CA2116109A1 - Multimeric forms of human rhinovirus receptor protein - Google Patents

Abstract

The present invention relates to novel forms and configurations of intercellular adhesion molecule (ICAM) including multimeric configurations that effectively bind to human rhinovirus and can effectively reduce HRV infectivity. When in a multimeric configuration, preferably as dimers, these proteins display enhanced binding of HRV and are able to reduce HRV infectivity as well as the infectivity of other viruses known to bind to the "major" group human rhinovirus receptor (HRR). The multimerized proteins may also be used to block tICAM interaction with lymphocyte function-associated antigen-1 (LFA-1).

Description

W~ 94/0~4X5 2 ~ P~r/US93/O~g72 ,~' J
MULT~MERIC FORMS OF HUMAN RHINOVIRUS RECEPTOR PROTEIN

BACKGR(:)IJND QF THE I~ENTION

This application is a continuation-in-part of copending application USSN
07/7049984 (filed 24 May 1991), which in turn IS a continuation-in-part of copending application USSN 07/556,238 (filed 20 July 1990).
The present invention relates to novel forms and multimeric configurations of intercellular adhesion molecule (ICAM), including both full-length and truncatedforms of these proteins, that effectively bind to human rhinovirus and can effectively reduce HRV infectivity, and to methods of making and using same.
Full-length ICAM, also known as human rhinovirus receptor (HRR), is termed transmembrane ICAM (tmICAM-1); non-transmembrane ICAM forms, also known as tn~ncated ICAM (tICAM), are less than full length. When in a multimeric ., configuration, preferably as dimers, these protems display enhanced binding of human ; rhinovirus (HRV)~ and~ are able ~o reduce HRV infectivity. ln addition, these :: `
15 ~ ~multimerized proteiDs may :also be used to reduce infectivity of other viruses that are known to bind to the 'major' group human rhinovirus receptor (HRR), such as Coxsache A virus, ~and may also be llsed ~to block ~transmembrane intercellular adhesion moiecule (tmlCAM) interac~ion with lymphocyte function-associated antigen-; ~ 1 (LFA~ which lS ;critical; to many cell ~adhesion processes.involvcd in the 20~ ~mmunologi~al response. ~Lastly, these~multimenzed proteins may be used to study the lCAM-1/HR~V interaction especially with respect to designing o~her ~rugs directed a~ affectillg this interaetion.
Human~ rhmov~ruses are the major causative agent of the cornmon cold. They belong to the picornavirus family and can be classified based on the host cell receptor to which they bind. Tomassini, et al., J. Yirol., 58: 290 (1986) reported the isolation o~ a receptor proteln~ lnvolv~d In the ~cell attachment of human rhinovirus.
~pproximately 90%~of the more than 1}5 serotypes of rhinoviruses, as well as several types of ~Coxsackie A virus, bind to a single common receptor termed the: ~
"major'i human rhinovirus receptor (HRR); the remaining 10% bind to one or more other cell receptors.

:
SUBST~TlJT~ ~h~

.. .. ..

2 1 ~ 9 -2-Recently, Greve, l. et al., Cell, 56:839 (1989), co-authored by the co-inventors herein, identified the major HRR as a glycoprotein with an apparent molecular mass of 95,000 daltons and having an annino acid sequence essentially identical to that deduced ~rom the nucleotide sequence of a previously described cell S surface protein named intercellular adhesion molecule (ICAM-1) ~see Fig. 1, Simmons, D. et al., Nature, 331:624 ~1988); Staunton, et al., Cell, 52:925-933 (l988)]. Subsequently, Staunton,~D.E., et al., Cell, 56:849 (1989), confirmed that ICA~-1 is the rnajor surface receptor for HRV. See also, Staunton, et al., Cell,61~:243-254 (1990). ICAM-1 is an integral membrane protein 505 amino acids long 10 and has: i) five Immunoglobu1in-llke extracellular domains at the amino-terminal end (arnino acid residues 1-453), ii) a hydrophobic transmembrane domain (454-477), and iii) a short cytoplasmic domain at ~he carboxy-terminal end (478-505). See Fig. 2.
ICAM-] is a ~member of the immunoglobulln sup~rgene family and functions as a ligand for the leukocyte molecule, lymphocyte function associated molecule-1 (LFA-15 1~, à member~ of the integrin ~amily. Heterotypic binding of LFA-1 to ICAM-1 mediates cellular adhesion~of diverse ~cell types and is important in a broad range of mmune mteractions; induct~on~of ICAM-l~expression by cytokines dunng the inflammatoryrésponse;may regulate 1eukocyte localization to~inflammatory sites. The primary~ structure of ICAM-I has been found~;to be homologous to two cellular 20~ ~ adhesion ~molecules, i.e., neural cell adhesion molecule ~N(:~A~) and myelin-;associated glycoprotein~(~AGj.
Several~ approaches to decreasing infectivity of viruses in general, and of ; rhinovlrus~in;particular, ~have~been pursued mcluding:~ i) developing antibody to the cell surface receptor for use in blocking viral binding to the cell, ii) using interferon 25 to promote an anti-vir~ state~ in host~cells; lii) developing various agents to inhibit vlraI replicabon; ~iv) developing~ antibodies to viral~ capsid proteins/peptides; and v) blocking viral ~inf~ion wlth~ solated ~cell surface receptor protein that specifically blocks the ~vlral blnding domain of the ~cell sur~ace receptor.
Us~ng~ thls last approach, Greve,~ et al., Cell, 56:879 (1989), supra, reported 3 0 that punfied tmIC~M-l could bind to~rhinovirus~ HRV3 in vitro. Unpublished results with HRV2, HRV3, and HRV14 demonstrate~a~positive correlation between the ability ...
: ~.
:::: : :

CI IR.~TITI ITF~ JFFT:

W0 94/00485 2 ~ 9 PC~/U~93/05~72 to bind to rhinovirus and the ability to neutralize rhinovirus particularly if the binding studies are carried out under conditions where ICAM-1 is presented in a particular form and configuration as discussed furthert infra. Results (unpublished) using HRV14 ~nd HRV2 demonstrate a positive correlation between the receptor class of S the virus and the ability to bind to tmICAM-1 in vitro. irhat is, ICAM-1, being the major receptor, can bind to HRV3, HRV14, and other "major" receptor serotypes and neutralize them, while it does not bind or neutralize HRV2, a "minor" receptor serotype. Further studies (unpublished), using puri~led tmICAM-l, demonstrate that it effectively inhibits rhinovirus infectivity in a plaque-reduction assay when the rhino~irus is pretreated with tmICAM-l ~50% reduction of titer at 10 nM receptor and one log reduction of titer at 100 nM receptor protein). These data were consistent with the affinity of rhinovirus for ICAM-l of Hela cells, which had an apparent dissociation constant of 10 nM, and indicated a direct relationship between the ability of the receptor to bind to the virus and to neutralize the virus. Because large-scale production of tmI(:~AM-l is not presently economically feasible, and because , mairltenance of tmICAM-I in an active form requires the use of detergents, alternate means of producing a receptor protein for use as a rhinovirus inhibitor are desirable.
Porms of the tmICAM-I cDNA gene have been developed (as well as cell lines that produce the expression ~products; USSN 07/390,662) that have been genetically altered toproduce truncated ICAM-l molecules. Seel~ig. 2. These truncated forms of ICAM-l (tlCAM(4533 and tlCAM(1~85~ lack the tr~nsmembrane r~gion and are secreted into the cell culture medium. They bind ~o rhinovirlls in the assay descnbed in Gre~e, et al., Ce11, 56:879 (1989j, supra, although at substantially reduced levels relative to tmlCAM-l. Thus, their effectiveness as inhibitors of rhinoviral infectivity appeared to be less~ than that of tmICAM-l. See generally co-pending applications USSN 07/239,571; USSN 07i'262,428; USSN 07/678,909; USSN 07/631,313; USSN
071301,192; USSN~ 07/449,356; USSN 07/798,267; USSN 07/556,238; USSN
07/7û4,996j and USSN 07/7û4,984.
USSN 0712397571 filed September 1, 1988, and its CIP applications USSN
07/262,428, USSN 07/390,662 (abandoned in favor of continua~ion USSN
07/678,909), USSN 07/631,313, and USSN 07/704,996 are dire~ted to the use of :

SUBSTIT~TE SH~E.- ~

WO 94/0048S PCr/US93/05~72 2 ~ 9 transmembrane rhinovirus receptor as an inhibit~r of rhinovirus infectivity using non-ionic detergent to maintain the transmembrane protein in solution, and directed to truncated intercellular adhesion molecules (tICAM) comprising one or more of theextracellular domains I, II, III, IV, and V of tmICAM, which truncated forms do not S require the presence of non-ionic detergent for solubilization ~see Fig. 2).
USSN 07/130,378 filed December ~, 1987 (abandoned in favor of continuation application USSN 07t798,267), and CIP application USSN 07/262,570 (now abandoned) are directed to transfected non-human mammalian cell lin s which express the major rhinovirus receptor (HRR) and to the identification of HRR as intercellular 10 adhesion molecule. ~ ~
USSN 07/301,192, filed January 24, 1989, and its CIP application USSN
07/449,356 are directed to a naturally- occurring soluble ICAM (sICAM) related to but distinct from tmlCAM in that this slCAM læks the amino acids spanning the transmembrane region and the cytoplasmic region; in addition this sICAM has a novel 15 sequence of 11 amino acids at the C-termlnus.
ubsequently,~ Marlin, S.D.; et al., Nature, 344:70 (l990), reported the construction~and punficat~on of a truncated soluble form of the normally membrane-bound ICAM-1 molecule; which~ $hey termed sICAM-1. It has both the transmembrane domain and the cytoplasmlc domain of the protein deleted and differs 20 from the wild-type amino acid sequenee by~ a single conservative s~bstitution at its carboxyl end.~ lt ls composed of residues 1-452 of ICAM-I plus z novel phenylalanine residue ~at the C-terminus. These workers demonstrated that slCAM-I was requiredat levels >50 ~g/ml to prevent ~he~binding of HRV14 virus to cells. Howev~r~ they also found that sICAM-I at l ~g/ml (18 nM), when continually present in the culture 25 medium, was able to inhlbit by 50~% ~h~ progressivn of an infection by HRV54. The inhibitory activity was correlated wlth the ~ receptor class of the virus, in that Coxsache A13 but not poliovirus~or HRV2 was~inhibited; infectivity data for HRV14 was not reported,~however. Thus,~ they ~did not demonstrate a direct correlationbetween binding and inhibition of iDfectivity. Further, as discussed in greater detail, 30 infra, attempts to ~reproduce the results obtained by Marlin, et al. have no~ been successful.

SlJBS I ~ SHEE;I

WO ~4t00485 PCl /US93/05972 21iSI~9 :

To date, no one has been able to demonstrate an agent that binds to and effectively reduces infectivity of human rhinovirus (by blochng vira~ infection with isolated cell surface receptor protein) ~s effectively as tmICAM-l; accordingly there continues to exist a need in the art for a form of ICAM-1 that can effectively bind to S human rhinovirus and can effectively reduce HRV infectivity.
: ' BR~F SIJMMARY OF THE INVENTION
.
Provided by the invention are multimeric configurations of transmembrane ICAM (tmlCAM-l~ and multimenc configurations of non-transmembrane ICAMs (tICAMs), having improved rhinovirus binding and inhibition activity.
As noted, supra, tmlCAM-I isolated from mammalian cells has the capacity to neutralize human rhinoviruses belonging to the major receptor group, ~ut only if maintained ~n solution with detergent. Certain ~soluble fragments of ICAM-I havebeen found to have~a reduced capacity for binding virus and do not reduce infectivity as effectively as~tmI AM-l. To date, no one has been able to ascertain the reason for this reduced capacity.
~ : , , It has~been proposed by others that the rhinovirus receptor exists on cells in apentameric~form [Tomassini, J., and Colonno, ~., J. Virol., 58 290-295 (1986)].However, quantitation ~(unpublished results of the co-inventors herein) of the rhinovirus and~anti~ AM-l monoclonal ~tibody (Mab) binding to HeLa cells has 20 ~ reveal~d: a maximum~of 30,000 virions ~bound per cell (détermined by the binding of [35S]methionirle-labeled HRV) and 50,000-60,000 ICAM-I molecules per cell ~etermined by the~ binding of radio-labeled Mab to ICAM-1). These results prompted further studies to examine the possibility that rather than five, only between , one~;and two ICAM-~l molecules~ on the ~surface of cells are bound per HRV particle bound to the cell. ~
Genetically engineered forms of truncated ICAM-1 that lack the C-terminal transmembrane domain are secreted into the culture medium of mammalian cel]s transfected with- the~recomb~nant gene. The purification of such secreted ICAM
molecules from spent culture medium of cells seably trans~ected with the genes ~ SUBSTITUTE SHEET

W~ 94/00485 PCI/US93/05972 . .
2 1 ~ s~ "

therefior is described herein. In a solution-HRV binding assay and in an 3HRV
neutralization assay, it was found that the monomeric forms tend to have substantially reduced avidity for HRV relative to tmICAM-1. However, it has now been discovered that when such tICAMs are presented in multimeric form and then .
S incubated with HRV, the virus-binding activity of the multimeric tICAMs becomes comparable to that of trmICAM-1. This binding of multimeric tICAMs tv HRV has the same properties as the binding of HRV to ICAM-l on HeLa cells: it is inhibited by anti-ICAM-1 Mabs, it is specific for rhinovimses of the major receptor group, and has the same temperature dependence as the binding of rhinovirus to cells (i.e., binds 10 well at 37C and undetectably at 4C). It is postulated that tmICAM exists in nature in a mu}timeric, possibly dimeric form, and that such constructs more closely resemble the native configuration, with its attendant high avidity for the humanrhinovirus. Such dimerization may conveniently be achieved in vitro by, e.g., crosslinking two ICAM monomers by chemical means or by crosslinking with 15 appropriate a~ntibodies, or by binding rnonomers to appropriate inert substrates.
Multimerization~can also be achieved in vivo by modific~tion of the gene sequence coding for the select ICAM to provide appropriate binding sites in the corresponding peptide sequence. For example, muteins can be engineered which contain appropriate cysteine residues to allow in vivo multimenzation via in~erchain disulfide bonding.
20 ~Iternatively, a DNA sequence coding for an ICAM may be fused with a DNA
sequence coding for an appro~riate lmmunoglobulin or fragment thereof, such thatthe fusion gen~ product possesses~ at least one site suitable for interchain bonding.
The resulting fusion peptide monomer can t!~en be expressed by the cell in multimeri~
form. Under certain circumstances, the benefits of multimeriza~ion may also be 25 ach~eved by construction of ICAM~ mu~eins containing multiple rhinovirus binding sites.
Also provid~d by the invention are methods for enhancing binding of ICAM
and functional denv~atives thereof to a llgand, i.e., human rhinovirus, and "major"
group receptor viruses, lymphocyte function-associated antigen-l (LFA-l), 30 Plasmodium falciparum (malaria) and the li}~e, wherein the ICAM is presented in a , : '.;

SUBS~ITU ~ E ~HEE I ~`

WO 94/0~485 PCr/US93/05972 2 ~ r~

multimeric configuration to the ligand to facilitate binding of the ICAM to the ligand.

The invention further comprises a method for inducing irreversible uncoating of human rh;novirus, said method comprising contacting said human rhinovims withICAM-l or a fra~gment thereof.
This invention also provides a novel method of irreversibly inhibiting infectivity of a rnammalian cell by a human rhinovirus, said method comprising contacting said human rhinovirus with ICAM- 1 or a fragment thereof under conditions which allow the ICAM-1 or fragment thereof to bind to said rhinovirus;
thereby stimulating irreversible uncoating of said rhinovirus.
Also provided by the invenhon are novel pharmaceutical compositions comprising a pharmaceutically acceptable solvent, diluent, adjuvant or carrier, and as the active ingredient, an e~tective amount of a polypeptide characterized by having ;- human rhinovirus binding activity and reduction of virus infectivity. Dirneric configurations of ICAM and fragments thereof are presently preferred.
Other aspects and advantages of the present invention will be apparent upon cohsideration of the following detailed description thereof which includes numerous , illustrative examples of the practice~ of the invention.

:: :
DESCRIPTION OF THE FIGURES

Fig. I shows the protein sequences of tmlCAM-1.
Flg. 2 is a schemat~c rendibon of a~ tmICAM-1, b) tICAM(A53), c) tICAM(283), d) tICAM~l85), and e) tICAM(88~.
Fig. 3 is a schematic diagram of the constructs of Example 12: a~ the heavy chain of human IgG; b) the ~fragment of the heavy chain used in making the immunoadhesin; c) the fragment of ICAM; d) the completed IgG/ICAM
immunoadhesin.
Fig 4 shows crosslinking of tICAM(453) into dimers by water-soluble carbodiimide/N-hydroxysuccinirnide. tICAM(453) at the indicated concentrations was ;
, -'., E S~it'~l' WO 94/004B5 PCl/US93/05972 2 1 ~ ' Jl crosslinked with 100 mM EDC/5 mM NHS at pH 7.5 for 18 hr at 20 C. The samples were analyzed by SDS PAGE followed by western blo~ting with anti-ICAM-l antiseira. a) Western blot of crosslinked ICAM(453) showing monomer and dimer species; b) dependence of crosslinking upon tICAM(453~ concentration; c) the 5 crosslinking of tICAM(453) is not inhibited by an excess of third-party proteins.
Fig. ~ is a schematic showing construction of tICAM(1-451)/LFA-3(210-237) chimera: a) tmICAM-1; b) tICAM(1-451); c) LFA-3; d) LFA-3(210-237); e) tICAM(1-451)/ LFA-3(210-237) chimera; structure of tmICAM-1 shown for comparison.
Fig 6 shows uncoating of HRV by tICAM(453) over Z4 hours. a) shift ~rom native 148S form to uncoated 42S forrn by tICAM(453); b) shift from native 148S to uncoated 42S form by tICAM(185); c)SDS-PAGEof [35S] methionine-labelled HRV-3 showing loss of VP4; d) dot-blot hybndization of RNA recovered from HRV3 specieswith an oligonucleotide probe for HRY. 50 ng of purified HRV3 RNA and RNA
extracted from 8 ng of HRV3 species were applied to the blot.
Fig. 7 shows the predicted alignmen~ of ICAM-l amino acid sequence in domains IV and V onto the immunoglobulin ~old rnotif. Arrows indicate beta strands, pointing from the N- to the C-terminus; italicized letters in bold indicate the beta strands, and numbered residues indicate cysteine residues with disulfide bonds ; ~ 20 indicat~d by lines. The dot~ed line divides the "B" and "F" faces of the domains.
Residues ~indicated with an * are among those replaced with cysteine residues.

DETAILED DESCRIPTION OF THE INVEMTION

.
As used herein, the following abbreviations and terms include, but are not necessarily limited to, the following definitlons.
.
: ~ :

: :

, SUBS~ S~EE i Wo 94/00~85 Pcr/us93/~5972 2~

bbreviation Definition ICAM Intercellular adhesion molecule - may be used to denote both full length (trans- membrane) and truncated (non-trans- membrane) forms of ~he protein.

ICAM- 1 Intercellular adhesion molecule- l, also known as tmlCAM-l and HRR; denoting the full-length transmembrane protein tmICAM-1 Transmembrane intercellular adhesion molecule-1, also known as ICAM-l and HRR; requires~ e.g., detergent conditions to be solubilized HRR Human rhinovirus receptor, also known as ICAM-l and tmlCAM- l sICAM-1 A naturally-occurring soluble truncated form of ICAM-1 having both the hydrophobic transmembrane domain ; ~; ~ and the ~ carboxy-terminal cytoplas~nic domain of ICAM i deleted; consists of amino acids 1-442 of ICAM-l plus ll novel amino acids; distinguishable from S~aunton, et al. tICAM4S3 which consists of ~ amino aclds 1-453 with the terminal tyrosine replaced with phenylalanine.

` tICAMs ~ Truncate~ intercellular adhesion molecules; soluble non-transmembrane lCAMs lacking the hydrophobic trans-membrane ~ domain and the carboxyl- terminal cytoplasmic domain of ICAM~

5UB~'~ uTE ~H~

Wo 94/0048~ PCr/US93~05972 21i6li~y -10- ' tICAM(1-453) Tnmca~ed form of ICAM comprising the ::

tICAM-453 entire extracellular amino-terminal tlCAM(453) domain of tmICAM (dornains I - V, amino acid .
residues 1 - 453) tICAM(1-283) Truncated form of ICAM comprising domains tICAM-283 I, II, and III (amino acid residues 1 -tICAM(283) 283 tICAM(1-185) Truncated form of ICAM comprising domains tICAM-185 1 and Il (amino acid residu~s I - 185 tICAM(l85) dCAM(1-88) Truncated form of ICAM comprising domain ~:
tlCAM-88 ~ 1 (amino acid res~dues l - 88) tICA~(88) tICAM(89-185) Truncated form of ICAM comprising d~main lI (amino ~ acid residues~89-185) ` ~

tICAM(186-283) ~ Trun~ated form of ICAM comprising domain III (amino ~; ~ acid residues 186-283) `
tICAM(284-385) : Truncated form of ICAM comprising domain IV (amino acid residues 284-385) ~: ~ 20 ~ ~ tICAM(386-4S3); Truncated form of ICAM comprising domain V (amino : acid residues 386-453) .

SUB~Tl i uT~ SH-~Ei WO 94/1)0485 2 1 ~ G 1 ~ 3 Pcr/US93/05972 , tICAM(75-77) Truncated form of ICAM compnsing amino acid residues 75-77 t[CAM(70-72) Truncated form of ICAM comprising amino acid residues 70-72 ~ICAM(64-66) Truncated form of ICAM comprising amino acid residues 64-66 '~

tICAM(40-43) Truncated form of ICAM comprising amino acid residues 40-43 .~
tlCAM(36-38) Truncated form of ICAM comprising amino acid residues 36-38 tICAMC3~33); ~ Truncated form of ICAM comprising amino acid residues 30-33 :

tICA~q(2~293 ~ ; Trunc ted form~ of~ ICAM comprising amino acid residues 26-29 15; ~ ~ The foregoing~ terms dehning specific ~ragments are intended to inc!ude ;functional~derivatives and~ analogs~thereof. Perssns skilled in the art will understand that ~the given boundalies~ may vary by a ~few amin acid residues without affe~ting the function of the given fragment.
"Mull~menzabon" ~`and ~ "multlmerlc"~ includej but are not limited to - 20 dimerization and dimeric, and include any multimeric configuration of ~he~I~AM-1 mole~ule, or ~fragment thereof,~ ~ that ~ is effective in reducing viral bindlng and nfe~tivity. ~

;

, ~ :

WO 94/00485 PCr/US93/05972 ~I ~ i,3 1~9 -}2-"Transmembrane" generally means forms of the ICAM-1 protein molecule which possess a hydrophobic membrane-spanning sequence and which are membrane-bound.
"Non-transmembrane" generally means soluble forms of the ICAM-1 protein 5 including truncated forms of:the protein that, rather than being membrane-bound, are secreted into the cell culture medium as soluble proteins, as well as transmembrane forms that have been solubilize~ from cell membranes by lysing cells in non-ionic detergent.
"Truncated" generally includes any protein form that is less than the full : 10 length transmembrane form of lCAM.
"Immunoadhesin" means: a construct comprising all or a part of a protein or peptide fused :to an immunoglobulin fragment, preferably a fragment comprising at least one constant reglon of an immunoglobulin heavy chain.
"Form" is generally: used ~herein to distinguish among full length and partial 5:: length ICAM fo~ms, whereas~ "configuration" ls generally used to distinguish among monomeric,~dimeric,~ and mulhmeric configurations of possibie ICAM forms.
All forms:and~conagurations~of the~ICAM-l molecule, whether full length or : a~fragment thereof, including muteins and lmmunoadhesins,:whether monomeric ormultimenc,:may be fully or partially~glycosylated; or completely unglycosylated, as 20~ ~ :,:1ong as the molecule remalns effective in reducing viral ~binding artd infectlvity.
:"Ligand"~is generally used herein to include anythillg capable of binding to a~least~ one of~ar~y of the forms and configurations of ICAM~ and~mcludes, but Is not limited to, ~human: rhinovirus, other vlruses~that bind to:the "major" group hurnan rhinovirus receptor, lymphocyte ~funetion-associated ~ntigen-l, and Plasmodium :~ : 25 falciparum (màlaria). ~
"Human~rhlnovirus" ~generally lncludes all human serotypes of human rhinovirus as~ ~catalogued in ~Hamparian, V., ;et al., Virol., 159:191-192 ~19~7).
The sequence of:amino acid residues in a peptide is designated in accordance with standard nomenclature such as that given~ In Lehninger's Biochemistr~l (Worth Publishers, New York~, 1970~

~:; : ; : ~ : `
:: : :
:
SUB~TlTuTE sH~ET

Wo 94/0048s Pcr/US93/0597~
21 1Sl ~J ) Full-length ICAM-l, also known as human rhinovirus receptor (HRR), is termed transmembrane ICAM(tmICAM-l). Non-transmembrane ICAMs are also known as truncated ICAMs, i.e,' ICAMs substantially without the carboxyl intracellular domain and without the hydrophobic membrane domain of tmICAM, S which are soluble without the; addition of detergent. tICAMs may conveFIiently comprise one or more domains selected substantially from domains I, II, III, IV, and ; V of the extracellular ~region of tmICAM. tICAMs may also comprise functional .
analogs of tmlCA~M~or fragments thereof, and may also comprise one or more fragments of tmICAM spliced together, with or without intervening non-tmICAM
lining sequences, and~not necessarily in the same order found in native tmICAM.
Presently preferred tlCAMs include but are not limited to forms tICAM(453), ' , .
tICAM(185), tlCAM(88), tICAM(283), ~ and tICAMs comprising one or more sequences~ selected; from tICAM(89-185),; tICAM(186-283), tICAM~284-385), tlCAM~386-453), tICAM(75-77), ~tICAM(70-72), tICAM(64-66), tICAM(40-43), t lCAM~36-38), ~tICAM(30-33), and tlCAM(26-2~. See USSN 07/631,313, USSN
07/678,909, and USSN07/704,996. Non-transmembrane forms of ICAM can include functional derivatives of ~ICAM, ~ mutein ~forms of tICAM to facilitate coupling, and i tICAM immunoadhesins. ~ ~When; the~ tICAMs are in ~a multimeric ~configu~ation, pre~erably~as dim'ers,~ they~display enhanced blnding of human rhinovirus and are able ;20~ ~ to reduce;viral infectivity.~
Mulbmen~tion~can~be achleved~by~ crosslinking a first ICAM to a second ICAM,~ using~ sultable ~ crosslinking~ ~agents, e.g. h~eterobifunctional and homobi~unetional cross-lmbog reagents~;such as bifunctianal N-hydroxysuccinimide esters,~ imidoestèrs,~or~bls-maleimidohexanes. :
The di'fferent forms of ICAM, transmembrane and non-transmembrane, can be~ multimeriz~;by~adsorption to~ a ~support. This support can be made of materials such as~nitrocellulose,~PVDF-,;~DEAE, Iipid polymers, as well as amino dextran, or a variety~of~inert~polymers~that can adsorb or can be coupled to ICAM~ either with or without a spacer or~!inker.
~ Multimeric ICAM~can also be multimerized by coupling the ICAM to a member,~ e.g., an antlbody lhat does not interfere with HR~ binding, or fragments S~B~ITUTl Sn~r~l~

WO g4/00485 PCI/US93/05972 ~ 1 A ~ 14--thereof; or to a protein carrier. An example of an antibody includes anti-ICAM
antibody CL 203 or a fragment thereof; suitable protein carriers include albumin and proteoglycans.
To facilitate coupling~ the ICAM can be modified with at least one reactive 5 amino acid residue such as lysine, cysteine, or other amino acid residue(s) to provide a site(s~ to facilitate coupling. These types of modified ICAM are referred tv as muteins. The nucleotide sequence for the lCAM of the method can be contained in a vector7 such as a plasmid, and the vector can be introduced into a host cell7 for example eukaryot~c or prokaryotic cells. The preferred eulcaryotic cell is a 10 mammalian cell, e.g. Chinese hamster ovary cells or HEK293S cells; the preferred prokaryotic cell is E. coli. In addition, the ICAM can be modified at either terminus ~o comprise a lipid capable of promoting formation of oligomer micelles. The ICAM
comprising the multimeric ICAM can be ~either fu}ly glycosylated, partially glycosylated, or non-glycosylated.
A preferred~ manner of making multimenc forms of ICAM- 1 is by engineering of cysteine residues into the tICAM sequence (tICAM(453) is particularly preferred) In a position at or close to the natural site of:~self-association on ICAM-l monomers.
Muteins with cysteine residues~placed at appropriate positions form covalent bonds (disulfide ~onds) that~ stabilize an interaction which is noncovalent in vivo. Such 20 ~ muteins are assembled ~intracellularly and are exprcssed as a disulfide-linked dimer;
alte~natively, monomenc muteins may be crosslinked in vltro by incubation at high protein concentration in mildly reducing conditions to encourage disulfide exchange, or by crosslinhng with bifunctional chem~cal crosslinhng r~gents which rcact with free~ sulfhydryl groups. Another advantage of such proteins is that any novel amino 25 acids engineered into ICAM-1 are hidden on the dimer interface and would be less - likely to be immunogenic. ~ ;
In another preferred ~embodiment, ICAM can also be multimerized by fusion with fragments of ~immunogiobulins to form ICAM immunoadhesins. For example, an ICAM or fragment theréof can be fused with a heavy or light chain 30 lmmunoglobulin or fragment~thereof, in particular with the constant region of the heavy chain of IgG, IgA, or TgM~ Preferably~ the constant region contains the hinge SUB~ T~ S~ 7 WO g4/004~s PCr/US93/05972 2 ~

region and one or more of CH2 and CH3, but does not contain CHl. The variable region ~Fab) of the immunoglobulin is thus replaced by the ICAM or fragmen~
thereof. Such constructs are conveniently produced by constru~tion and expression of a suitable fusion gene in a suitable expression system [see, e.g., Bebbington, C.R
S and C.C.G. Hentschel, "The use of vec~ors based on gene ampli~lcation ~or the expression of cloned genes in mammalian cells," in DNA Cloning~ Vol. III, D.
Glover, ed.(l987)] and are secreted in a dimerized configuration.
Also provided~by the invention are methods for enhancing binding of ICAM
and functional derivatives thereof to a ligand, i.e., human rhinovirus, and "major"
10 group receptor viruses, lymphocyte function-associated antigen-l (LFA-l), Plasmodium falciparum (malaria) and the like, wherein the ICAM is presented in amultimeric configuration to the ligand to facilitate binding of the ICAM to the ligand.
The inventlon further comprises~a method for inducing irreversibie uncoating of human rhinovirus, said method comprising contacting said human rhinovirus with 15 ICAM-l or a fragment~thereof, e.g. a tICAM as defined above.
: ~ :
This invention also provides a novel method of irr~versibly inhibi~ing infectivity of ~a mammalian cell by a human r~hinovirus, said method comprising contacting said~ human rhinovirus ~with ICAM-1 or a ~ragment thereof under - conditions whlch~allow~he ICAM-l or~ragment thereof (e.g. a tICAM as defined 20 above) ~to bind~ to~ said~rhlnovirus; thereby~stlmulating irreversible ~ncoating of said rh1novirus.
Also provlded ~by~the invention are~ novel pharmaceutical compositions comprising ~?~pharmaceutically acceptable solvent,~ diluent1 adjuvant or car~ier, and as the active ingredient, an effective amount of a polypeptide characterized by having 25 human rhinovirus binding activity and reduction of virus infectiYi~y. Dimericconfigurations of IAM and fragments thereof are presently preferred.
The following ~examples illustrate practice of the invention.
Example I relates~ to growth, purification and assay of rhinoviruses;
Example 2 relates to production and isolation of monoclonal an~ibodies to 30 ~ICAM~

SUB~T~TUT~ S~T

WO 94/00485 PCr/US93/05~72 ,.
2~ 9 -16-Example 3 relates to construction of non-transmembrane truncated forms of ICAM cDNA ~rom full length ICAM-1 cl:)NA;
~xample 4 relates to transfection of mammalian-cells and expression of non-transmembr~e tmncated forms of ICAM cDNA;
S Example S relates to isolation and punfication of non-transmembrane truncated forms of ICAM-1;
Example 6 relates to radioactive labeling of tmICAM-1~ tICAM(185), and tICAM(453) and demonstration of retained capacity for binding to monoclonal antibodies; .
Example 7 relates to human rhinovirus binding assays of transmembrane and of non-transmembrane truncated forms of ICAM-1; -Example 8 relates to CL203 IgG antibody-mediated cross-linking of tlCAM(453);
Example 9 r elates to multimenzation of trans-membrane and of non-transmembrane truncated forms of ICAM l;
Example 10 relates to infectivity-neutrallzation assay of multimeric transmembrane and of multimelic non-transmem~rane truncated forms of ICAM-l;
: ~ and ~ ~ ;
, Exampl~ 11 relates to use of multimeric forms of transmembrane and truncated forms of lCAM-l, as effective inhibitors of ICAM/LFA-L interaction.
Pxample 12~relates to canstruction of tICAM(185)/IgG and tIC~M~453~/IgG ;:

immunoadhesllls.
~ample 13 relates to rhinovlrus binding and neutrali:zation by a tICAM/IgG
immunoadhesins.
Exampie 14 relates to in vitro dimer~zation of ICAM-1. :~
Example 15 relates to a tlCAM(1-451)/LFA-3(210-237) chimera.
Example 16~relates to:irreversible inactivation of HRV by ICAM.
~xample i7 relates to cysteine muteins.
:

$~BS~lTU ~ L 5HEEl WO 94/û~8s Pcr/us93/05972 2 d, ~

GROW'TH PURIFICATION AND ASSAY OF RHINOVIRUSES
Rhinoviruses were grown, purified, and assayed essentially as described in Abraham, G., et al., J. Virol., 51:340 (1984) and Greve, et al., Cell, 56:839 (1989).
S The serotypes chosen for these studies include HRVl4, the standard in the field, and HRV3, which has an approxlmately 10-fold higher affinity for ICAM than does HRV14. HRV2, which binds to the "minor" receptor rather than the "major"
receptor, was used as a negative control.
Rhinovirllses HKV2, HRV3, and HRVl4 were obtaine{l from the American Type Culture Collection, plaque puri~led, and isolated ~rom lysates of infected HeLa-S3 cells. Purified rhinovirus was prepared by polyethylene glycol precipitation and sucrose gradient sedimentation. Viral purity was assessed by SDS-PAGE analysis of capsid proteins and by electron microscopy. Infectivity was quantitated by a limiting dilution infectivity assay scoring for cytopathic effect, essentially as described by Minor, PoD~ Growth, assay and: purification of picornaYiruses, in Virolo~A
:
B.W.J. Mahy, ed~(Oxford:IRL Press), pp. 25-41.

:

PRODUCTlON AND ISOLA~ION OF MONOCLONAL ANTIBODIES TO
: ~ ~ ICAM-1 -20 ~ BAWcBy~ ~emale mice were lmmunized by intraperitoneal injection of 107 intact HeLa~cells:in 0.5 ml of phosphate-buffered saline (PBS) three times at 3-wee~c intervals. Two weeks later the mice were bled and aliquots of serum were tested for protective effects agains~ HRVl4 infection of HeLa celIs. Positive mice were boosted by a fimal inJieetion of 107 HeLa cells, and 3 days later spleen cells were fused to : ~: 25 ~P3X:63-Ag8.653 myeloma ~cells (Gal*ej~ et al., Nature, 266:550-552 (1977)) eO
produce a total of approxlmately :700 hybndoma-eontaining wells. Each well was tested by incubatmg 3 x~ 104 HeLa cells ln 96-well plates with 100 ~l of supernatant :: ~ for I hr at:37 C; the cells were then~washed with PBS~ and a sufficient amount of HRVl4 was added to give complete cytopathic effect in 24-36 hr. Wells that were positive (protected from ~infection) were scored at 36 hr. :

SU~STiTV, ~ 7 Wo 94/004~5 Pcr/US93/05972 Cells were removed from wells which scored positive in the first sc~een and cloned by limiting dilution in 96-well microtiter plates. Supernat~nts ~rom these wells were tested in the cell ~rotection assay and positive wells were again identified.
Further clonings were performed until all of the hybridoma containing wells wereS positive indicating a clonal population had been obtained. Four cloned cell lines, and their corresponding antibodies, were obtained and were designa~ed c78. lA, c78.2A, c78.4A, c78.5A, c92.1A and cg2.5A, respectively. ;~
C92.1A was deposited on November 19, 1987 with the American l'ype Culture Collection, 12301 Parklawn Dr~ve, Rockville, Maryland 20852 and was 10 designa~ed HB 9594.
, EXAhIPLE 3 CONSTRUCTION OF tlCAM cDNAs FROM FULL LENGTH ICAM-1 cDNA
: .
A. Preparation of I(:AM-l cDNA
Randomly-prlmed cD~A was synthesized from poly A~ RNA frum HEl cells 15 using an Amersham(l~) cDNA synthesls ht under condltions recommended by the supplier. PCR amplification was per~ormed using 100 ng of cDN~ for 25 cycles ~using primers PCR~5.l:~(ggaattcATGGCTCCCAGCACiCCCCCGGCCC) and PCR
3.I: (g~gaattcTCAGGGAGGCGTGG~ITGTGTGl~r). Amplificationcyclesconsisted of 94 C 1 min, 5S ~C 2 min, and 72 C 4 min. The product of the PCR reaction was 20 dlgested ~with EcoRl~ and cloned with E~oR1 digested phage Yector lambdaGT10 (StIatagene~M)). Recombinant phage clones were sc~eened by plaque hybridi~ation , using ICAM-I specific oligonucleotides GAGGT(3TTCTCAAACAGCTCCAGCCCTTGGGGCCGCAGGTCCAGTTC
(ICAMl) and 25 CGCTGGCAGGACAAAGGTCTGG~AGCTGGTAGGGGGCCGA(3GTGTTCT
(ICAM3). ~ ~ ~
A positive clone designated lambdaHRR4 was selected and purified. The insert was removed by EcoR1 digestion and subcloned into the EcoRl site of Bluescript KS + . This clone was designated pHRR2. The entire insert was ~i~JB~U,~S~

WO 94/0~485 Pcr/us93/05972 21~1Q3 seq5uenced ~sd ~und to contain the entire ICAM-I coding sequence beginning wi~h the initiator ATG codon and endin~ with the TGA stop codon as specified by the PCR
ICAM-I sequence (Simmons, et al., Nature, 331:624 (1988); Staunton, et al., Cell, 52:925-933 (1988)) by a single substitution of Ala-1462 for Gly. This same change S was identifieds in several independent clones and thus represents a polymorphism of the ICAM-l gene.

B. Construction of tICAM(453~ and tlCAMf l 85!
Modified forms of the ICAM-1 cDNA were create~S by PCR amplification reactions (Saiki, et al~, Science, 230:1350-1354 (1985)) using the full length ICAM-1 cDNA clone pHRR-2 as template. The plasmid DNA was digested with EcoR1 to excise the ICAM-I insert and treated with alkaline phosphatase to prevent re-circulari~ation of the vector in subsequent ligation steps. Ten ng of template DNA
was subject~d to lO cycles of PCR amplification using oligonucleotide primers PCRS.S and PCR3.3 for tlCAM-453 and PCR5.5 and 3.10 ~or tICAM-185 under the lS ~ollowing conditions:
~ Time ~ins~
, 94 ~ ~ l 72 l~S
~; ~ 20~ 71 ~ 4 (final ex~ension) :
PCRS.5 has the sequence: GGAAl~CAAGCITCTCAGCCTCGCTATGG-CTCCCAGCAGCCCCCGGC~C whichconsistsofEcoRlandHindIIIsites,12bp ICAM-1 5' untranslateds seqSuenceSS and the first 24 bp encoding the signal peptide.
PCR3.3 has the sequence: ~ GGAATTCCTGCAGTCACTCsATACCGGGGG-;~ 25 GAGAGCACAl-r which conslsts of EcoRl and Pstl sites, a stop codon~ artsd 24 bp cornplementary to the bases encodlng the last 8 extracellular amino acids of ICAM-1 (residues 446-453) .

.:
:.

Sl)3~Tl~)TE ~t1EE~

WO 94/00485 P~/U~93/05972 21 1 ~ 1 D~ ~) -20- ~
PCR3.10 has the sequence: TTC:TAGAGGATCCTCAAAAGGTCTG(iAG-CTGGTAGGGGG which consists of Xbal and BamH1 sites, a stop codon, and 24 bp complementary to the bases encoding residues 178-185 of ICAM-l.
The PCR reaction products were digested with EcoR1 (tICAM(453)) or EcoR1 and BarnHl (tICAM(185)) and cloned into the polylinker site of BluescApt SK+
(Stratagene). Clones containing the desired inserts were verified by restrictionanalysis and DNA sequencing. The inserts were excised frvm Bluescript by digestion wi~h HindIII ard Xbal and Inserted into the expression vector CDM8 ~Seed, Nature, 239:840 (1987) at the HindIlI and XbaI sites. A clone cont~ining the tICAM(453) insert designated pHRR-8.2 and a clone containing the tICAM~18S) insert designated pHRR23-13 were selected and subjected to extensive sequence analysis. This verified the existence of the desired stop codons, and the integrity of the selected regions of ICAM-l codin~ sequence.
These plasmids were transfected into COS cells using the DEAE-dex~ran ;~
techniques and the cells were cultured 72 hr. before assay. Surface expression was monitored by FACS using indlrect immunofluorescence and a monoclonal antibody specific for ICAM-1. Transient expression in COS cells and immunoprecipitation of metabolical!y labelled ([3sS]cysteine) cell superna~n~s with c78.4A Mab (monoclonal antibody) demonstrated the production of soluble ICAM-l fragments of 45 kd and 80 kd from pHRR23-13 and pHRR8.2~ respectively. The preparation of stable Chinese hamster ovary cell trans~ectants is described below in Example 4.

C. ModitWl~on~lycQsvlated tTCAM-1 A modified full length ICAl!~- 1 was made by simultaneous mutagenesis of Asn at positions lO3, 1 l8, 156 and 173 each to Gln. This removes all four Asn-linked glycosylation sites from extracellular domain II ~f the ICAM-I molecule. The resultant molecule, referred to as ~non-glycosylated transmembrane ICAM, was expressed on the surface of COS cel!s and was able to bind radio-labeled HRV3 atlevels comparable t o unmodified ICAM-l. This result demonstrated that glycosylation of domain II ~the first 185 amino acids) is not required for virus binding to IC~M~
',:
8UBSTITU~I-E SHEET

4~5 PCr/US93/05972 . 2'1.~L~lg~

It is expected ~hat non-transmembrane ICAM can be similarly modified to yield modified non-glycosyla~ed llon-transmembrane ICAM-I molecules.

D. (~onstTuction of GeneticallY En~ineered Forms of tICAM Containin~ Reactive Residues Suitable for Cross-Linking to_Form Multimers A molecule consisting of the 453 amino acid extracellular domain of ICAM-l with the addition of a novel lysine residue at the C-terminus was constructed by PCR
modification of the pHRR-2 cDNA described in Example 3B. The primers used were PCR5.5 (Example 3B) and PCR 3.19 which has the sequence:
TTCTAGAGGATCCTCACTTCTCATA~CGGGGGGAGAGCACATT and consists of Xbal and BamHI sites, a stop codon, a Lys codon, and 24 bases cornplementary to the sequence encoding amino acid residues 446 to 453. Following cloning into the CDM8 vector, production of tICAM having a Lys at position 453 was confirmed by transient expression in COS cells. Stable CHO cell lines were generated by co-transfection with pSV2-DHFR as descnbed in Example 4. The same strategy was used to add a Lys residue to the C-terminus of tICAM(185) using PCR5.5 and P C R 3 . 2 0 w~ h i c h h a s t h e s e q u e n c e:
TICTAGAGGATCGTCAC~AAAGGTCTGGAGCTGGTAGGGGGC andconsists of XbaI and BamHI sites, a stop codon, a I,ys codon, and 24 bases complementary to the sequence encoding residues 178 ~o 185. Transient COS- cell expression confi~me~ the production of tICAM-185 and stable CHO cell lines were derived as ::
describe~ in Example 4. - ~
Three modified ~orms of tlCAM(452) that e~ch contain an additional Cys residue were constructed by site-directed~mlltagenesis of the full-length ICAM-1cDNA. In each construct a stop codon was introduced by changing the Glu residue at position~ 453 from GAG to TAG. The C-terminus is thus Tyr-452. Residues Asn-338, Thr-360, and Gln-387 were each separately mutated to Cys using a second site directed mutagenesis. The presence of the desired mutations were confirmed by DNA sequencing.
The residues selected for mutation to Cys were selected based on a computer generated plot of surface probability which predicts surface exposure of these regions.

, Wo 94/0048s Pcr/us93/~5972 2 ~

Also, Thr-360 is in ~lose proximity to Asn-358 which is a site of potential Asn-linked glycosylation. Each of the ~hree Cys mutants was expressed and secreted into themedium of transfected COS cells. Examination of the proteins under reducing and non-reducing conditions showed no indication of the presence of dimers. It is S anticipated that cross-linking reagents reactive with sulfhydryl groups can be used to cross-link the Cys-modified tICAM ~orms to obtain multimeric forms.
: :

TRANSFECTION OF CE LS AND EXPRESSION OF tlCAM cDNA

A. Transfect n of Eukarvotic Cells Chinese hamster ovary (CHO) cells deficient in dihydrofolate reductase (DHFR) were obtained from Cutter l:abs (Berkeley, CA.). DHFR- cells cannot , ; ~ ~ synthesizenucleosidesandthereforerequireanucleoside-supplement~dmedium. The cells were co-transfected with the plasmid pSV2-DHFR which contains the mouse dihydrofolate reductase~(DHFR) gene under control of the SV40 promoter, and withdCAM(45~3), or tICAM(184) ~construc~s in the CDM8 vector (Seed and Aruffo, PNASl 84:3365^3369; (1987)). ~ ~ ~
~ ~ .
Transféctions were~ done using both electroporation and caleium phosphate methods. Bebblngton;,~ supra~.~ T~ansfected~ DHFR-positive cells ~ere selec~ed by growth on nucleoside-free media, and pools of transfectants were cloned by limiting 20 ~ dilution.~
el~l lines~ that secrete~ tlCAM were identified by testlng culture supernatants with a two-slte radioimmune assay (RIA) for ICAM using Mabs c78.4A and c7~.5A
as follows. A monoclonal antibody against one epitope on ICAM ~for example, Mab c78.4A)~was~adsorbed~to~plastlc 96-well plates ~Immunlon plates, Dynatech lnc.),25 excess binding sites on the plates were blocked with bovine serum albumin (BSA3, and then culture supernatants were~incubated with the plates. The plates were washed ;~ and~incubated with ['25I~-Mab (directed against a second epitope on ICAM, e.g.
c78.5A), and, after~washing,~the amount of bound [~2s]I-lgG determined. The concentration of tICAM was determined by comparing ~IA data from unknowns : :
:
:~ :

:
',Ts~ 5 . E S~ rt i =~",.<.- "~......

WO 94/004~s P~r/US93/05972 . . .
21 ~ S~

against a standard curve of tmICAM at known concentrations. Positive clones wereexpanded and expression of tICAM forms was confirmed by immunoprecipitation of metabolically labeled cell supernatants with Mab c78.4A.
Cell lines CT.2A (tICAM(453)~ and CI:)12.1A (tICAM(185)) were selected for i~rther study and were subjected to gene amplification in methotrexate containing media as described by Bebbington, et al., supra. A clone derived frorn CT.2A
resis~nt to l00 nM methotre~ate and a CDl2.1A clone resistant to 1 ~M methotrexate were used for purification of soluble truncated ICAM-I proteins.

B. Transfection of Prokarvotic Cells Because glycosylation of the viral binding domain of ICAM is not required to retain viral binding (as demonstrated in Example 3C), it is anticipated that prokaryotic cells, such as E. coli~, can be successfull~ transfected to produce functional proteins.

:

;~ ISOI,ATION AND PURIF C~TION OF_tICAM-l Monoclonal antibody~af~lnity chromatography with c7g . 4A-Sepharose(TM) has been previously described~in co-pending USSN 07/130,378 and Greve, et al., Cell,56:839-847 (1989). tICAM sècreted into serum-containing media required additional purification steps due to the high level of cootaminating protein in the serum. Before elution from the~Mab-affinity.column, the column was washed with 1 M NaCI to ~ rèmoveloosely-boundproteins. FortIC~M(453~, thepartially purified tICAM(453) eluted from~the c78.4-Sepharose~) column was dialyzed into l0 mM Tris (pH
6.0), a~sorbed onto a mono-Q(TM) column (Pharmacia)~ and eluted with a 0-0.3 M
NaCI gradient. tICAM184 was further purified by gel filtration on a Superose-;~ ~ 12(1~M) column. ~
It ls also recogn~zed that non-transmembrane truncated forms of ICAM-l may be purified using standard ion exchange methodology without using monoclonal antibody affinity chromatography.

::

S~JB~Ti; ~ ~ r ~

wo ~4/00485 Pcr/US93/05972 2 ~ 9 RADIOACTIVE LABELING OF tmICAM-1, tICAM~185~, AND tICAM(453) AND DEMONSTRATION OF RETAINED CAPACITY FOR BINDING TO
MOMOCLONAL ANTIBODIES
The epitopes reactive with monoclonal antibodies c78.4A and c78.5A are conformationally-dependen~ epitopes and thus can be used as analytical probes for confirming retention of the native ICAM structure. Known amounts of purified ICAM were incubated with c78.4A or c78.5A IgG-Sepharose(TM) and the fraction of the radioactivity bound det~rmined. These experiments showed that the purified tmICAM-l, tICAM(185), and tICAM(453) completely retained the ability to bind to these monoclonal antibodies.
Transfectants were metabolically labeled with [35S]cysteine, and cell Iysates (f~r transmembrane ICAM3 or culture supernatants (for truncated I(:AM) were prepared and incubated with c78.4A IgG-Sepharose(TM) beads. The beads were washed ~nd adsorbe~proteins were e}uted with sodium dodecyl sulfate (SDS) and analysed by SDS-PAGE; see Greve, et al., Cell, 56:839-~47 (1989)). lt was found that the isolated prote~ns were quantitatively bound to the c78.4A and c78.5A Mabs.
Accordingly, the tICAM(185) and tICAM(453) both have retained native ICAM structure.

.
~ E~AMPLE 7 UMAN RHlNOVlRUS B~NDING ASSAYS OF tmICAM AND tICAMs Described below are three binding assays used to assess binding activity of the various forms of ICAM.

A. Pelleting Ass~
~35S]cysteine labeled tmICAM-l or tlCAM was mixed with HRV3 in 100 ~1 of 10 mM HEPES;(pH 7.5), 150 mM NaCI, I mM MgCI2, I mM CaCl2, 0.1% Triton X-100. The mixture was incubated for 30 min. at 37 C, cooled on ice, }ayered on top of a cushion of 200 ~l of 10~ glycerol, 0.2 M triethanolamine (pH 7.5~, and centrifuged in a Beckman air-driven centrifuge ~t 134 000 x g for 30 min. at 4 C.

.
S~BSiTlTUl'E S~ET

Wo 94/00485 PCI /US93/05~72 .,. ., 2 ~ a s The top 275 ,ul was removed, and the pellet was analyzed by SDS-PAGE and scintillation counting. Silver-staining of SDS gels of control experiments indicated that essentially all of the H[RV3 is pelleted under these conditions and essentially all of the ICAM remains in the supernatant. The results are shown in Table 1.

TABLE l ICAM % ICAM Pelleted*
tmICAM-I l 1.6%
tICAM(453) 1.0%
tICAM(185) 4.3 %

lO * average of 4 experiments; these numbers cannot be directly converted into relative affinities These data show that both truncated forms of ICAM bind to rhinovirus, but .
at substantially reduced levels relative to tmICAM.

B. Solution 13indin~ Assav ::
To obtain ~uantitative information on the relative affinity of trnICAM and tlCAM fragments in solutlon, a solution competition ~ssay was developed in whichsoluble tmlCAM or soluble tICAM fragments were used to inhibit the binding of [35S]HR~3 to previously immobilized ICAM-l) nonionic detergent (Triton X-100) was included in the~bu~fers so that the dif~erent proteins could be compared under identical conditions. First, tmIC~M-1 (isolated in the presence of 0.1%
octylglucoside instead of Triton X-100) was diluted 10-fold into a Tris/NaCl bu~fer and allowed to adsorb to the walls~of a mlcrotiter plate (Immunlon-4, Dynatech) overnight. Nonspecific binding sites on the plate were then bloeked with 10 mg/ml BSA and binding~experiments performed in 0.1% Triton X-100/1 mg/ml BSA/10 mM
Tris/200 mM Na(~ Approximately 20,000 cpm of ~35S]HRV3 were mixed with ; varying amounts of lCAM LtmICAM, tlCAM(453j or tICAM(185~], incubated for 1 ,:
:
- SUBS~ITUTI~ SHEE~

Wo 94/0048s Pcr/US93/05972 ""~'?
2 1 ~

hour at 37 C, and then added to wells o~ the microtiter plates and incubated for 3 hr at 37 C. The plates were washed and the bound radioactivity determined.
As shown in Table 2, tmICAM-l inhibits virus binding half-maximally at low concentrations (.008 ~M) whîle tICAM(453) and tICAM(185) inhibit at much higher concentrations (2.8 ,llM and 7.9 ,uM, respectively; or 350 to almost 1000-fold higher than tmICAM.

ICAM IC50*
.
tmICAM8.0 ~ 3.3 nM (N=3) tICAM(453)2.8 + 0.6 ~M (N=3) tICAM(185)7.9 + 2.8 ~4M (N=3~ .

~: : * IC50 is the concentration of soluble ICAM needed to inhibit HRV3 binding by ., 50%. :
:: ; . . .~'.' .
~: These data confirm and extend the earLier observations that tICAM(453) and :: :
tICAM(185) do bind to rhinovirus but with lower affinities than does tmICAM-l and ;
. provide evidence that the vlrus:bindlng site is encompassed within the two N-terminal domains(185:residues)oflCAM-I:.: :
;; : Subse~uent experiments performed at 34 C (the temperature at which ~:
rhinovirus normally repllcates) have yielded similar results.
~-20 C. ot-Blot Ass~
An alternative method of measuring binding activity was utilized in which tmICAM-l, tICAM(453), or tICAM(185) was adsorbed to nitrocellulose filters, the non-spesific binding sltes on the filters blocked with 10 mg/ml bovine semm albumin (BSA), and radioactive virus or [~25I]Mab to IC~M-l incubated with the filter for 60 25 min at 37 C. The filters- were washed with buffer and the filters exposed to X-ray film.
'''~

SU~ 3 Wo 94/0048~ Pcr/lJss3/o5972 The amount of radioactivity bound to the ~ ers was determined by densitometry of the autoradiograms, and the data is expressed as HRV3 binding (in arbitrary units) normalized to the amowlt of ICAM bound to the blot by a parallel determination of the amount of El2sI]Mab c78.4A or c78.5A bound to the ICAM
S ~bound to the blot). The results are shown in Table 3.

Binding of [355]HRV3 to Immobilized ICAM*
ICAM _ _ tICAM(453) _ _ ratio IÇAM/tTCAM453 ;
1.2 ~ 1.1 0.52 + 0.45 2.3 * Average of 5 expenments. Data is expressed in arbitrary densitometric units of[35S]HRV3 bindlng/[~'s]I~anti-ICAh~ Mab binding.
Additional studles wl~h tlCAM 185 have been performed. Binding expeliments have demonstrated equivocal ~results. It is anticipated that steric hindrance may play ~a ~role. ~ The si~e of the ~virus is approximately 30 nanometers.
The length o~ tICAM(185) is~less~than 10 nanometers. The use of a spacer or linker would provide better accessibility for binding.
The results~ from this experiment lndicate that under these assay conditions tICAM(453) is~cap~ble of binding rhmovirùs at levels~ comparable to those of tmI~AM-l when~-the amount ~of virus~bound ~was normalized to the amount of 20~ ['2sl]M~b~boùnd.~Further,~these results Indlcate that the tlCAM forms are capable of binding to~ r}~inoviNs~ but; that~ the binding avidity is dependent upon the - ~ configuration of the tlCAM. tmICAM-l is believed to be~a small multimer (probably a dimer) and presentation of tlCAM in a multimeric form~ mimics this multimeric ,, configuration. ~
~ Evidence~ supportlng ~thls hypothesls comes; from~ quantitative binding studies (unpublished),~in which the ratlo of the maximum number o~ rhinovirus particles and the~ ma~i`mum ~number~ of; antlbody molecules~ that ~can be bound to cells is approximateiy ~1.5~, as discussed supra. This is in contrast to the earlier work of Tomassini, ~J., et al., 3~. Virol., 58:290 (1986), which suggested a complex of five SUBS~U ~ E ~H~

W~ 94/00485 PCr/US93/05972 .
9 ' '' molecules needed for binding.Their conclusion was based on an erroneous interpretation of gel filtradon data that ~ailed to take into account bousld detergent molecules.

S CL203 I~G ANTI130Dy-MEDIATED CROSS-LINKING OF tICAM(4531 To provide additiona] evidence that the higher relative binding activi~y of tmICAM-1 is due to a multimeric form of the protein, the tICAM(453) protein was pre-incubated with CL203, a monoclonal antibody to IC:AM-1 that does not inhibitvirus binding to ICAM-l and binds to a site C-terminal to residue 184 (Staunton, et al., (:ell, 56:849 (1989) and Cell, 61:243 ~1990)). Thus, the antibody can effectively "cross-link" two molecules~of tICAM(453), to create "dimers" of tICAM(453), yet without blocking the virus-binding site on each of the two rnolecules of tICAM(453).
When a rnixture of CL203 IgG and tICAM(453) at a 4:1 weight ratio was tested in the competition ~ssay, it was found that the antibody cross-linked tICAM(453) ..
inhibited HRV3 binding at a concentration 7.4-fold lower than tICAM(453) alone consistent with the idea that tmlCAM-1 binds with higher affinity to rhinovirus because it is a dimer or a small multimer.
- ~ To create alternative multimeric forms of tICAM, several further modi~1ed truncated forms of ICAM were constructed as descnbed, supra, in Example 3.
These forms can then be multimerized as described in Example 9, below.

EXAMPl E 9 MULTIMERIZATION OF tm~CAM AND tICAMs , There are several ways that tICAM can be converted to a multimeric form having enh~nced vlral binding and neutrallzation activity over the monomeric form.
:.
25 For example, a first tICAM ~can be coupled to a second tICAM(which may be thesame or different),~ or to an inert polymer, such as amino-dextran (MW 40,000), using homobifunct~onal (such as N-hydroxysuccinimide (NHS) esters) or heterob~functional (such as those contalning NHS-ester and photoactivatable or SUBSTi~ t, 7 W(~ ~4/0~485 PCr/US93/OSg72 2~ ~ 61 ~

~9 sulfhydryl-reactive groups~ cross-linking reagents utilizing the amino group on the amino-d~xtran and an amino or other group on the tICAM. A number of examples of appropriate cross-linking reagents can be found in the Pierce Chemical Company catalog (:Rockford, Ill.). Similarly, ~he tICAMs can also be bound to other suitable inert polymers, such as nitrocellulose, PVDF, DEAE, lipid polyrner, and other iner~
po]ymers that can adsorb or be coupled to tICAM with or without a spacer or linker.
As tICAM is poorly reactive with NHS-ester-based compounds, a tICAM with a geneti ally-engineered C-terminal Iysine residue ~see Example 3) would have improved coupling ef~1ciency to supports with homobifunctional reagents whereas genetically-engineered C-terminal cysteine residues would facilitate coupling byheterobifimctional reagents, such as suIfo-maleimidobenzoyl-N-hydroxysuccinimideester (MBS). ;
ICAMs can also be multimerized by coupling with an antibody (e.g. CL203) or fragment thereof, or with a suitable protein carrier, e.g. albumin or proteoglycan. -ICAMs may also be multimerized by fusion with fragments of immunoglobulins to form ICAM immunoadhesins.
Alternativdy, soluble; tICAM multimers can be created by genetica1ly engineering reactive residues into tlCAM. ~ For example, free cystelne residues can be created in relatively hydrophilic sequences in the C-terminal region of tICAM(which would ha~e~a greater tendency to be solvent-exposed). This will allow thecreation of dimers ln~ situ;~ alternatively, monomers can be purified and dimers created in vltro by disulfide bondi~ng7 either directly or via suitable linkers.
Another approach requires the placement of lysine residues at similar positions ' '' and cross-linhng purified~ proteln in vitro with homobi~unctional NHS-esters.
Examples of such Iysine residues are residues 338, 360, 387. See Fig. 1.
Crosslinking ;cysteine residues to~ each other can be accompllshed by reaction of tICAM with free cysteine groups with bis-maleimidohexane (Pierce Chemical Co.) or other bis-malelmldo-analogs. Cross-linking free cysteine residues on tICAM toarnino groups on carrier mo!ecules can be accomplished by reaction with m-maleimidobenzoyl-N-hydroxy- succinimlde ester.

:
,.

~1lR.~T~ F~S~

WO 9~/00485 PCI /US93/05972 ,~., 21 if~

Crosslinking amino groups on tICAM molecules can be accomplished with homobifunctional N-hydroxysuccinimide esters (for examples, see Pierce Chemical Co. catalog). Alternatively, the carbohydrate groups on tICAM can be o~idized toaldehydes and coupled to hydrazine-activated amino groups on a carrier molecule.

EXAMPLE l0 TNFECTIVIT~-NEUTRALIZATION ASSAY OF tmICAM AND tICAMs Three different assays for virus infectivity have been used. These different assays take into account the differences in transmembrane ICAM and non- ;;
transmembrane solubilities.

10 A. plaque-reduction assav in the presence of deter~n The results of this assay indicate the highest dilution of virus that will still be ef~ctive in hlling cells. Virus is pre-incubated with transmembrane ICAM protein; ~ ~ in the presence of 0.l%~ Triton Xl001 serially diluted into culture medium, incubated for. 30 min with ~IeLa cells at l0~ cells/ml, diluted l0-fold, ~nd plated out into ; . .
l5 multiple wells of a 96-well microtiter plate having varying dilutions of virus.
0.1% Triton Xl~ was used~ as positive control. After S days, the wells are scored as either bein~ infected or not by the presence of cytopathic effect (CPE) and the titer expressed as~plaque-forming unltslml (PFU/ml) of the original virus. This ; ~ assay was descnbed in~USSN 07/239,57;1 and was used to demonstrate the antiviral ZO ~ activity of tmlCAM-I (which ~equired the presence of detergent to remain insolution). The concentration ~of lC~AM protein used is the initial concentration in the pre-incubation mixture; howeYer, the ICAM protein is not present continually during the infection in that the protein is serially dlluted. While the presence of detergen~
is requir~d to solu~ilize the tmlCAM, detergent kills the cells; thus, the need for the 25 ~erial dilutions o~ the~ tmlCAM-I/detergent to permit infection of cells.

B. Plaque-reduction assay In the absence-of detergent - ~ In ~his plaque-reduction assay, a more traditional ~ssay, HeLa cells are infected wiih serial dilution~of rhinovirus as above, but detergent is not present; thus, ~!3UB~;TIT~E SI~E~

WO94/0048s 2~ 3 PCI/US93/0597 this assay cannot be used ~o assay tmICAM. In this assay the tICAM is present continually in the culture medium at the indicated concentration. tmICAM-I (which requires the presence of detergent) cannot be assayed in this system because theaddition of the required detergent would kill the HeLa cells.

, 5 C. Plaque-reduction assay in con~nual presence of virus and ICAM
This assay is similar to that utilized by Marlin, et al. (Nature 1990) in which a culture of HeLa OElls is infected with 100 PFU of virus in the presence or absence of ICAM protein and cultured approxirnately 4 days until cytopathic effece (CPE) is apparent. The cultures are then scored for CPE visually. The assay conditions were 10 the same as Marlin, supra. Scoring was done visually rather than by a staining procedure using crystal violet.~ ~
I n this assay~, there is no detergent present, the TCAM is present continually,and this~assay measures~a reduction in virus replicabon/propagation at an arbitrary point in~dme. ~
~ The data~from ~these three~ di~ferent assays for virus infectivity is summarized in Ta~le 4. :~

TABLE 4 ~
IC50% (,uM)* ;;
AM ~ Assay: A B
~ tmICAM~ 0.03 ND
tI~AM(453) ~ 20 0.2 0.2 tICAM(185) ~ ~ >20 8 ND
* IC50%~is defined~ as the ~concentration of ICAM protein needed to inhibit HRV3infectivity by 50%.~

25~ ~ These data lndlcate that; tmICAM-l is slgnificantly more active in reducing viral infec~ivity than the truncated ICAM~ proteins, even when eompared in dif~erent assay systems. The~differences in neutlalization activity of tICAM(453) in assay (A) ST'~TUTE S~F~L.'~

WO 94/00485 PcrtUS93/05972 2 ~ 3 and assay ~B~ indicate that the neutralization rnediated by tICAM(453) requires the continual presence of tICAM(453) in the culture medium and is reversible. That the neutralization is reversible is indicated by the lack of significant neutralization observed in assay (A). In contrast, the neutralization activity of tmICAM-l is ~ 667-5fold higher than tICAM(453) and than tICAM~185) in assay (A) and could be even greater in assay (B) if it were possible to have the tmIC~M-l present continually in the eulture medium in the absence of detergent. The conditions in assays B-D more closely reflect the in vivo situation in which soluble ICAM could be used as an antiviral agent.
lOTo compare these results with those of Marlin et al., an attempt was made to reproduce their assay conditions. As shown in Table 4, there is a good correlation between the results in~assay (B) and assay (C), althuugh the IC50% for tICAM(453) is lO-fold greater than that seen by Marlin et al. To determine if this is due to a dif~erence in the serotype of rhinovirus used, the assay was repeated with HRV 14 and ~15~~ HRV54~(the serotype used by~ Marlin, et al.). The IC50% for both of these serotypes was 0.2 ,uM tICAM(453), lndicating that~ there is no difference in serotype sensitivity between HRVl4, ~HRV549 and HRV3.
To attempt to resolve~ this discrepancy, the same buffers that Marlin, et al.
used were used to see lf they affected the Infectivity of rhinovirus in assay (C).
20Marlin, et al. ~prepared~ ~their sICAM-l protein in a buffer containing 50 mM
t riethanolamine (TEA)120 mM Tns. When this buffer alone was added to control in~fechons (lllOth~volume, final concentrat~on 5 mM TEA/2 mM Tris~ of HRV3 and HRVl4, virtually compl~ete inhibition of CPE was observed. Thus, it is possible that there could be buffer effects on~ virus replication unrelated to the presence of any 25 ~ form of ICAM. ~ ~
However, ~subsequent assays usmg a broad panel of HRV serotypes indicates that the IC50% for HRV54 may ~in fact be significantly lower than for other HRV
serotypes, e.g. HRV3.

:

~: : :
~B~ ~T~ t f~ 1 s~ ~3 PCl/US93/05972 WO 94/004~5 -33- ~ :
~XA~PI,E 11 US~ OF MULTIM~RIC FORMS OF tmICA~ ANI:) tlCA~s AS EFFECTIVE
~I~ITORS OF ICA~IILFA-l INTE~CTION
The normal funchon of ICAM-l is to serve as a ligand of the leukocyte min at 37 C. The microtiter~plates were then washed three~times with me~la, and t e S numbcr of cells bound to the plate 5 d tlCAM(453) both inhibited JY ce binding at identical concentrations of between 5 and 20 ~M.
TA~3L~ 5 % JY~ Cell ~Binding O ~ tlCA~`t ~ tlCA~
2 ~ 20~ ~ ~ 100 0.6 ~ g3 ~ ~ 72 0.02~ 86 80 ~ o~oO6 : :: 89 97 Binding: t~ lCAM-I-coated mlcrotlter plates; 10 ~g/ml and-LFA-I or anti-lCAM
; ~ ~ MAb Inhiblted: bindlng to ~<l~o. ~ ~

:: : : : :: :

;iTi ~ ~r~r~
. ~

wo 94/00485 P~r~uS93/~5972 2 1 3 ~

Construction of tICAM/IgG Immunoadhesins A soluble derivative of ICAM-1 was constructed by a cDNA fusion which linked the first two domains of ICAM-1 (residues 1-1~5) to a segment of human S immunoglobulin heavy chain cDNA. This approach has been described previously for the CD4 molecule [Zettlmeissl, G., J-P Gregersen, J.M. Duport, S. Mehdi, G.
Reiner, and B. Seed, "Expression and Chara~terization of Human CD4 Immunog,lobulin Fusion Proteins", DNA and Cell Biology (1990) 9(5):347-353;
Capon, D.J., S.M. (:hamow, J. Mordenti, S.A. Marsters, T. Gregorys H. Mitsuya, }0 R.A. Bryn, C. Lucas, F.M. Wurm, J.E. Groopman, S. Broder, ard D.H. Smith, "Designing CD4 immunoadhesins for AIDS therapy", Nature (1989) 337:525-531;
Traunecker, A. J. Schneider, H. Kiefer and K. Karjalainen, "Highly efficient neutralization of HIV with recombinant CD4-immunoglobulin molecules", Nature (1989) 339:68-70~ and resulted in the expression of disulfide-linked dimers.
The cDNA fusion was accomplished by a two-stage polymerase chain reaction (PCR) strategy. ~Se~, e.g., Horton, R.M., Z. Cai, S.N. Ho, and L.R. Pease7 "GeneSplicing by Overlap Extension: Tailor-Made Genes Using the Polyrnerase Chain Reaction", BioTechnlques (1990) 8(5):5~8-535]. The first step involved the separate amplification of a fragment coding for resldues 1-185~of ICAM-1 and an IgG heavy20 chain fragment beginning at rç5idue 216 in the hinge region and ending at the C-terminus o~ the molecule~ (see Fig. 3). The PCR primer used at the 3' end of theICAM-l fragment~contained aD additional 24 bases complementary to the first 24 bases of the IgG fragment: CGG TGG GCA TGT GTG AGT l~ GTC AAA GGT
CTG GAG CTG GTA GGG GGC. The 5~ ~CAM-1 primer (5~ noncoding and signal 25 sequence) had the sequence: ~
:
HindI I I ~ .
GGA ATT CAA GCT TCT CAG CCT CGC TAT GGC TCC CAG CAG CCC CCG GCC C

The 5' IgG primer had the following sequence: GAC AAA ACT CAC ACA TGC
~CA CGG; the 3' primer from the end of the IgG coding sequence was: -~,.
SU~3STITUTE5~E~

wO 94/00485 ~ ~ ~ S ~ ) PCI/US93/05972 XbaI
G GGA $TC TCT AGA TCA TTT ACC CGG AGA CAG GGA GAG GCT

Amplifications were performed using lO ng of cloned lCAM-l or IgG1 heavy chain cDNA for 10 cycles with 1 min at 94 C, 2 min at 55 C and 1.5 min extensions at 72 5 C. The resulting amplified fragments were mixed in approximately equimolar amounts and used as template f~r the second step PCR reaction. This reaction used the 5~ ICAM primer and the 3' IgG primer above~ Amplification for 25 eycles under the same conditions as in the first.step produced a predominant band o~ approximately 1200 bp consistent with the desired product (see Fig. 3). The fragment was digested 10 with HindIII and XbaI (restriction sites incorporated into the 5' and 3' primers respectively), purified and ligated into HindIII/XbaI-cleaved CDM~ veetor.
Clones cont~ining the desired insert were identified by restriction analysis andtwo clones designated pHRR72 and pHRR73 were selected for sequence analysis Sequencing of the junction region between ICAM-1 and the IgG hinge confirmed that 15 both clones had the correct structure. The plasmids were transfected into COS cells which were labelled with [35S]cysteine overnight at 48 hours post-transfection as in Example 6. The supernatants were immunoprecipitated with anti-ICAM-1 monoclonal antibody c78.4A and analyzed by SDS gel eleetrophoresis as in Example6. Under reduclng conditions a band with an apparent molecular weight of 68 kl~
20 was specifically immunoprecipitated, corresponding to the ICAM^1/IgG fusion.
Expresslon of clone pHRR72 was consistently higher than pHRR73 so this clone wasscle~ted far further:stud~y.
COS: Gells were transfected with pHRR72 according to the method of Ex~mple 3 and at 48 hours after transfection the media was replaced with serum-free media 25 containlng [35S]cysteme and the cells were labelled overnight as above. The supernatants were:incubated with protein A- SepharQse Ibeads, and bound protein was ~: eluted with 0. l M acetic acid, neutralized and analyzed by gel electrophoresis under redueing and non-reducing conditions. A control was performed in which plasmids expressing heavy and light chains of a funetional antibody were co-tsansfected. This 30 experimen~ showed that the protein produced by pHRR72 is capable of binding protein A, showing ~hat the pHRR72 protein cont~ins the lgG constant regisn, and SUæ5TlT~TE SHEET

WO 9~1/004~5 PCI /US93/05972 i' 1. .~. tj 1 0 ~3 -36-that the 68 kD band seen under reducing conditions shifts to a high molecular weight dimerie ~orm under non-reducing conditions. Thus since only dimeric IgG binds protein A, and since the mobility under non-reducing conditions is at least twice that of the monomer, we conclude that the tICAM(185)tIgG immunoadhesin is a dimer.
5 Correct fo]ding of the ICAM-1 region is indicated by the specific immunoprecipitation -:~
, with c78.4A as in Example 6, and by the quantitative detection of the fusion protein using two ICAM-l-specific antibodies in a radioimmune assay (RIA) as in Example 4.
pHRR72 was co-transfected with pSV2-DHFR into CHO cells by the calcium 10 phosphate method of Example 4 and DHFR+ cells were selected in nucleoside-free medium. Indlvidua3~ colonies were picked, expanded and tested by RIA ~or expression. The three highest-expressing colonies were selected for further study and were recloned ~by limiting` dilutlon. Analysls of labelled cell supernatants by protein A binding and gel ~electrophoresis~ confirmed the expression of tICAM(185)/IgG
15 dimers.
In a simllar manner,~ domalns l -~ V of ICAM-1 (residues 1 453~ were linked to~a segment of human immunoglobulin heavy chain cDNA. A fragment coding for residues 1-453 of I(: AM-1 and a fragment coding for IgG heavy chain beginning at resldue 216 i n the~h~nge reglon and endin~at the C-term~inus of the molecule were - 20 ~ each ~ separately amplified.~ ~The ~PCR primer used at the 3' end of the I(:~AM-1 fragment contained an~ additional 24 bases complementary to the first 24 bases of the IgG fx~gment:~ ~CGG~TGG GCA TGT~GTG AGT1~ GTC (~TC ATA CCG GGG
GGA~:GAG~:CAC Al~. The S' iCAM-1 primer, ~' lgG primer, and ~' pritn~r from t he ei~d of ~the IgG; coding~ sequence were~ the ~same as for the tICAM~185)IgQ fusiol 25 ~ above. After P~R amplificatlon, a band of approximately 2000 bp consistent with a tlCAM(453)/IgG fusion was produced.
elones~containing the desired Insert were identified by restric~ion ~analysis and the clone designated~pHRR 95-9:was~ selected for sequence analysis. The cDNA
sequen~e Is~as~follows~

SUBSTITUTE S~E~

:::~ ~ : .
,;~,D ~:~ 'N

wo~q/00485 2 ~ n ~ PCr/US93/05972 .' 1 CAGACATCTG TGTCCC~CTC AAAAGTCATC CTGCCCCGGG GAGGCTCCGT

101 AGACCCCGTT GCCTA~AAAG GAGTTGCTCC TGCCT~GGAA CAACCGG~AG
151 G~GTATGAAC TGAGCAATGT GCAAGAAGAT AGCCAACCAA TGTGCTATTC
201 AAAC~GCCCT GATGGGCAGT CAACAGCTAA AACCTTCCTC ACCGTGTACT

301 GGCAAGA~CC TTACCCTACG CTGCCAGGTG GAGGGTGGGG CACCCCGGGC
351 CAACCTCACC GTGGTGCTGC TCCGT~GGGA GAAGGAGCTG AAACGGGAGC
401 CAGC$GTGGG GGAGCCCGCT GAGGTCACGA CCACGGTGCT GGTGAGGAGA

551 CC~TTGTCCT GCCAGCGACT CCCCCACAAC TTGTCAGCCC CCGGGTCCTA
601 GAGGTG~ACA CGCAGGGGAC CGTGGTCTGT TCCCTGGACG GGCTGTTCCC
65I AGTCTCGGAG GCCCAG~TCC ACCTGGCACT GGGGGACCAG AGGTTGAACC

751 GTGACCGCAG A~GACGAGGG CACCCAGCGG CTGACGTGT~ CAGTAATACT

901 GTGACAGTGA AGTGTGAGGC CCACCCTAGA GCCAAGGTGA CGC~GAATGG

1001 CCCCAGAGGA ~AAC~GGCGC AGCTTCTCCT GCTCTGCA~C CCTGGAGG$G
1051 GCCGGCCAGC TTATACACAA GAACCAGACC CGGGAGCTTG GTG~CCTGTA
1101 ~GGCCCCCGA CTGGAC~AGA GGGATT&TCC GGGAAACTGG ACGTGGCCAG
1151 AAAATTCCCA ~CAGACTCCA~ ATGTGCCAGG CTTGGGGGAA CCCATTGCCC
25: 1201 GAGCTCAhGT GTCTAAAGGA~ TGGCACTTTC CCACTGCCCA TCGGGGAATC
1251 AGTGACT~TC ACTCGAGATC TTGAGGGCAC CTACCTCTGT CGGGCCAGGA
1301~ GCACTCAAGG GGAGG~CA~C CGCAAGGTGA CCGTGAATGT GCTCTCCCCC
1351 ~CGGTATGAGg acaa~actca: cacatgccca ccgtgcecag cacctgaact : 1401 cctgggggga~ ~cogtcagtct~ tcctcttccc :cccaaaaccc aagg~Gaccc ; 30;; 1451 tcatgatctc ccggacccct ~gaggtcacat gcgtggtggt ggacgtgagc 1501 cacgaagacc ctgaggtcaa gttcaactgg tacgtggacg gcgtggaggt ~: 1551: gcataatgcc~a~agacaaaqc~ cgcgg~gagga gcagtacaac agcacgtacc 1601 gggtggtcag cgtcctcacc~ gtcctgcacc aggactggct gaatggcaag 1651 gagtacaagt gcaaggt~tc caacaaagcc ctcccagccc ccatcgagaa 1701 aaccatctcc aaagccaaag ~ggcagccccg agaaccacag gtg~acaccc 175i tgcccccatc ccgggatqag ctgaccaaga accaggtcag cctgacctgc 1801 ~ctggtcaaag gcttctatcc cagcgacatc gccgtggagt gggagagcaa : 1851 :tgggcagccg gagaacaact: acaagaccac gcctcccgtg ctgqactcc~
1901 acggctcctt cttcctctac~ agcaagctca ccgtggacaa gagcaggt~g 1951 cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa 2001 ccactacacg cagaagagcc tctccctgtc tccgggtaaa tga ~:UBSTIT~JTE SHE~I~
.

WO 94/~485 . PCr/US~3/~5g72 ,. . ~
2 ~ i S 1 ~ ~
-38~
The correspo~ding amino acid sequence of ~e mature fusion polypeptide is as follows:

51 VY~LSNVQED SQPMCYSNCP DGQS~AXTFL TYYW~PERVE LAPLPSWQPV
101 GKNLTLRCQV EGGAPRANLT VVILR&ÆKEL KREPAVGEPA EVTTTVLVRR
151 DH~GANFSCR TEL~LRPQGL ELFENTShPY QLQTFVLPAT PPQ~VSP~VL
201 EVD~QGT W C SLDGLFPVSE AQVHLALGDQ RLNPTVTYGN DSFSAXASVS
251 VTAEDEGTQR LTCAVILGNQ SQETLQTVTI YSFPAPNVIL $RPEYSEGTE
301 ~TVXC.~HPR AKVTLNGVPA QPLGPRAQLL LKATPEDNGR SFSCSATLEV
0 351 ~ AGQLIHKNQT RELRVLYGPR LDERDCPGNW TWPENSQQTP MCQAWGNPLP
401 ELKCLKD~TF PLPIGESVTV TRDL~GTYLC RARSTQGEVT ~KVTVNV1SP
451 RYEDKTHTCP PCPAPELLGG PSVFLFPPKP KDTLMIS~TP EVTCVVVDVS
501 ~EDPEVKFNW YVDGVEVHNA KTXP~EQYN STYR W SVLT VLHQDWLNGK

651 QQGNYFSCSV MHEALHNHYT QKSLSLSPGK *
:
The plasmids were transfected into CO5 cells which were labelled with p~S1cysteine overnight at 48 hours post-transl~ection as in Example 6. The filsion : polypeptide is expressed as a soluble secreted disulfide-linked dimer which binds 20 protein A. The supern~tants were immunoprecipitated with anti-ICAM-1 monoclonal antibody c78.4A and~ analyzed by SDS gel electrophoresis as in Example 6. Under : reducing conditions a band with an apparent molecular weight of 100 kD was specifically immunoprecipitated~ correspondillg to the ICAM-l/lgG fusion, while under non-reduclng condi~ions ;it migrates as a 200 kD dimer.
~: 25 : ~ : : EXAMPLE 13 Rhinovi~us Blndmg and Neutralization by tlCAMlIgG
lmmunoadhesins The tICAM(1853/lgG immunoadhesin of Example 12 consists of residues 1-185 of lCAM-l fused to ~residue 216 in the hinge region of an IgG1 heavy chain.
30 ~he molecule is a disul:fide-linked dimer contalning two rhinovilus binding sites. A
CHO cell line CHO72.2 secreting the immunoadhesin was grown overnight in sPrum-free media containing [35SIcysteine and the fusion protein was purified on protein A
beads. The labelled protein was tested for rhinovirus binding in the pelleting assay as described in Example 7(A). 1 he samples consisted of tICAM(185)/IgG (no visus), : ..
S~1~3STITUTE~ SHEET:

WO 94/00~85 2 ~ ) Pcr/US93/05972 tICAM~185)/IgG ~ HRV3, tICAM(185~/IgG + HRV3 + c78.4A, and ~ICAM(185)/IgG f HRV3 + irrelevant antibody. Pelleting of labelled protein indicative of virus binding was seen with virus and virus + irrelevant antibody by analysis on SDS gels. No pelleting was seen in the absence of virus and signifieantly 5 reduced pelleting was seen in the sample containing c78.4A. This result indicates that the tICAM(185)/IgG binds rhinovirus with a significantly higher affinity than the soluble monomers tICAM(185) and tICAM(453), which do not show levels of binding readily detectable under these conditions. See F,xample 7(A). While approximately 10% of tmICAM-1 pellets under these conditions, only 1% of tICAM(453) pellets, 10 presumably because tmlCAM- 1 is in a dimeric state. The result with tICAM(185)/IgG is similar to that seen in this assay with tmICAM-1, suggesting that the two forms of ICAM may have similar affinities for the virus, and providing further evidence that tmlCAM-1 is a dimer.
Cell supematant from CHO72.2 cells containing unpurified tICAM(18~)/IgG
15 was tested for rhinovirus neutralization in a virus in~ectivity assay according to the method of Exarnple lO(B). Serial dilutions of HRV3 were made in media containing50 % IgG supemat~nt or control supernatant from untransfected CHO cells. The virus dilutlons were mixed with HeLa cells and plated in wells of a 96-well microtiter plate (10 wells per dilution). V~rus titers were determined by scoring the number of ~0 infected wells at each dilution after 6 days. ln addition a quantitative assessment of ~y~opathic e~fect at high virus input was made 2 days after infection. In experiment i A the concentration of tICAM(185)/lgG estimated by RIA was 150 nglml and in experiment ~B) the concentration was 325 ng/ml.

Experiment A Experiment B
HRV3 I x 107 PFU/ml 4 x lo6 PFIl/ml .
HRV3 ~
tICAM(~185)/lgG 6 x 105 PFU/ml 5 x 105 PFU/ml ~:UE~STITlJTE SHEE~

WO ~4/00485 PCI /11~;93/OSg72 2 ~ 161 ~ 40- ~
E~oth experiments resulted in a ten-fold reduction in viral titer at a concentration of approximately 1 nM in experiment A and 2 nM in experiment B. For comparison, monomeric tICAM(453) in the same assay results in a 50% reduction in titer at 0.38 ~M or 30 ~g/ml. Thus the~increase in activity resulting from dimerization of theS rhinovims binding site is at least 2û0-~old and probably greater.
Cell supernatant from CHO72.2 at a concentration of 650 ng/ml (4 nM) was also tested in a competitive binding assay measuring the binding of [35S]HRV3 toICAM-1-coated plastic microtiter wells. Specific binding is determined by compar~ng counts bound with or without pre-incubation of the ICAM-1 in the well with Mab c78.4A.

cpm bound* % binding HRV3 ~ 4945 +/- 58 100 HRV3 + CHO~supernatant 5358 +/- 51 108 ~ ~ HRV3 ~ CHO72.2 supernatant 3187 +/- 206 64 *Mean values determined ~rom tTip!icate wells. Standard errors were less than 10%
of the mean.

The level of binding in the presence of tICAM~185)/IgG was 65% of the normal control binding and~54% of control binding in the presellce of CHO cell 20 ~ ~supernatant, indlcatingclosetoa`50% inhibitlonobinding. Forcomparison, soluble monomenc tlCAM(453)~ inhlb1ts;HRV3 blndmg;by 50% in the sarne assay at 240 ,ug/ml or 3.1~M.~On~a;molar basis the IC;AM-1 lgG immunoadhesin was thus almost ~a 1000-fold better competitor than the monorner. The above experiments were done w1th supernatants. Subsequent attempts to reproduce these results with highly 25 ;purified tICA~I( 1 85)/IgG were unsuccéssful.
The tlCAM(453)11gG~immunoadhesin of Example 12 consis~s of residues 1-4 53 of ICAM-I~ fused ~to residue 216 in the hinge region of an IgG1 heavy chain.
The molecule is a dlsulfide-linked dimer containing two rhinovirus binding sites. The fusion~ polypeptide was expressed~ in HeLa cells using the vaccinia/T~ sysiem and 30 ~ purified from the supernatant by affinity chromatography using an anti-ICAM-1 :
SUBSTiTUTE: SHE~

WO 94/0048S PCr/US93/~5g72 . S I ~ 3 -4 l -monoclonal antibody. The activity of the protein was examined in a competitive binding assay which measures th~ binding of r35S]-l2bellecl HRV to plates coated with purified tmICAM-l. For comparison, soluble monomeric tICAM-453 was included in a parallel assay as a positive control. The binding values are documented in Table 5 8 below:

TABL~ 8 lC50*
tICAM(453) 44 nM
t(453)/IgG
lQ Experiment 1 ll nM
Experiment 2 lO nM

*lCso is the concentration required to inhibit binding by S0%

These values~ are pPr: mol: of tICAM(453) determined by RIA. Since each usion polypeptide contains two tIC~M(453) polypeptides, the values for the fusion J~ polypeptide expressed per mol of dimer are 5.5 nM and S nM ~or Experiments 1 and 2, respectively.~ T herefore on a molar basis the activity of the fus~on polypeptide in the~ competitive bindmg assay is ten-~old greater than th~ tICAM~453) monomer~ In subsèquent experiments the relative activity was 2- to 4-~old greater.

: :~ In Vltro Dimerization f ICAM-l Se~reral lines~of:evidence:indicate that trnICAM-l exists as a noncovalent dimer at the cell surf~ce:~(i) the:stoichiometry of HRV/ICAM-l ~inding sites at the cell surface is approxlmately 2; (il) tlCAM(453), despite being properly folded, has a approximately lO0-~old lower affinity for HRV than purified tmICAM-l; and (iii~
~tICAM(453) and tmICAM-1 absorbed to nitrocellulose filters at a high density bind rhinovirus at equivàient levels. See Example 7. In addition, Stauntan et al. (Cell SlJBSTlT~JTE SH~ET
:: , Wo 94/00485 PCI /1 lS93/05~7t , .. . .
21~61~J

61:243-254 ~1990)) have reported that some mutants of lCAM-l form covalent dimers at the cell surface, indicating that this protein has the capability to self-associate isl vivo. Attempts to directly demonstrate the existence of dimers by chemical cross-linking with water-soluble carbodiimide/NHS, which is a heterobifilnctional S crosslinker which forms a covalent bond between a primary amine and a carboxyl group, did result in crosslinking of tICAM(453) into a 180 kD species, whose size is consistent with a dimer (Figure 4A). This crosslinking is directly dependent upon the concentration o~ tICAM(453), witn 50% crosslinking at 7 ,uM protein (Figure 4B). This concentration is consistent with the relatively high concentration of tmICAM-1 at the surface of a HeLa cell, which is approximately 2.5 ~M or 135 ~g/ml. The self-association detected by this crosslinking is specific, since it is not affected by high concentrations of third-party proteins (Figure 4C). tICAM(185) appears to be poorly crosslinked under the same conditions, indicating that domains 3-5 are involved in self-association. Because of the extensive modification of the : 15 protein by thls crosslinking procedure, the protein had no virus-binding activity However, this data shows that soluble ICAM can self-associate in solution, and that this self-association is concentration-dependent and -speciflc.

~EXAMPLE 15 In order to examine the: role: of the transmembrane and cytoplasmic domains ~: ~ of tmIC~M-l in high-affin~ty rhinoviNs binding, we constructed a chimeric ICAM-l which is anchored on the cell sur~ace by a phospholipid tall and lacks these domains (see Pig. 5). This experiment was designed to test whether the cytoplasmic and $~nsmembrane domalns are necessary for the formation of dimeric ICAM-l on the ~ cell surface, which~results in the high affinity binding of rhinovirus. In order to :
modify the ICAM-I cDNA to express a phospholipid-anchored form, we ~1rst used :`
site-direc~ed mutagenesis to create a unique SaclI site at residues 450/451 close to the ~:;
: ~ end of the extracellular region. This allowed the isolation of a cDNA fragment coding for residues 1-451 of ~ICAM-l, by dlgestion of the modified plasmid with HindIII and SacII. We used PCR tO genera~e ~ fragment coding for the C-terminal SIJBSTITIJTE SHEI~' .

Wo 94/00485 PCr/US93/0~972 .
21~6139 28 amino acids of the phospholipid-anchored form of LFA-3 (Seed, B., Nature (1987) 329:840-842). By including a SacII site in the 5' primer this fragment was ligated to the ICAM-1 extracellu}ar domain and cloned into the expression vector CDM8, resulting in the plasmid pHRR 70-lg. This plasmid contains a cDNA coding for residues 1-451 of ICAM-1 fused to residues 210-237 of LF~-1, which should resultin the expression of a phosphoplipid-anchored molecule containing the ICAM-1 extracellular region. See Fig. 5.
Trans~ection of CGS cells with pHRR 70-19 according to the method of Example 4 and FACS analysis with anti-ICAM-1 antibodies confirmed the cell surface lû expression of the fusivn~protein. The binding of ~5S]-labelled cells to COS cells .
transfected with the fusion protein was determined.

TABLE 9 ''' :' ,~ .
ICAM-I cpm bound % virus~ut % control tmICAM-1 2130 +1- 278 9.4 100 : :, tICAM(1~185~ / 238 2 +/-293 11.2 119 LFA-3~210-237)~chimera - This result shows~that there is no significant difference ~etween the ability of tmICAM-1 and the tlCAM(l-451;)/LFA-3(210-237) chimera to bind HRV. It can therefore be concluded~that the transmembrane and cytoplasmic domains are not ~;
20 required for HRV ~binding~, and that dimerization must depend on interactions between extracellular règions of the molecule. ;
Additlonal evidence that a form of I~AM-1 lacking the cy~oplasmic and transmembrane ~domains ~functions efficiently~ as a receptor f~r rhinoviruses was obtained~by transfect~on of the~ tlCAM(1-4513/LFA-3(210-237) chimeric gene into 25 HeLa 229~cells. We have determined that these cells do not express ICAM-l on the surface and are resistant to HRV~infection. Transfection of either tmICAM-I or the SUBSTITUTE SHEE~

Wo ~/0048s Pcr/l 1~93/05972 .
h ~ -? ~ -44-tICAM(1-451)/LFA-3(210-237) chimera results in cells which are readily infectable with rhinovirus and produce virus at levels comparable to normal HeId cells.

Irrevcrsible Inactivation of HRV bv TCAM
We have demonstra~ed that tIC~M(453) can, in addition to blocking the binding of HRV to cells, irreversibly inactivate HRV. Incubation of HRV with tICAM(453) at 34 C results in conversion of a fraction of the vin~s from the nati~e 148S form to a 42S form (Figure 6). The 42S form is non-infectious, lacks the viral subunit VP4, and lacks the RNA genome (empty capsid). This can be shown by SDS-PAG~ analysis of [35S~methionine labelled viral particles and by quantitation of viral RNA content by hybridization with a [32P]oligonucleotide probe for rhinovirus (5~-GCAl-rCAGGGGCCGGAG-3'). Thus, tICAM(453) can uncoat rhinovirus, an event that norrnally occurs intracellularly during the course of infection. The :: uncoating is a slow process, occur~ng with a tl/2 of 6 hours at 34 (::, in contrast with the inhibition of binding, which occurs with a tl/2 of ~ 30 minutes. The uncoating is highly ternperature-dependent, occurring 10 times faster at 37 C than at 34 C, the optimal temperatur~ of rhinovirus growth. Enhancement of this uncoating activity by soluble forms of ICAM-1 including multlmeric configurations of ICAM-1 will lead to improvement of antiviral activity by making neutraliz~tion irreversible.

~ : Example 17 Cysteine Muteins To identify the correct site to place cysteine residues for multimerization of ICAM-1, the region~ of the protein surface involved in sel~-association must be identi~led. Domains ~IV and V have been chosen because they are distal to the ~iral binding sites (domaln lj and because domains II-V are implicate~ in sel~-association ~: : (see Example 14). Sincè the structure of ICAM-1 is not certain, we hav~ attempted to align the sequen~e of domains IV and V at the C-terminus of the extracellulardomain of ICAM-I onto the immunoglobulin fold, as ICAM-I has homology to . .
SUB5TIT~IITE SHEE~T

WD 94/00485 ~ 9 pcr/us93/o~g72 members of the immunoglobulin supergene family. This alignment is shown diagrammatically in Fig. 7. Then, to identify probable sites involved in self-association, we have examined the three-dimensional structures of several memhers of the immunoglobulin supergene family, IgG and MHCl/beta-2 microglobulin.
5 Immuno~lobulin domains have two broad faces of beta sheet structure, here designated the 'IB'' face and the "F" face. Inspection of the above structures revealed that different immunoglobulin-like domains interacted via one or the other of these faces of the domain. IgG vanable regions associated via their F face, while IgG
constan~ regions (CH1, CH2, and CH3) and MHC1/beta-2 microglobulin all interact 10 via their B faces.
. .
ICAM-1 domains have highest homology to constant region-like domains.
Thus, the most likely sites of interaction are on the B face of the domains; the most , likely sites on thè B ~face to plAce c~ystelne residues are close to the center of the B
face (adjacent to the cysteine on. the B strand that ~orms the intrachain disulfide 15 bond), where lgG CH3~domains self-assoclate, or on the N-terminal end of the B
face, where IgG CH2 domains and MHCl/beta-2 microglobulin self-associate.
A number of mutants~were prepared to identify appropnate sites of interaction.
These mutants were prepared by~st~ndard~ site-directed mutagenesis methodology to mutate selected residues to;cysteine on tlCAM(453) and tmlCAM. These cDNAs in 20 t he vector CDM8 wére~ then transfected into COS cells and dimer formation accessed by biosynthétic~ labelling of lCAM-l ~ with [3sS]cysteine followed by immunoprecipitatlon and~non~reducing SDS-PAGE analysis. As shown in Table 10, of 13 mutants tested, two have beell found to form dimers at a small (about 5 %) but significant level~

: :: : :
:

:: ` :

SUBSTITUTESIIEEI-~: : . ' :

WO ~4/00485 . PCr/US93/05972 21~ 6~a9 -46-Position of Cvsteine Dimer Formation (tmICAM-l) 307 +

29 ~ ~.

: (tlCAM(453)) 338 ~ ~

37~

;:
.., These two mutelns, Cys-307 and Cys-309, are both located on the ~-terminal end of he B face:of:domain IV. The relatively low level of dimenzation may reflect the low 20 concentra~ion ~of IC~AM-1 on the cell sur~dce (low expression)~ or imperfect orientation of: the cysteine residues relative to the site of interaction. These data indicate that this region of the domain is a likely site of interaction. Other residues adjacent to residues 307 and 309, e.g. His-308, Arg-310, Glu-294, Arg-326, Gln-328, e likely to increase:; the efficiency of the dimer formation. Mutations that lead to 25 dimer formation of tmICAM-1 are then be placed on tICAM(453j for the secretion , of soluble ICAM-l dlmers.
; ~ A tlCAM(452) cysteine mutant was prepared by substituting a cysteine ~or an alanine at position 307 in the ICAM-l amino acid sequence and inserting a stop codon .
SUBSTITUTE SHEF
:

Wo 94/0~485 ~ 9 Pcr/us93/05972 after amino acid residue 452. The mutein was corlstructed by si~e~irected mlltagenesis using a full-length ICAM-1 cDNA and has the following DNA sequence:
1 CAGACATCTG TGTCCCCCTC ~AA~GTCATC CTGCCCCGGG GAGGCTCCGT
5l GCTGGTGACA TGCAGCACCT CCTGTGACCA GCCCAAGTTG TTGGGCATAG
lOl AGACCCCGTT GCCTAAAAAG GAGTTGCTCC TGCCTGGGAA CAACCGGAAG

20l AAACTGCCCT GATGGGCAGT CAACAGCTAA AACCTTCCTC ACCGTGTACT
: 25l GGACTCCAGA ACGGGTGGAA CTGGCACCCC TCCCCTCTTG GCAGCCAGTG

0 351 CAACCTCACC GTGGTGCTGC TCCGTGGGGA GAAG&AGCTG AAACGGGAGC

~S1 GATCACCATG GAGCCAATTT CTCGTGCCGC ACTGAACTGG ACCTGCGGCC
501 CCAAGGGCTG :GAGCTGTTTG AGAACACCTC GGCCCCCTAC CAGCTCCAGA
SSl CCTTTGTCCT: GCCAGCGACT CCCCCACA~C TTGTCAGCCC CCGGGTCCTA
lS 601 GAGGTGGACA CGCAGGGGAC CGTGGTCTGT TCCCTGGACG GGCTGTTCCC

701 ` CCACAGTCAC ~TATGGCAAC ~GACTCCTTCT CGGCCAAGGC CTCAGTCAGT
: 751 GTGACCGCAG AGGACGAGGG CACCCAGCGG CTGACGTGTG CAGTAATACT
801 GGGGAACCAG:~AGCCAGGAGA ~CACTGCA~AC AGT~ACCATC TACAGCT~TC
20: 851 CGGCGCCCAA CGTGATTCTG~ ACGAAGCCAG AGGTCTCAGA AGGGACCGAG
9Ol GTGACAGTGA AGTGTGAGtg CCACccgcgg GCCAAGGTGA CGCTGAATGG
95l GGTTCCAGCC ~CAGCCACTGG GCCCGAGGGC CCAGCTCCTG CTGAAGGCCA
`1001 CCCCAGAGGA~CAACGGGCGC AGCTTCTCCT GCTCTGCAAC CCTGGAGGTG
: iO51 GCCGGCCAGC: TTATACACAA: GAACCAGACC CGGGAGCTTC GTGTCCTGTA
;25 ~ llOl ~;TGGCCCCCGA ~CTGGACGAGA;~ GGGATTGTCC GGGAAACTGG ACGTGGCCAG
IlSl ~AAAATTCCCA GCAGACTCCA ::ATGTGCCAGG C~TGGGGBAA C~CATTGCCC
1201~ GAGCTCAAGT~:GTCTAAAGGA; TGGCACTTTC CCACTGCCCA TCGGGGAATC
1251 AGTGACTGTC ;ACTCGAGATC TTGAGGGCAC CTACCTCTGT ~CGGGCCAGGA
l30l~ GCACTC~AGG;~:GGAGGTCACC: CGCAAGGTGA CCGTG~ATGT GCTCTCCCCC
30 13Bl CGGTATTAG`~

The~foregoing examples describe the creation of soluble, multimeric ~orms of tlCAM that substantiall~y increase tl~::AM~binding and neutralizing activi~y.While the present i nvention~has been~ described in terms of specific methods and compositions, it~is understood~ that variations and modificatlons will occur to 35 ~ those skilled iDthe art upon~conslderation of:the presene invention.
: For~exarnple, It is~antlcipated that;smal!er pr(!tein fragments and peptides ~::; : derived ;from lCAM-l that still contain the vlrus-binding site would also be effective in a multimeric configuration. It Is also antlcipated that multimeric ICAM may be effective inhibitors of the ICAM-I/I FA-I interaction~ as ~he affinity between these , SUB8TIl~TE SHEEl- ;

W~ 94/00485 Pcr/US93/0597~
, 21~1 D9 e~fective inhibitors of the ICAM-l/LFA-1 interaction, as the af~lnity between these two molecules is quite low and the cell-cell binding mediated by these two molecules is highly cooperative.
Although the preferred form and configuration is a non-transmembrane (truncated) ICAM in dimeric con~lguration, it is not intended to preclude other forms ;
and configurations effective in binding virus and ef~ective in neutralizing viral activity from being included in the scope of the present invention.
Further, it is anticipated that the general method of the invetltion of preparing soluble protein forms from insoluble, normaily membrane bound receptor proteins can be used to prepare soluble multimeric forms of other receptor proteins useful for binding to and decreasing infectivity of viruses other than those that bind to the "major group" receptor. Such other viruses include polio, Herpes simplex, and Epstein-Barr virus. ;
Numerous modifications and vanations in the invention as described in the above illustrative examples are expected to occur to those skilled in the art and consequently only such limltations as appear in the appended claims should be placed thereon.
Accordingly it is intended~in the appended claims to cover all such equivalent variations which come within the scope~ of the invention as claimed.

:
' :

8UBSTITUTE SI~

.

`:~

Claims (43)

WHAT IS CLAIMED IS:

1. Multimeric ICAM.

2. The multimeric ICAM of claim 1 wherein said ICAM is non-transmembrane ICAM.

3. The multimeric ICAM of claim 2 wherein said non-transmembrane ICAM is substantially without the carboxyl intracellular domain and without the hydrophobic membrane domain.

4. The multimeric ICAM according to claim 2 wherein said non-transmembrane ICAM is a member selected from the group consisting of tICAM(453), tICAM(185), tICAM(88), tICAM(283), and tICAMs comprising one or more sequences selected from tICAM(89-185), tICAM186-283, tICAM(284-385), tICAM(386-453), tICAM(75-77), tICAM(70-72), tICAM(64-66), tICAM(40-43), tICAM(36-38), tICAM(30-33), and tICAM(26-29).

5. The multimeric ICAM of claim 1 wherein said ICAM is multimerized by adsorption to a support.

6. The multimeric ICAM of claim 5 wherein said support is an inert polymer and is a member selected from the group consisting of nitrocellulose, PVDF, DEAE, lipid polymer, and amino dextran.

7. The multimeric ICAM of claim 1 wherein said multimeric ICAM is multimerized by coupling to a member.

8. The multimeric ICAM of claim 7 wherein said ICAM is modified with at least one reactive amino acid to provide at least one site to facilitate coupling.

9. The multimeric ICAM of claim 8 wherein said reactive amino acid is a member selected from the group consisting of lysine and cysteine.

10. The multimeric ICAM of claim 7 wherein said member is a member selected from the group consisting of an antibody and a protein carrier.

11. The multimeric ICAM of claim 10 wherein said antibody is anti-ICAM antibody CL 203.

12. The multimeric ICAM of claim 10 wherein said protein carrier is a member selected from the group consisting of albumin and proteoglycans.

13. The multimeric ICAM of claim 1 wherein said ICAM is modified at either terminus to comprise a lipid capable of promoting formation of oligomer micelles.

14. The multimeric ICAM of claim 1 comprising two or more ICAMs, which may be the same or different, linked to each other.

15. The multimeric ICAM of claim 14 wherein said ICAMs are directly linked to each other without a linker.

16. The multimeric ICAM of claim 15 wherein said ICAMs are linked to each other via at least one disulfide bridge.

17. The multimeric ICAM of claim 16 wherein said ICAMs are crosslinked via a cysteine disulfide bridge at position 307 on each ICAM.

18. The multimeric ICAM of claim 16 wherein said ICAMs are crosslinked via a cysteine disulfide bridge at position 309 on each ICAM.

19. The multimeric ICAM of claim 14 wherein said ICAMs are indirectly linked viaa cross-linking agent.

20. The multimeric ICAM of claim 19 wherein said cross-linking agent is selectedfrom the group consisting of heterobifunctional and homobifunctional cross-linking reagents.

21. The multimeric ICAM of claim 20 wherein said cross-linking reagent is a member selected from the group consisting of bifunctional N-hydroxysuccinimide esters, imidoesters and bis-maleimido-hexanes.

22. The multimeric ICAM of claim 1 wherein said ICAM is a member selected from the group consisting of fully glycosylated ICAM, partially glycosylated ICAM, ornon-glycosylated ICAM.

23. In a method for enhancing the binding of ICAM to a ligand, the improvement comprising the steps of:
presenting said ICAM in a multimeric configuration.

24. The method according to claim 23 wherein said ICAM is tICAM.

25. The method according to claim 24 wherein said ICAM is a member selected from the group consisting of tICAM(453), tICAM(185), tICAM(88), tICAM(283), and tICAMs comprising one or more sequences selected from tICAM(89-185), tICAM186-283, tICAM(284-385), tICAM(386-453), tICAM(75-77), tICAM(70-72), tICAM(64-66), tICAM(40-43), tICAM(36-38), tICAM(30-33), and tICAM(26-29).

26. The method according to claim 23 wherein said ICAM is modified with at leastone reactive amino acid to provide at least one site to facilitate coupling.

27. The method according to claim 26 wherein said reactive amino acid is selected from the group consisting of lysine and cysteine.

28. The method according to claim 23 wherein said ICAM is modified at either terminus to comprise a lipid capable of promoting formation of oligomer micelles.

29. The method according to claim 23 wherein said multimeric configuration comprises a first ICAM cross-linked to a second ICAM.

30. The method according to claim 29 wherein said first and second ICAM are eachmuteinized to contain a cysteine residue at position 307, and said first and second ICAM are cross-linked via a disulfide bridge between said cysteines at position 307.

31. The method according to claim 29 wherein said first and second ICAM are eachmuteinized to contain a cysteine residue at position 309, and said first and second ICAM are cross-linked via a disulfide bridge between said cysteines at position 309.

32. The method according to claim 23 wherein said multimeric configuration comprises ICAM adsorbed to a support.

33. The method according to claim 32 wherein said support comprises a member selected from the group consisting of high molecular weight and substantially inert polymers.

34. The method according to claim 33 wherein said polymer is an inert polymer and is a member selected from the group consisting of nitrocellulose, PVDF, DEAE, lipid polymers, and amino dextran.

35. The method according to claim 33 wherein said multimeric ICAM is multimerized by coupling to a member.

36. The method according to claim 35 wherein said member is a member selected from the group consisting of an antibody and a protein carrier.

37. The method according to claim 29 wherein said cross-linking reagent is a member selected from the group consisting of heterobifunctional and homobifunctional cross-linking reagents.

38. The method according to claim 37 wherein said protein carrier is a member selected from the group consisting of albumin and proteoglycans.

39. The method according to claim 36 wherein said antibody is anti-ICAM antibodyCL 203.

40. The method according to claim 23, wherein said ligand is a member selected from the group consisting of human rhinovirus, major group receptor virus, lymphocyte-associated antigen-1 (LFA-1) and Plasmodium falciparum.

41. A pharmaceutical composition comprising a pharmaceutically acceptable solvent, diluent, adjuvant or a carrier, and, as the active ingredient, an effective amount of a polypeptide according to claim 1.

42. A method for inducing irreversible uncoating of human rhinovirus, said method comprising contacting said human rhinovirus with ICAM-1 or a tICAM fragment thereof.

43. A method of irreversibly inhibiting infectivity of a mammalian cell by a human rhinovirus, said method comprising contacting said human rhinovirus with ICAM-1 or a tICAM fragment thereof under conditions which allow the ICAM-1 or tICAM
to bind to said rhinovirus; thereby stimulating irreversible uncoating of said rhinovirus.