CA2121041C - Composite antibodies of human subgroup iv light chain capable of binding to tag-72 - Google Patents

Abstract

This invention concerns a subset of composite Hum4 V L, V H .alpha.TAG
antibody with high affinities to a high molecular weight; tumor-associated sislylated glycoprotein antigen (TAG-72) of human origin. These antibodies have variable regions with (1) V L segments derived from the human subgroup IV germline gene and (2) a V
H segment which is capable of combining with the V L to form a three dimensional structure having the ability to bind TAG-72. in vivo methods of treatment and diagnostic assay using these composite antibodies is also disclosed.

Description

~G'1'1'JA1J91 /OOSg3 ...
x COMPOSITE ANTIBODIES OF HUMAN SUBGPOUP IV LIGHT CHAIN
CAPABLE OF BINDING TO ':'AG-~72 The present invention is directed to the fields of immunology and genetic engineering.
'd'he following information is provided for the ourpo~se of making known information bel~eved by the applicants to be opossible relevance to the present invention. :~o admission is necessarily intended, nor snouid be construed, that any of the Following informat?on constitutes prior ar; agai.nst the present invention. ' Antibodies are specific immunoglobulin (Ig?
poiypeptides produced by the vertebrate ?mmune syst2:n i:~
response to challenges by foreign proteins, 1~ gl~ycoproteins, cells, or other antigenic foreign substances. The binding specificity of such polypeptides to a aarticular antigen is highly refined, with each antibody being almost exclusively directed -,o the partiauLar antigen~which elicited l;,.
Two major methods oi" generating vertebrate '~ ~ antibodies are presently utilized:generation insitu by . the ma~aal=an 3 lymphocytes and Qeneration in cell

2~ culture by 3-cell hybrias. Antiaodies are generated in SUBSTlTU'1P"E ~t-I~ET

WO 93/12231 '~ ~ ~ P~'f/AU91/0~583 situ as a result of the differentiation of immature B
lymphocytes into plasma cells (see Gough (1981), Trends Q' in Biochem Sci, b : 203 ( 1981 ) . Even when only a s ingle antigen is introduced into the immune system for a ..
particular mammal, a uniform population of antioodies does not result, l.c., the response is polyclonal.
The limited but inherent heterogeneity of polyclonal antibodies is overcome by the use of hybridoma technology to create '°a~onoclonal" antibodies 19 in cell cultures by B cell hybridomas (see Kohler and Milstein (1975). Nature. 256:~~5-~97)a In this pa~ocess, a mammal is injected with an antigen. and its relatively short-lived, or mortal. splenocytes or lymphocytes are fused with an immortal tumor cell line. The fusion produces hybrid cells or "hybridomas" which are both immortal and capable of producing the genetically-coded antibody of the B cell.
2G In many applications, the. use of monoclonal antibodies produced in non-human animals is severely restricted where the monoclonal antibodies are to be used in humans. Repea~:ed in,jectians in humans of a "foreign" antibody, such as a mouse antibody, may lead to harmful hypersensitivity reactions, l.c., an anti-id3otypic,. or human anti-mouse antibody (HAL~iAA) response, (see Shawler etal. (19$5), Journal of Immunolo~y, 135:153~-1535. and Sear etal.. J. 3iol. Resn.
Modifiers, 3:138-150).
30.
Qarious attempts have already seen :rade to ..
manufacture human-derived monoclonal antibodies by using l human hybridomas (see Olsson etal.. °roc. ~~atl= dead.
Sci. G.S.A., 77:529 (1980) and 3oder etal. (~986a, Methods in Enzvmolo~~, 121:x40-167. Unfortunately, SUBSTITUTE SHEBT

;,~ ~ r,, _ ,. , WO 93/~223X F'CT/AU9R100583 yields of monoclonal antibodies from human hybridoma cell lines are relatively low compared to mause hybridomas. In addition, human cell lines express~Cng immunoglobulins are relatively unstable compared to mouse cell lines, and the antibody producing capability of these human cell lines is transient. Thus, while human immunoglobulins are highly desirable, human hybridoma techniques have not yet reached the stage where human monoclonal antibodies with required antigenic specificities can be easily obtained.
Thus, antibodies of nonhuman origin have been genetically engineered. or "humanized"> aumanized antibodies reduce she HAMA response compared to that expected after injection of a human patient with a mouse antibody. Humanization of antibodies derived from nonhumans, for example. has taken two principal forms, i.e.,~ chimerization where non-human regions of immunoglobulin constant sequences are replaced by 20 corresponding human ones (see for example. USP 4,816,567 to Cabilly et al. , Genenteeh) and grafting of complementarily determining regions ((:DR) into human frameworfc.regions (FR) (sep ruropean Patent Office App.lieation (EPO) 0 239 X00 to Winter). Some 25~ researchers have produced Fv,antibodies (USP 4,62,334 to Moore, DNAX) and single chain Fv (SCFV) antibodies (see JSP,4,946,778 to Ladn~r, Genex).
The above patent applications only show the production pi" antibody tfragments in which 'some portion of the variable domains is coded °or by nonhuman 'J gene regions. Humanized antibodies to date still retain various portions pt'' =:.ght end heavy chain variable regions of nonhuman arigin: the chimeric. ;v and single chain ,Fv antibodies retain the entire variable region of 3UBSTtTUTE SHEET

~Y(3 93/12231 '~ ~ '~ ~ ~ ~ ~ P~'lf'/AU91/110583 _u_ nonhuman origin and CDR-grafted antibodies retain CDR of nonhuman origin.
Such nonhuanan-derived regions are expected to elicit an immunogenic reaction when administered into a human patient (see Bruggemann etul. (1989), J. EXD. Med., i7~:2153~2157~ and Lo Buglio (1991), Sixth International Conference on Monoclonal Antibody Immunoconjugates for Cancer, San Diego, Ca). Thus, it is most desirable to obtain a human variable region which is capable of binding to a selected antigen.
One known human carcinoma tumor antigen is tumor-associated glycoprotein-72 (TAG-T2), as defined by monoclonal antibody B72.3 (see Thor etal. (1986) Canaer Res., X6:3118-31Z~: and Johnson, etal. (198b), Cancer Res., x#6:850-857). TAG-72 is associated with the surface of certain tumor cells of human origin, specifically the LS17~T tumor cell line (American Type ZO Culture Collection (ATCC) No. CL 188), which is a variant of the LS180 (ATCC No. CL 187) colon adeno°
carcinoma line.
Numerous murine monoclonal antibodies have been Z5 developed which have binding specificity for TAG-72.
Exemplary ~iurine monoclonal antibodies include the °'CC"
(colon cancer) monoclonal antibodies, which are a library of murine monoclonal antibodies neveioped using ~A~°72 purified on an immunoa~finity column with an 3Q .~nobi?=zed anti-TAG-72 antibody, 372.3 (ATCC 3B°8108y (see EP 3~~277, to Sehiom etal., Vational Cancer institute). Certain CC antibodies were deposited with the ATCC: CC~9 (ATGC No. :.B 9459) CC83 (ATCC No. :iB
~~,53) ~ CC~6 (ATCC No. '~ 958); CC92 (ATCC No. ;iB 9~5~);
CC30 (ATCC N0. B 9~57)a CG11 (ATCC No. a~55) and CCiS
8'IBSl'ITIJTE SHEET

WO 93/I223I ~ ~ ~ ~ ~ ~~ ~ P(:T/AU91/00583 _~_ (ATCC No. HB 9~b0). Jarious antibodies of the CC series have been chimerized (see, for example, EPO 0 3b5 9g7 to ,~ Mezes etal., The Dow Chemical Company) .
It is thus of great interest to develop antibodies against ':AG-72 containing a light and/or heavy chain variable regions) derived from human antibodies. However, the prior art simply does not teach recombinant and immunologic techniques capable of routinely producing an anti-TAG-72 antibody in which the light chain and/or the heavy chain variable regions have specificity and affinity for TAG-72 and which are derived from human sequences so as to elicit expectedly low or no HAMA response. It is known that the function of an immunoglobulin molecule is dependent on its three dimensional structure, which in turn is dependent on its primary amino acid sequence. A change of a few or even . one amino acid can drastically affect the binding function of the antibody can drastically affect its the 20 bidning affinity of the antibody, l.c., the resultant antibodies are generally presumed to be a non-specific immunoglobulin (NSI), l.c.. lacking in antibody character, (see. for example, USP x,816,567 to Cabilly etad., Genentech) .

Surprisingly, the present invention is capable of meeting aany of these above mentioned needs and provides a method for supplying the desired antibodies.

For example, in one aspect, the present invention ~0 provides a cell'capable of expressing a composite antibody having binding specificity for TAG-72, said cell being transformed with (a) a DNA sequence encoding 'l at least a portion pi" a light chain variable region (VL) effectively homologous to the human Subgroup IV germline _ _ '.gene tvum~l VL); and a DNA sequence segment ancoding at ~UBST1TUTE a~-IE~' ;:.. . . ., ~: ,. . . ;:,~ ,, . . . ... .,,.
Wt~ 93/12231 ~ ~ ~ ~ ~ ~ PCT/AU9I/00583 _~_ least a portion of a heavy chain variable region (VH) capable of combining with the VL into a three dimensional structure having the ability to binii tow TAG-72.
In another aspect, the present invention provides a oomposite antibody or antibody having binding specificity for TAG-72, comprising (a) a DNA sequence encoding at least a portion of a light chain (VL) variable region effectively homologous to the human t4 Subgroup IV germline gene (cium4 VL); and a DNA sec_ruence segment encoding at least a portion of a heavy ch2~in variable region (VH) capable of combining with the VL
into a three dimensional structure having the ability to bind TAG-7.
r The invention further includes the aforementioned antibody alone or conjugated to an imagi:~g marker or therapeutic agent. The invention also includes a composition comprising the aforementioned antibody in unconjugated or conjugated form in a .
pharmaceutically acceptable, non-toxic, sterile carrier.
The invention is also directed to a method for 25 in.vivo diagnosis of cancer which comprises administering to an animal containing a tumor expressing TAG-72 a pharmaceutically eff eetive amount of the aforementioned composition for the insatu detection of carcinoma lesions.
. t The ~nvent:on is also directed to a method for intraoperative therapy which comprises (a) administering i to patient containing a tumor expressing TAG-72 a aharmaeeutieally effective amount of the aforementioned suss-rt~ru~ sH~~-composition, whereby the tumor is localized, and (b) excising the localized tumors.
Additionally, the invention also concerns a process for preparing and expressing a composite antibody.
Some of these processes are as follows. A process which comprises transforming a cell with a DNA sequence encoding at least a portion of a light chain variable region (VL) effectively homologous to the human Subgroup IV germline gene (Hum4 VL); and a DNA sequence segment encoding at least a portion of a heavy chain variable region (VH) which is capable of combining with the VL to form a three-dimensional structure having the ability to bind to TAG-72. A process for preparing a composite antibody or antibody which comprises culturing a cell containing a DNA sequence encoding at least a portion of a light chain variable region (VL) effectively homologous to the human Subgroup IV germline gene (Hum4 VL); and a DNA sequence segment encoding at least a portion of a heavy chain variable region (VH) capable of combining with the VL into a three-dimensional structure having the ability to bind to TAG-72 under sufficient conditions for the cell to express the immunoglobulin light chain and immunoglobulin heavy chain. A process for preparing an antibody conjugate comprising contacting the aforementioned antibody or antibody with an imaging marker or therapeutic agent.
In another aspect, the invention provides a Hum4 VL, VH antibody or an antigen-binding fragment thereof which specifically binds to TAG-72 antigen, said antibody fragment comprising at least one light chain variable region (VL) and at least one heavy chain variable region (VH), wherein (a) the VL is a human kappa Subgroup IV VL containing the human Subgroup IV germline gene (Hum4VL) amino acid sequence, 6 II II, ( ~~

7a Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and (b) the VH is an anti-TAG-72 VH encoded by a DNA coding sequence encoding, as said VH, at least the heavy chain variable region of an antibody which specifically binds TAG-72 antigen, said coding sequence being at least 90%
homologous to the VHaTAG germline gene (VHaTAG) coding sequence; and the VH is capable of combining with the VL to form a three dimensional structure having the ability to specifically bind TAG-72 antigen.
In another aspect, the invention provides a Hum4 VL, VH single chain antibody or an antigen-binding fragment thereof which specifically binds to TAG-72 antigen, said antibody or fragment comprising (a) at least one light chain having a variable region (VL), said VL being a human kappa Subgroup IV VL containing the human Subgroup IV germline gene (Hum4 VL) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;

I'~~~ ~d w 1I I i1 ~ I

7b and (b) at least one heavy chain having a variable region (VH), said VH being an anti-TAG-72 VH encoded by a DNA coding sequence encoding, as said VH, at least the heavy chain variable region of an antibody which specifically binds TAG-72 antigen, said coding sequence being at least 90%
homologous to the VHaTAG germline gene (VHaTAG) coding sequence; and at least one polypeptide linker linking the VH
and VL, wherein the VH is capable of combining with the VL to form a three-dimensional structure having the ability to bind TAG-72 antigen and the polypeptide linker allows the proper folding of the VH and VL into a single chain antibody which is capable of forming said three dimensional structure.
In another aspect, the invention provides a Hum4 VL, VH antibody conjugate comprising the Hum4 VL, VH antibody or fragment thereof as described above conjugated to an imaging marker or therapeutic agent.
In another aspect, the invention provides a cell capable of expressing a Hum4 VL, VH antibody or antigen-binding antibody fragment having binding affinity for TAG-72 antigen, said antibody or fragment comprising at least one light chain variable region (VL) and at least one heavy chain variable region (VH) , wherein (A) the VL is a human kappa Subgroup IV VL containing the human Subgroup IV germline gene (Hum4 VL) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala i . ,ri n ~ i 7c Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and (B) the VH is an anti-TAG-72 VH encoded by a DNA coding sequence encoding, as said VH, at least the heavy chain variable region of an antibody which specifically binds TAG-72 antigen, said coding sequence being at least 90%
homologous to said VHaTAG germline gene coding sequence, said VH being capable of combining with said VL to form a three-dimensional structure having the ability to specifically bind TAG-72 antigen; said cell being transformed with (C) a first DNA sequence encoding said VL; and (D) a second DNA
sequence encoding said VH.
In another aspect, the invention provides a process for producing a Hum4 VL, VH antibody or antibody fragment having binding affinity for TAG-72 antigen, said fragment comprising at least the variable domains of the antibody's heavy and light chains, in a single host cell, the process comprising the steps of: (A) transforming at least one host cell with (i) a first DNA sequence encoding a human kappa Subgroup IV light chain variable region (VL) containing the human Subgroup IV germline gene (Hum4 VL) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys, and ii) a second DNA sequence encoding an anti-TAG-72 heavy chain variable region (VH) which is capable of combining with II II FI I I

7d the VL to form a three-dimensional structure having the ability to bind TAG-72 antigen, the coding sequence thereof being at least 90~ homologous to the VHaTAG germline gene (VHaTAG) coding sequence and (B) independently expressing said first DNA sequence and said second DNA sequence in said transformed host cell.
In another aspect, the invention provides a process for preparing an antibody or antibody fragment conjugate which comprises contacting with an imaging marker or therapeutic agent: a Hum4 VL, VH antibody or antibody fragment having binding affinity for TAG-72 antigen and comprising at least one light chain variable region (VL) and at least one heavy chain variable region (VH) wherein (A) the VL is a human kappa Subgroup IV VL containing the human Subgroup IV germline gene (Hum4 VL) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and (B) the VH is an anti-TAG-72 VH encoded by a DNA coding sequence encoding, as said VH at least the heavy chain variable region of an antibody which specifically binds TAG-72 antigen, said coding sequence being at least 90%
homologous to said VHaTAG germline gene coding sequence, said VH being capable of combining with said VL to form a three-dimensional structure having the ability to specifically bind TAG-72 antigen.

7e Description of the Drawings Figure 1 illustrates a basic immunoglobulin structure.

31 ~~~~~'~~-~
WO 93!I22 PGTlAU91/005&3 _s~_ Figure 2 illustrates the nucleotide sequences of VHca'fAG, CC~6 VH, CC~+9 VH, CC83 VH and CC92 VH.
...
Figure 3 illustrates the amino acid sequences of VHccTAG, CC~6 VH, CC~l9 VHF CC83 VH and CC92 VH. :.
Figure ~ illustrates the VH nucleotide and amino acid sequences of antibody B17X2.
Figure 5 illustrates the mouse germline J-H
genes from pNP9.
Figure 6 illustrates the plasmid map oi" p~9 g1-2.3.
Figure T illustrates the plasmid map of p83 g1-i5 2,3~
Figure $ illustrates the entire sequence of HUMVL ( -~ ) and HUMVL ( - ) .
Figure 9 illustrates the human J~1 ( HJ~4 ~
nucleotide sequence and amino acid sequence.
Figure t0 illustrates the nucleotide sequences, and the amino acid sequences of Hump VL, Clad-HindIII
segment.
Figure 11 illustrates a schematic representa-Lion of the human germline Subgroup IV VL gene (fium~ VL), as the target for the PCR.
", figure 12 shows the results of agarose gel electrophoresis of the PCR reaction to obtain the Hump VL gene.
Figure 13 illustrates the restriction enzyme map of pRL1000, and precursor plasmids pSV2neo, SUBSTITUTE SHEET

WO 93/12231. ~ ~ ~ ~ Q 1~1 ~ PGT/AiJ91 /0U583 _o_ s pSV2neo-101 and pSV2neo-102. "7C°° indicates where the HindIII site of pSV2neo has been destroyed.
Figure 1u illustrates a polylinker segment made by synthesizing two oligonucieotides: CH(+) and CH(-):
Figure 15 illustrates a primer, NE0102SEQ, used for sequencing plasmid DNA from several clones of pSV2neo-102.
Figure 16 illustrates an autoradiogram depicting the DNA sequence of the polylinker region in oSV2neo-102.
Figure 17 illustrates a partial nucleotide sequence segment of pRL1000.
Figure 18 illustrates the restriction enzyme map of pRL1001.
Figure 19 illustrates an autoradiogram of DNA
sequence for pRL1001 clones.
Figure 20 illustrates a competition assay for binding to TAG-using a composite Hump V~,, VHaTAG
antibody.
Figure 21 illustrates a general DNA
construction of a single chain, composite Hump VL, VHaTAG.
Figure 22 illustrates the nucleotide sequence and amino acid sequence of SCFV1.
Figure 23 shows the construction of plasmid pCGS515/SCFV1. .
su~s-rtTU-r~ s~E~-p~7('/AU91/00583 WCs 93/12231 ~1~~~~~
_.a_ Figure 2~ shows the construction of plasmid pSCFV31 .
w r Figure 25 shows the construction of E. cola SCFV expression plasmids containing ~ium~ VL. - __ Figure 26 shows the DNA sequence and amino acid sequence of Hump VL°CC~49UH SCFV present in pSCFVUHH.
Figure 27 shOWS the construction plasmid pSCFV
ID UHH and a schematic of a combinatorial library of Vg genes c~ith Fium~+ VL
Figure 28 illustrates the nucleotide sequence of FLAG peptide adapter in pATDFLAG.
1~ Figure 29 illustrates the construction of pATDFLAG, pHumVL~HumVH (X) and pSC~9FLAG.
Figure 34 illustrates the nucleotide and amino acid sequences of pSC~49FLAG.
Detailed Deserintion of the Invention Nucleic acids, amino acids, peptides, protective groups, active groups and so on, when abbreviated, are abbreviated according to the IUPAC IUH
(Commission on Biological Nomenclature) or the practice in the ffields concerned.
The basic immunogiobulin structural unit is set forth in Figurw 1: T_h.e't~rms "constant" and "variable"
I'he variable regions of both are used =unctionally.
light (VL) and heavy (?H) chains determine binding recognition and specificity to the antigen. '~'he constant region domains of light (CL) and heavy (Cg) chains confer -important biological properties such as SiU~S'fl'tU'T~ S1~EE'r ~VU 93/12231 PCf/AU91/00583 -11~
antibody chain association, secretion, transplacental mobility, complement binding, binding to Fc receptors and the like. .
v The immunoglobulins of this invention have been developed to address the problems of the priar art. The methods of this invention produce, and the invention is directed to, composite antibodies. By "composite antibodies" is meant immunoglobulins comprising variable regions not hitherto found associated with each other in 1d nature. gy, "composite Hump VL, VH antibody" means an antibody or immunoreactive fragment thereof' which is characterized by having at least a portion of the VL
region encoded by DNA derived from the Hum4 VL germline gene and at least a portion of a VH region capable of combining with the Vi, to form a three dimensional structure having the ability to bind to TAG-72.
The composite Hum~l VL, VH antibodies of the 2G present invention assume a conformation having an antigen binding site which binds specifically and with sufficient strength to TAG-72 to form a complex capable of being isolated by using standard assay technicxues (e. g., enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or flourescence-activated cell sorter analysis (xAGS), immunohistochemistry and the like). Preferably, the composite Hump 'IL, VH antibodies . of ;he present invention have an antigen binding afF.inity or avidity greater than lOs M°l, more preTerably greater tzan;106 M'1 and most preferably greater than 108 M°l. :or a discussion of the techniques for generating and reviewing irlmunoglobuiin "' binding affinities see Munson ( 1983) , Methods ~.:~zmmol . , SUBSTITUTE ~H~ET

WO 93/12231 ~ ~ ~ ~- ~ ~'~ 1 P~'/A.1191/~QS83 _12-92;543-577 and Scatchard (1949), Ann. N.Y. Acad. Sci., 51:660-672.
r Human antibody kappa chains have been classified into four subgroups on the basis of 'invariant w amino acid sequences (see, for example, Kabat etal.
(1991), Seauences of Proteins of ImmunoloRical Interest {4th ed.), published by The U.S. Department of Health and Human Services). There appear to be approximately 80 human VK genes, but only one Subgroup IV VK gene has been identified in the human genome (see Klobeck, etal.
(1985), Nucleic Acids Research, 13:6516-6528). The nucleotide sequence of Hump! VL is set forth in Kabat et al. ( 1 X91 ) ~ supra; and Wang et a1. ( 19T3 ) 9 Nature , 243 : 126-12T.
Tt has been found, quite surprisingly, that an immunoglobulin having a light chain with at least a portion of the VL encoded by a gene derived from Hum4 V~, may, if combined with a suitable VH, have binding specificity for TAG-72.
The type of JL gene segment selected is not critical to the invention, in that it is expected that ~ 25 ,any JL' if present, can associate with the Hum4 VL. The present invention obviously contemplates the Hum4 VL in association with a human Jx sequence. The five human Jx sequences are set forth in Heiter et at. C 1982) , The _Journal oL Biological Che:nistrv_, 357:1516-1522.
however; the present inver:tion is not intended to be , Limited to the human JK. The present invention specifically contemplates the Hum4 VL in association :with any of the at Least six human JZ genes fsee Hoilis etal. {1982), Nature, 296:321-325).
SUBS'T1TU'~E SHEF'~' ,~ . : .' :. ,. - .. , : ' . ~ . : ;. , ,,.. , , . .
WO 93/12231 ~ ~ ~ ~ f~ ~~ ~ PCT/AU91/00583 An exemplary technique for engineering the Hump VL with selected JL segments includes synthesizing a primer having a so-called "wagging tail°', that ~daes not hybridize with the target DNA; thereafter, the sequences are amniified and spliced together by overlap extension ( see Norton st al. ( 19$9 ) , Gene, "T7: 61-68 ) .
The CL of the composite Hump U~,, VH antibodies is not critical to the invention. To date, the Hum4 UL
has only been reported as having been naturally rearranged with the single Ck gene (see Heiter ~tal.
(7980). Cell, 22:197-207). However, the present invention is not intended to be limited to the CK light chain constant domain. That is, the CL gene segment may ~ aiso be any of the at least six C~ genes (see Hollis et al. , supra ) .
The DNA encoding the heavy chain variable region consists roughly of a heavy chain variable ('JH) gene sequence, a heavy chain diversity (DH) gene sequence, and a heavy chain joining (JH) gene sequence.
;.
The present invention is directed to any VH
capable of combining with a light chain variable region effectively homologous to the light chain variable region encoded by the human Subgroup IV germline gene, to form a three dimensional structure having the ability to bind to TAG-72.
The choice o~ heavy chain diversity (DH) segment and the hleavy chain joining (JH) segment of the x i composite Hump VL, fH antibody are not critical to the f- ~, ~~''' a . , present invention. Obviously, human and marine DH and JH gene segments are contemplated, provided that a given E combination does not significantly decrease binding to SU~STtTUTE SHEET

WO 931x2231 PGT/AU91 /OOS8~
TAG-72. Specifically, when utilizing CC46 VH, CC49 VH, CC83 VH and CC92 VH, the composite Hump UL, VH antibody will, be designed to utilize the DH and JH segments~which -"
naturally associated with those VH of the respective hybridomas (see Figures 2 and 3)~ Exemplary murine and .human DH and JH sequences are set forth in Kabat etal.
(1991), supra. An exemplary technique for engineering such selected DH and JH segments with a VH sequence of choice includes synthesizing selected oligonucleotides, annealing and ligating in a cloning procedure (see, Horton etal., supra) .
In a specific embodiment the composite Hum4 Vr, VH antibody will be a ''composite Hum4 VL, VHaTAG
~5 antibody", means an antibody or immunoreaetive t''ragment thereof which is characterized by having at least a Dortion of the VL region encoded by DNA derived from the Hump VL ger~aline gene and at Ieast a portion of the VH
region encoded by DNA derived from the VHaTAG germline 20 gene, which is known in the art (see, for example, EPO 0 365 997 to Mezes etal., the Dow Chemical Company) .
Figure 2 shows the nucleotide sequence of VHaTAG, and the nueleatide sequences encoding the VH of the CC46.
CC~9, CC83 and CC92 antibodies, respectively. Figure 3 25 shows the corresponding amino acid sequences of 'JHaTAG, CC~l6 VH, CC49 VH,. CC83 VH and CC92 VH.
A comparison of the nucleotide and amino acid sequences of V~aTAG, CC~6 VH, CC~9 VH, CC83 VH and CC92 'JH shows that those CC'antibodies are derived °rom '~
VHaTAG. Somatic mutations occurring during productive r~earrangea~ent of the Vg derived from VHaTAG in a 9 cell gave rise to soave n~,xcleotide changes that may or may not SUSST1TUTE SHEET' WO 93/1Z231 ~ ~ ? ~; ~ '~ ~ PGT/AU91/OOS83 -15_ result in a homolagous amino acid change between the productively rearranged hybridamas (see, EP0 0 365 997).
M
Because the nucleotide sequences of UHa.TAG and Hum~4 V~, germline genes have been provided herein, the ' 5 present invention is intended to include other antibody genes which are productively rearranged from the VHaTAG
germline gene. Other antibodies encoded by DNA derived from VHaTAG may be identified by using a hybridixation probe made from the DNA or RNA of the VHaTAG or rearranged genes containing the recombined VH~xTAG.
Specifically, the probe will. include of all or a part of the VHaTAG germline gene and its flanking regions. Hy "flanking regions" is meant to include those DNA
sequences from the 5' end or the VHaTAG to the 3' end of the upstream gene, and from 3' end of the VHaTAG to the 5' end of the downstream gene.
The CDR from the variable region of antibodies derived from VHcsTAG may be grafted onto the c R of selected Vg, i.e., FR of a human antibody (see ~PO 0 239 X00 to Winter). For example, the cell line, B17X2, expresses an antibody utilizing a variable light chain encoded ~y a gene derived from Humid UL and a variable heavy chain which makes a stable VL and VH combination (see Marsh eta.l. (1985), Nueleie Acids Research, 13s6531-65~~; and Polke eta~. (1982), immunobiol. 163:95-109.
The~nucleotide sequence of the VH chain for 817X2 is shown in. Figure 4. The 317X2 cell line is publicly available. from Dr~. Christine Polke. Universitats-Kin.derklinik, Josef-Schne.ider-Str. 2, 8700 Wurzburg, FRG). .817X2 is directed to N-Acetyl-D-Glueosamine and is not specific far TAG-72.
BUBS'i'1TU'f~ SHEE'f p(: f/A.U91 /00583 2~ ~~~~~~

However, consensus sequences of antibody derived from the CDR1 of UHaTAG (amino acid residues 31 to 35 of Figure 3) may be inserted into B17X2 (amino ' acid residues 31 to 37 of Figure ~) and the CDR2 of VgaTAG (amino residues 50 to 65 of Figure 3) may be '' inserted into a17x2 (amino acid residues 52 to 67 of Figure ~+). The CDR3 may be replaced by any DH and JH
sequence which does not affect the binding of the antibody for TAG-72 but, specifically, may be replaced by the CDR3 of an antibody having its VH derived from VgaTAG, e.g., CC~6, CC49, CC83 and CC92. Exemplary techniques far such repiacer~ent are set forth in Horton et czl. ,. Supra .
z5 The CH domains of immunoglobulin heavy chain derived from VHaTAG genes, for example may be changed to a human sequence by known techniques (see, JSP 4,81&,567 to Cabilly, Genentech). Cg domains may be of various complete or shortened human isotypes, i.e., IgG (e. g., IgG', IgG2, IgG3, and IgG~), IgA (e. g., IgA1 and IgA2), IgD, IgE, IgM, as well as the various allotypes of the individual groups (see Kabat et at. ( 199 ~ ) , supra ) .
Given the teachings oz" the present invention, it should be apparent to the skilled artisan that human ttg genes can be tested for their ability to produce an anti-TAG-72 immunoglobiiin combination with whe Hump VL
gene. The VL may be used to isolate a gene encoding for a VH having the ability ,to bind to TAG-72 to test myriad combinations of Hump V~, and VH that may not ~ :aturally occur in nature, e.g., by generating a combinatorial library using the Hum~1 ~TL gene to select a suitable VH.
Examples oz" these enabling technologies include screening of combinatorial =ibraries of 7L-fiH
combinations using an Fab or single chain antibody suss~'-ru~ s~~~r WO 93/12231 ~, ~ ~ ~ ~ i". ~ Pd:T/AU91/00583 _ 17_ (SCFV) format expressed on the surfaces or' fd phage (Clackson, etal. (1991), Nature, 352:624-628), or using a .~ phage system for expression of Fv's or Fabs (Hose, et a al. (1989), Seienee, 246:1275-1281). However, according to the teachings set forth herein, it is now possible to a C
J clone SCFV antibodies in E. coli, and express the SCFVs as secreted' soluble proteins. SCFV proteins produced in E.
coli that contain a Hum4 V~, gene can be screened for binding to TAG-72 using, for example, a two-membrane filter screening system (Skerra, etel. (1991), Anaivtical Hioehemistrv, 196:151-155).
The desired gene repertoire can be isolated from human genetic material obtained from any suitable Z5 source, e.g., peripheral blood lymphocytes, spleen cells and lymph nodes of a patient with tumor expressing TAG-72. In some cases, it is desirable to bias the repertoire for a preselected activity, such as by using as a s~urce of nucleic acid, cells (source cells) from vertebrates in any one of various stages of age, health and immune response.
Cells coding for the desired sequence may be isolated, and genomic DNA fragmented by one or more restriction enzymes. Tissue (e.g., primary and secondary lymph organs, neoplastic tissue, white blood cells ~rom peripheral blood and hybridomas) from an animal exposed to TAG-72 may be probed for selected antibody producing B cells. Variability among 3 cells derived from a common~germline gene :nay result from somatic mutations occurring during productive rearrangement.
Generally, a probe made from the genomic ANA of a germline gene or rearranged gene can be used ay t:-pose SUBSTITUTE SHEET

~:.lw' . , . , ' , ' ' -1$-P(~f/AU91/00~83 skilled in the art to find homologous sequences from unknown cells. For example, sequence infor~aation obtained from Hum~# V~, and VHaTAG may be used to generate hybridization probes for naturally-occurring rearranged V regions, including the 5' and 3' nontranslated flanking regions. The genomic DNA may include naturally-occurring introns for portions thereof, provided that functional splice donor and splice acceptor regions had been present in the case of 1G mammalian cell sources.
Additionally, the DNA may also be obtained from a eDNA library. mRNA coding f or heavy or light chain variable domain may be isolated from a suitable source, 17, either mature B cells or a hybridoma culture, employing standard techniques of RNA isolation. The DNA or amino acids also may be syntheticall~r synthesized and constructed by standard techniques of annealing and ligating fragments (see Jones, etal. (1986), Nature, 20 321:522-525; Reichmann etal., (1988), Nature, 332:323-327; Sambrook et at. (1989), supra and Merrifield et al.
(j963), J. Amer. Chem. Soc., 85:219-2150 . ~ieavy and light chains may be combined in vitro to gain antibody activity (see Edelman, efal. (1963), Proc. Natl. Acad.
25 Sci . ETSA, 50: 753) The present invention also contemplates a gene library of VgaTAG homologs, preferably human homologs of vHafiAG, By "homolog" is meant a gene coding for a VH
JG region (not necessar~.ly ,deri ved from, or e~ren effectively homologous ~o, the VHaTAG germline gene) s capable of combining with a light chain variable region ' effectively homologous to the ?ight chain variable region encoded by the human Subgroup IV germline gene.
SUBSTITUTE S!-~EET

r4 WO 93/I2231 PCTlAU91/005~3 to form a three dimensional structure having the ability to bind to TAG-72.
Preferably, the gene library is produoed~by a primer extension reaction or cambination of primer extension reactions as described herein. The tIHaTAG
homologs are preferably in an isolated form, that is, substantially free of materials such as, for example, primer extension reaction agents andlor substrates, genomic DNA segments, and the like. The present invention thus is directed to cloning the VHaTAG-coding DNA homologs from a repertoire comprised of polynucleo-tide coding strands, such as genomic material containing the gene expressing the variable region or the messenger RNA (mRNA) which represents a transcript of the variable region. Nucleic acids coding for UHaTAG-coding homologs can be derived from cells producing IgA, igD, Ig~, IgG
or IgM, most preferably from IgM and IgG, producing cells.
The vgaTAG-coding DNA h~mologs may be produced by primer extension. The term "primer" as used herein refers to a polynueleotide whether pirified from a nucleic acid restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complimentary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymer-3G ization such as DNA polymerase, reverse transcr:.ptase and the like, and at a suitable temoerat;are and aH.
Preferably, the ~lrinTAG-ceding DNA r.omologs may be produced by polymerise chain reac~:.on (PCR) amplifi-c.a~ion~of double stranded genomic or cDNA, ;wherein two SUBSTITUTE SHEET

_20~

primers are used for each coding serand of nucleic acid to be exponentially amplified. ~_'he first primer becomes part of the nonsense (minus or complementary) strand and hybridizes to a nucleotide sequence conserved among Va (plus) strands within the repertoire. PCR is described in Mullis etal. (1987), Meth. Gnz., 155:335-350; and PCR
Technology, Erlich (ed.) (1989). PCR amplification of the mRNA from antibody-producing cells fs set forth in Orlandi et al. ( 1989) . Prac. Natl. Aced. Sci. . USA, 86:3387-3837.
According to a pref erred method, the VgaTAG-coding DNA homologs are connected nia linker to form a SCFV hav~.ng a three dimensional structure capable of 15 binding TAG-72. The SCFV construct can be in a Vr_,-L-'IR
or Vg-~-U'~, configuration. ~'or a discussion of SCFV see Bird etal. -(1958). Science, 242:423-426. The design of suitable peptide ?inker regions is described in U.S.
Patent No. 4,704,692 to Ladner etal.. Genex.
The nucleotide sequence of a primer is selected to hybridize with a plurality of '_mmunogiobulin heavy chain genes at a site substantially adjacent to the a; VgaTAG-coding DNA homolog so that a nucleotide seq'sence 25 coding for a functional (capable of binding) polygeptide is obtained. The choice of a primer's nucleotide sequence depends on factors such as the distance on the nucleic acid from the region coding for ~he desired a receptor. its hybridization site on the nucleic acid 30 relat~.ve to any '~secor~d~~ primer to be used, .the number ; of genes in the repertoire it is to hybridize to, and the like. To hybridize to a pluralit:r of different nucleic a acid strands of VKaTAG-cods..~.g DNA homolog, the primer SUBSTITUTE SHEET' i~'~.l 93/12231 P~:T/A1J91 /00583 must be a substantial complement of a nucleotide sequence conserved among the different strands.
..,.
The peptide linker may be coded for by the nucleic acid sequences that are part of the poly-.5 nucleotide primers used to prepare the various gene libraries. The nucleic acid sequence coding for the ' peptide linker can be made up or nucleic acids attached to one of the primers or the nucleic acid sequence coding for the peptide linker may be derived from nucleic acid sequences that are attached to several polynucleotide primers used to create the gene libraries. Additionally, noncomplementary bases or longer sequences can be interspersed into the primer, 15 provided the primer sequence has sufficient complemen-tarily with the sequence oz' the strand to be synthesized or amplified to non-randomly hybridize therewith and thereby form an extension product under polynucleotide ' synthesizing conditions (see Horton etal. (1989), Gene, 20 77:61-68~.

Exemplary human t1H sequences from which complementary primers may be synthesized a~e set forth in Kabat et al. ( 1991 ? , supra:
Humphries et al. ( 1988 ) .
, 25 Nature, 331r446-449: Sdhroeder etal. (i990), Proe. Natl.

Acad. Sci . USA, 87:6 i46-6150; German et al. ( 1988 ) , EMBO

,Journal, 7:727-738: Lee stal. ( 1987), ~1. Mol. 3iol. , 1'95:7fi 1-768) ; Marks et al. ( 7991 ) , Eur. ,; , immunol . , 21:985-991; Wille~s, etal. (1991), ,1. Immunol., 146:3646-3651 ; and Person et al. (r1991' ) Proc' Natl Acad Sci SSA

, .
.
.
, 8~8:~432-2436. To produce V~ coding DNA homologs. irst primer's are therefore chosen to hybridize to (l.c. be ' e complementary to) conserved :egions within the ~ region, CHl reg~.on~ hinge region, CH2 region, or CH3 region of immunogl.obulin genes and =:ne like. Second priers are SUBSTITUTE SHBB't' BYO 9311ZZ31 PCT/AU9110~583 ~1~~.~ ~ ~.
therefore chosen to hydribinize with a conserved nucleotide sequence at the 5' end of the ONaTAG-coning DNA homolog such as is that area coding for the' leader or first framework region.
Alternativellr, the nucleic acid sequences coding for the peptide linker may be designed as part of a suitable vector. As used herein, the term "expression vector" refers to a nucleic acid molecule capable of directing the expression of genes to which they are 1C operatively linked. The choice of vector to which a ~THaTAG-coding DNA homologs is operatively linked depends directly, as is well :cnown in the art, on the functional properties desired, e.~., replication or protein expression, and the host cell (either procaryotie or euearyotic) to be Transformed, these being limitations inherent in the art pt" constructing recombinant DNA
molecules. In preferred embodiments, the eucaryotic cell expression vectors used ineiude a selection marker 20 that is effective in an eucaryotic cell, preferably 3 drug resistant selection marker.
~xpressian rectors compatible with proearyotic t cells are well known in the art and are available from 25 several commercial sources. Typical of vector plasmids suitable for procar~rotic cells are pUC8, pUC9, gBA322.
and pBR329 available :rpm 3ioRad Laboratories, (Richmond, CA), and pPL and pi~K223 available from Pharmacies, (Piscataway, :~J) .
x expression nec"ors compatiole with aucaryot..c cells, preferably those compatible with vertebrate ce?ls, can also be used. ~ucaryotic cell oxprassion vectors are well known .n the art and are aYaii2ble from several commere=al sources. =ypically, such vectors are sues-rtTU-rE sH~~r WO 93!12231 '~ ~ ; '; r - PCTlAU91/0~583 YJ ~ ~~J ~..n -?3-provided containing convenient restriction sites for insertion of the desired DNA homologue. Typical of vector plasmids suitable for eucaryotic cells are.M
b pSV2neo and pSV2gpt (ATCC), pSVL and pKSV-10 (Pharmacia), pBPU~1/PML2d (International Bioteehnolo~gies, Ine.), and pTDT1 (ATCC).
The use of viral expression vectors to express the genes of the vHaTAG-coding DNA homologs is also contemplated. As used herein, the term "viral expression vector" refers to a DNA molecule that includes a promoter sequences derived from the long terminal repeat (LTR) region of a viral genome.
Exemplary phage include a phage and fd phage (see, Sambrook, etut. (1989), Molecular Cloning: A Laborator~t Manual . ( 2nd ed. ) , and MeCaf f erty et at. ( 199~ ) , Mature , s~52-~5~.
The population of VgaTAG-coding DNA homologs and vectors are then cleaved with an endonuclease at shared restriction sites. A variety ox" methods have been developed to operatively link DNA to vectors via complementary eohesivp termini. ror instance, complementary cohesive termini can be engineered into the VgaTAG--coding DNA homologs during the primer extension reaction by use of an appropriately designed poiynucleotide synthesis primer, as previously discussed. The complementary cohesive termini of the - vector and the DNA homolog are then operatively linked (Zigated)~ to produe~ a unitart' double stranded DNA
mo.l.ecule..
- .'he restriction fbagmenzs of Hum~4 VL-coding DNA
.and t he VHaTAG-coding DNA homologs population are ..raa~dom?y ligated to the cleaved rrector. 3 diverse, ~UBSTiTUTE SHEET

WO 93JI2231 ~ ~ ~ ~ ~ ~ ~ PCClAU91/OU583 _2t~_ random population is produced with each vector having a ~lgaTAG-coding DNA homolog and Hum~4 UL-coding DNA located in the sane reading frame and under the control of"the vector's promoter.
The resulting single chain construct is then introduced into an appropriate host to provide amplifi-cation and/or expression of a composite Hum4 VL, iTHaTAG
homolog single chain antibody. Transformation of appropriate cell hosts with a recombinant DNA molecule 1C of the present invention is accomplished by method s that typically depend on the type of vector used. With regard to transz'ormation of procaryotic host cells, see, for example. Cohen et aI. ( 1972 ) , Proceedinr~s National Aeademv of Science. USA. 69:2110; and Sambrook, efal.
C1989), supra. ~Jith regard to the transformation oz' vertebrate cells with retroviral vectors containing rDNAs, see for example. Sorge efal. (i98~), Mol. Cell.
Biol . , ~l :1730-1737; Graham et a1. ( 1973 ) , Virol. , 52: 456 ;
and Wigler eful. (1979), Proceedina;s National Academv of Sciences. ~SA,76:1373-1376.
Exemplary prokaryotic strains that may be used as . hosts include ~. cali. Bacilli, and other antero-bacteri aceae such as Salmonella fypF~imurium, and various Pseudamonas. Common eukaryotic microbes include S.
cerer~isiae and Piehia pastaris. Common higher eukaryotie host cells include Sp2/a, UERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, 3HK, COS-T and 3d MDCK cell ? fines. ~ ~ urthermore. it i s now ai'so e~rident that any cell 1?ne producing Hum4 UL, e.g., the 817X2 human cell line, can be used as a.recipient human cell ? fine for i.~.troduction of a VH gene complementary to the 3um~ jfL which allows binding to ':AG-72. :or example.
the 3 iTX2 heavy chain may be genet=call; modii'ied to zot SUBSTITUTE SHEET

WO 93/I2231 '~ ~ ~ 1 ~ '~ ~ PCT/AU91 /0583 _?~_ produce the endogenous heavy chain by well known methods; in this way, glycosylation patterns of the antibody produced would be human and not non-human derived.
'' S Successfully transformed cells, i.e., cells containing a gene encoding a composite Hum4 VL, VHaTAG

homolog single chain antibody operatively linked to a vector, can be identified by any suitable well known technique far detecting the binding of a receptor to a 1fl ligand. Preferred screening assays are those whers the binding of the composite Hum~4 VL, VHaTAG homolog single chain antibody to TAG-?2 produces a detectable signal, either directly or indirectly. Screening for productive 15 Hump VL and VHaTAG homoiog combinations, or in other words, tasting for effective antigen binding sites to TAG-?2 is possible by using for example, a radiolabeled or biotinylated screening agent, e.g., antigens, anti-bodies (e. g., B?2.3, CC~19, CC83~ CC~6, CC92, CC30, CC1.1 20 and CClS) or anti-idiotypie antibodies (see Huse et~al., supra, and Sambraok etal., supra) ; or the use of marker peptides to the NFi2- or COOH-terminus of the SCFV

construct (see Hopp etal. (1988). Siotechnolo~y, 6:',20~-1210 ) .

Of course, the Hum4 VL-coding DNA and the VHaTAG-coding DNA homologs may be expressed as individual polypeptide chains (e. g.. Fv) or with whole or fragmented constant regions (e. g., Fab, and Flab) ~).

30 _ Aecordirigly, the' aum~ 7~,--ending DNA and the JHaTAG-codi,rg DNA homologs may be individually inserted ..~.~o a Factor containing a CL or CH or fragment thereof, resge.ct~~~ely. rr~or a teaching or 'sow to prepare suitable SUBST1T'UT~E S!-IEE'T' WO 93/12231 ~ ~ ~ ~' ~ L~ ~ PCT/A.U91/OOS83 .?6_ vectors see EPO Q 365 997 to Mezes et al., The Dow Chemical Company.
a .,. .
DNA sequences encoding the light chain and heavy chain or" the composite ~ium~ VL, VH antibody may be inserted into separate expression vehicles, or into the same expression vehicle. When coexpressed within the same organism, either on the same or the different veetors, a functionally active Fv is produced. When the VHaTAG~°coding DNA homolog and Hump tIL polypeptides are '~ expressed in different organisms, the respective polypeptides are isolated and then combined in an appropriate medium to F"ora a Fv. See Greene etal.9.
Methods in Molecular 3iolo~y, Vol. 9, Wickner etal.
.~ 5 ( ed . ) ; and Sambrook et al. , supra ) .
Subsequent recombinations can be effected through cleavage and removal of the Hum~+ Vr-coding DNA
secauence to use the VHaTAG-coding DNA aomologs to 2G .produce hump VL-coding DNA homologs. '~o produce a ~ium~4 - Vl,-coding DNA homolog, first primers are chosen to hybridize with (i.e. be complementary co) a conserved region within the J'region or constant region of immunoglobulin light czain genes and the ?ike. Second 25 primers become part of the coding (plus) strand and hybridize to a nucleotide secruence~ conserved among minus strands. Hump VE-coding DNA homologs are 'iigated into the vector containing she VHaTAG-coding DNA homolog, Thereby creating a second population of expression vectors.' 'Fhe present _avenbion thus is di~eeted to cloning the Hum~t 7L-coding DNA homalogs from a repertoire comprised os polynucleotide coding strands, ~ ' such as genomie mateHial containing the gene expressing the ~:ar=able region or the messenger RNA (mRNA) which represents a transcript of the variable region. =t is ~U~STI'~'IJTE SHEET

WO 93112231 ~ ' ~- P~,'f/A~J91/005g3 thus possible to use an iterative process to define yet further, composite antibodies, using later generation v~raTAG-coding DNA homologs and Hum~l UL-coding DNA.
homologs.
The present invention further contemalates genetically modifying the antibody variable and constant regions to include effectively homolagous variable region and constant region amino acid sequences.
Generally, changes ~z the variable region will be made in order to improve or otherwise modify antigen minding properties of the receptor. Changes in the constant regian of the antigen receptor will, in general, be made in order to improve or otherwise modify biological propertees, such as complement Lixation, interaction with r~emnranes, and other effector cunctions.
"Effectively homologous" refers to the concept that differences in the primary structure of the zQ . variable region may not alter the binding . characteristics of the antigen receptor. Normally, a DNA sequence is effectively homologous to a second DNA
sequence if at least 70 percent, preferably at least 30 percent, and most preferably at least ~0 percent of the active portions of the DNA sequence are homologous.
Such changes are permissable in effectively homologous amino acid sequences so long as the resultant antigen receptor retains its desired property.
?!3 If there, is on:l.y a conservative difference between zomologous positions of sequences, they may be regarded as equivalents under certain circumstances.
General categories of potentially equivalent amino acids are set forth below, wherein, amino acids within a group may be suDStituted .or other amino acids in that group:

WO X3/12231 ~ ~ ~ ~ ~' J" 1 PGT/AU91100583 (1) glutamie acid and aspartie acid; (2) hydrophobic amino acids such as alanine, valine, leucine and isoleucine; (3) asparagine and glutamine; (~4) lysine, arginine; and C5) threonine and serine.
Exemplary techniques for nucleotide replacement include the addition, deletion, or substitution of various nucleotides, deletion or substitution of various nucleotides, provided that the proper reading frame is maintained. Exemplary techniques include using polynucleotide-mediated, site-directed mutagenesis, l.c., using a single strand as a template f or extension of the oligonucleotide to produce a strand containing the mutation (see Zoller etal. f19$2), Nuc. Acids Res., ,0:6~$?-6500; Norris et al. (19$3), Nuc. Acids Res., 1'i:5103-5172; Zoller et al. (19$u), DNA9 3~~?9-~$8!
a Kramer etal. (19$2), Nuc. Acids Res., 10:675-685 and palymerase chain reaction, l.c., exponentially amplifying DNA in vitro using sequence specified oligo-20 nucleotides to incorporate selected changes (see PCR
Technolo~y: Principles and Applications for DNA
Amplification, Erlich, (ed.) (19$9~~ and Horton etal.
suFra ) .
25 Further, the antibodies may have their constant region domain modified, lc., the CL, CHI, hinge, CH2, CH3 and/or CHI domains of an antibody polypeptide chain may be deleted, inserted or changed (see :.PO 3Z7~ 37$ A1 to Morrison etal., the TrusteES of Columbia University;
USP =~,f~~'2.33~ to ~Moore fetal.,. DNAX: and USP '4.04.692 to Ladner et al., Genex ) .
Once a final ONA construct is obtained, the composite Hump '~IL, UH antibadies may be produced in large quantities by injecting the host cell into the SUBSTITUTE S~-IEE'r WO 93/12231 ~ ~ '~ ~ '~ ~ PCT/AL191/005~3 -peritoneal, cavity of pristane-primed mice, and after an appropriate time (about 1-2 weeks), harvesting ascites fluid from the mice, which yields a very high t~it.~r of homogeneous composite Hum~4 UL, VH antibodies, and isolating the composite Hump YL, YH antibodies by '' S methods well known in the art (see Stramignoni . et al.

(1983), Intl. J. Cancer, 31:548-552). The host cell are grown anUivo, as tumors in animals, the serum or ascites fluid of which can provide up to about 50 mg/mL of composite Hum~+ VL, Vg antibodies. Usually, injection (preferabl.y intraperitoneal) of about 10S to 107 histocompatible host cells into mice or rats will result .in tumor formation after a few weeks. It is possible to obtain the composite c:um~d VL, YH antibodies from a fermentation culture broth of procaryotic and eucaryotic cells, or from inclusion bodies pt'' ~.co~i cells (see Buckholz and Gleeson (1991), BIOTECHNOLOGY, 9:1057-1072. T.he composite Hum~t VL, VH antibodies can then be collected and processed by well-known methods (see generally, Immunolo~ical Methods, vols. I & II, eds.

. Lefkovits, I. and Pernis, B., (1979 & 1981) Academic ?ress, flew York, ~J.Y.: and Handbook of Hxoerimental i~nmunolo~y, ed. ~Jeir, 0. , ( 1978 ) Blackwell Scientif is ubl?eations, St. Louis, M0.) The composite Hump VL, VH antibodies can then be~stored in various buffer solutions such as phosphate . buffered saline (PHS), which gives a generally stable antibody solution for further use.
Uses The composite :ium~4 VL, 'JH antibodies provide snique benefits for use in a variety pi' cancer treat:aents. In addition to the ability to bind SUBSTITUTE SHEET

p~'/A.U91/005~3 WO 93/I223d specifically to malignant cells and to localize tumors and not bind to normal cells such as fibroblasts, endothelial cells, or epithelial cells in the major organs, the composite Hum~+ tIL, vH antibodies may be used to greatly minimize or eliminate ANHA respanses'thereto.
Moreover, TAG-72 contains a variety of epitopes and thus it may be desirable to administer several different composite Hump VL, Vg antibodies which utilize a variety of 1TH in combination with Hump tlL~
SpeBifically, the composite Hum~4 VL, VH
antibodies are useful for, but not limited to, in. a~ivo and in vitro uses in diagnostics, therapy, imaging and biosensors.
~5 The composite Hump 'JL, VH antibodies may be incorporated into a pharmaceutically acceptable, non--to~cie, sterile carrier. Tnjectable compositions of the present invention may be either in suspension or solution form. In solution form the complex (or when desired the separate companents) is dissolved in a pharmaceutically acceptable carrier. Such Barriers comprise a suitable solvent, preservatives such as benzyl alcohol, if needed, and buffers. iJseful solvents include, for example, water. aqueous alcohols, glycols, and phosphonate or carbonate esters. Such aqueous solutions generally contain no more than 50 percent of the organic solvent by volume.
Injectabl,e suspensions require a liquid suspending medium, with or without adjuvants, as a Bzrr_er. 'fhe suspending medium can be, for example, aqueous polyvinyl-pyrroiidone, :pert oils such as vegetable oils or highly refined mineral oils, or aqueous carboxymethlycpllulose. Suitable physio-SUBSTITUTE SHEET

Wfl 93/12~3I ~, ~'GT/AU91/OUS83

-3~-logically-acceptable adjuvants, if necessary to keep the complex in suspension, may be chosen from among thickeners such as carboxymethylcellulose, polyvinyl-pyrrolidone, gelatin, and the alginates. Many, surfactants are also useful as suspending agents, for example, lecithin, alkylphenol, polyethylene oxide adducts, naphthalenesulfonates, alkylbenzenesulfonates, and the polyoxyethylene sorbitan esters. Many substances which effect the hydrophibicity, density, and Surface tension of the liquid suspension medium can assist in making injectable suspensions in individual cases. For example, silicone antifoams, sorbitol, and sugars are all useful suspending agents.
Methods of preparing and administering conjugates of the composite Hum~4 VL, VH antibody, and a therapeutic agent are well known to or readily determined. Moreover, suitable dosages will depend on the age and weight of the patient and the therapeutic agent employed and are well known or readily determined.
Conjugates of a composite Hum4 VL, VH antibody and 3n imaging marker may be administered in a pharma-ceutically effective amount .for the in viuo diagnostic assays of human carcinomas, or metastases thereof, in a patient having a tumor that expresses ':AG-?2 and then detecting the presence of the imaging marker by appropriate detection means.
. Administ~at,ion:and detection of the conjugates of the composite Iium~ VL, VH antebody and an imaging . ~ marker, as well as methods of conjugating the composite Hump VL, VH antibody to the imaging marker are acc~ompl=shed by methods readily known or readily determined. she dosage of such conjugate will vary 3ldBST~TI,BT'E SHEET

WO 93/12231 ~ ~ ~ ~ ~'i PGT/AU91/00583 _32_ depending upon the age and weight of the patient..
Generally, the dosage should be effective to visualize or detect tumor sites, distinct from normal tissues. _ Preferably, a ape-time dosage will be between 0.1 mg to 200 mg of the conjugate of the composite Hum4 tTL anti- , body and imaging marker per patient.
Examples of imaging markers which can be conjugated to the composite Hump VL antibody are well known and include substances which can be detected by diagnostic imaging using a gamma scanner or hand held gamma probe, and substances which can be detected by nuclear magnetic resonance imaging using a nuclear magnetic resonance spectrometer.
Suitable, but not limiting, examples of substances which can be detected using a gamma scanner include lZSz' 13~I, 123I~ 111In~ 105Rh' 153Sm, S7Cu, 67Ga, I65Ho, lT7Lu, IB~Re, t88Re and 9~mTe. An example .
of a substance which can be detected using a nuclear magnetic resonance spectrometer is gadolinium.
Conjugates of a composite aum~ YL, VIA anti-bodies and a therapeutic agent may be administered in a l harmaceutica3ly effective amount for the in uivo p t treatment of human carcinomas, or metastases thereof, in a patient having a tumor that expresses TAG-72. A
"pharmaceutically effective amount" of the composite s Hump VL antibody means the amount of said antibody ~0 (whether unconjugated.,,i.e., a naked antibody, or conjugated to atherapeutic agent? in the pharmaceutical composition should be sui"ficient to achieve effective .., _ binding to TAG-T2.
3~lBS'~'1'~'tJTE SHEE'?' h~,F; ...~ . . . . . . ...
WO 93/12231 ~ ~ ~ ~ ~ ~~ ~ PCT/AU91/00583 Exemplary naked antibody therapy includes, for example, administering heterobifunctional composite Hump VL, VH antibodies coupled or combined with another...
antibody so that the complex binds both to the carcinoma and effector cells, e.g., killer cells such as ~T cells, or monocytes. In this method, the composite Hum4 VL
antibody-therapeutic agent conjugate can be delivered to the carcinoma site thereby directly exposing the carcinoma tissue to the therapeutic agent. Alter-natively, naked antibody therapy is possible in which antibody dependent cellular cytoxicity or complement dependent cytotoxicity is mediated by the composite Hum4 VL antibody.
Examples of the antibody-therapeutic agent conjugates which can be used in therapy include antibodies coupled to radionuclides, such as 1811, 9 105Rh~ ~4'TSe, 6ZCu, 212Big 211At9 67Ca9 125I~ 186Re9 18$Re, l~7Lu, g9mTc, 153Sm, 1231 and 111In; to drugs, 2fl such as methotrexate, adriamycin; to biological response modifiers, such as interferon and to toxins, such as ricin.
Methods of preparing and administering i conjugates of the composite Hum~4 VL, VH antibodies and a therapeutic agent are well known or readily determined.
Tie pharrnaceutieal composition may be administered in a single dosage or multiple dosage form. Moreover, suitable dosages will depend on the age and weight of wthe patia:~t and the therapeutic agemt employed and are well known or readily determined.
Composite Hump VL, JH antibodies, and parti-cularly composite Hump ~L, lH single chain antibodies hereof, are particularly suitable for radioimmunoguided sues-rrTU-rE sH~~r ~~~~~~. L
-3~-surgery (RIGS). In RIGS, an antibody labeled with an imaging marker i.s injected into a patient having a tumor that expresses TAG-72. The antibody localizes to tYle tumor and is deteeted by a hand-held gaumna detecting probe (GDP). The tumor is then excised (see Martin etal.
(1g8$), Amer. d. Surg., 156:386-3~2~ and Martin etal.
(7986), Hvbridoma, 5:597-5108). An exemplary GIMP is the Neoprobe~' scanner, commercially available from Neoprobe Corporation, Columbus, OH. The relatively small size and human character of the composite Hump vL, Vg single chain antibodies will accelerate whole body clearance and thus reduce the waiting period after injection before surgery can be effeetively initiated.
Administration and detection oi" the composite Hump VL, Vg antibody-imaging marker conjugate may be accomplished by methods well-known or readily determined.
The dosage will vary depending upon the age and weight of the patient, but generally a one time dosage of about 0.1 to 200 mg of antibody-marker conjugate per patient is administered.
30 , a SUBSTITUTE SHEET

EXA- PLES
The following nonlimiting examples are merely far illustration of the construction and expression of composite Fium4 YL, VH antibodies. All temperatures not otherwise indicated are Centigrade. All percents not otherwise indicated are by weight.
Example I
CCU9 and CC83 were isolated from their respective hybridomas using pNP9 as a probe (see Figure 5). CC4g VH was obtained from p49 g1-2.3 (see cigure 6) and CC83 VH was obtained from p83 g1-2.3 (see Figure 7), following the procedures set forth in EPO 0 365 997.
DNA encoding an antibody light chain was isolated from a sample of blood from a human following the protocol of Madisen et. al. ( 1987 ) . Am. J . Med . Genet . , 20 27:3T9-390) with several modifications. Two ~ ml purple-cap Vacutainer~tubes (containing EDTA as an anticoagulant) were filled with blood and stored at ambient temperature for 2 hours. The samples were transf er:~ed to two 4.5 mL centrifuge tubes. To each 25 tube was added 22.5 mL of filter-sterilized erythrocycte lysate Suffer (0.155 M NH4C1 and 0.17 M Tris. ~H 7.65.
in a volume ratio of 9:1), and incubated at 37°C for 6.5 minutes. The t::bes became Nark red due to the iysed red blood cells. The samples were centrifuged at 9°C for i0 30 minutes, using an SS-34 rotor and a Sorvall centrifuge at 5.300 revolutions per minute trpm) ('3,400 X g). The resulting white cel'_ pellets were ~esuspended in 25 .r.L
of 0.15 M NaCl solution. The white blood ells were then centrifuged as before. The pellets were resuspended in 500 ~L of 0.15 M NaCI and transferred to *Trade-mark WO 93/12231 PGT/AU91/OQ5~3 1.5 mL microeentrifuge tubas. The cells were pelleted again for 3 minutes, this time in the microcentrifuge at 3,000 rpm. Very few red blood cells remained ~n the pellet. After the supernatants were decanted from the two microcentrifuge tubes, 0.6 mL high TE buffer (100 mM
firis, pH 8.0i was added. The tubes were hand-shaken for and 15 minutes. The resulting viscous solution was extracted with phenol, phenol-chloroform and finally with just chloroform as described in Sambrook etal., 10 supra. To 3.9 mL of pooled extracted DNA solution was added 0.~6 mL NaOAe (3 M, pH 5), and 10 mL 100 percent ethanol. A white stringy precipitate was recovered with a yellow pipette tip, transferred into a new Epgendorf tube, washed once with 70 percent ethanol, and finally washed with 100 percent ethanol. The DNA was dried fn vcrc~to for 1 minute and dissolved in 0.75 mL deionized water. A 20 gL aliquot was diluted ~to 1.0 mL and the OD
260 nm value was measured and recorded. The concentration of DNA in the original solution was 2Q calculated to be 0.30 mg/mL.
Oligonucleotides (aligns) were synthesized using phosphoramidite chemistry on a 380A DNA
synthesizer (Applied Biosystems, Foster, CA) starting on 0.2 ~.M solid support columns. Protecting groups on the final. products were removed by heating in concentrated ammonia solution at 55°C for 12 hours. Crude mixtures of oligonueleotides (approximately 12 OD 260 n~a units) ~0 :were applied to 16 percent polyaerylamide-urea gels and y electrvphoresed. 'DNA in :he gels was visualized by short wave UV light. Bands were cut out and ~he DNA
- eluted by heating the gel gieces to 65°C for 2 hours.
Final purification was achieved by application of the ejuted DNA solution onto C-18 Sep-Fae" columns SUBSTITUTE SHEET

pC'f/AU91 /00583 °37-(Millipore) and elution of the bound oligonucleotide with a 60 percent methanol solution. The pure DNA was dissolved in deionized distilled water (ddH20) and quantitated by measuring OD 260 nm.
A GeneAmpTM DNA amplification kit (fetus Corp. , Emeryville, CA) was used to clone the Hum~# VL germline gene by the PCR which was set up according to the manufacturer°s directions. A thermal cycler was used for the denaturation (9~ °C), annealing (45 °C) and elongation (72 °C) steps. Each of the three steps in a cycle were carried out for 4 minutes; there was a. total of 3o cycles.
Upstream of the regulatory sequences i~ the Hump V
L germline gene, there is a unique Vila I
restriction enzyme site. Therefore, the 5' end oligonucleotide for the PCR technique, called HUMVL(+) (Figure 8), was designed to include this Gla Z site.
. The 3' end oligonucleotide, called HUMVL(--) (Figure 8), contained a unique Hind III site; sufficient mouso intron sequence past the splicing site to permit an effective splice donor function; a human J~ sequence contiguous with the 3' end of the UL axon of Hum~l VL to complete the CDR3 and FRS sequences of the UL domain (see Figures 9 and 10); nucleotides to encode a tyrosine residue at position ~~ in CDR3; and 29 nucleotides close to the. 3' end of the VL axon of Hum4 VL (shown underlined in the oligonucleotide HUMVL(-) in Figure 8) to anneal with the zuman DNA target. in total, this ~°
end oligonucleotide for the PCR was 98 bases long with a non-annealing segment (a "wagging tail") of 69 nucleotides. A schematic of the Hum4 JL gene target and sues-r~-ru~ sHE~°r PCflAU9I /00583 the oligonucleotides used for the PGR are shown in Figure 11.
- ... _ A PCR reaction was set up with 1 ~g of total human DNA in a reaction volume of 100 p.L. Primers HUM1TL(-? and HUMVL(+) were each present at an initial concentratiuon of 100 pmol. Prior to the addition of T'aq polymerase (2.5 units/reaction) 100 gals of mineral oil were used to overlay the samples. Control samples were set up as outlined below. The samples were heated t~ 95 °G for 3 minutes. When the PGR was complete, 20 gL samples were removed for analysis by agarose gel electrophoresis.
Based on the known size~of the Hum4 VL DPNA
fragment to be cloned, and the size of the oligonucleatides used to target the gene, a product of 1099 by was expected. A band corresponding to this size was obtained in the reaction (shown in lane 7, Figure 0 12~.
To prepare a plasmid suitable for cloning and subsequently expressing the :~ium~ ~lL gene, the plasmid pSV2neo was obtained from ATCG and subsequently modified. pSV2neo was modified as set forth below (see Figure 13).
The preparation of pSV2neo-101 was as follows.

Ten micrograms of purified p5V2neo were digested with ~0 units of Find ICI at 37 'G for 1 hour. The lineari~ed plasmid DNA was p recipitated :with ethanol, washed, dried -:. and dissolved in 10 ~aL er. Two microliters each of wat .;
-:,: 10 mM dATP, dCTP, dGTP and dTTP were added, as well. as 2 gL of lOX iigase buffer. r i re units ( 1 p.L ) of DNA

polymerase 1" were added to make blunt the hind III

SUBST1'TU'fE SHEET

~~.i~~~~~.

sticky ends. The reaction mixture was incubated at room temperature for 30 minutes. The enzyme was inactivated by heating the mixture to 65°C for 15 minutes. ~ The reaction mixture was phenol extracted and ethanol precipitated into a pellet. The pellet was dissolved in 20 g1 deionized, distilled water. A 2 p1 aliquot (ca. 1 gg) was then added to a standard 20 laL ligation reaction, and incubated overnight at ~ °C.
Competent E.coli DH1 cells were transformed with 1 ~L and 10 gL aliquots of the ligation mix (Invitrogen, San Diego, CA) according to the manufacturer's.
directions. Ampicillin resistant colonies were obtained on LB plates containing 100 pg/mL ampieillin. Selected clones grown in 2.O mL overnight cultures were prepared, samples of plasmid DNA were digested with Hand III and Bam HI separately, and a correct representative clone selected.
The resulting plasmid pSV2neo-101 was verified by size mapping and the lack of digestion with Hind III.
A sample of DNA from pSV2neo-10 mini-lysate was prepared by digesting with 50 units of Bam HI at 37°C
for 2 hours. The linearized plasmid was purified from a ' ~i percent DNA polyacrylamide gel by electroelution. The y . DNA ends were made blunt by filling in the Bam HI site usiyg dNTPs and Klenow fragment, as described earlier for the Hind III site of oSV2 neo-101.

A polylinker segment containing multiple n j el-oniwg sites was :.ncorporated at the Bam HI site of pSV2neo-101 to create pSV2neo-102. Equimolar amounts of two oligonucl.eotides. Ca(+) and CH(-) (shown in Figure 11t) were annealed by heati~g for 3 minutes at 90 °C and sues-r~TU-rE steer WO 93/iZ231 PGT/AU91l00583 ~1.!~.~~°~~
1~ 0 .~
cooling to 50 °C. Annealed linker DNA and blunt ended pSV2neo-101 were added, in a ~40a1 molar volume to a standard 20 ~L ligation reaction. E, coIi DH1 was ""
transformed with 0.5 ~L and 5 ~L aliquots of the ligation mixture (Invitrogen). Twelve ampicillin resistant colonies were selected for analysis of plasmid DNA to determine whether the linker had been incorporated.
A Find III digest of mini-lysate plasmid DNA
revealed linker incorporation in six of the clones. The plasmid DNA from several clones was sequenced, to determine the number of linker units that were blunt-end ligated to pSV2neo-101 as well as the relative orientations) with the linker. Clones for sequencing were selected on the basis of positirre digestion with Hind III.
A SequenaseT~f sequencing kit (ITnited States t 20 Biochemical Corp, Cleveland, 0H was used to sequecne i the DNI~. A primer, NE0102SEQ, was used for sequencing and is shown in Figure 15. It is complementary to a E sequence located upstream fram the ,Bam HI site in the vector. Between 3 ~g and 5 ~Zg of piasmid DNA isolated from E. coli mini-? ysates were used for sequencing. The DNA was denatured and precipitated prior to annealing, as. according to the manufacturer's instructions.
Electrophoresis was carried out. at 1500 volts; gels were dried prior to exposure, ~o,Kodak X-ray film. Data was ~0 processed~using Hi'tachi's DNASIS=" computer program.
Fro~a the DNA sequence data of ~ clones analyzed (see~photograph of autoradiogram - Figure 16), compared to the expected sequence in cigure 1~~ two clones having SUBSTITUTE SHEET

i.~G..:- : . ' _- ~.,'.. :.. .. ..... '. ',.'. . ,~-:~..~' ..
WO 93/12231 ~ ~~ /~- ~' _' ~ PCT/AU91/00583 -'~ 1-the desired orientationwere obtained. A representative clone was selected and designated pSV2neo-102.
A human Cx gene was inserted into pSY2neo-102 to farm-pRL1000. The human Cx DNA was contained in a ' S 5.0 kb Hind III-Bam HT fragment (Hieter et al. (1980), Cell , 221 197 200 0 A 3 pg sample of DNA from a mini-Iysate of pSll2neo-102 was digested with Bam HI and Hind III. The vector DNA was separated from the small Bam HI-~;~Iind III
linker fragment, generated in the reaction, by electrophoresis on a 3.75 percent DNA polyacrylamide gel,. The desired DNA fragment was recovered by elec'troelution. A pBR322 clone containing the 5.0 kb 5 .Hind I I I-Bam HI f ragment of the human Cx gene ( see Hieter ctal., supra) was designated.phumCx. The 5.0 kb .Find III-Eam HI fragment was ligated with pSV2neo-102r and intr~duced into E. coli DH1 ( Invitrogen) . rlmpieillin z0 resistant colonies were screened and a clone containing the human Gk gene was designated pRL1000.
Finally, pRL1000 clones were screened by testing mini-lysate plasmid DNA from E.coli with Hind III
25 and Eam HI. A clone producing a plasmid which gave 2 bands, one at 5.8 Kb (representing the vector) and the other at. 5.0 kb (representing the human Cx insert) was .selected. Further characterization of pRL1000 was achieved by sequencing downstream from the Hind III site 30 in the ;intron -region of the . human Cx insert . The oligonucleoti.de used to prime the sequencing reaction was NE0102SEQ (Figure 'S). Two hundred and seventeen .~ bases were determined (see Ffigure 17). A new bligonueleotide corresponding to the (-) strand near the Hind ZZT site (shown is =figure 1?) was synthesized so suesT~TU~ sHEE-r . ,-, WO 93/12231 ~ 1 ~ .~ ~ '~ -~~- PCTlAU91/00583 that clones, containing the HHum4 VL gene that were cloned into the Cla I and Hind III sites in pRL1000 (see Figure 13), could be sequenced. ~ ~w A Cla I-Hand III DNA fragment containing Hump VL
obtained by PCR was cloned into the plasmid vector pRL1000. DNA of pRL1000 and the Hump VL were treated with Cla Z and Hand III and the fragments were gel purified by electrophoresis, as described earlier.
The pRL1000 DNA fragment and fragment containing Hump VL gene were ligated, and the ligation mixture used to transform E.coli DH1 (Invitrogen), following the manufacturer's protocol. Ampicillin resistant clones were screened for the presence of the Hum~t VL gene by restriction enzyme analysis and a representative clone designated pRL1001 (shown in Figure 1~)s Four piasmids having the correct Cla I-Hind III
restriction pattern were analyzed further by DNA
sequencing of the insert region (see Figure 19). Hind III Cxt°) (shown in Figure 17), HUMLIN1(-) (shown in Fagure 10), EIUMLIN2(-) (shown in Figure i0) were used as the sequencing primers. Two out of the four' plasmids analyzed had the expected sequence in the coding regions (Figure 19, clones 2 and 9).
Clone 2 was chosen and used for generating sufficient plasmid DNA for cell :ransformatians and other analysis. This plasmid was used for sequencing thraugh the Hum4 VL, and the upstream region to the Cla T site. Only one change at nucleotide position 8~ from a C to a G (Figure ~0) was observed, compared to a SUBSTITUTE SHEET

WO 93112231 ~ ~ ~ ~ o l~ ~ PC'T/AU9~/005g3 -'~ 3 -published sequence (Klobeck sfal. (19$5), supra). The DNA sequence data also indicates that the oligonucleotides used for the PCR had been correctly incorporated in the target sequence.
The Biorad Gene Pulser"' apparatus was used to transfect Sp2/0 cells with linearized plasmid DNAs containing the light or heavy chain constructs. The Hump vL was introduced in Sp2/0 cells along with corresponding heavy chains by the co-transfection scheme indicated in Table 1.
Table 1 DNA Added Cell Line Designation L Chain H Chain ~! Chain pRL1001 P49 pB3 g1-2.3 g1-2.3 MP1-44H 20 ~g 1S pg 0 ~g MPl-64H 20 pg 0 gg 15 ug A total of 8.0 x 10b Sp210 cells were washed in sterile PBS buffer (0.$ ml o~ 1 X 107 viable cells/mL) and held on ice for 10 minutes. DNA o~'' pRL1001, line.arized at the Cla I site, and the DNA of either p~9 g1-2.3 or p83 g1-2.3, linearized at their respective Nde I sites, were added, in sterile PBS, to the cells (see protocol - Table 2) and held at 0 °C for a further 10 minutes. A single 200 volt, 960 pF.electrical pulse lasting between 20 and 30 milliseconds was used for the '' electroporation. After holding the perturbed cells on ice for 5 minutes, 25 ml of RPMI medium with 10 percent fetal calf serum were ?ntroduced, and 1.0 ml samples ali~uoted in a 24 well tissue culture plate. 1'he cells were incubated at 37 °C in a ~ percent C02 atmosphere.
SUBSTITUTE SHEET

WO 93!I2231 ~ ~ ~ ~ ~ ~ ~ PGT/AL191/00583 _~1~_ After 48 hours, the media was exchanged with f rash selection media, now containing both 1 mglmL Geneticin (G~1~) (Difco) and 0.3 p.g/ml mycophenolic acid/gpt ~"
medium. Resistant cells were cultured for 7-10. days.
Supernatants from wells having drug resistant colonies were tested on ELISA plates for aotivity against TAG-72. A roughly 10 percent pure TAG-72 solution prepared from LS147fi tumor xenograft cells was diluted 1:40 and used to coat flexible polyvinyl chloride microtitration plates (Dynatech Laboratories, Inc.). Wells were air-dried overnight, and blocked the next day with 7 percent 3SA. supernatant samples to be tested for anti-TAG-72 antibody were added to the washed wells and incubated for between 1 and 2 hours at 37 °C.
Alkaline phosphatase labeled goat anti-human IgG
(diluted 1:250) (Southern Biotech Associates, Hirmingham, AL) was used as the probe antibody.
Incubation was for 1 hour. The substrate used was p-nitrophenylphosphate. Color development was terminated by the addition of 1.0 N NaOH. The plates were read spectrophotometrically at 405 nm and 450 rim, and the values obtained were 405 nm-x+50 nm.
Those samples producing high values in the assay were subcloned from the original 24 well~plate onto 96 well plates. Plating was done at a cell density of half a cell per well (nominally 50 cells) to get pure monoclonal cell lines. Antibody produc;ng cell lines were frozen down 'n media containing 10 percent DMSO.
Two cal? lines were procured having the desi.gnations: ~iP 1-~4H and ;~P 3-34H. MP 1-44H has t:~e ehimeric GC~9 ~1 heavy chain with the Hump ~TL light SUBSTITUTE SHEET

WO 93/12231 PCT/~U91/OU583 2l~I~f~~.
_q5_ chain; and MP1-8~IH has the chimeric CC83 g1 heavy chain with the Humvklf light chain.
'~ A 1.0 L spinner culture of the cell Iinew MP1-~~H was grown at 37°C for 5 days far antibody production. The culture supernatant was obtained free of cells by centrifugation and filtration through a 0.22 micron filter apparatus. The clarified supernatant was passed over a Protein A cartridge (Nygene, New York). Immunoglobulin was eluted using 0.1 M sodium citrate buffer pH 30. The pH of the eluting fractions containing the antibody was raised to neutrality by the addition of Tris base, pH 9Ø The antibody-containing fractions were concentrated and passed over a Pharmacia Superose 12 HR 10/30 gel filtration column. A protein was judged to be homogeneous by SDS polyaerylamide gel electra~horesis. Isoelectric focusing further demonstrated the purity of MP1-~~H.
The biological performance of the human composite antibody, MP1-~~H, was evaluated by comparing immunohistochemistry results with two other anti-TAG-72 antibdoies CC~9 (ATCC No. H8 959) and Ch44 (ATCC No. H8 9$$~). Sections of human colorectal tumor embedded in paraffin were tested with the three antibodies by methods faniliar to those skilled in this art. All threw antibodies gave roughly equivalent binding recognition of the tumor antigen present on the tumor tissue sample.
A further test of the affinity and biological integrity of the human composite antibody MP1-~4~H was a competition assay, based on cross~competing radioiodine--labeled versions of the antibody with CC~9 and Ch~4 in all combinations. :rpm the data shown in Figure 20, it SUBST1TlJTE SHEET

~i:~ ~ ~r~
is apparent that the affinity of all 3 antibodies is equivalent and can bind effectively to tumor antigen.
.M
MP1-~+~H (ATCC HB 10426) and MP1-$4H (ATCC HH
1047) were deposited at the American Type Culture Collection (ATCC).. The contract with ATCG provides for permanent availability of the cell lines to the public on the issuance of the U.S. patent describing and identifying the deposit or the publications or upon the laying open to the public of any U.S. or foreign patent application, which ever comes first, and f or availability of the cell line to one determined by the II.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 CFR X122 and the Commissioner's rules pursuant thereto (including 3? CFR
~1.14 with particular reference to $86 0G 63$). The assignee of the present application has agreed that if the cell lines on deposit should die or be lost or destroyed when cultivated under suitable conditions for 20 a period of thirty X30) years or five (5) years after the last request, it will be promptly replaced on notification with viable replacement cell lines.
example 2 Single-chain antibodies consist of a VL, VH
and a peptide linker joining the VL and VH domains to produce SCF~Ts. A single chain antibody, SCFV1, was constructed to have the Hum4 VL as V Domain 1 and CC49 VH as V..Domain. 2, ($ee Figure 27 ).
:he polypeptide linker which joins the two V
domains was encoded by the DNA introduced at the 3'~end of the VL DNA during the 'CR. '.'he oligonucleotides SCF~FIa and 5CFV2 were designed to obtain the DNA segment SUBSTITUTE SHEET

~ ,~ 1 Au7_ incorporating part of the yeast invertase leader seauence, the Hum~1 VL and the SCFV linker.
..,.
The polypeptide linker for SCFV1 was encoded in oligonucleotide SCFVIb (see below). The underlined portions of the oligonucleotides SCFVIa and SCFVIb are complementary to sequences in the Hum~l VL and linker respectively. The sequences of SCFVIa and SCFVIb are as follows, with the hybridizing sequences underlined:
SCFVIa with the HindIII in bold:
Hind I I I
5'CTGCAAGCTTCCTTTTGCTTTTGGCTGGTTTTGCAGCCAAAATATCTGCAG
ACATCGTGATGACCCAGTC~-3' SCFVIb with the Aat II site in bold:
~2.0 5'-CGTAAGACGTCTAAGGAACGAAATTGGGCCAATTGTTCTGAG
GACGGAACCTGACTCCTTCACCTTGGTCCCTCCGCCG-3' The target DNA in the PCR was pRL1001 shown in.Figure 1$). The PCR was performed pursuant to the teachings of Mullis et al. supra. A DNA fragment containing tl~e Hum~4 , VL-linker DNA component for the . construction of SCFV1 was obtained and purified by polyaerylamide gel electrophoresis according to the teachings of Sambrook et al. , supra.
sues-rt-ru~ s~~E-r WO 93!12231 ? ~ ~ ~ ~ '' ~ PcrC.A~lga/ooss~
p~E9 g1-2.3~ containing CG~9 VH, was the target DNA in the PCR. PCR was performed according to the methods of Mullis etal., supra. The oligonueleo~fdes used for the PCR of CC~9 ~lH are as follows,, with the hybridizing sequences underlined: _ SCFVi~c, with the Aat II site in bold:
5'-CCTTAGACGTCCAGTTGCAGCAGTCTGACGC-3' SCFtTId,~ with the Flied III site in bold:
5'-GATCAAGCTTCACTAGGAGACGGTGACTGAGGTTCC-3' The purified Hump VL-linker and Vg DNA
_fragments were treated with Aat II CNew England Biolabs, Beverly, MA) according to the manufacturer's protoool, and purified frbm a 5 percent polyaerylamide gel after electrophoresis. An equimolar mixture of the Aat II
fragments was ligated overnight. Ths T4 DNA ligase was heat inactivated by heating the ligation reaction mixture ~.t 65 'v ' foz° 10 ' minutes. Sodium chloride was . r added to the mixture to give a final concentration of 50 - mM and the mixture was further with Hind III. A Hind III DNA fragment eras ssolated and purified from a ~1.~
percent polyacrylamide gel and cloned ynto a yeast expression vector Csee Carter etal. C1987), In: DNA
~UBSTtTUTE SHEET

WO 93/12231 PC.'T/ALJ91/00583 ~1~~~ ~'~~.
Cloning, A Practical Aneroach, Glover (ed.) Vol. III:
1~1-161). The sequence of the fragment, containing the contiguous SCFV1 construct, is set forth in Figure...~2.
The anti-TAG-72 SCFV1 described herein utilized the yeast invertase leader sequence (shown as positions -19 to -1 of Figure ~2), the Hump V~, (shown as positions 1 to 113 of Figure 22), an 18 amino acid linker (shown as positions 114 to 132 of Figure 22) and CC~9 VH~(shown as positions 133 to 248 of Figure 22).
The complete DNA and amino acid seqmence of SCFV1 is given in Figure 22. The oligonucleotides used to sequence the SCFV1 are set forth below.
TPI:
5'-CAATTTTTTGTTTGTATTCTTTTC-3'.
HUVKF3:
2D 5'-CCTGACCGATTCAGTGGCAG-3°.
DC113:
5'-TCCAATCCA'TTCCAGGCCCTGTTCAGG-3'.
SUC2T:
~'-CTTGAACAAAGTGATAAGTC-3'.
Examule 3 A plasmid, pCGS517 (Figure 23), containing a proxennin gene was digested with Hind III and a 6.5 kb fragmewt was isolated. The plasmid pCGS517 has a triasephosphate isomerase promoter, invertase [SUC2]
signal sequence, the prorennin gene and a [SUC2]
SUBSTITUTE SHEET

WO 93/I2231 ~ ~ ~ ~ ~ ~ ~ P(:f/AL191/00583 -50~
terminator. The Hirxd IIIwdigested SCFV1 insert obtained above (see Figure 23) was ligated overnight with the Hind III fragment of pCG5517 using T~ DNA ligase -.-(Stratagene, La Jolla, CA).
The correct orientation existed when the Hind III site of the insert containing; part of the invertase signal sequence ligated to the vectar DNA to form a gene with a contiguous signal sequence. E'.coli.
DHI (Invitrogen) cells were transformed and colonies screened using a filter-microwave technique (see 3uluwela, etczl: (1989), Nucleic Acids Research, 17r452).
From a transformation plate having several hundred colonies, 3 positive clones were obtained. Digesting °he candidate plasmids with .Sal I and Kpn I, each a single cutter, differentiated between orientations by the size of the DNA fragments produced. A single clone, pDYSCF'~1 (Figure 23), had the correct orientation and was used for further experimentation and cloning. The 20~ probe used was derived from pRL1001, which had been digested with Kpn I and Cla I (see Figure 18). The probe DNA was labeled with 3~P a-dGTP using a random oligcnueleotide primer labeling kit (Pharmacia LKH
Biotechnology. Piscataway, NJ). -The next step was to introduce the Bgl II-~al 1 fragment from pDYSCFV1 into the same restriction sites of another vector (ca. 9 kb), which was derived t'rom PCGS515 (Figure 23). to give an autonomously replicating pl2sm3d 'i n S. cer~visiae.
DNA from the vector and insert were digested in separate reactions with Bgl II and Sal I
~ssing 14X buffer ncmber 3 (5Q MM Tris-HGI (pH 8.0), 100 mM NaCl, 3AL). The sDNA fragment from pDYSCF~II was run SUBSTITUTE SHEEt ,,;? -, 1~Y0 93/12231. ~ ~ c~ .~ ~ ;~ ~ P(:T/AU91/00583 m:. a - a 1--in and electroeluted from a 5 percent polyacrylamide gel and the insert DNA was run and electroeluted from a 3.75 .,, percent polyaerylamide gel. A standard ligationwsing T11 DNA ligase (Stratagene) and a transformation using E.
coli DH1 (Invitrogen) was carried out. Out of 6 clones selected for screening with Bgl Il and Sal II, all 6 we're carrectly oriented, and one was designated pCGS5151SCFV1 (Figure 23).
DNA sequencing of pCGS515/SCFVI DNA was done using a Sequenase~' kit (U. S. Biochemical, Cleveland, OH) using pCGS515/SCFV1 DNA. The results have been presented in Figure 22 and confirm the sequence expected, based on the linker, the Huml4 VL and the C~C~9 VH.
Transformation of yeast cells using the autonomosly replicating plasmid pCGS515/SCFV1 was . carried out using the lithium acetate procedures z0 described in Ito et al. ( 1983) , J . Bacteriol. , 153: 163-168'; and Treco (7987), In: Curent Protocols in Molecular Biology, Ausebel et al. (eds), 2:13.71-13.7.6. The recipient strain of S.eerevasiae was CGY128~ having the - , genotype - MAT a (mating strain n), ura 3-52 (uracil z E 25 auxotrophy), SSCi-1 (supersecreting 1), and PEP4+
(peptidase ~ positive).
Transformed clones of CGY1284 carrying SCFV
plasmids were selected by their ability to grow on 30 minimal,:~edia in the absence of uracil. Transformed colonies appeared within 3 to a days. The colonies were transf erred, grown and plated in YEPD medium. shake flasks were used to provide culture supernatant with expressed product.

An ELISA procedure was used to detect biological activity of the SCFV1. The assay was set up such that the SCFV would compete with biotinylated CC4g (biotin-CC~19) for binding to the TAG-T2.antigen on the ELISA plate .
SCFV1 protein was partially purified from a crude yeast culture supernatant, using a Superose~'12 gel filtration column (Pharmacia LKB Biotechnology), and found to compete with biotinylated CC4g in the competition ELISA. These results demonstrate that ~he SCFV1 had TAG-72 binding activity.
The SCFV1 protein has been detected by a standard Western protocol (see Towbin etal. (1979), Proc.
Natl. Acad. Sci.. . ., U.S A T6 u350-u354). The detecting agent was biotinylated FAIDI~t (ATCC No. CRL 10256), an anti-idiotypic monoclonal antibody prepared from mice that had been immunized with CC49. A band was visualized that had an apparent molecular weight of approximately 26,000 daltons, the expected size of the SCFV1. This result demonstrated that ~he SCFV1 had peen secreted and properly processed.
Example 4 The following example demonstrates the cloning of human 'lH genes into a SCFV plasmid construct containing sequence coding for the ~um4 VL and a 25 amino acid linker called UNIHOPE.
J
A vector was prepared froc plasmid pRW 83 containing a chloramphenicol resistance (Camr) gens ~"or clone selection, and a penP gene with a penP promoter and terminator ( see Mezes , et al. ( 1983 ) , ,t . 8 i o 1 . Chem . .
258:11211-11218) and the pel B signal sequence (see Lei *Trade-mark WO 93/12231 ~ i ~ ~ 0 ~~ 1 P~.'f/AU91/~0583 etal. (1987) suprc). The vector was designated Fragment A. (see Figure 2~). The penP gene was removed with a Hind III/Sal I digest.
re The penP promoter and pel B signal sequence were obtained by a PCR using pRW 83 as a template and oligonucleotides penP1 and penP2 as primers. The fragment was designated Fragment B (see Figure 2~d), A
Nco I enzyme restriction site was introduced at the 3' 1G end of the signal sequence region by the penP2 oligonucleotide.
penP1:-5'-CGATAAGCTTGAATTCCATCACTTCC-3' 15 penP2:
5'-GGCCATGGCTGGTTGGGCAGCGAGTAATAACAATCCAGCG GCT
GCCGTAGGCAATAGGTATTTCATCAAAATCGTCTCCCTCCGTTTGAA-3' A SCFV comprised of a ~ium~ VL, a CCU9 VH, and 20 an 18 amino acid linker (Lys Glu Ser Gly Ser Val Ser Ser Glu Gln Leu Ala Gln Phe Arg Ser Leu Asp) was obtained from pCGS515/SCFV1 by PCR using oligonueleotides penP3 and penP6. This fragment was designated Fragment D (see Figure 24). A Bcl I site was introduced at the 3' end z5 of the V re ion b the g g y penP6 oligonucleotide.
penP3:
5'-GCTGCCCAACCAGCCATGGCCGACATCGTGATGACCCAGTCTCC-3' 3o penPsc-):
a 5'-CTCTTGATCACCAAGTGACTTTATGTAAGATGATGTTTTG ACG
GATTGATCGCAATGTTTTTATTTGCCGGAGACGGTGACTGAGGTTCC-3' Fragments B and D were joined by PCR using oligonucleotides penP1 and penP6, v"ollowing the 3UBS?'1TllT'E SHEET

WO 93/1Z23I PG"I'IAU91/00583 5~
procedures of Harton etal., supra. The new fragment was designated E (See Figure 2~4).
Fragment C captaining the penP termination~codon "' was isolated by digesting pRW 83 with Pcl I and.,Sa1 I, and designated Fragment G. pRW 83 was isolated from E. °
coli strain GM161, which is DNA methylase minus or dam".
Plasmid pSCFV 31 (see Figure 2~) was created with a three part ligation Fragments A, C, and E.
The Nco I restriction enzyme site within the Camr gene and the Mind III site located at the 5' end of the penP promoter in pSCFY 31 were destroyed through a PCR DNA amplification using oligonucleotides Ncol.1 and Ncol.3(-) to generate an Eco RI-Nco I fragment and oligonucleotides Ncoi.2 and Ncolr~e(-) to gen~rate a Nco I to ~co RI fragme:~t. These two fragments were joined by PCR-SOE using oligonucleotides Ncol.i'and Ncoi.~c(-).
The oligonucieotides are set forth below:
Neol.'1:
5°-TCCGGAATTCCGTATGGCAATGA-3' Neo 1 r 3 ( ) r 5°-CTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGC-3°
Neol.2:
5'-ATGGGCAAATATTATACGCAAG-3' Neol.~c(-):
5'-CACTGAATTCATGGATGATAAGCTGTCAAACATGAG-3' ' pSCFv 31 was digested with Eco RI and the larger Fragment was isolated by polyacrylamide gel electrophoresis. To prevent self ??gation, the DNA was StJBSTITtJ'YE SHEET

WO 93/12231 P~'/AU91/00583 _~~_ 2~.2:~~~:~~
dephosphorylated using calf intestinal alkaline phosphatase according to the teachings of Sambrook etal.9 Sll~l'a s .,~
A two part ligation of the larger pSCFV 31 digested fragment and the PCR-SOE fragment, described y above-, resulted in the creation of pSCFV 31b (see Figure 25).
pSCFV 31b was digested with Nco I arid Sal I
and a fragment containing the Camr gene was isolated.
The Hump Vi, was obtained by PCR DNA
amplification using pCGS515lSCFVI as a template and oligonucleotides 10~IBHi and 10~48H2(-) as primers.
10~8H1:
5°-CAGCCATGGCCGACATCGTGATGACCCAGTCTCCA-3' lo~8H2(-):
5'-AAGGTTGCCCCATGCTGCTTTAACGTTAGTTTTATCTGCTGG
AGACAGAGTGCCTTCTGCCTCCACCTTGGTCCCTCCGCCGAAAG-3' The CC~49 VH was obtained by PCR using p49 . g1-2.3 (Figure 5) as a template and oli onucleotides a g 1083 and 10~B4(-) as primers. A Nhe I enzyme restriction site was introduced just past the termination colon in the 3' end (before the Bcl I site) by oliganueleotide lo4B~6(-) .
3o io~a3:
t x 5'-GTTAAAGCAGCATGGGGCAAGCTTATGACTCAGTTGCAGCAGTC':GACGC-3' SUBSTiTt~TE SHEET

i ~ ~~
WO 93/12231 1~GT/AU91/005g3 d~6_ ~0~~~(-):
~'-CTCTTGATCACCAAGTGACTTTATGTAAGATGATGTTTTGACGGATT
CATCGCTAGCTTTTTATTTGCCATAATAAGGGGAGACGGTGACTGAGGTTCC-3' In the PCR which joined these two fragments -using oligonucleotides T0~3H'1 and 104B~t(-) as primers, a coding region for a 22 amino acid linker was formed.
A fragment C (same as above) containing the penP termination codon was isolated from. pRW 83 digested with ~c1 T and Sal I.
Plasmid pSCFV 33H (see figure 25) was created with a three part ligation of the vector, fragment C, and the SCFV fragment described above.
pSCFV 33H was digested with Ncol and lVhel, and the DNA fragment containing the Camr Gene was isolated as a vector.
Hump VL was obtained by PCR DNA
amplification using pRL1001 (see figure 18) as a template and oligonucleotides UNIH1 and UNIH2(-) as primers. Oligonucleotides for the PCR were:
UNIH'1 S'-CAGCCATGGCCGACATTGTGATGTCACAGTCTCC-3' The .~Ico I site is in bold and the hybridising seauence is underlined.
;.
UNIH2(-):
5'-GAGGTCCGTAAGATCTGCCTCGCTACCTAGCAAA _ AGGTCCTCAAGCTTGATCACGACCTTGGTCCCTCCGC-3' The Bind III site is in bold.
SUBSTITUTE SHIEST

W0 93/I2231 . '~ ~ ? ~ ~ ~~ ~ PCT/AU9~/00583 The CC~69 VH was obtained by a PCR using p~49 81-2.3 (see Figure 6) as a template and oligonucleotides UNI3 and UNI~4 { - ) as primers . ~ ...
UNI3:
5'-AGCGAGGCAGATCTTACGGACCTCGAGGTTCAGTTGCAGCAGTCTGAC-3'.
The Xho I site is in bold and the hybridizing sequence is underlined.
UNIT(-):
5'-CATCGCTAGCTTTTTATGAGGAGACGGTGACTGAGGTTCC-3'.
The Nhe I site is in bold and the hybridizing sequence is underlined.
Oligonueleotides UNIH1 and UNIT(-) were used in the PCR-SOE amplification which joined the Hump VL and CC~9 VH fragments and formed a coding region for a negatively charged fifteen amino acid linker. The DNA
was digested with Nh.e I and Nco I and ligated with the 20 vector fragment from the Neo I-Nhe I digest of pSCFV
33H. The resultant plasmid was designated pSCFV UNIH
(shown in Figure 25).
With the construction of pSCFV UNIH, a 25 universal vector for any SCFV was created with all the desired restriction enzyme sites in place.
pSCFV UNIH was digested with Fffnd III/Xho I, and the J.arge DNA'fragment containing the Camr gene.
Hump VL and CC~9 YH was isolated.
30.
A fragments coding for a 25 amino acid linker, wa:S made by annealing the two oligonueleotides shown below. The linker UNIHOPE is based on 20aC SCA'" linker x . {see Whitlow, (1990) Antibody En~:::eerinQ: Vew ~Teehnolos~y and Auolication Implications. IHC USA
SI~BSTiTtJ'fB SHEET

WO 93/I~23I ~ ~ ~ ~ ~ !~ ~ Pc~rAU~~r~u~s~
_~~~.
Conf erenees Inc, MA), but the first amino acid was changed from serine to leucine and the twenty-fifth amino acid were was changed from glycine to leueine, to aecomodate the .Hcnd III and Xho I restriction sites.
The nucleotide sequence encoding the linker UNIHOPE is set forth below:
UNIHOPE (Figure 26):

5'-TATAAAGGTTAGTGCGGACGATGCGAAAAAGGATGCTGCGAAG
AAGGATGACGCTAAGAAAGACGATGCTAAAAAGGACCTCGAGTCTA-3' UNIHOPE(--) (Figure 26):
5'TAGACTCGAGGTCCTTTTTAGCATCGTCTTTCTTAGCGT CAT
CGTTGTTCGCAGCATCCTTTTTCGCATCGTCCGCACTAAGCTTTATA-3' I5 °The resulting strand was digested with F~ircd IIIlXho I and Iigated into the vector, thus generating the plasmid pSCFV UHH shown in Figure 27). Plasmid pSGFV UHH expresses a biologically active, TAG-72 binding SCF~T consisting of the Hump v~, and CC49 ~IH. T_he 20 expression plasmid utilises the ~i-lactamase penP
promoter, pectate lyase pe~B signal sequence and the penP
terminator region. Different immunoglobulin light chain variable regions can be inserted in the Nca I-Hind III
restriction sites, different SCFV linkers can be 25 inserted in the find III-Xha I sites and differewt immunoglobulin heavy chain variable regions can be inserted in the .~'ha I-a'Vhe T sites.
E.cali AGI (Stratagene) was transformed with the 3G ligation mix, and after screening, a single chloramphenicol resistant clone, having DNA with the correct restriction map, was used for further work.
The DNA sequence and deduced amino acid sequence of the SCF~I gene .n the resulting plasmid are shown in Figure 26.
~UBS'd°1"1'lJ'fE SHEET' 1~~'l'~3 93f~22~1 ~ ~ 2 ~ ~ '~~ ~, PCT/A~J9~1p05~3 .~. ~oli AG i containing pSCFV U~-iH were grown in 2 ml of LB broth with 20 ~xg/mL chloramphenicol (CAM 20).

The culture was sonicated and assayed using a competition ELISA. The cells were found to produce anti~TAG~72 binding material. The competition assay was set up as follows: a 9b well plate was derivatized with a TAG-72 preparation from LS17~T cells. Tkae plate was blocked with 1~ H5A in PBS for 1 hour at 31 C and then washed 3 times with 200 p.L of biotinylated CC~9 (1/20,000 dilution of a 1 mg/mL solution) were added to the wells and the plate was incubated for 30 miwutes at 31 C. The relative amounts of TAG-72 bound to the plate, biotinylated CC~t9, streptavidin-alkaB ne phosphatase, and color development times were determined empirically in order not to have excess of either antigen or biotinylated CC~t9s yet have enough signal to detect coaapetition by SCF'V. Positive controls were CC~d9 at 5 ~g/mL and CC~+9 Fab at 10 ~L/mL. Negative controls were 1~ HSA in PHS and/or concentrated LB. Unbound proteins were washed away.

Fifty mieroliters of a 1:1000 dilution of streptavidin conjugated with alkaline phosphatase (Southern Biotechnology Associates, Inc., Birmingham, AL) were. added and the plate was incubated for 30 minutes at 31 C. The plate was washed 3 more times.

Fifty microliters of a pare-~nitrophenylphosphate s:ol.ution (Kirkegaard & Perry Laboratories, Inc., Gaithersbur~, ~~.'0) were added and the color reaction was t al?owed to develop or a minimum of 20 minutes. The relative amount of SCFV binding was measured by optical density scanning at ~05~~450 nm using a microplate reader (Molecular Devices Corporation, Menlo Park, CA).

Hinding of the SCP'V resulted in decreased binding of the W~ 93/I~,Z31 ~ ~ ~ ~ ~ ~~ ~ PCf/AL1~1/00583 _50--biotinylated CC~9 with a concomitant decrease in color development. The average value for triplicate test samples is shorn in the table belowm . .~
Sample (50 ~ZL) 0D ~0~ nm .- OD 4~0 nm Ualue (mixed 1e1 with CC~9 Biotin) at ~Q minutes Sonicate E. colt AG1 / pSCFVUHH
clone 10 0.072 Sonicate .~. coli AG1 / pSCFvUHH 0 ~ 0~~
clone 71 CC~9 at ~ mglmL 7.076 CC~9 Fab at ~0 mg/mL 0.078 LB (negative control) 0~59 20 The data indicates that there was anti-TAG-72 activity present in the E.coli AGI/pSCFUUHH clone sonicate.
Example 7 The plasmid pSCFPUHH may be used to host other VH genes on Yho i.-N~~ I fragments and test in a SCFU
format, following the procedures set forth below. A
schematic for this process is shown here.
30 ;
~IJBST'1'Ct~T~ ~l~~E'f' F~e J.. ~e.
W~ ~3/I2231 ~'~r/AU~3Y/005~3 Discodery of Hum4 V~,--VH combinations Chat camp~ete crith l~nown osototype TAIy-binding antibodies or mimetics. .".
pSCFVUHH ~h0 I/N3te I
Vector DNA Fragment (CC49 Vg removed) or pATDFLAG XhoI,SPiheI Elector DHA Fragment Lsolate mHtdA fr~m peripheral blood lymphocytes Synthesize cDNA
a PCR amplify human Vg genQs using oligos HVH135, HVH2A, FiVH46 (as the 5° targeting oligos) and JHl245, JH3 and JH6 (as the 3' targeeing oligos) in all 9 combinations.
gel purify D~1A

Digest with Xho I and ~Vl~e I
Cel. purify .OPtA (~~H inserts ) Ligate Vector and Transform VH insert c~NAs F.coli s W~ 93/12231 p~'I'/A1.J91/005~3 -.M
Plate transformation mix onto hydrophilic membranes °
(137 mm) which are placed on LU CAM 20 agar plates (150 mm) with a calony density of ~ 50,000 per plate.
Grav for 8-16 hours at 37 'C.1 m SCFV is secreted Transfer hydrophilic membrane onto fresh L8 CAM 20 plate by E.cola having a TAG'-72-coated hydrophobic membrane (137 mm) already and may placed on the agar surface. Incubate for 24-96 hours.
bind to TAG.
I
Process hydrophobic membrane using a prototype biotinylated TAG-competing antibody, e.g. a72.3, CC49, CC83 or biotinylated competing peptide or mimetic. tTse assay stseptavidin conjugated with alkaline phosphatase to bind to biotin and suitable substrate for alkaline phosphatase to develop a color reacf~fon.

Co-relate clear zones on membrane assaq with calany(ies) on hydrophilic membrane. Isolatefpurify correct clone as necessary. Characterize DHA (sequence) and determine binding afFinity of SCF'Y to TAG-72. Purify SCI'V and perform in.occo animal biodistribucion studies.
Determine normal:tumor tissue binding profile by immunohistocaemistry.
Utilize Hum4 VG and Vg in e~refesred antibody farmers e.g. whole Ig (IgGl, IgE, IgM etc.) Fab or F(ab')2 fragment, or SCFd.
~~~5~~~~~~~

" 64693-5203 Isolatinz total RNA f~om oerioheral blood lvmohocvtes:
3lood from a normal, healthy donor is drawn into three 5 mL purple-cap Vacutainer tubes. Seven :nL
o~ blood are added to two 15 mL polypropylene tubes. An equal volume of lymphoprep (cat# AN5501, Accurate) is added and the solution is mixed by inversion. Both tubes are centrifuged at 1000 rpm and 18 °C for 20 minutes. The resulting white area near the too of the liquid (area not containing red blood cells) is removed Iron each sample and placed into two sterile polypropylene csntr'_fuge tube. Ten mL of sterile ?9S
are added and the tube mixed by inversion. The saaoles are centrifuged at 1500 rim and 18 °C for 20 minutes Total RNA is isolated from resulting pellet according to the RNAzoi~B Method (Chomczynski and Sacchi (1987), Analytical Biochemistry, 162:156-15g), Briefly, ~::e cell pellets are lysed in 0.u mL RNAzol solution (cat#:CS-105, Cinna/Biotecx). RNA is solubilized by passing :he cell pellet through a t mL pipet tip. Sixty p,L of chloroform are added and the solution is shaken for 15 seconds. RNA solutions are then placed on ice for 5 minutes. °hases are separated by centrifugation at 12000 x g and a °C ~or 25 minutes. The upper (aqueous) phases are transferred ;.o fresh RNase-free microcentrifuge tubes. One volume of isoorooanol is added and the samples placed at -20 °C for 1 hour. the samples are then placed on dry ce for 5 ;ninutes and ,0 finally centrifuged for u0 seconds at 1,000 :< g and J
°C. The resulting supernatant is removed from eac.~.
sampl-2 and the pellet is dissolved in 1:~4 u1, of ster;le RNase-free Water. final n~olarity is brought to 0.2M
NaCL. The DNA is reprecipitated by adding 2 volumes of 100 ethanol. leavi.~.g on ar~_~ ice for 10 minutes. s:~d *Trade-mark CA 02121041 2000-04-20 _ centrifugation at 14,000 ram and 4 C for 15 Minutes.

The supernatants are tzen removed, the pellets washed with 75~ ethanol and centrifuged for 8 minutes at '2000 x g and 4 C. The ethanol is then removed and the pellets dried under vacuum. The resulting RNA is then dissolved in 20 sterile watercontainin 1 g pi RNas in ~' (cat~:N2511, ?romega).

cDNA svnthesis:

cDNA synthesis is performed using a Gene Amp"

PCR kit (catl~: 'J808-0017 in clmer Cetus). RNasin'"
Perk (cats: :2511. ?romega), and MV reverse transcriptase A

(cat~t: :9004. ?romega). the following protocol 's used for each sample:

Components Amount MgCI= solution 4 p1 p 2 p1 PCR
buffer .I

c dATP 2 X11 dCTP 2 ~tl dGTP 2 ~t 1 dTTP 2 ~t 1 3' primer 1 p1 c5 (random hexamers) RNA sample 2 p1 RNasin 1 p1 AMV RT '_ . 5 ~t 1 ~0 Samples are heated at 80 'C f or ? ~i::utes _:~
slowly cooled to ~8 'C. ':he samales are .hen centr_:uged .or '0 seconds. :,MV ~~ve~se trar.scr:~tase is added .o the saaples whic:~ are then _~cuoated °or ~0 minutes at 57 °C. ~f tar _~cuoat_on. 0.5 u1 o:' e_c;~ ~NT?
*Trade-mark ~2j:~~~~.~
w~ ~3i~zz~~
_~~_ and 0.75 reverse transcriptase (cat~:109118, ~oehringer :Iannheim) are added. The samples are incubated for an additional 15 minutes at 87 °C.
PCR Reaction:
0ligonucleotides are designed to amplify human genes by polymerise chain reaction. The 5' oligonucleotides are set forth below:
HVH 1,35:
5'-TATTCTCGAGGTGCA(AG)CTG(CG)TG(CG)AGTCTGG-3' HVH2A :
5'-Tr?TTCTCGAGGTCAA(CG)TT(AG)A(AG)GGAGTCTGG-3' HVH~l6 :
5'-TATTCTCGAGGTACAGCT(AG)CAG(CG)(AT)GTC(ACG)GG-3' The 3' oligonucleotides are set forth below:
JH 125 :
5'-TTATGCTAGCTGAGGAGAC(AG)GTGACCAGGG-3' 2o JH3: ' 5'-TTATGCTAGCTGAAGAGACGGTGACCATTG
JH6:
5'-TTATGCTAGCTGAGGAGACGGTGACCGTGG-3' PCR reactions are performed with a GeneAmp'" ?CR
~cit (eat;~:N808-0017, Perkin ~lmer C~t~as) . Components are listed below:
a ~~J~3ST~~~~E SHE

~W~ 9~1I223I ~ ~ ~ ~ ~ /~{ ~ PC7r/AU91 /0053 ~06-~
Comvonents Amount dc3H~0 75 ~xr . _"

1d x buffer LO ~x1 d.~I.TP 2 p,1 _ dCTP 2 ~.I

d~TP 2 ~t 1 dTTP ~ ~1 I* Target D~1.~ 1 ~C1 2* 5 ~ primer 2 . 5 ~tl 3' primer 2.0 ~xl ~* AmpliTaq'' l.3 ~,1 Polvmerase *comz~onents addea in order at 92 °C
of first cycle PCR prograr~a stern 1 9~ 'C for 30 see~nds step 2 n0 °C for 1 minutes ~C step 3 T2 °C for ~5 seconds Approximately 35 cycles are completed for each reaction.
All PCR reactions are performed using a Pericin ~lmer CetuS PCR System 900 thermal cycier.
Treatment of ~iumaa~ V~, inserts with Yho I and Nhe I:
human V~ genes are digested ~aitt~ .Yho I ( cat~~:
~.31h,. New England Rio~abs) and a'Yhe I (cat~~: 14~L, New RngLand Biolabs). The following protocoL.i.s used for 3C each samules SL~~3S'~°~"~C!'~ ~~~E~' ~~ ~~i~zz3~ ~ .~ ~ ~ ~ ~% ~. ~~iA~~mo~s~3 --07°°
SU~3STANC~ At~IQUI~~' DN,~ ~ d ~ 1 ' w NEB Bu~~er ~2 4.S p1 Nhe i z ~tl Xho I 2 p1 ddHzO 16.5 ~xl 1Q Samples are incubated at 37 °C for one hov.r.
After this incubation, an additional 1.5 ~aL, Nh.e I is added. and samples are incubated an additional two hours at 37 °C.
Purification of DNA:
After the restrictive en~y~ne digest DNA :i.s run on a 5 percent golyaCrylamide gel (Saanbrook et al. (1989,, supra) . Bands o.f 390--420 by i.n size are excised from the gel. DNA is electroeluted and ethanol precipitated according to standard ~arocedures.
PCR products resulting from oligoa~ucleotide combinations are pooled togethero JHlz45 with HVH135, HtIHZA- and HVH46; vH3 with HVH135, HvIH2A and ~i~1469 JH6 G5 with HVH135, H~IHZA and HVH4~a. 'the volume of the .
resulting pools are reduced under vacuum to 50 ~icroliters. The pools are then purified from a 4 percent poiyacrylartide gel. ( Sambrook et al. ( 199 ) , sz~pra ) to isolate DNA fragments. Bands resultizsg at 390-42(3 by 3~ are excised from the ge3.. The DNA from excised gel slices is electroeluted according to standard protocols set forth in Sambrook, supraa ~ tJ ~ ~TI'~'l1'~°~ ~ Q~1 ~ "

Isolation of pSCFVUFiH Xho IlNhe I Vector Fraement Approximately 5 ug is 1~ uL oz pSCFVUHH piasmid is isolated using the Magic Mini-prep'" system (Promega). To this is added 5.4 pL OF_ lOX Buffer r2 (New England Biolabs), 43 units of Xho I (New England Biolabs), 15 units oz Nhe I and 24 pL of ddH20. The reaction is allowed to proceed ~or 1 hour at 37 °C. The sample is loaded on a 4X polyacrylamide gel, electrophoresed and purified by electroelution, as described earlier. The DNA pellet is dissolved in 20 uL
of ddH20.
One ::unared nanograms of pSCFVUHH digested with Yho I lNhe I is ligated with a 1 : t :polar ratio of >> ?urified human UH inserts digested with Xho I and Nhe I
using T4 DNA ligase (Stratagene). Aliquots are used to ;.ransform competent E. coli AG1 cells ( Stratagene ) according ~o the supplier's instructions.
GVWP hydrophilic membranes*(cat# GVWP1~250.
Millipore) are placed on CAM 20 LH agar plates (Samorook etal., 1989), One membrane is added ~o each plate. Four hundred microliters of the E.coli AG1 transformation suspension from above are evenly spread over the surface 25 of each membrane. The plates are incubated for 16 hours at 37 °C ambient =emperatures.
?reparation of TAG-72-coated mempranes:
A 1x dilution of partially ~urif:ed tumor 30 associated glycoprotein-72 !TAG-72) produced in LS174 'F-cells is prepared is T3S (cattt 28376. Piercs). Ten milliliters of t!~.e TAG dilution are placed to a Petri plate (catty 3-7~7-1u. Fisher) for future use.
immooilon-P PVDF~'transfer mempranes (cant SE151103.
Millipore) are immersed in methanol. :"he memoranes are *Trade-mark :han rinsed three times in sterile double distilled water. After the final wash, the excess water is allowed to drain. Each of the membranes are placed :n milliliters of dilute TAG-72. The memoranes are incubated at ambient temperature from t hour with gentle 5 shaking. After incubation, the membranes are blocked with Western blocking solution (25 mM Tris. 0.15 M NaCl, pH 7.6; tx HSA) for about t hour at ambient temperature.
Blocking solution is drained from the TAG
membranes. With the side exposed to TAG-72 facing up.
~he membranes are placed onto fresh CAM 20 plates.
resulting air pocKets are removed. The oacter:~l memoranes are then added, colony side up, to a TAG
t5 membrane. The agar plates are incubated for 24 to 96 hours at ambient Lemperatures.
The orientation of the TAG-72 and bacterial membranes are marked with permanent ink. Soth membranes are removed from the agar surface. T.he TAG-72 membrane is placed in 20 ml of Western antibody buffer (T8S in 0.05: Tweeri 20. cats P-t379, Sigma Chemical Co.; t~ BSA, cat~3203, Biocell Laboratories) contain=ng 0.2 ng of CC49-Hiotin probe antibody. The Dact~r'_al membranes are replaced on the agar surface in their prigiaal orientation and set aside. CC49-3iotin is allowed to bind to the TAG membranes for t hour at 3t °C with gentle shaking. :he aembranes are then washed three Limes with TTBS (TBS. 0.05 :weep-20) :or : minutes on an orbital shaker at :00 rpm. Strepta~r:cin alkaline anosphatase ( =at# 7100-v4. Southern ~io~ec.~..~,oiogy associates) is added .c Western antibody ::::fer ~o produce a 0. 1 ~ soiutiar.. :'he TAG-r 2 .Tinmbl'2~eS are eac~
:amersed in t5 milliliters o: Lhe strepcavicin solution and allowed Lo incubate '_'ar =0 :~inuLes at , 'C with *Trade-mark CIO 93/I223I PCTlAU9I/00~83 _70_ gentle shaking. After incubation, the membranes are washed as previously described. A final sash is then performed using Western alkaline phosphate buffer (8.~4 g NaC03, 0.203 g MgCl2~H?0, pF3 9.8), for 2 minutes at 200 rpm at ambient temperature. lo develop the membranes, o Western blue stabilized substrate (cats S38~d~, Promega) is added to each membrane surface. After 30 minutes at ambient temperatures, development of the membranes is stopped by rinsing the membranes three times with ddH20.
The membranes are then photographed. ';'he membranes are then photograhed and clear zones are corelated with colonies on the hydrophilic membrane, set aside ear lier.
Colony(ies) are isolated for growth in culture and used to prepare plasmid ONA for sequencing and protein preparation to evaluate specificity and affinity.
Identification of Hum4 Vr., human Vr~ combinations using pATDFLAG.
In a second assay system, Hum4 VL - human Vg ~0 combinations are discovered that bind to TAG-72 according to the schematic, suprc, exeeat for the following: at the assay step, IBI I~fII antibody is used as a probe to detect any Hum4 VL - Vg SCFV combinations 5 that have bound to the hydrophobic membrane coated with TAG-?2.
The plasmid pATDFLAG was generated from pSCFVUHH (see Figure 29) to incorporate a flag-coating sequence 3' of any human V~r genes to be expressed ,',0 continguously with Hum4 'J~. The plasmid pATDFLAG, when digestzd raith mho I and sYhe I and nuritied becomes the human C~ discogery piasmid containing Hum4 VL in this SCFV format. The plasmid pATDFLAG was generated as -follows. Plasmid pSCFVOH~i treated ;with ~:ho I and lVhe I
(isolated and described aboae) ;aas used in a ligation SIUESTITUTE S!-~EET

~i'~ 93/12231 PC°I'/A'LJ9~/Ofl583 --71-°
reaction with the annealed FLAG and FLAGNC
oligonucleotides.
FLAGCs 5°~TCGAGACAATGTCGCTAGCGACTACAAGGACGATGATGACAAATAAAAAC~3' FLAG~IC
5'--CTAGGTTTTTATTTGTCATCATCGTCCTTGTAGTCGCTAGCGACATTGTC~3' Fquimolar amounts (1 x 10"x~ moles of each of 1Q the oligonucleotides FLAGC and FLAGNC were mixed together using a ligation buffer (St.ratagene). '~,'he sam.~le is heated to 94 °C and is allowed to cool to below ~5 °C before use in the ligation reaction below.
~5 Li~ation Reaction to Obtain pATDFLAG
COt~PONEII~11'r AMG(JIeTTT
pSCF V U.Gdg ~~~ ~ ~~~P. ~ a 5 ~~
I vector 20 ANNFALED 0.X5 ~1 FL~1GC/F'LAGI~1C
lOX Ligation 2 ~1 buffer T4 DNA LIGASE 1 p.1 25 ~,o ~ ATg 2 ~z ddHzO 12.65 p1 ~0 °~he zeaction is carried out using the following components and amounts according the ligation protocol disclosed above, Ecoli AG1 cells (Stratagene) are traasformed with 3 p.1 of the above ?igation reaction and c~lonies se~.ected using CAM 20 plates. Clones haring ~ t~J B ~'~'1~'L~?'l~ ~ ~-I ~ ~°t°

'W~ 93/12231 ~ ~ ~ ~ ~ ~ ~ PC~/AU9I/00583 appropriate Nhe x, Xho I and .Nhe IlXho I restriction patterns are selected for DNA sequencing.
x The oligonucleotide used to verify the sequence of the FIaAG linker in PATDFLAG (see Figure 2S) is called .
PENPTSEQ: 5'-CTTTATGTAAGATGATGTTTTG-3. This oligonucleotide is derived fro~aa the non-coding strand of the peraP teraainator region. DNA sequencing is performed using Sequenase"' sequencing kit (U. S. Eiochemical, Cleveland, OH) following the manufacturer's directions.
~D The DNA and deduced amino acid sequences of the H:um4 VL
- UNI~OPE linker -- FLAG peptide is shown in Figure 2S.
Generating nSC49~ FLAG_ The GC49V~ is inserted into the sites of ~'~ho i - N'he I gATDFLAG (see Figure 29) and evaluated. for biological activity with the purpose of serving as a positive control for the FLAG assay system to detect binding to TAG-12. The new plasmid, called pSC49FLAG
(see Figure 29) is generated as follows. The plasmid pATDFLAG C5 mg, purified from a 2.5 ml culture by the Magic MinipreF~" system ~Promega) is treated ~~rith s~ho I
and l~he .I and the large vector fra~.gment purified as described above for pSCFVtTHA. The CC49 V~ insert DNA
fragment ~.s obtained by gCR amplification from pSCFVUHH
and oligonucleotides ITNI3 as the ~' end oligonucleotide and SC49FLAG as the 3' end oligonucleotide. The resulting DNA and amino acid sequences of this SCFV
30 antibody, with the FLAG peptide at the C-Cera~inus~ °s shown in Figure 30. The PCR reaction is carried out using 100 pmol each of the oligonueleotides, 0.1 ng of _ pSCFtarget DNA (uncut) and the standard protocol and reagents provided by Perkin Elm.er Cetus. The DNA is first gel purfied, then treated with ~Yho I and. ~'~Tha I to ~ lJ ~ ~'f iTU'1'~ S H ~ ET

WO 93/1~2~~ ~ ~ ~ ~ ~ ~~ ~ PCT/ALJ91/005$3 _73~
generate sticky ends and purified from a ~~
polyacrylamide gel and electroeluted as described earlier. The DNA vector (pATD~'LAG treated wraith :oho z and Nhe T ) and the insert °( CC~9 Vg PCR product from.
' pSCFVLTFiH treated with ~~ho I and Nhe T ) are ligated in a 1:1 molar ratio, using 100 ng vector DNA (Stratagene kit) and used to transform ~.coli AG1 competent cells (Stratagene) according to the manufactureris directions.
A coi.ony with the correct plasuqid DNA is picked as the pSC49FLAG clone.
Liaation of pATDFLAG Vector with PCFt Amplified H!.~m4 V
Inserts The protocol for the ligation reaction is as follows:
COMPO~I~NT AMOUNT
DNA vector : pATD.~ LAG X~ho 2 . 5 pL
I/Nhe I
Fium Vs (X) DNA inserts: Xho 6 ~aL
I/Nhe I
10 mM ATP (Stratagene) 2 pL
lOX buffer (Stratagene) 2 pL
T4 DNA ligase (Stratagene) 1 pL
ddH~o b.5 ~L
m 30 DNA vector, ATP, lOX buffer and ddH~,O are combined. DNA insert and T4 DNA ligase are then added.
Ligation reactions are then placed in a 4 L beaker containing H20 at 18 °C. The temperature of the water ~ll~S'~'ITtJ'TE S!-iEE'T' WO ~~/12231 ~ ~ ~ _~ y ~ ~ PG"'f/AU91/00583 _T~
is gradually reduced by refrigeration at 4 °C overnight.
This ligation reaction generates p~ium~r V~, °~ hum.V~ (X).
Transzormat~.on of E. toll AG1 with Hum4 V~-~ium V.. (X ) Li~ati.on Mix Transformation of pATDFLAG into competent E.cvli .A.~Gl cells (Stratagene, La Jolla) is achieved following the supplier's protocol.
TBT MTI Anti-FLAG Antibody Plate Assay The first three steps, preparation of TAG~-coated membranes, plating of bacterial membranes, 3:Id assembly of TAG and bacterial membranes, are the same as those described in the CC49-Biotin Competition ?hits Assay.
After the 24 hour incubation at ambient temperatures, the membranes are washed with TTBS three times at 250 rpm for four minutes. The MIT antibody (cats IB130't0, Tnternational Biotechnologies, Inc.) is then diluted with TBS to a concentration ranging f:°om T0.85 gg/ml to 0.03 ~Zg/ml. Ten millilters of the diluted antibody are added to each membrane. The membranes are then incubated for 1 hour at ambient temperatures and shaken on a rotary shatter at 70 rpm.
After incubation, the MII antibody is removed and ~he membranes are washed three times at 250 rpm and ambient temperatures for a minutes. The final wash is removed and 20 miliiters of a 1:2000 dilution oi" sheep anti-mouse horseradish peroxidase .inked whole antivody .
(cat~~ NA931t Amersham) is prepared with TBS and added to each membrane. The membranes are again incubated for 1 hour at ambient temperatures and 70 rpm. FO110W~.rag incubation, the membranes are washed three Times _.. 250 8lIE3S'f1'fU'f E ~HE~'1' rpm and ambient temperature for 5 minutes each.
Enzygraphie Webs~(cat~ IB821?05~. International 6iatechnologies. Inc.) are used according to develop the memoranes, according to the manufacturer's instructions.
The membranes are then photographed:
Instead of seeing a clear zone on the developed membrane for a positive Hum4 VL-VH (X) clone producing an SCFV that binds to TAG-72, (as seen with the competition screening assay) in this direct FLAG -detectin assn g y, a blue-purple spot is indicative of a colony producing a SCFV that has bound to the TAG-72 coated membrane. The advantage of using the FLAG system is that any Hum4 VL - V~ SCFV combination that has bound to TAG-72 will be detected. Affinities can be measured by Scatchard analysis (Seatchard (1949), supra) and specificity by immunohistochemistry. These canidates could then be checked for binding to a specific epitope by using the competition assay, supra, and a competing antibody or mimetic, if desired.
The present invention is not to be limited in scope by the cell lines deposited since the deposited embodiment is intended astwo illustration of one asoect of the invention and all cell lines which are functionally eauivalent are within the scope of the invention. Indeed. while this invention has been described in detail and with reference to specific embodiments thereof. .t will be apparent .o one skilled in_the art that various chances and modifications could be made therein without ceparting °rom the spirit and scope of the appended claims.
*Trade-mark

Claims (44)

CLAIMS:

1. A Hum4 V L, V H antibody or an antigen-binding fragment thereof which specifically binds to TAG-72 antigen, said antibody fragment comprising at least one light chain variable region (V L) and at least one heavy chain variable region (V H), wherein (a) the V L is a human kappa Subgroup IV V L
containing the human Subgroup IV germline gene (Hum4V L) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and (b) the V H is an anti-TAG-72 V H encoded by a DNA
coding sequence encoding, as said V H, at least the heavy chain variable region of an antibody which specifically binds TAG-72 antigen, said coding sequence being at least 90% homologous to the V H .alpha.TAG germline gene (V H .alpha.TAG) coding sequence; and the V H is capable of combining with the V L to form a three dimensional structure having the ability to specifically bind TAG-72 antigen.

2. ~The Hum4 V L, V H antibody or fragment thereof of Claim 1, wherein the V L is further encoded by a human J gene segment.

3. ~The Hum4 V L, V H antibody or fragment thereof of Claim 1, wherein the V H is encoded by a DNA coding sequence which comprises the V H .alpha.TAG germline gene (V H .alpha.TAG) coding sequence or a productively rearranged anti-TAG-72 V H-encoding derivative thereof.

4. ~The Hum4 V L, V H antibody or fragment thereof of Claim 1, wherein the V H is further encoded by a mammalian D
gene segment.

5. ~The Hum4 V L, V H antibody or fragment thereof of Claim 1, wherein the V H is derived from the variable regions of CC46, CC49, CC83, or CC92.

6. ~The Hum4 V L, V H antibody or fragment thereof of Claim 1, wherein the V H is a humanized anti-TAG-72 V H
comprising (1) anti-TAG-72 V H CDRs grafted into (2) human V H
framework regions.

7. ~The Hum4 V L, V H antibody or fragment thereof of Claim 1, wherein the light chain further comprises at least a portion of a human constant region (C L) and the heavy chain further comprises at least a portion of a mammalian constant region (C H).

8. ~The Hum4 V L, V H antibody or fragment thereof of Claim 7, wherein the CH is human IgG1-4, IgM, IgA1, IgA2, IgD, or IgE.

9. ~The Hum4 V L, V H antibody or fragment thereof of Claim 7, wherein the C L is kappa or lambda.

10. ~A Hum4 V L, V H single chain antibody or an antigen-binding fragment thereof which specifically binds to TAG-72 antigen, said antibody or fragment comprising (a) at least one light chain having a variable region (V L), said V L being a human kappa Subgroup IV V L
containing the human Subgroup IV germline gene (Hum4 V L) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and (b) at least one heavy chain having a variable region (V H), said V H being an anti-TAG-72 V H encoded by a DNA
coding sequence encoding, as said V H, at least the heavy chain variable region of an antibody which specifically binds TAG-72 antigen, said coding sequence being at least 90% homologous to the V H.alpha.TAG germline gene (V H.alpha.TAG) coding sequence; and at least one polypeptide linker linking the V H
and V L, wherein the V H is capable of combining with the V L to form a three-dimensional structure having the ability to bind TAG-72 antigen and the polypeptide linker allows the proper folding of the V H and V L into a single chain antibody which is capable of forming said three-dimensional structure.

11. ~A Hum4 V L, V H antibody conjugate comprising the Hum4 V L, V H antibody or fragment thereof of Claim 1 conjugated to an imaging marker or therapeutic agent.

12. ~The Hum4 V L, V H antibody conjugate of Claim 11, wherein the imaging marker is selected from the group consisting of 125I, 131I, 123I, 111In, 105Rh, 153Sm, 67Cu, 67Ga, 166Ho, 177Lu, 186Re, 188Re, and 99m Tc.

13. ~The Hum4 V L, V H antibody conjugate of Claim 11, wherein the therapeutic agent is a drug or biological response modifier, radionuclide, or toxin.

14. ~The Hum4 V L, V H antibody conjugate of Claim 13, wherein the drug is methotrexate, adriamycin or interferon.

15. ~The Hum4 V L, V H antibody conjugate of Claim 13, wherein the radionuclide is 131I, 90Y, 105Rh, 47Sc, 67Cu, 212Bi, 211At, 67Ga, 125I, 186Re, 188Re, 177Lu, 99m Tc, 153Sm, 123I, or 111In.

16. ~A composition for cancer treatment comprising a pharmaceutically effective amount of the Hum4 V L, V H antibody or fragment thereof of Claim 1 in a pharmaceutically acceptable, non-toxic, sterile carrier.

17. ~A composition for cancer detection comprising a pharmaceutically effective amount of the Hum4 V L, V H antibody conjugate of Claim 12 in a pharmaceutically acceptable, non-toxic, sterile carrier.

18. ~A composition for cancer treatment comprising a pharmaceutically effective amount of the Hum4 V L, V H antibody conjugate of any one of Claims 13 to 15 in a pharmaceutically acceptable, non-toxic, sterile carrier.

19. ~A method for in vivo diagnosis of cancer which comprises administering to a mammal a pharmaceutically effective amount of the composition of Claim 17 for the in situ detection of carcinoma lesions.

20. ~The method of Claim 19, wherein the mammal is a human.

21. Use of the composition of Claim 18 for the treatment of cancer in a mammal.

22. The use according to Claim 21, wherein the mammal is a human.

23. Use of the composition of Claim 17 for localizing a tumor in intraoperative therapy in a mammal.

24. The use of Claim 23, wherein the mammal is a human.

25. A cell capable of expressing a Hum4 V L, V H antibody or antigen-binding antibody fragment having binding affinity for TAG-72 antigen, said antibody or fragment comprising at least one light chain variable region (V L) and at least one heavy chain variable region (V H), wherein (A) the VL is a human kappa Subgroup IV V L
containing the human Subgroup IV germline gene (Hum4 V L) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and (B) the V H is an anti-TAG-72 V H encoded by a DNA
coding sequence encoding, as said V H, at least the heavy chain variable region of an antibody which specifically binds TAG-72 antigen, said coding sequence being at least 90% homologous to said V H.alpha.TAG germline gene coding sequence, said VH being capable of combining with said V L to form a three-dimensional structure having the ability to specifically bind TAG-72 antigen;

said cell being transformed with (C) a first DNA sequence encoding said V L; and (D) a second DNA sequence encoding said V H.

26. The cell of Claim 25, wherein the first and second DNA sequences are contained within at least one biologically functional expression vector.

27. A process for producing a Hum4 V L, V H antibody or antibody fragment having binding affinity for TAG-72 antigen, said fragment comprising at least the variable domains of the antibody's heavy and light chains, in a single host cell, the process comprising the steps of:

(A) transforming at least one host cell with (i) a first DNA sequence encoding a human kappa Subgroup IV light chain variable region (V L) containing the human Subgroup IV germline gene (Hum4 V L) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys, and (ii) a second DNA sequence encoding an anti-TAG-72 heavy chain variable region (V H) which is capable of combining with the V L to form a three-dimensional structure having the ability to bind TAG-72 antigen, the coding sequence thereof being at least 90% homologous to the V H.alpha.TAG germline gene (V H.alpha.TAG) coding sequence and (B) independently expressing said first DNA
sequence and said second DNA sequence in said transformed host cell.

28. The process according to Claim 27, wherein said first and second DNA sequences are present in at least one vector.

29. The process according to Claim 28, wherein the antibody heavy and light chains of the Hum4 V L, V H antibody or fragment that are expressed in the host cell are secreted therefrom as an immunologically functional antibody molecule or antibody fragment.

30. The process of Claim 27, wherein the second DNA
sequence encodes the V H of CC46, CC49, CC83 or CC92.

31. A process for preparing an antibody or antibody fragment conjugate which comprises contacting with an imaging marker or therapeutic agent:

a Hum4 V L, V H antibody or antibody fragment having binding affinity for TAG-72 antigen and comprising at least one light chain variable region (V L) and at least one heavy chain variable region (V H) wherein (A) the V L is a human kappa Subgroup IV V L
containing the human Subgroup IV germline gene (Hum4 V L) amino acid sequence, Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Val Ile Lys;
and (B) the V H is an anti-TAG-72 V H encoded by a DNA
coding sequence encoding, as said V H at least the heavy chain variable region of an antibody which specifically binds TAG-72 antigen, said coding sequence being at least 90%
homologous to said V H.alpha.TAG germline gene coding sequence, said V H being capable of combining with said V L to form a three-dimensional structure having the ability to specifically bind TAG-72 antigen.

32. The process of Claim 31, wherein the imaging marker is 125I, 131I, 123I, 111IN, 105Rh, 153Sm, 67Cy,m 67Ga, 166Ho, 177Lu, 186Re, 188Re or 99m Tc.

33. The process of Claim 31, wherein the therapeutic agent is a radionuclide, drug or biological response modifier, toxin or another antibody.

34. The Hum4 V L, V H antibody or fragment thereof of Claim 1 wherein the antibody is MP1-44H produced by a cell line having the identifying characteristics of ATCC HB 10426 or MP1-84H produced by a cell line having the identifying characteristics of ATCC HB 10427.

35. The cell of Claim 25 wherein the Hum4 V L, V H
antibody or fragment has, at least one V H thereof, a V H
derived from a heavy chain of CC46, CC49, CC83, or CC92.

36. The cell of Claim 25 wherein the Hum4 V L, V H
antibody or fragment is MP1-44H produced by a cell line having the identifying characteristics of ATCC H B 10426 or MP1-84H produced by a cell line having the identifying characteristics of ATCC H B 10427.

37. The cell of Claim 25 wherein the anti-TAG-72 V H of the Hum4 V L, V H antibody or fragment is a humanized anti-TAG-72 V H comprising (1) anti-TAG-72 V H complementarity determining regions (CDRs) grafted into (2) human V H
framework regions.

38. The cell of Claim 25 wherein the Hum4 V L, V H
antibody or fragment has, as each light chain thereof, one said V L covalently attached to a human light chain constant domain (C L) and has, as each heavy chain thereof, one said V H
covalently attached to at least one mammalian heavy chain constant domain (C H).

39. The cell of Claim 38 wherein the Hum4 V L, V H
antibody or fragment thereof has the C H selected from the group consisting of IgG1-4, IgM, IgAl, IgA2, IgD or IgE.

40. The process of Claim 31 wherein the Hum4 V L, V H
antibody fragment has the V H derived from the variable regions of CC46, CC49, CC83 or CC92.

41 The process of Claim 31 wherein the V H of the Hum4 V L, V H antibody or fragment is a humanized anti-TAG-72 V H
comprising (1) anti-TAG-72 V H complementarity determining regions (CDRs) grafted into (2) human V H framework regions.

42. The process of Claim 31 wherein the Hum4 V L, V H
antibody or fragment has, as each light chain thereof, one said V L covalently attached to a human light chain constant domain (C L) and has, as each heavy chain thereof, one said V H
covalently attached to at least one mammalian heavy chain constant domain (C H).

43. The process of Claim 42 wherein the Hum4 V L, V H
antibody or fragment thereof has the C H selected from the group consisting of IgG1-4, IgM, IgAl, IgA2, IgD or IgE.

44. A process for preparing an antibody or antibody fragment conjugate which comprises contacting with an imaging marker or therapeutic agent:

a Hum4 V L, V H antibody or antibody fragment having binding affinity for TAG-72 antigen;

wherein said Hum4 V L, V H antibody or fragment is produced according to the process of any one of Claims 27-30.