AU675441B2 - Multimeric forms of human rhinovirus receptor protein - Google Patents

Description

MULTIMERIC FORMS OF HUMAN RHINOVIRUS RECEPTOR PROTEIN

BACKGROUND OF THE INVENTION

This application is a continuation-in-part of copending application US 07/704,984 (filed 24 May 1991), which in turn is a continuation-in-part of copendi application USSN 07/556,238 (filed 20 July 1990).

The present invention relates to novel forms and multimeric configurations intercellular adhesion molecule (ICAM), including both full-length and truncat forms of these proteins, that effectively bind to human rhinovirus and can effectiv reduce HRV infectivity, and to methods of making and using same. Full-length ICAM, also known as human rhinovirus receptor (HRR), is term transmembrane ICAM (tmICAM-1); non-transmembrane ICAM forms, also kno as truncated ICAM (tICAM), are less than full length. When in a multime configuration, preferably as dimers, these proteins display enhanced binding of hum rhinovirus (HRV) and are able to reduce HRV infectivity. In addition, th multimerized proteins may also be used to reduce infectivity of other viruses that known to bind to the 'major' group human rhinovirus receptor (HRR), such Coxsackie A virus, and may also be used to block transmembrane intercellu adhesion molecule (tmlCAM) interaction with lymphocyte function-associated antig 1 (LFA-1), which is critical to many cell adhesion processes involved in t immunological response. Lastly, these multimerized proteins may be used to stu the ICAM-1/HRV interaction especially with respect to designing other drugs direct at affecting this interaction.

Human rhinoviruses are the major causative agent of the common cold. Th belong to the picornavirus family and can be classified based on the host cell recep to which they bind. Tomassini, et al., J. Virol., 58: 290 (1986) reported the isolati of a receptor protein involved in the cell attachment of human rhinovir Approximately 90% of the more than 115 serotypes of rhinoviruses, as well several types of Coxsackie A virus, bind to a single common receptor termed t "major" human rhinovirus receptor (HRR); the remaining 10% bind to one or m other cell receptors. Recently, Greve, J. et al. , Cell, 56:839 (1989), co-authored by the inventors herein, identified the major HRR as a glycoprotein with an appar molecular mass of 95,000 daltons and having an amino acid sequence essentia identical to that deduced from the nucleotide sequence of a previously described c surface protein named intercellular adhesion molecule (ICAM-1) [see Fig. Simmons, D. et al., Nature, 331:624 (1988); Staunton, et al., Cell, 52:925-9 (1988)]. Subsequently, Staunton, D.E., et al., Cell, 56:849 (1989), confirmed t ICAM-1 is the major surface receptor for HRV. See also, Staunton, et al., Ce 61:243-254 (1990). ICAM-1 is an integral membrane protein 505 amino acids lo and has: i) five immunoglobulin-like extracellular domains at the amino-terminal e (amino acid residues 1-453), ii) a hydrophobic transmembrane domain (454-477), a iii) a short cytoplasmic domain at the carboxy-terminal end (478-505). See Fig. ICAM-1 is a member of the immunoglobulin supergene family and functions as ligand for the leukocyte molecule, lymphocyte function associated molecule- 1 (LF 1), a member of the integrin family. Heterotypic binding of LFA-1 to ICAM mediates cellular adhesion of diverse cell types and is important in a broad range immune interactions; induction of ICAM-1 expression by cytokines during t inflammatory response may regulate leukocyte localization to inflammatory sites. T primary structure of ICAM-1 has been found to be homologous to two cellul adhesion molecules, i.e., neural cell adhesion molecule (NCAM) and myeli associated glycoprotein (MAG),

Several approaches to decreasing infectivity of viruses in general, and rhinovirus in particular, have been pursued including: i) developing antibody to t cell surface receptor for use in blocking viral binding to the cell, ii) using interfer to promote an anti-viral state in host cells; iii) developing various agents to inhi viral replication; iv) developing antibodies to viral capsid proteins/peptides; and blocking viral infection with isolated cell surface receptor protein that specifical blocks the viral binding domain of the cell surface receptor.

Using this last approach, Greve, et al., Cell, 56:879 (1989), supra, report that purified tmICAM-1 could bind to rhinovirus HRV3 in vitro. Unpublished resu with HRV2, HRV3, and HRV14 demonstrate a positive correlation between the abili to bind to rhinovirus and the ability to neutralize rhinovirus particularly if the bind studies are carried out under conditions where ICAM-1 is presented in a particu form and configuration as discussed further, infra. Results (unpublished) us HRV14 and HRV2 demonstrate a positive correlation between the receptor class the virus and the ability to bind to tmICAM-1 in vitro. That is, ICAM-1, being major receptor, can bind to HRV3, HRV14, and other "major" receptor serotypes neutralize them, while it does not bind or neutralize HRV2, a "minor" recep serotype. Further studies (unpublished), using purified tmICAM-1, demonstrate t it effectively inhibits rhinovirus infectivity in a plaque-reduction assay when rhinovirus is pretreated with tmICAM-1 (50% reduction of titer at 10 nM receptor one log reduction of titer at 100 nM receptor protein). These data were consist with the affinity of rhinovirus for ICAM-1 of Hela cells, which had an appar dissociation constant of 10 nM, and indicated a direct relationship between the abil of the receptor to bind to the virus and to neutralize the virus. Because large-sc production of tmICAM-1 is not presently economically feasible, and beca maintenance of tmICAM-1 in an active form requires the use of detergents, altern means of producing a receptor protein for use as a rhinovirus inhibitor are desirab Forms of the tmICAM-1 cDNA gene have been developed (as well as cell lines t produce the expression products; USSN 07/390,662) that have been genetica altered to produce truncated ICAM-1 molecules. See Fig. 2. These truncated for of ICAM-1 (tICAM(453) and tICAM(185)) lack the transmembrane region and secreted into the cell culture medium. They bind to rhinovirus in the assay descri in Greve, et al., Cell, 56:879 (1989), supra, although at substantially reduced lev relative to tmICAM-1. Thus, their effectiveness as inhibitors of rhinoviral infectiv appeared to be less than that of tmICAM-1. See generally co-pending applicati USSN 07/239,571; USSN 07/262,428; USSN 07/678,909; USSN 07/631,313; US 07/301,192; USSN 07/449,356; USSN 07/798,267; USSN 07/556,238; US 07/704,996; and USSN 07/704,984.

USSN 07/239,571 filed September 1, 1988, and its CIP applications US 07/262,428, USSN 07/390,662 (abandoned in favor of continuation US 07/678,909), USSN 07/631,313, and USSN 07/704,996 are directed to the use transmembrane rhinovirus receptor as an inhibitor of rhinovirus infectivity using n ionic detergent to maintain the transmembrane protein in solution, and directed truncated intercellular adhesion molecules (tICAM) comprising one or more of extracellular domains I, II, III, IV, and V of tmlCAM, which truncated forms do require the presence of non-ionic detergent for solubilization (see Fig. 2).

USSN 07/130,378 filed December 8, 1987 (abandoned in favor of continuat application USSN 07/798,267), and CIP application USSN 07/262,570 (n abandoned) are directed to transfected non-human mammalian cell lines which expr the major rhinovirus receptor (HRR) and to the identification of HRR as intercellu adhesion molecule.

USSN 07/301,192, filed January 24, 1989, and its CIP application US 07/449,356 are directed to a naturally- occurring soluble ICAM (sICAM) related but distinct from tmlCAM in that this sICAM lacks the amino acids spanning transmembrane region and the cytoplasmic region; in addition this sICAM has a no sequence of 11 amino acids at the C-terminus.

Subsequently, Marlin, S.D., et al. , Nature, 344:70 (1990), reported construction and purification of a truncated soluble form of the normally membra bound ICAM-1 molecule which they termed sICAM-1. It has both transmembrane domain and the cytoplasmic domain of the protein deleted and diff from the wild-type amino acid sequence by a single conservative substitution at carboxyl end. It is composed of residues 1-452 of ICAM-1 plus a novel phenylalani residue at the C-terminus. These workers demonstrated that sICAM-1 was requir at levels > 50 μg/ml to prevent the binding of HRV14 virus to cells. However, th also found that sICAM-1 at 1 μg/ml (18 nM), when continually present in the cult medium, was able to inhibit by 50% the progression of an infection by HRV54. inhibitory activity was correlated with the receptor class of the virus, in t Coxsackie A13 but not poliovirus or HRV2 was inhibited; infectivity data for HR was not reported, however. Thus, they did not demonstrate a direct correlati between binding and inhibition of infectivity. Further, as discussed in greater det infra, attempts to reproduce the results obtained by Marlin, et al. have not b successful. To date, no one has been able to demonstrate an agent that binds to a effectively reduces infectivity of human rhinovirus (by blocking viral infection wi isolated cell surface receptor protein) as effectively as tmICAM-1; accordingly the continues to exist a need in the art for a form of ICAM-1 that can effectively bind human rhinovirus and can effectively reduce HRV infectivity.

BRIEF SUMMARY OF THE INVENTION

Provided by the invention are multimeric configurations of transmembra ICAM (tmICAM-1) and multimeric configurations of non-transmembrane ICA (tICAMs), having improved rhinovirus binding and inhibition activity. As noted, supra, tmICAM-1 isolated from mammalian cells has the capaci to neutralize human rhinoviruses belonging to the major receptor group, but only maintained in solution with detergent. Certain soluble fragments of ICAM-1 ha been found to have a reduced capacity for binding virus and do not reduce infectivi as effectively as tmICAM-1. To date, no one has been able to ascertain the reas for this reduced capacity.

It has been proposed by others that the rhinovirus receptor exists on cells a pentameric form [Tomassini, J. , and Colonno, R., J. Virol., 58:290-295 (1986 However, quantitation (unpublished results of the co-inventors herein) of t rhinovirus and anti-ICAM-1 monoclonal antibody (Mab) binding to HeLa cells h revealed a maximum of 30,000 virions bound per cell (determined by the binding [³⁵S]methionine-labeled HRV) and 50,000-60,000 ICAM-1 molecules per c (determined by the binding of radio-labeled Mab to ICAM-1). These resu prompted further studies to examine the possibility that rather than five, only betwe one and two ICAM-1 molecules on the surface of cells are bound per HRV parti bound to the cell.

Genetically engineered forms of truncated ICAM-1 that lack the C-termin transmembrane domain are secreted into the culture medium of mammalian ce transfected with the recombinant gene. The purification of such secreted ICA molecules from spent culture medium of cells stably transfected with the gen

SUBSTITUTE SHEET therefor is described herein. In a solution-HRV binding assay and in an H neutralization assay, it was found that the monomeric forms tend to have substanti reduced avidity for HRV relative to tmICAM-1. However, it has now b discovered that when such tICAMs are presented in multimeric form and t incubated with HRV, the virus-binding activity of the multimeric tICAMs beco comparable to that of tmICAM-1. This binding of multimeric tICAMs to HRV the same properties as the binding of HRV to ICAM-1 on HeLa cells: it is inhibi by anti-ICAM-1 Mabs, it is specific for rhinoviruses of the major receptor group, has the same temperature dependence as the binding of rhinovirus to cells (i.e. , bi well at 37°C and undetectably at 4°C). It is postulated that tmlCAM exists in nat in a multimeric, possibly dimeric form, and that such constructs more clos resemble the native configuration, with its attendant high avidity for the hu rhinovirus. Such dimerization may conveniently be achieved in vitro by, e. crosslinking two ICAM monomers by chemical means or by crosslinking w appropriate antibodies, or by binding monomers to appropriate inert substrat Multimerization can also be achieved in vivo by modification of the gene seque coding for the select ICAM to provide appropriate binding sites in the correspond peptide sequence. For example, muteins can be engineered which contain appropri cysteine residues to allow in vivo multimerization via interchain disulfide bondi Alternatively, a DNA sequence coding for an ICAM may be fused with a D sequence coding for an appropriate immunoglobulin or fragment thereof, such t the fusion gene product possesses at least one site suitable for interchain bondi The resulting fusion peptide monomer can then be expressed by the cell in multime form. Under certain circumstances, the benefits of multimerization may also achieved by construction of ICAM muteins containing multiple rhinovirus bindi sites.

Also provided by the invention are methods for enhancing binding of IC and functional derivatives thereof to a ligand, i.e., human rhinovirus, and "maj group receptor viruses, lymphocyte function-associated antigen-1 (LFA Plasmodium falciparum (malaria) and the like, wherein the ICAM is presented i multimeric configuration to the ligand to facilitate binding of the ICAM to the liga

The invention further comprises a method for inducing irreversible uncoati of human rhinovirus, said method comprising contacting said human rhinovirus w ICAM-1 or a fragment thereof. This invention also provides a novel method of irreversibly inhibiti infectivity of a mammalian cell by a human rhinovirus, said method comprisi contacting said human rhinovirus with ICAM-1 or a fragment thereof un conditions which allow the ICAM-1 or fragment thereof to bind to said rhinovir thereby stimulating irreversible uncoating of said rhinovirus. Also provided by the invention are novel pharmaceutical compositio comprising a pharmaceutically acceptable solvent, diluent, adjuvant or carrier, a as the active ingredient, an effective amount of a polypeptide characterized by havi human rhinovirus binding activity and reduction of virus infectivity. Dime configurations of ICAM and fragments thereof are presently preferred. Other aspects and advantages of the present invention will be apparent up consideration of the following detailed description thereof which includes numero illustrative examples of the practice of the invention.

DESCRIPTION OF THE FIGURES

Fig. 1 shows the protein sequences of tmICAM-1. Fig. 2 is a schematic rendition of a) tmICAM-1, b) tICAM(453), tICAM(283), d) tICAM(185), and e) tICAM(88).

Fig. 3 is a schematic diagram of the constructs of Example 12: a) the hea chain of human IgG; b) the fragment of the heavy chain used in making t immunoadhesin; c) the fragment of ICAM; d) the completed IgG/ICA immunoadhesin.

Fig. 4 shows crosslinking of tICAM(453) into dimers by water-solu carbodiimide/N-hydroxysuccinimide. tICAM(453) at the indicated concentrations crosslinked with 100 mM EDC/5 mM NHS at pH 7.5 for 18 hr at 20 C. samples were analyzed by SDS-PAGE followed by western blotting with anti-ICA antisera. a) Western blot of crosslinked ICAM(453) showing monomer and di species; b) dependence of crosslinking upon tICAM(453) concentration; c) crosslinking of tICAM(453) is not inhibited by an excess of third-party proteins.

Fig. 5 is a schematic showing construction of tICAM(l-451)/LFA-3(210- chimera: a) tmICAM-1; b) tICAM(l-451); c) LFA-3; d) LFA-3 (210-237); tICAM(l-451)/ LFA-3(210-237) chimera; structure of tmICAM-1 shown comparison. Fig. 6 shows uncoating of HRV by tICAM(453) over 24 hours, a) shift f native 148S form to uncoated 42S form by tICAM(453); b) shift from native 148 uncoated 42S form by tICAM(185); c)SDS-PAGE of [³⁵S]-methionine-labelled HR showing loss of VP4; d) dot-blot hybridization of RNA recovered from HRV3 spe with an oligonucleotide probe for HRV. 50 ng of purified HRV3 RNA and R extracted from 8 ng of HRV3 species were applied to the blot.

Fig. 7 shows the predicted alignment of ICAM-1 amino acid sequenc domains IV and V onto the immunoglobulin fold motif. Arrows indicate beta stra pointing from the N- to the C-terminus; italicized letters in bold indicate the strands, and numbered residues indicate cysteine residues with disulfide bo indicated by lines. The dotted line divides the "B" and "F" faces of the doma Residues indicated with an * are among those replaced with cysteine residues.

DETAILED DESCRIPTION OF THE INVENTION

As used herein, the following abbreviations and terms include, but are necessarily limited to, the following definitions. Abbreviation Definition

ICAM Intercellular adhesion molecule - may be used to den both full length (trans- membrane) and truncated (no trans- membrane) forms of the protein.

ICAM-1 Intercellular adhesion molecule- 1, also known tmICAM-1 and HRR; denoting the full-leng transmembrane protein

tmICAM-1 Transmembrane intercellular adhesion molecule-1, al known as ICAM-1 and HRR; requires, e.g., deterge

10 conditions to be solubilized

HRR Human rhinovirus receptor, also known as ICAM-1 a tmICAM-1

sICAM-1 A naturally-occurring soluble truncated form of ICA 1 having both the hydrophobic transmembrane doma

15 and the carboxy-terminal cytoplasmic domain ICAM-1 deleted; consists of amino acids 1-442 ICAM-1 plus 11 novel amino acids; distinguishab from Staunton, et al. UCAM453 which consists amino acids 1-453 with the terminal tyrosine replac

20 with phenylalanine.

tICAMs Truncated intercellular adhesion molecules; soluble no transmembrane ICAMs lacking the hydrophobic tran membrane domain and the carboxyl- termin cytoplasmic domain of ICAM-1. tICAM( 1-453) Truncated form of ICAM comprising the

tICAM-453 entire extracellular amino-terminal tICAM(453) domain of tmlCAM (domains I - V, amino ac residues 1 - 453)

tICAM(l-283) Truncated form of ICAM comprising domains

tICAM-283 I, II, and III (amino acid residues 1 tICAM(283) 283

tICAM(l-185) Truncated form of ICAM comprising domains tICAM-185 I and II (amino acid residues 1 - 185)

10 tICAM(185)

tICAM(l-88) Truncated form of ICAM comprising domain tICAM-88 I (amino acid residues 1 - 88) tICAM(88)

tICAM(89-185) Truncated form of ICAM comprising domain II (ami

15 acid residues 89-185)

tICAM(l 86-283) Truncated form of ICAM comprising domain III (ami acid residues 186-283)

tICAM(284-385) Truncated form of ICAM comprising domain IV (ami acid residues 284-385)

20 tICAM(386-453) Truncated form of ICAM comprising domain V (ami acid residues 386-453)

T tICAM(75-77) Truncated form of ICAM comprising amino a residues 75-77

tICAM(70-72) Truncated form of ICAM comprising amino a residues 70-72

tICAM(64-66) Truncated form of ICAM comprising amino a residues 64-66

tICAM(40-43) Truncated form of ICAM comprising amino a residues 40-43

tICAM(36-38) Truncated form of ICAM comprising amino a residues 36-38

tICAM(30-33) Truncated form of ICAM comprising amino a residues 30-33

tICAM(26-29) Truncated form of ICAM comprising amino a residues 26-29

The foregoing terms defining specific fragments are intended to incl functional derivatives and analogs thereof. Persons skilled in the art will underst that the given boundaries may vary by a few amin acid residues without affecting function of the given fragment.

"Multimerization" and "multimeric" include, but are not limited dimerization and dimeric, and include any multimeric configuration of the ICA molecule, or fragment thereof, that is effective in reducing viral binding infectivity. "Transmembrane" generally means forms of the ICAM-1 protein molec which possess a hydrophobic membrane-spanning sequence and which are membra bound.

"Non-transmembrane" generally means soluble forms of the ICAM-1 prot including truncated forms of the protein that, rather than being membrane-bound, secreted into the cell culture medium as soluble proteins, as well as transmembr forms that have been solubilized from cell membranes by lysing cells in non-io detergent.

"Truncated" generally includes any protein form that is less than the length transmembrane form of ICAM.

"Immunoadhesin" means a construct comprising all or a part of a protein peptide fused to an immunoglobulin fragment, preferably a fragment comprising least one constant region of an immunoglobulin heavy chain.

"Form" is generally used herein to distinguish among full length and par length ICAM forms; whereas "configuration" is generally used to distinguish am monomeric, dimeric, and multimeric configurations of possible ICAM forms.

All forms and configurations of the ICAM-1 molecule, whether full length a fragment thereof, including muteins and immunoadhesins, whether monomeric multimeric, may be fully or partially glycosylated, or completely unglycosylated, long as the molecule remains effective in reducing viral binding and infectivity.

"Ligand" is generally used herein to include anything capable of binding to least one of any of the forms and configurations of ICAM and includes, but is limited to, human rhinovirus, other viruses that bind to the "major" group hu rhinovirus receptor, lymphocyte function-associated antigen-1, and Plasmodi falciparum (malaria).

"Human rhinovirus" generally includes all human serotypes of hu rhinovirus as catalogued in Hamparian, V., et al., Virol., 159: 191-192 (1987).

The sequence of amino acid residues in a peptide is designated in accorda with standard nomenclature such as that given in Lehninger's Biochemistry (Wo Publishers, New York, 1970). Full-length ICAM-1, also known as human rhinovirus receptor (HRR), termed transmembrane ICAM(tmΙCAM-l). Non-transmembrane ICAMs are a known as truncated ICAMs, i.e, ICAMs substantially without the carbo intracellular domain and without the hydrophobic membrane domain of tmlCA which are soluble without the addition of detergent. tICAMs may convenien comprise one or more domains selected substantially from domains I, II, III, IV, V of the extracellular region of tmlCAM. tICAMs may also comprise functio analogs of tmlCAM or fragments thereof, and may also comprise one or m fragments of tmlCAM spliced together, with or without intervening non-tmlC lining sequences, and not necessarily in the same order found in native tmlCA Presently preferred tICAMs include but are not limited to forms tICAM(45 tICAM(185), tICAM(88), tICAM(283), and tICAMs comprising one or m sequences selected from tICAM(89-185), tICAM( 186-283), tICAM(284-38 tICAM(386-453), tICAM(75-77), tICAM(70-72), tICAM(64-66), tICAM(40-4 tICAM(36-38), tICAM(30-33), and tICAM(26-29). See USSN 07/631,313, US 07/678,909, and USSN 07/704,996. Non-transmembrane forms of ICAM can incl functional derivatives of ICAM, mutein forms of tICAM to facilitate coupling, tIC AM immunoadhesins. When the tICAMs are in a multimeric configurati preferably as dimers, they display enhanced binding of human rhinovirus and are a to reduce viral infectivity.

Multimerization can be achieved by crosslinking a first ICAM to a seco ICAM, using suitable crosslinking agents, e.g. heterobifunctional a homobifunctional cross-linking reagents such as bifunctional N-hydroxysuccinim esters, imidoesters, or bis-maleimidohexanes. The different forms of ICAM, transmembrane and non-transmembrane, be multimerized by adsorption to a support. This support can be made of materi such as nitrocellulose, PVDF, DEAE, lipid polymers, as well as amino dextran, a variety of inert polymers that can adsorb or can be coupled to ICAM, either w or without a spacer or linker. Multimeric ICAM can also be multimerized by coupling the ICAM t member, e.g. , an antibody that does not interfere with HRV binding, or fragme thereof; or to a protein carrier. An example of an antibody includes anti-IC antibody CL 203 or a fragment thereof; suitable protein carriers include albumin proteoglycans.

To facilitate coupling, the ICAM can be modified with at least one react amino acid residue such as lysine, cysteine, or other amino acid residue(s) to prov a site(s) to facilitate coupling. These types of modified ICAM are referred to muteins. The nucleotide sequence for the ICAM of the method can be contained a vector, such as a plasmid, and the vector can be introduced into a host cell, example eukaryotic or prokaryotic cells. The preferred eukaryotic cell is mammalian cell, e.g. Chinese hamster ovary cells or HEK293S cells; the prefe prokaryotic cell is . coH. In addition, the ICAM can be modified at either termi to comprise a lipid capable of promoting formation of oligomer micelles. The IC comprising the multimeric ICAM can be either fully glycosylated, parti glycosylated, or non-glycosylated. A preferred manner of making multimeric forms of ICAM-1 is by enginee of cysteine residues into the tICAM sequence (tICAM(453) is particularly prefeπ in a position at or close to the natural site of self-association on ICAM-1 monome Muteins with cysteine residues placed at appropriate positions form covalent bo (disulfide bonds) that stabilize an interaction which is noncovalent in vivo. S muteins are assembled intracellularly and are expressed as a disulfide-linked dim alternatively, monomeric muteins may be crosslinked in vitro by incubation at hi protein concentration in mildly reducing conditions to encourage disulfide exchan or by crosslinking with bifunctional chemical crosslinking reagents which react w free sulfhydryl groups. Another advantage of such proteins is that any novel ami acids engineered into ICAM-1 are hidden on the dimer interface and would be l likely to be immunogenic.

In another preferred embodiment, ICAM can also be multimerized by fusi with fragments of immunoglobulins to form ICAM immunoadhesins. For examp an ICAM or fragment thereof can be fused with a heavy or light ch immunoglobulin or fragment thereof, in particular with the constant region of heavy chain of IgG, IgA, or IgM. Preferably, the constant region contains the hin region and one or more of CH2 and CH3, but does not contain CHI . The varia region (Fab) of the immunoglobulin is thus replaced by the ICAM or fragm thereof. Such constructs are conveniently produced by construction and expressi of a suitable fusion gene in a suitable expression system [see, e.g., Bebbington, C and C.C.G. Hentschel, "The use of vectors based on gene amplification for expression of cloned genes in mammalian cells," in DNA Cloning. Vol. Ill , Glover, ed.(1987)] and are secreted in a dimerized configuration.

Also provided by the invention are methods for enhancing binding of ICA and functional derivatives thereof to a ligand, i.e. , human rhinovirus, and "maj group receptor viruses, lymphocyte function-associated antigen-1 (LFA-

Plasmodium falciparum (malaria) and the like, wherein the ICAM is presented i multimeric configuration to the ligand to facilitate binding of the ICAM to the liga

The invention further comprises a method for inducing iπeversible uncoati of human rhinovirus, said method comprising contacting said human rhinovirus w ICAM-1 or a fragment thereof, e.g. a tICAM as defined above.

This invention also provides a novel method of iπeversibly inhibiti infectivity of a mammalian cell by a human rhinovirus, said method comprisi contacting said human rhinovirus with ICAM-1 or a fragment thereof un conditions which allow the ICAM-1 or fragment thereof (e.g. a tICAM as defin above) to bind to said rhinovirus; thereby stimulating iπeversible uncoating of s rhinovirus.

Also provided by the invention are novel pharmaceutical compositio comprising a pharmaceutically acceptable solvent, diluent, adjuvant or carrier, a as the active ingredient, an effective amount of a polypeptide characterized by havi human rhinovirus binding activity and reduction of virus infectivity. Dime configurations of ICAM and fragments thereof are presently prefeπed.

The following examples illustrate practice of the invention.

Example 1 relates to growth, purification and assay of rhinoviruses;

Example 2 relates to production and isolation of monoclonal antibodies ICAM-1; Example 3 relates to construction of non-transmembrane truncated forms ICAM cDNA from full length ICAM-1 cDNA;

Example 4 relates to transfection of mammalian-cells and expression of no transmembrane truncated forms of ICAM cDNA; Example 5 relates to isolation and purification of non-transmembrane truncat forms of ICAM- 1;

Example 6 relates to radioactive labeling of tmICAM-1, tICAM(185), a tICAM(453) and demonstration of retained capacity for binding to monoclo antibodies; Example 7 relates to human rhinovirus binding assays of transmembrane a of non-transmembrane truncated forms of ICAM- 1 ;

Example 8 relates to CL203 IgG antibody-mediated cross-linking tICAM(453);

Example 9 relates to multimerization of trans-membrane and of no transmembrane truncated forms of ICAM-1 ;

Example 10 relates to infectivity-neutralization assay of multime transmembrane and of multimeric non-transmembrane truncated forms of ICAM- and

Example 11 relates to use of multimeric forms of transmembrane a truncated forms of ICAM-1, as effective inhibitors of ICAM/LFA-1 interaction.

Example 12 relates to construction of tICAM(185)/IgG and tICAM(453)/Ig immunoadhesins.

Example 13 relates to rhinovirus binding and neutralization by a tICAM/Ig immunoadhesins. Example 14 relates to in vitro dimerization of ICAM-1.

Example 15 relates to a tICAM(l-451)/LFA-3(210-237) chimera.

Example 16 relates to iπeversible inactivation of HRV by ICAM.

Example 17 relates to cysteine muteins. EXAMPLE 1 GROWTH. PURIFICATION AND ASSAY OF RHINOVIRUSES Rhinoviruses were grown, purified, and assayed essentially as described Abraham, G., et al. , J. Virol., 51:340 (1984) and Greve, et al. , Cell, 56:839 (198 The serotypes chosen for these studies include HRV14, the standard in the field, HRV3, which has an approximately 10-fold higher affinity for ICAM than d HRV 14. HRV2, which binds to the "minor" receptor rather than the "maj receptor, was used as a negative control.

Rhinoviruses HRV2, HRV3, and HRV 14 were obtained from the Ameri Type Culture Collection, plaque purified, and isolated from lysates of infected He S3 cells. Purified rhinovirus was prepared by polyethylene glycol precipitation sucrose gradient sedimentation. Viral purity was assessed by SDS-PAGE analysis capsid proteins and by electron microscopy. Infectivity was quantitated by a limit dilution infectivity assay scoring for cytopathic effect, essentially as described Minor, P.D., Growth, assay and purification of picomaviruses, in Virolog Practical Approach. B.W.J. Mahy, ed (Oxford:IRL Press), pp. 25-41.

EXAMPLE 2 PRODUCTION AND ISOLATION OF MONOCLONAL ANTIBODIES TO

ICAM-1 BALB/cByJ female mice were immunized by intraperitoneal injection of 1 intact HeLa cells in 0.5 ml of phosphate-buffered saline (PBS) three times at 3-w intervals. Two weeks later the mice were bled and aliquots of serum were tested protective effects against HRV14 infection of HeLa cells. Positive mice were boos by a final injection of 10⁷ HeLa cells, and 3 days later spleen cells were fused P3X63-Ag8.653 myeloma cells (Galfre, et al. , Nature, 266:550-552 (1977)) produce a total of approximately 700 hybridoma-containing wells. Each well tested by incubating 3 x 10⁴ HeLa cells in 96-well plates with 100 μl of supernat for 1 hr at 37 C; the cells were then washed with PBS, and a sufficient amount

HRV14 was added to give complete cytopathic effect in 24-36 hr. Wells that w positive (protected from infection) were scored at 36 hr. Cells were removed from wells which scored positive in the first screen cloned by limiting dilution in 96-well microtiter plates. Supernatants from these w were tested in the cell protection assay and positive wells were again identifi Further clonings were performed until all of the hybridoma containing wells w positive indicating a clonal population had been obtained. Four cloned cell lines, their coπesponding antibodies, were obtained and were designated c78.1A, c78.2 c78.4A, c78.5A, c92.1A and c92.5A, respectively.

C92.1A was deposited on November 19, 1987 with the American T Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852 and designated HB 9594.

EXAMPLE 3 CONSTRUCTION OF tICAM cDNAs FROM FULL LENGTH ICAM-1 cDN

A. Preparation of ICAM-1 cDNA

Randomly-primed cDNA was synthesized from poly A+ RNA from HE1 c using an Amersham(TM) cDNA synthesis kit under conditions recommended by supplier. PCR amplification was performed using 100 ng of cDNA for 25 cyc using primers PCR 5.1: (ggaattcATGGCTCCCAGCAGCCCCCGGCCC) and P 3.1: (ggaattcTCAGGGAGGCGTGGCTTGTGTGTT). Amplification cycles consis of 94 C 1 min, 55 C 2 min, and 72 C 4 min. The product of the PCR reaction digested with EcoRl and cloned with EcoRl digested phage vector lambdaGT (Stratagene(TM)). Recombinant phage clones were screened by plaque hybridizati using ICAM-1 specific oligonucleotides

GAGGTGTTCTCAAACAGCTCCAGCCCTTGGGGCCGCAGGTCCAGT (ICAM1) and CGCTGGCAGGACAAAGGTCTGGAGCTGGTAGGGGGCCGAGGTGTT (ICAM3).

A positive clone designated lambdaHRR4 was selected and purified. T insert was removed by EcoRl digestion and subcloned into the EcoRl site Bluescript KS + . This clone was designated pHRR2. The entire insert sequenced and found to contain the entire ICAM-1 coding sequence beginning w the initiator ATG codon and ending with the TGA stop codon as specified by the P ICAM-1 sequence (Simmons, et al., Nature, 331:624 (1988); Staunton, et al., C 52:925-933 (1988)) by a single substitution of Ala-1462 for Gly. This same chan was identified in several independent clones and thus represents a polymorphism the ICAM-1 gene.

B. Construction of tICAMf453) and tICAMf!85)

Modified forms of the ICAM-1 cDNA were created by PCR amplificati reactions (Saiki, et al., Science, 230: 1350-1354 (1985)) using the full length ICA cDNA clone pHRR-2 as template. The plasmid DNA was digested with EcoRl excise the ICAM-1 insert and treated with alkaline phosphatase to prevent circularization of the vector in subsequent ligation steps. Ten ng of template D was subjected to 10 cycles of PCR amplification using oligonucleotide prim PCR5.5 and PCR3.3 for tICAM-453 and PCR5.5 and 3.10 for tICAM-185 under t following conditions:

Temperature (°C) Time (mins

94 1

55 2

72 1.5 71 4 (final extension)

PCR5.5 has the sequence: GGAATTCAAGCTTCTCAGCCTCGCTATG CTCCCAGCAGCCCCCGGCCC which consists of EcoRl and Hindlll sites, 12 ICAM-1 5' untranslated sequence, and the first 24 bp encoding the signal peptid

PCR3.3 has the sequence: GGAATTCCTGCAGTCACTCATACCGGGG GAGAGCACATT which consists of EcoRl and Pstl sites, a stop codon, and 24 complementary to the bases encoding the last 8 extracellular amino acids of ICA (residues 446-453). PCR3.10 has the sequence: TTCTAGAGGATCCTCAAAAGGTCTGGA CTGGTAGGGGG which consists of Xbal and BamHI sites, a stop codon, and bp complementary to the bases encoding residues 178-185 of ICAM-1.

The PCR reaction products were digested with EcoRl (tICAM(453)) or Eco and BamHI (tICAM(185)) and cloned into the polylinker site of Bluescript SK (Stratagene). Clones containing the desired inserts were verified by restricti analysis and DNA sequencing. The inserts were excised from Bluescript by digesti with Hindlll and Xbal and inserted into the expression vector CDM8 (Seed, Natur 239:840 (1987) at the Hindlll and Xbal sites. A clone containing the tICAM(45 insert designated pHRR-8.2 and a clone containing the tICAM(185) insert designat pHRR23-13 were selected and subjected to extensive sequence analysis. This verifi the existence of the desired stop codons, and the integrity of the selected regions ICAM-1 coding sequence.

These plasmids were transfected into COS cells using the DEAE-dextr techniques and the cells were cultured 72 hr. before assay. Surface expression w monitored by FACS using indirect immunofluorescence and a monoclonal antibo specific for ICAM-1. Transient expression in COS cells and immunoprecipitation metabolically labelled ([³⁵S]cysteine) cell supernatants with c78.4A Mab (monoclon antibody) demonstrated the production of soluble ICAM-1 fragments of 45 kd and kd from pHRR23-13 and pHRR8.2, respectively. The preparation of stable Chine hamster ovary cell transfectants is described below in Example 4.

C. Modified Non-glycosylated tICAM-1

A modified full length ICAM- 1 was made by simultaneous mutagenesis of A at positions 103, 118, 156 and 173 each to Gin. This removes all four Asn-link glycosylation sites from extracellular domain II of the ICAM-1 molecule. T resultant molecule, refeπed to as non-glycosylated transmembrane ICAM, w expressed on the surface of COS cells and was able to bind radio-labeled HRV3 levels comparable to unmodified ICAM-1. This result demonstrated th glycosylation of domain II (the first 185 amino acids) is not required for virus bindi to ICAM-1.

SUBSTITUTE SHEET It is expected that non-transmembrane ICAM can be similarly modified yield modified non-glycosylated non-transmembrane ICAM-1 molecules.

D. Construction of Genetically Engineered Forms of tICAM Containing Reacti Residues Suitable for Cross-Linking to Form Multimers A molecule consisting of the 453 amino acid extracellular domain of ICA with the addition of a novel lysine residue at the C-terminus was constructed by P modification of the pHRR-2 cDNA described in Example 3B. The primers used we PCR5.5 (Example 3B) and PCR 3.19 which has the sequenc TTCTAGAGGATCCTCACTTCTCATACCGGGGGGAGAGCACATT and consi of Xbal and BamHI sites, a stop codon, a Lys codon, and 24 bases complementa to the sequence encoding amino acid residues 446 to 453. Following cloning into t CDM8 vector, production of tICAM having a Lys at position 453 was confirmed transient expression in COS cells. Stable CHO cell lines were generated by c transfection with pSV2-DHFR as described in Example 4. The same strategy w used to add a Lys residue to the C-terminus of tICAM(185) using PCR5.5 a P C R 3 . 2 0 w h i c h h a s t h e s e q u e n c e TTCTAGAGGATCCTCACTTAAAGGTCTGGAGCTGGTAGGGGGC and consi of Xbal and BamHI sites, a stop codon, a Lys codon, and 24 bases complementa to the sequence encoding residues 178 to 185. Transient COS cell expressi confirmed the production of tICAM-185 and stable CHO cell lines were derived described in Example 4.

Three modified forms of tICAM(452) that each contain an additional C residue were constructed by site-directed mutagenesis of the full-length ICAM cDNA. In each construct a stop codon was introduced by changing the Glu resid at position 453 from GAG to TAG. The C-terminus is thus Tyr-452. Residues As 338, Thr-360, and Gln-387 were each separately mutated to Cys using a second si directed mutagenesis. The presence of the desired mutations were confirmed DNA sequencing.

The residues selected for mutation to Cys were selected based on a comput generated plot of surface probability which predicts surface exposure of these regio Also, Thr-360 is in close proximity to Asn-358 which is a site of potential Asn-link glycosylation. Each of the three Cys mutants was expressed and secreted into t medium of transfected COS cells. Examination of the proteins under reducing a non-reducing conditions showed no indication of the presence of dimers. It anticipated that cross-linking reagents reactive with sulfhydryl groups can be used cross-link the Cys-modified tICAM forms to obtain multimeric forms.

EXAMPLE 4 TRANSFECTION OF CELLS AND EXPRESSION OF tICAM cDNA

A. Transfection of Eukaryotic Cells Chinese hamster ovary (CHO) cells deficient in dihydrofolate reducta

(DHFR) were obtained from Cutter Labs (Berkeley, CA.). DHFR- cells cann synthesize nucleosides and therefore require a nucleoside-supplemented medium. T cells were co-transfected with the plasmid pSV2-DHFR which contains the mou dihydrofolate reductase (DHFR) gene under control of the SV40 promoter, and wi tICAM(453), or tICAM(184) constructs in the CDM8 vector (Seed and Aruff PNAS, 84:3365-3369 (1987)).

Transfections were done using both electroporation and calcium phospha methods. Bebbington, supra. Transfected DHFR-positive cells were selected growth on nucleoside-free media, and pools of transfectants were cloned by limiti dilution.

Cell lines that secrete tICAM were identified by testing culture supernatan with a two-site radioimmune assay (RIA) for ICAM using Mabs c78.4A and c78.5 as follows. A monoclonal antibody against one epitope on ICAM (for example, M c78.4A) was adsorbed to plastic 96-well plates (Immunlon plates, Dynatech Inc. excess binding sites on the plates were blocked with bovine serum albumin (BSA and then culture supernatants were incubated with the plates. The plates were wash and incubated with [¹²⁵I]-Mab (directed against a second epitope on ICAM, e. c78.5A), and, after washing, the amount of bound [¹²⁵]I-IgG determined. T concentration of tICAM was determined by comparing RIA data from unknow against a standard curve of tmlCAM at known concentrations. Positive clones w expanded and expression of tICAM forms was confirmed by immunoprecipitatio metabolically labeled cell supernatants with Mab c78.4A.

Cell lines CT.2A (tICAM(453)) and CD12.1A (tICAM(185)) were selec for further study and were subjected to gene amplification in methotrexate contain media as described by Bebbington, et al., supra. A clone derived from CT. resistant to 100 nM methotrexate and a CD 12.1 A clone resistant to 1 μM methotrex were used for purification of soluble truncated ICAM-1 proteins.

B. Transfection of Prokaryotic Cells Because glycosylation of the viral binding domain of ICAM is not required retain viral binding (as demonstrated in Example 3C), it is anticipated that prokary cells, such as I cpji, can be successfully transfected to produce functional protei

EXAMPLE 5 ISOLATION AND PURIFICATION OF tICAM-1 Monoclonal antibody affinity chromatography with c78.4A-Sepharose(TM) been previously described in co-pending USSN 07/130,378 and Greve, et al., C 56:839-847 (1989). tICAM secreted into serum-containing media required additio purification steps due to the high level of contaminating protein in the serum. Bef elution from the Mab-affinity column, the column was washed with 1 M NaCl remove loosely-bound proteins. For tICAM(453), the partially purified tICAM(4 eluted from the c78.4-Sepharose(TM) column was dialyzed into 10 mM Tris ( 6.0), absorbed onto a mono-Q(TM) column (Pharmacia), and eluted with a 0-0.3 NaCl gradient. UCAM184 was further purified by gel filtration on a Supero 12(TM) column. It is also recognized that non-transmembrane truncated forms of ICAM-1 be purified using standard ion exchange methodology without using monoclo antibody affinity chromatography. EXAMPLE 6 RADIOACTIVE LABELING OF tmICAM-1 , tICAM(185), AND tICAM(45 AND DEMONSTRATION OF RETAINED CAPACITY FOR BINDING T

MONOCLONAL ANTIBODIES The epitopes reactive with monoclonal antibodies c78.4A and c78.5A conformationally-dependent epitopes and thus can be used as analytical probes confirming retention of the native ICAM structure. Known amounts of puri ICAM were incubated with c78.4A or c78.5A IgG-Sepharose(TM) and the frac of the radioactivity bound determined. These experiments showed that the puri tmICAM-1, tICAM(185), and tICAM(453) completely retained the ability to bin these monoclonal antibodies.

Transfectants were metabolically labeled with [³⁵S]cysteine, and cell lys (for transmembrane ICAM) or culture supernatants (for truncated ICAM) prepared and incubated with c78.4A IgG-Sepharose(TM) beads. The beads washed and adsorbed proteins were eluted with sodium dodecyl sulfate (SDS) analysed by SDS-PAGE; see Greve, et al., Cell, 56:839-847 (1989)). It was fo that the isolated proteins were quantitatively bound to the c78.4A and c78.5A M Accordingly, the tICAM(185) and tICAM(453) both have retained na ICAM structure.

EXAMPLE 7

HUMAN RHINOVIRUS BINDING ASSAYS OF tmlCAM AND tICAMs Described below are three binding assays used to assess binding activity of various forms of ICAM.

A. Pelleting Assay [³⁵S]cysteine-labeled tmICAM-1 or tICAM was mixed with HRV3 in 10 of 10 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM MgCl₂, 1 mM CaCl₂, 0.1% Tri X-100. The mixture was incubated for 30 min. at 37 C, cooled on ice, layered top of a cushion of 200 μl of 10% glycerol, 0.2 M triethanolamine (pH 7.5), centrifuged in a Beckman air-driven centrifuge at 134,000 x g for 30 min. at 4

SUBSTITUTE SHEET The top 275 μl was removed, and the pellet was analyzed by SDS-PAGE scintillation counting. Silver-staining of SDS gels of control experiments indica that essentially all of the HRV3 is pelleted under these conditions and essentially of the ICAM remains in the supernatant. The results are shown in Table 1.

TABLE 1

ICAM % ICAM Pelleted* tmICAM-1 11.6% tICAM(453) 1.0% tICAM(185) 4.3%

* average of 4 experiments; these numbers cannot be directly converted into relat affinities

These data show that both truncated forms of ICAM bind to rhinovirus, at substantially reduced levels relative to tmlCAM.

B. Solution Binding Assay To obtain quantitative information on the relative affinity of tmlCAM tIC AM fragments in solution, a solution competition assay was developed in wh soluble tmlCAM or soluble tICAM fragments were used to inhibit the binding [³⁵S]HRV3 to previously immobilized ICAM-1; nonionic detergent (Triton X-100) included in the buffers so that the different proteins could be compared un identical conditions. First, tmICAM-1 (isolated in the presence of 0. octylglucoside instead of Triton X-100) was diluted 10-fold into a Tris/NaCl bu and allowed to adsorb to the walls of a microtiter plate (Immunlon-4, Dynate overnight. Nonspecific binding sites on the plate were then blocked with 10 mg/ BSA and binding experiments performed in 0.1% Triton X-100/1 mg/ml BSA/10 Tris/200 mM NaCl. Approximately 20,000 cpm of [³⁵S]HRV3 were mixed w varying amounts of ICAM [tmlCAM, tICAM(453) or tICAM(185)], incubated f

SUBSTITUTE SHEET hour at 37 C, and then added to wells of the microtiter plates and incubated for 3 at 37 C. The plates were washed and the bound radioactivity determined.

As shown in Table 2, tmICAM-1 inhibits virus binding half-maximally at l concentrations (.008 μM) while tICAM(453) and tICAM(185) inhibit at much high concentrations (2.8 μM and 7.9 μM, respectively; or 350 to almost 1000-fold high than tmlCAM.

TABLE 2 ICAM IC50*

tmlCAM 8.0 ± 3.3 nM (N=3) tICAM(453) 2.8 ± 0.6 μM (N=3) tICAM(185) 7.9 ± 2.8 μM (N=3)

* IC50 is the concentration of soluble ICAM needed to inhibit HRV3 binding 50%.

These data confirm and extend the earlier observations that tICAM(453) a tICAM(185) do bind to rhinovirus but with lower affinities than does tmICAM-1 a provide evidence that the virus binding site is encompassed within the two N-termin domains (185 residues) of ICAM-1.

Subsequent experiments performed at 34 C (the temperature at whi rhinovirus normally replicates) have yielded similar results.

C. Dot-Blot Assay

An alternative method of measuring binding activity was utilized in whi tmICAM-1, tICAM(453), or tICAM(185) was adsorbed to nitrocellulose filters, t non-specific binding sites on the filters blocked with 10 mg/ml bovine serum album (BSA), and radioactive virus or [^I25I]Mab to ICAM-1 incubated with the filter for min at 37 C. The filters were washed with buffer and the filters exposed to X-r film. The amount of radioactivity bound to the filters was determined densitometry of the autoradiograms, and the data is expressed as HRV3 binding arbitrary units) normalized to the amount of ICAM bound to the blot by a para determination of the amount of [¹²⁵I]Mab c78.4A or c78.5A bound to the IC (bound to the blot). The results are shown in Table 3.

TABLE 3 Binding of [³⁵S]HRV3 to Immobilized ICAM*

ICAM tICAMC453) ratio ICAM/tICAM453

1.2 ± 1.1 0.52 ± 0.45 2.3

* Average of 5 experiments. Data is expressed in arbitrary densitometric units [³⁵S]HRV3 binding/[¹²⁵]I anti-ICAM Mab binding.

Additional studies with tICAM 185 have been performed. Bind experiments have demonstrated equivocal results. It is anticipated that ste hindrance may play a role. The size of the virus is approximately 30 nanomete The length of tICAM(185) is less than 10 nanometers. The use of a spacer or lin would provide better accessibility for binding.

The results from this experiment indicate that under these assay conditi tICAM(453) is capable of binding rhinovirus at levels comparable to those tmICAM-1 when the amount . of virus bound was normalized to the amount [¹²⁵I]MAb bound. Further, these results indicate that the tICAM forms are capa of binding to rhinovirus, but that the binding avidity is dependent upon configuration of the tICAM. tmICAM-1 is believed to be a small multimer (proba a dimer) and presentation of tICAM in a multimeric form mimics this multime configuration. Evidence supporting this hypothesis comes from quantitative binding stud

(unpublished), in which the ratio of the maximum number of rhinovirus particles the maximum number of antibody molecules that can be bound to cells approximately 1.5, as discussed supra. This is in contrast to the earlier work Tomassini, J., et al. , J. Virol. , 58:290 (1986), which suggested a complex of molecules needed for binding. Their conclusion was based on an errone interpretation of gel filtration data that failed to take into account bound deterg molecules.

EXAMPLE 8 CL203 IgG ANTIBODY-MEDIATED CROSS-LINKING OF tICAM(453^

To provide additional evidence that the higher relative binding activity tmICAM-1 is due to a multimeric form of the protein, the tICAM(453) protein pre-incubated with CL203, a monoclonal antibody to ICAM-1 that does not inhi virus binding to ICAM-1 and binds to a site C-terminal to residue 184 (Staunton, al. , Cell, 56:849 (1989) and Cell, 61 :243 (1990)). Thus, the antibody can effectiv "cross-link" two molecules of tICAM(453), to create "dimers" of tICAM(453), without blocking the virus-binding site on each of the two molecules of tICAM(45 When a mixture of CL203 IgG and tICAM(453) at a 4:1 weight ratio was tested the competition assay, it was found that the antibody cross-linked tICAM(4 inhibited HRV3 binding at a concentration 7.4-fold lower than tICAM(453) al consistent with the idea that tmICAM-1 binds with higher affinity to rhinovi because it is a dimer or a small multimer.

To create alternative multimeric forms of tICAM, several further modi truncated forms of ICAM were constructed as described, supra, in Example 3. These forms can then be multimerized as described in Example 9, below.

EXAMPLE 9

MULTIMERIZATION OF tmlCAM AND tICAMs

There are several ways that tICAM can be converted to a multimeric fo having enhanced viral binding and neutralization activity over the monomeric for For example, a first tICAM can be coupled to a second tICAM(which may be same or different), or to an inert polymer, such as amino-dextran (MW 40,00 using homobifunctional (such as N-hydroxysuccinimide (NHS) esters) heterobifunctional (such as those containing NHS-ester and photoactivatable sulfhydryl-reactive groups) cross-linking reagents utilizing the amino group on amino-dextran and an amino or other group on the tICAM. A number of examp of appropriate cross-linking reagents can be found in the Pierce Chemical Comp catalog (Rockford, 111.). Similarly, the tICAMs can also be bound to other suita inert polymers, such as nitrocellulose, PVDF, DEAE, lipid polymer, and other in polymers that can adsorb or be coupled to tICAM with or without a spacer or link As tICAM is poorly reactive with NHS-ester-based compounds, a tICAM w a genetically-engineered C-terminal lysine residue (see Example 3) would h improved coupling efficiency to supports with homobifunctional reagents wher genetically-engineered C-terminal cysteine residues would facilitate coupling heterobifunctional reagents, such as sulfo-maleimidobenzoyl-N-hydroxysuccinim ester (MBS).

ICAMs can also be multimerized by coupling with an antibody (e.g. CL2 or fragment thereof, or with a suitable protein caπier, e.g. albumin or proteoglyc ICAMs may also be multimerized by fusion with fragments immunoglobulins to form ICAM immunoadhesins.

Alternatively, soluble tICAM multimers can be created by genetica engineering reactive residues into tICAM. For example, free cysteine residues be created in relatively hydrophilic sequences in the C-terminal region of tIC (which would have a greater tendency to be solvent-exposed). This will allow creation of dimers in situ; alternatively, monomers can be purified and dimers crea in vitro by disulfide bonding, either directly or via suitable linkers.

Another approach requires the placement of lysine residues at similar positi and cross-linking purified protein in vitro with homobifunctional NHS-este Examples of such lysine residues are residues 338, 360, 387. See Fig. 1.

Crosslinking cysteine residues to each other can be accomplished by reacti of tICAM with free cysteine groups with bis-maleimidohexane (Pierce Chemical C or other bis-maleimido-analogs. Cross-linking free cysteine residues on tICAM amino groups on carrier molecules can be accomplished by reaction with maleimidobenzoyl-N-hydroxy- succinimide ester. Crosslinking amino groups on tICAM molecules can be accomplished w homobifunctional N-hydroxysuccinimide esters (for examples, see Pierce Chemi Co. catalog). Alternatively, the carbohydrate groups on tICAM can be oxidized aldehydes and coupled to hydrazine-activated amino groups on a carrier molecul

EXAMPLE 10

INFECTIVITY-NEUTRALIZATION ASSAY OF tmlCAM AND tICAMs Three different assays for virus infectivity have been used. These differ assays take into account the differences in transmembrane ICAM and n transmembrane solubilities.

A. Plaque-reduction assay in the presence of detergent

The results of this assay indicate the highest dilution of virus that will still effective in killing cells. Virus is pre-incubated with transmembrane ICAM prot in the presence of 0.1% Triton X100, serially diluted into culture medium, incubat for 30 min with HeLa cells at 10⁶ cells/ml, diluted 10-fold, and plated out i multiple wells of a 96-well microtiter plate having varying dilutions of virus.

0.1% Triton X100 was used as positive control. After 5 days, the wells scored as either being infected or not by the presence of cytopathic effect (CPE) a the titer expressed as plaque-forming units/ml (PFU/ml) of the original virus. T assay was described in USSN 07/239,571 and was used to demonstrate the antivi activity of tmICAM-1 (which required the presence of detergent to remain solution). The concentration of ICAM protein used is the initial concentration in t pre-incubation mixture; however, the ICAM protein is not present continually duri the infection in that the protein is serially diluted. While the presence of deterg is required to solubilize the tmlCAM, detergent kills the cells; thus, the need for t serial dilutions of the tmICAM-1 /detergent to permit infection of cells.

B. Plaque-reduction assay in the absence of detergent

In this plaque-reduction assay, a more traditional assay, HeLa cells a infected with serial dilution of rhinovirus as above, but detergent is not present; th

SUBSTITUTE SHEET this assay cannot be used to assay tmlCAM. In this assay the tICAM is pres continually in the culture medium at the indicated concentration. tmICAM-1 (wh requires the presence of detergent) cannot be assayed in this system because addition of the required detergent would kill the HeLa cells.

C. Plaque-reduction assay in continual presence of virus and ICAM

This assay is similar to that utilized by Marlin, et al. (Nature 1990) in wh a culture of HeLa cells is infected with 100 PFU of virus in the presence or abse of ICAM protein and cultured approximately 4 days until cytopathic effect (CPE apparent. The cultures are then scored for CPE visually. The assay conditions w the same as Marlin, supra. Scoring was done visually rather than by a stain procedure using crystal violet.

In this assay, there is no detergent present, the ICAM is present continua and this assay measures a reduction in virus replication/propagation at an arbitr point in time. The data from these three different assays for virus infectivity is summari in Table 4.

TABLE 4

IC50% (μM)* ICAM Assay: A B C tmICAM-1 0.03 ND tICAM(453) > 20 0.2 0.2 tICAM(185) > 20 8 ND

* IC50% is defined as the concentration of ICAM protein needed to inhibit HR infectivity by 50% .

These data indicate that mICAM-1 is significantly more active in reduc viral infectivity than the truncated ICAM proteins, even when compared in differ assay systems. The differences in neutralization activity of tICAM(453) in assay and assay (B) indicate that the neutralization mediated by tICAM(453) requires continual presence of tICAM(453) in the culture medium and is reversible. That neutralization is reversible is indicated by the lack of significant neutralizat observed in assay (A). In contrast, the neutralization activity of tmICAM-1 is > 6 fold higher than tICAM(453) and than tICAM(185) in assay (A) and could be e greater in assay (B) if it were possible to have the tmICAM-1 present continually the culture medium in the absence of detergent. The conditions in assays B-D m closely reflect the in vivo situation in which soluble ICAM could be used as antiviral agent. To compare these results with those of Marlin et al., an attempt was made reproduce their assay conditions. As shown in Table 4, there is a good coπelati between the results in assay (B) and assay (C), although the IC50% for tICAM(4 is 10-fold greater than that seen by Marlin et al. To determine if this is due t difference in the serotype of rhinovirus used, the assay was repeated with HRV 14 HRV54 (the serotype used by Marlin, et al.). The IC50% for both of these seroty was 0.2 μM tICAM(453), indicating that there is no difference in serotype sensitiv between HRV 14, HRV54, and HRV3.

To attempt to resolve this discrepancy, the same buffers that Marlin, et used were used to see if they affected the infectivity of rhinovirus in assay ( Marlin, et al. prepared their sICAM-1 protein in a buffer containing 50 triethanolamine (TEA)/20 mM Tris. When this buffer alone was added to cont infections (1/lOth volume, final concentration 5 mM TEA/2 mM Tris) of HRV3 a HRV14, virtually complete inhibition of CPE was observed. Thus, it is possible t there could be buffer effects on virus replication unrelated to the presence of a form of ICAM.

However, subsequent assays using a broad panel of HRV serotypes indica that the IC50% for HRV54 may in fact be significantly lower than for other H serotypes, e.g. HRV3. EXAMPLE 11 USE OF MULTIMERIC FORMS OF tmlCAM AND tICAMs AS EFFECTIV INHIBITORS OF ICAM/LFA-1 INTERACTION The normal function of ICAM-1 is to serve as a ligand of the leukoc integrin LFA-1; interaction between these two molecules leads to adhesion betwe leukocytes and a variety of other cells. The ability of tICAMs to inhibit adhesi between ICAM-1 and LFA-1 on cells was examined as follows. ICAM-1 was adsorb to microtiter plates as described in Example 7C. JY cells, which express LFA adhere to ICAM-expressing cells or to ICAM-1-coated culture dishes (Staunton, et a JCB). JY cells (10⁷ cell/ml in 10 mM HEPES pH 7.5/150 mM NaCl/1 mM CaCl₂ mM MgCl₂ containing 1 mg/ml BSA) labeled with 10 μCi/ml [³⁵S]-cysteine for hours) were pre-incubated in the presence or absence of tICAM(453) or tICAM(18 for 30 min at 37 C, and then added to the ICAM-1-coated plates and incubated for min at 37 C. The microtiter plates were then washed three times with media, and t number of cells bound to the plates were quantified by scintillation counting.

As shown in Table 5, tICAM(185) and tICAM(453) both inhibited JY c binding at identical concentrations of between 5 and 20 μM.

TABLE 5 % JY Cell Binding μM ICAM-1 tICAM(453) tICAMQ85

20 100

6 5

2 47 50

0.6 83 72 0.02 86 80

0.006 89 97

^♦Binding to ICAM-1-coated microtiter plates; 10 μg/ml anti-LFA-1 or anti-ICA MAb inhibited binding to < 1% . EX AMPLE 12 Construction of tICAM/IgG Immunoadhesins

A soluble derivative of ICAM-1 was constructed by a cDNA fusion wh linked the first two domains of ICAM-1 (residues 1-185) to a segment of hu immunoglobulin heavy chain cDNA. This approach has been described previou for the CD4 molecule [Zettlmeissl, G. , J-P Gregersen, J.M. Duport, S. Mehdi, Reiner, and B. Seed, "Expression and Characterization of Human C Immunoglobulin Fusion Proteins", DNA and Cell Biology (1990) 9(5):347-3 Capon, D.J., S.M. Chamow, J. Mordenti, S.A. Marsters, T. Gregory, H. Mitsu R.A. Bryn, C. Lucas, F.M. Wurm, J.E. Groopman, S. Broder, and D.H. Smi "Designing CD4 immunoadhesins for AIDS therapy", Nature (1989) 337:525-5 Traunecker, A. J. Schneider, H. Kiefer and K. Karjalainen, "Highly effici neutralization of HIV with recombinant CD4-immunoglobulin molecules", Nat (1989) 339:68-70] and resulted in the expression of disulfide-linked dimers. The cDNA fusion was accomplished by a two-stage polymerase chain reacti

(PCR) strategy. [See, e.g. , Horton, R.M. , Z. Cai, S.N. Ho, and L.R. Pease, "Ge Splicing by Overlap Extension: Tailor-Made Genes Using the Polymerase Ch Reaction", BioTechniques (1990) 8(5):528-535]. The first step involved the separ amplification of a fragment coding for residues 1-185 of ICAM-1 and an IgG hea chain fragment beginning at residue 216 in the hinge region and ending at the terminus of the molecule (see Fig. 3). The PCR primer used at the 3' end of t ICAM-1 fragment contained an additional 24 bases complementary to the first bases of the IgG fragment: CGG TGG GCA TGT GTG AGT TTT GTC AAA G CTG GAG CTG GTA GGG GGC. The 5' ICAM-1 primer (5' noncoding and sig sequence) had the sequence:

Hindlll GGA ATT CAA GCT TCT CAG CCT CGC TAT GGC TCC CAG CAG CCC CCG GCC C

The 5' IgG primer had the following sequence: GAC AAA ACT CAC ACA T CCA CGG; the 3' primer from the end of the IgG coding sequence was:

SUBSTITUTE SHEET Xbal G GGA TTC TCT AGA TCA TTT ACC CGG AGA CAG GGA GAG GCT

Amplifications were performed using 10 ng of cloned ICAM-1 or IgGl heavy c cDNA for 10 cycles with 1 min at 94 C, 2 min at 55 C and 1.5 min extensions a C. The resulting amplified fragments were mixed in approximately equim amounts and used as template for the second step PCR reaction. This reaction u the 5' ICAM primer and the 3' IgG primer above. Amplification for 25 cycles u the same conditions as in the first step produced a predominant band of approxima 1200 bp consistent with the desired product (see Fig. 3). The fragment was dige with Hindlll and Xbal (restriction sites incorporated into the 5' and 3' pri respectively), purified and ligated into Hindlll/Xbal-cleaved CDM8 vector.

Clones containing the desired insert were identified by restriction analysis two clones designated pHRR72 and pHRR73 were selected for sequence analy Sequencing of the junction region between ICAM-1 and the IgG hinge confirmed both clones had the coπect structure. The plasmids were transfected into COS c which were labelled with [³⁵S]cysteine overnight at 48 hours post-transfection a Example 6. The supernatants were immunoprecipitated with anti-ICA monoclonal antibody c78.4A and analyzed by SDS gel electrophoresis as in Exa 6. Under reducing conditions a band with an apparent molecular weight of 68 was specifically immunoprecipitated, coπesponding to»the ICAM-1/IgG fusio Expression of clone pHRR72 was consistently higher than pHRR73 so this clone selected for further study.

COS cells were transfected with pHRR72 according to the method of Exa 3 and at 48 hours after transfection the media was replaced with serum-free m containing [³⁵S]cysteine and the cells were labelled overnight as above. supernatants were incubated with protein A- Sepharose beads, and bound protein eluted with 0.1 M acetic acid, neutralized and analyzed by gel electrophoresis un reducing and non-reducing conditions. A control was performed in which plas expressing heavy and light chains of a functional antibody were co- transfected. experiment showed that the protein produced by pHRR72 is capable of bind protein A, showing that the pHRR72 protein contains the IgG constant region,

SUBSTITUTE SHEET that the 68 kD band seen under reducing conditions shifts to a high molecular wei dimeric form under non-reducing conditions. Thus since only dimeric IgG bi protein A, and since the mobility under non-reducing conditions is at least twice t of the monomer, we conclude that the tICAM(185)/IgG immunoadhesin is a dim Coπect folding of the ICAM-1 region is indicated by the specific immunoprecipitati with c78.4A as in Example 6, and by the quantitative detection of the fusion prot using two ICAM- 1 -specific antibodies in a radioimmune assay (RIA) as in Exam 4. pHRR72 was co-transfected with pSV2-DHFR into CHO cells by the calci phosphate method of Example 4 and DHFR+ cells were selected in nucleoside-f medium. Individual colonies were picked, expanded and tested by RIA expression. The three highest-expressing colonies were selected for further study a were recloned by limiting dilution. Analysis of labelled cell supernatants by prot A binding and gel electrophoresis confirmed the expression of tICAM(185)/I dimers.

In a similar manner, domains I - V of ICAM-1 (residues 1-453) were lin to a segment of human immunoglobulin heavy chain cDNA. A fragment coding residues 1-453 of ICAM-1 and a fragment coding for IgG heavy chain beginning residue 216 in the hinge region and ending at the C-terminus of the molecule w each separately amplified. The PCR primer used at the 3' end of the ICA fragment contained an additional 24 bases complementary to the first 24 bases of t IgG fragment: CGG TGG GCA TGT GTG AGT TTT GTC CTC ATA CCG G GGA GAG CAC ATT. The 5' ICAM-1 primer, 5' IgG primer, and 3' primer fr the end of the IgG coding sequence were the same as for the tICAM(185)IgG fusi above. After PCR amplification, a band of approximately 2000 bp consistent w a tICAM(453)/IgG fusion was produced.

Clones containing the desired insert were identified by restriction analysis a the clone designated pHRR 95-9 was selected for sequence analysis. The cD sequence is as follows:

SUBSTITUTE SHEET

SUBSTITUTE SHEET The corresponding amino acid sequence of the mature fusion polypeptide is as follows:

1 QTSVSPSKVI LPRGGSVLVT CSTSCDQPKL LGIETPLPKK ELLLPGNNRK

51 VYELSNVQED SQPMCYSNCP DGQSTAKTFL TVYWTPERVE LAPLPSWQPV 101 GKNLTLRCQV EGGAPRANLT WLLRGEKEL KREPAVGEPA EVTTTVLVRR

151 DHHGANFSCR TELDLRPQGL ELFENTSAPY QLQTFVLPAT PPQLVSPRVL

201 EVDTQGTWC SLDGLFPVSE AQVHLALGDQ RLNPTVTYGN DSFSAKASVS

251 VTAEDEGTQR LTCAVILGNQ SQETLQTVTI YSFPAPNVIL TKPEVSEGTE

301 VTVKCEAHPR AKVTLNGVPA QPLGPRAQLL LKATPEDNGR SFSCSATLEV 351 AGQLIHKNQT RELRVLYGPR LDERDCPGNW TWPENSQQTP MCQAWGNPLP

401 ELKCLKDGTF PLPIGESVTV TRDLEGTYLC RARSTQGEVT RKVTVNVLSP

451 RYEDKTHTCP PCPAPELLGG PSVFLFPPKP KDTLMISRTP EVTCVWDVS

501 HEDPEVKFNW YVDGVEVHNA KTKPREEQYN STYRWSVLT VLHQDWLNGK

551 EYKCKVSNKA LPAPIEKTIS KAKGQPREPQ VYTLPPSRDE LTKNQVSLTC 601 LVKGFYPSDI AVEWESNGQP ENNYKTTPPV LDSDGSFFLY SKLTVDKSRW

651 QQGNVFSCSV MHEALHNHYT QKSLSLSPGK *

The plasmids were transfected into COS cells which were labelled with SJcysteine overnight at 48 hours post-transfection as in Example 6. The fusion polypeptide is expressed as a soluble secreted disulfide-linked dimer which binds protein A. The supernatants were immunoprecipitated with anti-ICAM-1 monoclonal antibody c78.4A and analyzed by SDS gel electrophoresis as in Example 6. Under reducing conditions a band with an apparent molecular weight of 100 kD was specifically immunoprecipitated, corresponding to the ICAM-1/IgG fusion, while under non-reducing conditions it migrates as a 200 kD dimer. EXAMPLE 13

Rhinovirus Binding and Neutralization by tICAM/IgG Immunoadhesins The tICAM(185)/IgG immunoadhesin of Example 12 consists of residues 1- 185 of ICAM-1 fused to residue 216 in the hinge region of an IgGl heavy chain. The molecule is a disulfide-linked dimer containing two rhinovirus binding sites. A CHO cell line CHO72.2 secreting the immunoadhesin was grown overnight in serum- free media containing PSJcysteine and the fusion protein was purified on protein A beads. The labelled protein was tested for rhinovirus binding in the pelleting assay as described in Example 7(A). The samples consisted of tICAM(185)/IgG (no virus),

SUBSTITUTE SHEET tICAM(185)/IgG + HRV3, tICAM(185)/IgG + HRV3 + c78.4A, a tICAM(185)/IgG + HRV3 + iπelevant antibody. Pelleting of labelled prot indicative of virus binding was seen with virus and virus + irrelevant antibody analysis on SDS gels. No pelleting was seen in the absence of virus and significan reduced pelleting was seen in the sample containing c78.4A. This result indicates t the tICAM(185)/IgG binds rhinovirus with a significantly higher affinity than t soluble monomers tICAM(185) and tICAM(453), which do not show levels of bindi readily detectable under these conditions. See Example 7(A). While approximat 10% of tmICAM-1 pellets under these conditions, only 1 % of tICAM(453) pelle presumably because tmICAM-1 is in a dimeric state. The result w tICAM(185)/IgG is similar to that seen in this assay with tmICAM-1, suggesting t the two forms of ICAM may have similar affinities for the virus, and providi further evidence that tmICAM-1 is a dimer.

Cell supernatant from CHO72.2 cells containing unpurified tICAM(185)/I was tested for rhinovirus neutralization in a virus infectivity assay according to t method of Example 10(B). Serial dilutions of HRV3 were made in media containi 50% IgG supernatant or control supernatant from untransfected CHO cells. The vir dilutions were mixed with HeLa cells and plated in wells of a 96-well microtiter pl (10 wells per dilution). Virus titers were determined by scoring the number infected wells at each dilution after 6 days. In addition a quantitative assessment cytopathic effect at high virus input was made 2 days after infection. In experim A the concentration of tICAM(185)/IgG estimated by RIA was 150 ng/ml and experiment (B) the concentration was 325 ng/ml.

TABLE 6 Experiment A Experiment B

HRV3 1 x 10⁷ PFU/ml 4 x 10⁶ PFU/ml

HRV3 + tICAM(185)/IgG 6 x 10⁵ PFU/ml 5 x 10⁵ PFU/ml

SUBSTITUTE SHEET Both experiments resulted in a ten-fold reduction in viral titer at a concentratio approximately 1 nM in experiment A and 2 nM in experiment B. For comparis monomeric tICAM(453) in the same assay results in a 50% reduction in titer at 0 μM or 30 μg/ml. Thus the increase in activity resulting from dimerization of rhinovirus binding site is at least 200-fold and probably greater.

Cell supernatant from CHO72.2 at a concentration of 650 ng/ml (4 nM) also tested in a competitive binding assay measuring the binding of [³⁵S]HRV3

ICAM-1-coated plastic microtiter wells. Specific binding is determined by compa counts bound with or without pre-incubation of the ICAM-1 in the well with C78.4A.

TABLE 7 cpm bound* % binding

HRV3 4945 +/- 58 100

HRV3 + CHO supernatant 5358 +/- 51 108 HRV3 + CHO72.2 supernatant 3187 -+-/- 206 64

*Mean values determined from triplicate wells. Standard eπors were less than 1 of the mean.

The level of binding in the presence of tICAM(185)/IgG was 65% of normal control binding and 54% of control binding in the presence of CHO supernatant, indicating close to a 50% inhibition of binding. For comparison, solu monomeric tICAM(453) inhibits HRV3 binding by 50% in the same assay at μg/ml or 3.1 μM. On a molar basis the ICAM-1 IgG immunoadhesin was t almost a 1000-fold better competitor than the monomer. The above experiments w done with supernatants. Subsequent attempts to reproduce these results with hig purified tICAM(185)/IgG were unsuccessful.

The tICAM(453)/IgG immunoadhesin of Example 12 consists of residues 453 of ICAM-1 fused to residue 216 in the hinge region of an IgGl heavy ch The molecule is a disulfide-linked dimer containing two rhinovirus binding sites. fusion polypeptide was expressed in HeLa cells using the vaccinia/T7 system purified from the supernatant by affinity chromatography using an anti-ICA

SUBSTITUTE SHEET monoclonal antibody. The activity of the protein was examined in a competit binding assay which measures the binding of [³⁵S]-labelled HRV to plates coated purified tmICAM-1. For comparison, soluble monomeric tICAM-453 was inclu in a parallel assay as a positive control. The binding values are documented in Ta 8 below:

*IC₅₀ is the concentration required to inhibit binding by 50%

These values are per mol of tICAM(453) determined by RIA. Since e fusion polypeptide contains two tICAM(453) polypeptides, the values for the fusi polypeptide expressed per mol of dimer are 5.5 nM and 5 nM for Experiments 1 2, respectively. Therefore on a molar basis the activity of the fusion polypeptide the competitive binding assay is ten-fold greater than the tICAM(453) monomer. subsequent experiments the relative activity was 2- to 4-fold greater.

EXAMPLE 14 In Vitro Dimerization of ICAM-1

Several lines of evidence indicate that tmICAM-1 exists as a noncoval dimer at the cell surface: (i) the stoichiometry of HRV/ICAM-1 binding sites at cell surface is approximately 2; (ii) tICAM(453), despite being properly folded, a approximately 100-fold lower affinity for HRV than purified tmICAM-1; and ( tICAM(453) and tmICAM-1 absorbed to nitrocellulose filters at a high density b rhinovirus at equivalent levels. See Example 7. In addition, Staunton et al. (

SUBSTITUTE SHEET 61:243-254 (1990)) have reported that some mutants of ICAM-1 form covalent dim at the cell surface, indicating that this protein has the capability to self-associate vivo. Attempts to directly demonstrate the existence of dimers by chemical cro linking with water-soluble carbodiimide/NHS, which is a heterobifunctio crosslinker which forms a covalent bond between a primary amine and a carbo group, did result in crosslinking of tICAM(453) into a 180 kD species, whose s is consistent with a dimer (Figure 4A). This crosslinking is directly dependent up the concentration of tICAM(453), with 50% crosslinking at 7 μM protein (Fig 4B). This concentration is consistent with the relatively high concentration tmICAM-1 at the surface of a HeLa cell, which is approximately 2.5 μM or 1 μg/ml. The self-association detected by this crosslinking is specific, since it is affected by high concentrations of third-party proteins (Figure 4C). tICAM(1 appears to be poorly crosslinked under the same conditions, indicating that domai 3-5 are involved in self-association. Because of the extensive modification of t protein by this crosslinking procedure, the protein had no virus-binding activi However, this data shows that soluble ICAM can self-associate in solution, and t this self-association is concentration-dependent and -specific.

EXAMPLE 15 A tICAMα-451VLFA-3(210-237 Chimera In order to examine the role of the transmembrane and cytoplasmic domai of tmICAM-1 in high-affinity rhinovirus binding, we constructed a chimeric ICAM which is anchored on the cell surface by a phospholipid tail and lacks these domai (see Fig. 5). This experiment was designed to test whether the cytoplasmic a transmembrane domains are necessary for the formation of dimeric ICAM-1 on t cell surface, which results in the high affinity binding of rhinovirus. In order modify the ICAM-1 cDNA to express a phospholipid-anchored form, we first us site-directed mutagenesis to create a unique SacII site at residues 450/451 close to t end of the extracellular region. This allowed the isolation of a cDNA fragm coding for residues 1-451 of ICAM-1, by digestion of the modified plasmid w Hindlll and SacII. We used PCR to generate a fragment coding for the C-termi

SUBSTITUTE SHEET 28 amino acids of the phospholipid-anchored form of LFA-3 (Seed, B., Nature (198 329:840-842). By including a SacII site in the 5' primer this fragment was ligat to the ICAM-1 extracellular domain and cloned into the expression vector CDM resulting in the plasmid pHRR 70-19. This plasmid contains a cDNA coding f residues 1-451 of ICAM-1 fused to residues 210-237 of LFA-1, which should res in the expression of a phosphoplipid-anchored molecule containing the ICAM extracellular region. See Fig. 5.

Transfection of COS cells with pHRR 70-19 according to the method Example 4 and FACS analysis with anti-ICAM-1 antibodies confirmed the cell surfa expression of the fusion protein. The binding of [³⁵S]-labelled cells to COS ce transfected with the fusion protein was determined.

TABLE 9 ICAM-1 cpm bound % virus input % contro

tmICAM-1 2130 +/- 278 9.4 100

tICAM(l-185)/ 2382 +/- 293 11.2 119

LFA-3(210-237) chimera

This result shows that there is no significant difference between the ability tmICAM-1 and the tICAM(l-451)/LFA-3(210-237) chimera to bind HRV. It c therefore be concluded that the transmembrane and cytoplasmic domains are n required for HRV binding, and that dimerization must depend on interactions betwe extracellular regions of the molecule.

Additional evidence that a form of ICAM-1 lacking the cytoplasmic a transmembrane domains functions efficiently as a receptor for rhinoviruses w obtained by transfection of the tICAM(l-451)/LFA-3(210-237) chimeric gene in HeLa 229 cells. We have determined that these cells do not express ICAM-1 on t surface and are resistant to HRV infection. Transfection of either tmICAM-1 or t

SUBSTITUTE SHEET tICAM(l-451)/LFA-3(210-237) chimera results in cells which are readily infecta with rhinovirus and produce virus at levels comparable to normal HeLa cells.

EXAMPLE 16 Iπeversible Inactivation of HRV by ICAM We have demonstrated that tICAM(453) can, in addition to blocking binding of HRV to cells, iπeversibly inactivate HRV. Incubation of HRV tICAM(453) at 34 C results in conversion of a fraction of the virus from the nat 148S form to a 42S form (Figure 6). The 42S form is non-infectious, lacks the vi subunit VP4, and lacks the RNA genome (empty capsid). This can be shown SDS-PAGE analysis of [³⁵S]methionine-labelled viral particles and by quantitation viral RNA content by hybridization with a [³²P]oligonucleotide probe for rhinovi (5'-GCATTCAGGGGCCGGAG-3'). Thus, tICAM(453) can uncoat rhinovirus, event that normally occurs intracellularly during the course of infection. uncoating is a slow process, occurring with a tl/2 of 6 hours at 34 C, in contrast w the inhibition of binding, which occurs with a tl/2 of < 30 minutes. The uncoati is highly temperature-dependent, occurring 10 times faster at 37 C than at 34 C, optimal temperature of rhinovirus growth. Enhancement of this uncoating activity soluble forms of ICAM- 1 including multimeric configurations of ICAM- 1 will l to improvement of antiviral activity by making neutralization iπeversible.

Example 17

Cysteine Muteins

To identify the coπect site to place cysteine residues for multimerization ICAM-1, the region of the protein surface involved in self-association must identified. Domains IV and V have been chosen because they are distal to the vi binding sites (domain I) and because domains II-V are implicated in self-associati (see Example 14). Since the structure of ICAM-1 is not certain, we have attempt to align the sequence of domains IV and V at the C-terminus of the extracellu domain of ICAM-1 onto the immunoglobulin fold, as ICAM-1 has homology

SUBSTITUTE SHEET members of the immunoglobulin supergene family. This alignment is sho diagrammatically in Fig. 7. Then, to identify probable sites involved in s association, we have examined the three-dimensional structures of several memb of the immunoglobulin supergene family, IgG and MHCl/beta-2 microglobul Immunoglobulin domains have two broad faces of beta sheet structure, h designated the "B" face and the "F" face. Inspection of the above structures revea that different immunoglobulin-like domains interacted via one or the other of th faces of the domain. IgG variable regions associated via their F face, while I constant regions (CHI , CH2, and CH3) and MHCl/beta-2 microglobulin all inter via their B faces.

ICAM-1 domains have highest homology to constant region-like domai Thus, the most likely sites of interaction are on the B face of the domains; the m likely sites on the B face to place cysteine residues are close to the center of th face (adjacent to the cysteine on* the B strand that forms the intrachain disulf bond), where IgG CH3 domains self-associate, or on the N-terminal end of the face, where IgG CH2 domains and MHCl/beta-2 microglobulin self-associate.

A number of mutants were prepared to identify appropriate sites of interacti These mutants were prepared by standard site-directed mutagenesis methodology mutate selected residues to cysteine on tICAM(453) and tmlCAM. These cDNAs the vector CDM8 were then transfected into COS cells and dimer formation acces by biosynthetic labelling of ICAM-1 with [³⁵S]cysteine followed immunoprecipitation and non-reducing SDS-PAGE analysis. As shown in Table of 13 mutants tested, two have been found to form dimers at a small (about 5%) significant level:

SUBSTITUTE SHEET

These two muteins, Cys-307 and Cys-309, are both located on the N-terminal end the B face of domain IV. The relatively low level of dimerization may reflect the l concentration of ICAM-1 on the cell surface (low expression), or imperf orientation of the cysteine residues relative to the site of interaction. These d indicate that this region of the domain is a likely site of interaction. Other resid adjacent to residues 307 and 309, e.g. His-308, Arg-310, Glu-294, Arg-326, Gln-3 are likely to increase the efficiency of the dimer formation. Mutations that lead dimer formation of tmICAM-1 are then be placed on tICAM(453) for the secreti of soluble ICAM-1 dimers.

A tICAM(452) cysteine mutant was prepared by substituting a cysteine for alanine at position 307 in the ICAM-1 amino acid sequence and inserting a stop cod

SUBSTITUTE SHEET after amino acid residue 452. The mutein was constructed by site-directed mutagenesis using a full-length ICAM-1 cDNA and has the following DNA sequence:

1 CAGACATCTG TGTCCCCCTC AAAAGTCATC CTGCCCCGGG GAGGCTCCGT

51 GCTGGTGACA TGCAGCACCT CCTGTGACCA GCCCAAGTTG TTGGGCATAG

5 101 AGACCCCGTT GCCTAAAAAG GAGTTGCTCC TGCCTGGGAA CAACCGGAAG

151 GTGTATGAAC TGAGCAATGT GCAAGAAGAT AGCCAACCAA TGTGCTATTC

201 AAACTGCCCT GATGGGCAGT CAACAGCTAA AACCTTCCTC ACCGTGTACT

251 GGACTCCAGA ACGGGTGGAA CTGGCACCCC TCCCCTCTTG GCAGCCAGTG

301 GGCAAGAACC TTACCCTACG CTGCCAGGTG GAGGGTGGGG CACCCCGGGC

10 351 CAACCTCACC GTGGTGCTGC TCCGTGGGGA GAAGGAGCTG AAACGGGAGC

401 CAGCTGTGGG GGAGCCCGCT GAGGTCACGA CCACGGTGCT GGTGAGGAGA

451 GATCACCATG GAGCCAATTT CTCGTGCCGC ACTGAACTGG ACCTGCGGCC

501 CCAAGGGCTG GAGCTGTTTG AGAACACCTC GGCCCCCTAC CAGCTCCAGA

551 CCTTTGTCCT GCCAGCGACT CCCCCACAAC TTGTCAGCCC CCGGGTCCTA

15 601 GAGGTGGACA CGCAGGGGAC CGTGGTCTGT TCCCTGGACG GGCTGTTCCC

651 AGTCTCGGAG GCCCAGGTCC ACCTGGCACT GGGGGACCAG AGGTTGAACC

701 CCACAGTCAC CTATGGCAAC GACTCCTTCT CGGCCAAGGC CTCAGTCAGT

751 GTGACCGCAG AGGACGAGGG CACCCAGCGG CTGACGTGTG CAGTAATACT

801 GGGGAACCAG AGCCAGGAGA CACTGCAGAC AGTGACCATC TACAGCTTTC

20 851 CGGCGCCCAA CGTGATTCTG ACGAAGCCAG AGGTCTCAGA AGGGACCGAG

901 GTGACAGTGA AGTGTGAGtg CCACccgcgg GCCAAGGTGA CGCTGAATGG

951 GGTTCCAGCC CAGCCACTGG GCCCGAGGGC CCAGCTCCTG CTGAAGGCCA

1001 CCCCAGAGGA CAACGGGCGC AGCTTCTCCT GCTCTGCAAC CCTGGAGGTG

1051 GCCGGCCAGC TTATACACAA GAACCAGACC CGGGAGCTTC GTGTCCTGTA

25 1101 TGGCCCCCGA CTGGACGAGA GGGATTGTCC GGGAAACTGG ACGTGGCCAG

1151 AAAATTCCCA GCAGACTCCA ATGTGCCAGG CTTGGGGGAA CCCATTGCCC

1201 GAGCTCAAGT GTCTAAAGGA TGGCACTTTC CCACTGCCCA TCGGGGAATC

1251 AGTGACTGTC ACTCGAGATC TTGAGGGCAC CTACCTCTGT CGGGCCAGGA

1301 GCACTCAAGG GGAGGTCACC CGCAAGGTGA CCGTGAATGT GCTCTCCCCC

30 1351 CGGTATTAG

The foregoing examples describe the creation of soluble, multimeric forms of tICAM that substantially increase tICAM binding and neutralizing activity.

While the present invention has been described in terms of specific methods and compositions, it is understood that variations and modifications will occur to 35 those skilled in the art upon consideration of the present invention.

For example, it is anticipated that smaller protein fragments and peptides derived from ICAM-1 that still contain the virus-binding site would also be effective in a multimeric configuration. It is also anticipated that multimeric ICAM may be effective inhibitors of the ICAM-l/LFA-1 interaction, as the affinity between these effective inhibitors of the ICAM-l/LFA-1 interaction, as the affinity between th two molecules is quite low and the cell-cell binding mediated by these two molecu is highly cooperative.

Although the prefeπed form and configuration is a non-transmembr (truncated) ICAM in dimeric configuration, it is not intended to preclude other for and configurations effective in binding virus and effective in neutralizing viral activ from being included in the scope of the present invention.

Further, it is anticipated that the general method of the invention of prepa soluble protein forms from insoluble, normally membrane bound receptor proteins be used to prepare soluble multimeric forms of other receptor proteins useful binding to and decreasing infectivity of viruses other than those that bind to "major group" receptor. Such other viruses include polio, Herpes simplex, Epstein-Ban virus.

Numerous modifications and variations in the invention as described in above illustrative examples are expected to occur to those skilled in the art a consequently only such limitations as appear in the appended claims should be pla thereon.

Accordingly it is intended in the appended claims to cover all such equival variations which come within the scope of the invention as claimed.

SUBSTITUTE SHEET

Claims (43)

WHAT IS CLAIMED IS:

1. Multimeric ICAM.

2. The multimeric ICAM of claim 1 wherein said ICAM is non-transmembra ICAM.

3. The multimeric ICAM of claim 2 wherein said non-transmembrane ICAM substantially without the carboxyl intracellular domain and without the hydropho membrane domain.

4. The multimeric ICAM according to claim 2 wherein said non-transmembra ICAM is a member selected from the group consisting of tICAM(453), tICAM(18 tICAM(88), tICAM(283), and tICAMs comprising one or more sequences select from tICAM(89-185), tICAM186-283, tICAM(284-385), tICAM(386-45 tICAM(75-77), tICAM(70-72), tICAM(64-66), tICAM(40-43), tICAM(36-3 tICAM(30-33), and tICAM(26-29).

5. The multimeric ICAM of claim 1 wherein said ICAM is multimerized adsorption to a support.

6. The multimeric ICAM of claim 5 wherein said support is an inert polymer a is a member selected from the group consisting of nitrocellulose, PVDF, DEAE, li polymer, and amino dextran.

7. The multimeric ICAM of claim 1 wherein said multimeric ICAM is multimeriz by coupling to a member.

8. The multimeric ICAM of claim 7 wherein said ICAM is modified with at le one reactive amino acid to provide at least one site to facilitate coupling.

SUBSTITUTE SHEET

9. The multimeric ICAM of claim 8 wherein said reactive amino acid is a mem selected from the group consisting of lysine and cysteine.

10. The multimeric ICAM of claim 7 wherein said member is a member select from the group consisting of an antibody and a protein carrier.

11. The multimeric ICAM of claim 10 wherein said antibody is anti-ICAM antibo CL 203.

12. The multimeric ICAM of claim 10 wherein said protein carrier is a mem selected from the group consisting of albumin and proteoglycans.

13. The multimeric ICAM of claim 1 wherein said ICAM is modified at eit terminus to comprise a lipid capable of promoting formation of oligomer micelle

14. The multimeric ICAM of claim 1 comprising two or more ICAMs, which m be the same or different, linked to each other.

15. The multimeric ICAM of claim 14 wherein said ICAMs are directly linked each other without a linker.

16. The multimeric ICAM of claim 15 wherein said ICAMs are linked to each oth via at least one disulfide bridge.

17. The multimeric ICAM of claim 16 wherein said ICAMs are crosslinked vi cysteine disulfide bridge at position 307 on each ICAM.

18. The multimeric ICAM of claim 16 wherein said ICAMs are crosslinked via cysteine disulfide bridge at position 309 on each ICAM.

SUBSTITUTE SHEET

19. The multimeric ICAM of claim 14 wherein said ICAMs are indirectly linked a cross-linking agent.

20. The multimeric ICAM of claim 19 wherein said cross-linking agent is select from the group consisting of heterobifunctional and homobifunctional cross-linki reagents.

21. The multimeric ICAM of claim 20 wherein said cross-linking reagent is member selected from the group consisting of bifunctional N-hydroxysuccinimi esters, imidoesters and bis-maleimido-hexanes.

22. The multimeric ICAM of claim 1 wherein said ICAM is a member selected fr the group consisting of fully glycosylated ICAM, partially glycosylated ICAM, non-glycosylated ICAM.

23. In a method for enhancing the binding of ICAM to a ligand, the improvem comprising the steps of: presenting said ICAM in a multimeric configuration.

24. The method according to claim 23 wherein said ICAM is tICAM.

25. The method according to claim 24 wherein said ICAM is a member select from the group consisting of tICAM(453), tICAM(185), tICAM(88), tICAM(28 and tICAMs comprising one or more sequences selected from tICAM(89-18 tICAM186-283, tICAM(284-385), tICAM(386-453), tICAM(75-77), tICAM(70-7 tICAM(64-66), tICAM(40-43), tICAM(36-38), tICAM(30-33), and tICAM(26-29

26. The method according to claim 23 wherein said ICAM is modified with at le one reactive amino acid to provide at least one site to facilitate coupling.

SUBSTITUTE SHEET

27. The method according to claim 26 wherein said reactive amino acid is select from the group consisting of lysine and cysteine.

28. The method according to claim 23 wherein said ICAM is modified at eith terminus to comprise a lipid capable of promoting formation of oligomer micelles

29. The method according to claim 23 wherein said multimeric configurati comprises a first ICAM cross-linked to a second ICAM.

30. The method according to claim 29 wherein said first and second ICAM are ea muteinized to contain a cysteine residue at position 307, and said first and seco ICAM are cross-linked via a disulfide bridge between said cysteines at position 30

31. The method according to claim 29 wherein said first and second ICAM are ea muteinized to contain a cysteine residue at position 309, and said first and seco ICAM are cross-linked via a disulfide bridge between said cysteines at position 30

32. The method according to claim 23 wherein said multimeric configurati comprises ICAM adsorbed to a support.

33. The method according to claim 32 wherein said support comprises a memb selected from the group consisting of high molecular weight and substantially ine polymers.

34. The method according to claim 33 wherein said polymer is an inert polymer an is a member selected from the group consisting of nitrocellulose, PVDF, DEAE, lip polymers, and amino dextran.

35. The method according to claim 33 wherein said multimeric ICAM multimerized by coupling to a member.

SUBSTITUTE SHEET

36. The method according to claim 35 wherein said member is a member select from the group consisting of an antibody and a protein carrier.

37. The method according to claim 29 wherein said cross-linking reagent is member selected from the group consisting of heterobifunctional a homobifunctional cross-linking reagents.

38. The method according to claim 37 wherein said protein carrier is a memb selected from the group consisting of albumin and proteoglycans.

39. The method according to claim 36 wherein said antibody is anti-ICAM antibo CL 203.

40. The method according to claim 23, wherein said ligand is a member select from the group consisting of human rhinovirus, major group receptor viru lymphocyte-associated antigen- 1 (LFA-1) and Plasmodium falciparum.

41. A pharmaceutical composition comprising a pharmaceutically acceptable solven diluent, adjuvant or a carrier, and, as the active ingredient, an effective amount of polypeptide according to claim 1.

42. A method for inducing iπeversible uncoating of human rhinovirus, said meth comprising contacting said human rhinovirus with ICAM-1 or a tICAM fragme thereof.

43. A method of iπeversibly inhibiting infectivity of a mammalian cell by a hum rhinovirus, said method comprising contacting said human rhinovirus with ICAM or a tICAM fragment thereof under conditions which allow the ICAM-1 or tICA to bind to said rhinovirus; thereby stimulating iπeversible uncoating of sa rhinovirus.

SUBSTITUTE SHEET