 9 PCI/US93/05672 neuron survival, growth, andlor differentiation, one can compare mot--neurons exposed to an NT-4 protein, derivative or peptide fragment to motor neurons not exposed to an NT-4 protein, d~rivative or peptid~
fragments, using, for example, vital dyes to ~valuate survival, phase-contrast microscopy and/or neurofilament stain to measure neurite sprouting, or techniques thàt measure the bioactivity of motor neuron-associated compounds, such as choline acetyltransferase (CAT), or any other methods known in the art. CAT activity may be measured, for example, by harvesting and Iysing trea~ed and untreated motor neurons in a 1 0 20 mM Tris-HCI (pH 8.6) solution containing about 0.1% Triton X-100, removing an aliquot of several microliters, and measuring for CAT activity using, as a substrate, 0.2 ml ~1 - C] acetyl-CoA, 300 mM NaCI, 8 mM
choline bromide, 20 mM EDTA, and 0.1 mM neostigmine in 50 mM NaH2PO4 (pH 7.4) buffer, using the micro-Fonnum procedure as described in Fonnum, 1 5 1975, J. N~ufoche",. 24:407-409, incorporated by reference in its entirety herein.
In a specific, non-limiting embodiment of the invention, motor neurons may be prepared, and cultured in vitro, as follows. At Isast a portion of a spinal cord, preferably obtained from an embryonic organism such as a rat, may be ~ceptic~lly obtained and separated from the bulb, sensory ganglia, and adhering meninges. The ventral segments of the cord may then be isolated, as motor neurons are localized in the ventral (anterior) horns of the spinal cord. Ventral cord segments may be diced into small pieces and incubated in about 0.1%trypsin and 0.01% deoxyribonucleasetype 1 in calcium and magnesium-free phosphate buffered saline (PBS) at 37C for about 20 minutes. Thc trypsin solution may then b~ removed, and the cslls may be rinsed and placed in fresh medium, such as 45% Eagle's minimum esser,lial (MEM), 45% Ham's nutrient mixture F12, 5% heat inactivated fetal calf serum, 5% heat inactivated horse serum, glutamine (2 mM), penicillin G
(0.5 U/ml), and streptomycin (0.5 g/ml). The tissue may be m~chanically W O 93/25684 ~ 1 3 7 ~ ~ $ PC~r/US93/05672 dissociated by gentle trituration through a Pasteur pipet, and the supernatants pooled and filtered through a nylon filter (e.g. Nitex, Tetko; 40 m). The filtered cell suspension may then be fractioned using a modification of the method set forth in Schnaar and Schaffner (1981, J. Neurosci. 1:204-5 217). All steps are desirably carried out at 4C. Metrizamide may be dissolved in F12:MEM medium (1:1) and a discontinuous gradient may be esPhlished that consists of a 18% mel,i~a",ide cushion (e.g. 0.5 ml), 3 ml of 17% metrizamide, 3 ml of 12% metrizamide, and 3 ml of 8%
metrizamide. The filtered cell suspension (e.g. 2.5 ml) may be layered over the step gradient and the tube may be centrifuged at 2500 9 for about 15 minutes using a swing-out rotor (e.g. Sorvall HB4). Centrifugation may be expected to result in three layers of cells: fraction I (at 0-8% interface), fraction ll (at 8-12% interface) and fraction lll (at 12-17% interface).
Fraction 1, enriched for motor neurons, may be removed in a small volume 15 (e.g. about 1 ml) and rinsed twice with a serum-free defined medium such as 50% F12 and 50% MEM s~ppl~mented with glutamine (2 mM), insulin (5 g/ml), transferrin (100 g/ml), progesterone (20 nM), putrescine (100 M), and sodium selenite (30 nM, see B~llenslein and Sato, 1979, Proc. Natl.
Acad. Sci. U.S.A. 76:514-517). Viable cell count may then be obtained by 20 hemocytometer counting in the presence of trypan blue. The motor neuron enriched cell suspensiG" may then be plated at a density of about 100,000 cells/cm2 in tissue culture wells (preferably 6 mm) precoated with poly L-~r"ill,ine (e.g. 10 g/ml) and laminin (e.g. 10 g/ml). An NT-4 protein, derivative or peptide factor may then be added. For example, in specific 25 embodiments, NT-4 may be added to achieve a final concentration of between about 0.01 and 100 ng/ml, and preferably about 50 ng/ml. The motor neuron cultures may then be maintained in serum-free defined medium at 37C in a 95% air/5% CO2 al",osphere at nearly 100% relative humidity.
In a further embodiment of the invention, the NT-4 related 3 0 recombinant nucleic acid sequence, such as co--lained in bacteriophage HG7-W093/25684 ~ 9~ ` ~ PCI`/US93/05672 2, 7~G4-2, and/or HG2-1, may be utilized to construct chimel--prepro/mature NT-4 genes. For example, when it is desired to express a mature NT~ protein, derivative or peptide fragment in vivo or in vitro, one can fuse the pre-pro region of a distinct neurotrophic gene to the mature coding region of the NT4 related sequence. The neurotrophic genes which can provide the prepro region include but are not limited to NGF, BDNF, and NT-3. Such a chimeric construct may promote increased stability of the chimeric mRNA transcript in relation to a wild type NT-4 mRNA transcript, may increase translational efficiency or may generate a more suitable 1 0 template for proteolytic processing to a mature, biologically active neurotrophin protein or peptide fragment, thus increasing ex~,ression. One of ordinary skill in the art possesses the requisite knowledge to construct such chimeric nucleic acid sequences, given the published DNA sequences of other neurotrophin genes such as NGF (Scott et al., 1983, Nature 302: 538-540; Ullrichetal., 1983, Nature 303:821-825), BDNF(Leibrock etal., 1989, Nature 341:149-152) and NT-3 (Hohn et al., 1990, Nature 344:339-341;
Maisonpierre et al., 1990 Science 247:1446-1451; Ernfors et al., 1990, Proc.
Natl. Acad. Sci. USA 87:5454-5458; Rosenthal et al., 1990, Neuron 4:767-773), as well as guidance as to strategies for generating a fusion junction (for example, see Darling et al., 1983, Cold Spring Harbor Symposium Quantative Biology 48:427-434; Edwards et al., 1988, J. Biol. Chem.
263:6810-6815; Suter et al., 1991, EMBO J. 10:2395-2400). in another embodiment, chimeric constructions fusing the pre-pro region of an NT-4 related recombinant nucleic acid, such as con~ained in bacteriophage HG7-2, HG4-2 and HG2-1, to the mature regions of other neurotrophins, can also be used to promote efficient expression of such other neurotrophins, as liscu~sed supra.
The present invention also provides methods of detecting or measuring NT-4 activity. As described in Example 12, we have discovered that trkB is a functional receptor for NT~. Based on this discoYery, the WO 93/25684 2 1 3 7 7 ~ ~ PCI/US93/0~672 invention provides methods for detecting or measuring NT-4 activity comprising exposing a cell that expresses trkB to a test agent, and detec~ing or measuring binding of the test agent to trkB, in which specific binding to trkB positively correlates with NT~ activity in the test agent. In 5 a specific embodiment, the cell that expresses trkB is a transfected cell such as a 3T3 fibroblast, which expresses recombinant trkB, such that the survival of the cell is dependent upon exposure to neurotrophin-4 or BDNF.
Thus detecting of binding of the test agent can be carried out by observing the survival of such transfected cells.

6. EXAMPLE: EVOLUllONARY STUDIES OF THE
NERVE GROWrH FACTOR FAMILY REVEAL A
NOVEL M~RFP~ ABUNDANTLY EX~ .SS~
IN XENOPUS OVARY

6. 1. MATERIALS AND METHODS

6.1 .1 . DNA PREPARATION

Genomic DNA was isolated by standard procedures (Davis et al., 1986, ~Basic Methods In Molecular Biology~, Elsevier, New York)) from human leukocytes and from liver of Sprague-Dawley rat, frog (Xenopus laevis) and ray (Raja clavata). Genomic DNA was also obtained from salmon (Salmon) and from the elephant snake (Vipera lebetina). The DNA
was precipitated with ethanol, collected using a glass hook, washed in 80%
ethanol, dried and dissolved in water to a final concentration of 1 mg/ml.
Salrnon DNA (Sigma, St. Louis, MO) was dissolved in water, extracted twice with phenol and once with chloroform, and precipit~ted with ethanol.

W O 93/25684 PC~r/US93/05672 6.1 ~ RASE CHAIN REACTIONS, MOLECULAR
CLONING AND DNA SEQUENCING
Six separate mixtures of 28-mer oligonucleotides representing all 5 possible codons corresponding to the amino acid sequence KQYFYET(SEQ
ID NO:110) (5'-oligonuclaotide) and WRFIRID (SEQ ID NO:111) (3'-oligonucleotide) (Fig. 1A) were synthesized on an Applied Biosystem A381 DNA synthesizer. The 5' oligonucleotide contained a synthetic EcoRI site and the 3'-oligonucleotide contained a synthetic Hindlll site (Knoth et al., 1988, 1 0 Nucl. Acids Res. 16:1093; Nunberg et al., 1989, J. Virology 63:3240-3249).
Each mixture of oligonucleotides was then used to prime the amplification of 0.8 9 of genomic DNA using the polymerase chain reaction (PCR) (Taq DNA
polymerase, Promega) (Saiki et al., 1985, Science 230:1350-1354). The PCR
products were restricted with Hindlll and EcoRI, analyzed on a 2% agarose 1 5 gel and cloned into plasmid Bluescript KS+ (Stratagene, La Jolla,CA). The size of th2 amplified region plus primers is 179 base pairs (bp) for NGFand 182 bp for BDNF and NT-3. As a result of internal EcoRI sites in some cases, shorter fragments of 144 bp and 95 bp were also isolated. The cloned DNA fragments were sequenced using the dideoxy nucleotide chain 2 0 t~rmination method (Sanger st al., 1977, Proc. Natl. Acad. Sci. U.S.A.
74:5463-5467) with T7 DNA polymerase (Pharmacia, Upps~l~). Between 2 and 20 independent clones were sequenced for each gene and species, and altogether mor~ than 200 independent clones were sequenced.
Approximately 2,000,000 clones from a Xenopus genomic library prepared by insertion of Mbol-digested genomic DNA in the BamHI site of phasa ~lEMBL-3 were screened using conventional procedures with a 182 bp PCR fragment of Xenopus NT-4 labeled with l -32PldCTP by nick translation to a specific activity of approximately 5 x 108 cpm/ 9. Hybridization was carried out in 4 x SSC (1 x SSC is 150 mM NaCI, 15 mM sodium citrate (pH

7.0)), 40% formamide, 1 x Denhardts solution, 10% dextran sulfate at 42C.
The filters were washed at 55C in 0.1 x SSC, 0.1% SDS and exposed to 9 q W O 93/25684 PC~r/US93/05672 Kodak XAR-5 films at -70C. Eig~t~hag~clon~s w~r~ isolated, and a hyb,idi~ing 1.5 kb Pstl fragment from one of these clones was subcloned in the plasmid pBS-KS (Stratagene). The nucleotide sequence of the subcloned fragment was determined by the dideoxy chain termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467).

6.1.3. COMPUTER ANALYSIS OFTHE SEQUENCE DATA

DNA and amino acid sequence comparisons and alignments shown in 1 0 Table I were performed on a VAX computer using UWGCG software (Devereux et al., 1984, Nucl. Acids Res. 72:387-395). The results of comparing amino acid sequences using the UWGCG programs are presented as percent amino acid similarity or nucleotide identity between the sequences, taking conservative amino acid changes into consideration 1 5 (Gribskov and Burgess, 1986, Nucl. Acids Res. 14:6745-6763; Schwartz andDayhoff, 1979, ~An Atlas of Protein Sequence and Structure~, ed., Natl.
Biomed. Res. Found., Was~,inylon D. C., pp. 353-358). Phylogenetic Analysis Using Par:,;",o,ny (PAUPversion 3.0f) was used for the construction of the phylograms (Felsenslein, 1988; Annu. Rev. Gene. 22:521-555; Swofford and Olsen, 1990, in ~Molecular Systematics,~ Hills and Morik, Eds., Sunderland, MA., Sinaver Assoc., Inc. pp. 441-501). Searches for the most probable trees were run using both exhaustive and heuristic (branch swapping) algorithms.

2 5 6.1.4. PRODUCTION OF RECOMBINANT PROTEIN, BINDING ASSAY TO PC12 CELLS, AND ASSAYS OF NEUROTROPHIC ACTlVmES
For transient expression of recombinant proteins in COS oells, appropriate DNA fragments were cloned in the vector pXM (Yang et al., 1986, Cell 47:3-10). For NT-4 the sequenced 1.5 kb Pstl fragment from Xenopus was cloned in pXM, and for NGF a 771 bp BstEII-Pstl fragment w0 93~2~684 3~ PCI/US93/05672 from~t~e 3~ exon of the rat NGFgene was used (Halbook et al., 1988 Development 108:693-704). To express BDNF protein, a PCR-ampiified fragment containing the prepro-BDNF coding sequence from the mouse BDNF gene (Hofer et al., l990, EMBO J. 9:2459-2464) was also subcloned in 5 pXM. For NT-3, a 1020 bp rat cDNA cione was inserted in pXM (Ernfors et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:5454-5458).
COS cells (Gluzman, 1981, Cell 3:175-182) grown to about 70%
confluency were transfected with 25 9 of plasmid DNA per 100 mm dish using the DEAE-dextran-chloroquine protocol (Luthman and Magnusson, 1 0 1983, Nucl. Acids Res. 17:1295-1305). Transfected cells were then grown in complete medium (DMEM plus 10% FCS), and conditioned medium was collected 3 days after transfection. Dishes (35 mm) transfected in parallel were grown over the third night after transfection in the presence of 200 Ci/ml [35S]cysteine (Amersham, UK). Aliquots (10-20 1 each) of the in vivo 1 5 labeled conditioned media were analyzed by SDS-PAGE in 13%
polyacrylamide gels. The gels wer~ treated with EnHance (New England Nuclear, Boston, MA), dried, and exposed to Kodak XAR5 films with inlensif~ing screens for 24-48 hr at 80C. Autoradiographs were scanned in a Shimadzu densitometer, and the relative amounts of the different recombinant proteins were estimated by Cy~lc~ tirl9 the area corresponding to each protein rslativ2 to that obtained with rat NGF. The absolute amount of rat NGF protein was ~-csessed by quanlilali~e immunoblotting of conditioned media using standards of purified mouse NGF and was used to determine the protein concentration in the samples containing the other recombinant proteins.
For binding assay of recombinant proteins to PC12 cells (Greene and Tischler, 1976, Proc. Natl. Acad. Sci. U.S.A. 73:2424-2428), mouse NGFwas lab~led wi~h 125I by the chloramine-T method to an average activity of 7 x 107 cpm/ 9. Stsady-state binding was measured in competition assays performed at 37C or 0C using 1 x 104 c~lls per ml, 1.5 x 10-9 M 125INGF;

WO 93/25684 2 1 ~ 7 7 ~ ~ PCr/US93/05672 --and serial dilutions of conditioned media containing equivalent amounts of NGF or NT-4. All components were added at the same time, and cells were collected by centrifugation after equilibrium was reached (1-3 hr incubation).
Control experiments using medium from mock-transfected COS cells showed 5 that other proteins present in the conditioned medium had no effect on the binding of 125I-NGF to PC12 cells. Nonspecific binding was measured in a parallel incubation to which at least a 1000-fold excess of unlabeled NGF
was added. All results were corrected for this nonspecific binding which was always less than 10% of the total binding.
10The biological activities of the different proteins were measured by the ability of transfected COS cell conditioned media, containing equal amounts of recombinant protein, to stimutate neurite outgrowth from explanted sympathetic, nodose, and dorsal root ganglia from E9 chicken embryos (Ebendal, 1984, ~Organizing Principles of Neural Development, S.
1 5Sharms, ed., New York: Plenum Publishing Corp., pp. 93-107; Ebendal, 1~89, ~Use of Collagen Gels to Bioassay Nerve Growth Factor Activity In Nerv~
Growth Factors~, R. A. Rush, ed. (Chichester: John Wiley 8 Sons, pp. 81-93).
Serial dilutions of conditioned medium were assayed and the fiber outgrowth was scored.
6. 1. 5. RNA PREPARATIONS AND BLOT ANALYSIS

The indicated tissues from adult female Xenopus were dissected and frozen in liquid nitrogen. The brain and spinal cord were pooled. Several 25lobes of the ovary were dissected out, including oocytes of different stages.
The frozen tissue samples were homogenized in 4 M guanidine isothiocyanate, 0.1 M û-mercaploethanol, 0.025 M sodium citrate (pH 7.0) and homogenized three times for 15 s with a Polytron. Each homogenate was layered ov~r a 4 ml cushion of 5.7 M CsCI in 0.025 M sodium citrate 30(pH 5.5) and centrifuged at 15C in a Beckman SW41 rotor at 35,000 rpm WO 93/256~4~3~ PCI'/US93/05672 for 76 hr (Cl,i,y~:in ot al., 1979, Biochemistry 78:5294-5299). Poly(A)+ RN~
was purified by oligo(dT)-cellulose chromatography (Aviv and Leder, 1972, Proc. Natl. Acad. Sci. U.S.A. 69:1408-1412), and the recovery of RNA was quantified spectrophotometrically before use in RNA blot analysis. Poly(A)~
RNA (10 9) from each sampl~ was electrophoresed in a 1% agarose gel containing 0.7% formaldehyde. UV-transillumination of the stained gel was used to confirm that all samples contained similar amounts of intact RNA.
The gel was then transferred to a nitrocellulose filter. The filter was hybridized to the indicated DNA probes. The probes were labeled with [ -1 0 32P]dCTP by nick translation to a specific activity of around 5 x 105 cpm/ 9, and the hybridization was carried out as described above. Filters were washed at high stringency (0.1 x SSC, 0.1% SDS, 54C) and exposed to Kodak XAR-5 films.

1 5 6.2. RESULTS

DNA fragments coding for NGF, BDNF and NT-3 from human, rat, snake, frog, and fish were isolated using the PCR technique with degenerate primars from conserved regions in these three proteins located between 2 0 Iysine 50 and threonine 56 for the upstream primer and between tryptophan 99 to aspartic acid 105 for the dow"~ am primer (Fig. 1A).
The amplified region contains three of the six cysteine residues and covers approximately one third of the mature molecules. A comparison of the amplified region in already characterized NGF molecules from different 2 5 species shows that it contains two variable regions, arginine 59 to serine 67 and aspartic acid 93 to alanine 98. A hydrophilic stretch believed to be exposed on thQ surface of th~ molecules (Bradshaw, 1978, Ann. Rcv.
Biochem. 47:191-216), as well as the highly conserved regions glycine 68 to tryptophan 76 and threonine 85 to threonine 91 are also included in the 30 amplified region. The BDNF and NT-3 molecules have an extra amino acid WO 93/25684 ~ 1 ~ 7 ~ ~ ~ PCr/US93/OS672 between positions 94 and 95 of the mouse NGF protein which is also included in the ampiified region.
The sequences of the entire mature molecule of mouse NGF, BDNF
and NT-3 proteins were compared in order to calculate how representative the amplified region is of the complete molecule. The entire mature molec~ s show 65/57% similarity (amino acid sequence similarity/nucleotide sequence identity) between NGF and BDNF, 70/61% similarity between NGF
and NT-3 and 68/58% similarity belY:een BDNF and NT-3. When comparing the region isolated in this study, the similarity between NGF and BDNF is 1 0 62/53%, that bel~:~,on NGF and NT-3 is 67/58%, and that between BDNF
and NT-3 69/60%. This strongly suggests that the region isolated in this study is representative for the entire molecule and that it can be used to monitor the evolutionary relationships among the different factors. Pairwise sequence comparison were performed (Table 1) taking conservative amino 1 5 acid replacements into consideration, using the comparison matrix of Schwark and Dayhoff (1979, ~In Atlas of Protein Sequence and Structure, M.O. Dayhoff, ed., Washin~ton, D.C., Natl. Biomed. Res. Found., pp. 353-358).
Therefore, comparisons of amino acid sequences given below and shown in Table I indicate percent similarity, not identity. Phylogenetic trees wsre 20 constructed using parsimony analysis (Felsenstein, 1988, Ann. Rev. Genet.
22:521-565; Swofford and Olsen, 1990, ~In Molecu~r Systematics, D. M. Hills and C. Morik, eds., Sunderland, MA:Sinauer Assoc., Inc., pp. 411-501). As shown below, all isolated DNA fragments with predicted amino acid sequencss related to those of NGF, BDNF, and NT-3 contained conserved 25 cysteine residues at the correct positions. This was used as an initial criterion for a sequence to be considered as a member of the nerve growth factor gene family.

W O 93/25684 ~ ~ ~ PC~r/US93/05672 6. 2. 1. NGF, BDNF AND HDNF/NT-3 ARE HIGHLY
CONSERVED DURING EVOLUllON

6. 2. 1. 1. NERVE GROWrH FQCTOR

The nucleotide sequence (Fig. 1B [human (SEQ ID NO:3), rat (SEQ ID
NO:4), chicken (SEQ ID NO:5), viper (SEQ ID NO:6), Xenopus (SEQ ID NO:7), salmon (SEQ ID NO:8)] and the predicted amino acid sequence of the 10 isolated fragments coding for NGF are highly conserved from fish to human (Fig. 2 [human (SEQ ID NO:24), rat (SEQ ID NO:25), chicken (SEQ ID NO:26), viper (SEQ ID NO:27), Xenopus (SEQ ID NO:28), salmon (SEQ ID NO:29]).
Most of the non-conservative amino acid changes were found in the variable regions arginine 59 to serine 67 and aspartic acid 93 to alanine 98 (Fig. 2).
1 5 The similarity between the Xenopus and human NGF sequences is 93/79%
(Table 1). Xenopus and chicken NGF are identical excapt for one conservative change from Iysine 62 to arginine 62 (Fig. 2). The sequences of viper and salmon NGF contain 11 and 19 amino acid differences (out of 42), respectively, compared with human NGFwhile all other species only 20 showed four dir~erences. None of the NGFamino acid sequences isola~ed cGnlained the ~xtra amino acid residue present in BDNF and NT-3 between glutamic acid 94 and Iysine 95 of the human NGF sequences.
The interspecies relationships of the different NGF sequences were analyzed by the construction of a phylogenetic tree (Figure 3A). The 25 salmon NGF sequence appears to have diverged more than the NGF
sequences isolated from other speçie~. No NGF sequence could be isolated from ray using the described PCR technique, suggesting that ray NGF
sequences may be above the mismatch tolerance of the primers used in our PCR protocol. Alternatively, the absence of NGF in cartilaginous fishes would 30 imply that NGF appeared after the splitting of the branch leading to the evolution of the bony fishes (some 450 million years ago) but before WO 93/25684 2 1 ~ 7 7 ~ J PCI/US93/05672 amphibians and highar vertebrates evolved from this branch (about 400 million years ago).
Nucleotide identities & amino acid similarities were calculated with a VAX computer (software package from the UW~CG; Devereux et al., 1984, Nucl. Acids Res. 12: 389-395) according to the comparison matrix of Schwartz and Dayhoff (1979, Washington, D.C. Nat'l Biomed. Res. Found.
pp. 353-358), taking conservative amino acid changes into consideration.
The figures below the diagonals show percent nucleotide identity. ~he figures above the diagonals show the percent amino acid similarity. X
indicated that the sequences were not isolated from those species (NGF) from ray and NT-3 from viper). Hum, human; Chi, chicken; Vip, viper; Sal, salmon; Xen, Xenopus.

6. 2. 1. 2. BRAIN-DERIVED NEUROTROPHIC FACTOR

DNA sequences similar to that of human BDNF were found in all species investigated (Fig. 1B [SEQ ID NOS:1-21, listed supra). The similarity in amino acid and nucleotide sequences between ray, the most primitive species investigated, and human are 93/77% (Table 1). Only two non-20 conservative changes were seen out~ide the variable regions, whereas tensimilar changes were found in the two variable regions (Fig. 2). In Xenopus, (SEQ ID NO:34) leucine 90 is replaced by a phenylalanine as a result of a single base pair mutation, C to T in the first position of the codon, and in salmon (SEQ ID NO:35), tryptophan 77 is repl~^ed by tyrosine as a result of 25 a double mutation, chaoginy the codon from TGG to TAT (Fig. 1B [SEQ ID
NO:14]). All i-~ol~ted sequences contained an extra amino acid residue at position 96, compared with NGF (Fig. 2 [SEQ ID NO:24-29]). The BDNF
sequences from different species appeared as a homogenous group of sequences when analyzed by the parsimony method (Figure 3B).

W0 93~25684 ~3~ PCI/US93/05672 6. 2. . . NEUROTROPHIN-3 The nucleotide and predicted amino acid sequences for human (SEQ
ID NO:16 and 37), rat (SEQ ID NO:17 and 38), chicken (SEQ ID NO:18 and 39), Xenopus (SEQ ID NO 19 and 40), salmon (SEQ ID NO:20 and 41), and ray NT-3 are highly similar (Figs. 1B, Figure 2). Most of the changes ar~
silent mutations resulting from changes in the third position of the codons, usually transitions that preserve the pyrimidine or purine feature of the base pair. Only non-conservative amino acid changes were found within the two variable regions and no amino acid replacements were seen outside the two variable regions. The salmon sequence lacks Asp-94 which is present in all other NT-3 molecules (Fig. 2) and has a longer distance from the branching point in the phylogenetic tree than NT-3 sequences from other species (Figure 3C).

1 5 6. 2. 1. 4. A NOVEL ~FM~cn OFTHE NERVE
GROWrH FACTOR GENE FAMILY
Additional DNA fragments were isolated from viper (SEQ ID NO:1) and Xenopus (SEQ ID NO:2), and the predicted amino acid sequences (SEQ
ID NO:22 and SEQ ID NO:23, respectively) revealed that these fragments contained all three cysteine residues in the same positions as in NGF, BDNF
and NT-3 (Fig. 1B, Fig. 2). A comparison with the sequences of Xenopus NGF, BDNF and NT-3 indicated that this new sequence is related, but not identical, to the sequences of the other members of the NGFfamily. The gene including this sequence was therefore named neurotrophin-4 (NT-4).
Comparison of the nucleotide and amino acid sequences show that Xenopus and viper NT-4 are 91/73% similar. This similarity is in the same range as the one seen between Xenopus and viper NGF and BDNF (Table 1). As for the other members of the NGF family, non-conservative amino acid changes were only seen in the two variable regions (Fig. 2).

Wo 93/25684 ~ ~ ~ 7 7 9 ~ PCI/US93/05672 6. 2. 1. ~. COMPARISONANDPHYLOGENYOFTHEMEMBERS
IN THE NERVE GROWrH FACTOR GENE FAMILY
A comparison of the phylogenetic trees for NGF, BDNF, and NT-3 showed longer branches in the NGF tree, indicating a higher rate of 5 evolutionary change (Figures 3A-3C). The relationship of each member of the NGFfamily to the other members was studied by the construction of a phylogram comparing the deduced amino acid sequences for the four members of the family. The phylogram showed that NGF is more closely related to NT-3 than to BDNF and NT-4 (Figure 3D). NT-3 is as related to 1 0 NGF as to BDNF. NT-4 is clearly more related to BDNF than to the other two members.

6.2.2. STRUCTURAL FEATURES OF THE NT-4 PROTEIN

1 5 To enable a more detailed characterization of the NT-4 gene and itsgene product, we screened a Xenopus genomic library with the NT-4 F~R
fragment and isolated a phage clone containing a 16 kb insert. From this insert, a 1.5 kb Pstl fragment was subcloned and sequenced Figure 4A (SEQ
ID NO:43). The nucleotide sequence contained an open reading frame encoding a 236 amino acid protein (SEQ ID NO:44) that showed several structural features characteristic of the other members of the NGF family.
The amino terminus of the predicted NT-4 protein contains an 18 amino acid putative signal sequence in which a region of 4 amino acids is identical to the corresponding regions in pig and rat BDNF (Leibrock et al. 1989, Nature 341, 149-152; Maisonpierre, et al., 1990, Science, 247, 1446-1451). A
~oler,lial signal cleavage site, which is also identical to the one proposed forBDNF (Figura 4A), follows. A potential cleavage site for a 123 amino acid mature NT-4 protein is found after amino acid 113 in the prepro-NT-4 protein. A single predicted N-glycosylation site (Asn-Lys-Thr) is located 8 amino acids before the putative cleavage site.

WO 93/25~ 99 PCI/US93/05672 A compa,ison of the mature NT~ protein ~o the mature BDNF, NT~
and NGF proteins from mouse reveaied 60%, 58% and 51% amino acid identity, respectively. Included in the mature NT-4 protein are all 6 cysteine residues involved in the formation of disulfide bridges [Figure 4B (SEQ ID
NO:45-48)]. The regions that are identical between NGF, BDNF, and NT-3 are also similar in the NT-4 protein. Most sequence differences between the NT-4 protein and the other three proteins were found within the same variable regions previously identified in the other members of the family.

1 0 6. 2. 3. BINDING TO THE NGF-R AND

The 1.5 kb Xenopus Pstl fragment was cloned in the expression vector pXM (Yang et al., 1986, Cell 47: 3-10) and transiently expressed in COS cells. SDS-PAGE of conditioned media from transfected cells labeled with [35S] cysteine sho~NGd an NT-4 protein with an Mr of 14K (Figure 5A).
NGF protein produced and labeled in parallel dishes migrated somewhat faster than the NT~ protein. This difference in mobility is most likely due to variations in the charge of the two proteins. Similar mobility differences have also been observed for NGF prolei.,s with identical sizes from different 2 0 srec;r-s.
Conditioned media from transfected COS cells containing equal amounts of rat NGF and Xenopus NT-4 protein were tested for their ability to compet~ for binding of ~25I-labeled NGF to its receptor on PC12 cells.
Binding assays were done at 37C and under conditions in which 80% of the 125I-NGF ~c-soci~ted to the cells is bound to the low affinity NGF-R (Sutter et al., 1979, J. Biol. Chem. 254, 3972). Similar concentrations of NGF and NT-4 (6x10-lOM) were required to ~ispl~ce 50% of the 125I-NGF from the PC12 cells, indicating that the two proteins bind to the low affinity NGF-R with a similar affinity (Figure 5B). At higher concer,l~alions, the NT-4 protein was 3 0 less efficient in displ- ,ing 125I-NGF, suggesli,-g that in this case the remaining WO 93/25684 ~ ~ ~ f ~ ~ ~ PCI/US93/05672 NGF associated with the cells was bound to high affinity or internalized receptors. The fact that this difference could not be seen in a parallel assay performed at 0C in which no membrane mobilization or internalization occurs suggests that the NT-4 protein is not able to 5 compete with NGF for internalization, a process known to be mediated exclusively through the high affinity receptors (Olsnder and Stach, 1980, J.
Biol. Chem. 255, 9338-9343; Bernd and Greene, 1984; J. Biol. Chem. 259, 15509-15516; Hosang and Shooter, 1987, EMBO ~. 6, 1197-1202).
The NT~ protein t,al)sienlly sx~ressed in COS cells was tested for its 1 0 ability to promote neurite growth from explanted embryonic chick ganglia.
A clear stimulation of neurite outgrowth from explanted chicken dorsal root ganglia was seen (Figure 6A). Comparison of dose-response curves using equal amounts of NT~ and NGF protein revealed that the activity obtained with NT-4 was lower than that seen with NGF (Figures 5A and 5B).
1 5 Recombinant NT-4 and BDNF proteins stimulated neurite outgrowth in the dorsal root ganglia to a similar extent (Figures 6A and 6C). The NT-4 protein elicited a weak, but consistent, neurite outgrowth from the nodose ganglia (Figure 6G), whereas no activity could be detected in sympathetic ganglia (Figure 6E). This is in contrast to NGF,which markedly stimulates 20 neurite outgrowth from sympathetic ganglia (Figure 6F), and NT-3, which showed a clear activity in the nodose ganglia (Figure 6H). As for NT-4, the neurite outgrowth-promoting activity of BDNF in the nodose ganglia (Figure 61) was lower than the activity seen with NT-3.

2 5 6. 2. 4. EXPRESSION OF NT-4 mRNA IN
DIFFERENT XENOPUS TIS~SIJFS
Polyadenylated RNAwas prepared from 11 di~erent Xenopus tissues and used for Northern blot analysis. Hybridization with the Xenopus NT-4 probe revealed high levels of two NT-4 lransc,i~s of 2.3 kb and 6.0 kb in the ovary (Figure 7A). In contrast, the level of NT~ mRNA was below the W O 93/2568~ PC~r/US93/05672 detection limit in all other tissues analyzed. Hybridization with the Xenopu~
NGF probe showed a 1.3 kb NGF mRNA in the heart (Figure 7A) and brain.
However, the amount of NGF mRNA in these tissues was on the order of 100 times lower than the level of NT-4 mRNA in the ovary. NGF mRNA was 5 also detected in the ovary, though the amount of NGF mRNA was approximately 100 times lower than the level of NT-4 mRNA in this tissue (Figure 7B). The levels of BDNF and NT-3 mRNAs in ovary were both below the detection limit (Figure 7B).

6. 3. DISCUSSION

We have used the polymerase chain reaction (PCR) in combination with degenerate oligonucleotide primers to isolate the genes for different members in the NGF family from different species. A comparison of the nucleotide and amino acid sequences of the entire mature NGF, BDNF and NT-3 proteins revealed similarities that are the same as those obtained by comparing the region of the genes analyzed in this study. Hence, this region appears to be represenlalive for the rest of the gene and can therefore be used to study the evolutionary conservation of the entire mature protein.
2 0 The NGF, BDNF and NT-3 genes from different species include regionswhich show complete identity be~wecn fish and mammals, as well as regions with lower similarity. A comparison of NGF sequences from different species with the corresponding sequences of BDNF or NT-3 showed that the NGF
gene is less conserved in vertebrates than both BDNF and HDNF/NT-3. The two latter genes appear to be equally conserved in all species studied, except in salmon, in which NT-3 is less conserved than BDNF. In this context, it is interesting to speculate about the fact that the molecular clock seems sped up in some branches, notably NGF, and not in others. It is generally be5eved that there is a selective force that preserves the correct tertiary structure of a protein (Dickerson, 1971, J. Mol. Evol. 1, 26-45;

W O 93/25684 ~ 1 ~ 7 7 ~ ~ ; Pc~r/us93/05672 Kimura 8 Ohta, 1974, Proc. Natl. Acad. Sci. USA, 71: 2848-2852). The dirrer~l,ce in the evolutionary conservation of the three factors suggests that there has been a higher selective pressure on BDNF and NT-3 than on the NGF gene. Environmental changes have been proposed to lead to changes in the selective pressure altering the performance optimum of a specific gene product (Kimura 1983, in ~Evolution of Genes and Proteins~, pp.
208-233). In this context, it is possib'e that the more extensive evolutionary changes seen in NGF compared to BDNF and NT-3 reflect the fact that the function of NGF has changed more during evolution. Structure-function 1 0 studies of NGF have shown that this molecule can tolerate considerable structural changes without loss or modification of its activity profile, suggesting that the lower degree of evolutionary conservation of NGFcould be dua to a more stable structure of this protein, which is therefore less easily perturbed by substitutions. Another possiblc explanation is that the 1 5 regions of the genome whera the genes for the different factors are located have dirrerenl general mutation rates. Different mutation rates have been shown for non-coding ragions of the genome (Wolfe, et al., 1989, Nature, 337: 283-285) but it is less clear if this can lead to an increased number of changes in coding regions.
Salmon NGF and NT-3 are notably more different when compared with these molecules in other species. Some amino acids including the threonine 82 and the histidine-ll,reGni"e-phenylalanine at position 85 to 87 in NGF, as well as the absence of the amino acid between positions 94 and 95 (compared to the two other proteins), are consistent features of the NGF
protein. The fact that the isolated salmon sequence contains all of these NGFspecific motifs argues that it is not an additional member of the family, but rather represents salmon NGF. In cGnlrasl to all other NT-3 sequences studied, salmon NT-3 lacks the amino acid in position 95. Since the extra amino acid is present in ray NT-3, it is likely that the common ancestor of ray and salmon had an ancestral NT-3 sequence which included the extra WO 93/2~ ~ PCI-/US93/05672 amino acid in position 95. Therefore, the changes in the salmon NT~
molecule must have occurred after this gene split from the common ancestor. Most of the changes in the amino acids of the salmon sequence are in the same regions that vary, to a lesser degree, also in ~he other species, strongly suggesting that the isolated salmon NGF or NT-3 sequences are not pseudogenes. The greater divergence of salmon NGF
and NT-3, compared with the other species, probably reflects the high degree of evolutionary expansion of the bony fishes.
The results in this study indicate that the NGF family probably existed 1 0 500 million years ago in the primitive fishes, which were the ancestors of today's higher vertebrates. The gene family could have been formed by gene duplication, which is believed to be the most common mechanism whereby new genes evolve (Li, W., 1983, in ~Evolution of Genes and rloteins, pp. 14-37). Duplications of functional genes could have been facilitated, 1 5 since all information required for the synthesis of a biologically active protein is cGnlained within a 3' exon (Hallbook, et al., 1988, Mol. Cell. Biol. 8: 452-456; Leibrock, et al., 1989, Nature, 341: 149-152; Hohn, et al., 1990, Nature, 344: 339-341). The formation of the family has involved several gene duplications (Figure 3D).
Since NT~ is more closely related to BDNF than to NT-3 or NGF, it appears that NT-4 and BDNF were formed from a common ancestral gene.
However, since no progenitor-like molecule for all four factors can be distinguished from the present data, the evolutionary relation of the putativs BDNF/NT-4 dnc~slor to the ancestors of NGF and NT-3 cannot be definil~ly est~hlished. The topology of the phylograms using data from differant species is in general agreement with the consensus evolutionary relationship among di~eren~ .spec Qs However, for both NGF and BDNF, the chicken sequences show an earlier branching in the phylogram than expected. Comparison of NT-4, NGF, and BDNF from viper and Xenopus revealed that the NT-4 sequences in these species have 11 amino acid WO 93/25684 2 1~-~?~ PCI`/US93/05672 replacemants, compared with 9 and 8 replacements in NGF and BDNF, respectively. This suggests that in these species, NT-4 has diverged with a rate that is comparable to, or faster than, the rate of NGF or BDNF
divergence.
Replacements of highly conserved amino acids in the NGF molecule do not abolish the biological activity, but in many cases these affect the amount of protein produced, indicating that there are constraints other than the biological activity, such as protein stability, which may be important for the conservation of the NGF protein. In addition, the fact that all members of the N~iFfamily can interact with the low affinity NGCR
suggests that the complete conservation of certain regions in these factors may be due to constraints on these genes to retain proteins that can interact with the NGF-R. The basic mechanisms and strategies for the early ontogeny of the embryo are similar in all vertebrates and presumably involve genes that are conserved in all vertebrates. The evolutionary conservation of the neurotrophic factors is therefore consistent with the notion that they are important in early embryonic development in many different species.
The hip~o~."pus contains the highest levels of NGF, BDNF, and NT-3, mRNA in the brain (Ernfors et al., 1990 J. Dev. Neurosci. 9, ~7-66). It is a highly specialized structure derived from the archipallium, which first appeared in the brains of amphibians and reptiles. The mammalian hippocampus is important for memory, learning and cognitive functions known to be ~ssoci~ted with high neuronal plasticity (Crutcher and Collins, 1982, Science 277:67-68). These demands may have generated a selective pressure during phylogeny for pl~cticity-promoting mechanisms, possibly medicated by neurotrophic factors. However, the results in this study clearly show that the duplication event of the genes for the neurotrophic factors preceded by far the formation of the hippocampus. This finding ind;c~es that the neurotrophic factors did not evolve as a conse~uence of WO 93/25684 . ' ' - PCI/US93/05672 the formation of the hippocampus and supports the notion that th~
neuronal plasticity in this brain region is at least in part due to these mlo'~cu'es The organization of the nervous system of primitive vertebrates, i.e., cartilaginous fishes, shows some basic simiiarities to the nervous system of higher vertebrates. The cranial nerves and the somatic sensory and autonomic nervous systems in cartilaginous fishes are in general similar to those of higher vertebrates (Young, J.Z., 1981, The Life of Vertebrates, New York Oxford University Press). It is therefore likely that the principles of neurotrophic intsractions are the same in both primitive and higher vertebrates. The evolutionary conservation of the NGF-like neurotrophic factors also in primitive vertebrates suggests that these factors first avolvQd in invertebrates and were later adapted to function in the development of the vertebrate nervous system.
1 5 Our study of the evolutionary conservation of the NGF farnily led to the isolation of a novel member of this family, named neurotrophin-4 or NT-4, PCR fragments from the NT-4 gene ware isolated from Xenopus and viper, and a genomic clone was subsequently isolated from Xenopus.
Nucleotide sequence analysis of this clone revealed an open reading frame for a 236 amino acid protein, which showed several structural features resembling those of the three other members of the NGF family. These include the presence of a putative amino-terminal signal sequence and a potential N-glycosylation site close to a proteolytic cleavage site that predicts a 123 amino acid mature NT-4 protein. The size of the mature NT-4 protein is 4 amino acids longer than that of BDNF and NT-3 and 5 amino acids longer than that the mature NGF protein. Within the mature NT-4 protein, all 6 cystein residues involved in the formation of disulfide bridges are cons~lved. The NT~ protein differs from lhe other members of the family in the same regions that vary among the sequences of the three 3 0 other family members. As for NGF, BDNF, and NT-3, the entire prepro-NT-4 WO 93/25684 ~ 1 ~ 7 7 ~ ~ PCI`/US93/05672 protein is encoded in one singla exon. Hence, both the gene organization and the structural features of the predicted protein indicate that the NT-4 gene is an additional member of the NGFfamily. The fact that the NT-4 gene was isolated from both reptiles and amphibians suggests that it is present in several different species.
Both BDNF and NT-3 have been shown to interact with the low affinity NGF-R (Rodriguez-Tebar et al., 1990, Neuron 4:487-492; Ernfors et al., 1g90, Proc. Natl. Acad. Sci. USA 87:5454-5458). The Xenopus NT-4 protein displaced 125-NGF from its low affinity recaptor on PC12 cells, 1 0 indicating that the fourth member of this family can also interact with the low affinity NGF-R. The comparison of displacement curves obtained at 37C and 0C suggesls that the NT-4 protein cannot compete for binding to the high affinity NGF-R. The protein encoded by the low affinity NGF-R gene appears to form part of both the low and the high affinity receptors 1 5 (Hempstead et al., 1989, Scienca 243:373-375). The mechanis", by which two kinetically different receptors are formed from the same receptor gene is not known, although it has been proposed that the two states can be generated by the formation of a complex between the cytoplasmic domain of the receptor and an intr~ellul~r protein (Radeke et al., 1987, Nature 325:593-597; Meakin and Shooter, 1991, Neuron 6:153-163). Alternatively, a high affinity receptor chain may be encoded by a separate gene and, similar to the intarleukin-2 receptor (Hatakeyama et al., 1989, Scienoe 744:551-556) and the platelet-derived growth factor receptor (Matsui et al., 1989, Science 243:800-804), the two receptor chains may form a dimer that conslilutes the high affinity receptor. The fact that all four members of the NGF family can interact with the low affinity NGF-R suggests that the low affinity state of the NGF-R may be, in an as yet ur,hr,o~n way, involved in mediating the biological effects of all these factGrs. In this context, it is inlere~ling to note that the low affinity NGF-R gene has been shown to be expressed in many tissues of both neuronal and nonneuronal origin not wo 93/~43~ ~ ~9 ~ PCI`/US93/05672 known to respond to NGF. These include mes~ncl~yme, somites and neur~
tube cells in the early chick embryo (Hallbook et al., 1990, Development 108:693-704; Heuer at al., 1990a, Dev. Biol. 137:287-304; Heuer et al., 1990b, Neuron 5:283-296), as well as developing and regenerating spinal cord motorneurons (Ernfors et al., 1989, Neuron 2:1605-1613; Ernfors et al., 1991, J. Dev. Neurosci. 9:57-66). It would therefore be of interest to investigats whether the NT-4 protein is of functional importance in any of these tissues or neuronal populations.
The neurotrophic activity of the NT-4 protein was assayed on 1 0 explanted chick embryonic ganglia, and as for the other three members ofthe NGF family, the NT-4 protein showed a clear stimulation of neurite outgrowth from dorsal root ganglia. However, when compared to NGF,the NT-4 protein showed lower activity in dorsal root ganglia. Both BDNF and NT-3 readily elicit neurite outgrowth in explanted nodose ganglia, though the 1 5 response with NT-3 was consistently stronser than that with BDNF. NGF
strongly stimulates neurite outgrowth in sympathetic ganglia, and NT-3 also has activity in this ganglia, though it is much lower than that of NGF
(Maisonpierre st al., 1990, Science 247:1446-1451; Ernfors et al., 1990, Proc. Natl. Acad. Sci. USA 87:5454-5458). NT-4 showed weaker activity in 2 0 nodose ganglia compared with NT-3 and no activity in the sympathetic ganglia. The spectrum of the biological activity of NT-4 on peripheral explanted ganglia resembles that of BDNF, which is in agreement with the fact that NT-4 is structurally similar to BDNF.
Northern blot analysis of 11 different tissues from Xenopus showed high levels of NT-4 in the ovary, whereas the level of NT-4 mRNA was below the detsction limit in all other tissues examined. Two NT-4 mRNAs of 2.3 kb and 6.0 kb were seen in the oocytes. The presence of two transcripts from the same gene has previously been observed for BDNF, in which case two mRNAs of 1.4 kb and 4.0 kb ar~ presenl in the rat brain (Leibrock et al., 1989, Nature 341:149-152; Maisonpierre at al., 1990, Science 247:1446-WO 93/25684 ,~ ~ ~ 77 9 ~ PCI/l~S93/05672 1451; Ernfors et al., 1 990a, Proc. Natl. Acad. Sci. USA 87:5454-5458).
Hybridization to a Xenopus NGF probe revealed NGF mRNA in the Xenopus heart, most likely as a result of NGF mRNA expression in target tissues for neuronal innervation. The level of NGF mRNA in the heart was, however, 5 more than 100-fold lower than the level of NT-4 mRNA in the ovary. Since the high level of NT~ mRNA in the ovary does not correlate with neuronal innervation, it appears unlikely that the NT~ protein has only a neurotrophic function in this case. Instead, the abundant expression of NT~ mRNA in Xenopus ovary implies an additional and important nonneurotrophic function for the NT-4 protein. NGF mRNA was also detected in Xenopus ovary though at almost 100 times lower levels than those of NT-4 mRNA; BDNF
and NT-3 mRNAs were not detected in this tissue.
mRNAs for two growth factors havs been described as maternal mRNAs in Xenopus oocytes. One of these mRNAs encodes a protein with 15 strong similarity to basic fibroblast growth factor (Kimelman and Kirschner, 1987, Cell 51:869-877); the other mRNA encodes a protein homologous to transforming growth factor (Weeks and Melton, 1987, Cell 51:861-867).
These factors have been suggested to function as morphogens for the formation of mesoderm and the subse~uQnt induction of this tissue into the 20 neural tube. In the rat, in situ hybridization studies have revealed NT-3 mRNA in the epithelium of secondary and tertiary follicles, and a role for NT-3 in oogenesis has been suggested (Ernfors et al., 1990, Neuron 5:511-526).

WO 93/25684 PCI'/US93/05672 7. E)~AMPLE: IDENT FICAllON OF CEL~S
EXPRESSING M-4 mRNA IN THE XENOPUS
LAEVIS OVARY BY IN SITU HYBRiDlZATlON

7.1. MATERIALS AND METHODS

7.1.1. ISOLATION, HANDLING AND CULTURE OF
XENOPUS OOCYrES, EMBRYOS AND CELLS

Male and female X. Iaevis frogs were maintained in the laboratory at 19C. After immersion-anesthesia of the animals in 0.25% tricaine methane sulfonate (Sandoz, Switzerland), ovarian lobes were surgically removed, washed with modified Barth's saline H~pes (MBSH) (Gurdon and Wickens, 1 5 1983, Methods Enzymol, 101: 370-86) and dissociated by overnight incubation at 20C in calcium-free MBSH containing 2 mg/ml collagenase.
Crude separation of pre-vitellogenic and vitelloenic oocytes was obtained by differential sedimentation, and oocytes were further sorted manually under a dissecting microscope into the developmental classes described by Dumont (1972, supra).
Sy"chronously cleaving embryos were obtained by in vitro fertilization essentially as described by Newport and Kirschner (1982).
A6 Xenopus kidney cells were cultured in Leibowitz L15 medium diluted with distilled water 60:40 (vh) and supp'emented with 10 mM Hepes pH 7.35, 10 M hypoxanlhine (Sigma), 4 mM glutamine and 10% fetal bovine serum (Gibco) at 20C. Cultures were equilibrated with air and kept in ~he dark.

7.1.2. IN SITU HYBRIDIZATION
Fresh-frozen ovaries from adult Xenopus laevis frogs were sectioned (14) in a cryostat (Leitz, Germany) and the sections were thawed onto WO 93/25684 ~ 7 ~ ~ ~ PCI'/US93/OS672 poly-L-lysine (50 g/ml) pretreated slides after which they were fixed in 10%
formalin for 30 min and rinsed twice in PBS. Dehydration was carried out in a graded series of ethanol including a 5 min incubation in chioroform after which the slides were air dried. Two 53-mer oligonucleotides, one specific for Xenopus NT-4 mRNA (5Y~CCACMGC I l ~i l I GGCATCTATGGTCAGAGCCCT
CACATMGACIcil I I IGC3' ~SEQ ID NO:109]) and another one, as a control, specific for chicken BDNFmRNA (corresponding to amino acids 61 to 77 of the mature chicken BDNF protein (Hallbook et al., 1991, Neuron 6: 845-58 [contained within SEQID NOS.: 11 and 32]), were labeled at the 3' end with 35S-dATP using terminal deoxyribonucleotidyl transferase (IBI, New Haven) to a specific activity of approximately 1x109 cpm/ . Hybridization was performed at 42C for 16 hours in 50% formamide, 4x SSC, Ix Denhardts solution, 1% Sarcosyl, 0.02M NaPO4 (pH 7.0), 10% dextransulphate, 0.5 mglml yeast tRNA, 0.06M DDT,0.1 mg/ml sheared salmon sperm DNA and 1x107 cpmlml of 35S-labeled oligonucleotide probe. Sections were subse~ ently rinsed, washed 4 times (15 min. each) at 55C in 1 x SSC, rinsed in water, dehydrated in a graded series of ethanol and air-dried. The sections were exposed to X-ray film followed by coating in Kodak NTB-3 photo emulsion (diluted 1:1 in water), exposed for 5-6 weeks at -20C, developed, fixed and counter:jlained with cresyl violet.

7.1.3 RNA BLOT ANALYSIS

The indicated samples were homogenized in 4M guanidine isothiocyanate, 0.1M l~-mercaploethanol, 0.025M sodium citrate pH 7.0 and homogenized 3 times for 15 seconds with a Polytrone. Each homogenate was layered over a 4ml cushion of 5.7M CsCI in 0.025M sodium citrat~ pH
5.5 and centrifuged at 15C in a Beckman SW41 rotor at 35,000 rpm for 16 hrs. (Chirgwin et al., 1979, Biochemistry 78: 5294-5299).
Polyadenylated RNA (Poly(A)+ RNA) was purified by oligo (dT) cellulose Wo 93/25~ Pcr/us93/05672 chromatography (Aviv and Leder, 1972, PNAS 69: 1408-1412) and tt~
recovsry of RNA (40 9) was quantified spectrophotometrically before use in RNA blot analysis. Total celluiar RNA (40 9) or where indicated poly(A)+RNA (5 9) from each sample was electrophoresed in a 1% agarose 5 gel conlaining 0.7% formaldehyde. UV-transillumination of the stained gel was used to confirm that all samples contained similar amounts of intact RNA. The gel was then transferred to a nitrocellu~ase filter. The filter was then hybridized to a 350bp Hincll fragment from the 3' exon of the Xenopus NT-4 gene (Hallbook et al., 1991, Neuron 6: 845-858). The fragment was 1 0 l~heled with -(32p)-dCTP by nick translation to a specific activity of around 5x108 cpm/ 9 and the hybridization was carried out as described (Ernfors st al., 1988, Neuron 1: 983-96). Filters were washed at high stringency (0.1xSSC, 0.1% SDS, 54C) and exposed to Kodak AR-5 films at -70C.

1 5 7.2 RESULTS

Tissue sections through the adult Xenopus laevis ovary were hyLridi~ed to a 3sS-dATP labeled oligonucleotide probe specific for Xenopus NT-4 mRNA. As a control for the specificity of the hybridization, adjacent 20 sections were hy6ridi~sd to an oligonucleotide probe of the same length and GC-conlenl complemantary to mRNA for chicken brain-derived neurotrophic factor (BDNF). The NT-4 mRNA specific probe revealed an intense labeling over many cslls sodller~d throughout the ovary with a size (50-400 m in diameter) corresponding to oocytes in early stages of oogenesis (Fig. 9A), 25 No NT~ mRNA could be detected over mature, post-vitellogenic stage Vl oocytes (arrows in Fig. 9A). The chicken BDNF mRNA specific control probe did not label any cells in the Xenopus ovary.
Analysis of emulsion autoradiographs from the hybridized sections revealed an intense lab~ling over the cytoplasm of oocytes with a diameter 3 0 of 50-200 m (Fig. 1 OA and 1 OB) corresponding to stage I oocytes W O 93/25684 ~ 73~ PC~r/US93/05672 according to Dumont, 1972, supra. The NT-4 mRNA specific probe also labeled oocytes with a larger diameter corresponding to stages ll to IV, though the intensity of labeling over these cells was lower than that seen over stage I oocytes. In agreement with the analysis of low magnification - 5 dark-field illuminations (Fig. 9), the emulsion autoradiographs did not show any labeling over more mature oocytes of stages V and Vl. No labeling was seen over any cells after hybridi~tion with the control BDNF probe (Fig.
10C). To enable a more detailed determination of the level of NT-4 mRNA
during oogenesis, the number of grains per an arbitrarily chosen area unit was counted. The area unit chosen corresponded to approximately one hundredth of the cross section area of a stage I oocyte. The result of this analysis showed that th~ intensity of labeling over stage I oocytes was 1.7 and 4.3 times higher than over stage ll/lll and IV oocytes respectively (Fig.
11). The number of grains per area unit over stage V and Vl oocytes was not siy"iricanlly above the level of the background labeling.

7.2.1 NORTHERN BLOT ANALYSIS OF NT-4 mRNA EXPRESSION
DURING XENOPUS OX~!-S!S AND EARLY DEVELOPMENT

A fixed amount of total cellular RNA (40 g) prepared from different stages of oocytes as well as from a fraction enriched from follicle cells was analyzed by Northern blots using a Xenopus NT~ specific probe (Hallbook et al., 1991 supra). In agreement with the results of the in situ hyl~riJi~tion, the highest levels of NT-4 transc,ipls with sizes of 2.3 kb and 6.0 kb was ~rese"l in the smallest oocytes (stages I and ll) (Fig. 12). The level of NT-4 mRNA declined abruptly in more mature stage V and Vl oocytes. A weak hyLridi~alion signal was seen in the follicle cell preparation which was probably due to a contamination with a small number of stage I
and ll oocytes. The same result was obtained when a fixed amount (5 9) w093/256 ~9s~ ;s i~ PCI/US93/05672 ~f polyadenylated RNA was analyzed from the differenca samples shown ~
Fig.12.
The results of the analysis of the NT-4 mRNA e~,ression in the ovary showed that NT-4 mRNA is restricted to immature oocytes. To test the possibility that expression of NT-4 mRNA is induced after fertilization, the level of NT-4 mRNA was ~csesssd in developing Xenopus embryos by Northern blots of polyadenylated RNA. A low level of NT-4 mRNA was found in Xenopus somatic A6 cultured kidney cells which were also included in the analysis. How~ver, no NT-4 mRNA could be detected in early embryos 1 0 from the onset of cleavage divisions to the neurula stage.

7.3 DISCUSSION

The abundant expression of NT-4 mRNA in the Xenopus ovary 1 5 (Hallbook et al., 1991 supra) indicates that this membQr of the NGF family plays a role in oogenesis and/or early embryogenesis. I oc~ tion of oells expressing NT-4 mRNA in the ovary provided insights into the putative function of the NT-4 protein in the ovary. In amphibians, as in all other vertebrates, ferti~ tion of the eg~ triggers a period of rapid cell cleava~e.
This evant is controlled by a class of solublc maternal mRNAs expressad during oogenesis and stored in the unfertilized egg for subsequent development (Davidson, 1g86, Gene Activity in Early Development (New York, Academic Press). This class of maternal mRNAs includes two growth factors, basic fibroblast growth factor (Kimelman and Kirschner, 1987, Cell, 51: 869-77) and transforming growth factor-~ (Weeks and Melton, 1987, Cell, 51: 861-67), as wall as several protooncogenes such as c-myc (Godeau et al., 1986, EMBO J., 5: 3571-77); (Vriz et al., 1989, EMBO J. 8: 4091 -97), c-fos (Mohun et al., 1989, Development, 107: 835-46), ras (Andeol et al., 1990, Dev. Biol., 139: 24-34), ets-2 (Chen et al., 1990, Science, 250: 1416- c 18) and c-mos (Sagata et al., 1988, Nature, 335: 519-25). Immature WO 93/25684 ~77~` PCI'/US93/05672 stage Vl Xenopus oocytes are al-e:,led in prophase of meiosis I and both c-mos (Sagata et al., 1988) and ets-2 (Chen et al., 1990) have been shown to function during reinitiation of meiotic division. The finding of high levels of NT-4 mRNA in stage I and ll oocytes but a decreased level below the detection limit of both Northern blots and in situ hybridization in stage V
and Vl oocytes strongly suggests that the NT-4 mRNA does not belong to - the class of maternal mRNAs. This result also argues against a role of the NT-4 protein in the reinitiation of meiotic division or in early embryogenesis.
In agreement with this, addition of recombinant NT-4 protein to immature 1 0 stage Vl oocytes failed to induce germinal vesicle breakdown in vitro and no NT-4 mRNA was detected in Xenopus early embryos. Instead, the putative function of the NT-4 protein in the ovary appears to be coupled to events occurring in the pre-vitellogenic and early mid vitellogenic oocyte. Both N~' (Ayer-LeLievre et al., 1988, PNAS 85: 2628-2632) the 7~kD low-affinity NGF
1 5 receptor (Persson et al., 1990, Science, 247: 704-707) and the trkA high-affinity component of the NGF receptor (J.P. Merlo and H. Persson, unpublished) are expressed in the testes where NGF has recently been shown to stimulate DNA synthesis at the onset of meiosis (Parvinen et al., 1991, submitted). Hence, it appears that the neurotrophins do not only 2 0 function as neurotrophic factors but also play an important role in reproductive tissues 8. E)CAMPLE: ISOLATION AND CHARACTERIZATION
OF NUCLEIC ACID FRAGMENTS ENCODING

8.1. MATERIALS AND METHODS

8.1.1. DNA PREPARATION
Genomic DNA was isolated as described in 6.1.1, supra.

WO 93/25684 ~ ` PCI/US93/05672 3~ ` ~
8.1.2. POLYMERASE CHAIN REACTIONS, MOLECULAR CLONING AND DNA
.~yJFNc~lG
Mixtures of 34-mer oligonucleotides (including tail) representing all possible codons corresponding to the amino acid sequences QYFFET
(contained within SEQ ID NO:51 ) and QYFYET (SEQ ID NO:52) (5'-oligonucleotide) and, WISECK, CKAKQS and WIRIDT (each contained within SEQ ID NO:51) (3'-oligonucleotide) (Fig. 13) were synthesized, with linkers, as described in 6.1.2., supra. Together, 2Y (derived from xNT-4 [SEQ ID
NO:50]) and 2Z (derived from BDNF/NT-3 [SEQ ID NO:51]) represent all known sequence for neurotrophins from all species in this region. A primary amplification of both rat and human genomic DNA was carried out with Taq polymerase (Cetus) with cycles of 1 minute at 95C, 2 minutes at 43C and 2 minutes at 72C. An aliquot from the primary PCR reactions was then reamplified using either the same primers as in the primary amplification or with new nested degenerate oligonucleotide primers which would result in an expected size shift. PCR products from the reamplification procedure were purified as follows: bands of prospective size were gel purified, reamplified, and column purified using Stratagene ~primerase~ columns. These were then digested to completion with EcoRI and Sall, analyzed and re-purified using Primarase columns (Stratagene) and ligated into EcoRI-Xhol digested Bluescript KS(-). Transformants were screened for pBS-KS containing an insert of the approximate predicted size. The cloned fragmants were subjected to DNA sequence analysis as described in 6.1.2, supra.

8.1.3. ISOLATION OF FULL LENGTH GENOMIC AND cDNA CLONES ENCODING
rNT- 4 AND NT-4 A human ovary cDNA library in ~lGT-10 was obtained from Clontech.
A human hippocampus cDNA library in ~:ZAPII was obtained from Stratagene. A human genomic DNA library in EMBL3/SP61T7 was obtained wo 93/25684 ~ 1 ~ 7 7 9 9 b PCI /US93/05672 from Clontech. A rat brain cDNA library in ~l-ZAP was obtained from Stratagene.
Isolation of NT-4 clones can be carried out as follows:
A cloned insert encoding the rNT-4 fragment (Fig. 14 lSEQ ID NO:61]) 5 or the hNT~ fragment (Fig. 15 [SEQ ID NO:63]) are labeled by P~P~ to a specific activity of approximately 5x108 cpmlng. HyL,idi~alion is carried out in hyl,ridi~alion solution consisting of 0.5 mg/ml salmon sperm DNA at 60C. The filters are washed at 60C in 2 x SSC, 0.1 % SDS and exposed to Kodak XAR-5 film at -70C. Alternatively, oligonucleotides whose s~quence 10 co,-esponds exactly to the desir~d mammalian neufot,ophin can be used to generate probes (e.g. kinase labelling) and can be used to screen the sama libraries by conventional methods. Positive phage are plaque purified and infected at low multiplicity in an ~pro~.riate E. coli strain in liquid broth asdescribed by Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold 15 Spring Harbor Laboratory, Cold Spring Harbor, New York). GT-10 and EMBL3/SP6/T7 phage are prepared as follows: Cultures are inoubated overnight at 37 with constant shaking. The overnight suspension is brought to 1M NaCI and 8% PEG, mixed well and inc~ ted over-,iyl,t at 4C
to precipitate the bacteriophage. Tha bacteriophage are pelleted via centrifugation, resuspended in TM buffer (10mM Tris-HCI, pH 7.~; 10mM
MgCI2), layered upon a CsCI step gradient and centrifuged at appropriate speed and length of time to band the ba.,1~riophage. The bact~riophage are removed, transferred to a fresh Eppendorf tube and Iysed by the ~dd~ion of 1 volume of formamide. EMBL-3 DNA is precipilaled by the addition of 2 volumes of 100% ethanol. The EMBL-3 DNA is recovsred by microcentrifugation, washed in 70% ethanol and re~uspended in TE buffer (10mM Tris-HCI, pH 7.5; 1mM Na2-EDTA). The DNA is sxtracted several times with ph~nol:chloroform:isomyl alcohol (24:24:1), ethanol precipitatad, resusperided in TE buffer, digested with various restriction enzymes and electrophoresed through a 1% agarose gel. Subsec~l)ent to electrophoresis, w093/256843~9 PCI/US93/05672 r~strict~d DNA is lr~,~sf~r~ed to nitroc~lluloss and hybridiz~d to the 32p--l~helled rNT-4 or hNT-4 probe, under conditions described supra. The hyLridi~ing band is subcloned into pBS-KS plasmid vector and subjected to DNA sequence analysis by the dideoxy chain termination method (Sanger, et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74: 5463-5467).
The ~l-ZAP plasmid preparations are performed as follows: 20011 of OD600=1.0 XL1-Blue cells, 20011 of the hi-titer phase stock, and 1~L of R408 helper phage (1x10 minutes pfu/ml) are combined. For a negative control, add no phage stock. Incubate 15 minutes at 37C. Add 5 ml of 2XYT
1 0 media, shake for 3 hours at 37C. At the end of the 3 hours, the nega~ive control should be cloudy and the samples clear. Samples are heated at 65C for 30 minutes, spun at 40009 for 5 minutes. Supernatant contains phagemid stock. To rescue the phagemid, add 0.511 of the stock to 200 of XL1-Blue cells (OD600s1). Incubate 37C for 15 minutes. Plate 1-100 1 5 (preferably 10~L) on LB ampicillin plates. Incubate 37C x overnight andlarge col~n-,es are picked. After plasmid DNA is purified, it is sequenced as abova.
Lambda phage cDNA libraries are screened according to standard methods (Mani~lis, at al., supra) as desc,il,ed supra.
2 0 Positiv~ plaques are purified, reisolated and subjected to DNA
sequence analysis as desc,ibed supra.

8.2. RESULTS AND DISCUSSION

A region of the Xenopus NT-4 coding sequence was used as a model for sy(,ll,ssis of degenerate oligonucleotide primers. Figure 13 d~notes that the 5'-oligonucleotide primer 2Y [SEQ ID NO:53] (QYFFET) and 3'-oligonucleotide primers, 3Y [SEQ ID NO:55] (WISECK), 3Z [SEQ ID NO:56]
(CKAKQS) and 4Z [SEQ ID NO:58] (WIRIDT) wer~ derived from the xNT-4 amino acid s~qu~nce. The 5'-oligonucleotide primer 2Z [SEQ ID NO:54]

WO 93/25684 ~ ~ ~ 7 7 9 9 PCI/US93/0~;672 (QYFYET) is derived from the homologous region of rBDNF. All ~ le combinations of these degenerate oligonuc'~otides were utilized to amplify DNA from both rat and human genomic DNA libraries. Since the primers represented by 3Y[SEQIDNO:55] and 3Z[SEQID NO:56~ of xNT~ ar~ not 5 conserved in the NGF/BDNF/NT-3 gene family, and therefore were n~t likely to amplify NGF,BDNF or NT-3, these two primers were utilized in the reamplification, or secondary PCR.
DNA fragments of the approximate expected sizes were obtained from PCR amplification and reamplification of both the rat and human 10 genomic libraries when the following primer combinations were utilized:
(1) 2YI3Z (primary PCR): 2Y, 2Z/3Y (se~nda,~ PCR) (2) 2Y/3Z (primary PCR): 2Y,2~32(secondafy PCR) (3) 2Y/4Z (primary PCR): 2Y, 2Z/32 (secGnda,y PCR) (4) 2~4Z (prima~ PCR): 2Y,2~3Z (secor-Ja~ PCR) The secondary PCR products of the approximate exl~e~.1e~l size were electrophoresed through a 2% agarose gel, eluted by standard tec~.ni~ues, 2 0 digested with EcoRI and Sall and ligated in EcoRI-Xhol digested pBS-KS DNA.
Positive transformants were selected, and inserted fragments were subjected to DNA sequencing by the didsoxy chain termination method (Sanger, et al., supra).
An open ~eadil-g frame has been ~leduced for a portion of the rat NT-4 (Fig. 14 [SEQ ID N0:62]) and human NT-4 (Fig. 15 [SEQ ID N0:64]) amino acid coding sequence. Figure 16 illusliales the homologous region of the rNT-4 (SEQ ID N0:62) and hNT-4 (SEQ ID N0:64) fragment t o represent~ti./e members of the NGF/BDNF/NT-3 gene family.
An open reading frame encoding a larger portion of human NT~ than 3 0 that J;sclosefJ in Figure 15 is shown in Figure 17A (SEQ ID N0:69 and SEQ ID

PCI~/US93/0~i672 NO:70). Figure 17A presents additional 3~ sequence information for th~
human NT~ coding region. The 192 bp nucleic acid fragment was isolated as desc,il,ed supra in the Description of the Figures.
The actual size of the PCR products recovered from the reamplification procedure was larger than predicted due to the ~dditi~.,al 7 amino acids in the rat NT-4 (GPGVGGG) lSEQ ID No:101] and human NT-4 (GPGAGGG) [SEQ ID NO:102] DNA fragment.
The 7 amino acid insertions of rNT-4 and hNT-4 are describ~d as 'GPGXGGG'[SEQID NO:100], where X=V for rNT-4 and X=A for hNT-4.
Valine and alanine possess nonpolar R group. Whether position four is conserved to contain a nonpolar R group at position 4 in other mammalian NT~ pro~oins is not preser,lly known, nor wl,ell,er the 7bp insertion itself will be characteristic of other mammalian NT~ g2nes. It is inlereslins~ to note that fish NGF has a 22 amino acid b~se,lion in the same region as disclosed in the presenl invention.

9. EXAMPLE: ISOLATION AND CHARACTERIZATION OF AN NT-4 HUMAN GENOMIC CLONE
We have screened a human placenta genomic library in Ch~RI ~ SP6/T7 (Clontech, K802 as host). A total of 1.25 x 106 pfu were plated on large NZY plates. Duplicate lifts were made using Schleicher & Schuell nitrocellulose fil~ers, and were hybridized to a 120 bp probe (from hNT-4 clone 17B, which was obtained from hurnan genomic DNA using primers 2 5 2,4Z followed by 2Z3Z), l~helled by PCR using oligonucleotide primers 2Z/3Z.
The filters were hybridized at 60C with the r~;ol~'~eled probe (10~ cpm/
ml) under the following hybridi7~tion conditions: 0.5 M NaPO", 1% BSA, 7%
SDS, 1 mM EDTA, and 100 g/ml salmon sperm DNA. The filters were then washed at 60C with 2xSSC and 0.1% SDS, and subjected to autoradiography. Following four days of exposure, positive signals were identified on the duplic~te lifts. A total of seven plugs were picked, put into WO93/25684 ~ 7~i~ PCr/US93/05672 1 ml SM buffer, shaken for 2 hr, and replated as follows: 1) 100 1 of 10-3 dilution (1 1 in 1 ml), mixed with 100 I cells, and plated; an almost confluent plate was obtained; 2) 200 1 of 10-5 dilution, which gave isolated pl~ es.
Duplicate lifts were made, and screened as described above with the hNT-4 5 120 bp probe. Following a 2 day exposure, many positives were identified on the confluent plate for plugs HG2, 4, and 7. A well-isolated positive was identified on both HG4-2 and HG7-2 plates. A single plaque for HG4-2 and HG7-2 was picked, put into 500 1 of SM buffer, and shaken for 2 hr, following which 100 1 of eluant was mixed with 100 I cells and plated. The 10 plate was then flooded with 3 ml SM buffer, and supernatant collected as the first high titer stock. Three plates were then plated using 100 1 of this first stock mixed with 100 I cells. The plates were flooded with 3 ml SM
and shaken on rotator for 3 hr at room temperature. Supernatant was removed, spun to remove debris, following which chloroform was added, 15 and this used as the second high titer stock. Two I of HG4-2 and HG7-2 high titer stock was spotted onto Schleicher & Schuell nitrocellulose filter, and was found to hybridize to the rNT-4 180 bp probe lisolated from the plasmid cGnlai.-ing an insert obtained by PCR from rat genomic DNA using primers designed based on our rat NT-4 clone sequence coding for the 20 amino acidGELSVCD (SEQ ID NO:112) (degenerate primer) and KAESAG
(SEQ ID NO:113) (exact primer)]. Plate Iysates and liquid Iysates were prepared for HG4-2, HG7-2 and HG2-1. Phage DNA was made, an aliquot of which was run on agarose gel and subjected to Southern analysis. HG4-2, HG7-2 and HG2-1 were found to hybridize to the rNT-4 180 bp probe 25 (NaPO" hybridization as above, 65C), and a 45mer oligonucleotide probe (GG~r~~ ~GTGGAcAGGAGG~ CTGGGTATCTGAG) [SEQ ID
NO:114] corresponding to amino acid GGGCRGVDRRHWVSE [SEQ ID
NO:115] coded for by human PCR fragment clone 17B (6xSSC, 45C
hybridization). The size of the insert for these three genomic clones is 30 approximately 9-23 kb. They both contain the coding exon of the gene(s) WO 93/25684~ 1 3 7 7 9 ~ PCI/US93/05672 that is closely related to the probes ussd for the screening, hNT4 (120 b~
and rNT4 (180 bp). The phage DNA for the genomic clones was digested with several restriction enzymes and subjected to Southern analysis. The appropriate fragment that hybridizes to the probe rNT4 (180 bp) can be subcloned into Bluescript vector. The size of DNA fragments to be subcloned are as follows: clone 2-1 (1.0 kb Xhol fragment), clone 4-2 (4.0 kb Xhol fragmant) and clone 7-2 (5.0 kb BamHI fragment). Complete coding sequence can be obtained and this information can be used to identify the exon boundaries to allow subcloning of this gene into an appropriate expression vector.
To this end, nucleotide sequence analysis was performsd on human genomic phage clone 7-2, which had been obtained by screening a human genomic library with a PCR fragment derived from human genomic DNA
using degenerate oligonucleotides to the DNA sequence of Xenopus NT~
(see ~iscussicn, supra). Sequenca analysis revealed that human phage clone 7-2 contains a sequence identical to the sequence of the PCR fragment used as a probe to screen the genomic library. This sequence is contained within what appears to be an exon encoding a novel neulutrophic factor (Figure 18, SEQ ID NO:7~ and SEQ ID NO:76).
Alignment of the protein encoded by this exon (Figure 19, SEQ ID
NO:77) with the known neu,ul,ûph;lls revealed that it shares features found in all the known neurotrophins (Figure 19, SEQ ID NOS:78-92). It contains a prepro region in which are conserved many of the identical amino acids consel.led between the prepro regions of previously defined neurotrophins.
Fullllerl,.ore, this prepro region is preceded by a splice acceptor site localized in the same region as in other neurotrophin genes. The prepro region also contains a consensus glycosylation site at the appropriate position, and terminates at a cleavaga site which was very similar to the cleavage sites found in the other neurotrophins (Figure 18). The prepro region of 7-2 is unusual, however, due to its short length as compared to W O 93/25684 2 ~ ~ 7 ~ ~ ~ PC~r/US93/05672 the prepro region of known neurotrophins. The decrease in length occurs in the N-terminal portion of the prepro region, which is the least conserved portion of prepros between family members. The mature region retains all 6 cysteines found in all previously identified neurotrophins. Many of the 5 residues shared between different members of the neurotrophin family are also conserved. F~ch~ing the exlensive sequence similarity shared by aPCR
fragment derived from rat genomic DNAwhich may correspond to the rat equivalent of the protein encoded by the human 7-2 clone, computer alignments revealed that the neurotrophin encoded by the 7-2 phage clone 10 was most similar to that of Xenopus NT-4. This was true for both the prepro and mature regions. The protein encoded by the 7-2 clone is unusual, as compared to the known neurotrophins, due to the presence of an insertion situated between the second and third cysteines in the mature region.
Ssquence analysis was also performed on two additional human clones isolated in the same screen;ng procedure that yielded clone 7-2 (see disc~ssicn, supra). The sequence of these clones was similar to, but not identical to, that obtained from clone 7-2, raising the possibility that thay encode novel neulot,ophins more closely related to 7-2 than to the other 20 known neu-ol,ophins. The partial sequence of one of these clones, clone 2-1, is presented in Figure 20 (SEQ ID NO:93 and SEQ ID NO:94). The sequence disclosed starts at a position corresponding to amino acid number 50 in the alignments clepi~1ed in Figure 19. Partial sequence of the other clone, clone 4-2, is presented in Figure 21 (SEQ ID NO:116 and SEQ ID
NO:117).

10. EXAMPLE: TISSUE SPECIFIC EXPRESSION OF HUMAN NT4 A 680 bp Xhol-Notl fragment, containing the entire coding region of 30 the human genomic NT-4 clone, HG7-2, was radiolabeled and utilized in W093/~5684 i~,~``f~ PCI/US93/05672 Northern analysis of various human tissue specific PolyA+ RNAs. The huma~
tissue specific mRNAs were fractionated by electrophoresis through a 1%
agarose-formaldehyde gel followed by capillary transfer to a nylon membrane with 10X SSC. The RNAs were cross-linked to the membranes by e~posure to ultraviolet light and hybridized at 65C to the 680 bp Xho1-Not1 r~diol~heled NT-4 probe in the presence of 0.5M NaPO4 (pH 7), 1%
bovine serum albumin (Fraction V, Sigma), 7% SDS, 1 mM EDTA and 100 ng/ml sonicated, denatured salmon sperm DNA. The filter was washed at 65C with 2X SSC, 0.1% SDS and subjected to autoradiography overnight with one intensifying screen and X-ray film at -70C. Ethidium bromide staining of the gel demonstrated that equivalent levels of total RNA were being assayed for the different samples.
The human NT-4 probe hybridized strongly to mRNA from skeletal muscle, proslale, thymus, testes and place"la (Figure 22). The NT-4 probe hybridized to a larger transcript in skeletal muscle than prostate mRNA.
This data suggests that a small human NT-4 multigene family, po~sessing di~erenl e,~,ession levels as well as l,dnsc,ipl sizes, may be pressnl.
The high sx~,ression of human NT-4 in muscle tissue suggests that the present invention may be utilized to treat disorders of ths nervous system, 2 0 speci~ically the wide array of neurological d;sorders affecting motor neurons (see ~iscu~sion, supra). Additionally, high expression of human NT~ in pn.sldle tissue suggests that the pfesenl invention may be utilized to treat proslate ~ise~se, preferably BPH and impotency (see discussion~ supra).
Finally, ~ression of human NT-4 in thymus tissue suggests that the presenl invention may be utilized to treat immunological related disorders of nerve and muscla tissue, including but not limited to myasthenia gravis (see scussion, supra).

WO93/25684 ~ 17~;~ PCr/US93/05672 J~ 11. EXAMPLE: CONSTRUCTION OF HUMAN NT-4 IN EUKARYOTIC
EX~htSSlON VECTORS AND THE MEASU11~1ENT OF BIOLOGICAL

11.1 MATERIALS AND METHODS

11.1.1.CONSTRUCTION OF EUKARYOTIC EXPRESSION VECTORS ENCODING

Two eukaryotic expression vectors containing the prepro precursor coding region of the human genomic clone HG7-2 were constructed in pCMX
(NRRLAcce~sion No. B-18790). The first construction utilized the normal translation initiation site of pCMX (pCMX-HG7-2Q), while the other utilized the Kozak consensus translation initiation site (pCMX-HG7-2M). A 5 kb genomic fragment of HG7-2, contaWng the entire coding region cloned in the BamHI site of Bluescript, was amplified by PCR utilizing the following oligonucleolides;
hNT4-5XhoM:CGGTACCCTCGAGCCACCATGCTCCCTCTCCCCTCA
lSEQ ID NO:118]
2 0 hNT4-3'N~t~TACM~r~XGC I l l; l 1 GGGCATGGGTCTCAG
[SEQ ID NO:119]
hNT4~XhoQ:CGGTACCC I ~GAGCCACCCA~i l ~; 1 CCGAGAGATG
lSEQ ID NO:1201 Oligonucleotide primer combinations of hNT4-5'XhoM and hNT4-3'Not were used to construct pCMX-HG7-2M, while oligos hNT4-5'XhoQ and hNT4-3'Not were used to construct pCMX-HG7-2Q. The PCR fragment was digested with Xho1/Not1 and subcloned into Xho1/Not1 digested pCMX.

WO 93/25684 . PCr/US93/05672 11.1 ~.CONSTRUCTION OF CHIMERIC GENES FUSING A
NElJ~ ~IIN PREPRO REGION TO THE MATURE CODING REGION OF

Two additional eukaryotic expression vectors encoding ths mature portion of human NT-4 were constructed. First, the prepro region of human NT-4 was replaced with the prepro region of Xenopus NT-4 (pCMX-xNT4/hNT4). Second, the prepro region of human NT-4 was replaced with the prepro region of human NT-3 (pCMX-hNT3/hNT4). The following oligonucleotides were utilized in the construction of pCMX-xNT4/hNT4 and pCMX-hNT3/hNT4:

(1) 5'CDM8: GAGACCGGMGC I l C l AGAGATC [SEQ ID NO:121]
(2) hNT3/hNT4 fusion (~US~ oligonucleotide):
1 5 TGCAG I I I CGCTCACCCCCCGl~ I CCGCCGTGATGT [SEQ ID NO:122]
(3) hNT3/hNT4 fusion (~DS~ oligonucleotida):
ACATCACGGCGGAAAC(~ r.TGAGCGMACTGCA ~SEQ ID NO:123]
(4) xNT4/hNT3 fusion (~DS~ oligonucleotide):
ACTTCCCGGCTAMACGGt3~t3~`TGAGCGAAACTGCA [SEQ ID NO:124]
(5) xNT4/hNT4 fusion (~US~ oligonucleotide):
TGCAG I I I CGCTCACCCCCCG I I I I AGCCGGGAAGT [SEQ ID NO: 109]
The hNT-3 containing plasmid vector (pC8-hNT3) was amplified by PCRwith the 5'CDM8 and hNT3/hNT4 fusion oligonucleotides as primers.
The hNT-4 containing plasmid (pCMX-HG7-2Q) was amplified by PCR with the hNT3/hNT4 fusion ~DS~ oligonucleotide and the hNT4-3'Notl oligonucleotide.
The PCRfragment obtained was excised from the gel, and reamplified by PCR with the 5'CDM8 and hNT4-3'Notl oligonucleotides. The product was then digested with Hindlll and Pstl and subcloned into Hindlll/Pstl digested pCMX-HG7-2Q. Therefore, the expression plasmid pCMX-hNT3/hNT4 contained the hNT3 prepro region fused to the mature coding region of human NT-4. Similarly, the human NT-4 eA~,r~ssion plasmid (pCMX-HG7-2Q) WO 93/25684 2 1 ~ 7 7 q 9 PCI`/US93/05672 was amplifi~d by PCR with the 5'CDM8 and xNT4/hNT4/fusion ~US~
oligonucleotides as primers, while pCMX-HG7-2Q was amplified with the xNT4/hNT4-fusion ~DS~ oligonucleotide and the hNT4-3'Not1 oligonucleotide.
The PCR fragment was excised from the gel, and reamplified with the 5 5'CDM8 and the hNT4-3'Not oligonucleotides. The product was then digested with Hindlll and Pst1 and subcloned into Hindlll/Pst1 digested pCMX-HG7-2Q. Therefore, the resulting eukaryotic expression piasmid, pCMX-xNT4/hNT4 contains the Xenopus NT-4 prepro region fused to the mature coding region of human NT-4.
11.1.3.EXPRESSION OF RECOMBINANT

COS M5 cells were set up at a density of 1.5 x 105 cellshNell of a 15 Costar 6 well dish in DMEM media supplemented with 10% FBS, glutamine and Na pyruvate (all from Irvine Scientific except FBS).
The next day the cells were aspiraled and refed with 2 ml/well of RPMI media containing 400 g/ml DEAE-Dextran (Pharmacia), 400 M
chloroquine (Sigma), 4 mM glutamine (Irvine), 1 x ITS (insulin, transferrin, 20 selenium, Sigma). To each well 2 9 of the appropriate DNA was added and mixed by swirling. Three separate constructs were used: pCMX-xNT4, containing the prepro precursor of Xenopus NT-4; and two human NT-4 constructions, pCMX-HG7-2M and pCMX-HG7-2Q. After the addition of the DNA the plates were returned to 37C, 5% CO2 incub~tor for 3 hours 15 25 minutes. Ths media/DNA mixture was then aspirated and 2 mlhNell of 10%
DMSO in PBS without Ca2+, Mg2+ was added for 2 minutes. The DMSO/PBS was aspirated and wells washed once with 10% FBS DMEM, then - refed with 10% FBS DMEM. The next morning, plates to be l~io~-~s~yed were washed onc~ with Defined Media (DM) and refed 2 ml/well of DM. Three 30 days post-lra"sfection, supernatants wers removed from cells and debris WO 9~5~7 7 ~ 9 PCI`/US93/05672 pelleted by microcentrifugation Supernatants were transferred to fres!
tubes and assayed for bioactivity.

11.1.4. PREPARATION OF ENRICHED MOTOR NEURON CULTURES
Embr,vos (E14) from Sprague-Dawley rats (HSD or Zivic-Miller) were used for all experiments. Pregnant rats were sacrificed by carbon dioxide asphyxiation, and embryos were rapidly removed and placed in ice-cold medium for further ~issection. Spinal cords were removed aseptically from 10 rat embryos of 14 days gestation. The spinal cord was severed caudal to the bulb (at the level of the first dorsal root ganglion), freed of sensory ganglia and adhering meninges. The cord was then subdivided into ventral and msdiodorsal segments for separate cultures. The ventral spinal cord tissues were diced into small pieces and incub~ted in 0.1% trypsin (GIBCO) and 0.01% deoxyribonuclease type 1 (Sigma) in PBS at 37C for 20 minutes.
Trypsin solution was then removed, rinsed and replaced with medium consisting of 45% Eagle's minimum essential medium (MEM), 45% Ham's nutrient mixture F12 (F12), 5% heat inactivated fetal calf serum (GIBCO), 5% heat inactivated horse serum (GIBCO), glutamine (2 mM), penicillin G (0.5 U/ml), and streptomycin (0.5 g/ml). The tissue was then mechanically dissociated by gentle trituration through a Pasteur pipet, and the supernatants were pooled and filtered through a nyion fiber (Nitex, Tetko;
40 m). Ths filtered cell suspension were then subjected to a modification of the fraction procedure described by Schnaar and Schaffner (1981, J.
Neurosci, 1:204-217). All steps were carried out at 4C. Mel(i~cai"ide was dissolved in F12:MEM (1:1 ) medium, and a discontinuous gradient was esl~hlished which consialed of a 18% metrizamide cushion (0.5 ml), 3 ml of 17% metrizamide, 3 ml of 12% metrizamide, and 3 ml of a 8% mstrizamide was prepared. The filtered ventral spinal cord cell suspension (2.~ rnl) obtained as described above was layered over the step gradient, the tube WO 93/25684 2 1 3 7 7 9 9 PCi'/US93/05672 was centrifuged at 2500 x 9 for 15 minutes using a swing-out rotor (Sorvall HB4). Centrifugation resulted in three layers of cells: fraction I (at 0-8%
interface), fraction ll (at 8-12% interface), and fraction lll (at 12-17%
interface). The cells from each interface were removed in a small volume 5 (about 1 ml), rinsed twice with serum-free defined medium consisting of 50% F12 and 50% MEM, sllpp!emented with glutamine (2 mM), insulin (5 g/ml), transfe~,in (100 g/ml), progesterone (20 nM), putrescine (100 M), and sodium selenite (30 nM) (Bollensleil, and Sato, 1979, Proc. Natl. Acad.
Sci. 76:514-517). Viable cell count was obtained by hemocytometer 10 counting in the presence of trypan blue. Fractionated ventral spinal cord cells (enriched with motor neurons) were then plated at a density of 100,000 cells/cm2 in 6 mm wells precoated with poly-L-ornithine (Sigma: 10 g/ml) and laminin(GlBCO: 10 g/ml). Treatment with COS cell supernatants conlaining NT-4 was COS cell was given on the day of plating. Cultures were maintained in serum-free defined medium at 37C in 95% air/ 5% CO2 atmosphere at nearly 100% relative humidity. On day 2 (48 hours), oells were harvested for measurements of choline acetyltransferase (CAT) as desc,ibed in Fonnum, 1975, J. Neurochem. 24:407-409.

2 0 11.1.5. PREPARATION OF ENRICHED HUMAN MOTOR NEURON CULTURES
Seven to 9 week old human embryonic material was obtained from aspiration abortions at the Geneva Cantonal I lospil~i. Appropriate consent forms for experimental use of embryonic tissues were obtained from the Ethics Commission for the Department of Gynecology and Obstetrics at the Hospital. The age of the embryo was estimated according to menstrual history, foot size (Streeter, 1920 Contri. Embryol. 11, 143) and external characteristics (Moore, 1982, in UThe Develop;ng Human~, K.L. Moore, ed., pp 70-92, W.B. Saunders, Phi'^ lelpl,ia). The material was kept at 4 C for 2 to 6 hours until dicse~tion. The spinal cords were carefully isolated, all the spinal roots were removed, and the meninges and other adhering tissue W O 93/25684 PC~r/US93/05672 ~r~ discarded. The cords were minced and incubated in 0.12% trypsin ir~
Ca2~, Mg2~- free salt solution for 10 minutes at 37C. The cells were dispersed into a suspension by repeated trituration through a pipette. Cells were centrifuged and resuspended in a standard culture medium (MEM plus 5 13% decomplemented human serum). The Petri dishes were covered with a solution of polyornithine at a concentration of 1 mg/ml for 1 hr at 37 C
and rinsed three times with phosphats-buffered saline solution (PBS) before plating. Cells were plated at a density of 4 X 104 and 10-15 X 104 cells per 6 and 11 mm tissue culture well, respectively. The cultures were maintained 1 0 at 37C in 5% C2/2 air. The medium was changed ev~ry three days and cytosine arabinoside (ara C) (a0-6M) was added during the last 4 days of culture. Human neurotrophic factors CNTF, NT-3 and NT-4 were added from the start of the culture period at a concentration of 1 Ong/ml and lthe culture medium was changed every 3 days. Choline acetyltransferase 1 5 (ChAT) was determined by measuring the synth~sis of 3H-acdtylcoenzyme A. The ChAT measurements were done according to the method of Fonnum, F. J., 1975, Neurochem. 24:407-409 with the modifications of Raynaud, et al., 1987, Dev. Biol. 119:305-312 and Martinou et al., 1989, J.
Neurosci. 9:3645-3656 (1989).
11.2 RESULTS
11.2.1.EUKARYOTIC EXPRESSION OF BIOLOGICALLY ACTIVE RECOMBII\IANT

rla~",id DNA from each of the pCMX-based constructions (pCMX-HG7-2Q, pCMX-HG7-2M, pCMX-hNT3/hNT4 and pCMX-xNT4/hNT4) was prepared and individually transfected into COS cells. COS supernatants from each transfectsd cell line were utilized in order to ~Csess the biological activity of each respective recombinant form of NT-4. The volumes of C06 supernatants tested were 10, 50 and 250 1 in a total volume of 2 ml. Q1 (pCMX-HG7-2Q), N7 (pCMX-hNT3/hNT4 fusion), and X1 (pCMX-xNT4/hNT4) WO 93/25684 2I 3 7 7 ~ ~ PCr/US93/05672 possessed neurite-promoting activity on DRG explants (Figure 23). In addition, both Q (pCMX-HG7-2Q) and M (pCMX-HG7-2M) were examined for their survival-promoting activity on DRG ~issoci~ted cells. Volumes tested were 5-250 1 in a total volume of 2 ml. When added to cultures of 5 dissociated DRG neurons, COS supernatant containing hNT4 promoted 30%
neuronal survival compared to 10% survival with mock transfected C06 supernatants (Figure 24).
The biological effect of human recombinant protein from supernatants of COS cells trans~ected with pCMX-HG7-2M was tested on 10 motor neuron enriched cultures prepared as described supra in Example Section 11.1.4. and on human spinal cord neurons as described supra in Example Section 11.1.5. Treatment of motor neuron enriched cultures with pCMX-HG7-2M derived human NT-4 diluted to 1:5 resulted in a 2.9 fold increase in choline acetyltransferase (CAT) activity after 48 hours as 15 compared to untreated (C-NT) and mock transfected (MOC COS) controls (Figure 25). The increase in CAT activity dropped to 1.7 fold when a 1:50 dilution was tested, suggesting that it was a dose dependent response (Figure 25).
The biological effect of the neurotrophins on cultured human spinal 20 cord neurons, as measured by ChAT activity, was as follows. Since there was a dir~erence in the ChAT values from one experiment to another, the values in the control wells were normalized to 100% in order to compare results from dirrerenl experiments. The results have been pooled from 20 dir~erent cultures and are ex,uressed as the mean +/- S.E.M. (n=number of 2 5 wells):
Condition (n) % ChAT Activity Control (77) 100 NT-3 (24) 231 +/- 23 BDNF (12) 252 +/- 27 NT-4 (25) 318 +/- 38 WO 93/2~3 7 7 9 ~ PCI`/US93/05672 11.3 DISCUSSION

The present invention provides for the utilization of an in vitro eukaryotic expression system to express recombinant human NT-4. The present invention discloses several strategies to express a biologically active form of racombinant human NT-4 in COS cells. In one example, the DNA
sequence encoding NT-4 prepro precursor was amplified utilizing two FCR
amplification strategies to yield pCMX-based expression plasmids containing either the pCMX translation initiation site (pCMX-HG7-2M) or a Kozak consensus translation site (pCMX-HG7-2Q). In another example, two chimeric neurotrophin genes fusing either the prepro region of Xenopus N~-4 (pCMX-xNT4/hNT4) or the prepro region of human NT-3 (pCMX-hNT3/hNT4) to the mature coding region of NT-4 were constructed for 1 5 ex~ ression in COS cells (see Section 5, supra, for a cliscussion of the use of chimeric constructions to express NT-4 in vitro).
Expression of a biologically active form of human NT-4 in an in vitro eukaryotic expression system substantially increases the ease at which the production of human recombinant NT-4, peptides or derivatives thereof may be scaled up for both therapeutic and diagnostic applications discussed supra. In view of the instant invention, one of ordinary skill in the art can readily construct a plasmid containing an identical DNA sequence as disclQsed or a similar DNA sequence encoding a homologous yet dislin~ NT-4 like protein or derivative thereof. The skilled artisan can also pick and 2 5 choose between numerous DNA plasmid vectors known in the art to construct an e~,ression plasmid for use in a eukaryotic expression system.
We have demonsl,aled that recombinant human NT-4, whether produced as a full prepro precursor or via a neurotrophin-based chimaric construction, is biologically active as demGns~,dled by the stimulating effect W0 93/25684 2~ ~ 7 7 n ~ PCr/US93/05672 of recombinant NT-4 COS supernatants on neurite outgrowth in DP~
explants and the bioactivity on rat and human cultured motor neurons.

12. EXAMPLE: TRKB IS A RECEPTOR FOR NEUROTROPHIN-4 12.1 MATERIALS AND METHODS

-12.1.1 3T3 FIBROBLAST SURVIVAL ASSAYS

C06 cell supernatants were examined in a survival assay utilizing 3T3 fibroblasts. In this assay system, 3T3 fibroblasts, which do not express neurotrophin receptor proteins, are transfected with mammalian ek~,ression vectors encoding either trkA, trkB or trkC. 3T3 fibroblast survival is dependent on the addition and receptor specific binding of the respective 1 5 neurotrophic factor.
COS-M5 cells were cultured and lfansfe~ed with either pCMX-HG7-2Q, pCMX-HG7-2M or pCMX-HG7-2Q as described in Example Section 11.1.3.
A full-length rat trkA cDNA clone was obtained from Dr. Eric Shooter of Stanford University. Tha rat trkA cDNA was subcloned into thc 20 mammalian expression vector, pCMX, to generate pCMX-trkA.
Full-length rat trkB and trkC cDNA clones were obtained by screening a rat brain cDNA library in the lambda ZAP2 vector (Stratagene) with rat trkB-specific and trkC specific oligonucleotides corresponding to the most 5' and 3' coding regions of trkB and trkC. Ths rat trkB and trkC cDNAs were 25 subclQned into pCMX to gener;~te pCMX-trkB and pCMX-trkC.
3T3 fibrobl~t-c wera cultured and transfected as described in Glass, et al., 1991, Cell 66:405-413.
In this survival assay system, 3T3 ribrobl~ , which do not express neurotrophin receptor proteins, have been l,ansfected with trkA, a proto-3 0 oncogene encoJ;"g a tyrosine kinase receptor for NGF, with trkB, a tyrosine WO 9?~?~63~7 7 ~ 9 PCI'/US93/05672 kinase which serves as a functional binding protein for BDNF and NT-3, o~
with trkC, a tyrosine kinase which serves as a functional binding protein for NT-3. The transfected cells are dependent upon the addition of the corresponding neurotrophin for survival, and thus may be used to assay for biological activity of neurotrophins.

12.1.2 TRANSFECTION OF PC12 CELLS

A full length rat trkB cDNA was placed under control of the CMV
promoter in the pcDNA I expression vector (Invitrogen), which also contains an LTR-promoted neo resistance gene. PC12 cells (a gift of Dr. Eric Shooter, Stanford University) (107 cells per 10cm dish) were incub~ted for 24 hr in 5 ml OptiMEM medium (GIBCO BRL) conlai,)ing 25 mg DNA and 100 mg Lipofectin (GIBCO BRL), thsn rinsed and placed in frash medium. Five days after transfection cells were select~d in 0.4 mg/ml G418. Resistant colonies were assayed for differentiation in the presence of 100ng/ml BDNF
and one clone (PC12/trkB) was selected for further study.

12.1.3 CROSS LINKING STUDIES
Cross-linking studies were performed as follows: Briefly, cell lines and cell suspensions from cortex, hippocampus and striatum were incub~ted in PBS-glucose with 1nM of 1251 l~helled NT~, in the presence or absence of excess cold naurotrophins for 2 hr at 4C. The cross-linking agent (6mM
2 5 EDAC for 1251-BDNF and 1251-NT~, 0.2mM DSS for 1251-NGF) was added, and rotated at room temperature for 20 minutes. The mixtur~ was washed 3 times with a solution cGnlaining tris/NaCI. The cell pellet was resuspended in complete RlPAlysis buffer. After centrifugation, the supernatant containing cross-linked complexes was immunopreci~ led with trk-antibody (RG22), wo 93/25684 ~ I ~ 7 7 9 t~ PCr/US93/05672 and subjected to electrophoresis. The fixed and dried gels were exposed for autoradiography.

12.2 RESULTS

12.2.1 3T3 trkB CELLS REMAIN VIABLE IN THE PRESENCE OF NT-4 -Addition of NT-4 containing COS cell supernatants in this bioassay indicated that viable cslls remain after 48 hours only in 3T3 trkB cultures 10 (Table 2; data not shown indicated inability of NT-4 containing COS
supernatants to support 3T3-trkC cultures). Thus, these results demonslrate that NT-4 protein has biological activity in this system, and suggests that trkB, but not trkA or trkC, serves as a functional binding protein for NT-4.

Assay of COS Super"ata,)ts on 3T3 Cell Lines Ex~,essing TrkA and TrkB

DilutionsMock HG7- HG7-hNT3/
2Q 2M hNT4 1:5 _ -- -- --1:10 2 5 3T3 1:20 1 :50 1:5 1:10 3 0 3T3-trkA 1:20 1 :50 1:5 _ + + +
1:10 _ + + +
3 5 3T3-trkB 1:20 _ + + +
1:50 _ + + +

7 ~ ~ ~
12.2.2 HUMAN AND RAT NT-4 ARE SIMILAR TO XENOPUS NT~ IN THEIR
ABILITY TO SPECIFICALLY ACTIVATE trkB.
To compare human and rat NT-4 to xNT-4 for their abilities t o activate the various trk receptors, we first expressed all three of these proteins transiently in COS cells; metabolic labeling was used to demonstrate that all three proteins were produced in approximately equal amounts by these cells (data not shown). COScell supsrnatents containing the three proteins were then assayed for their ability to induce tyrosine phosphorylation of the three known trks expressed in NIH3T3 fibroblasts.
Human and rat NT-4 were identical to xNT-4 in that they were specifically able to induce the tyrosine phosphorylation of trkB, but not trkA or trkC
(Figure26). Furthermore, human NT-4 and xNT-4 induced trkB tyrosine phosphorylation with very similar dose-dependencies (Figure 27A). Human NT-4 and xNT-4 also displayed sirnilar dose-dependencies in their ability to slicit grow~h of NIH3T3 cells ex~,lessing trkB receptors (Figure 27B). In addition, both stimulated neurite outgrowth in PC12 cells expressing introduced trkB receptors; neither human NT-4 nor xNT-4 could elicit 2 0 phenotypic effects from untransfected versions of these cells, or cells expressing the other trk receptors (not shown). Thus mammalian NT-4 and xNT-4 are very similar in their ability to functionally activate trkB but not trkA or trkC.

2 5 12~.3 TYROSINE PHOSPHORYLATION OF trkB BY NT-4 The assay described above suggested that not only are mammalian NT-4/5 and xNT-4 similar to BDNF in being spscific ligands for trkB, but they might also be as potent as BDNF in their ability to activate trkB. To dirsctly 30 determine the specific activities of all the known mammalian neurotrophins for each of the known trk receptors, we firs~ obtained highly purified -WO 93/25684 ~ ~ 3 7 ~ ~ PCI/US93/05672 preparations of each of the mammalian neurotrophins. Each of these purified factors was then tested for its ability to induce tyrosine phosphorylation of each of the trk receptors expressed in NIH3T3 fibroblasts. NGFwas clearly the preferred ligand for trkA, with very minor 5 inductions by very high concentrations of NT-3 and NT-4, while NT-3 was clearly the preferred ligand for trkC, with minor induction by very high concentrations of BDNF (Figure 28A and 28C). BDNF, NT-3 and NT-4 were all quite effective at inducing tyrosine phosphorylation of trkB, although the NT-3 induction appeared to raquire higher concentrations to achieve 10 saturation (Figure28B).
To compare specific activities for inducing phosphorylation with those required for function effects, each of the purified neurotrophins was then assayed for its ability to promote cell growth of NIH3T3 cells expressing each of the trk receptors. Strikingly, the dose-responses for cell growth in 15 fibroblasts almost exactly paralleled those for phosphorylation (compare panels A, B and C with D, E and F in Figure 28); by this assay, BDNF and NT-4 were essentially indistinguishable in their ability to activate trkB, whereas NT-3 was about 50-fold less potent. In all cases, the "preferred" ligands for each trk receptor (i.e. NGF for trkA, BDNF or NT-4 for trkB, and NT-3 for 2 0 trkC) exhibited 50% of their maximum activity (EC50's) of between 1-1 Ong/ml.

12.2.4 ACTIVATION OF PC12/trkB CELLS BY NT-4 2 5 In addition to the 3T3/trkB system, we hava also compared the abilities of human NT-4 to activate trkB in PC1 2/trkB cells. Of the 4 - neurollophins tested, parental PC12 cells are only responsive to NGF (Figure 29). In PC12 cells stably l,ansfected with trkB, NT~ increased the survival -(Figure 29B) and perce"lage of neurite-bearing PC12/trkB cells (Figure 29A) 30 in a dose-dependent manner, similar to that seen with BDNF. PC12/trkB

cells responded to NT-3 only at high concer,lrhlions. Results of tyrosine phosphorylation assays performed with 4 neurotrophins in PC 12 or PC12trkB cells showed that NGF induced trkA phosphorylation in PC12 cells, while BDNF and NT-4 and NT-3 (to a lesser extent) induced trkB
phosphorylation in PC12/trkB cells (Figure 29C).

12.2.5 NT~ COMPETES FOR trkB BINDING WITH BDNF and NT-3 Cross-linking experiments were carried out with radiodinated neurotrophins. Iodinated NGF was found to cross-link to a protein (presumed trkA) immunoprecipitable with trk antibody in PC12 cells and striatal homogenates (rat postnatal day 7) (Figure 30A), and 3T3/trkA
cells (data not shown). In all cases, this cross-linked protein could be competed by excess cold NGF, and not by BDNF, NT-3 or NT~. This data in~;c~tes that NT-4 did not interact appreciably with the trkA receptor in cell lines or in vivo. Similarly, iGdi.1dled BDNF could be cross-linked to a trk-immunoprecipitable protein (presumed trkB) in 3T3/trkB cells, PC12/trkB
cells (data not shown), and cortex (rat postnatal day 7); this cross-linked protein could be competed by BDNF, and NT-4, to a lesser extent by NT-3, but not by NGF (Figure 30B). Iodinated NT~ cross-linking experiments gave similar results. That is, in 3T3nrkB cells, PC12ttrkB cells (data not shown), cortex and hippocampus (postnatal day 7), NT-4 cross-linked protein could be competed by BDNF and NT-4, to a lesser extent by NT-3, and not by NGF (Figurs 30C).

13. E)CAMPLE: NT 4 t~tC 1~ NEURITEOUTGROWlH AND CELL SURVIVAL OF
DORSAL ROOT GANGLION EXPLANTS
Neurotrophin responses in cultured primary neurons were examined.
The survival of sensoly neurons derived from embryonic E14 rat dorsal root ganglia were supported by all of the known neurotrophins, albeit to differing WO 93/25684 2 ~ ~ ~ 7 ~ ~ PCr/US93/05672 extents, which suggest that different neuronal subpopulations in the ganglia are responding to the different neurotrophins (Figure 31). RNA was prepared from immediately explanted dorsal root ganglia, as well as ganglia that had been maintained for 24 hours in the presence of individual 5 neurotrophins; after this 24 hour treatment, only neurons responsive to (and thus presumably expressing the appropriate trk receptor for) the given neurotrophin survive, while non-responding neurons die. Untreated ganglia immediately removed from the animals expressed all of the trks (Figure 32). In contrast, ganglionic neurons surviving in the presence of 10 BDNF or NT-4 showed significant trkB message, but no detectable trkC
message (Figure 32). Ganglionic neurons surviving in the presence of NT-3 expressed trkC but not trkB. These data demonstrated that NT-4 act on trkB and not on trkC. Similar studies were not possible with trkA because, in contrast to the mutually exclusive relationship between trkB and trkC
15 ex~ressing neurons, it appears that subsPrltial numbers of trkB and trkC
ex~.ressi,lg neurons co-e,c~ress trkA (data not shown).

14. EXAMPLE: DISTRIBUTION AND RETROGRADE TRANSPORT OF NT-4 2 0 14.1 MATERIALS AND METHODS

NT-4 was iodina~ed by a modification of the lactoperoxidase method.
Briefly, 1 mCi of Na125I (NEN) was added with 1.2 ~lg of lactoperoxidase (Sigma), 85 ~M H202 and 10 ~9 of NT-4 at pH 6.0 for 12 min. The 25 reaction was stopped by addition of 0.1 M Nal, 0.1 M Na phosphate and 1.0 M NaCI, pH 7.5. The reaction was diluted 1:1 with 2% bovine serum albumin (Boehringer Mannheim) in PBS. The solution was dialyzed to eliminate free (unincorporated) 1 25I. Percent incorporation (55%) was determined by thin layer chromatography. Specific activity (2047 W O 93/25684~ PC~r/US93/05672 cpm/fmole) was calculated based on a molecular weight of 26,000 for NT~.
For sciatic nerve studies adult male Sprague-Dawlsy rats (Zivic Miller;
200-220 9; n=30) were anesthetized with a mixture of pentobarbital (35.2 mg/kg) and chloral hydrate (170 mg/kg), and the right sciatic nerve was exposed. Two ~11 of ~25I-labeled NT-4, containing PBS or a 50-fold excess of unlabeled neurotrophins, were injected into the nerve at the level of the tendon of the obturator internus muscle with a Hamilton syringe. Wounds were sutured and the animals allowed to recover for 18 hr. Rats were killed, the DRGs were dissected, placed in 4% paraformaldehyde and 1 0 counted in a gamma counter for 1 min. Differences in mean transport values were analyzed by analysis of variance (ANOVA).
For sympathetic neuron transport studies, 125I-labeled NT-4 was injected into the anterior eye chamber as described (.lohnson et al., 1978).
After 16 hr SCGswere removed and counted in 4% paraformaldehyde as 1 5 for DRGs.
Fixed DRGs and spinal cords were equilibrated with buffered sucrose, frozen in methyl butane and se~ioned in a cryostat (10 llm for DRG and SCG, and 20 ~lm for spinal cord) and then mounted onto microscope slides.
The brains from perfused animals were removed, equilibrated in buffered sucrose, and 25 ~Lm frozen sections were cut in the coronal plane and mounted. Slides were then processed for emulsion autoradiography (using Kodak NTB-2 emulsion) following established procedures (Cowan et al., 1972). FYposlJre times ranged 1-3 weeks; however, comparable exposure times were used for any individual region. After being developed, tissues were counterstained through the emulsion (NTB-2, Kodak) with thionin.
For studies involving transport in the brain, male Sprague-Dawley rats were anesthetized with chloral hydrate-pentobarbital and fixed in a stereotaxic apparalus. Small volumes of [~25I]-l~heled trophic factors (0.2-0.5 ~I) w~re injected slowly into the hippocampus or neostriatum by way of a borosilic~te glass micropipelle. In other experiments, larger volumes (10 W O 93/25684 ~ 1 3 7 7g~ PC~r/US93/05672 1) were injected into the right lateral cerebral ventricle. The wounds were closed and the animals allowed to recover. Approximately 24 hours later, the animals were sacrificed and the brains fixed by transcardial perfusion of buffered paraformaldehyde. The brains were then removed, sectioned and 5 processed for film and emulsion autoradiography. Hippocampal injections were centered in the Dentate Gyrus/CA4 - Hilar region. Striatal injections were located centrally in the rostral caudate-putamen.
Intracerebroventricular (ICV) injections were verified as being made into the ventricular space. Similar amounts of [125I]-NGF, NT-3 and BDNF have been 10 injected at these sites previous experiments, permitting a clear determination as to the specificity of the patterns of distribution and retrograde transport within the CNS.

14.2 RESULTS

14.2.1 TRANSPORTOF NT-4 IN THE BRAIN

Film and emulsion autoradiographic experiments (Table 3) showed that, like NGFlabeli"g associated with retrogradely transported NT-4 was 20 well loc~ e~l to magnocellular neurons of the medial septum and diagonal band, cells which are known to provide the cholinergic input to hippocampus.
In general, more magnocellul~r neurons appear to be labeled in NGF-injected animals compared to animals injected with NT-4.
Examination of film and emulsion autoradiograms available to date 25 have not provided evidence of transport of NT-4 to any other CNS cell group following intrastriatal or intrahippocampal injections, in marked contrast to results obtained with BDNFwhich is widely Iransported within the CNS (Table 3).

WO 93/25684 ~ ~ ` PCI/US93/05672 Table 3: Retrograde Neuronal Labeling rOIIo~:;"y Hippo~mpal p~37,~9 Injections of Rad;odi,)dled NGF, BDNF and NT~

Brain Area ~ ~E NT-4 Basal Forebrain Medial Septum ++++ ++ ++
Diagonal Band (v) ++++ ++ ++
Diagonal Band (h) ++ + +
Basal Nuc. Meynert + _ _ Hippocampus Hilus/CA 4 _ ++++
Hilus/CA 4 (contra) _ + + +
CA 1 _ +
CA2 _ +
CA3 ++

Brain Area ~3E ~IE NT-4 Dentate Gyrus ? ? ?
2 0 !Subic~ ~'u~n _ +
Par~s~ Ihlicu~um _ + + +

Other Supramam. NUCIelJS ++ +++
2 5 Reuniens Nucleus _ +
Entorhinal Cortex _ + + +

Data reported above is derived from emulsion autoradiographic experiments. Pluses represent relative numbers of cells l~hele~ in a given 30 area, from ~++++~ indicating many labeled cells to ~+~ i,-d;caling a few.

W O 93/25684 2 1 ~ 7 7 9 ~ PC~r/US93/OS672 Minus signs irl~l;G:~IeS that no l~heled cells were observed. A question mark indicates areas that were difficult to evaluate given their proximity to the illjeUliGn site 14.2.2 DISTRIBUTION OF NT~ FOLLOWING ICV ADMINISTRATION

-In previous experiments, we have found that NGF diffuses widely into the brain parenchyma following ICV administration, such that the 10 radiolabeled ligand becomes available to and concentrated within NGF-responsive neuronal populations (eg. the cholinergic neurons of the basal forebrain). Diffusion of NT-3, and particularly BDNF into the brain subsPnce is much more limited in the rat, such that at most a few neurons within the neural parenchyma concentrate sufficient amounts of labeled BDNF to be 1 5 clearly discriminable. Follov :ng ICV adminisl,alion of BDNF (and to a lesser extent NT-3), labeling of the apical surface of the ventricular ependyma is particularly prominent.
Following ICV administration of [125I~- NT-4, the pattern of distribution seen is distinctly different from that described above for the 20 other neurotrophins. As for NGF, label associated with NT-4 is distributed for some distance into the brain substance bordering the ventricles, espec;e~ly at the level of the injection site. There is likewise some diffusion into neural tissues from the extracerebral subarachnoid CSF space. In co,lttast to NGF, no concentration of NT-4 ~csoci~ted label was apparenl in 25 neurons following ICV admini~lr~lion.

14.2.3 RETROGRADE TRANSPORT OF NT4 BY L4 AND L5 DRG NEURONS

125I-NT-4 was retrogradely transported by L4 and L5 DRG neurons.
30 This accumulation was specific as ~sessed by the fact that few counts WO 93/2~ 8~ t ~ PCI/US93/05672 accumulated in the contralateral (non-injected) L4 or L5 DRGs and that~
transport was blocked by the co-injection of a 16-fold excess of NT-4. NT-4 transport was blocked to varying degrees by all members of the neurotrophin family. BDNF and NGF (57-fold) ware approximately equal in blocking transport, while NT-3 was as effective as NT-4, when injected at a 57-fold excess. NT-4 was transported to SCG neurons when injected into the anterior eye chamber.

15. EXAMPLE: BINDING OF 125I-NT-4 TO BRAIN AND RETINA

15.1 MATERIALSANDMETHODS

NT-4 was iodinated by ths lactoperoxidase method to a specific activity of 2400-3500 cpm/fmol (1211-1789 Ci/mmol of NT-4). [12sI]-NT-4 1 5 was stor~d at 4C and used within 1-3 days after preparation. Biological activity of the radioiiodinated NT-4 was verified by bioassay.
Male Sprague-Dawley rats (200-250 9, Zivic Miller) were maintained on a 12:12 h li5Jhl.dark cycle and given food and water ad libitum. The brains and eyes of each rat were frozan in isopentane at -15C within 5 min.
of death. Serial, 12 um thick sections of these tissues were collected on gelatin coated slides and were used for binding studies.
Sagittal whole body sections of adult male rat were mounted on a large piece of adhesive tape which was then attached to a plastic frame.
This plastic frame created a rec~ss in which each section was incubated with the [125I]-NT-4.
Binding assays using [125I]-NT-4 were performed as follows: After being thawed, adjacent brain and whole body sections were preincubated for 0.5 h in phosphate buffered saline, pH 7.4 followed by a 3 h incubation at room temperature in DMEM tissue culture medium containing high glucose, 10% heat- inactivated fetal calf serum (60C for 0.5 h), 25 mM

wo 93/25684 2 1 3 7 7 9 ~ PCI/US93/05672 Hepes buffer, 4 ug/ml leupeptin, 0.5 mM PMSF (BRL, Gaithersburg, MD., dissolved to 0.1 mglmg ethanol, 0.5 mM MgCI2 and I nM l125Il-NT-4 with (non-specific) or without (total) I ~M unlabeled NT-3 or NT-4. Following the incubation, the sections were washed for 0.5 h in PBS. Eye sections were 5 not preincubated, and were washed for 0.5 h in binding buffer without labeled or unlabeled neurotrophin, since this procedure maintained the anatomical integrity of the retina during the binding procedure. After washing, sections were fixed for lO min in 4% paraformalde-hyde at 22OC, rinsed for 2 seconds in dH20 and dried with a stream of room temperature 10 air. The labeled sections and 125I-containing radioactivity standards (Amersham, Inc.) were exposed at room temperature for 2-5 days to 125I-sensitive film (Hyperfilm, Amersham, Inc.). Slides were then dipped in Kodak NTB-2 photographic emulsion diluted 1:1 with distilled water and developed 1 to 2 weeks later in Kodak D-19 at 15C.
Slides conl~ning eye sections were stained with hematoxylin-eosin for histological examination.

15.2 RESULTS

In whole body sections of adult rats, specific binding of [125I]-NT-4 was restricted to the central nervous system, including the brain, spinal cord and retina as well as to the dorsal root ganglia.
In brain sections, specific [125I]-NT-4 binding was found to be widely distributed throughout the brain including the cortex, striatum, hippoc~mpus, cerebellum, olfactory bulbs, periaqueductal gray, and raphe nuclei.
Results from dry film eYposlJre of [125I]-NT-4 labeled rat eye sections and human eye sections revealed high levels of displaGe~b'~ binding in the retina. When examined at the emulsion level, intense, ~ispl~r,e~t~le labeling WO 93/25684 PCI'/US93/05672 2~3 was found in the inner plexiform and ganglion cell layers of the retina as w~
as in the human optic nerve.

16. EXAMPLE: THE COMPARATIVE EFFECT OF NEUROTROPHINS IN
HIPPOCAMPUS

16.1 MATERIALSANDMETHODS

Hippocampi were dissected from E18 rat embryos of Sprague-Dawley rats, and collected in F10 medium. The tissues were minced, rinsed twice with F10 medium (Gibco) and trypsinized with 0.25% trypsin (Gibco) for 20 minutes at 37C. Trypsin was inactivated by the addition of a serum-containing medium composed of minimum essential medium (MEM
supplemented with fetal calf serum (FCS, 10%), glutamine (2 mM), penicillin (25 U/ml) and streptomycin (25 llg/ml) in DME plus 10% fetal calf serum.
After 4 hours of culture, the medium was changed to DME plus I mg/ml BSA
and N2 media supplement [Bottenstein, st al., Methods Enzymol. 58:94-109]
and 1 mM pyruvate, at which time NT-4 was added. The media was changed every three to four days, with re-addition of the factor.
16.2 RESULTS

Purified recombinant human NT-4 produced an increase in fos mRNA
in these cells similar to that seen with BDNF or NT-3 (Figure 33A). This increase was followed by an increase in fos protein when examined at 2 hr after treatment. The three neurotrophins (BDNF, NT-3 and NT-4) were found to cause tyrosine phosphorylation of proteins immunoprec4)ilabl~ by a pan trk-specific antibody (Figure 33B). Two cell populations that were shown to respond to BDNF also responded to NT-4. That is, there was an increase in the number of acetylcholinesterase-positive cellsand calbindin-immunoposili~e cells in hippocampal cultures treated with NT-4 (Figure 34).

W O 93/25684 PC~r/US93/05672 ~1~77~
.

17. EXAMPLE: NT4 INCREASES SURVIVAL AND DIFFERENTIATED FUNCTIONS
OF RAT SEPTAL CHOI INERGIC NEURONS IN CULllJRE

17.1 MATERIALS AND METHODS

17.1.1. PREPARATION OF DISSOCIATED CELLS AND CELL CULTURE
- CONDITIONS

1 0 The septal region from rats (Sprague-Dawley) after 17 days of gestation was dissected free from the surrounding tissue. Tissue fragments were pooled, washed three times with Ham's F-10, and then transferred to a 35mm tissue culture dish and minced. A single cell suspension was made by incub~ing the tissue with 0.25% trypsin for 20 1 5 minutes at 37~C. Following the inactivation of the trypsin by a five minute incubation at room temperature in growth medium (in~). containing 100 ~lg/ml deoxyribonuclease type 1 (Sigma), the cells were dissociated by passing the fragments rep~atedly through the constricted tip of a Pasteur pipet. The dissoc,~led cells were then centrifuged at 500xg for 45 seconds.
The super-,alanl was removed and recentrifuged.
The loose cell pellets were resuspended and combined in normal growth medium (5% (v/v) horse serum (Gibco), 1 % N3 additives (v/v) (Romijn et al. 1982, Dev. Brain Res. 2: 583-589), 0.5% (v/v) glutamine (200mM, Gibco), and 0.25% (v/v) penicillin-sl-eptomycin (10,000 units/ml, 10,000 mcg/ml respectively, Gibco) in Dulbecco's modified Eagle's medium (DMEM). Three to four hours after plating, sterile coverslips were placed in each well to cover the cells. Neuronal-enriched cultures were prepared by replacing 2/3 of the growth medium, 24 and 72 hours after plating with N3/DMEM: DMEM containing 1% N3 additives, 0.5% glutamine, and 0.25%
~.enicillin and streptomycin. All suhse~luent medium changes, carried out every other day, were done by removing 1/2 the volume o~ medium and W O 93/25684 9 PC~r/US93/05672 2~ replacing it with an equal volume of fresh N3/DMEM. To limit the growth astrocytes, the cultures were treated for 24 hours with cytosine arabinoside at a concenl,dlion of 2~M after 1 week in culture.

17.1 .2 ASSAY OF CHOLINE ACETYLTRANSFERASE (ChAT) ACTIVITY

The growth medium was removed from the cultures and 125 ~l of the Iysis buffer (50 mM KHaP4 pH 6.7 containing 200 mM NaCI and 25%
(v/v) Triton x-100) was added. With the tissue culture plates on ice, the 10 cells were scraped from the plates and the wells were rinsed with an additional 125111 of Iysis buffer. The two aliquotes were then combined in sppindorf tubes and quick frozen in a dry-ice methanol slurry.

17.2 RESULTS

The culture conditions used in this study limit the proliferatiorl of astrocytes and allow for the long-term maintenance of basal forebrain neurons in vitro. E. coli produced NT-4 was added to tha cultures 24 hrs after plating and was replenished with svery medium change. At the end of 20 the two week treatment period, the cells were harvested. Figure35 depicts ths dose related effect of NT-4 on ChAT activity. At a saturating concentration of 25 ng/ml, NT-4 produced an approximate two-fold il1creass in ChAT activity. This level of enzyme induction was maintained up to the highest concentration (100 ng/ml) of NT-4 tested. The level of ChAT
25 induction observed with NT-4 is approximately equivalent to that observed with BDNF. These data thus demonstrat~ that the basal forebrain cholinersic neurons are a target for NT-4.

W 0 93/25684 ~I~77~ PC~r/US93/05672 18 EXAMPLE: NT4 SUSTAINS THE SURVIVAL OF DOPAMINERGIC
NElJPfONS

18.1 MATERIALSANDMElHODS

18.1.1. METHODS FOR CULTURING DOPAMINERGIC
SUBSTANTIA NIGRA NEURONS

-Ventral mesencephalon was dissected from brains of rat embryos 10 varying in age from embryonic day 13 to embryonic day 15. Typically, two litters were used in each experiment. The dissection solution had the f~llowing composition: NaCI, 136.8 mM, KC1, 2.7 mM, Na2HPO4.7H20, 8.0mM, KH2PO4, 1.5 mM, glucose, 6 mg/ml, and BSA, 0.1 mg/ml, pH 7.4.
This solution was prepared and subsequently filter sterilized through a 15 0.211M pore filter. The dissection was performed under non-sterile conJilions. Once the tissue was dEcsected from all the brains, the rest of the procedure was carried out under sterile conditions. The tissue fragments were placed in a 35 mm culture dish and minced using a fine scissGr~. Two ml of F-12 nutrient media containing 0.125% trypsin was 20 then added to the tissue, snd incub~ted at 37 C. At the end of this incob~ion period, DNAsel was added to the slurry such that the final concentration was 80 ng/ml. Another idenlical incub~tion was carried out, and the tissue slurry was sl~bse~luently added to 8.0 ml of growth medium consisting of Minimal Csse,)lial Medium (MEM) supplemented with 2mM
25 glutamine, 6 mg/ml glucose, 5 units/ml penicillin, 5mg/ml streptomycin, and 7.5% fetal calf serum (FCS). The sample was centrifuged in a tabletop centrifuge at room temperature at 500 rpm for a period of 5 minutes. The medium was aspirated, and 2 ml growth medium was added to the cell pellet. A fire polished pipette with an Gpening of I mm was used to triturate 3 0 the cells eight times. The remaining tissue fragments were allowed to settleby gravity, and a small aliquot of the supe",atant was taken to ~cse~s cell W O 93/25684 PC~r/US93/05672 number by counting in a hemocytomater. After c~ll density was dstermine~
the cells were plated into tissue culture plates at a density of 50,000/cm2.
The culture plates were prepared on the day prior to dissection.
Tissue plates (24 well, 2 cm2/well) were precoated with polyornithine (molecular weight 30,000-70,000 g/mol), 0.5 mg/ml, at room temperature for 3 hours. The plates were extensively washed with water, and subse~luently treated with mouse laminin, 5 ~lg/ml, at room temperature for 3 hours. The plates were then washed with water as above, and incubated overnight at 37C in a humidified atmosphere consisling of 5% CO2, 95% air, in the presence of growth medium. The medium in the plates was removed the following day and replaced with fresh growth madium.
Once the cells were plated onto the culture plates, the cells were placed in an incubator set at 37C and 5% CO2/95% air for a period of 24 hours. The culture medium was changed to a serum-free formulation (SFM) having the following composition: a 1:1 (vol:vol) mixture of Basal Eagle Medium (BEM) and nutrient mixture F-12 with glucose (33 mM), glutamine (2mM), NaHCO3 (15 mM)~ HEPES (10mM), supplQmented with insulin (25 ~g/ml), putrescine (60 ~M), progesterone (20 nM), sodium selenite (30 nM), penicillin (5 U/ml), strsptomycin (5 mg/ml), and T3 (30 nM). In some experiments, purified BDNF was added to the cultures after the media change to SFM on culture day 2.
The solutions used for culturing dopaminergic neurons were prepared using water taken from a Milli-Q reagent water system. The tissue culture media formulations were obtained through Gibco Laboratories (Santa Clara, California), as was the fetal cal serum (lot number 43N1086) and the mouse laminin. All other media components were purchased fTom Sigma Chemical (St. Louis, MO), and were cell culture tested grade. The polyornithine and DNAsel were also obtained from Sigma. Trypsin was obtained from Worthington (Freehold, NJ), lot number 3667. Commercial WO 93/25684 2 ~ ~ 7 7 ~ ~ PCI`/US93/05672 chemicals were of analytical grad~, purchased from Baker Chemical (Phillipsburg, NJ).

18.1.2. METHODS FOR IMMUNOCYTOCI 1'~11GAL STAINING
OF VENTRAL MESENCEPHALON CULTURES
..
Fixativs solutions were prepared fresh for each experiment. For the - staining of tyrosine hydroxylase (TH), the fixative was 4.0%
paraformaldehyde in Sorenson's phosphate buffer. The Sorenson buffer was prepared by adding a 0.2 M solution of KH2PO4 to a stock of 0.2 M
NA2H P04 until tha pH reached 7.3. Ths paraformaldehyde was subse~uently added to the solution and briefly heated, to allow it to be dissolved, and cooled to room temperature before use.
To begin the procedure, culture medium was removed from the 15 culture dishes by gentle suction, and the proper fixative solution was gentlyadded to the dish. A room temperature incubation of 20 minutes was carrisd out. Three washes in Sorenson's phosphate buffer, for 5 minutes each, with gentle rotation, followed. The cells were then incubated in a quench solution for 30 minutes at room temperature with gentle rotation.
20 The quench solution for the cultures to be stained for TH consisted of Sorenson's phosphale buffer containing 2% normal horse serum. Next, the cultures were incllb~ted in permeabilization buffer at room temperature for 30 minutes with gentle rotation. The solution consisled of Sorenson's buffer containing 0.2% saponin, and 1.5% of normal horse serum for the cultures 2~ to be stained for TH. Following the perma~hi'i~tion step, the cultures were incub~ted in the presence of primary antibody overnight at 4C. The antibody against rat TH was a mouse monoclonal antibody of isotype IgG2a. It was used at 40 llg/ml in a colution of 20 mM NaPO4, 50mM NaCI, 0.2% saponin pH 7.5. Following the primary antibody incubation, the 30 cultures were washed 5 times for 15 minutes each in the appropriate permeabilization buffer. Next, the cultures were incub~ted with secondary anlibody conjugated to biotin, that is biotinylated horse anti-mouse IgO
2 ~ This incubation was carried out at room temperature for two hours with gentle rotation. Washes identical to those described above followed, and the cultures were then incubated in the presence of a preformed avidin-5 biotinylated horseradishperoxidase complex (ABC reagent, Vector Laboratories, Burlingame, CA) prepared according to manufactur~r's protocol. After a 30 min. incubation at room temperature with gentle rotation, the cultures were washed as described above. The cultures were subse~uently incubated with 55 mM Tris-CI pH 7.3 containing 0.5 mg/ml 10 diaminobenzidine and 0.02% hydrogen peroxide. The development of reaction product was allowed to proceed for 2-5 min. after which the solution was removed and the cultures were washed several times with the ice cold PBS. The number of positive cells/cm2 was then ascertained.
The paraformaldehyde and the glutaraldehyde were obtained from 15 Fluka Chemical. Ve~t~ct~in kits containing normal serum (used as a blocking agent), biotinylated, affinity-purified anti-immunoglobulin, avidin DH, and biotinylated HRP-H wera purchased from Vector Laboratories. The diaminober,~idine was obtained from BRBDNFL (Gaithersberg, MD).

18.2 RESULTS

Two sets of data from experiments in which 2 lots of human NT-4(made in E. coli) were used are shown in Figures 36A and 36B. Cultures were prepared as previously described, and were treated with increasing 25 concentrations of NT-4. In ths experiment shown in Figure 36A, the treatment of cultures with NT-4 was given as a single addition on the day of plating. In ths experiment shown in Figure 36B, the NT-4 treatment was given as multiple additions at the day of plating (culture day 1), and subse~uently at culture days 4 and 7 (CD4, CD7). At culture day 8, the 3 0 cultures were processed for immunocytochemical staining for the WO 93/25684 2~ ~ 3 7 'i ~ 9 PCI'/US93/05672 dopaminergic marker tyrosine hyroxylase. The number of dopaminergic neurons presenl in each dish was then determined. Each treatment group represenls 5 replic~te cultures.
The results from both experiments show that NT-4 treatment leads 5 to an increase in the number of dopaminergic neurons detected by TH
immunocytochemical staining. This increase is dose dependent and saturable as shown in Figure 36B.

19. EXAMPLE: EFFECTS OF NT-4 ON STRIATAL NEURONS IN VITRO

19.1 METHODS

19.1.1 DISSOCIATED CULTURE PREPARATION

Striatal neuronal cultures were prspared from E1 7 rat brains as follows: striatal tissue was minced in calcium- and magnesium-free Hank's balanced salt solution and dicsoc;~ted by enzymatic treatment with 0.25%
trypsin and DNAase (0.2 mg/ml) followsd by mechanical trituration in medium composed of D~'bscco'sModified Eagle's Msdium and 10% fetal calf serum (DME-FCS). Dissociated cells were seeded at a density of 104 cells/well in serum-free N2 medium in 9C woll tissue culture plates that had been previously coated with polylysine and merosin. Human NT-4 (0.1-50 ng/ml) was added at the time of plating and replenished every other day.

2 5 19.1 ~ IMMUNOHISTOCHEMICAL STAINING FOR CALBINDIN

Striatal cultures at 8 days in vitro (8 DIV) were fixed in 4%
paraformaldehyde for 30 minutes, rinsed with PBS, permeabilized for 15 minutes in 0.1% Triton X-100/PBS, and blocked with 10% horse serum/1%
30 bovine serum albumin/PBS for 90 minutes at room temperature. Cultures W0~9~84 PCI/US93/05672 were then inu)b~ted with the primary antibody (Mouse-anti-calbindin. Sigma~
1:5000 dilution) plus 5% normal horse serum overnight at 4C prior to incubation with the secondary antibody (biotinylated horse-anti-mouse (Vector Labs, 1:400 dilution) for 90 minutes at room temparature.
Call,i".lin immunoreactivity was visu~ ed by using the Vectastatin ABC kit (Vector Labs). The number of total neurons as well as the numbsr of neurons immunoreactive for calbindin were counted in approximately 5-10% of the total area of each of four duplicate culture wells.

1 0 19.1.3 MEASUREMENT OF HIGH-AFFINITY GABA UPTAKE

High-affinity GABA uptake was measured according to a modification of the procedure of Tomozawa and Appel, 1986, Brain Res. 399:111-124.
Cells were washed once in buffer containing 140 mM NaCI, 2.6 mM KCI, 0.75 mM MgCI2, 0.75 mM CaCI2, 1 mM KH2PO4, 1 mM Na2HPO4, 6 mg/ml glucose, 2 mM l~-alanine, and 1 mg/ml BSA. Following one wash, cells were incub~ted in the uptake buffer for 5 minutes at 37C. 3H-GABA (NEN, NET-191X,100 Ci/mmol) was then added at a final concenlfalion of 17 nM, and cells were incub~ted for 15 minutes at 37C. In both incubations, neuron-specific uptaks was verified by the ar~dition of 1 mM nipecotic acid to some wells.
Following the second incub~tion~ cells were washed four times with uptake buffer at 4C, and then incub~ted with 0.5 M NaOH for two hours at room tsmperature. The cell extract was then collected and the 3H-GABA in the extract counted.
19.2 RESULTS
Striatal cultures were treated with human NT-4 purified from E. coli.
In striatal cultures treated with NT-4 for 8 days, the percent of total neurons that were calbindin-immunoreactive increased by approximately 3 to 4 fold compared to untreated control cultures (Figure 37).

wo 93/25684 2 ~ ~ 7 7 ~ ~ PCI/US93/05672 NT-4 treatment produced an approximately 3 to 4 fold increase inthe level of high-affinity uptake of GABA as compared to untreated controls (Figure 38).

20. EXAMPLE: EFFECTOF M~ ON NIGRAL GABAergic NEURONS
20.1 METHODS

20.1.1 PREPARATION OF VENTRAL MESENCEPHALON CULTURES
Cultures were prepared from the ventral mesencephalon of embryonic day 14 (E14) rat embryos as before (Hyman et al, 1991,Nature, 350:230-232; Spina et al., 1992, J. Neurochem., 59:99-106). The single cell suspension obtained following trypsinization and mechanical dissociation of the brain tissue was seeded at a density of 5 x 104 oell per cm2 onto 35mm dishes which had been precoated with poly-L-lysine and merosin (Collaborative Research). After a 4 hour incub~tion in MEM sur)plQmented with glutamine (2mM), glucose (6 mg/ml), penicillin G (0.5U/ml), streptomycin (5 llg/ml), and fetal calf serum (FCS,7.5%) to allow for cell attachment to the subst~atum, cells were cultured in the presence or absence of trophic factors in a defined medium consisting of F12 and basal Eagle medium (1:1,vh) with N2 supplements as described by Bottenstein and Sato,1979, Proc. Natl. Acad. Sci. USA, 64:787-794, except that the insulin concentration was reduced to 20 ng/ml, and glutathione was included at 2.5 ~g/ml.

2 5 20.1.2 3H~ABA UPTAKE MEASUREMENT
The measurement of high-affinity GABA uptake activity was carried out accor.ling to the method set forth in Example 19.

20.1.3 GLUTAMIC ACID DECARBOX~LASE (GAD) IMMUNOCYTOCHEMICAL

W O 93/25684 PC~r/US93/05672 2,3 3~ 9 Cultures to be stained for GAD were prefixed in a 1 :1 mixture of 4 parafor",aldehyde and F12/BME (1:1, v/v) for 10 minutes, followed by 30 minutes incubation in 4% paraformaldehyde. Cultures were then incub~ted in the presence of phosphate buffer containing 4% goat serum and 0.02%
5 saponin, after which the cultures were incubated overnight at 4C with goat anti-feline GAD 67 antiserum (3enerously s~ppi Qd by Dr. A. Tobin, UCLA, CA) at a dilution of 1/7500 . Cultures were washed, incubated with goat anti-rabbit IgG at a concenlralion of 1.5 ~Lg/ml, and specifically bound antibody was detected after binding of avidin-HRP, by development using DAB with 1 0 NiSO4 intensification (Hancock et al, 1982,Neurosci. Lett., 31:247-252).

20.1.4 MEASUREMENT OF GABA CONTENT
Cultures were prepared and maintained in vitro for various times, either in the presence or absence of trophic factors. At the end of the 1 5 culture period, cells were harvested and immediately acidified ~lvith 0.4 N
perchlorate containing 0.1 mM ascorbate and 2.5 ng/ml dihydroxybenzylamine (DHBA, an internal standard). Following homogenization and centrifugation to remove precipitated protein, the catecholamines in the extract were absorbed onto alumina (ICN). The 2 0 samples were then washed extensively, and the catecholamines recovered by extraction from the alumina with 174nM acetic acid containing 0.05%
sodium disulfite and 0.025% EDTA. The protein content of the sample was determined after resuspension of the pelleted precipitate in PBS by the method of Smith et al, 1985, Anal. Biochem. 76-85. GABA determinations 25 were carried out, after derivatization with ophthalaldehyde, by an HPLC
separation using a reverse phase C18 column in a mobile phase consisting of 25% methanol, 3.1% acetonitrile, 0.1 M Na2PO4, pH 6.8. Quantitation of the various amino acids was performed after alectrochemical detection (ESA
5500 coulochem electrode array system detector) of the eluted peaks from 3 0 the HPLC, and the data normalized to the protein content of the sample.

WO 93/25684 PCI'/US93/05672 213~7~

20.2 RESULTS
20 ~ 1 EFFECT OF NEUROTROPHINS ON GABAERGIC NEURONS
To examine possi~le effects of the neurotrophins on nigral GABAergic 5 neurons, high-affinity GABA uptake, GABA content, and GAD activity were measured in control and treated cultures. The presence of GABAergic neurons in the cultures was first detected by immunocytochemical staining using an antibody specifically directed against the 67kD form of G~D, which is found in terminal processes and neuronal perikarya (Gonzales et al, 1991, J. Neurocytol., 20: 953-961; Kaufman et al, 1991, J. Neurochem.
56:720-723). Fig. 4 shows representative GAD staining patterns obtained in cultures maintained in the absence of any neurotrophic factors for 4, 7, or 11 days (41A-C, respectively). No staining was observed in the absence of primary antibody (41D). Cell counts indicated that the number of G~D
positive neurons in cultures maintained for one week in vitro in the absence of neurotrophins represented 3.3+0.7% of the total cell count at that time.
Only NT-3 produced a significant increase (63%) in the number of GAD
positive neurons after 7 days in vitro.
Although BDNF did not increase the number of GAD-positive neurons, BDNF as well as NT-3 produced dose-dependenl increases in GAD enzymatic activity in cultures maintained for 7 days, as shown in Fig. 42A and 42B
respectively. NT-3 produced a greater increase than BDNF (3-fold vs 1.8-fold) whereas NT-4/5 was without effect at any concentration tested (Fig.
42C; and up to 200ng/ml, data not shown).
As another marker of GABAergic neurons, we e,cplored the effects of each of the neurotrophins on the high-affinity GABA uptake capacity of cells cultured for 7 days. As shown in Fig. 43A, all three neufol,ophins tested (BDNF, NT-3 and NT-4/5) elicited increases of 2- to 3-fold in GABA uptake.
The dose responses of BDNF and NT-3 were similar, reaching maxima at approximately 20 ng/ml. NT-4/5 was effective at lower concenl,dlions than .:
Wo 93/25684 Pcr/uss3/os672 ~,~3~ BDNF or NT-3, saturating at 10 ng/ml with decreased effects at high~
concer,lf~lions. When we assessed possibie additive or synergistic effects on GABA uptake, no combinatorial effects of any of the neurol~ophins were observed (Fig. 43B). NGF (50 ng/ml) had no effect on GABA uptake 5 activity.
As a further marker of the GABAergic ph~notype, we measured GABA conlenl in cultures treated with each of the neurotrophins (Fig. 44).
BDNF, NT-3, and NT4/5 all produced modest but significant increases in the GABA content of cultures grown with these factors for 7 days. Again, NGF treatment was without effect. These data are consistent with the increases observed in the high-affinity GABA uptake activity measurements.

20.2.2 ANALYSIS OF TRK RECEPTOR DISTRIBUTION IN SUBSTANTIA NIGRA
To address the question of the site of action of the neurotrophins in mediating the above effects on cultured nigral neurons, it was of interest to ascertain the expression pattern of high-affinity BDNF and NT-3 receptors (TrkB and TrkC, respectively) in both embryonic cultures and adult rat brain subsP~ltia nigra. As shown in Fig. 4~, in situ hybridization clearly indicated high levels of TrkB (45B, 45C) and TrkC (45D-F) mRNA in both the ventral tegmental area (VTA) and substantia nigra of adult rat brain. The distribution of TrkC is more widespread than TrkB. Examination of the TrkC localization pattern at higher magnification (Fig. 45E,45F), demonstrates that Trk C is expressed in large perikarya, indicative of neurons.
To ascertain if TrkB and TrkC are expressed in embryonic rat ventral mesencepl,alic tissue, RNA prepare(J from E14 mesencephalic cultures grown in the presencs or absencQ of BDNF or NT-3 for various times was probed by Northern blot analysis. As shown in Fig. 46A, a probe to the kinase domain of TrkB indic~ted the presence of a 9 kb transcript under all conditions. F~poslJ~e of cultures to BDNF or NT-3 for up to 29 hours did W O 93/25684 2 ~ ~ 7 7 9 g PC~r/US93/05672 not substantially alter the expression levels of TrkB mRNA. The 9 kb transcript detected is one of the 2 brain-specific transcripts described by Klein et al, 1991, Cell 65:189-197 which was shown to correspond to the full length Trk B tyrosine kinase cell surface receptor. In the blot probed for 5 TrkC (Fig. 46C), a 14kb transcript was detected both in adult brain and E14VM culture RNA. This species has been identified as the major lransc,ipt encoding full length TrkC (Valenzuela et al, 1993, in press). The expression level of this transcript was not strikingly altered in NT-3 treated cultures.
An additional 5kb TrkC transcript was detected. Migrating just above the 1 0 28S ribosomal RNA band, this is one of two known transcripts which encode truncated forms of TrkC (Valenzuela et al., 1993, in press).

20.2.3 DISCUSSION
The above data provides evidence that the neurotrophins may 1 5 provide a role in supporting GABAergic neurons in the su~ nlia nigra. In general, altered GABAergic neu~lrans",ission is ~ssoci~ted with generalized seizures. In particular, generalized seizures can be prevented by increasing GABAergic neurol(ar,s",ission within the subst~rltia nigra. Gale, K., 1985, Federation Proceedings 44:2414-2424; Olsen, R.W., et al., 1986, in 20 Neurotransminers, Seizures and Epilepsy lll, Nistico, et al. (eds), Raven Press, New York. Accordingly, data provided herein suggest that the neu,ol.ophins may have potential utility for the treatment of seizure related disorders.

21. EXAMPLE: NT-4 IN COMBINATION WITH OTHERNEUROTROPHIC
FACTORS SUSTAINS THE SURVIVAL OF MOTOR NEURONS

The effect of NT-4 on motor neurons was measured by monitoring ChAT activity as described above. NT-4 stimulated ChATactivity in motor 3 0 neuron enriched cultures in a dose dependent manner (Figure 39).
Simultaneous treatment of motor neuron enriched cultures with NT-4 and 99 CNTF in combination as well as NT-4 and NT-3 in combination resulted in mor~ than additive Qffect on ChAT activity. NT-4 (100 ng/ml) alon~
increassd ChAT activity 3.8 foid and CNTF (50ng/ml) alone increase ChAT
activity 4.5 fold. However, when they wer2 added simultaneously, ChAT
activity was elevated 13.4-fold, suggesting synergistic actions of the two factors.
(Figure 40).

21. DEPOSIT OF MICROORGANISMS

The following recombinant bacteriophage, containing a human genomic sequencs related to neurotrophin-4, were deposited on August 22, 1991 (HG4-2 and HG7-2) and September 11, 1991 (HG2-1) with the Amsrican Type Culture Collection, 12301 Parklawn Drive, Roclcville, Maryland 1 5 20852, and assigned the indicated ~cc~ssicn number. Additionally, the chimeric gene construction, pCMX-hNT3/hNT4, was deposited on October 30, 1991 with the American Type Culture Collection and assigned the indicated ~ccession number. A recombinant bacteriophage (hCNTF-G1), containing a human gsnomic sequence related to ciliary neurotrophic factor (CNTF), was deposited on September 12, 1989, with the American Type Culture Collection and assigned accession number ATCC 40657. A
recombinant bacteriophage [phi hN3(G1)], containing a human genomic sequence related to neurotrophin-3 (NT-3), was deposited on February 28, 1990 with the American Type Culture Collection and assigned accession 2 5 numbsr ATCC 40763.

Bacteriophage ATCC Accession Number WO 93/25684 2 ~ ~ 7 7 9 ~ PCI/US93/05672 pCMX-hNT3/hNT4 75 133 The present invention is not to be limited in scope by the deposited microorganisms or the specific embodiments described herein. indeed, 5 various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
Various public~l;o,)s have been cited herein which are incorporated by 10 reference in their entireties.

WO 93/25684 PCI'/US93/05672 International ~rpli~ ion No PCT/
MICROORGANISMS
Option~l Sh~ct in with tho ' _ ' rcfened to on pa~p t 10 line~ 9-30 ~md p~oe 1 t 1 lin~t 1 of the description A ~uEn N I~lCATION OF DEPOSIT ' Furth~r depo~iti rt~ id~ntifbd on ~n Addition~l ~he~lt ' Name of deposit~try institulion ~mencan Type Culture CoDection Addrnss of dcpositary institution (includinçl postnl code and country) ' 12301 Pnrklnwn Drive Rockville MD 10582 US

D8te of deposit ' Auaust 22. 1991 Accos~;on Number ' 75069 B ADDITIONAE INDICATIONS ~ b~ U a ~ppl'~tb) Tbi in~otttt l;on i. or~in~d r~ dnl ~et ED

C DESIGNATED STATES FOR WHICH INDlCATtONS ARE MADE ~

D SEPARATE FURNISHING OF INDICATIONS ~'D ~ ur a pp~b) Tl~- inr~i~ tion h.ted b~low will b~ ubrnitterl to the ~nt~rn tior~ ~u e-u l-ter lsp~city th- oener-l n tur~ Of the i~irJ.~ion. ~ 0 Acre~ion Nurnber of Depo it'l - -E I~This sneet was received with tne I -' ' application when filed (~o bc chec ed by tne receiving Offlce) (Aulhorized 0ffil3 O The date of receipt (from tbe applicant) by tbe 1- ~ ' ' 8ureau "

(Autnorized OfGcer) Form PCT/RO/134 ~January 1981 ) WO 93/25684 ~ 1 ~ 7 7 ~ ~ PCI/US93/05672 .

I"t~ tiondl A!, ' ~ No: PCT/

Form PCT/RO/134 ~cont.) Americ~n Type Culture Collection 12301 PArkbwn Drive Aockville, MD 10582 US

Accession No. D~te of DePosit 75070 Au~ust 22, 1991 75098 Sl."t.,.,.L.~r 11, 1991 75133 October 30, 1991 W O 93/25684 P ~ /US93/05672 9 ~h~Uh~r; LISTING

(1) GENP'RAT INFORMATION:
(i) APPLICANT: Ip and Yancopoulo~
(ii) TITLE OF lNvr;h~ION: Therapeutic and DiagnoQtic Method~
Baqed on Neurotrophin-4 Expreusion (iii) NUMBER OF Sr;yur;N~S: 124 (iv) CORRESPONDENCE ADDRESS:
A~I ADDRESSEE: R~g~neron Pharmaceuticalff, Inc.
BI STREET: 777 Old Saw Mill River Road C CITY: Tarrytown D STATE: New York El COuh~r: U.S.A.
,,F, ZIP: 10591 (v) COMPUTER ~T.~AnARTT.~ FORM:
A'l MEDIUM TYPE: Floppy di~k Bl COMPUTER: IBM PC compatible CI OPERATING SYSTEM: PC-DOS/MS-DOS
,D, SOFTWARE: PatentIn Relea~e #1.0, Ver~ion #1.25 (Vi) ~UKR~l APPLICATION DATA:
(A) APPLICATION NUMBER: 07/898,194 (B) FILING DATE: 12-JUN-92 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER: US 07/791,924 (B) FILING DATE: 14-NOV-9l (viii) A.lORNr;r/AGENT INFORMATION:
(A) NAME: Gail M. Kempler (B) REGISTRATION NUMBER: 32,143 (C) R~rriK~N~/DOCKET NUMBER: 6526-115/Reg 80 (ix) TELECOMMUNICATION INrORMATION:
(A) TELEPHONE: 914 347-7000 (B) TELEFAX: 914 347-2113 (C) TELEX:

(2) INFORMATION FOR SEQ ID NO:1:
( i ) ~U~I.~ CHARACTERISTICS:
'A' LENGTH: 130 baue pair~
Bl TYPE: nucleic acid C, STRANDEDNESS: double ~D, TOPOLOGY: unk- ."
(ii) MOLECULE TYPE: DNA ( g~nr ~ C ) (xi) ~riQ~ DESCRIPTION: SEQ ID NO:1:
CAAATGTAAT CCCGCTGGTG GAA~.~lGGG TGGCTGCCGG GG.~.GATC GACGCCATTG 60 GAl~.. GGC 130 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:

WO 93/25684 ~ 1 ~ 7 7 'I ~ PCr/US93/05672 IA'I LENGTH: 130 base pairs B TYPE: nucleic acid ,C STRANDEDNESS: double Dl TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

GATATCTGAG TGCAAAGCAA AACAGTCTTA TGTGAGGGCT CT~.AC~AT~G ATGCCAACAA 120 G~.`~.GG~ 130 (2) INFORMATION FOR SEQ ID NO:3:
(i) ~yu~N~ CHARACTERISTICS:
'A) LENGTH: 127 ba~e pair~
B) TYPE: nucleic acid C) STRANDEDNESS: double ,D) TOPOLOGY: tlnkn~
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CAAGTGCCGG r-ACCrAAATC CCGTTGACAG CGGGTGCCGG GGCATTGACT CAAAGCACTG 60 (2) INFORMATION FOR SEQ ID NO:4:
(i) S~yu~.._~ CHARACTERISTICS:
'A'l LENGTH: 127 ba~e pair~
,B TYPE: nucleic acid ,C, STRANDEDNESS: double ~Dl TOPOLOGY: I~nk- "
(ii) MOLECULE TYPE: DNA (genomic) (xi) ~'QU~:N~ DESCRIPTION: SEQ ID NO:4:
CAAGTGCCGG GCCC~AAATC CTGTAr-~r-~G TGGATGCCGG GGCATTGACT CCAAGCACTG 60 GAACTCATAC TGCACCACGA CTCACACCTT TGTCAAGGCG TTGACAACAG ACGA~A.AAr~ 120 (2) INFORMATION FOR SEQ ID NO:5:
(i) ~Qu~._~ CHARACTERISTICS:
~A~I LENGTH: 127 base pairs 'B, TYPE: nucleic acLd C, STRANDEDNESS: double lD, TOPOLOGY: I~nk- ,."
- ( ii ) MOT~CUT~F TYPE: DNA (y~r- ic) (Xi) ~QU~N~: DESCRIPTION: SEQ ID NO:5:

WO 93/25684 PCI'/US93/05672 CAAGTGCAGG GACCCTAGGC CGG~ CCAG CGGGTGCCGA GGGATCGATG CGAAGCATTG 60 GAACTCTTAC TGCACCACGA rACAr~CCTT CGTCAAAGCA CTGACCATGG AGGGCAAGCA 120 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
,~A'I LENGTH: 127 baE~e pair~
B TYPE: nucleic acid , Cl STRANDEDNESS: double ,,D,I TOPOLOGY: llnknot/"
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

GAATTCGTAT TGCACCACAA rAt'.A~Ar~TT TGTCAGGGCA TTAACCATGG AAGGCAATCA 120 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
,~A~I LENGTH: 127 base pairs ,8, TYPE: nucleic acid ,C, STR~NDEDNESS: double D TOPOLOGY: , n knl . "
(ii) MOLECULE TYPE: DNA (genomic) (Xi) ~ iQU~;N~:~; DESCRIPTION: SEQ ID NO:7:
CAAATGCAGG GACCr~AAGC TAGTTTCAAG CGGATGCCGT GGGATTGATG CAAAGCATTG 60 GAACTCTTAT TGTACCACCA CGCACACCTT TGTCAAAGCA TTAAr~ATGG AAGGGAAGCA 120 (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
A'l LENGTH: 127 base pair~
, Bl TYPE: nucleic acid C STRANDEDNESS: double l,DI TOPOLOGY: 1nlrnot."
(ii) MOLECULE TYPE: DNA (genomic) (xi) S~:QIJ~ .CE DESCRIPTION: SEQ ID NO:8:

GAACTCCTAC TGCACCAACT CGCACACCTT CGTGCGGGCG CTGACTTCCT TTAp~r-GAccT 120 (2) INFORMATION FOR SEQ ID NO:9:

W O 93/25684 ~ ~ 3 7 7 9 ~ PC~r/US93/OS672 (i) SEQUENCE CHARACTERISTICS:
/A~I LENGTH: 130 ba~e pairs 'B TYPE: nucleic acid ,C STRANDEDNESS: double ,DI TOPOLOGY l-nknl~."
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE D~Sr~TPTION: SEQ ID NO:9:
CAAGTGCAAT CCCATGGGTT AcAc-AA~An~ AGGCTGCAGG GGCATAGACA AAAGGCATTG 60 (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERrSTICS:
/A'I LENGTH: 130 ba~e pair~
B TYPE: nucleic acid ,C, STRANDEDNESS: double DJ TOPOLOGY: l~nl-- ~."
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CAAGTGTAAT CCCATGGGTT ACACr-~A~A AGGCTGCAGG GGCATAGACA AAAGGCACTG 60 GAACTCGCAA TGCCGAACTA CCCAATCGTA ~ CGGGCC CTTACTATGG ATAGCAAAAA 120 (2) lN~O~MATION FOR SEQ ID NO:11:
yDh-.~E CHARACTERISTICS:
'A' LENGTH: 130 base pair~
Bl TYPE: nucleic acid Cl STRANDEDNESS: double ,Dj TOPOLOGY: nnl--~"
(ii) MOLECULE TYPE: DNA (genomic) (xi) ~yuhl.~ DESCRIPTION: SEQ ID NO:ll:
CAAATGCAAC CCr-AAGGGGT Ar,ACAAArGA AGGCTGCAGG GGrATAr-~CA AGAGGCACTG 60 GAACTCACAG TGCCGAACTA CCCAGTCTTA CGTGAGAGCT CTCACCATGG ~AAr.,AA~AA 120 (2) INFORMATION FOR SEQ ID NO:12:
(i) ~yu~_~ CHARACTERISTICS:
~A' LENGTH: 130 ba~e pair~
'B TYPE: nucleic ~cid ,C, STRAN,DEDNESS: double l,D, TOPOLOGY: l~nl~ , "
(ii) MOLECULE TYPE: DNA (genomic) W O 93/25684 ' P ~ /US93/05672 213~79~ --(xL) SEQUENCE DESCRIPTION: SEQ ID NO:12:
CAAGTGCAGC ACGAAGGGTT ATG~AAAAr-A AGGCTGTAGA GGCATA~-Ar~ AGAGGTACTG 60 (2) INFORMATION FOR SEQ ID NO:13:
(i) ~Q~N~L CHARACTERISTICS:
'A' LENGTH: 130 ba~e pair~
,B TYPE: nucleic acLd C STRANDEDNESS: double ~D, TOPOLOGY: unk- . "
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

(2) INFORMATION FOR SEQ ID NO:14:
(i) S~:yULN~ CHARACTERISTICS:
'A' LENGTH: 130 ba~e pair~
B TYPE: nucleic acLd C STR~NDEDNESS: double .,D,I TOPOLOGY: llnkn~tl~l (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
CAAATGTAAC CCTATGGGGT A~-ACAAAr-G~ GGGC~GCCGI GGAATAGACA AGAGGCATTA 60 (2) INFORMATION FOR SEQ ID NO:15:
(i) ~QuL.-'CE CHARACTERISTICS:
'A'l LENGTH: 130 baQe pair~
B TYPE: nucleic acLd C, STRANDEDNESS: double ~D, TOPOLOGY: ~nknl.."
(ii) MOLECULE TYPE: DNA (genomic) (xi~ ULN~: DESCRIPTION: SEQ ID NO:lS:
CAAATGTAAC CCCAAGGGTT Tr~C~ A AGGCTGCAGA GG~ATAGA~-A A~-AAA-~TTG 60 GAATTCGCAG TGTAGAACCA GCCAATCCTA TGTGCGAGCT CTAAC~ATGG ATAGTAGGAA 120 WO 93/25684 2 ~ ;~ 7 ~ ~ ~ PCI/US93/05672 (2) lNrO~MATION FOR SEQ ID NO:16:
(i) ~h~UhN~h CHARACTERISTICS:
'A'l LENGTH: 130 base pairs B TYPE: nucleic acid C, STRANDEDNESS: double ,,DI TOPOLOGY: unknown ( ii ) ~OT T'`CUT ~ TYPE: DNA (genomic) - (xi) ~hyuhN~h DESCRIPTION: SEQ ID NO:16:
GCGATGTAAG GAAGCCAGGC CGGTCAAAAA CGGTTGCAGG GGTATTGATG ATAAAcAcTG 60 GAACTCTCAG TGCAAAACAT CC~AAArCTA CGTCCn~G~A CTGACTTCAG A~-~A-rAATAA 120 A~ GGGC 130 ~2) INFORMATION FOR SEQ ID NO:17:
(i) ~hyUb~ : CHARACTERISTICS:
~A~I LENGTH: 130 base pairs B, TYPE: nucleic acid ,C STRANDEDNESS: double ,D) TOPOLOGY: llnk~
(ii) MOLECULE TYPE: DNA (9~-- ;c) (xi) ~h~U~ DESCRIPTION: SEQ ID NO:17:
GAGGTGTAAA ~-AAGC~Ar-GC CAGTCA ~AA CGGTTGCAGG GGGATTGATG ACAAACACTG 60 GAACTCTCAG TGrAAAACGT CGCAAACCTA CGTCCGAGCA CTGACTTCAG AAAA~AprAA 120 (2) INFOR~ATION FOR SEQ ID NO:18:
(i) ~h~U~:N'~: CHARA'CTERISTICS:
'A'l LENGTH: 130 ba~e pair~
,'8, TYPE: nucleic acid C, STRANDEDNESS: double ~DJ TOPOLOGY: llnknr~,"
( ii ) ~T~T~crJr~ TYPE: DNA (genomic) (xi) ~r;gDL~ : DESCRIPTION: SEQ ID NO:18:

GAACTCCCAG TGrAA~-ACAT CC~AAACTTA CGTTAGAGCA TTGACTTCAG AAAA~ATAA 120 = (2) INroR~ATIoN FOR SEQ ID NO:l9:
(i) Shy~hr._r; CHARACTERISTICS:
(A) LENGTH: 66 base pair~
(B) TYPE: nucleic acid W O 93/25684 PC~r/US93/05672 (C) STRANDEDNESS: double (D) TOPOLOGY: llnkn~"
?, ~ ( ii, MOLECULE TYPE: DNA ~genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:
AAGGTGTAAA GAGGCAAGAC CTGTCAAAAA TGGCTGTCGA GGrAT~r~ArG ACAAACACTG 60 (2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
~A' LENGTH: 128 base pairs B TYPE: nucleic acid C STRANDEDNESS: lln~
,D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) S~QU~:N~: DESCRIPTION: SEQ ID NO:20:

GAACTCGCAG TGTAAr-AccT CTCAGACGTA CGTCAGAGTC TCTGACGCAG GACCGTACCT 120 (2) INFORMATION FOR SEQ ID NO:21:
Q~ CHARACTERISTICS:
'A' LENGTH: 130 ba~e pair~
Bl TYPE: nucleic acid C STRANDEDNESS: double ,D,, TOPOLOGY: llnkn~,...
(ii) MOLECULE TYPE: DNA (genomLc) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
CCGCTGCAAG GAGTCGAAGC CGGGCAAGAA CGGGTGCCGG GGCATCGACG ACAAACACTG 6û
GAACTCGCAG TG~Ar-AcrA Gcr~r-AccTA TGTCCGAGCG CTGAGCAAGG Ar-AArAATAA 120 (2) lN~OR~ATION FOR SEQ ID NO:22:
( i ) ~U~N~ CHARACTERISTICS:
,'A', LENGTH: 43 amino acids IB TYPE: amino acid ,C STRANDEDNESS: single l,D, TOPOLOGY: 1~ n'~
( i i ) MOT~CUT ~ TYPE: peptide (xi) ~QU~:N~ DESCRIPTION: SEQ ID NO:22:

Lys Cys Asn Pro Ala Gly Gly Thr Val Gly Gly Cys Arg Gly Val Asp W O 93/25684 ~ 7 ~ ~ PC~r/US93/05672 Arg Arg Hi8 Trp Ile Ser Glu Cy~ Ly- Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Met A~p Ser Asp LYB Ile Val Gly (2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
,'A' LENGTH: 43 amino acid~
BI TYPE: amino acid ~ ,C STRANDEDNESS: Hingle - ~D, TOPOLOGY: unl- - "
(i$) MOLECULE TYPE: peptide (xi) ~hy~NCE DESCRIPTION: SEQ ID NO:23:
Ly~ Cy~ A~n Pro Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val A~p Ly~ Ly~ Gln Trp Ile Ser Glu Cys Ly~ Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ile Asp Ala A~n LyQ Leu Val Gly (2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 42 amino acids BI TYPE: amino acid ,C STRANDEDNESS: single ,D, TOPOLOGY: un~ wn (ii) MnT.T~CUT.T~ TYPE: peptLde (Xi) ~Q~N~ DESCRIPTION: SEQ ID NO:24:
Ly~ Cy~ Arg Affp Pro Asn Pro Val A~p Ser Gly Cys Arg Gly Ile A~p Ser Ly~ Hi~ Trp A~n Ser Tyr Cyff Thr Thr Thr His Thr Phe Val Lye Ala Leu Thr Met A~p Gly Ly~ Gln Ala Ala (2) lN~0~l5ATION FOR SEQ ID NO:25:
( i ) ~N~: CHARACTERISTICS:
'A) LENGTH: 42 amino acids B) TYPE: amino acid C) STRANDEDNESS: single ,D) TOPOLOGY: u nkr "
(ii) MOLECULE TYPE: peptide -(Xi) ~y~N~ DESCRIPTION: SEQ ID NO:25:
Lys Cy~ Arg Ala Pro A~n Pro Val Glu Ser Gly Cy3 Arg Gly Ile A~p W O 93/25684 ' P ~ /US93/05672 .

~ ~Ser Ly~ Hi~ Trp Ann Ser Tyr Cy~ Thr Thr Thr Hi~ Thr Phe Val Ly~
2~ 9 ~ 20 25 30 Ala Leu Thr Thr Asp A~p Lys Gln Ala Ala (2) IN~ORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 42 amino acids ~B TYPE: amino acid C STRANDEDNESS: single l,D, TOPOLOGY: unknown (iL) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
Lys Cys Arg Asp Pro Arg Pro Val Ser Ser Gly Cys Arg Gly Ile Asp Ala Ly~ His Trp Asn Ser Tyr Cy~ Thr Thr Thr His Thr Phe Val Ly~

Ala Leu Thr Met Glu Gly Lys Gln Ala Ala (2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
'A'l LENGTH: 42 amino acids Bl TYPE: amino acid ,C STRANDEDNESS: ~ingle l,D~ TOPOLOGY: tlnknl,,"
(ii) M~T.FCrJr.r~ TYPE: peptLde (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
Ly~ Cy8 Ly~ Asn Pro Ser Pro Val Ser Gly Gly Cy8 Arg Gly Ile Asp Ala Ly~ His Trp A~n Ser Tyr Cy~ Thr Thr Thr Asp Thr Phe Val Arg Ala Leu Thr Met Glu Gly A3n Gln Ala Ser (2) INFORMATION FOR SEQ ID NO:28:

(i) ~UL.._~ CHARACTERISTICS:
'A'I LENGTH: 42 amino acid~
B TYPE: amino acid C, STRANDEDNESS: ~ingle ~DJ TOPOLOGY: 1- nk~
( ii ) ~T~T'`CuT~T'' TYPE: peptide W O 93/25684 ~ ~ 3 7 7 9 ~ PC~r/US93/05672 .

(xi) ~P:yu~ DESCRIPTION: SEQ ID NO:28:
Ly~ Cy~ Arg A~p Pro Ly~ Pro Val Ser Ser Gly Cy8 Arg Gly Ile A~p Ala LYB His Trp Asn Ser Tyr Cy~ Thr Thr Thr His Thr Phe Val Lys Ala Leu Thr Met Glu Gly Ly~ Gln Ala Ala (2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
'A~ LENGTH: 42 amino acids B TYPE: amino acid C STRANDEDNESS: 3ingle D TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
Thr Cy~ Arg Gly Ala Arg Ala Gly Ser Ser Gly Cy8 Leu Gly Ile Asp Gly Arg Hi~ Trp A~n Ser Tyr Cyq Thr A~n Ser Hi~ Thr Phe Val Arg Ala Leu Thr Ser Phe Lys Asp Leu Val Ala (2) lN~uR~ATION FOR SEQ ID NO:30:
(i) ~kyDk~._~ CHARACTERISTICS:
lAI LENGTH: 43 amino acid~
Bl TYPE: amino acid C, STRANDEDNESS: ~ingle ~D/ TOPOLOGY: nn~
( ii ) MnT~CUT ~ TYPE: peptide (xi) ~:yuk..~~ DESCRIPTION: SEQ ID NO:30:
Ly~ Cy~ Asn Pro Met Gly Tyr Thr Ly~ Glu Gly CYB Arg Gly Ile Asp Ly~ Arg His Trp A~n Ser Gln Cy~ Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met A~p ser Ly~ Ly~ Arg lle Gly (2) INFORMATION FOR SEQ ID NO:31:
( i ) x~yu~N~ CHARACTERISTICS:

W O 93/25684 PC~r/US93/05672 IA' LENGTH: 43 amino acid~
B TYPE: amino acid ,C, STRANDEDNESS: ~ingle ,DJ TOPOLOGY: I~n~n~.,, (ii) ~OLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
Ly~ Cys A~n Pro Met Gly Tyr Thr Ly~ Glu Gly Cy~ Arg Gly Ile A~p Ly~ Arg His Trp A~n Ser Gln Cy~ Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met Asp Ser LYB Lys Arg Ile Gly (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
~A LENGTH: 43 amino acids ~B TYPE: amino acid ,C STRANDEDNESS: ~ingle l,D, TOPOLOGY: ~nknr, (ii) MOLECULE TYPE: peptide (xi) ~yu~r._~ DESCRIPTION: SEQ ID NO:32:
LYH Cys A~n Pro Ly~ Gly Tyr Thr Ly~ Glu Gly Cy5 Arg Gly Ile A~p Ly~ Arg His Trp A~n Ser Gln Cy~ Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met A~p Asn Lys Lys Arg Val Gly (2) INFORMATION FOR SEQ ID NO:33:
(i) ~QU~_~ CHARACTERISTICS:
~A' LENGTH: 43 amino acid~
B TYPE: amino acid C, STRANDEDNESS: ningle l,DJ TOPOLOGY: l~ n ~n~ .. "
(ii) MOLECULE TYPE: peptide (xi) ~QD~ DESCRIPTION: SEQ ID NO:33:
Ly~ Cy~ Ser Thr Ly~ Gly Tyr Ala Ly~ Glu Gly Cys Arg Gly Ile Asp Ly~ Arg Tyr Trp Asn Ser Gln Cy~ Arg Thr Thr Gln Ser Tyr Val Arg WO 93/25684 ~ 1 ~ 7 ~ ~ ~ PCI/US93/05672 Ala Leu Thr Met A~p A3n Ly~ Ly~ Arg Ile Gly (2) lN~u}~ATION FOR SEQ ID NO:34:
( i ) ~Q~N~' CHARACTERISTICS:
'A' LENGTH: 43 amino acid~
B TYPE: amino acid C, STRANn~nN~CS: ningle ~D, TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
Ly~ Cyu Ann Pro Met Gly Tyr Met Ly~ Glu Gly Cy~ Arg Gly Ile A~p LYR Arg Tyr Trp Asn Ser Gln Cy~ Arg Thr Thr Gln Ser Tyr Val Arg Ala Phe Thr Met A~p Ser Arg Ly~ Ly~ Val Gly (2) INFORMATION FOR SEQ ID NO:35:
(i) S~yU~:N~: CHARACTERISTICS:
(A' LENGTH: 43 amino acid~
(Bl TYPE: amino acid (C STRANDEDNESS: single (D, TOPOLOGy: ~In~n~
(ii) MOLECULE TYPE: peptide (Xi) S~U~N~: DESCRIPTION: SEQ ID NO:35:
Ly~ CYB A~n Pro Met Gly Tyr Thr Ly~ Glu Gly Cy~ Arg Gly Ile A~p Ly~ Arg Hi~ Tyr Asn Ser Gln Cy~ Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met A~p Ser Lys Lyu Lys Ile Gly (2) INFORMATION FOR SEQ ID NO:36:
- (i) SEQUENCE CHARACTERISTICS:
~A'l LENGTH: 43 amino acid~
B TYPE: amino acid C STRANDEDNESS: ~ingle ,DJ TOPOLOGY: ~In~- .~"
(ii) MOLECULE TYPE: peptide W O 93/25684 PC~r/US93/05672 ) SEQUENCE DESCRIPTION: SEQ ID No:36:
Lys Cy- A~n Pro Ly~ Gly Phe Thr Asn Glu Gly Cyn Arg Gly Ile Asp Ly~ Lys Hi~ Trp Asn Ser Gln Cys Arg Thr Ser Gln Ser Tyr Val Arg Ala Leu Thr Met A~p Ser Arg Ly~ Ly~ Ile Gly (2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 43 amino acid~
B TYPE: amino acid C STRANDEDNESS: ~ingle ,D, TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
Arg Cy~ Lys Glu Ala Arg Pro Val Lys A~n Gly Cys Arg Gly Ile Asp A~p Ly~ His Trp Asn Ser Gln Cy~ Ly~ Thr Ser Gln Thr Tyr Val Arg Ala Leu Thr Ser Glu A~n Asn Ly~ Leu Val Gly (2) lNrORMATION FOR SEQ ID NO:38:
(i) ~yuh~CE CHARACTERISTICS:
'Al LENGTH: 43 amino acid~
Bl TYPE: amino acid C, STRANDEDNESS: single ,DI TOPOLOGY: t~nkn~
(ii) MOLECULE TYPE: peptide (xi) ~u~_~ DESCRIPTION: SEQ ID NO:38:
Arg Cy~ Ly~ Glu Ala Arg Pro Val Lys Asn Gly Cy~ Arg Gly Ile Aap Asp Ly~ Hi~ Trp A~n Ser Gln Cys Lys Thr Ser Gln Thr Tyr Val Arg Ala Leu Thr Ser Glu A~n A~n Ly~ Leu Val Gly (2) INFORMATION FOR SEQ ID NO:39:

( i ) ~h~U~ CHARACTERISTICS:
(A) LENGTH: 43 amino acidt WO 93/25684 2 :~ 3 7 7 ~ ~ PCI'/US93/05672 (B) TYPE: amino acid - (C) STR~ND~n~CS: single (D) TOPOLOGY un~- "
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
Arg Cys Lys Glu Ala Lys Pro Val Lys Asn Gly Cys Arg Gly Ile Asp ' 1 5 10 15 - Asp Ly~ His Trp Asn Ser Gln Cy~ Ly~ Thr Ser Gln Thr Tyr Val Arg Ala Leu Thr Ser Glu A~n Asn Lys Leu Val Gly (2) INFORMATION FOR SEQ ID NO:40:
(i) ~yu~N~: CHARACTERISTICS:
A~l LENGTH: 21 ~mino acids B TYPE: amino acid ,C, STRANDEDNESS: 8 ingle l,DI TOPOLOGY: unknown ( ii ) Mor~cuT~F TYPE: peptide (xi) S~yu~ DESCRIPTION: SEQ ID NO:40:
Arg Cys Lys Glu Ala Arg Pro Val Lys Asn Gly Cys Arg Gly Ile Asp Asp Ly~ His Trp Asn (2) INFORMATION FOR SEQ ID NO:41:
(i) SEQUENCE CHARACTERISTICS:
Al LENGTH: 42 amino acids B TYPE: amino acid C STRANDEDNESS: single ~Dl TOPOLOGY: ~1nl~ ..n (ii) MOLECULE TYPE: peptide (xi) ~yD~.._~ DESCRIPTION: SEQ ID NO:41:
Ly~ Cy~ Arg Thr Ala Ly~ Pro Phe Lys Ser Gly Cy~ Arg Gly Ile A~p A~p Lys His Trp Asn Ser Gln Cys Lys Thr Ser Gln Thr Tyr Val Arg Ala Leu Thr Gln Asp Arg Thr Ser Val Gly W O 93/25684 P ~ /US93/05672 ~2~ lNrORhATION FOR SEQ ID NO:42:
~QUL.._~ CHARACTERISTICS:
~A, LENGTH: 43 amino acids IBI TYPE: amino acid ,C, STRANDEDNESS: ~inqLe ~D, TOPOLOGY: ~lnkn~ "
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
Arg Cys Lys Glu Ser Lys Pro Gly Lys Asn Gly Cys Arg Gly Ile A~p Asp Lys Hi~ Trp Asn Ser Gln Cys Lys Thr Ser Gln Thr Tyr Val Arg Ala Leu Ser Lys Glu A~n Ann Ly~ Tyr Val Gly (2) INFORMATION FOR SEQ ID NO:43:
(i) ~u~.~ CHARACTERISTICS:
'A'l LENGTH: 1302 ba~e pairs ,BI TYPE: nucleic acid C STRANDEDNESS: double D, TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NANE/REY: CDS
(B) LOCATION: join(529..534, 538..1248) (xi) ~Qu~-..CE DESCRIPTION: SEQ ID NO:43:

AAGCAGCTTT GTTTATGCCG ATCCCTAAGC AGCC~PGACC ACACTGAGCA TGTGCACAGT 120 CTTAGTCTTG ~AA~-ATGTT TAACAAPGTT ArpAGp~GGT GACCCC~r~ AGCCAACTTT 180 GAAAGCATAA ATCATTTGTT TGATTAGGCT ~rlG~rlGCAG TAAGTTCATG TTTATATTTA 240 G~ATArAAAA TACAGCATTT CTAGCCTTAT TCTATTTTAG ACTTTACCCT TTAATGCCCA 300 GTTCTGCCCA TTGCCTTATA GATGTTAAAG TCCrAATATC ACATTGGCAT CCTCGGCTGT 360 TTA~AA~AAA CATTAAAACT TGTACTTATA TTTAACATTC ~ rl~ 1. C~AATATTCC 420 ATCACACTTA GACCCTAPAA GAATTATATG TA~A~AATTT Gr-ATAAATTA TATA~TGGCA 480 GCCGTATTCT AA..~.~.-. .................. TTTTTGCAGT GGTCTGAG GTG GAT 534 Val A~p Val Met Ile Leu Arg Leu Tyr Ala Met Val Ile Ser Tyr Cyn Cy~

W O 93/25684 ~ ~ 3 7 7 ~ ~ PC~r/US93/05672 Ala Ile Cys Ala Ala Pro Phe Gln Ser Arg Thr Thr Asp Leu Asp Tyr Gly Pro A~p Ly~ Thr Ser Glu Ala Ser ABP Arg Gln Ser Val Pro Asn Ann Phe Ser His Val Leu Gln Asn Gly Phe Phe Pro Asp Leu Ser Ser Thr Tyr Ser Ser Met Ala Gly Lys Asp Trp Asn Leu Tyr Ser Pro Arg ~ 70 75 80 Val Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe Leu Ser Glu Glu Thr Val Val His Pro Glu Pro Ala Asn Ly~ Thr Ser Arg Leu Ly~ Arg Ala Ser Gly Ser Asp Ser Val Ser Leu Ser Arg Arg Gly Glu Leu Ser Val Cys Asp Ser Val Ann Val Trp Val Thr A~p Lys Arg Thr Ala Val A~p Asp Arg Gly Lys Ile Val Thr Val Met Ser Glu Ile Gln Thr Leu Thr Gly Pro Leu Ly~ Gln Tyr Phe Phe Glu Thr Ly~ Cys Asn Pro Ser Gly Ser Thr Thr Arg Gly Cy~ Arg Gly Val Asp Ly~ LYB

Gln Trp Ile Ser Glu Cys Lys Ala Lys Gln Ser Tyr Val Arg Ala Leu Thr Ile A~p Ala Ann Ly~ Leu Val Gly Trp Arg Trp Ile Arg Ile Aap Thr Ala Cys Val Cy~ Thr Leu Leu Ser Arg Thr Gly Arg Thr TAAAAr-Arr-A GGGTTAGCAA AATAr-Ar-AGA AGAGGTTGAT CCGTTGACCT GCAG 1302 -(2) INFORMATION FOR SEQ ID NO:44:

(L) ~u~._~ CHARACTERISTICS:
A) T- _~n: 239 amino acidn B) TYPE: amino acid ,D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) ~k~U~._~ DESCRIPTION: SEQ ID NO:44:
1 Asp Val Net Ile Leu Arg Leu Tyr Ala Met Val Ile Ser Tyr Cy8 Cy~ Ala Ile Cys Ala Ala Pro Phe Gln Ser Arg Thr Thr A~p Leu A~p Tyr Gly Pro A~p Ly~ Thr Ser Glu Ala Ser A~p Arg Gln Ser Val Pro Asn A~n Phe Ser Hi~ Val Leu Gln A~n Gly Phe Phe Pro A~p Leu Ser Ser Thr Tyr Ser Ser Met Ala Gly Ly~ A~p Trp A~n Leu Tyr Ser Pro Arg Val Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe Leu Ser Glu Glu Thr Val Val His Pro Glu Pro Ala Asn Lys Thr Ser Arg Leu Ly~ Arg Ala ser Gly Ser A~p Ser Val Ser Leu Ser Arg Arg Gly Glu Leu Ser Val Cyn A~p Ser Val A~n Val Trp Val Thr Asp Lys Arg Thr Ala Val A~p A~p Arg Gly Ly~ Ile Val Thr Val Met Ser Glu Ile Gln Thr Leu Thr Gly Pro Leu Lys Gln Tyr Phe Phe Glu Thr Ly~

Cys Asn Pro Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val Asp Lys Ly~ Gln Trp Ile Ser Glu Cys Ly~ Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ile Asp Ala A~n Ly~ Leu Val Gly Trp Arg Trp Ile Arg Ile Asp Thr Ala Cy~ Val Cyn Thr Leu Leu Ser Arg Thr Gly Arg Thr (2) INFORMATION FOR SEQ ID NO:45:
(i) ~uk..'E CHARACTERISTICS:
'A LENGTH: 123 amino acids IBI TYPE: amino acid ,C, STRANDEDNESS: aingle ~D, TOPOLOGY: , n k- - "
(ii) MOLECULE TYPE: peptide (Xi) ~Qu~N~k DESCRIPTION: SEQ ID NO:45:

Ala Ser Gly Ser A~p Ser Val Ser Leu Ser Arg Arg Gly Glu Leu Ser Val Cy~ Asp Ser Val Affn Val Trp Val Thr Asp Ly~ Arg Thr Ala Val 13û

W O 93/25684 ~ 1 ~ 7 7 ~ ~ PC~r/US93/05672 A~p A~p Arg Gly Lys Ile Val Thr Val Met Ser Glu Ile Gln Thr Leu Thr Gly Pro Leu Ly~ Gln Tyr Phe Phe Glu Thr Lys Cy~ A~n Pro Ser Gly Ser Thr Thr Arg Gly Cy~ Arg Gly Val A~p Ly~ Ly~ Gln Trp Ile Ser Glu Cy~ Ly~ Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ile A~p Ala A~n Ly~ Leu Val Gly Trp Arg Trp Ile Arg Ile A~p Thr Ala Cys Val Cy~ Thr Leu Leu Ser Arg Thr Gly Arg Thr (2) INFORMATION FOR SEQ ID NO:46:
(i) SEQUENCE CHURACTERISTICS:
'A, LENGTH: 118 amino acid~
B TYPE: amino acid C STRANDEDNESS: ~ingle ~D, TOPOLOGY~ knr~."
(ii) MOLECULE TYPE: peptide (Xi) S~yU~N~: DESCRIPTION: SEQ ID NO:46:
Ser Ser Thr His Pro Val Phe Hi~ Met Gly Glu Phe Ser Val Cy~ Asp Ser Val Ser Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp Ile Ly~

Gly Ly~ Glu Val Thr Val Leu Ala Glu Val A~n Ile A~n A3n Ser Val Phe Arg Gln Tyr Phe Phe Glu Thr Lys Cy~ Arg Ala Ser A~n Pro Val Glu Ser Gly Cy~ Arg Gly Ile A~p Ser Ly~ His Trp Asn Ser Tyr Cy~

Thr Thr Thr His Thr Phe Val Ly~ Ala Leu Thr Thr A~p Glu Ly~ Gln Ala Ala Trp Arg Phe Ile Arg Ile A~p Thr Ala Cys Val Cy~ Val Leu Ser Arg Ly Ala Thr Arg (2) r~-~R~ATION FOR SEQ ID NO:47:
( i ) S~Qu~N~ CH7~RACTERISTICS:
~ lA~I LENGTH: 119 amino acid~
- B, TYPE: amino acid C, STRANnT~'nNESS: 8ingle lDI TOPOLOGY: lln~r ~
( ii ) M~T.T~'CUT.T~' TYPE: peptide WO 93/25684 PCr/US93/05672 ~X1) 51:,~Uhl~CI!; DESCRIPTION: SEQ ID NO:47:
Hi~ Ser A~p Pro Ala Arg Arg Gly Glu Leu Ser Val Cy~ Asp Ser Ile Ser Glu Trp Val Thr Ala Ala Anp Ly~ Lys Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu Glu Ly~ Val Pro Val Ser Ly~ Gly Gln Leu Ly~ Gln Tyr Phe Tyr Glu Thr Ly~ Cy~ Aun Pro Met Gly Tyr Thr Ly~ Glu Gly CYB Arg Gly Ile A~p Ly~ Arg Hi~ Trp A~n Ser Gln Cy~

Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met A~p Ser Ly~ Lys Arg Ile Gly Trp Arg Phe Ile Arg Ile A~p Thr Ser Cy~ Val Cy~ Thr Leu Thr I le Ly~ Arg Gly Arg (2) INFORNATION FOR SEQ ID NO: 48:
U~NC;h CHARACTERISTICS:
(A' LENGTH: 119 amino acid~
( B TYPE: amino ac id (C STRANDEDNESS: ~ingle ( D TOPOLOGY: llnk- "
( i i ) ~tOT.~CUT.~ TYPE: pept ide (xi) ~guhN~; DESCRIPTION: SEQ ID NO:48:
Tyr Ala Glu Hi~ Ly~ Ser Hil~ Arg Gly Glu Tyr Ser Val CYQ A~p Ser Glu Ser Leu Trp Val Thr A~p Lys Ser Ser Ala Ile Asp Ile Arg Gly Hi~ Gln Val Thr Val Leu Gly Glu Ile Lys Thr Gly Asn Ser Pro Val Ly~ Gln Tyr Phe Tyr Glu Thr Arg Cys Ly~ Glu Ala Arg Pro Val Ly~

Asn Gly Cyn Arg Gly Ile A~p A~p Lys Hi~ Trp Al~n Ser Gln Cy8 Ly~

Thr Ser Gln Thr Tyr Val Arg Ala Leu Thr Ser Glu A~n A~n Ly~ Leu W O 93/25684 ~ ~ 2 7 7 ~ ~ PC~r/US93/05672 Val Gly Trp Arg Trp Ile Arg Ile A~p Thr Ser Cy~ Val Cy~ Ala Leu Ser Arg Ly~ Ile Gly Arg Thr (2) INFORMATION FOR SEQ ID NO:49:
~ ( i ) ~U~N~ CHARACTERISTICS:
- 'A) LENGTH: 1313 ba~e pair~
B) TYPE: nucleic acid ,C) STRANDEDNESS: double ~D) TOPOLOGY: ~nl~
(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 552 1259 (xi) S~Qu~ DESCRIPTION: SEQ ID NO:49:
CTGCAGGGAA ACAATCATAC TTATGAACAG CAGGGGGAGC CCTCGCCTTA ~l~cc~AGcc 60 ATGCAGAACT CAAGCAGCTT TGTTTATGCC GATCCCTAAG CAGCCrAr-AC CACACTGAGC 120 ATGTGCACAG TCTTAGTCTT GrpAAGATGT TTAAr-AAAGT TArA~r~A-TGG Tr~r,c~c~c~,G 180 TAGCCAACTT TGAPAGCATA AATCATTTGT TTGATTAGGC ..G.G~.GCA GTAAGTTCAT 240 GTTTATATTT AGr-ATAr-APA ATAr,AGrATT TCTAGCCTTA TTCTATTTTA GACTTTACCC 300 ~C~.CGGCTG TTTArAAr-AA ACATTAAAAC TTGTACTTAT ATTTAACATT ~.G..~..~. 420 TC'SAPTATTC CATCACACTT Ar-ACCCTAAA AGAATTATAT GTATATAATT TGrATAAATT 480 ATATAATGGC AGCCGTATTC TAA .~-.G.~ ... .L~..GCAG G~.GAGG 540 Met Ile Leu Arg Leu Tyr Ala Met Val Ile Ser Tyr Cyn Cy~ Ala Ile Cyn Ala Ala Pro Phe Gln Ser Arg Thr Thr A~p Leu ABP

Tyr Gly Pro Asp Ly~ Thr Ser Glu Ala Ser A~p Arg Gln Ser Val Pro Asn Asn Phe Ser His Val Leu Gln A~n Gly Phe Phe Pro Asp Leu Ser Ser Thr Tyr Ser Ser Met Ala Gly Ly~ Asp Trp Asn Leu Tyr Ser Pro ~3~ 3 PCr/US93/05672 Arg Val Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe Leu Ser Glu Glu Thr Val Val Hi~ Pro Glu Pro Ala Asn Lys Thr Ser Arg Leu Ly~ Arq Ala Ser Gly Ser Aup Ser Val Ser Leu Ser Arg Arg Gly Glu Leu Ser Val Cy~ A~p Ser Val Asn Val Trp Val Thr Asp Ly~

Arg Thr Ala Val A~p A~p Arg Gly Ly~ Ile Val Thr Val ~et Ser Glu 145 150 lS5 Ile Gln Thr Leu Thr Gly Pro Leu Lys Gln Tyr Phe Phe Glu Thr Ly~

Cy~ A~n Pro Ser Gly Ser Thr Thr Arg Gly Cy~ Arg Gly Val Asp Ly~

Ly3 Gln Trp Ile Ser Glu Cy8 Ly~ Ala Lys Gln Ser Tyr Val Arg Ala Leu Thr Ile Asp Ala A~n Ly~ Leu Val Gly Trp Arg Trp Ile Arg Ile A~p Thr Ala Cy~ Val Cys Thr Leu Leu Ser Arg Thr Gly Arg Thr TAAAAG~CGA GGGTTAGCAA AATA~.A~.A~.A AGAGGTTGAT CCGTTGACCT GCAG 1313 (2) INFORMATION FOR SEQ ID NO:50:
(i) ~SD~-..CE CHARACTERISTICS:
A) LENGTH: 236 amino acid~
B) TYPE: amino acid ,D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) 5~ ~ DESCRIPTION: SEQ ID NO:50:
Met Ile Leu Arg Leu Tyr Ala Met Val Ile Ser Tyr Cys CYB Ala Ile Cy~ Ala Ala Pro Phe Gln Ser Arg Thr Thr ARP Leu Asp Tyr Gly Pro Anp Lys Thr Ser Glu Ala Ser Asp Arg Gln Ser Val Pro A~n A~n Phe Ser Hi~ Val Leu Gln A~n Gly Phe Phe Pro Asp Leu Ser Ser Thr Tyr Ser Ser Met Ala Gly Ly~ A~p Trp A~n Leu Tyr Ser Pro Arg Val Thr WO 93/25684 Z 1 3 7 7 g ~ PCI'/US93/05672 Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe Leu Ser Glu Glu Thr Val Val Hi~ Pro Glu Pro Ala A~n Lyu Thr Ser Arg Leu Ly~

Arg Ala Ser Gly Ser A~p Ser Val Ser Leu Ser Arg Arg Gly Glu Leu Ser Val Cyu Asp Ser Val Aan Val Trp Val Thr Aup Lys Arg Thr Ala Val Asp Asp Arg Gly Ly~ Ile Val Thr Val Met Ser Glu Ile Gln Thr Leu Thr Gly Pro Leu Ly~ Gln Tyr Phe Phe Glu Thr Ly~ Cy~ Asn Pro Ser Gly Ser Thr Thr Arg Gly Cy~ Arg Gly Val Anp Ly~ Ly~ Gln Trp Ile Ser Glu Cy~ Lys Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ile Asp Ala Asn Lys Leu Val Gly Trp Arg Trp Ile Arg Ile Asp Thr Ala Cys Val Cy8 Thr Leu Leu Ser Arg Thr Gly Arg Thr (2) lNrOR~ATION FOR SEQ ID NO:51:
( i ) ~kQ~k.._~' CHARACTERISTICS:
,~A'I LENGTH: 57 amino acid~
IB TYPE: amino acid ,C, STRANDEDNESS: single lD, TOPOLOGY -n'~ ,"
(ii) MOLECULE TYPE: peptide (xi) ~hQur;N~r; DESCRIPTION: SEQ ID NO:51:
Gln Tyr Phe Phe Glu Thr Ly~ Cy~ Asn Pro Ser Gly Ser Thr Thr Arg 1 5 10 , 15 Gly Cy~ Arg Gly Val Asp Lys Lys Gln Trp Ile Ser Glu Cys Lys Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ile A~p Ala A~n Ly~ Leu Val Gly Trp Arg Trp Ile Arg Ile A~p Thr (2) lNrOR~ATION FOR SEQ ID NO:52:
' ($) SEQUENCE CHARACTERISTICS:
- 'AJ LENGTH: 6 amino acids B TYPE: amino acid C STRANDEDNESS: 3ingle ,D~ TOPOLOGY ~nkn~ "

W O 93/25684 PC~r/US93/05672 ~(Li) MnT~CUT ~ TYPE: pQptide (xi) S~ur;~ DESCRIPTION: SEQ ID NO:52:
Gln Tyr Phe Tyr Glu Thr (2) lNrO~MATION FOR SEQ ID NO:53:
(i) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 17 base pairs B TYPE: nucleic acid C, STRANDEDNESS: singlc ,D, TOPOLOGY l~nl-- ,. "
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:

(2) INFORMATION FOR SEQ ID NO:54:
(i) ~r;Qur,~ri CHARACTERISTICS:
'A'l LENGTH: 17 base pairs B TYPE: nucleic acid C STRANDEDNESS: ~ingle ,,D, TOPOLOGY: I~nkn~,...
(ii) MOLECULE TYPE: DNA (genomic) (xi) ~bQDr;N~r; DESCRIPTION: SEQ ID NO:54:

(2) INFORMATION FOR SEQ ID NO:55:
(i) ~r;Q~r,N~r; CHARACTERISTICS:
'A' LENGTH: 17 base pairs ~B~ TYPE: nucleic acid C STRAND~nNESS: ~ingle ,D,I TOPOLOGY: tln~
( ii ) ~r~FCur~ TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: 9 (D) OTHER lNrOh~ATION: /label~ N
/note= "N = I"
(ix) FEATURE:
(A) NAME/KEY: modified base (B) LOCATION: 12 (D) OTHER INFORMATION: /label~ N
/note= "N = I"

(xi) ~r;QB~N~r; DESCRIPTION: SEQ ID NO:55:

W O 93/25684 ~ 1 ~ 7 7 9 9 PC~r/US93/05672 TTRCAYTCNS WNATCCA . 17 (2) lN~Ok~ATION FOR SEQ ID NO:56:
(i) SEQUENCE CHARACTERISTICS:
A~I LENGTH: 17 ba~e pair~
BI TYPE: nucleic acid C, STRANDEDNESS: ~ingle ,,D~ TOPOLOGY: un~n~..n (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: modified ba~c ~B) LOCATION: 9 (D) OTHER IhrOR~ATION: /label= N
/note~ ~N ~ I~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:
GAr.~Y~,-.G CYTTRCA 17 (2) INFORMATION FOR SEQ ID NO:57:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 17 ba~e pair~
(B TYPE: nucleic acid (C STRANDEDNESS: single (D, TOPOLOGy: un~r:....
(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: modified_ba~e (B) LOCATION: 9 (D) OTHER l~rO~ATION: /label= N
/note~ "N ~ I n (xi) sriyuri~r; DESCRIPTION: SEQ ID NO:57:
~,Y.~Y,,NG CYTTRCA 17 (2) INFORMATION FOR SEQ ID NO:58:
( i ) sriyDL~-T~ CHARACTERISTICS:
~A' LENGTH: 17 ba~e pair~
Bl TYPE: nucleic acid C, STRAN~ SS: ~inqle ~D~ TOPOLOGY: 1 l n 1-~ .. "
( ii ) MOT T'~CUT~T~ TYPE: DNA ( gen~ ~ C ) (ix) FEATURE:
(A) NAME/KEY: modified ba~e (B) LOCATION: 6 (D) OTHER l~rORMATION: /label~ n /notes ~N ~ I"

(ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: 9 (D) OTHER l~rO~ATION: /label~ N

W O 93/25684 P ~ /US93/05672 .~ .~ . ,~
i 13 7 7 9 9, F~ATURE ' ~' ~
(A) NAME/KEY: modified ba~e~
(B) LOCATION: 12 (D) OTHER INFORMATION~ ~label= N
/note= "N - I"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:

(2) INFORMATION\FOR SEQ ID NO:59:
( i ) S~'yU~N~ CHARACTERISTICS:
'A' LENGTH: 17 baMe pairs ,B TYPE: nucleic acid C STR~NDEDNESSs ~inglc D,l TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) ~E~u~n~ DESCRIPTION: SEQ ID NO:59:

(2) INFORMATION FOR SEQ ID NO:60:
( i ) S~QU~N~ CHARACTERISTICS:
'A'l LENGTH: 17 ba~e pairD
B TYPE: nucleic acid C, STRANDEDNESS: 3ingle ,D~ TOPOLOGY: llnl-- . "
(ii) MOLECULE TYPE: DNA (genomic) (xi) ~u~.._~ DESCRIPTION: SEQ ID NO:60:
GACTCGAGTC GACATCG ' 17 (2) INFORMATION FOR SEQ ID NO:61:
QDL..CE CHARACTERISTICS:
IA' LENGTH: 126 ba~e pair~
B TYPE: nucleic acid C ST~ANn~-nNESS: double ~D, TOPOLOGY: unknown ( ii ) ~r~CuT~F TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..126 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:

Gln Tyr Phe Tyr Glu Thr Arg Cy~ Ly~ Ala Glu Ser Ala Gly Glu Gly Gly Pro Gly Val Gly Gly Gly Gly Cy~ Arg Gly Val Asp Arg Arg His W O 93/25684 .' 2 1 37 7 9 g PC~r/US93/0~672 20 ;25 ~ i 30 TGG CTC TCA GAA TGT AAA GCC AA~A CAA TCG 126 Trp Leu S-r Glu Cy~ Ly~ Ala Ly~ Gln Ser (2) lN~ORMATION FOR SEQ ID NO:62:
ti) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 amino acids (B) TYPE: amino acid (D) TOPOLOGY: lincar ~ii) MOLECULE TYPE: protein (xi) SEQUENCE DFC~PTPTION: SEQ ID NOs62:
Gln Tyr Phe Tyr Glu Thr Arg Cy~ Lyff Ala Glu Ser Ala Gly Glu Gly Gly Pro Gly Val Gly Gly Gly Gly Cys Arg Gly Val A~p Arg Arg Hi~

Trp Leu Ser Glu Cys Lys Ala Lys Gln Ser (2) INFORMATION FOR SEQ ID NO:63:
( i ) shQUh~h CHARACTERISTICS:
'A~l LENGTH: 126 base pairs Bl TYPE: nucleic acid C STRANDEDNESS: double lD, TOPOLOGy: 1nkn~ ,., (ii) MOLECULE TYPE: DNA (g,e~

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..126 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:

Gln Tyr Phe Tyr Glu Thr Arg Cys Lys Ala A~p Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly Gly Cy~ Arg Gly Val A~p Arg Arg Hi~

Trp Val Ser Glu Cy~ Ly~ Ala Lys Gln Ser (2) lNrOh~ATION FOR SEQ ID NO:64:
(i) SEQUENCE CHA~ACT~TSTICS:
' (A) LENGTH: 42 amino acids = (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein :
t~

93/25684 ,. -~ ~ P ~ /US93/05672 ~ ~ xi) ~r:yu~N~ DESCRIPTION: SEQ ID NO:64:
? ~ ~ 9 Gln Tyr Phe Tyr Glu Thr Ary Cy~ Ly~ Ala Asp A~n Ala Glu Glu Gly 1 5 - 10 15 Gly Pro Gly Ala Gly Gly Gly Gly Cy~l Arg Gly Val A~p Arg Arg Hiu Trp Val Ser Glu CYR Ly~ Ala Lys Gln Ser (2) INFORMATION FOR SEQ ID NO:65:
(i) SEQUENCE CHARACTERISTICS:
,~A' LENGTH: 35 amino acid~
B TYPE: amino acid C, STRANDEDNESS: ~ingle ,DJ TOPOLOGY: llnknrs,,, (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:
Gln Tyr Phe Phe Glu Thr Ly~ Cys Asn Pro Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val A~p Lys Lys Gln Trp Ile Ser Glu CYR Lys Ala Lys Gln Ser (2) INFORMATION FOR SEQ ID NO:66:
(i) SEQUENCE CHARACTERISTICS:
,'A'I LENGTH: 35 amino acid~
IB TYPE: amino acid ,C, STR~NDEDNESS: ~ingle ,,D~ TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) ~yu~CE DESCRIPTION: SEQ ID NO:66:
Gln Tyr Phe Phe Glu Thr LYR Cys Arg Ala Pro Asn Pro Val Glu Ser Gly Cys Arg Gly Ile A~p Ser LYR His Trp ARn Ser Tyr Cy~ Thr Thr Thr Hi~ Thr (2) INFORMATION FOR SEQ ID NO:67: -(i) ~Q~ CE CHARACTERISTICS:
'A'I LENGTH: 35 amino acid~
Bl TYPE: amino acid C STRANDEDNESS: single D,I TOPOLOGY: 11nk- ~
( ii ) M~T.T~'.CUT.T~` TYPE: peptide WO 93/25684 2 1 3 7 7 g g PCI`/US93/0567 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:
Gln Tyr Phe Tyr Glu Thr Lyn Cyff A~n Pro Met Gly Tyr Thr Lya Glu Gly Cy~ Arg Gly Ile A~p Ly~ Arg Hin Trp Affn Ser Gln Cyff Arg Thr Thr Gln Ser (2) INFORMATION FOR SEQ ID NO:68:
(i) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 35 amino acids B TYPE: amino acid C STRANDEDNESS: ffingle ,D,I TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:
Gln Tyr Phe Tyr Glu Thr Arg Cy~ Ly~ Glu Ala Arg Pro Val Lya A~n Gly Cys Arg Gly Ile Affp Affp Lyff His Trp Asn Ser Gln Cy~ Lys Thr Ser Gln Thr (2) INFORMATION FOR SEQ ID NO:69:
(i) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 192 baffe pairs IB TYPE: nucleic acid ,C, STRANDEDNESS: double l,DJ TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..192 (xi) ~yu~CE DESCRIPTION: SEQ ID NO:69:

Gln Tyr Phe Phe Glu Thr Arg Cyff Lyff Ala Affp A~n Ala Glu Glu Gly l 5 10 15 Gly Pro Gly Ala Gly Gly Gly Gly Cyff Arg Gly Val Affp Arg Arg Hiff Trp Val Ser Glu Cy~ Ly~ Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ala Affp Ala Gln Gly Arg Val Gly Trp Arg Trp Ile Arg Ile A~p Thr WO93~256'84 .; ~ PCI`/US93/0567Z

t2) INFORMATION FOR SEQ ID NO:~0~
~ ~ 3 j 7 99 ( i, SEQUENCE CHARACTERISTICS:
(A) LENGTH: 64 amino acLd~
(8) TYPE: amino acid (D) TOPOLOGY: linear ($i) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70:
Gln Tyr Phe Phe Glu Thr Arg Cys Lys Ala Asp Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly Gly Cy~ Arg Gly Val Anp Arg Arg His Trp Val Ser Glu Cys Lys Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ala A~p Ala Gln Gly Arg Val Gly Trp Arg Trp Ile Arg Ile AQP Thr (2) INFORMATION FOR SEQ ID NO:71:
(i) SEQUENCE CHARACTERISTICS:
,~A' LENGTH: 35 base pairs B TYPE: nucleic acid C STRANDEDNESS: double ,D TOPOLOGY: ~ n~- - ,, "
(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/REY: CDS
(B) LOCATION: 18..35 (xi) ~:yu~N~L DESCRIPTION: SEQ ID NO:71:

Glu Thr Arg Cys Ly Ala (2) INFORMATION FOR SEQ ID NO:72:
( i ) XLS D~N~;~ CHARACTERISTICS:
A) LENGTH: 6 amino acids ,B) TYPE: amino acid l,D) TOPOLOGY: linear (ii) ~OLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72:
Glu Thr Arg Cys Lys Ala (2) INFORMATION FOR SEQ ID NO:73:
( i ) i~gUL.. - ~ CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double W O 93/25684 P ~ /US93/05672 2 1 3 7 7 g 9 ~ s ~
(D) TOPOLOGY: un~U"`
(ii) MOLECULE TYPE: DNA (genomic) ; -. ,; , (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 18 35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73:

A~p Asn Ala Glu Glu Gly (2) INFORMATION FOR SEQ ID NO:74:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acid~
(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74:
A~p A~n Ala Glu Glu Gly (2) INFORMATION FOR SEQ ID NO:75:
(i) SEQUENCE CHARACTERISTICS:
rA~I LENGTH: 1404 ba~e pairQ
,BI TYPE: nucleic acid C STRANv~N~SS: double ~,D, TOPOLOGY: 1~ n ~ - - ,, "
(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 460 .1104 (xi) ~yu~N~ DESCRIPTION: SEQ ID NO:75:
~..~.~ACCC A6GT6GCACC CGAGTGGTGC A~ .GCT CACTGCAACC TCGGCCTCCT 60 GGGTTCGAGT GA--~-C~-A CCTCAGCCTA CTGAGTAGCT GGGATTACAG GCGTGCAGCA 120 CTATGCCCGG TTAATTTTGG TA..~..~. AGAGATGAGG TTTCACAATG TTGACCAGCT 180 GCTCTGGAAC TCCTGACCTC AAGTCATCCA CCTGCCTCAG c~.cc~ Ar- TGCTGGGATT 240 AGA6~.~.GG GGCACAGTGC CTGGCCTGTA GTAGTTGAAT ATTTATTATT AATCTACAAG 300 TTGCGCATTA CGCAAGCCCT A~-~TATAGGG ~CCCC-~AAC TTCTA~-AAr~ AG6G~..CCC 360 CACAATCCTG GCAGGCAAGC ~.CCC~.GGG 6..CC~AACT .~..lCCCCA CTGAAGTTTT 420 TA~'CCC~,,C TCTAATCCCA GC~.CC~.~. ....... ~.~.~.C CAG GTG CTC CGA GAG 474 Gln Val Leu Arg Glu WO 93/25684 ' ~ " PCI'/US93/05672 2 13 ~A~G~ CTC CCT CTC CCC TCA TGC TCC CTC CCC ATC CTC CTC CTT TTC CTC 522 - , Me~ Leu Pro Leu Pro Ser Cy~ Ser Leu Pro I le Leu Leu Leu Phe Leu '' 10 15 20 Leu Pro Ser Val Pro Ile Glu Ser Gln Pro Pro Pro Ser Thr Leu Pro Pro Phe Leu Ala Pro Glu Trp Asp Leu Leu Ser Pro Arg Val Val Leu Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu Phe Leu Leu Glu Ala Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala Asn Arg Ser Arg Arg Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg Gly Glu Leu Ala Val Cy~ Asp Ala Val Ser Gly Trp Val Thr Asp Arg Arg Thr Ala Val Asp Leu Arg Gly Arg Glu Val Glu Val Leu Gly Glu Val Pro Ala Ala Gly Gly Ser Pro Leu Arg Gln Tyr Phe Phe Glu Thr Arg Cys Lys Ala Asp Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly Val Asp Arg Arg His Trp Val Ser Glu Cys Lys Ala Lys Gln Ser Tyr Val Arg Ala Leu Thr Ala A~p Ala Gln Gly Arg Val Gly Trp Arg Trp Ile Arg IlQ Asp Thr Ala Cys Val Cys Thr Leu Leu Ser Arq Thr Gly CGG GCC Tr-AI~-ACc~AT GCC~C~AAA ATAACAGAGC TGGATGCTGA GAGACCTCAG 1154 Arg Ala GGATGGCCCA GCTGATCTAA Gr-ACCCÇ~GT TTGGGAACTC AT~AAATAAT CACAAAATCA 1214 CAA~,. .G ATTTGGAGCT CAATCTCTGC AGGATGGGTG AAACCAr~ATG GGG.~GGA 1274 GGTTGAATAG GA~..~ ~C~;~ GGAGCAACTT GAGGGTAATA ATGATGATGA TATAATAATA 1334 ATAGCCACTA TTTACTGAGT GTTTACTGTT TCTTATCCCT AATAI'ATAA~' TCCTCAGATC 1394 W O 93/25684 2 1 ~ ~ i9 9 PC~r/US93/05672 (2) INFORMATION FOR SEQ ID NO:76: ~J~
(i) s~Q~hCE CHARACTERISTICS:
(A) LENGTH: 215 amino acid~
(B) TYPE: amLno acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein r (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:
Gln Val Leu Arg Glu Met Leu Pro LQU Pro Ser Cys Ser Leu Pro Ile - Leu Leu Leu Phe Leu Leu Pro Ser Val Pro Ile Glu Ser Gln Pro Pro Pro Ser Thr Leu Pro Pro Phe Leu Ala Pro Glu Trp Asp Leu Leu Ser Pro Arg Val Val Leu Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu Phe Leu Leu Glu Ala Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala Asn Arg Ser Arg Arg Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg Gly Glu Leu Ala Val Cy~ A~p Ala Val Ser Gly Trp Val Thr Asp Arg Arg Thr Ala Val Asp Leu Arg Gly Arg Glu Val Glu Val Leu Gly Glu Val Pro Ala Ala Gly Gly Ser Pro Leu Arg Gln Tyr Phe Phe Glu Thr Arg Cy~ Lys Ala Asp Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg G6y Val Asp Arg Arg Hio Trp Val Ser Glu Cy Ly~

Ala Lys Gln Ser Tyr Val Arg Ala Leu Thr Ala Asp Ala Gln Gly Arg Val Gly Trp Arg Trp Ile Arg Ile A~p Thr Ala Cyn Val Cy~ Thr Leu Leu Ser Arg Thr Gly Arg Ala (2) IN~ORhATION FOR SEQ ID NO:77:
(i) ~Quh~CE CHARACTERISTICS:
'A' LENGTH: 214 amino acid~
B TYPE: amino acid C STRANDEDNESS: ~ingle D~ TOPOLOGY: lln~n~

(ii) MOLECULE TYPE: peptide (xi) X~QD~N~ DESCRIPTION: SEQ ID NO:77:

W O 93/25684 '! '~ p ~ /Us93/05672 r ~
21377 9 9 Val Leu Arg Glu Met Leu Pro Leu Pro Ser Cy~ Ser Leu Pro le Leu Leu Leu Phe Leu Leu Pro Ser Val Pro Ile Glu Ser Gln Pro Pro Pro Ser Thr Leu Pro Pro Phe Leu Ala Pro Glu Trp A~p Leu Leu Ser Pro Arg Val Val Leu Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu Phe Leu Leu Glu Ala Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala A~n Arg Ser Arg Arg Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg Gly Glu Leu Ala Val Cy~ A~p Ala Val Ser Gly Trp Val Thr Asp Arg Arg Thr Ala Val A~p Leu Arg Gly Arg Glu Val Glu Val Leu Gly Glu Val Pro Ala Ala Gly Gly Ser Pro Leu Arg Gln Tyr Phe Phe Glu Thr Arg Cy~ Lys Ala A~p A~n Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly Val A~p Arg Arg Hi~ Trp Val Ser Glu Cys Lys Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ala A~p Ala Gln Gly Arg Val Gly Trp Arg Trp Ile Arg Ile A~p Thr Ala cys Val Cys Thr Leu Leu Ser Thr Arg Gly Arg Ala (2) INFORMATION FOR SEQ ID NO:78:
ti) ~yu~:N~ CHARACTERISTICS:
'A' LENGTH: 176 amino acidn ,B TYPE: amino acid ,C STRANDEDNESS: ~ingle ~D TOPOLOGY: lln~ "
t ii ) ~nT~CTJT T~ TYPE: peptide txi) ~yu~w~E DESCRIPTION: SEQ ID NO:78:
Ser Ser Thr Tyr Ser Ser Met Ala Gly Ly~ ARP Trp Asn Leu Tyr Ser Pro Arg Val Thr Leu Ser Ser Glu Glu Pro Ser Gly Pro Pro Leu Leu Phe Leu Ser Glu Glu Thr Val Val Hi~ Pro Glu Pro Ala Asn Ly~ Thr Ser Arg Leu Ly~ Arg Ala Ser Gly Ser A8p Ser Val Ser Leu Ser Arg WO 93/25684 2 1 3 7 7 9 9 PCI'/US93/05672 Arg Gly Glu Leu Ser Val Cy~ A~p Ser Val A~n Val Trp Val Thr Asp Ly~ Arg Thr Ala Val A~p Asp Arg Gly Lys Ile Val Thr Val Met Ser Glu Ile Gln Thr Leu Thr Gly Pro Leu Ly~ Gln Tyr Phe Phe Glu Thr r 100 105 110 Ly~ Cys Asn Pro Ser Gly Ser Thr Thr Arg Gly Cys Arg Gly Val Asp - Lys Ly~ Gln Trp Ile Ser Glu Cy~ Ly~ Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ile Asp Ala Asn Ly~ Leu Yal Gly Trp Arg Trp Ile Arg Ile Asp Thr Ala Cys Val Cy~ Thr Leu Leu Ser Arg Thr Gly Arg Thr ~2) INFORMATION FOR SEQ ID NO:79:
(i) SEQUENCE CHARACTERISTICS:
IA' LENGTH: 177 amino acids B TYPE: amino acid C, STRANDEDNESS: ~Lngle ~Dl TOPOLOGY: I~nl-- . "
(ii) MOLECULE TYPE: peptide (xi) ~Qu~CE DESCRIPTION: SEQ ID NO:79:
Glu Phe Gln Pro Met Ile Ala Thr Asp Thr Glu Leu Leu Arg Gln Gln Arg Arg Tyr A~n Ser Pro Arg Val Leu Leu Ser A~p Ser Thr Pro Leu Glu Pro Pro Pro Leu Tyr Leu Met Glu Asp Tyr Val Gly Asn Pro Val Val Ala A~n Arg Thr Ser Pro Arg Arg Ly~ Tyr Ala Glu Hi~ Ly~ Ser His Arg Gly Glu Tyr Ser Val Cy~ Anp Ser Glu Ser Leu Trp Val Thr A~p Ly~ Ser Ser Ala Ile Asp Ile Arg Gly His Gln Val Thr Val Leu Gly Glu Ile Lys Thr Gly Asn Ser Pro Val Lys Gln Tyr Phe Tyr Glu Thr Arg Cy~ Ly~ Glu Ala Arg Pro Val Ly~ Asn Gly Cys Arg Gly Ile A~p Asp Ly~ Hi~ Trp A~n Ser Gln Cyn Ly~ Thr Ser Gln Thr Tyr Val Arg Ala Leu Thr Ser Glu Asn Asn Lys Leu Val Gly Trp Arg Trp Ile WO 93/25684 ~ . P~/US93/05672 2 1 3~ ~95 150 155 160 Arg Ile ARP Thr Ser Cy8 Val Cy8 Ala Leu Ser Arg Ly~ Ile Gly Arg Thr (2) INFORMATION FOR SEQ ID NO:80:
(i) SEQUENCE CHARACTERISTICS:
~A LENGTH: 175 amino acid~
IB TYPE: amino acid ,C, STRANDEDNESS: ~ingle ~D, TOPOLOGY: unl~ "
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:
Gln Pro Val Ile Ala Met A~p Thr Glu Leu Leu Arg Gln Gln Arg Arg 1 5 lo 15 Tyr Ann Ser Pro Arg Val Leu Leu Ser A~p Thr Thr Pro Leu Glu Pro Pro Pro Leu Tyr Leu Met Glu A3p Tyr Val Gly Ser Pro Val Val Ala A~n Arg Thr Ser Arg Arg Lya Arg Tyr Ala Glu His Ly~ Ser Hi~ Arg Gly Glu Tyr Ser Val Cy~ A~p Ser Glu Ser Leu Trp Val Thr Asp Ly~

Ser Ser Ala Ile A~p Ile Arg Gly Hi~ Gln Val Thr Val Leu Gly Glu Ile Ly~ Thr Gly Asn Ser Pro Val Lys Gln Tyr Phe Tyr Glu Thr Arg loo 105 llo Cys Ly~ Glu Ala Arg Pro Val Ly~ AQn Gly Gly Arg Gly Ile A~p A~p Ly~ Hi~ Trp ARn Ser Gln Cy~ Ly~ Thr Ser Gln Thr Tyr Val Arg Ala Leu Thr Ser Glu A~n Asn Ly~ Leu Val Gly Trp Arg Trp Ile Arg Ile A~p Thr Ser Cys Val Cy~ Ala Leu Ser Arg Lys Ile Gly Arg Thr 2) INFORMATION FOR SEQ ID NO:81:
(i) SEQUENCE CHARACTERISTICS:
'A` LENGTH: 178 amino acids B TYPE: amino acid C, STRANDEDNESS: ~ingle ,D, TOPOLOGY: l-n~
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:81:

WO 93/25684 ~1 ~ 77g9 PCl/US93/05672 Glu Phe Gln Pro Met Ile Ala Thr A~p Thr Glu Leu Leu Arg Gln ~ n~;~ ?
1 5 10 15 ';~
Arg Arg Tyr A~n Ser Pro Arg Val Leu Leu Ser Asp Ser Thr Pro Leu Glu Pro Pro Pro Leu Tyr Leu Met Glu Asp Tyr Val Gly A~n Pro Val Val Thr Asn Arg Thr Ser Pro Arg Arg Ly~ Arg Tyr Ala Glu Hi~ Ly~

Ser His Arg Gly Glu Tyr Ser Val Cy~ Asp Ser Glu Ser Leu Trp Val -Thr A~p Ly~ Ser Ser Ala Ile Asp Ilo Arg Gly Hi~ Gln Val Thr Val Leu Gly Glu Ile Lys Thr Gly Asn Ser Pro Val Lys Gln Tyr Phe Tyr Glu Thr Arg Cys Lys Glu Ala Arg Pro Val Ly~ Atn Gly Gly Arg Gly Ile A~p A~p Ly~ His Trp Atn Ser Gln Cys Lys Thr Ser Gln Thr Tyr Val Arg Ala Leu Thr Ser Glu Asn A~n Lys Leu Val Gly Trp Arg Trp Ile Arg Ile Asp Thr Ser Cy~ Val Cys Ala Leu Ser Arg Lyn Ile Gly 165 170 175 .
Arg Thr ~2) INFORMATION FOR SEQ ID NO:82:
(i) SEQUENCE CHARACTERISTICS:
~A' LENGTH: 160 amino acid3 ,B TYPE: amino acid ,C, STRANDEDNESS: ~ingle ,D, TOPOLOGY: t,nl~
(ii) MOLECULE TYPE: peptide (Xi) ~L~UL~ DESCRIPTION: SEQ ID NO:82:
Asp Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Gln Val Pro Leu Glu Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Ly~ Asn Tyr Leu A~p Ala Ala A~n Met Ser Met Arg Val Arg Arg Hi~ Ser Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cy~ Asp Ser Ile Ser Glu Trp Val Thr Ala Ala A~p Lys Lys Thr Ala Val A~p Met Ser Gly Gly Thr Val Thr Val Leu Glu Ly~ Val Pro Val Ser Lys Gly Gln Leu Lys Gln Tyr Phe Tyr Glu C~
W O 93/25684 PC~r/US93/05672 ~ ~ r Ly~ Cys A~n Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Gly Ile ~1377 loo 10S 110 Aap Ly~ Arg His Trp Asn Ser Gln Cy~ Arg Thr Thr Gln Ser Tyr Val . ~ 115 120 125 Arg Ala Leu Thr Met Anp Ser Lys Lys Arg Ile Gly Trp Arg Phe Ile Arg Ile AQp Thr Ser Cys Val Cys Thr Leu Thr Ile Lys Arg Gly Arg (2) INFORMATION FOR SEQ ID NO:83:
(i) SEQUENCE CHARACTERISTICS:
A LENGTH: 160 amino acids B TYPE: amino acid C STRANDEDNESS: single lD TOPOLOGY: llnkn~ .~"
(ii) MOLECULE TYPE: peptide (xi) ~yu~:N~ DESCRIPTION: SEQ ID NO:83:
Asp Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Gln Val Pro Leu Glu Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys Asn Tyr Leu A~p Ala Ala A~n Met Ser Met Arg Val Arg Arg Hi~ Ser Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cy~ Asp Ser Ile Ser Glu Trp Val Thr Ala Ala Anp Ly~ Ly~ Thr Ala Val A~p Met Ser Gly Gly Thr Val Thr Val Leu Glu Lys Val Pro Val Ser Lys Gly Gln Leu Lys Gln Phe Phe Tyr Glu Thr Lys Cy~ AQn Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg A~p Ile A~p Lys Arg Hit Trp A~n Ser Gln Cys Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met A~p Ser Lys Ly~ Arg Ile Gly Trp Arg Phe Ile Arg Ile A~p Thr Ser Cy8 Val Cys Thr Leu Thr Ile Ly~ Arg Gly Arg (2) INFORMATION FOR SEQ ID NO:84:
(i) ~hQ~:N~ CHARACTERISTICS:
'A'l LENGTH: 160 amino acids Bl TYPE: amino acid C, STRANDEDNESS: ~ingle lD,I TOPOLOGY: tlnkn~
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:84:

-'h.. ' WO93/25684 ~ 77~ PCr/US93/05672 A~p Leu Tyr Thr Ser Arg Val Met Leu Ser Ser Gln Val Pro Leu Glu 1 5 10 15 , ~:
Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Ly~ A~n Tyr Leu A~p Ala ~ t Ala A~n Met Ser Met Arg Val Arg Arg Hi~ Ser A~p Pro Ala Arg Arg Gly Glu Leu Ser Val Cy~ A~p Ser Ile Ser Glu Trp Val Thr Ala Ala Asp Ly3 LYB Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu Glu Lys Val Pro Val Ser Lys Gly Gln Leu Lys Gln Tyr Phe Tyr Glu Thr Lys Cy~ A~n Pro Met Gly Tyr Thr Lys Glu Gly Gly Arg Asp Ile A~p Ly~ Arg His Trp Asn Ser Gln Cyq Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met A~p Ser Ly~ Ly~ Arg Ile Gly Trp Arg Phe Ile Arg Ile ABP Thr Ser Cys Val Cy~ Thr Leu Thr Ile Ly~ Arg Gly Arg (2) INFORMATION FOR SEQ ID NO:85:
(i) ~Qu~ CHARACTERISTICS:
,'A' LENGTH: 160 amino acLd~
B TYPE: amino acid C STRANDEDNESS: single ~DJ TOPOLOGY: unknown (ii) MOT.T~CU~.E TYPE: pept$de (xi) SEQUENCE DESCRIPTION: SEQ ID NO:85:
A~p Met Tyr Thr Ser Arg Val Met Leu Ser Ser Gln Val Pro Leu Glu Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Ly~ A~n Tyr Leu Asp Ala Ala A~n Met Ser Met Arg Val Arg Arg Hi~ Ser A~p Pro Ala Arg Arg Gly Glu Leu Ser Val Cy~ A~p Ser Ile Ser Glu Trp Val Thr Ala Ala A~p Ly~ Lys Thr Ala Val ARP Met Ser Gly Gly Thr Val Thr Val Leu Glu Ly~ Val Pro Val Ser Ly~ Gly Gln Leu Ly~ Gln Tyr Phe Tyr Glu ~ Thr Lys Cy5 A~n Pro Met Gly Tyr Thr Ly~ Glu Gly Gly Arg A~p Ile A~p Ly~ Arg HL~ Trp A~n Ser Gln Cy~ Arg Thr Thr Gln Ser Tyr Val W O 93~25684 ,~ P ~ /US93/05672 Arg Ala Leu Thr Met A~p Ser Lys Lys Arg Ile Gly Trp Arg Phe Ile 2~7~ Arg Il~ ABP Thr Ser Cy8 Val Cy8 Thr Leu Thr Ile Ly~ Arg Gly Arg (2) lN~ORhATION FOR SEQ ID NO:86:
(i) SEQUENCE CHARACTERISTICS:
A' LENGTH: 180 amino acids B TYPE: amino acid C STRANDEDNESS: ningle ~D TOPOLOGY: I~n~nl "
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86:
Ala Ala Arg Val Thr Gly Gln Thr Arg Asn Ile Thr Val A~p Pro Arg Leu Phe Lys Lys Arg Arg Leu His Ser Pro Arg Val Leu Phe Ser Thr Gln Pro Pro Pro Thr Ser Ser A~p Thr Leu A~p Leu Anp Phe Gln Ala His Gly Thr Ile Pro Phe Asn Arg Thr Hi~ Arg Ser Lys Arg Ser Ser Ser Hi~ Pro Ile Phe Hi~ Arg Gly Glu Phe Ser Val Cy~ Asp Ser Val Ser Val Trp Val Gly Asp Ly~ Thr Thr Ala Thr Asp Ile Ly~ Gly Ly~

Glu Val Met Val Leu Gly Glu Val A~n Ile A~n A~n Ser Val Phe Ly~

Gln Tyr Phe Phe Glu Thr Ly~ Cys Arg Asp Pro Asn Pro Val A~p Ser Gly Gly Arg Asp Ile A~p Ser Ly~ His Trp A~n ser Tyr Cy~ Thr Thr Thr His Thr Phe Val Lys Ala Leu Thr Thr A~p Glu Lys Gln Ala Ala Trp Arg Phe Ile Arg Ile Asp Thr Ser Cy~ Val Cy~ Val Leu Ser Arg Ly3 Ala Thr Arg (2) INFORMATION FOR SEQ ID NO:87:
(i) ~Q~ ~ CHARACTERISTICS:
'A'l LENGTH: 180 amino acid~
B TYPE: amino acid C, STRANDEDNESS: ~ingle ,D TOPOLOGY: unknown (Li) MOLECULE TYPE: peptide WO 93/25684 2`1 3 7 7 9 g PCI/US93/05672 .

(xi) SEQUENCE DESCRIPTIoN: SEQ ID NO:87:
Ala Ala Arg Val Thr Gly Gln Thr Arg Asn Ile Thr Val Asp Pro Lys Leu Phe LYB Lys Arg Arg Leu Arg Ser Pro Arg Val Leu Phe Ser Thr Gln Pro Pro Pro Thr Ser Ser Asp Thr Leu Asp Leu Asp Phe Gln Ala His Gly Thr Ile Ser Phe Asn Arg Thr His Arg Ser Lys Arg Ser Ser Thr His Pro Val Phe HL~ Met Gly Glu Phe Ser Val Cys Asp Ser Val Ser Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp Ile Lys Gly Lys Glu Val Thr Val Leu Gly Glu Val Asn Ile A~n Asn Ser Val Phe Lys Gln Tyr Phe Phe Glu Thr Lyn Cys Arg Ala Pro Asn Pro Val Glu Ser Gly Gly Arg Asp Ile A~p Ser Lys His Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Val Lys Ala Leu Thr Thr Asp Asp Lys Gln Ala Ala Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val Cys Val Leu Ser Arg Lys Ala Ala Arg (2) lNrORMATION FOR SEQ ID NO:88:
(i) SEQUENCE CHARACTERISTICS:
/A'I LENGTH: 179 amino acids Bl TYPE: amino acid ,C, STRANDEDNESS: ningle ~D,, TOPOLOGY: In~rlu..
(ii) MOTFCYr~ TYPE: peptide (xi) sr;QuhL~-r~ DESCRIPTION: SEQ ID NO:88:
Ala Ala Arg Val Ala Gly Gln Thr Arg A~n Ile Thr Val Asp Pro Arg Phe Lys Lys Arg Arg Leu Arg Ser Pro Arg Val Leu Phe Ser Thr Gln Pro Pro Arg Glu Ala Asp Thr Thr Gln Asp Leu Asp Phe Glu Val Gly Gly Ala Ala Pro Phe Asn Arg Thr His Arg Ser Lys Arg Ser Ser Ser His Pro Ile Phe His Arg Gly Glu Phe Ser Val Cy~ Asp Ser Val Ser ~al Trp Val Gly A~p Ly~.~Thr Thr~Ala Thr Asp Ile Ly~ Gly Lys Glu ' 90 95 Val Met Val Leu Gly Glu Val A~n Ile A~n A~n Ser Val Phe Ly~ Gln 2 1 3 7 7 9 9 loo 105 110 Tyr Phe Phe Glu Thr Ly~ Cy~ Arg A~p Pro Asn Pro Val A~p Ser Gly Gly Arg A~p Ile A~p Ser Lyn Hi~ Trp A~n Ser Tyr Cy~ Thr Thr Thr Hi~ Thr Phe Val Ly- Ala Leu Thr Met A~p Gly Ly3 Gln Ala Ala Trp Arg Phe Ile Arg Ile Anp Thr Ser Cy~ Val Cy~ Val Leu Ser Arg Ly~

Ala Val Arg (2) INFORMATION FOR SEQ ID NO:89:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 163 amino acid~
(B, TYPE: amino acid (C, STRANDEDNESS: ~ingle (D,, TOPOLOGY: ~nkn,~
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:89:
Phe Phe Ly~ Ly~ Ly~ Arg Phe Arg Ser Ser Arg Val Leu Phe Ser Thr Gln Pro Pro Pro Glu Ser Arg Lyn Gly Gln Ser Thr Gly Phe Leu Ser Ser Ala Val Ser Leu A~n Arg Thr Ala Arg Thr Ly~ Arg Thr Ala Hi~

Pro Val Leu His Arg Gly Glu Phe Ser Val Cy~ A~p Ser Val Ser Met Trp Val Gly A~p Lys Thr Thr Ala Thr Asp Ile Ly~ Gly Ly~ Glu Val Thr Val Leu Gly Glu Val Ann Ile A~n A~n A~n Val Phe Ly~ Gln Tyr Phe Phe Glu Thr Ly~ Cy~ Arg A~p Pro Arg Pro Val Ser Ser Gly Gly Arg Asp Ile A~p Ala Ly~ His Trp A~n Ser Tyr Cy~ Thr Thr Thr Hi~

Thr Phe Val Ly~ Ala Leu Thr Met Glu Gly Ly~ Gln Ala Ala Trp Arg Phe Ile Arg Ile A~p Thr Ser Cy5 Val Cy~ Val Leu Ser Arg Ly~ Ser Gly Arg Pro ?1~7~
(2) INFORMATION FOR SEQ ID NO:90: ` --( i ) ~hQ~L~L CHARACTERISTICS: ;
'A) LENGTH: 124 amino acids l'B) TYPE: amino acid ,C) STRANDEDNESS: single ,D) TOPOLOGY: 1~nkn~ "
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:90:
~ His Arg Ser Ly~ Arg Ser Ser Glu Ser His Pro Val Phe His Arg Gly Glu Phe Ser Val Cys Asp Ser Ile Ser Val Trp Val Gly ARP Lys Thr Thr Ala Thr Asp Tle Lys Gly Lys Glu Val Met Val Leu Gly Glu Val Asn Ile Asn Asn Ser Val Phe Lys Gln Tyr Phe Phe Glu Thr Ly~ Cys Arg A~p Pro Asn Pro Val Asp Ser Gly Gly Arg ARP Ile Asp Ala Lys His Trp Asn Ser Tyr Cys Thr Thr Thr His Thr Phe Val Ly~ Ala Leu Thr Met A~p Gly Ly~ Gln Ala Ala Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val Cys Val Leu Ser Arg Ly3 Thr Gly Gln llS 120 (2) INFORMATION FOR SEQ ID NO:91:
(i) SEQUENCE CHARACTERISTICS:
'A'I LENGTH: 164 amino acids l'B TYPE: amino acid ,C STRhNDEDNESS: 3ingle ~DJ TOPOLOGY: 1-nk- ."
(ii) MOLECULE TYPE: peptide (Xi) ~h~UL.. - ~ DESCRIPTION: SEQ ID NO:91:
Val A~p Pro Lys Leu Phe Gln Ly3 Arg Gln Phe Gln Ser Pro Ary Val Leu Phe Ser Thr Gln Pro Pro Leu Leu Ser Arg Asp Glu Glu Ser Val Glu Phe Leu Asp Asn Glu Asp Ser Leu Asn Arg Asn Ile Arg Ala Ly~

Arg Glu Asp Hi~ Pro Val His Asn Leu Gly Glu His Ser Val Cy~ Asp Ser Val Ser Ala Trp Val Gly Lys Thr Thr Ala Thr Asp Ile Lys Gly Asn Thr Val Thr Val Met Glu Asn Val Asn Leu Asp Asn Lys Val Tyr 2~ 7899 i~ PCI/US93/05672 Ly~ Gln Tyr Phe Pho Glu Thr Lys Cy~ Arg A~n Pro Asn Pro Glu Pro Ser Gly Gly Arg A~p Ile A~p Ser Ser Hi~ Trp A~n Ser Tyr Cy~ Thr Glu Thr A~p Gly Phe Ile Ly~ Ala Leu Thr Met Glu Gly Asn Gln Ala Ser Trp Arg Phe Ile Arg Ile A~p Thr Ser Cy~ Val Cy~ Val Ile Thr Ly~ Ly~ Ly~ Gly (2) lN~ORMATION FOR SEQ ID NO:92:
~QU~N~ CHARACTERISTICS:
,'A~, LENGTH: 196 amino acid~
IBI TYPE: amino acid ,C STRANDEDNESS: ningle ~D, TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) S~u~_~ DESCRIPTION: SEQ ID NO:92:
Pro Ala Gly Ser Ser Pro Asp Pro Ser Ser Pro Val Val Asp Pro Ly~

Leu Phe Ser Ly~ Arg Hi~ Tyr Pro Ser Pro Arg Val Val Phe Ser Glu Val Ile Pro Ser Hi~ A~p Val Leu A~p Gly Glu Gly Tyr Asp Phe Glu Arg Val Arg Gly Leu Arg Val Arg Arg Ly~ Ala Val Ser Hi~ Thr Met His Arg Gly Glu Tyr Ser Val Cy~ A~p Ser Ile A~n Thr Trp Val A~n Thr Ly~ Arg Ala Thr A~p Met Ser Gly A~n Glu Val Thr Val Leu Ser His Val Thr Val A~n ADn LYB Val Ly~ Lya Gln Leu Phe Tyr Glu Thr Thr Cys Arg Ser Pro Thr Hi~ Arg Ser Ser Gly Ile Val Ile Gly Gly Arg Ser Gly Gly Arg Gly Gly Ser Gln Gly Ser Ly~ Thr Gly A~n Ser Gly Gly Arg A~p Ile Asp Ser Arg Tyr Trp A~n Ser Hi~ Cy~ Thr A~n Thr A~p Ile Tyr Val Ser Ala Leu Thr Val Phe Ly~ Glu Gln Thr Ala Trp Arg Phe Ile Arg Ile Asn Ala Ser Cyn Val Cy~ Val Ser Arg Thr WO 93/25684 ~ 7 7 9 g PCI`/US93/05672 A~n Ser Trp Ser . , (2) INFORMATION FOR SEQ ID NO:93:
(i) SEQUENCE CHARACTERISTICS:
,'A'I LENGTH: 225 ba~e pairn B TYPE: nucleic acid ,C STRANDEDNESS: double ,,DJ TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/REY: CDS
(8) LOCATION: 1..225 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:93:

Arg Val Val Leu Ser Arg Gly Ala Ala Ala Gly Pro Pro Leu Val Phe Leu Leu Glu Thr Gly Ala Phe Arg Glu Ser Ala Gly Ala Arg Ala Asn Arg Ser Gln Arg Gly Val Ser Asp Thr Ser Pro Ala Ser His Gln Gly Glu Leu Ala Leu Cys Asp Ala Val Ser Val Trp Val Thr A~p Pro Trp Thr Ala Val A~p Leu Gly Val Leu Glu Val Glu (2) INFORMATION FOR SEQ ID NO:94:
(i) ~QD~CE CHARACTERTSTICS:
A) LENGTH: 75 amino acids B) TYPE: amino acid ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:94:
Arg Val Val Leu Ser Arg Gly Ala Ala Ala Gly Pro Pro Leu Val Phe Leu Leu Glu Thr Gly Ala Phe Arg Glu Ser Ala Gly Ala Arg Ala A~n Arg Ser Gln Arg Gly Val Ser Asp Thr Ser Pro Ala Ser His Gln Gly - Glu Leu Ala Leu Cys Asp Ala Val Ser Val Trp Val Thr A~p Pro Trp Thr Ala Val Asp Leu Gly Val Leu Glu Val Glu W O 93/25684 PC~r/US93/05672 2137~9g ~ ."~
(2) lNrOR~ATION FOR SEQ ID NO:95:
( i ) ~h~U~N~ CHARACTERISTICS:
'A'l LENGTH: 53 ba~e pair~
IB TYPE: nucleic acid ,C STRANDEDNESS: single ~D,l TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA

(Xi) ~hyU~Ne~ DESCRIPTION: SEQ ID NO:95:

(2) INFORMATION FOR SEQ ID NO:96:
( i ) ~yU~N~ CHARACTERISTICS:
~'A~ LENGTH: 10 amino acids B TYPE: amino acid C STR~NDEDNESS: ~inqle ~D, TOPOLOGY: ~l n ~n~ . "
(ii) ~OLECULE TYPE: peptide (xi) ~:yu~ DESCRIPTION: SEQ ID NO:96:
Ly~ Cy~ Asn Pro Ser Gly Ser Thr Thr Arg l 5 lO
(2) INFORMATION FOR SEQ ID NO:97:
yu~.._~ CHARACTERISTICS:
'A', LENGTH: 7 amino acid~
Bl TYPE: amino acid C STRANDEDNESS: 3ingle ,D, TOPOLOGY: llnl-- ,,"
(ii) MOLECULE TYPE: peptide (xi) ~gu~N~ DESCRIPTION: SEQ ID NO:97:
Arg Gly Cy~ Arg Gly Val Asp (2) INFORMATION FOR SEQ ID NO:98:
( i ) ~Q~N~ CHARACTERISTICS:
~A' LENGTH: 5 amino acid~
B TYPE: ~mino acid ,C, STRANDEDNESS: ~ingle ,D,, TOPOLOGY: llnl~
(ii) MOLECULE TYPE: peptide (xi) S~:yU~N~ DESCRIPTION: SEQ ID NO:98:
Ly~ Gln Trp Ile Ser (2) INFORMATION FOR SEQ ID NO:99:

W O 93/25684 PC~r/US93/05672 2137799 `; ``
(i) ~yu~nCE CHARACTERISTICS~
'A'l LENGTH: 6 amino acids 7 ' B TYPE: amino acid C, STRANDEDNESS: ~ingle ~Dl TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:99:
Ly~ Gln Ser Tyr Val Arg - (2) INFORMATION FOR SEQ ID NO:100:
(i) SEQUENCE CHARACTERISTICS:
'A'l LENGTH: 7 umino acid~
~B TYPE: amino acid C STRANDEDNESS: ~ingle ,D, TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:100:
Gly Pro Gly Xaa Gly Gly Gly (2) INFORMATION FOR SEQ ID NO:101:
(1) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 7 amino acid~
B TYPE: amino acid C STRANDEDNESS: ~ingle ,D, TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:101:
Gly Pro Gly Val Gly Gly Gly (2) INFORMATION FOR SEQ ID NO:102:
QDriN~ CHARACTERISTICS:
,'A` LENGTH: 7 amino acid~
BI TYPE: amino acid Cl STRANDEDNESS: ~ingle ~,D~ TOPOLOGY: ~n~n, ..., (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:102:
Gly Pro Gly Ala Gly Gly Gly (2) lNroR~ATIoN FOR SEQ ID NO:103:

(i) ~r;yu~nCE CHARACTERISTICS:
(A) LENGTH: S amino acid~
(B) TYPE: amino acid W O 93/25684 ,'~ ' , ~ ; P ~ /US93/05672 9 ~c, STRANDEDNESS: single 213 7 7 D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) ~Q~hNCE DESCRIPTION: SEQ ID NO:103:
Glu Ser Ala Gly Glu (2) INFORMATION FOR SEQ ID NO:104:
(i) s~Qu~ r- CHARACTERISTICS:
'A' LENGTH: 5 amino acid~ -IB TYPE: amino acLd ,C STRANDEDNESS: ~ingle ~D,l TOPOLOGY: lln~
(ii) MOLECULE TYPE: peptide (xi) SEQDLN~L DESCRIPTION: SEQ ID NO:104:
A~p A~n Ala Glu Glu (2) INFORMATION FOR SEQ ID NO:105:
(i) s~g~:N~ CHARACTERISTICS:
'A' LENGTH: 18 ba~e pair~
BI TYPE: nucleic acid C, STRANDEDNESS: ~ingle ~D,, TOPOLOGY: t, nkn ~_ ,, ~, ( ii ) M~T.~CUT.T~` TYPE: DNA (genomic) (Xi) ~:yuL~ : DESCRIPTION: SEQ ID NO:105:
CAGTATTTTT AC~AAACC 18 (2) lN~OR~ATION FOR SEQ ID NO:106:
(i) SEQUENCE CHARACTERISTICS:
'A', LENGTH: 18 ba~e pair~
B TYPE: nucleic acid C, STRANDEDNESS: ~ingle ,D,I TOPOLOGY: unknown ( ii ) M~T~T~CYT~T~ TYPE: cDNA

(Xi) S~U~N~L DESCRIPTION: SEQ ID NO:106:
ACA~.LCG~ G 18 (2) INFORMATION FOR SEQ ID NO:107:
( i ) SLgUL.. T' CHARACTERISTICS:
'A' LENGTH: 18 ba~e pair~
B TYPE: nucleic ac$d C, STRANDEDNESS: ~ingle l,DJ TOPOLOGY: llnkn~ ~"
(ii) MOLECULE TYPE: DNA (genomic) W O 93/25684 2 1 ~ 7 7 9 9 PC~r/US93/05672 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:107: ~, CAGTATTTTT ~AG~rG 18 .

(2) INFORMATION FOR SEQ ID NO:108:
(i) ~yuh~_E CHARACTERISTICS:
A', LENGTH: 18 ba~e pair~
,BI TYPE: nucleic acid - C sTRA~n~np~ss: ~inqle ,D, TOPOLOGy llnl-- - ,,"
- (ii) MOLECULE TYPE: cDNA

(xi) ~:QuhNCE DESCRIPTION: SEQ ID NO:108:
ACAlllCGGL TTGTTAGC 18 (2) INFORMATION FOR SEQ ID NO:109:
(i) SEQUENCE CHARACTERISTICS:
'Al LENGTH: 36 base pairs B TYPE: nucleic acid C, STRANDEDNESS: ~ingle ~D TOPOLOGY: ~
(ii) MOLECULE TYPE: DNA (genomic) ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:109:
TGCAGTTTCG CTC~CCCCCC GTTTTAGCCG GGAAGT 36 (2) INFORMATION FOR SEQ ID NO:110:
( i ) ~QD~N~ CHARACTERISTICS:
'A' LENGTH: 7 amino acids BI TYPE: amino acid ,C STRANDEDNESS: single lDJ TOPOLOGY: ~lnkn~
(ii) MOLECULE TYPE: peptide (xi) ~:yu~ DESCRIPTION: SEQ ID NO:110:
Lys Gln Tyr Phe Tyr Glu Thr (2) INFORMATION FOR SEQ ID NO:lll:
( i ) ~QU~N~ CHARACTERISTICS:
A' LENGTH: 7 amino acids lB TYPE: amino acid ,C, STRANDEDNESS: single ,D, TOPOLOGY: I-nknot~,, - (ii) MOLECULE TYPE: pept$de (xi) SEQUENCE DESCRIPTION: SEQ ID NO:lll:
Trp Arg Phe Ile Arg Ile Asp W O 93/25684 ; ~ t ~ ~ ~ P ~ /Us93/05672 2~3~ 9~ 5 , ~2) INFORMATION FOR SEQ ID NO:112:
Q~N~r; CHARACTERISTICS:
'A'l LENGTH: 7 amino acidn ~B TYPE: amino acid ,C STRANDEDNESS: single ~D,, TOPOLoGy I~nk- ,,"
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:112:
Gly Glu Leu Ser Val Cys Asp (2) INFORMATION FOR SEQ ID NO:113:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 6 amino acids (B TYPE: amino acid (C STRANDEDNESS: single (D, TOPOLOGY: llnkn-,~n (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:113:
Lys Ala Glu Ser Ala Gly (2) INFORMATION FOR SEQ ID NO:114:
( i ) S~yUh~: CHARACTERISTICS:
'A' LENGTH: 45 ba~e pairs B' TYPE: nucleic acid C STRANDEDNESS: ~ingle ~D, TOPOLOGY: ~nkr ....
( ii ) MoT~cuT~ TYPE: peptide (xi) ~riQuk.._r; DESCRIPTION: SEQ ID NO:114:
GGAGGGGGCT GCCGGGr~ T GGACAGGAGG CACTGGGTAT CTGAG 45 (2) lNru~ATION FOR SEQ ID NO:115:
( i ) ~UL.._~: CHARACTERISTICS:
'A'l LENGTH: 15 amino acids B TYPE: amino acid ,C STRANDEDNESS: single ~D,l TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) ~yuh~cE D~Sr~TPTION: SEQ ID NO:115:
Gly Gly Gly Cys Arg Gly Val Asp Arg Arg Hi~ Trp Val Ser Glu l 5 10 15 (2) INFORMATION FOR SEQ ID NO:116:

W O 93/25684 2 1 ~ 7 7 g 9 PC~r/US93/05672 (i) s~:~Dh~_~ CHARACTERISTICS~
fA'I LENGTH: 582 ba~e pairr ~B TYPE: nuclei~ acid C STRANDEDNESS: double D,, TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1.. 396 ., - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:116:

Val Val Cy~ Pro Ile Met Ser Hi~ His Arg Ser Lys Val Pro Ser Gln l 5 10 15 Arg Ser Ser Arg Val Ala Pro Ala Thr Cy~ Arg Arg Arg Thr Gly Arg Tyr Gly Arg Ser Leu Glu Val Glu Val Leu Gly Glu Val Pro Pro Ala Val Gly Ser Ser Leu Arg Gln Hi~ Phe Phe Val Ala Arg Phe Glu Ala A~p Lys Ser Glu Glu Gly Gly Pro Gly Val Gly Gly Gly Ala Ala Ala Gly Val Trp Thr Gly Gly Hin Trp Val Ser Glu Cyq Lys Ala Ly~ Gln Ser Tyr Val Arg Ala Leu Thr Ala A~p Ala Gln Gly Arg Val A~p Trp Arg Trp Ile Gln Thr Gly Thr Ala Cyr Val Cy~ Thr Leu Leu Ser Arg ACT GGC TGG GCC TGAGACTTAT ACC~PGr7AAC TGGTCAGGCA GAAAPAGAAC 436 Thr Gly Trp Ala ~ 130 AGAGCTGGAT GCTr-AGAGAC CTCAGGGTTG GCCCAGCTGC TCTACGGACG GACCC~GTT 496 - GGGGAACTCA TGAAATCATC A~AAAATCAC AA~-~.GA ATTTGAGCTC AATCTCTGCA 556 W O 93/25684 ~ . P ~ /US93/05672 .. .. . . .. ..
(2) INFORMATION FOR SEQ ID NO:117:
n Q (i) SEQUENCE CH M ACTERISTIC5:
~l~7~ ~ (A) LENGTH: 132 amino acid~
(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:117:
Val Val Cyn Pro Ile Met Ser Hi~ Hin Arg Ser LYB Val Pro Ser Gln Arg Ser Ser Arg Val Ala Pro Ala Thr Cyn Arg Arg Arg Thr Gly Arg Tyr Gly Arg Ser Leu Glu Val Glu Val Leu Gly Glu Val Pro Pro Ala Val Gly Ser Ser Leu Arg Gln Hi~ Phe Phe Val Ala Arg Phe Glu Ala Asp Ly~ Ser Glu Glu Gly Gly Pro Gly Val Gly Gly Gly Ala Ala Ala Gly Val Trp Thr Gly Gly Hi~ Trp Val Ser Glu Cy~ Ly~ Ala Lys Gln Ser Tyr Val Arg Ala Leu Thr Ala A~p Ala Gln Gly Arg Val A~p Trp Arg Trp Ile Gln Thr Gly Thr Ala Cys Val CYB Thr Leu Leu Ser Arg Thr Gly Trp Ala (2) INFORMATION FOR SEQ ID NO:118:
(i) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 36 ba~e pair~
B TYPE: nucleic acid C STRANDEDNESS: ~ingle ,,DI TOPOLOGY: 1~n1__ ,,"
(ii) MOLECULE TYPE: DNA (genomic) (xi) ~yur;N~r; DESCRIPTION: SEQ ID NO:118:
CGGTACCCTC GAGCCACCAT G~.CC~.~.C CCCTCA 36 (2) lwrOfi~ATION FOR SEQ ID NO:119:
(i) sriQ~N~r; CHARACTERISTICS:
'A) LENGTH: 36 ba~e pairs IB) TYPE: nucleic ~cid ,C) STRANDEDNESS: ~ingle ,D) TOPOLOGY: tlnl-~:.l"
(ii) MOLECULE TYPE: DNA (genomic) (xi) ~r;yur;N~ DESCRIPTION: SEQ ID NO:119:

W O 93/25684 21 ~ 7 7 ~ 9 PC~r/US93/05672 CGGTACAAGC GGCCGCTTCT TGGGCATGGG TCTCAG , 36 (2) 1N~fi~ATION FOR SEQ ID NO:120: ,, 1! ,/ ~ ~ "~
(i) ShQDhN~h CHARACTERISTICS
I~A~I LENGTH: 36 ba~e pairs B, TYPE: nucleic acid ,C, STRANDEDNESS: ~ingle ~D, TOPOLOGY: ~n~n~t,., - (ii) MOLECULE TYPE: DNA ( genomic) Xi) S~YU~ _h DESCRIPTION: SEQ ID NO:120:
CGGTACCCTC GAGC~rC~ GG.~.CCGA GAGATG 36 (2) INFORMATION FOR SEQ ID NO:121:
(i) SEQUENCE CHARACTERISTICS:
~A~, LENGTH: 2 3 base pairs ,B TYPE: nucleic acid C, STRANDEDNESS: ging1e ~D, TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA ~ genomic) (Xi) S~UhN~ DESCRIPTION: SEQ ID NO:121:
~GACCGGAA GCTTCTAGAG ATC 23 (2) INFORMATION FOR SEQ ID NO:122:
(i) ~hYUhhCE CHARACTERISTICS:
,'A' LENGTH: 36 ba~e pairs ,B, TYPE: nucleic acid C STRANDEDNESS: ffLngle ~D, TOPOLOGY: 11n~
(ii) MOLECULE TYPE: DNA ( genomic) (Xi) ShgUhh-E DESCRIPTION: SEQ ID NO:122:
TGCAGTTTCG CT~rCCCCC G.-.CCGCCG TGATGT36 (2) INFORMATION FOR SEQ ID NO:123:
(L) X~QUhh-h CHARACTERISTICS:
I~A~I LENGTH: 36 ba~e paLr~
B, TYPE: nucleLc acid ,C, STRANDEDNESS: 8 Lngle ,D, TOPOLOGY lln'~
(LL) MOLECULE TYPE: DNA ( genomLc) (xL) ~g~hN~ DESCRIPTION: SEQ ID NO:123:
ACATCACGGC GGAAACGGGG GGTrr ,C~-~A ACTGCA 36 (2) INFORMATION FOR SEQ ID NO:124:
(L) SEQUENCE CHARACTERISTICS:

WO 93/25684 ,,, ~ j PCI/US93/05672 ~ 9 9 I'A'I LENGTH: 36 ba~e pair~
Z~31 B TYPE: nucleic acid ,C, STRANDEDNESS: single ,DJ TOPOLOGY llnkn~
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:124:
A~lCCCGGC TAAA~CGGGG GGTGAGCGAA ACTGCA 36

Claims (28)

WE CLAIM:

1. A method of treating an NT-4 related motor neuron disorder comprising administering, to a patient in need of such treatment, an effective amount of an NT-4 protein capable of supporting the survival, growth and/or differentiation of motor neurons as demonstrated in an in vitro culture system.

2. The method of claim 1 wherein the NT-4 protein is encoded by a recombinant nucleic acid molecule comprising the NT-4 related DNA
sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

3. The method of claim 1 wherein the NT-4 protein is encoded by a recombinant nucleic acid molecule which is at least about 70%
homologous to the corresponding DNA sequence as contained in bacteriophage HG7-2 as deposited with the ATCC and assigned accession number 75070.

4. The method of claim 1 comprising administering, in combination with said NT-4 protein, an effective amount of a second neurotrophic factor capable of supporting the survival, growth and/or differentiation of motor neurons as demonstrated in an in vitro culture system.

5. The method of claim 4 in which the second neurotrophic factor is ciliary neurotrophic factor, neurotrophin-3 or nerve growth factor.

6. A method of promoting dopaminergic neuron survival, growth, and/or differentiation comprising exposing the neurons to an effective concentration of an NT-4 protein that is capable of promoting the survival, growth, and/or differentiation of dopaminergic neurons as demonstrated in an in vitro culture system.

7. A method of treating a dopaminergic neuron disease or disorder comprising administering, to a patient in need of such treatment, an effective amount of an NT-4 protein that is capable of promoting the survival, growth, and/or differentiation of dopaminergic neurons as demonstrated in an in vitro culture system.

8. The method of claim 7 wherein said disease or disorder is Parkinson's disease.

9. A method of promoting cholinergic neuron survival, growth, and/or differentiation comprising exposing the neurons to an effective concentration of an NT-4 protein that is capable of promoting the survival, growth, and/or differentiation of cholinergic neurons as demonstrated in an in vitro culture system.

10. A method of treating a cholinergic neuron disease or disorder comprising administering, to a patient in need of such treatment, an effective amount of an NT-4 protein that is capable of promoting the survival, growth, and/or differentiation of cholinergic neurons as demonstrated in an in vitro culture system.

11. The method according to claim 10 in which the cholinergic neurons are basal forebrain cholinergic neurons.

12. The method according to claim 10 in which the cholinergic neurons are septal cholinergic neurons.

13. The method of claim 10 wherein said disease or disorder is Alzheimer's disease.

14. A method of treating a peripheral neuropathy comprising administering, to a patient in need of such treatment, an effective amount of an NT-4 related protein that is capable of promoting the survival, growth, and/or differentiation of dorsal root ganglia or other sensory neurons as demonstrated in an in vitro culture system.

15. The method of claim 14 wherein said peripheral neuropathy is acute neurapraxia, neurotmesis, axotmesis, diabetic neuropathy, amyotrophic lateral sclerosis and compression.

16. A method of treating a disease or disorder involving cells of the hippocampus comprising administering, to a patient in need of such treatment, an effective amount of an NT-4 related protein that is capable of promoting the survival, growth, and/or differentiation of hippocampal cells as demonstrated in an in vitro culture system.

17. The method of claim 16 wherein said disease or disorder is related to ischaemia, hypoxia, hypoglycemia or stroke.

18. A method of treating a disease or disorder involving cells of the striatum comprising administering, to a patient in need of such treatment, an effective amount of an NT-4 related protein that is capable of promoting the survival, growth, and/or differentiation of striatal cells as demonstrated in an in vitro culture system

19. The method of claim 18 wherein said disease or disorder is Huntington's chorea, striatonigral degeneration, cerebral palsy, stroke, ischaemia, hypoxia or hypoglycemia.

20. A method of diagnosing an NT-4 related peripheral nervous system disorder comprising injecting detectably labeled NT-4 into a peripheral nerve and determining whether the labeled NT-4 is retrogradely transported, in which a failure to be retrogradely transported positively correlates with lack of responsiveness to NT-4 and indicates that the peripheral nervous system disorder is NT-4 related.

21. The method of claim 20 in which the disease or disorder is selected from the group consisting of acute neurapraxia, neurotmesis, axotmsesis, diabetic neuropathy, amyotrophic lateral sclerosis and compression.

22. A method of diagnosing an NT-4 related central nervous system disorder comprising injecting detectably labeled NT-4 into a central nerve and determining whether the labeled NT-4 is retrogradely transported, in which a failure to be retrogradely transported positively correlates with lack of responsiveness to NT-4 and indicates that the central nervous system disorder is NT-4 related.

23. The method of claim 22 in which the disease or disorder is selected from the group consisting of tumor, abscess, trauma, Alzheimer's disease, and Parkinson's disease.

24. A method of treating a disease or disorder of the retina comprising administering to a patient in need of such treatment, an effective amount of an NT-4 related protein.

25. The method of claim 24 where said disease or disorder is retinal detachment, age related or other maculopathies, photic retinopathy, surgery-induced retinopathy, retinopathy of prematurity, viral retinopathy, uvetis, ischemic retinopathy due to venous or arterial occlusion or other vascular disorders, retinopathy due to trauma or penetrating lesions of the eye, peripheral vitreoretinopathy or inherited retinal degeneration.

26. The method of claim 24 wheren said disease or disorder involves the optic nerve.

27. The method of claim 24 wherein said disease or disorder involves degeneration of retinal ganglion cells.

28. A method of treating seizures comprising admistering to a patient in need of such treatment, an effective amount of NT-4.