CA2096658A1 - Anti-sense nucleic acid derivative - Google Patents

Anti-sense nucleic acid derivative

Info

Publication number
CA2096658A1
CA2096658A1 CA002096658A CA2096658A CA2096658A1 CA 2096658 A1 CA2096658 A1 CA 2096658A1 CA 002096658 A CA002096658 A CA 002096658A CA 2096658 A CA2096658 A CA 2096658A CA 2096658 A1 CA2096658 A1 CA 2096658A1
Authority
CA
Canada
Prior art keywords
groups
carbon atoms
group
substituents
alpha
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002096658A
Other languages
French (fr)
Inventor
Hidehiko Furukawa
Kenji Momota
Yo Takiguchi
Hitoshi Hotoda
Masakatsu Kaneko
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sankyo Co Ltd
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2096658A1 publication Critical patent/CA2096658A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/312—Phosphonates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/312—Phosphonates
    • C12N2310/3125—Methylphosphonates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/314—Phosphoramidates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3527—Other alkyl chain
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3531—Hydrogen
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)

Abstract

ABSTRACT OF THE DISCLOSURE

A compound represented by general formula (1), its salt, and antiviral and antitumor drugs containing the same, wherein k is 0 to 20; m is 0 or 1; n is 4 to 29, X represents OH, methyl, sulfhydryl, C1 to C4 alkoxy or C1 to C6 monoalkylamino; Y and Z represent each O or S: R1, R2 and R3 may be the same or different from each other and each represents H, C1 to C6; alkyl, or C6 to C10 aryl which may have the substituent(s) of group .alpha.; and D and B represent each independently a residue of any of the compounds of group .beta.; provided that m is 0 when k is 0, and a base sequence containing B is complementary to a tumor gene or a virus gene: group .alpha.: OH, C1 to C6; alkyl, C1 to C6 alkoxy, methylenedioxy, nitro, azido, halogen, C6 to C10 aryl, C6 to C10 aryloxy, and aralkyloxy composed of a C6 to C10 aryl moiety and a C1 to C2 alkyl moiety, group .beta.: adenine, guanine, cytosine and thymine.

Description

O ~ 2 ' M&C FOLIO: P67154 2 0 ~ 38 WANGDOC: 0427W
~", ' .

PN~ _ LEIC ACID DERIVATIVE

The pre3ent invention relates to a compound which inhibits the expre~sion ~f a virus gene or a tumour gene, which gene originates in a virus or is present in a tumour cell~ a~ well as to an antiviral agent and an autitumour agent having said compound as its active ingredient. .

Viruis genes or tumour genes can be broadly cla~sified into those that are present in cell~ and, in ~i the case of tumour genes, those from the outside that originate in viruses. It has been verified from earlier ~:~
re~earch that the e~pression of these gene~ i3 one of ~-:
~he factors that induces viral disease or which causes celli3 to become cancerous. . .. ~
~. - . . . ' More ~pecifically, when the genes in normal cells are expressed abnormally, regardle~s of whether the :-virus gene or tumour gene is internal or externial, morphological change~, changes in adhesion or abnorm~l :
proliferation occur, the~e being charact~ristic phenomena associated wi~h viral di~ea~es or cancer.
. ' .
Thu~, drugs that suppres~ ~his type of gene activation or expres3ion are expected to be developed as having u~e in the prevention and treatment of viral .
diseases or cancer.

An oligonucleotide having a sequence of the code chain of a certai~i-gene, or ha~ing a 3equence - ~
complementary to mRNA transcribed from ~aid gene :::
(hereinafter to be referred to a~ an "anti-sense ~ -oligonucleotide") i8 knowni to demon~trate action in , ~.
, ; ' . ~ ' , '. ' . : . . ' ; ;; , , ~ , ' , ' ;

,. "'. ' .'' '' ';' ,,:';i' ' ' ', '' O ~ 2 7 ~ - 2 2 ~
inhibiting the expre~9ion of that gene. In particular, detailed re~earch ha9 been conducted on the action of an anti-sense oligonucleotide of virus and tumour genes.
For example, it hag been reported ~hat an anti-sense nucleotide demonstrateg anti-HIV action. In addition, it has also been reported that an oligonucleotide having 18 ba~e pair~ complementary to ~RNA transcribed from the c-myb gene inhibit~ the proliferation of cells having said gene [Proc. Natl. Acad. Sci. USA, Q6, 3379-3383 (1989)~.

However, there are problems with the effects, and the ~uration of such effects, of oligonucleotides when they are used a~ antiviral agents and antitumour agents, these problems including the low up-take efficiency into cells of naturally-occurring oligonucleotide~, a~ well as the fact that the oligonucleotide~ are su~ceptible to decomposition by nuclease~.

In order to compensate for these shortcomings, variou3 chemically modified derivatives ha~e been synthesised, and research has been conducted on their effects again~t virus-infected cells or cells having tumour gene3 (hereinafter to be simply referred to as "tumour cells"). In particular, it ha~ been di~covered that anti-~ense methylphosphonate oligonucleotides, in which ~he hydroxy groups of the phosphodiestar bond portion~ are substituted with methyl groups (U.S. Patent No. 4,511,713) and anti-~en~e phosphorothioate oligonucleotides, in which the oxygen atoms of the phosphodiester bond portion~ are substituted with ~ulphur atom~ (Japanese Pate~t ~pplication No.
Hei-1-503302), bring about a decrease in the rate of formation of colonies and an inhibition of the proliferation of virus-infected cell~ and tumour cells, thereby confirming their efficacy as antiviral agents or antitumour agent~.

,: .:
2 ~ 8 As a result of in~ensive research conducted over an extended period ~f time, the inventors of the present invention diScovered that, when studies were conducted on the effectg of a~ti-9en9e oligonucleotide derivatives on virus-infected cells and tumour cell3, which oligonucleotides were obtained by chemical modification completely different from methods described in the prior art, or in other words, anti-sense oligonucleotides wherein the hydroxy group of ~he 5~-position of a 5 terminal nucleotide i8 modified with various substituents, the~e compounds demonstrated the ability to suppres~ viral proliferation and tumour cell proliferation, to suppress the occurrence of viral diseases and the characteri~tic morphological changes of tumour cells, and to demon~trate other eff2cts, such as specific ~uppression of proliferation, thereby leading to completion of the present in~ention.

In the present specification, adenine is abbreviated as A, guanine as G, cyto~ine as C, thymine as T, the adenine nucleotide as A, the guan:ine nucleotide as G, the cytosine nucleotide as C, and the thymine nucleotide as T.

In the present invention, viruses are to include either DNA viruses or RNA viruses.
- ,' .
Examples of DNA viruse~ includ~ adenoviru~, hepatitis A virus, hepatitis B virus and herpes virus.

Examples of RNA viruce~ include AIDS virus (hereinafter to be referred to as "HIV"), adult T type leukaemia virus, influenza viru~ and hepatitis C virus, of which HIV is the preferred virus referred to herein.

In the present invention, "virus gene~" and "tumour gene~" generically refer to those genes whose activity ~ -- 4 2~S~a~
induce~ normal cell~ to undergo viral lesions or to become cancerous~regardl~ss~ o~ whether the genes are internal or external.

More specifically, examples o~ genes which cause normal cell~ to become cancerous include c-Ha-ras [Nature, 302, 33-37, (1983); Nature, 300, 149-152, (1982); Proc. Natl. Acad. Sci. U.S.~., 81, 4771-4775;
and Proc. Natl. Acad. Sci. U.S.A., 81, 5384-5388, ~1984)~, K-ra~ ~Proc. Natl. Acad. Sci. U.S.A., 81, 71-75, (1984)], N-ras ~EM~O.J., 3, 1321-1326 (1984)], C-Ci9 [Mol. Cell. Biol., 6, 3018-3022, (1986)], c-myc [Mol. Cell. ~iol., 8, 124-129, ~1988)], myb tProc~ Natl.
Acad. Sci. U.S.A., 83, 9636-9640, (1986)~, erb B
[Nature, 319, 230-234, (1986)], c-jun [Proc. Natl. Acad.
Sci. U.S.A., 85, 914a-9152, (1988)] and src ~Mol. Cell.
Biol., 7, (1978) 1983-1987].

In addition, examples of yenes that cause ~iral ~;
lesions include HIV-l tProc~ Natl. Acad. Sci. USA, 85, 5507-5511 (1988), Proc. Natl. Acad. Sci. USA, 86, -4244-4248 (1989), Proc. Natl. Acad. Sci. USA, 84, 7706-7710 (1987), Gene, 72, 343-347 tl988), Proc. Natl.
Acad. Sci. USA, B6, 7790-7794 (1989), Proc. Natl. Acad.
Sci. USA, 85, 7079-7083 (1988), Proc. Natl. Acad. Sci.
USA, 83, 4143-4146 (1986)], HSV-l tProc. Natl. Acad. - ;
Sci. USA, 83, 2787-2791 (1986~, Proc. Natl. Acad. Sci.
USA, ~, 6868-6872 (1989~], and VSV [~iochemistry, 25, 6268-6275 (1986), Proc. Natl. Acad. Sci. USA, 84, 648-652 (1987), ~ucleosi~es &-Nucleotides, 8, a25-828 (1989) and Nucleic Acids Res., 1~, 3777-3783 (1990)].
In particular, detailed research ha~ been conducted regarding HIV-l, and examples of the genes identified include tat tScience, 229, 69-73 (1985)] and rev - `
LNature~ 321, 412-417 (1986)].
' ' "To be complementary" means that the thymine ~ ;

.: . .
.-'`.

'.', l ' . '.,, ; . ' . . ' ' ' ':" : . ':: . ,' :: . . ". . '.'. ~:

~ - 5 $
nucleotide is complementary to the adenine nucleotide or ~::
the uracil nucleotide; the cytoisine nucleotide i9 complementary to the guanine nucleotide; the guanine nucleotide i~ complementary to the cytosine nucleotide; ;:~
and the adenine nucleotide is complementary to the .
thymine nucleotide of a virus gene or of a tumour gene of DNA itself or of RNA.

"Being complementary to a virus gene or tumour gene"
means that a sequence i9 complementary to the nucleotide sequence of the code chain side of a tumour gene, or being complementary to the nucleotide sequence of mRNA
transcribed by a virus gene or tumour gene, either before or after splicing.
. ~
"A ~ingle base site" refers to a point mutation site in a tumour gene that causes activation of a tumour gene, at which 1 or 2 nucleotides of the original nucleotide sequence are substituted.

The compound of the present invention i3 the .~:
compound repre~ented by the general formula (1).
' ',., ,' ' , .

, 'i ' . . ~', .
.; .

'',':: , ". ' , : ' ' "' ", '": ''.. 't'~ '. '' ~ , ,:, . ' ~ 6 .
~ 0 ~ 3 Rl ~:

33 ~ ~
~ . .' O
- X-f-o o , CH~
\~ \~a :
y t~
f x- P= o O -, .: , O ' ~

~b :~
, .
In the above fonmula ~
. .. -; ,.
k represent~ 0 or an integer of 1 to 20; :
m repre~ents 0 or 1;
n represents an integer ~f 4 to 29; ;~
X represents a hydroxy group, a methyl group, a ~.
mercapto group, an alkoxy group having 1 to 4 carbon `:-atom~ or a monoalkylamino group having 1 to 6 carbon ;.;
atoms;
Y and Z individually represent an oxygen atom or a sulphur atom; --. .:
R1, R2 and ~3 are the ~ame or different and -.
each represents a hydrogen atom, an alkyl group ~ ;
having 1 to 6 carbon atom~ or an aryl group having 6 : :
to 10 carbon atom3 optionally substituted by a ~ubstituent ~elected from the following group of :~
substituent~ ~; and . ~ .
D and ~ individually repre~ent a re~idue .

, . . ~
.' ' . ;','~ :

:
2~t~3bS~3 indepen~ently ~elected from the following group of substituents ~ in regpective nucleotide units, with the proviso that m = 0 when k = 0, and the base sequence containing B i8 the base sequence complementary to a partial tumour gene or ~iru9 gene;
~ : ' Sub~tituents ~:
~ : -hydroxy groups, alkyl groups having 1 to 6 carbonatom~, alkoxy groups ha~ing 1 to 6 carbon atoms, methylenedioxy groups, nitro group~, azide groups, halogen atom~, aryl groups having 6 to 10 carbon atoms, aryloxy group~ having 6 to 10 carbon a~oms and aralkyloxy group~ in which the aryl moiety ha~ from 6 to : ~ .
10 carbon atom~ and the alkyl moiety has 1 or 2 carbon atom~;

Substituent~ ~:

adenine (A~, guanine (G), cytosine (C) and thymine (T)~
..
In addition, the pre~ent invention relates to an -- antiviral agent and antitumour agent having as its active ingredient a compound of general formula (1), a~ :.
defined above, or a salt thereof.
~ '~
The "base seguence containing B" refers to the following formula:

, , vr .. - .-, , , .. , . - ; ;.;. , . . ., . .. .. , . . .... .. , . i ,.. ,.. . . ... ~. I ., - . :

O ~ 2 7 ~ - 8 - .
2~6~

I
: X- P= o o ,, . __I , "

- - ~. .. :.
:: wherein, when n i~ more than 1, each B may be the same . ~.~
~ or different. .:

: In the above-mentioned general formula (1), examples ~:~ of X in the form of an alkoxy group having 1 to 4 carbon atoms include the methoxy, ethoxy, propoxy, isopropoxy, . :
butoxy, i~obutoxy, s-butoxy and t-butoxy groups;
preferably the methoxy and ethoxy groups.
' ''~-"", : : In the above-mentioned general formula (1), examples j - of X in the form of a mo~oalkylami.no group having from 1 ~`
to 6 carbon atom~ include the methylamino, ethylamino, ~ propyl~mino, isopropylamino, butylamino, i~obutylamino, .
I s-butylamino, t-butylamino, pentylamino, isopentylamino, . . .
2-methylbutylii~mino, neopentylamino, 1-ethylpropylamino, hexylamino, 4-methylpentylamino, 3-methylpentylamino, . : :
2-methylpentylami~o, 1-methylpentylamino, 3,3-dimethylbutylamino, 2,2-dimeth~lbutylamino, ; .
dimethylhutylamino, 1,2-dimethylbutylamino, ~::
1,3-dimethyibutylamino, 2,3-dimethylbutylamino and :. .
2-ethylbutylamino groups; preferably 3uch groups having . from 1 to 4 carbon atoms, and more preferably the ethylamino, propylamino and butylamino groups.

Z ' -.' ' ' , ' .

In the above-mentiOned general formula (1), exampleg of R1, R2 and R3 in the form of alkyl groups having from 1 to 6 carb~n atom~ include the methyl, et~yl, propyl, isopropyl, butyl, isobutyl, s-butyl, t-butyl, pentyl, isopentyl, 2-methylbutyl, neopentyl, 1-ethylpropyl, hexyl, 4-methylpentyl, 3-methylpentyl, 2-methylpentyl, 1-methylpantyl, 3,3-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbu~yl, 1,2-dimethylbutyl, : 1,3-dimethylbutyl, 2,3-dimethylbutyl and 2-ethylbutyl groups, and preferably tho~e having from 1 to 4 carbon atoms.

In the above-mentioned general formula (1), examples :
of Rl, R2 and R3 in the fonm of aryl group3 :
include the phenyl, 1-naphthyl, 2-naphthyl, 1-anthryl and 2-anthryl group~, pre$erab1y the phenyl and naphthyl group~, and more preferably a phenyl group.
:
In the above-mentionad general formula (1), examples of R1, R2 and R3 in the form of alkyl group3 having from 1 to 6 carbon atom~ a~ ~ub~tituted portions of aryl groups include the methyl, ethyl, propyl, . :
isopropyl, butyl, isobutyl, 3-butyl, t-butyl, pentyl, isopentyl, 2-methylbutyl, neopentyl, 1-ethylpropyl, hexyl, 4-methylpentyl, 3-methylpe~tyl, 2-methylpentyl, 1-methylpentyl, 3,3-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl, 1,Z-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl and 2-ethylbutyl group3, preferably such groups having from 1 to 4 carbon atoms, and more preferably the i~opropyl and t-butyl groups.

In the above-mentioned general formula (1~, example3 of R1, R~ and R3 in the form of alkoxy group3 having from 1 to 6 carbon atoms ae ~ub~tituted portions of aryl group3 include the methoxy, ethoxy, propoxy, i~opropoxy, butoxy, i~obutoxy, s-butoxy, t-butoxy, pentoxy, i~opentoxy, 2-methylbutoxy, neopentoxy, ,. . .

2~ ;3~

hexyloxy, 4-methylpen~oxy, 3-methylpentoxy, 2-methylpentoxy~ 3~3-dimethylbutoxY~ 2,2-dimethylbutoxy, 1,1-dimethylbutOxy/ 1,2-dimethylbutoxY, 1,3-dimethylbutoxy and 2,3-dimethylbuto~y groups, preferably ~uch groupg having 1 to ~ carbon atoms, and more preferably the methoxy and ethoxy groups. ~
:'.; .' In the above-men~ioned general formula (1), examples of R1, R2 and R3 in the form of halogen atoms as ~ubstituent~ of aryl groups include the fluorine, chlorine, bromine and iodine atoms, and preferably the fluorine, chlorine and bromine atoms.

In the above-mentioned general formula (1), examples of R1, R2 and R3 in the form of aryl groups having from 6 to 10 carbon atoms a~ sub~titue~t~ of aryl groups include the phenyl, 1-naphthyl, 2-naphthyl, 1-anthryl and 2-anthryl group~, preferably the phenyl and naphthyl group~, and more preferably the phenyl group.
~.
In the above-mentioned general formula ~1), examples of Rl, R2 and R3 in the form of aryloxy groups having from 6 to 10 carbon atoms a3 substituents of aryl group~ include the phenyloxy, 1-naphthyloxy, 2-naphthyloxy, 1-anthryloxy and 2-anthryloxy groups, and preferably the phenyloxy and naphthyloxy groups.

In tha above-mentioned general formula (1), examples of R1, R2 and R3 in the form of aralkyloxy groups with an aryl moiety having from 6 to 10 carbon atom~ and an alkyl moiety ha~ing 1 or 2 carbon atoms, which groups are substituents of aryl group~, include the phenylmethyloxy, phenethyloxy, 1-naphthylmethyloxy, 2-naphthylethyloxy and 2-anthrylmethyloxy groups, an~
preferably the phenylmethyloxy and naphthylmethyloxy group-. :

, ' .. ,.,, ,.,. ,,,,.,.,.. ,.. ,, .. , . ,.. ~........... .

O ~ 2 7 2~&~
In the above-mentioned general formula (1), n is preferably 8 to 29, and more preferably 13 to 18-In the above-mentioned general formula (1), k is preferably 0 to 15, and more pre~erably 0 to 12.

In the above-mentioned general formula (1), while the base sequence contai~ing B include~ all base sequences, provided that they are se~uences complementary to a virus gene or tumour gene, preferable examples of ~aid sequence are as listed below.

(1) A base ~equence of 9 to 30 base~ complementary to all or a part o~ a nucleotide se~uence including ba~e number 7947 to base number 7975 of the HIV gene ~Nature 313, 450-458 (1985)]; and (21 A base ~equence o~ 14 to 19 bases complementary to all or a part of a nucleotide seq~lence including base number 7947 to ba~e number 7975 of the HIV gene. --In addition, (3) the base seguence containing B i9 a base sequence of 9 to 30 ba~es com~lementary to all or a part of a region of 30 nucleotide~ spanning a particular nucleotide which i~ les~ than 30 nucleotides from a translation -~
initiation site in a tumour gene;
(4) the baae se~uence containing ~ i~ a ba~e sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which i~
less than 30 nucleotides from a translation initiation site in a tumour gene;
(5) the base sequence containing ~ i9 a base sequence of 9 to 30 ba~es complementar~ to all or a part of a region ' ', . ~ '' ', . " ' , ' " ' ' . . . ..

of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumor gene;
(6) the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 cucleotides from a translation initiation site in a tumour gene;
(7) the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or part of a region of 30 nucleotides spanning a particular nucleotide which is a single base site in a tumour gene;
(8) the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is a single base site in a tumour gene;
(9) the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes; and, (10) the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes.
In the above-mentioned general formula (1), preferred compounds include:
2) A compound wherein:
k is 0 to 20, 2~9~J~
m is 0 or 1, n i9 4 to 29, ~:~
X is a hydroxy group, Y is an oxygen or a sulphur atom, Z i9 an oxygen or a ~ulphur atom, R1, R2 and R3 are the same or dif~erent and each represent~ a hydrogen atom, an alkyl group having 1 to 6 ~arbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents ~; and the base sequence containing B is a base sequence complementary to a tumour gene or a virus gene;

Substituents a: .
: ' hydroxy group~, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, .
aryloxy groups ha~ing 6 to 10 carbon atoms and aralkyloxy group~ with an aryl mo.iety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon ~ .:
atoma.

3) A compound wherein:
k is O to 15, m i9 o or 1, j n is 8 to 29, ;~
~:: X is a hydroxy group, a methyl group, a mercapto ~ group, a~ alkoxy group having 1 to 4 carbon atom~ or a i monoalkyl amino group ha~ing 1 to 6 carbon atoms, Y i~ an oxygen or a sulphur atom, Z i9 an oxygen or a sulphur atom, R1, R2 and R3 are the ~ame or diff~rent and each represents a hydrogen atom, an alkyl group having 1 ~o 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally ~ubstituted by a substituent selected .
~-.

,: . . . . .
,... , , . : . ~ . ,: .:

O ~ 2 7 : ~ ~
~ - 14 -2 1~ 3 6 ~i 8 from the following group of substituents a; and :
the base se~uence containi~g B i~ a base sequence complementary to a tumour gene or a VirU9 gene;

Substituents a: ~ ~
' ' .
hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy group~, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy group~ with an aryl moiety having 6 to 10 -~
carbon atom~ and an alkyl moiety having 1 or 2 carbon atoms.
' ' 4) A compound wherein:
k is O to 15, m is O or 1, ~ i9 8 to 29, X i3 a hydroxy group, Y is an oxygen or a ~ulphur atom, Z i~ an oxygen or a ~ulphur atom, Rl, R2 and R3 are the ~ame or different and each repreRents a hydrogen atom, an alkyl group having 1 to 6 carbon atom3 or an aryl group having 6 to 10 carbon atom~ optionally sub~tituted by a ~ub~tituent sélected from the following group of ~ubstituents a; and the base sequence containing B is a ba3e sequence -~
complementary to a tumour gene or a virus gene;
Sub~tituent~ a hydroxy groups, alkyl group~ having 1 to 6 carbon atoms, alkoxy groups ha~ing 1 to 6 carbon atoms, - ~
methylenedioxy groups, nitro groups, azide groups, : ~:
halogen atoms, aryl group~ having 6 to 10 carbon atoms, aryloxy group~ having 6 to 10 carbon atoms and ', ~ 15 -2 ~ 9 ~
aralkyloxy groups with an aryl moiety having 6 to 10 carbon atom~ and an alkyl moiety having 1 or 2 carbon atom~.

5) A compound wherein:
k is O to 12, m is O, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group ha~ing 1 to 4 carbon atoms or a monoalkyl amino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z i8 an oxygen or a sulphur atom, Rl, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 .
to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally 3ub~tituted by a substituent selected from ~he following group of ~ubstituents a; and ~:
the base ~equence containing B is a biase sequence complementary to a tumour gene or a virus gene;

Substitue~

hydroxy groups, alkyl groups having 1 to 6 carbon atom~, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups haviny 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atom~ and aralkyloxy group~ with an aryl moiety having 6 to 10 carbon atom~ and an alkyl moiety having 1 or 2 carbon atoms.

6) A compound wherein:
k is 0 to 12, m i9 0 or 1, n is 13 to 18, X is a hydroxy group, .

,. .', ;, ,. , , : , ' , , O ~ 2 7 ~ 1 6 7 8 ~ :

Y i5 an oxygen or a sulphur atom, Z i~ an oxygen or a sulphur atom, R1, R2 and R3 are the 9ame or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atom9 or an aryl group having 6 to 10 carbon :
atoms optionally substituted by a substituent selected from the following group of substituen~ ~; a~d the base seguence containing ~ i~ a base sequence complementary to a tumour gene or a viru~ gene;

Sub~tit~ents a:
,~
hydroxy group~, alkyl groups having 1 to 6 carbon atom~, alkoxy group~ having 1 to 6 carbon atoms, met~ylenedioxy groups, nitro groups, azide group~, halogen atoms aryl groups having 6 to 10 carbon atoms, aryloxy group~ having 6 to 10 carbon atoms and aralkyloxy group~ with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety ha~ing 1 or 2 carbon .
atoms.

7) A com~ound wherein:
k is 0 to 12, m i~ O or 1, n i~ 13 to 18, X is a hydroxy group, Y i9 an oxygen atom, Z i~ an oxygen atom, Rl, R2 and R3 are the same or dif~erent and each repre~ent~ a hydroge~ atom, an alkyl group having 1 ~ ;;
to 4 carbon atoms or an aryl group having 6 to 10 carbon `~
atom~ optionally substituted by a substituent selected from the following group of ~ubstituents '; and the base sequence containing B is a base 3equence complementary to a tumour gene or a viru~ gene; ~ .
"' '' "

" ,~"." " ,'.. ,;;." ",, ", ,, "-" , ;.,,,~

2 ~ 9 ~
Substituent~

hydroxy groups, alkyl group5 having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl group~, phenyloxy group3, phenylmethyloxy groups and naphthylmethyloxy groups.

8) A compound whexein: :
k is 0 to 12, :
m i~ O or 1, r-n i9 13 to 18, X is a hydroxy group, Y i~ an oxygen atom, :
Z i~ an oxygen atom~ .
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atom~, or a phenyl group optionally ~ubstituted by a substituent selected from the following group of substituents a; and the base sequence containing B is a ba~e ~equence complementary to a tumour gene or a virus gene;
Substituents a ~:

methyl groups, ethyl group~, propyl groups, t-butyl groups, methoxy groupe, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy group~.

9) A compound wherein:
k is ~ to 20, m i9 0 or 1, n i5 4 to 29, X i~ a hydroxy gxoup, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, OE a monoalkylamino group having 1 to 6 carbon atom~, Y i9 an oxygen or a sulphur atom, Z i9 an oxygen or a 3ulphur atom, : .... . . ; . . , . ., . ~ .. .

:. , . : .. . : , ... .. .. . .

2 a ~ 8 : ~
Rl, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atom3 optionally substituted by a ~ubstituent selected from the followiny group of substituents ~; and the base sequence containing B is a base ~equence of 9 to 30 ba9es complementary to all or a part of a nucleotide ~equence including bai~e number 7947 to base .
number 7975 of the HIV gene;
~' Substituent~
,' hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy group3 having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups ha~ing 6 to 10 carbon atom~
aryloxy group~ having 6 to lQ carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon :~
atoms.

lO).A compound wherein~
k i~ 0 to 20, ~
m is 0 or 1, -n i9 4 to 29, : X is a hydroxy group, Y is an oxygen or a sulphur atom, Z i~ an oxygen or a ~ulphur atom, Rl/ R2 and R3 are the same or different and each represent~ a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl groups having 6 to 10 1 ;
carbon atoms optionally substituted by a sub~tituent selected from the following group of subi~tituents x; ~:
and - .
the baae sequence containing B i~ a ba2e sequence of 9 to 30 ba~es complementary to all or a part of a nucleotide sequence including base number 7947 to base : .

....

O ~ 2 7 2096~a8 number i975 of the HIV gene; -: , Substituents ~
.
hydroxy groups, alkyl grOUp5 having l to 6 carbon atom~, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro group~, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atom and an alkyl moiety having 1 or 2 carbon atoms.
11) A compound wherein:
k i~ O to 15, m is O or 1, n i9 8 to 29, X i9 a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkyl~mino group having 1 to 6 carbon atoms, Y i8 an oxygen or a sulphur atom, Z i9 an oxygen or a sulphur atom, R1, R2 and R3 are the ~ame or different and each represents a hydrogen atom, an alk~1 group ha~ing 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally sub~titu~ed ~y a sub9tituent selected from the following group o~ substituents ~; and the base ~equence containing B i~ a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequence including ba~e number 7947 to base number 7975 of the HIV gene;

Sub~ituents a:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, O ~ 2 7 ~ 20 -2 ~ 9 ~ ~ S 8 halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
12) A compound wherein:
k is O to 15, m i~ O or 1, n i~ 8 to 29, ~;:
X i9 a hydroxy group, Y i9 an oxygen or a 3ulphur atom, -':
Z i9 an oxygen or a sulphur atom, Rl, R2 and R3 are the same or di~ferent and :.
each repre~ents a hydrogen atom, an alkyl group having 1 to 6 carbon atom~ or an aryl group having 6 to 10 carbon atoms optionally sub~tituted by a substituent selected ~:
from the following group of ubi3tituents a; and the base sequence containing B is a base sequence of ::
9 to 30 basPs complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the ~IV gene;

Substituents a: ;
. ' hydroxy groups, alkyl group having 1 to 6 carbon atoms, alkoxy group having 1 to 6 carbon atome, methylenedioxy groups, nitro sroups, azide group~, halogen atomi~i, axyl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and . .
aralkyloxy group~ with a~ aryl moiety having 6 to 10 carbon atoma and an alkyl moiety having 1 or 2 carbon atom~.
: ~
13) A compound wherein~
k i~ O to 12, .
m i~ 0, ~. .

. . . , , , . , . , ,. . , , ,, ,, , . ,. . . ,, ;.. ,.. . . , ., :

O ~ 2 7 2 ~

n iB 13 ~0 18, X i9 a hydro~y group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atom~, Y i9 an oxygen or a sulphur atom, Z is an oxyge~ or a sulphur atom, R1, R2 and R3 are the ~ame or di~erent and each repre9ent9 a hydrogen atom, an alkyl group having 1 to 6 carbon atom9 or an aryl group having 6 to 10 carbon ~ :
atoms optionally substituted by a substituent selected from the following group of sub~tituents ~; and -~he ba~e ~equence containing B is a base ~equence of 9 to 30 ba3es complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HI~ gene;

Substituent~ a:

hydroxy group , alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, : --methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group3 having 6 to 10 carbon atoms, ~.
aryloxy groups having 6 to 10 carbon a~oms and aralkyloxy groups with an aryl moiety having 6 ~o 10 carbon ato~ and an alkyl moiety having 1 or 2 carbon atoms.
14) A compound wherein:
k is 0 to 12, m i~ O or 1, n i9 13 to 18, X i~ a hydroxy group, Y i9 an oxygen or a sulphur atom, Z i~ an oxygen or a sulphur atom, R1, R2 and R3 are the ~ame or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon :, : . . :,;~
,.~ . , . . ,, . ... : .: , , O ' 2 7 r atoms optionally substituted by a substituent selected -~
from the following group of substituents ~; and the base seguence containing B i9 a base sequence of g to 30 bases complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents a:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy group~ having 1 to 6 carbon atom~
methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 caxbon atom~ and an alkyl moiety having 1 or 2 carbon atoms.
15) A compound wherein:
k i~ O to 12, -m is O or 1, n i9 13 to 18, .;~:
X is a hydroxy group, ~ :
Y is an oxygen a~om, :. .
Z i9 an oxygen atom, ~. .
Rl, R2 and R3 are the same or different and each represent~ a hydrogen atom, an alkyl group having 1 to 4 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally sub~tituted by a substituent selected .
from the following group of substituents a '; and the base sequence containing 8 i9 a base sequence of . ~:
9 to 30 bases complementary to all or a part of a nucleotide ~equence including base number 7947 to base number 7975 of the HIV gene; :
.'~ ".

O ~ 2 7 213~) 6 ~ ~ 8 Substituents a ~

nydroxy groups, alkyl group9 having 1 to 4 carbon atom3, alkoxy groups having 1 to 4 carbon atoms, phenyl groupsj naphthyl group~, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.
16) A compound wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y i9 an o~ygen atom, Z is an oxygen atom, Rlj R2 and R3 are the same or different and each repre~ents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally 3ubstituted by a substituent ~elec~ed from thé following group of ~ub,3tituent9 ~"; and the base sequ~nce containing B i9 a base sequence of 9 to 30 ba~es complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituent~ a 1' methyl groups, ethyl gxoup~, propyl group~, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
17) A compound wherein: .
k iis 0 to 20, m is 0 or 1, n i8 4 to 29, X i~ a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atom~, or a :
monoalkylamino group having 1 to 6 carbon atoms, " . , .
2~9~6~
Y i~ an oxyyen or a ~ulphur atom, Z i~ an oxygen or a sulphur atom, R1, R2 and R3 are the ~ame or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of sub~tituents ~; and the base se~uence containing B i~ a base sequence of 14 to 19 base~ complementary to a par~ of a nucleotide .
seque~ce including base number 7947 to base number 7975 of the HIV gene; .

: Substi~uents_~:

hydroxy group~, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, ~ ~ .
halogen atoms, aryl group~ having 6 to 10 carbon atoms, axyloxy groups having 6 to 10 carbon atom~ and -~
aralkyloxy group~ with an aryl moiety having 6 to 10 . :
carbon atom~ and an alkyl moiety having 1 or 2 carbon :
atom~
18~ A compound wherein~
k is 0 to 20, m i~ 0 or 1, i n is 4 to 2g, X is a hydroxy group, Y is an oxygen or a ~ulphur atom, Z i~ an oxygen or a sulphur atom, R1, R2 and R3 are the ~ame or different and each represents a hydrogen atom, an alkyl group having 1 ~:
to 6 carbon atom~ or an aryl group having 6 to 10 carbon atoms optionally sub~tituted by a ~ubstituent ~elected from the following group of sub~tituents a; and the ba~e se~uence containing B is a base sequence of :
14 to 19 ba~e~ complementary to a part of a nucleotide ";,, , ,, ;,~ ";~ ,,., ":~,."' - 20~v6~
including base number 7947 to base number 7975 of the HIV gene;

Substituents ~:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having l to 6 carbon atoms, methylenedioxy groups, nitro group~, azide groups, halogen atom~, a~yl groups ha~ing 6 to 10 carbon atoms, aryloxy groups ha~lng 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 tp 10 carbon atoms and an alkyl moiety havi~g 1 or 2 carbon atoms.
19) A compound wherein-k is 0 to 15, m i~ O or l, ~ is 8 to 29, X i9 a hydroxy group, a methyl group, a mercapto group, an alkoxy group having-1 to 6 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a ~ulphur atom, Z i9 an oxygen or a sulphur atom, Rl, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atom~ or an aryl group having 6 to 10 carbon atom~ op~ionally ~ubY~ituted by a subs~ituent ~elected from the following group of ~ubstituents a; and the base ~equence containing B i9 a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to ba~e number 7975 of the HIV gene;

Substituents ~:

hydroxy groups, alkyl groups having 1 ~o 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, ,,, .,: , .. : , , , ,,.,, :.. ,,, . .. : .. , ... . ., ~ ., .. , ., . ", 6~3 8 methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with ~n aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
- .
20) A compound wherein:
k is O to 15, m i~ O or 1, n is 8 to 29, X i9 a hydroxy group, . ~-Y i9 an oxygen or a sulphur atom, Z i8 an oxygen or a sulphur atom, : -~
Rl, R2 and R are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon a~om~ or an aryl group having 6 to 10 carbon atom3 optionally substituted by a substituent selected from the following group of sub~tituents a; and the base ~equence containing B i9 a base sequence o~ ~ -14 to 19 bases complementary to a part of a nucleotide se~uence including base number 7947 to ba~e number 7975 : :
of the HIV gene;
Su~stituçn~s a:

hydroxy group~, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atom~, :
methylenedioxy groups, nitro groups, azida groups, halogen atoms, aryl group~ having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atom~ and an alkyl moiety having 1 or 2 carbon atom~
. .
21) A compound wherein:
k i~ O to 12, O ~ 2 7 ~ - 27 -209~8 m is 0, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto gxoup, an alkoxy group having 1 to 4 carbon atoms, or a monoalky~amino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, Rl, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atom9 or an aryl group having 6 to 10 carbon atom~ optionally ~ub~tituted by a substituen~ selected from the following group of substituents a; and the base ~equence containing ~ i~ a base sequence of 14 to 19 bases complementary to a par~ of a nucleotide ~equence including base number 7947 to ba~e number 7975 of the ~IV gene;

Sub~tituçnts ~

hydroxy groups, alkyl group~ having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atom~, methylenedioxy groups, nitro groups, azide groups, halogen atom~, aryl group~ having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atom~ and an alkyl moiety having 1 or 2 carbon atoms.
22) A compound wherein:
k is ~ to 12, m is O or 1, n is 13 to 1~, X iY a hydroxy group, Y i~ an oxygen or a ~ulphur atom, Z i~ an oxygen or a sulphur atom, Rl, R2 and R3 are the ~ame or different and each represents a hydrogen atom, an alkyl group having 1 ~ 28 ~ 20~

to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents ~; and the base ~equence containing B i8 a base sequence of 14 to 19 base3 complementary to a part of a nucleotide seguence including base number 7947 to base number 7975 -~
of the HIV gene; ~

Substituents a: :
. ' hydroxy gxoup3, alkyl groups having 1 to 6 carbon atoms, alkoxy group~ having 1 to 6 carbon atoms, methylenedioxy groups, nitro group~, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy group~ with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atom~.
, 23) A compound wherein:
k is O to 12, m is O or 1, n is 13 to 18, ::
X is a hydroxy group, Y i~ an oxygen atom, Z i~ an oxygen atom, R1, R2 and R3 are the ~ame or different and each reprei~ent~ a hydrogen atom, an alkyl group ha~ring 1 to 4 carbon atoms or an aryl group ha~ing 6 to 10 carbon ;~
atom~ optionally substituted by a substituent selected : :
from the following group of subYtituents a '; and the base sequence containing B is a ba e sequence of 14 to 19 ba~e~ complementary to a part of a nucleotide 3e~uence including base number 7947 to base number 7275 of the HIV gene; : ;

'~, , , s 2~9~3l~

Sub~^tituents a~

hydroxy group~, alkyl groupS having 1 to 4 carbon atom~, alkoxy group~ having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.
24) ~ compound wherein:
~ is 0 to 12, m i8 0 or 1, n i~ 13 to 18, X i9 a hydroxy group, Y iis an oxygen atom, Z i~ an oxygen atom, Rl, R2 and R3 are the same or different and ~ach represents a hydrogen atom, an alkyl group having to 4 carbon atoms, or a phenyl group optio~ally sub~tituted by a substituent select~d from the following group of subs~ituents "; and the ba~e sequence containing B is a base ~equence of 14 to lg bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HI~ gene;
, Sub~tituen~s a methyl group~, ethyl groups, propyl groups, t-butyl group~, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy group~.
25) A compound wherein~
k is 0 to 20, ~ ;
m i9 0 or 1, n is 4 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms or a mo~oalkylamino group having 1 to 6 carbon atoms, :.
";, 30- 209G6~8 - -.
.
Y is an oxyge~ or a sulphur atom, Z i9 an oxygen or a sulphur atom, Rl, R2, and R3 are the ~ame or different and ~
each represents a hydrogen atom, an alkyl yroup having 1 ~ :
to 6 carbon atom~ or an aryl group having 6 to 10 carbon .
atoms optionally substituted by a gubstituent selected -~.
from the following group of substi~uent3 a; and :
tha base sequence containing B i~ a base sequence of -~
9 to 30 bases complementary to all or a part of a region of 30 nucleotides ~panning a particular nucleotide which ~::
is less than 5 nucleotides ~rom a tranelation initiation site in a tumour gene;
':
Sub~tituents a: -' ~ ' hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, :
halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atom~ and an alkyl moiety having 1 or 2 carbon atoms. i~
;;
26) A compound wherein: :
k is 0 to 20, m is 0 or 1, n i8 4 to 29, X i9 a hydroxy group, Y is ~n oxyge~ or a sulphur atom, Z i8 an oxygen or a sulphur atom, Rl, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group ha~ing 6 to 10 car~on atoms optionally substituted by a substituent selected :
from the following group of substituents ~; and the base sequence containing B i~ a base ~equence of : .

~, . . ,. . , .. , , . . ., . . . , .. ,. ." .. , . ... , .. " . .. ~ .. . - . . . . . .

.

~ - 31 -2~9~6~8 9 to 30 bases complementary to all or a part of a region of 30 nucleotide3 spanning a particular nucleotide which is less than 5 nucleotideg from a translation initiation site in a tumour ~ene;
Substituent~ a:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atom3, aryl groups ha~ing 6 to 10 carbon atoms, aryloxy groups ha~ing 6 to 10 carbon atoms and aralkyloxy group~ with an aryl moiety ha~ing 6 to 10 carbon atom~ and an alkyl moiety having 1 or 2 carbon atoms.
:
27) A compound wherein:
~ is O to 15, m i9 0 or 1, n is 8 to 29, X is a hydroxy group, a methyl group, a mercapto . :- -group, an alkoxy group having 1 to 4 carbon atom~, or a monoalkylamino group having 1 to 6 carbon atom~, :
Y i~ an oxygen or a sulphur atom, ~ --Z i8 an oxygen or a ~ulphur atom, .:
R1, R2, and R3 are the ~ame or different and ~:
each repre~ents a hydrogen atom, an alkyl group having 1 ~:
to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally ~ubstituted by a sub~tituent selected from the following group of substituents ~; and the base sequence containing B i~ a base ~e~uence of 9 to 30 base~ complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which i~ less than 5 nucleotides from a translation initiation 3ite in a tumour gene:

- 32 - :
2~9~38 Substituents ~:

hydroxy groupY, alkyl group~ having 1 to 6 carbon ~.
atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy group~, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
28) A compound wherein:
k is O to 15, m i9 0 or 1, ::
n is 8 to 29, X i9 a hydroxy group, Y i9 an oxygen or a sulphur atom, Z i~ an oxygen or a ~ulphur atom, -Rl, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1.
to 6 carbon atom~ or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents ; and the base sequence containing ~ i9 a base sequence of .
9 ~o 30 bases complementary to all or a part of a region :~
of 30 nucleotides spanning a particular nucleotide which i9 le~ than 5 nucleotides from a translation initiation site in a tumour gene; ~-Sub~ti~uents ~

hydroxy group~, alkyl group~ having 1 to 6 carbon atom~, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 o 4 2 7 ~ ~ 33 ~ 2 ~ 9 ~ ~ 5 ~

carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
29) A compound wherein:
k is O to 12, m is o, ~ :
n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to ~ carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are ~he same or different and -each represents a hydrogen atom, an alkyl group having 1 :
to 6 carbon atoms or an aryl group ha~ing 6 to 10 carbon :
atoms optionally i~ubs~ituted by a isubstituent selected : :
from the following group of substituents ); and the base sequence containing ~ i9 a base seguence of ~ :
9 to 30 base~ complementary to all or a part of a region of 30 nucleotide~ spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Sub~tituents a: :
~ '' hydroxy groupis, alkyl groups having 1 to 6 carbon atom~, alkoxy groups ha~ing 1 to 6 carbon atoms, methylenedioxy groups, nitro group~, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, ;~
aryloxy groups having 6 to 10 carbon atomis and -~
aralkyloxy groups with an aryl moiety having 6 to 10 ::
carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
, 30) A compound wherein: .
k ii~ O to 12, m i~ O or 1, ~.

. , , O ~ 2 7 2~9~5~ :
n is 13 to 18, X is a hydroxy group, Y i9 an oxygen or a sulphur atom, Z is an o~ygen or a sulphur atom, Rl, R2, and R3 are the same or different and each represents a hydrogen atom; an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent ~elec~ed from the following group of substituents ~; and the base se~uence containing B is a ba~e sequence of 9 to 30 bases complementary to all or a part of a region ~ -of 30 rlucl~otide3 spanning a particular nucleotide which i~ le9~ than 5 nucleotides from a translation initiation ~ite in a tumour gene;

Substituente hydroxy groups, alkyl groupY having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy group~, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy group~ with an aryl moiety having 6 to 10 -:
carbon atom~ and an alkyl moiety having 1 or 2 carbon a~oms. . ~j :
31) A compound wherein: .
k i~ O to 12 J ~ -m l8 0 ox 1, n i~ 13 to 18, :-X is a hydroxy group, Y i9 an oxygen atom, Z i9 an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms or an aryl group having 6 to 10 carbon . :
atoms optionally substituted by a sub~tituent selected ~;

' ' ' ' ' ' ,.'~ '' ' ', `"' " ' ' ' O ~ 2 7 from the following group of substitu2e~t9s~a', and the base seq~ence containing B is a base sequence of 9 to 30 bases complementary to all or part of a region of ~ nucleotides spanning a particular nucleotide which i9 les~ than ~ nucleotides from a translation initiation 8ite in a tumour gene;

Substituents a~:
~ '. ', hydroxy groups, alkyl groups having 1 to 4 carbon atom~, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, . ~:
phenylmethyloxy groups and naphthylmethyloxy groups.
32) A compound wherein~
k is 0 to 12, :~
m i~ O or 1, . .:
n is 13 to 18, X is a hydroxy group, Y i9 an oxygen atom, ~::
. . .
Z i9 an o~ygen atom, :: .
R1, R2, a~d R3 are the same or different and ..
each represents a hydrogen atom~ aIl alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally :: -substituted by a substituent selected from the following group of subs~ituent~ ~"; and ~:
the ba~e Yequence containing B i3 a base sequence of ~-9 to 30 ba~e~ complem~ntary to all or a part of a region of 30 nucleotide~ ~panning a particular nucleotide which i8 le. 8 than 5 nucleotides from a tran~lation initiation site in a tumour gene;
.:
Substituents a " ~
` ' methyl groups, ethyl groups, propyl groups, t-butyl :~
group~, methoxy group~, ethoxy group~, propoxy groups, t-butoxy group~, and phenylmethyloxy group~. :

:- "', :. ' '~' ' ' ' ' . " , ' ' ' ' ' ' ' ' ':' ' ' ' " .,',, ' ''.. ' ~ ';' . .' " . ''i ' ' ': ' ' - 36 ~ 209~B~

3 3 ) A compound wherein:
k i~ O to 2 O, m i~ O or 1, n i~ 4 to 29, - -' X is a hydroxy group, a methyl group, a mercapto :~
group, an alko~y group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to-6 carbon atoms, Y is an oxygen or a ~ulphur atom, Z is an oxygen or a sulphur atom, Rl, R2, and R3 are the same or diEferent and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atom~ or an aryl group having 6 to 10 carbon atoms optionally substituted by a ~ub~tituent selected from the following group of substituents ; and :.
the base sequence containing B is a ba3e sequence of 14 to 19 base~ complementary to a part of a region of 30 nucleotide~ ~panning a particular nucleotide which is ~:
les~ than 5 nucleoti~es from a translation initiation isite in a tumour gene;
.
Substituen~s ~
;
h~droxy groups, alkyl groups having 1 to 6 carbon atom~, alko~y groups having 1 to 6 carbon atoms, methylenedioxy groupi3, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon a~oms, aryloxy group~ having 6 to 10 carbon atoms and ~ :
aralkyloxy group~ with an aryl moiety having 6 to 10 carbon atom~ and an alkyl moie~y having 1 or 2 carbon .:
a~om~. . t ~. -.:
34) A compound wherein: ~ :
k is 0 to 20, m is 0 or 1, n is 4 to 29, X i~ a hydroxy group, . :
Y i~ an oxygen or a ~ulphur atom, :

'~ - 37 -20g6~'j8 Z is an oxygen or a sulphur atom, R , R , and R3 are the same or diffexent and each representS a hydrogen atom, an alkyl group having 1 - ~:
to 6 carbon atomg or an aryl group having 6 to 10 carbon atoms Optionally substituted by a subgtituent selected -from the following group of substituents a; and ~::
the base gequence containing ~ is a base ~equence of :~
14 to 19 ba~es complementarY to a part of a region of 30 nucleotides ~panning a particular nucleotide which i ::
less than 5 nucleo~ides from a translation initiation -.
site in a tumour gene; ~ ~
: , Substituents ~

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, .:
methylenedioxy group~, nitro groups, azide group3, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy group~ having 6 to 10 carbon atoms and aralXylo~y groups with an aryl moiety having 6 to 10 ~ :
carbon atoms and an alkyl moiety ha~ing 1 or 2 carbon atom~.

35~ A compound wherein~
k is 0 to 15, m is O or 1, ~ i9 ~ to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, ox a monoalkylamino group having 1 to 6 carbon atoms, i~ an oxygen-or a sulphur atom, Z is an oxygen or a ~ulphur atom, : .
R1, R2, and R3 are the same or different and :
each represents a hydrogen atom, an alkyl group ha~ing 1 to 6 carbon atom~ or an aryl group having 6 to 10 carbon . ., atoms optionally substituted by a sub~tituent selected :.
from the following group of substituentc ~; and : ., :, :;-.~,:

" ' ' ! ' ' . . , ; . , ~, 2~9~
the ba~e sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a partiCular nucleotide which is less than 5 nucleotides from a tran91a~ion initiation site in a tumour gene; ..

Sub3tituents a:

hydroxy groups, alkyl groups ha~ing 1 to 6 carbon atom~, alkoxy groups having 1 to 6 carbon atoms, - -methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups ha~ing 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.

36) A compound wherei~: :
k is 0 to 15, m is O or 1, .
n is 8 to 29, X i9 a hydro~y group, Y is an oxygen or a sulphur at:om, ::
Z i9 an oxygen or a sulphur atom, Rl, R2, and g3 are the ,~3ame or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group ha~ing 6 to 10 carbon atoms optionally sub~tituted by a 3ubsti~uent selected from the following group of substituent~ ~x; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotldes spanning a particular nucleotide which is le~,s than 5 nucleotides from a trans,lation initiation site in a tumour gene;

,~ - 39 . . . :. ..
209~6~
Substituents ~:

hydroxy groups, alkyl groups having 1 to 6 carbon ~.
atoms, alkoxy groups having 1 to 6 carbon atoms, :
methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, :.
aryloxy groups having 6 to 10 carbon atoms and : -aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms. ~: .
...
37) A compound wherein: ~:
k is 0 to 12, m is O, n i9 13 to 18, - .
X i9 a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a ~ulphur atom, ~:;
Z is an oxygen or a ~ulphur atom, Rl, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 ~:
to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally sub~tituted by a ~ub~tituent selected :~
from the following gxoup of sub~tit:uents ~; and the base sequence containing B i9 a base sequence of 14 to 19 ba~es complementary to a part of a region of 30 nucleotide~ spanning a particular nucleotide which i9 less than 5 nucleotides from a translation initiation site in a tumour gene;
.,,, .: .,.
Substituent9 a ~
.
hydroxy groups, alkyl groups having 1 to 6 carbon~
atoms, alkoxy groups having 1 to 6 carbon atom~, ~
methylenedioxy group~, nitro groups, azide groups, ~ :
halogen atoms, aryl groups having 6 to 10 carbon atoms, .,: .

: - 40 2 0 ~ 8 aryloxy~groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.

38) A compound wherein:
k is 0 to 12, m i~ O or 1, n is 13 to 18, ~ .
X is a hydroxy group, Y îs an oxygen or a sulphur atom, Z i~ an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each repre~ents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group ha~ing 6 to 10 carbon atom~ optionally substituted by a substituent selected from the following group of substituents a; and the base sequence containing B is a base ~equence of 14 to 19 ba~e~ complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which i9 le89 than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents a:

hydroxy groups, alkyl groups having ~ to 6 carbon-atom~, alkoxy groupe having 1 to 6 carbon atoms, methylenedioxy groups, nitro group~, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atom~ and an alkyl moiety having 1 or 2 carbon atom~.
:
39) A compou~d wherein:
~ i~ O to 12, m i~ O or 1, , n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z i9 an oxygen atom, Rl, R2, and R3 are the siame or different and ;i~
each represents a hydrogen atom, an alkyl group having 1 .
to 4 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a sub~tituent selected from the following group of substituents ~; and, the base se~uence containing B i9 a base se~uence of:~
14 ~o 19 bases complementary to a part of a reyion of 30 nucleotides spanning a particular nucleotide which is ~;~
le~s than 5 nucleotides from a tran~lation ini~iation site in a tumour gene;
.' .
Substituents a ': :

hydroxy groups, alkyl groups ha~ing 1 to 4 carbon : ;
atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl group~, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups. ~:

40) A compound wherein: -~.:
k is O to 12, m is O or 1, n is 13 to 18, X is a hydroxy group, ;~
Y is an oxygen atom, :~:
Z i~ an oxygen atom, -~.
Rl, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1~:~
to 4 carbon atoms, or a phenyl group optionally substituted by a ~ubstituent 8elected from the following -group of 8ub3tituents a 1l; and the ba8e sequence containing B is a base seque~ce of 14 to 19 ba~es complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is '' ' ~ ~ .

.:

less than 5 nucleotides from a translation initiation site in a tumour gene;
Substituents .alpha.':
methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-buoxy groups and phenylmethyloxy groups.
41) A compound wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, x is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hrdrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene;
Substituents .alpha.:
hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylendioxy groups, nitro groups, azide gorups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy group with an aryl moiety having 6 to 10 .. . .
2 0 9 v ~
carbon atoms and an alkyl moiety having ~ or 2 carbon atoms .
;""'"
42) A compound wherein: :
k is 0 to 20, m i~ 0 or 1, n is 4 to 29, X is a hydroxy group, Y i3 an oxygen or a sulphur atom, Z i~ an oxygen or a 9ulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 aarbon atoms or an aryl group having 6 to 10 carbon atom~ optionally isub~tituted by a substituent selected from the following group of substitue~t a; and the base sequence containing B i~ a base sequence of ~:
9 to 30 base~ complementary to all or a part of a region .
of 30 nucleotide~ ispanning a particular nucleotide which is less than 5 nucleotides ~rom a ~ingle base site in a.: :
tumour gene;

Subgtituents a~

hydroxy groups, alkyl group~ having I to 6 carbon :-atomi3, alkoxy group~ having 1 to 6 carbon atom~
methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy group~ having 6 to 10 carbon atoms and aralkyloxy group~ with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety ha~ing 1 or 2 carbon atom~

43) A compound wherein~
k i~ 0 to 15, m ii3 0 or 1, n i~ 8 to 29, X is a hydroxy group, a methyl group, a mercapto i .

O ~. 2 7 ~ - 4~ -209~
group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atom Y ifs an oxygen or a 9ulphur atom, Z i9 an oxygen or a sulphur atom, Rl, R2, and R3 are the sfame or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of ~ubstituents f~; and ~he base sequence containing E~f ig a bafe sequence of 9 to 30 ba3es complementary to all or a part of a region of 30 nucleotifdefs spanning a particular nuclf~ffotide which i9 less than 5 nucleotides from a single base site in a tumour gene;

Substituents :

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and . :
aralk~loxy groups wi~h an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atomsO

44) A compound wherein:
~ i9 0 to 15, m is 0 or 1, n i9 8 to-29, X is a hydroxy group~ ' Y i~f an oxygen or a sulphur atom, Z iS an oxygen or a ~ffUlphUr atom, R1, R2, and R3 are the ~ame or different and each repreeffents a hydrogen atom, an alkyl group having 1 to 6 carbon atomfef or an aryl group having 6 to 10 carbon atom~ optionally subetituted by a eubetituent selected :':

', " i ~ . - " ; ' . ! . . ' ' ,' . . . . ..

_~ 45 2~9S~78 from the following group o~ substituents ~; a~d, the base sequence containing B is a base sequence of g to ~0 bases complementary to all or a part of a region of 30 nucleotide~ spanning a particular nucleotide which i~ less than 5 nucleotides from a single base site in a tumour gene;
Sub~tituents ~:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms,~
methylenedioxy groups, nitro groups, azide groups, i.
halogen atoms, aryl group3 having 6 to 10 carbon atoms, aryloxy grol-ps having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atom~ and an alkyl moiety having 1 or 2 carbon atoms.
.'' .
45~ A compound wherein~
k is 0 to 12, :~
m i9 O, n i8 13 to la, X i~ a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y i~ an oxyg n or a ~ulphur atom, :
~ i8 an oxygen or a sulphur atom, Rl, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 ;
to 6 carbon atoms or an aryl group having 6 to 10 carbon -atoms optionally substituted by a ~ub~tituent selected :
from the following group of substituents ~; and -.
the ba~e sequence containiny B is a base sequence of 9 to 30 base3 complementary to all or a part of a re~ion o~ 30 nucleotides spanning a particular nucleotide which i8 less than 5 nucleotides from a single base site in a tumour gene;.

~ - 46 -2 09 ~ 6 ~ ~
Sub~tituents ~:

hydroxy groups, alkyl group9 ha~ing 1 to 6 carbon atom~, alkoxy groups having 1 to 6 carbon atoms, methylen~dioxy groups, nitro groups, azide groups, halogen atoms, aryl group~ having 6 to lo carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy group9 with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms .

46) A compound wherein:
k is O to 12, m is O or 1, n is 13 to 1~, X is a hydroxy group, Y i~ an oxygen or a ~ulphur atom, Z is an oxygen or a sulphur atom, Rl, R2, and R3 are the same or different and each repre~ents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally sub~tituted by a subetituent selected from the following group of substituents a; and the ba3e sequence containing E3 is a base sequenc2 of 9 to 30 baseis complemen~ary to all or a part of a region of 30 nucleotidei~ spanning a particular nucleotide which is less than s nucleotides from a single base site in a tumour gene;

Substituents a:
~ ~ .
hydroxy groupi~, alkyl group~ having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy group~, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy group~ having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 .~.:. .
, , - ~7~ 9 ~ ~ ~ 8 - ~

carbon atoms and an alkyl moiety having 1 or 2 carbon atomis.
.:
47) A compound wherein:
k is 0 to 12, -m i9 0 or 1, ~
n i9 13 to 18, .
X i9 a hydroxy group, Y i9 an oxygen atom, Z is an oxygen a~om, Rl, R , and R are the same or different and each xeprese~t~ a hydrogen atom, an alkyl group having 1 to 4 carbon atoms or an aryl group having 6 to 10 carbon ~ ~
atoms optionally substituted by a substituent selected ~-from the following group of sub~tituents ~'; a~d, : ~
the base sequence containing B i8 a base sequence of ~ ~ -9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotide~ from a single base site in a ;;~
tumour gene;
. . ':
Substituents ~
,' hydroxy groups, alkyl groups ha~ing 1 to 4 carbon atoms, alkoxy groupi~ having 1 to 4 carbon atoms, phenyl groups, ~aphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.
"
48) A compound wherein~
k is 0 to 12, m i8 0 or 1, n i~ 13 to 18, :
X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the isame or different and each represents a hydrogen atom, an alkyl group having 1 -,, O ~ 2 7 2 ~ 9 ~ 6 ~ ~
to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents ~"; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotide9 fxom a single base site in a tumour gene;

Substituents a ~:
. ~
methyl groups, ethyl group~, propyl groups, t-butyl groups, methoxy grollp~, ethoxy groups, propoxy group~, t-butoxy groups and phenylmethyloxy groups.

49) A compound wherein- ~
k is 0 to 20, ~ :
m i~ 0 or 1, ~ :
n is 4 to 29, : ~:
X is a hydroxy group, a methyl group, a mercapto ~:-group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamiino group having 1 to 6 carbon atoms, Y i9 an oxygen or a sulphur atom, Z i9 an oxygen or a sulphur atom, Rl, R2, and R3 are the same or different and each represent a hydroge~ atom, an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon ~ ~
atoms optionally substitu~ed by a substituent selected - .~:
from the following group o~ sub~ti~uent~ a; and the ba~e ~equence containing ~ i9 a base ~equence of ~:
14 to 19 ba~es complementary to a part o~ a region of 30 nucleotide~ spanning a particular nucleotide which i8 less than 5 nucleotides from a single base site in ras and c-myb tumour genes; -: ~' ,.
:.

:" , . , , '" ' '' , ' . ' . , ' " ,:', . ' ', ' . .'`, :, ',' ' " . ' '; .` . ",: ' '' O ~ 2 7 . 49 20966~8 .
Substituen~ts~:

hydroxy groupi~, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atom~ and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.

50) A compound wherein:
k i~ 0 to 20, m i8 0 or 1, n i5 4 to 29, :
is a hydroxy group, Y i9 an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, Rl, R2, and R3 are the ~ame or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atom3 or an aryl group having 6 to 10 ~arbon ~:
atoms optionally ~ubstituted by a substituent selected from the ~ollowi~g group of subitituents ~; and the base ~equence contiaining B i9 a baee sequence of :-14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is le~s than 5 nucleotide~ from a ~ingle base site in ras and c-myb tumour gene~
Substituents ~:

hydroxy group~, alkyl groupe having 1 to 6 carbon atoms, alkoxy group~ having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, - ..
halogen atom~, aryl groups ha~ing 6 to 10 carbon atom~, arylo~y group~ having 6 to 10 carbon atom~ and aralkyloxy groups with an aryl moiety having 6 to 10 O ~ 2 7 ~ 50 ~ 2~66S~

carbon atoms and an alkyl moiety having 1 or 2 carbon atoms .

51) A compound wherein:
k is O to 15, m is 0 or 1, n is ~ to 29, X i9 a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, : :
Y is an oxygen or a sulphur atom, Z i~ an oxygen or a sulphur atom, Rl, R2, and R3 are the same or different and :. .
each repre~ents a hydrogen atom, an alkyl group having 1 ~o 6 carbon atom~ or an aryl group having 6 to 10 carbon ~: -atom~ optionally sub~tituted by a substituent selected from the following group of ~ub~tituents ~; and the ba~e ~equence containing B is a base sequence of ~:~
14 to 19 ba~es complementary to a part of a region of 30 :;
nucleotide~ spanning a particular nucleotide which i9 la~s than 5 nucleotidea from a single base site in ras .
and c-myb tumour genes;

Sub~ituents a ~
.; : :.
: hydroxy groups, alkyl groups ha~ing 1 to 6 carbon atoms, alkoxy groups ha~ing 1 to 6 carbon atoms, methyle~edioxy group~, nitro groups, azide groups, ~ ~ :
~: ~ halogen atoms, aryl group~ having 6 to 10 carbon atoms,: ~:
a~yloxy groups having 6 to 10 carbon atoms and :~
aralkyloxy groups with an aryl moiety having 6 to 10 ~.
carbon atoms and an al~yl moiety having 1 or 2 carbon atoms.

52) A compound wherein: -k is O to 15, m is O or 1, . .
.

O ~ 2 7 - 51 - ~7 n is a to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z i9 an oxygen or a sulphur atom, ::
R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally sub~tituted by a substituent Relected :-from the following group of substituents a; and the base sequence containing B i9 a base sequence of 14 to l9 bases complementary to a part of a region of 30 nucleo~ides spanning a particular nucleotide which is le77 than 5 nucleotide~ from a single base site in ras -.
and c-myb tumour genes; .

SubstituentR ~

hydroxy groups7, alkyl groups having 1 to 6 carbon atoms, alkoxy groups ha~ing 1 to 6 carbon atoms, methylenedioxy groups, nitro group7, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and i :
aralkylo~y groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoma.
.
53) A compound whexein:
k is 0 to 12, m is 0, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atom~, or a monoalkylamino group having 1 to 6 carbon atomR, :
Y i~ an oxygen or a sulphur atom, Z i9 an oxygen or a sulphur atom, `, R1, R2, and R3 are the same or different and '. each represents a hydrogen atom, an alkyl group having 1 ::

i~ , .. .. . . .

~95~8 to 6 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents ; and the hase sequence containing B is a base se~uence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is : :
less than 5 nucleo~ides from a single base site in ras ::
and c-myb tumour genes; --:- . ,: .
Substi.tu nts ~
.~.
hydroxy groups, alkyl groups having 1 to 6 carbon :
atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, -aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon :
atoms.
. :'.: ':
54) A compound wherein:
k is O to 12, ~
m is 0 or 1, :~ ;
n is 13 to 18, X is a hydroxy group, Y is an oxygen or a sulphur atom, z is an oxygen or a sulphur atom, R1, R2, and R3 are the sarne or different and : :
each represents a hydrosen atom, an alkyl group having 1 ::
to 6 carbon atoms or an aryl group having 6 to 10 carbon . :
atoms optionally substituted by a substituent selected from the following group of substituents a; and the base sequence containing ~ i3 a ba3e sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides ~rom a single base site in ra~
and c-myb tumour genes;
.'' ", ~ - 53 -2 0 9 6 6 ;~ 8 Substituents :

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atom3, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, :
aryloxy groups having 6 to 10 carbon atoms and ::
aralkyloxy groups with an aryl moiety having 6 to 10 : :carbon atoms and an alkyl moiety having 1 or 2 carbon atoms. `
~
55) A compound wherein: :
k i~ O to 12, m is O or 1, n is 13 to l~, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected .
from the following group of substituents ~'; and, .
the base sequence containing B i9 a base sequenca of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is le6s than 5 nucleotides from a ~ingle base site in ra~
and c-myb tumour geneR;

Substituents ~

hydroxy groups, alkyl groups having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy group~ and naphthylmethyloxy groups.

.: ' , ' , : .
: ,' ,.', ' ~, . , , ' ' : ~ ` , . .;,' :

, ~ / . : , '.. ' .:. :

~) 4 2 7 2 ~ 9 ~ 6 a 8 - - - ~

56) A compound wherein: : :
k is 0 to 12, m is O or 1, : -.. . . .
n is 13 to 18, ~.
X i9 a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and :
each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atom~, or a phenyl group optionally .~
substituted by a substituent selected from the following : :
group of substituents a "; and - - : :
the base ~equence containing B is a base sequence of . :::
14 to 19 bases complementary to a part of a region of 30 . . .
nucleotides spanning a particular nucleotide which is :-:
less than 5 nucleotides from a single base site in ras and c-myb tumour genes; . ~:~

Substituents x": .
. . .
methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, :t-butoxy groups and phenylmethyloxy groups. ..
.,:
, . 57) A compound wherein: ~;
k is O, m i9 O, X i8 a hydroxy group, Z i5 an oxygen atom, -:::
R1, R2 a~d R3 are the same or different and each represent~ a phenyl group optionally substituted by a substituent selected from the following group of ~::
substituent~ a 1' '; and the base sequence is AGGTGGGTCTGAAAC; ~ .~.

' '-..:
: :.
, , . ~

-~ 2 ~ 9 ~

Substltuents ~

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups. ~, 58) A compound wherein:
k is 0, m is 0, X is a hydroxy group, ~ -Z is an oxygen atom, .
R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of subs~ituent~ a " '; and the base sequence is TCGGGGTTGGGAGGT;
Substituents ~

metho~y groups, ethoxy groups, propoxy groups and t-butoxy groups. ,~

59) A compound wherein:
k is O, m is 0, X is a hydroxy group, Z is an oxygen atom, Rl, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents ~ nd the base sequence is TTGGGAGGTGGGTCT;
Substituents ~"':

methoxy group~, ethoxy groups, propoxy group~ and t-buto~y groups.

., ~ . :, , , ~ : .' , :
.''', . . .' , : ':" ' . ::
', ' ' ,' ' ~' . ' ' ,, ,.",', ", 209~6~8 60) A compound wherein~
k i~ 0, m i~ 0, ~ .
X is a hydroxy group, ~ -~ is an oxygen atom, Rl, R2 and R3 are the same or different and each represent~ a phe~yl yroup optionally ~ubstituted by ~:~
a substituent aelected from the following group of~ ~
substituents ~ n ~; and ~ ~ :
the base sequence is ATACTCAGTCATTTTTAGCAG;

Substituent~ a n ~:

methoxy group3, ethoxy group~, propoxy groups and t-butoxy groups.
.
61) A compound wherein~
- k is 0, m is 0, ~
X i9 a hydroxy group, . -Z i9 an o~ygen atom, Rl, R2 and R3 are the same or different and ~:
each represents a phen~l group optionally substituted by a substituent selected from the following group of ubsti~uents x n~l; and the ba~e sequence i8 ~C~9C ~IL~II9fi~c;

Substituçnts a n~:

: methoxy groups.

62) A compound wherein~
k is 0, :
m is 0, X i9 a hydroxy group, Z i~ an oxygen atom, Rl, R2 and R3 are the same or different and ~ 57 :.
2~96~

each repre~ents a phenyl group optionally substituted by a substituent selected from the following group of substituents a " '; and the ba~e sequence is TGGGTCTGAAACGAT;
Substituents a~l t . ' ' . . ' - ' methoxy groups, ethoxy groups, propoxy groups and t-butoxy group~.
.
63) A compound wherein: - -k i~ 0, .
m is 0, X is a hydroxy group, ;:.:
Z i~ an oxygen atom, ~- :
Rl, R2 and R3 are the ~ame or different and each represents a phenyl group optionally sub3tituted by :~
a sub~tituent selected from the following group of substituents a ~1~; and -; the base sequence is T~GTGGGTcTGAAAc;
': .
Substituents a"'~:
methoxy groups.

6i) A compound wherein:
k is O, m is 0, X i9 a hydroxy group, ~ ;
Z is an oxygen atom, Rl, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of aub3tituents a " '; and the baae sequence i~ GGTGGGTCTGAAAC~;

~ 58 - .:.
20966~ :
Substituents x methoxy groups, ethoxy groups, propoxy groups and :
t-bu~oxy groups. : : :
. .
65) A compound wherein: .
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and :
each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents "'; and .
the base sequence is GGTGGGTTGCTTTGA;

Substituents a ~
" ' ,.
methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups. ~: .

66) A compound wherein~
~ is O, m i9 O, ' ~.
X is a hydroxy group, ;~ .
Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally sub~tituted by a substituent selected from the following group of . ~ :
substituentY "~; and the base sequence is GGAGGTGGGTCTGAA;

Substituentg a " ':

methoxy groups, ethoxy groups, propoxy group~ and :~.
t-butoxy groups. -~

:

'",.''' ':' ' '' , ~ - 59 -20~S6~
67) A compound wherein-k is o, m i9 O, X is a hydroxy group, Z is an oxygen atom, Rl, R2 and R3 are the same or different and each represents a phenyl group optionally sub~tituted by a ~ubstituent selected from the following group of :.
substituents 1~; and the base ~equence is GGGAGGTGGGTCTGA;

Sub~tituents a 1' ':

methoxy group~, ethoxy groups, propoxy groups and t-butoxy group~.

68) A compound wherein:
k is O, m i9 O, X is a hydroxy group, Z i8 an oxygen atom, , R2 and R3 are the same or different and each repre~ent~ a phenyl group optionally subs~ituted by a substituent ~elected from the ~ollowing group of sub3tituents a 1 '; and the ba~e sequence i~ GTTGGGAGGTGGGTC;
. . .
Sub~tituept~ a ~ ':
methoxy groups.

69) A compound wherein:
k is 0, m is O, X i9 a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the ~ame or different and ,: , . . ., . . , ~ , ,:., . :.

2~9~

each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents x'''; and .
the base sequence is GGGTTGGGAGGTGGG;

Substituents ~"': . -.

methoxy groups, ethoxy groups, propoxy groups and ~.
t-butoxy groups. ~:

70) A compound wherein:
k is 0, m i9 0, :~
X is a hydroxy group, Z is an oxygen atom, ~1, R2 and R3 are the same or different and each represent~ a phenyl group optionally substituted by ;
a substituent selected from the following group of !~
3ubstituents ~"'; and the base sequence is TGGGAGGTGGGTCTG; ..

Substituents a " ': . :

methoxy groupe, ethoxy groups, propoxy groups and t-butoxy group~.

71) A compound wherein: .
k is ~
m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the ~ame or different and :
each represents a phenyl group optionally sub~tituted by a substituent selected from the following group of substituents ~"'; and ~ .
the base sequence is TGGGAGGTGGGTCT; ~' ',,, ' .:

._~ O ~ 2 7 - 61 ~ 2 ~9 6~;~ 8 -.

Substituents Y'~
f ~
methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.

72) A compound wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, ~
R1, R2 and R3 are the same or different and ;-each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents a ~ '; and the base sequence is TGGGAGGTGGGTC;

Substituents ~
,.

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.

73) A compound wherein:
k is O, m is O, X i9 a hydroxy group, Z i~ an oxygen atom, R~, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents i"'; and the base sequence i~ TGGGAGGTGGGT;

Substituents "':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
- :

. 2~6~(~ ' '' 74) A compound wherein:
k is 0, m i9 O, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of::
substituents a ~1 '; and the base ~equence is TGGGAGGTGGG; :
' Substituents x''':

methoxy groups, ethoxy groups, propo~y groups and -~
t-butoxy groups.

75) A compound wherein~
k is 0, m is 0, X i~ a hydroxy group, Z i9 an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group opt:ionally substituted by . ~:~
a substituent selected from the ~o:Llowing group of :
substituents ~"'; and the base sequence is TGGGAGGT~ ;

Substituents - .
methoxy groups, ethoxy groups, propoxy groups and .:: : .
t-butoxy groups. ~ -76) A compound wherein: :
k i~ 0, ~ .
m is 0, X is a hydroxy group, Z is an o~ygen atom, `~ -: , O ~ 2 7 2a~66.~
R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents ~"'; and the base sequence is TGGGAGGTG;

Substituents ~

metho.xy groups, ethoxy groups, propoxy groups and t-butoxy groups.

: Preferred compounds of the present invention specifically include those listed in the ~ollowing Table.

In the Table the following abbreviations are used:
.

: Ph represents a phenyl group, Me represent~ a methyl group, ~
Et represents an ethyl group, . ~ -Pr represent~ a propyl group, iPr represents an isopropyl group, tBu represents a tert-butyl group, MDO represents a 3,4-methylenedioxy group, ~y represent~ a phenylmethyl group, NaPh repre~ents a naphthyl group, NaPhme represents a naphthylmethyl group, and dByOBy represents a (3,5-dibenzyloxy)benzyl group.

In the nucleotide sequence portion in the formula (I), .

[1] represent~ AGGTGGGTCTGAAAC (in the text, it is abbreviated as ODN-1), .
[2~ represents TCGGGGTTGGGAGGT (in the text, it i9 abbreviated a~ ODN-21 .:~

: :, ; . , . ., . ~"

,-- ~
~ - 64 -2~9~f~J~ ' [3] represents TTGGGAGGTGGGTCT (in the text, it is abbreviated as ODN-3) -[4] represents ATACTCAGTCATTTTTAGC~G (in the text, it is abbreviated as ODN-4) [5] represents GTGCCGGGGTCTTCGGGC (in the text, it is abbreviated as ODN-5) .:
~6] represents TGGGTCTGA~ACGAT (in the text, it is abbreviated as ODN-6) ~7] represent3 T~AGGTGGGTCTGAAAC (in the text, it i9 abbreviated as ODN-7) : .
[8] represents GGTG GTCTGAAACG tin the text, it is abbreviated as ODN-8) . ;;

[9] representY GGTGGGTTGCTTTGA (in the text, it is abbreviated as ODN-9) :-''';
[10] represents GGAGGTGGGTCTGAA (in the text, it is abbreviated as ODN-10) ~11] represent~ GGGAGGTGGGTCTGA (in the text, it is -.
abbreviated as ODN-ll) [12] represents GTTG~GAGG~ (in the text, it i9 abbraviated as ODN-12) -: ;

[13~ represents GGGTTGGGAr,GTGGG (in the text, it is abbreviated as ODN-13) [14] represents TGGGAGGTGGGT~TG (in the text, it is .:.
abbreviated as ODN-14) :
,;
[15] ~epre~ents TGGGAGGTGGGTCT (in the text, it i9 ~-.' ', 20g~6:~ 8 abbreviated as ODN-15) [a] represents TGGGAGGTGGGTC (in the text, it i8 abbreviated as ODN-16) [b] represents TGGGAGGTGGGT (in the text, it is abbreviated as ODN-17) [c] represents TGGGAGGTGGG (in the text, it is abbreviated as ODN-18) [d] represents _GGAGGTGG (in the text, it is abbreviated a~ ODN-l9) [e] represents TGGGAGGTG (in the text, it is abbreviated :~
as ODN-20) ~1 Z2 1,_r r~ CZ2 ~ z _r,~

X--P= O
` .

~_ .

~ ~ 8 0~
X- P= O
o _ l p 2 0 9 ~

..... _ ..... _ .

No. k m n X Y Z R R2 R3 Seq.
. .. ~

1 0 0 13 OH - O 4-MeOPh 4-MeOPh Ph [I4]
2 0 0 13 OH - O 3-MeOPh 3-MeOPh Ph [14]
3 0 0 13 OH - O 4 MeOPh Ph Ph [14]
4 0 0 13 OH - O 3-MeOPh Ph Ph [14]
0 0 13 OH - O 2-MeOPh Ph Ph [14]
6 0 0 13 OH - O Ph Ph Ph [14]
7 0 0 13 OH - O 4-EtOPh 4-EtOPh Ph [14]
~ 0 0 13 OH - O 3-EtOPh 3-EtOPh Ph [14]
9 0 0 13 OH - O 2-EtOPh 2-~tOPh Ph [14]
0 0 13 OH - O 4-tBuOPh Ph Ph [14]
11 0 0 13 OH - O 3-tBuOPh PH Ph [14]
12 0 0 13 OH - O 2-tBuOPh Ph Ph [14]
13 0 0 13 OH - O 4-tBuOPh 4-tBuOPh Ph [14]
14 0 0 13 OH - O 3-tBuOPh 4-tBuOPh Ph [14]
0 0 13 OH - O 2-tBuOPh 4-tBuOPh Ph [14]
16 0 0 13 OH - O 4-EtPh 4-EtPh 4-EtPh [14]
17 0 0 13 OH - O 3-EtPh 3-EtPh 3-EtPh [14]
18 0 0 13 OH - O 2-EtPh 2-EtPh 2-~tPh [14]
19 0 0 13 OH - O 4-iPrOPh 4-iPrOPh 4-iPrOPh [14]
0 0 13 O~I - O 3-iPrOPh 3 iPrOPh 3-iPrOPh [14]
21 0 0 13 OH - O 4-t~uPh 4-tBuPh Ph [14]
22 0 0 13 OH - O 2-tBuPh 2-tBuPh Ph [14]
23 0 0 13 OH - O MDOPh MDOPh Ph [14]
24 0 0 13 OH - O 4-NO2Ph 4-NO2Ph Ph [14]
0 0 13 OH - O 3-NO2Ph 3-NO2Ph Ph [14]
26 0 0 13 OH O 4-~3Ph Ph Ph [14]
27 0 0 13 OH - O 2-NaPh Ph Ph [14]
28 0 0 13 OH - O 4-N3Ph 4 N3Ph Ph [14 29 0 0 13 OH O 3-N3Ph 4-N3Ph Ph [14]
0 0 13 OH - O 4-BrPh 4-BrPh 4-BrPh [14]
~ .
'. ' 2~9~S~ ~

. . .

No. k m n X Y Z Rl R2 R3 Seq.
. ... . __ 31 0 0 13 OH - O 3-BrPh 3-BrPh 3-BrPh ~14]
32 0 O 13 OH - O Ph Ph H [14]
33 O 0 13 OH - O Ph H H [14]
34 0 0 13 OH - O l-NaPhme H H [14]
35 0 0 13 OH - O 2-NaPhme H H ~14]
36 0 0 13 OH - O 4-BrPh Ph H [14]
37 0 0 13 OH - O -3-BrPh Ph H [14]
38 0 0 13 OH - O 4-IPh 4-IPh Ph [14]
39 0 0 13 OH - O 2-IPh 2-IPh Ph [14] ~ :
O 0 13 OH - O 4-ByOPh 4-ByOPh 4-ByOPh [14 41 0 0 13 OH - O 3-ByOPh 3-ByOPh 3-ByOPh [14]
42 0 0 13 OH - O 2-ByOPh 2-ByOPh 2-ByOPh [14]
43 O 0 13 OH - O dByOBy H H [14]
44 0 0 13 OH - O dByOBy dByOBy H [14]
0 0 13 OH - O Bu CH3 CH3 [14]
46 0 0 13 OH - O Bu Pr CH3 [14]
47 0 0 13 OH - O Bu Bu Et [14]
48 0 0 13 OH - S 4-MeOPh 4-MeOPh Ph [14]
49 0 0 13 OH - S 3-MeOPh 3-MeOPh Ph [14]
O 0 13 OH - S 2-MeOPh 2-MeOPh Ph [14] 5 51 O 0 13. OH - S 4-MeOPh Ph Ph [14]
52 o O 13 OH - S 3-MeOPh Ph Ph [14]
53 0 0 13 OH - S 3-MeOPh Ph Ph [14~ .
54 0 0 13 OH - S Ph Ph Ph [14]
55.i o 0 13 OH - S 4-PrOPh 4-PrOPh Ph ~14]
56 0 0 13 OH - S 3-PrOPh 3-PrOPh Ph [14 57 0 0 13 OH - S 2-PrOPh 2-PrOPh Ph [14] ::
58 0 0 13 OH - S 4-tBuPh 4-tBuPh Ph [14]

' :': "
,~
: ':

~ O ~ 2 7 - 6a ~-~ 9 S ~.

No. k m n X Y Z R R2 R3 Seq.

.
59 0 0 13 OH - S 3-tBuPh 4-tBuPh Ph [14]
0 0 13 OH - S 2-tBuPh 2-tBuPh Ph [14]
61 0 0 13 OH - S MDOPh MDOPh Ph [14]
62 0 0 13 OH - S Ph Ph H [14]
63 0 0 13 OH - S Ph X H [14]
64 0 0 13 OH - S 4-NO2Ph 4-NO2Ph Ph [14]
0 0 13 OH - S 3-NO2Ph 3-NO2Ph Ph [14]
66 0 0 13 OH - S 2-NO2Ph 2-NO2Ph Ph [14]
67 0 0 13 OH - S - 4-IPh 4-IPh Ph [14]
68 0 0 13 OH - S 3-IPh 3-IPh Ph [14]
69 0 0 13 OH - S tBu tBu CH3 [14]
0 0 13 SH - O 4-MePh 4-MePh Ph [14]
71 0 0 13 SH - O 3-MePh 3-MePh Ph [14]
72 0 0 13 SH - O 4-MeOPh Ph Ph [14]
73 0 0 13 SH - O 3-MeOPh Ph Ph [14]
74 0 0 13 SH - O 2-MeOPh Ph Ph [14]
0 0 13 SH - O Ph Ph Ph [14]
76 0 0 13 SH - O 4-PrOPh 4-PrOPh Ph [14]
77 0 0 13 SH - O 2-PrOPh 2-PrOPh Ph [14]
78 0 0 13 SH - O 4-tBuPh 4-tBuPh Ph [14]
79 0 0 13 SH - 0 2-tBuPh 2-tBuPh Ph [14]
0 0 13 SH - O MDOPh M~OPh Ph [14]
81 0 0 13 SH - O Ph Ph H [14]
82 0 0 13 SE - O Ph H H [14]
83 0 -0 13 SH - O 4-NO2Ph 4-NO2Ph Ph~14]
84 0 0 13 SH - 0 3-NO2Ph 3-NO2Ph Ph[14]

0 0 13 SH - O 4-IPh 4-IPh Ph. [14]
86 0 0 13. SH - O 2-IPh 2-IPh Ph [14]
. . .

209~ 8 . _ . ... .

No. k m n X Y Z Rl R2 R3 Seq.

87 0 0 13 SH - O tBu . tBu CH3 [14]
88 0 0 13 CH3 - O 4-MeOPh 4-MePh Ph [14]
89 0 0 13 CH3 - O 3-MeOPh 3-M~Ph Ph [14]
0 0 13 CH3 - O Ph Ph 4-MeOPh [14J
91 0 0 13 CH3 - O Ph Ph Ph [14]
- 92 0 0 13 CH3 - O 4-EtOPh 4-EtOPh Ph [14]
93 0 0 13 CH3 - O 2-EtOPh 2-EtOph Ph ~14]
94 0 0 13 CH3 - 0 4-tBuOPh Ph Ph [14]
0 0 13 CH3 - 0 3-tBuOPh Ph Ph [14]
96 . 0 0 13 CH3 - O 4-tBuOPh 4-tBuOPh Ph [14]
97 0 0 13 CH3 - O 3-tBuOPh 3-tBuOPh Ph [14]
:~ 98 0 0 13 CH3 - O 4-EtPh 4-EtPh 4-EtPh [14]
99 0 0 13 CH3 - 3-EtPh 3-EtPh 4-EtPh [14]
: 100 0 0 13 CH3 - O 2-EtPh 2-EtPh 4-EtPh [14]
101 0 0 13 CH3 - 0 4-iPrOPh 4-iPrOPh 4-iPrOPh [14]
102 0 0 13 CH3 - O 2-iPrOPh 2-iPrOPh 4-iPrOPh [14]
103 0 0 13 PrO - O 4-tBuPh 4-tBuPh Ph ~14~
104 0 0 13 PrO - O 2-tBuPh 2-tBuPh Ph [14]
105 0 0 13 PrO - O MDOPh MDOPhPh [14]
10~ 0 0 13 RrO - O 4-NO2Ph 4-NO2Ph Ph ~14]
107 0 0 13 PrO - O 3-N02Ph 3-NO2Ph Ph [14]
108 0 0 13 PrO - O 4-N3Ph Ph Ph [14]
109 0 0 13 PrO O 2-N3Ph Ph .Ph [14]
110 0 0 13 PrO ~ 3Ph 4 N3Ph Ph [14]
111 0 0 13 PrO - O 2-N Ph 2-N3PhPh [14]
112 0 0 13 PrO ~ O 3 N3Ph 3 N3Ph Ph [14]
113 0 0 13 PrO - O 4-BrPh 4-BrPh4-BrPh [14]
114 0 0 13 PrO - O 3-BrPh 3-B~Ph4-BrPh [14]
115 0 0 13 PrO - O 2-BrPh 2-BrPh4-BrPh [14]
.- .
.. ..

' ' ', ' ,. :' ,: ,'; ~'' 2 ~ 9 ~

No. k m n X Y Z Rl R2 R3 Seq. ~
.: . .
.... - ---116 0 0 13 PrO - O Ph Ph H [14]
117 0 0 13 PrO - O Ph H H [14 118 0 0 13 BuO - O 4-ClPhPh H [14]
119 0 0 13 BuO - O 3-ClPhPh H [14]
120 0 0 13 BuO - O 2-ClPhPh H [14]
121 0 0 13 BuO - O 4-BrPhPh H [14]
122 0 0 13 BuO - O 3-BrPhPh H [14]
123 0 0 13 BuO - O 4-IPh4-IPh Ph ~14]
124 0 0 13 BuO - O 2-IPh2-IPh Ph [14]
125 0 0 13 BuO - O 4-ByOPh 4-ByOPh 4-ByOPh [14]
126 0 0 13 BuO - O 3-ByOPh 3-ByOPh 3-ByOPh ~14]
127 0 0 13 RuO - O 2-ByOPh 2-ByOPh 2-ByOPh [14]
128 0 0 13 EtNH - O 4-MeOPh 4-MeOPh Ph [14]
129 0 0 13 EtN~ - O 2-MeOPh 2-MeOPh Ph [14]
130 0 0 13 EtNX - O 4-MeOPh Ph Ph [14]
131 0 0 13 EtNH - O 3-MeOPh Ph Ph [14]
132 0 0 13 EtNH - O Ph Ph Ph [14]
133 0 0 13 EtNH - O 4-PrOPh 4-PrOPh Ph [14]
134 0 0 13 EtNH - O 3-PrOPh 3-PrOPh Ph [14]
135 0 0 13 EtNH - O 4-tBuOPh 4-tBuOPh Ph [14 . .
136 0 0 13 EtNH - O 2-tBuOPh 2-tBuOPh Ph [14~
137 0 0 13 EtNH - O MDOPhMDOPh Ph [14]
138 0 0 13 EtNH - O Ph Ph H [14]
139 0 0 13 EtNH - O Ph HH . [14]
140 0 0 13 PrNH - O 4-NO2Ph 4-NO2Ph Ph [14]
141 0 0 13 PrNH - O 3-NO2Ph 3-NO2Ph Ph [14]
142 0 0 13 PrNH - O 4-IPh4-IPh Ph [14]
143 0 0 ~3 PrNH - O 2-IPh2-IPh Ph [14~
144 0 0 13 PrNH - O 4-tBuPh tBu CH3 [14]
,, ~

: .
; . .

O ~ 2 7 20~6~

.

No. k m n X Y Z Rl R2 R3 Seq.

1450 0 13 PrNH - O 3-tBuPh tBu CH3 [14]
14615 0 13 OH - S H H H [14]
14712 0 13 OH - S Ph Ph Ph [14]
1486 0 13 OH - S Ph Ph H [14]
1496 0 13 OH - S PH Ph 4-MeOPh[14]
1506 0 13 OH - S Ph Ph 2~-MeOPh[14]
15115 0 13 SH - S H H H [14]
15212 1 13 OH O S Ph Ph Ph [14]
15312 1 13 OH O S 4-MeOPh 4-MeOPh Ph [14]
15412 1 13 OH O S 3-MeOPh 3-MeOPh Ph [14]
15510 1 13 OH O S Ph Ph . H [14]
15610 1 13 SH O S Ph Ph Ph [14]
1576 1 13 SH O S Ph Ph 4-MeOPh[14]
1586 1 13 SH O S Ph Ph 3-MeOPh[14]
1596 1 13 SH S S Ph Ph H [14]
16012 1 13 CH3 S Ph Ph Ph [14]
16112 1 13 CH3 S 4-BuPh 4-BuPh Ph [14]
16212 1 13 CH3 S 3-BuPh 3-BuPh Ph [14]
16312 1 13 OBu O S Ph Ph Ph [14]
16412 1 13 OMe O S Ph Ph H [14]
16512 1 13 OMe O S Ph Ph Ph [14]
1666 1 l NHB~ O S Ph Ph Ph [14~
1676 1 13 NHBu O S Ph Ph Ph [14]
16~6 1 13 SH O S 4-MeOPh 4-MeOPh Ph [14]
1696 1 13 SH O S 2-MeOPh 2-MeOPh Ph [14]
1700 0 13 OH - O 4-MeOPh 4-MeOPh Ph [1]
1710 0 13 OH - O 4-MeOPh 4-MeOPh Ph ~2]
1720 0 13 OH - O 4-MeOPh 4-MeOPh Ph [3]
1730 0 13 OH - O 4-MeOPh 4-MeOPh Ph ~ [4 1740 0 13 OH - O 4-MeOPh 4-MeOPh Ph [5 ' .

.

, ' . . .
~ . . . .
- ~ :

0 4 2 7 : . ' , ~ - 7 2 - ~
2096&~

.. . .
..
No. k m n X Y Z Rl R2 R3 Seq.
- :.. ;.
.
1750 0 13 OH - O 4-MeOPh 4-MeOPh Ph [6]
1760 0 13 OH - O 4-MeOPh 4-MeOPh Ph [7]
1770 0 13 OH - O 4-MeOPh 4-MeOPh Ph [8]
1780 0 13 OH - O 4-MeOPh 4-MeOPh Ph [9]
1790 0 13 OH - O 4-Me~Ph 4-MeOPh Ph ~10]
1800 0 13 OH - O 4-MeOPh 4-MeOPh ~h [11]
1810 0 13 OH - O 4-MeOPh 4-MeOPh Ph [12]
1820 0 13 OH - O 4-MeOPh 4-MeOPh Ph [13]
1830 0 13 OH - O Ph Ph Ph [1]
1840 0 13 OH - O Ph Ph Ph ~2]
1850 0 13 OH - O Ph Ph Ph [3]
1~60 0 13 OH - O Ph Ph Ph [4]
1870 0 13 OH - O Ph Ph Ph [5]
1880 0 13 OH o Ph Ph Ph [6]
1890 0 13 OH - O Ph Ph Ph [7]
1900 0 13 OH - O Ph Ph Ph [8]
1910 0 13 OH - O Ph Ph Ph [9]
192~ 0 0 13 OH o Ph Ph Ph [10]
1930 0 13 OH - O Ph Ph Ph [11]
1940 0 13 OH - O Ph Ph Ph [12]
1950 0 13 OH - O Ph Ph Ph [13]
1960 0 13 OH - O 4-MeOPh 4-MeOPh Ph ~15]
1970 0 13 OH - O 4-MeOPh 4-MeOPh Ph ~a]
1980 0 13 OH - O 4-MeOPh 4-MeOPh Ph [b]
1990 0 13 OH - O 4-MeOPh 4-MeOPh Ph [c]
2000 0 13 OH - O 4-MeOPh 4-MeOPh Ph [d]
~010 0 13 OH - O 4-MeOPh 4-MeOPh Ph [e]
2020 0 13 OH - O Ph Ph Ph [15]
2030 0 13 OH - O Ph Ph Ph [a~

2 0 9 6 ~ ~ 8 No. k m n X Y Z __ R3 Seq.

204 0 0 13 OH o Ph Ph Ph [b]
205 0 0 13 OH - O Ph Ph Ph [c]
206 0 0 13 OH - O Ph Ph Ph [d]
. 207 0 0 13 OH - O Ph Ph Ph ~e~

.
', ~
More preferred compounds are 1, 3, 6, 20 32, 33, 35, 43, 45, 46, 47, ~, 54, 6~, 69, 70, 75, 81, 82, a7, 88, - :
91, 128, 132, 147, 153, 157, 159, 160, 165, 166, 168, -170, 17~, 172, I73, 175, 180, 181, 182, 183, 196, 197, 198, 199, 200, and 201. :
, . .
The most preferred compounds are: ~.

5'-0-~4,4'-dimethoxytrityl)-TGGGA~TGGGTCT (Compound ~.
Number 1), .

5'-0-(4-methoxytrityl)-TGGGAGGTGGGTCTG (Compound Number ~: 3~
.: ~
: S'-O-trityl-TGGGAGGTGGGTCTG (Compound Number 6), , .
' .'~
5'-O-diphenylmethyl-TGGGAGGTGGGTCTG (Compound Number 32), ;:::
~, :
5'-O-phenylmethyl-TGGGAGGTGGGTCTG (Compound Number 33), :~

5'-0-(2-naphthylmethyl)-TGGGAGGTGGGTCTG (Compound Number .
35), ~ ~ ~-5~-o-[(3l5-dibenzyloxy)benzyl]-TGGGAGGTGGGTcTG (Compound ..
Number 43), . -, ~ - 7~
2 ~9 ~

5'-S-diphenylmethyl-TGGGAGGTGGGTCTG (Compound Number 62) 5'-S-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTCTG (Compound Number 70), 5'-S-trityl-TGGGAGGTGGGTCTG (Compound Number 75), 5'-0-(4,4' dimethoxytrityl)-AGGTGGGTCTGAAAC (Compound Number 170), ~;

5'-0-(4,4'-dimethoxytrityl)-TCGGGGTTGGGAGGT (Compound Number 171), ~
" ~' 5'-0-(4,4'-dimethoxytrityl)-TTGGGAGGTGGGTCT (Compound ;, Number 172), :~

5'-0-(4,4'-dimethoxytrityl)-ATACTCAGT,CATTTTTAGCAG ~
(Compound Number 173), -5'-0-(4,4'-dimethoxytrityl~-TGGGTC,TGAaACGAT ~Compound Number 175), ~-5'-0-~4,4'-dimethoxytrityl~-GGGAGGTGGGTCTGA (Compound Number 180), :.

5'-0-(4,4~-dimethoxytrityl)-GTTGGGAGGTGGGTC (Compound ~
Number 181), ,.
'' ~ .' 5'-0-(4,4'-dimethoxytrityl)-GGGTTG,GGAGTGGGG (Compound Number 182), a~d -,: , 5'-O-trityl-TGGGAGGTGGGTCTG (Compound Number 183), .. ~, 5'-0-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTCT (Compound~.
Number 196), , 5'-O-~4,4'-dimethoxytrityl)-TGGGAGGTGGGTC (Compound ~. ','' ', ." ~ ' ' ~" ' . ' .'. ,',' . ~ . .''; ' ' '.' , ~ " ' , ' ,. . i ' . . ., ; . .' ` " ,', ': , ' , .

2 ~ 9 ~
Number 197), 5~-0-(4,4'-dimethoxytri tyl)-TGGGAGGTGGGT (Compound Number 198), 5'-0-(4,4'-dimethoxytrityl) -TGGGAGGTGGG (Compound Number 199 ), 5'-0-(4,4'-dimethoxytrityl) -TGGGAGGTGG (Compound Number ;~-~
200), - : -. .
5~-0-(4,4~-dimethoxy~ri tyl)-TGGGAGGTG (Compound Number 201). ~
....".
The compound of the present invention of general formula (1), as defined above, can be used in the form of a salt. Examples of suitable salts include inorganic or organic salts, including alkali metals, such as ;~
~odium and potassium; alkaline earl:h metals, such as calcium; ammonia; basic amino acids, such as lysine and arginine; and alkylamines, such as triethylamine.
Preferred such salts are the salts with alkaline metals, such as the sodium and pota3sium salts.

The compound of general formula (1) of the present invention can be manufactured u~ing Compound (2): ~ ;
,, ~
... ..
D ~ .
R2 _ C ~ y 3 ,, ( CH2 ~ Z ~0 R~
(2 ) HO

which is prepared according to Proce~se~ A-1, A-2, A-3 and A-4, Process B, C or D when X in general formula (1) is a hydroxy group, Process E when X i~ general formula (1) i8 a methyl group, Process F when X in general .
.

~ 76 -2~9~ 8 formula (1) is a iaulphydryl group, Process G when X in general formula (1) is an alkoxy group having from 1 to 6 carbon atoms, and Process H when X in general formula (1) is a monoalkylamino group having from 1 to 6 carbon atoms.

In Compound (2), R1, R2, R3, Y, Z, m and k have the same meanings as given for these groups in connection with the g~neral formula (1), while D' represents a base selected from the following group or a protected homologous base.
:
~ Substituents ~: ~
, adenine ~A), guanine (G), cytosine (C) and thymine (T). ~
:,. :
In Proces~ B:

(a) a 3~-phosphorous acid derivative prepared by reacting a phosphitylating agent with Compound (2); and (b) [1] an oligodeoxynucleotide (hereinafter to be abbreviated as l'ODN"), produced by synthesis with a DNA
syn~hesiser using a nucleotide wherein the basic portion and phosphate portion are protected with protecting groups, and then elimination of the 5~-terminal dimethoxytrityl group only, which ODN is coupled to controlled pore glass (hereinafter to be abbreviated as "CPG"~ or [2] an ODN having a free hydroxy group on its 5'-terminal, which is synthesised by a liquid phase technique, u~ing a nucleotide wherein the basic portion and phosphate portion are protected with protecting groups; are (c) condensed using a condensing agent to form ..
tripho~phite bonds; followed by ,:
(d) oxidising to the triphosphate using an oxidising agent or, when coupled to CPG, severing the ODN using ', '.

_ - 77 -20~6~

ordinary techniques to eliminate the protecting groups;
and (e) purification by ordinary purification techniques to obtain the desired compound.

In Process C:

~a) a 3' phosphoric acid derivative prepared by reacting a phosphorylating agent with Compound (2); and ::~
~b) [1] an ODN, produced by synthesis with a DNA :
synthesiser using a nucleotide wherein the basic portion - :
is protected with protecting groups, and then -. :
elimination o~ the 5'-terminal dimethoxytrityl group ~ -only, which ODN is coupled to CPG or [2~ an ODN having a free hydroxy group on its 5'-terminal, which is ~ :
synthesised by a liquid phase technique, using a nucleotide wherein the basic portion is protected with a protecting group; are (c) condensed using a condensillg agent to form phosphodiester or phospho~riester bonds; and then :-(d) the protecting groups other than the substituent bonded to the 5' carbon a~oms of the 5'-terminal are : :
.. . .
eliminated, after severing the ODN using ordinary techniques when it is coupled to CPG; followed by (e) purification by ordinary purification technigues to obtain the desired compound. -- :

In Process D:
~ .
a) a 2'-deoxypho~phonic acid deri~ative, wherein if an amino group is present in the basic portion of the 2' deoxynucleotide, the amino group is protected with a protecting group, the desired substituent is introduced to the 5'-position, and a pho~phonate group is introduced to the 3'-position; and (b) [1] an ODN produced by synthesis with a DNA
synthesiser, using a nucleotide wherein the basic - ~ -"". ..

~ 2 07~

portion is protected with protecting groups such as an acyl group, from which only the 5'-terminal dimethoxytrityl group is eliminated, which ODN is coupled to CPG, or [2] an ODN having a free hydroxy group on its 5'-terminal, which i9 synthesised by a liquid phase technique using a nucleotide wherein the basic portion is protected with protecting groups; are (c) oxidised by reaction with an acid halide in the presence of a base to form phosphodiester or ~.
phoi~photriester bonds; followed by (d) elimination of the protecting groups, after severing the ODN using ordinary technigues when it is coupled to CPG; and :
(e) purification by ordinary purification techniques to obtain the desired compound.
: ' The following provide3 a detailed description of Processes A to H.

In the reaction schemes of Processes A to H, R1, R2, R3, Y, Z, m, k, B, D, n and D' have the same -meanings as defined above, while Hal represents a halogen atom,`B' represents a bas~ selected from the .
following group of substcituents ~, or a protected homologous base, A1 represents a protecting group of a hydroxy group or mercapto group, and A2 represents a protectiny group of a hydroxy group; .

Substituents ~:

adenine (A), guanine (G), cytosine (C) and thymine (T).

-`" 2 0 ~ 8 Proce: A

This process is for preparing a nucleotide ~:
intermediate (2) to serve as the 5'-terminal of the compound of the present invention. :.

.'" '.

.:

...
, ~"~

~ - 80 -20~6~
Process A- 1 ~
, Step 1 A Z ~

HO HO :
(3) (4) :-:

Step 2 , Step 3 ~

A2 0 A2 0 ' ; .
( 6 ) ~::
~ 5 ) ( 6 ) P ¦ N2_C--~y ~, ( CH2~H~e R3 ( 1 1 ) r --R2 _ C ~ y _~~ CN2 ~ Z ~

:
( 7 ) A10 Step 5 ¦

RI :
R2 _ Iy ),,, ~ CH2 )k 2 0 ¦ ;~
R3 ~ ~ .
~ : -HO
(2) O ~ 2 7 2 ~ 8 .
Process A-1 is composed of Step 1 to Step 5.

Step 1:

This step is for preparing Compound ~4~, in which only the hydroxy group at the 5'-position is selectively .
protected by reacting a hydroxy group protecting reagent -:
with Compound (3) in an inactive solvent [provided that .~:
the acylation pro~ecting process for those amino groups ~ :
present is included in the previous stage when the base portions are A, G and C. The protecting process~can be easily carried out according to known method-[J. Am.
Chem. Soc., 104, 1316 (1982)]. Lower aliphatic acyl or :
aromatic acyl groups are generally used for the protecting groups of the amino groups. Examples of those lower aliphatic acyl groups used include the ~ .
formyl, acetyl t propionyl, butyryl, isobutyryl, pentanoyl, pi~aloyl, vaIeryl and isovaleryl groups and examples of suitable aromatic acyl groups include the -~
benzoyl, ~-acetoxybenzoyl, 4-methoxybenzoyl, 4-methylbenzoyl and 1-naphthoyl groups. It is preferred to use benzoyl groups when the base portion is A or C, and isobutyryl groups when the ba~e portion is G.
. .. .. .
The solvent which may be used preferably includes aromatic hydrocarbons, such as benzene, toluene and -.
xylene; halogenated hydrocarbons, such as methylene chloride, chloroform, carbon tetrachloride, ~;
dichloroethane, chlorobenzene and dichlorobenzene; `~
esters, such as ethyl formate, ethyl acetate, propyl ~ :-acetate, butyl acetate and diethyl carbonate; ethers, such as diethyl ether, dii~opropyl ether, tetrah~drofuran, dioxane, dime~hoxyethane and diethylene glycol dimethyl ether; ketone~, such as acetone, methyl ethyl ketone, methyl isobutyl ketone, isophorone and cyclohexanone; nitro compounds, such as nitroethane and ::.
nitrobenzene; nitriles, such as acetonitrile and -, .',, ' .

isobutyronitrile; amides, such as formamide, dimethylformamide, dimethylacetamide and hexamethylphosphorotriamide; sulphoxides, such as dimethyl sulphoxide and sulpholane; aliphatic tertiary amines, such as trimethylamine, triethylamine and N-methylmorpholine; and aromatic amines, such as pyridine and picoline; more preferably halogenated hydrocarbons (particularly methylene chloride) and amides (particularly DMF).

There are no particular restrictions on the`
protecting reagent used, provided that it is able selectively to protect the 5'-position only and that it can be eliminated under acidic or neutral conditions.
Preferred such reagents include triarylmethyl halides, such as trityl chloride, monomethoxytrityl chloride and dimethoxy~rityl chloride.

A base is usually used when using a triarylmethyl halide as the protecting reagent.

Examples of bases that are used include heterocyclic amines, such as pyridine, dimethylaminopyridine and pyrrolidinopyridine; and aliphatic tertiary amines, such as trimethylamine and triethylamine; preferably organic bases ~particularly pyridine, dimethylaminopyridine and pyrrolidinopyridine).

When organic amines are used as the solvent, there is no need to add another acid acceptor, since the organic amine itself functions as an acid acceptor.

While the reaction temperature varies depending on the starting material, reagent, solvent, etc. employed, it i9 usually 0 to 150C, and preferably 20 to 100C.

While the reaction time varies depending on the ~' ' , . . : ' ' ~ :, ',, ' . ;~ , , ' ' . '' :, ' : ', O ~ 2 7 6 ~

starting material, solvent and reaction temperature used, it is usually 1 to 100 hours, and preferably 2 to 24 hours.

After completion of the reaction, for example, the solvent is distilled off and the reaction mixture is poured in water, made acidic with inorganic acids, such as hydrochloric acid and sulphuric acid, extracted with a water-immiscible solvent such as benzene, ether and ethyl acetate, followed by evaporation of the solvent -from the extract. The product obtained in this manner i5 usually used as such in the subsequent step. If desired, the product can be purified by isolation and by various chroma~ographic techniques or by recrystallisation.

Step 2:
. ., ~
This step is for preparing Compound (5) by reacting Compound (4) with a protecting reagent for hydroxy group in an inert solvent.

The solvent used preferably includes aromatic -;
hydrocarbons, such as benzene, toluene and xylene;
halogenated hydrocarbons, such as methylene chloride, chloroform, carbon tetrachloride, dichloroethane, chlorobenzene and dichlorobenzene; esters, such as ethyl formate, ethyl acetate, propyl acetate, butyl acetate and diethyl carbonate; ethers, such as diethyl ether, diisopropyl ether, tetrahydrofuran, dioxane, dimethoxyethanè and diethylene glycol dimethyl ether;
alcohols, such as methanol, ethanol, propanol, isopropanol, butanol, isobuta~ol, t-butanol, isoamyl alcohol, diethylene glycol, glycerol, octanol, ~
cyclohexanol and methyl cellosolve; ketones, such as acetone, methyl ethyl ketone, methyl isobutyl ketone, isophorone and cyclohexanone; nitro compounds, such a~

O ~ 2 7 2 0 9 ~
nitroethane and nitrobenzene; nitriles, such as acetonitrile and isobutyronitrile; amides, such as formamide, dimethylformamide, dimethylacetamide and hexamethylphosphorotriamide; sulphoxides, such as dimethyl sulphoxide and sulpholane; and more preferably halogenated hydrocàrbons (particularly methylene chloride), aromatic hydrocarbons (particularly toluene) and amides ~particularly D~F).

The choice of protecting reagent employed is not particularly limited, as long a~ it can deprotect all groups except the 5~-position, and examples preferably include silyl halides, such as t-butyldimethylsilyl chloride; haloalkoxycarbonyl halides, such as trichloroethoxycarbonyl chloride; and aralkyloxycarbonyl halides, such as benzyloxycarbonyl chloride.

When the silyl halides, haloalkoxycarbonyl halides and aralkyloxycarbonyl halides are used as the protecting reagent, bases are usually used.

The base used preferably includes organic bases (particularly triethylamine, pyridine, N methylmorpholine, DBU, etc.).

While the reaction temperature varies depending on the reagent, starting material, solvent, etc. employed, it is usually -20 to 150C, and preferably -10 to 50C.

While the reaction time varies depending on the starting material, solvent and reaction temperature employed, it is usually 1 to 100 hours, and preferably 1 to 24 hours.
, ~
After completion of the reaction, for example, the solvent i9 distilled off and the reaction mixture i9 ' poured in water, made acidic with inorganic acids, such , ~ - 85 ~96~8 ''. ~' ' '.:
as hydrochloric acid and sulphuric acid, extracted with a water-immiscible solvent such as benzene, ether and ethyl acetate, followed by evaporation of the solvent from the extract. The product obtained in thi~ manner is usually used as such in the subsequent step. If desired, the product can be purified by isolation and by various chromatographic techniques or by recrystallisation.

Step 3: ~

This step is for preparing Compound (6) by reacting a deprotecting reagent with Compound (5) in an inert solvent to eliminate selectively the hydroxy group at the 5'-position.

The solvent used preferably includes aromatic hydrocarbons, such as benzene, toluene and xylene;
halogenated hydrocarbons, such as methylene chloride, chloroform, carbon tetrachloride, dichloroethane, ~-chlorobenzene and dichlorobenzene; esters, such as ethyl formate, ethyl acetate, propyl acetate, butyl acetate and diethyl carbonate; ethers, such as diethyl ether, ~-diisopropyl ether, tetrahydrofuran, dioxane, dimethoxyethane and diethylene glycol dimethyl ether;
alcohols, such as methanol, ethanol, propanol, i~opropanol, butanol, isobutanol, t-butanol, isoamyl alcohol, diethylene glycol, glycerol, octanol, cyclohexanol and methyl cellosolve; ketones, ~uch as acetone, methyl ethyl ketone, methyl isobutyl ketone, isophorone and cyclohexanone; nitro compounds, such as nitroethane and nitrobenzene; nitriles, such as acetonitrile and isobutyronitrile; amides, such as formamide, dimethylformamide, dimethylacetamide and - -hexamethylpho~phorotriamide; and sulphoxides, such as dimethyl sulphoxide and sulpholane; and more preferably alcohols (particularly methanol and ethanol).

~09~5~
The choice of deprotecting reagent to be used is not particularly limited, as long as it is normally used for that purpose, and includes, for example acetic acid, trifluoroacetic acid and hydrochloric acid methanol when the protecting group is a triarylmethyl group, and preferably acetic acid and trifluoroacetic acid.

While the reaction temperature varies depending on the reagent, starting material, solvent, etc. employed, it is usually -10 to 100C, and preferably 0 to 50C.

While the reaction time varies depending on the starting material, solvent and reaction temperature employed, it i9 usually 1 to 50 hours, and preferably 1 to 24 hour~.

After completion of the reaction the solvent is, for example, distilled off and the reaction mixture is poured in water, made acidic with inorganic acid~, such as hydrochloric acid and sulphuric acid, extracted with a water-immiscible solvent such as benzene, ether and ethyl acetate, followed by evaporation of the solvent from the extract. The product obtained in this manner is usually used as such in the subsequent step. If desired, the product can be purified by isolation and by various chromatographic techniques or by recrystallisation.
~ Y~d ~
Step ~:

This step is for preparing Compound (7) by reacting Compound (~) with Compound (11) (in the formula, Hal represents a halogen atom) in an inert solvent and in the presence of a base.

The halide portion of Compound (11) employed includes chlorine, bromine and iodine, and preferably ~ - 87 -~ ~ 9 ~
chlorine and bromine.

The base employable preferably includes organic bases (particularly triethylamine, pyridine, N-methylmorpholine, DBU, etc.) -., , While the reaction temperature is not particularly limited, it is usually 0C to 100C, and the reaction is ~
carried out preferably at 50C. -While the reaction time is usually from 5 minutes to 30 hours, the reaction completes in 10 hours when it is carried out at 50C'C.

After completion of the reaction, the reaction mixture i9, for example, appropriately neu~ralised or, ~ -if insolubles exist therein, they are removed by filtration. Then, an organic water-immiscible solven~
such as ethyl acetate i9 added to the filtrate, followed by washing with water. The organic layer containing the desired compound i9 separated and dried over anhydrous magne,ium sulphate, followed by evaporation of the solvent to give the desired compound.

The desired compound obtained in this manner can further be purified by conventional procedures, such as recrystallisation, reprecipitation, chromatography, etc., if desired.

Step 5:

This step is for preparing Compound (2) by reacting a deprotecting agent with Compound (7) in an inert solvent .

1) In the case where a ,ilyl group is used as the 3'-poaition protecting group, it i9 usually removed by " ~ ' ' ; '; '~ ' ' ! ; . , O ~ 2 7 r~ - as ; 6 treating with a compound which forms a fluorine anion, such as tetrabutylammonium fluoride.

While the choice of solvent to be used is not particularly limited, unless it inhibits the reac~ion, it pre~erably includes ethers, such as tetrahydrofuran and dioxane.

While the reaction temperature is not particularly limited, it is usually -30C to 100C, and the reaction i8 carried out preferably at O~C to 30C.

While the reaction time i~ u~ually from 5 minutes to 30 hours, the reaction completes in 10 hours when it is carried out at 20C.

After com~letion of the reaction, the reaction mixture is, for example, appropriately neutralised or, if insolubles exist therein, they are removed by filtration. Then, an organic water-immiscible solvent such as ethyl acetate is added to the filtrate, followed by wa~hing with water. The organic layer containing the de~ired compound is separated and dried over anhydrous mag~e~ium sulphate, followed by evaporation of the - `
solvent ~o give the desired compound.

The desired compound obtained in this manner can further be purified by conventional procedure such as recrystallisation, reprecipitation, chromatography, etc., if desired. ~-' ' ~ .
2) When a haloalkoxycarbonyl group is used as the ~ ~-3'-position protecting group, zinc powder i9 usually u~ed. -'. .' . .
While the choice of solvent to be used is not particularly limited unles~ it inhibits the reaction, it :~
, . i~
~ ' ' O ~ 2 7 ~~ - 89 -2~966;~

preferably includes acetic acid, alcohols and a mixture of water and these solvents.

While the reaction temperature is not particularly limited, it is usually 0C to 100C, and the reaction is carried out preferably at room temperature.
: : .
While the reaction time is usually from 5 minutes to 30 hours, the reaction completes in 10 houxs when it is carried out at room temperature.
.
After completion of the reaction, the reaction mixture is, for example, appropriately neutralised or, if insolubles exist therein, they are removed by -~
filtration. Then, an organic wa~er-immiscible solvent such a~ ethyl acetate i8 added to the filtrate, followed ~i by washing with water. The organic layer containing the ~ -deYired compound is separated and dried over anhydrous magnesium sulphate, followed by evaporation of the solvent to give the desired compound.

The desired compound obtained in this manner can further be purified by conventional procedure such as xecrystallisation, reprecipitation, chromatography, etc., if desired.
~ '~
3) In the ca~e where an aralkyloxycarbonyl group is used as the ~'-po~ition protecting group, the deprotection i9 usually carried out by catalytic reduction or oxidisation.

While the choice of cataly~t to be used when the catalytic reduction is carried out is not particularly limited, ~o long as it i9 usually used for the catalytic reduction reaction, it preferably include~ palladium carbon, Raney nickel, platinum oxide, platinum black, rhodium-aluminium oxide, triphenylphosphine-rhodium ,, , . i.
'. ~'"

., ,: ' .' ' ' ' . i G ~1 (J

chloride and palladium-barium sulphate~

Whilè the presaure is not particularly limited, the reac~ion is u~ually carried out at 1 to 10 atmospheres.

While the reaction temperature and the reaction time vary depending on the s~arting material and the type of solvent and catalyst, the reaction is usually carried out at 0 ~o 100C for 5 minute~ to 24 hours.

While the choice of solvent to be used in the elimination by oxidi~ation i9 not particularly limited, unle~ it participates in the pre~ent reaction, it i~
preferably a water-containing organic solvent.

Such organic solvents preferably include ketones, such aa acetone; halogenated hydrocarbon~, ~uch as methylene chloride, chloroform and carbon tetrachloride;
nitriles, such as acetonitrile; ethers, such as diethyl ether, tetrahydrofuran and dioxane; amides, 3uch as dimethylformamide, dimethylacetamide and hexamethylpho~phorotriamide; and sulphoxides, such a3 dimethyl sulphoxide.

While the choice of oxidising agent to be u~ed is not particularly limiteds as long as it i~ a compound to be used for oxidi~ation, paotassi ~ ~ersulphate, sodium persulphate, ~Yc~tr~cerium~nitrate (CAN), 2,3-dichloro-5,6-dicyano-p-benzoquinone (DDQ~ are preferably used.

While the reaction temperature and the reaction time vary depending on the starting material, and the type of ~ -~olvent and catalyst, the reaction is usually carried out at 0 to 150C for 10 minute~ to 24 hour~.

Also, the 3'-poaition protecting group can be o ~ 2 7 ~ 2 0 9 ~ ~ 3 ~ ~

eliminated by reacting with an alkali metal, such as metallic lithium and metallic sodium in liquid ammonia, or an alcohol such as methanol and ethanol at -78 to ~
-20C. ~ :
.' , Further, the 3'-position protecting group can be eliminated by using aluminum chloride-sodium iodide or an alkylsilyl halide, such as trimethylsilyl iodide in a solvent.

While the choice of solvent to be used i9 no~
particularly limited, unless it particiates in the present reaction, it preferably include~ nitriles, such as acetonitrile, halogenated hydrocarbons, such as methylene chloride and chloroform, and a mixture of these solvents. ;;

While the reaction temperature and the reaction time ;
vary depending on the type of starting material and solvent, the reaction is usually carried out at 0 to 50C for 5 minutes to 3 days.
:
If the reaction substrate contains a sulphur atom, aluminum chloride-sodium iodide is preferably employed. ~
: .
The reaction mixture is then, ~or example, appropriately neutralised or, if insolubles exist therein, they are removed by filtration. Then, an ;
organic water-immi~cible solvent such as ethyl acetate is added to ~he filtrate, followed by washing with water. The organic layer containing the desired compound is separated and dried over anhydrous magnesium sulphate, followed by evaporation of the solvent to give the desired compound. ~

The desired compound obtained in this manner can further be purified by conventional procedure such as .

',', ''' . . . : '. . , - . ,!, .j;',, ' ', ' ' ;.'.' ' . ! ' ' ' ' ; ' '"

O ~ 2 7 ~ - 92 -i` 2~966~8 recrystallisation, reprecipitation, chromatography, etc., if desired.

Process A-2 HO

Step 6 (1 . , , R I D
. R2--C~Y~ ( CH2 )k Z~~ . :
R3 ~ ~:
~10 :'':,.:
(2) ; -`

~ ~ ' ' ``.''''`'' : ~ , .~' ~' " .
.

' ~' ' ' '~
":~. ':.

~ .

93 ?0966~ig ~-27 Process A- 3 A~ O ~ ~ .
( 6 ) H ~ Y 3,,, -~ CH2 )h Ha ~
Step 7 ( 1 2 ) ~-D' :
HY - ( CH2 ~ Z ~ O

( 8 ) A20 -~
~' ' . .' (1 1) - ' Step 8 -:
R I D
R2--C ~ y ~ CH~ ~ Z ~

,, ( 9 ) A20 ,~
Step 9 : :
' ~,',.. ~
R I D
R2 - C ~ y )m ( CH2 ~ Z ~0~
R3 ~/ ~:
HO :~. -. ( 2 ) : -.

- 9 9~ _ 2096~ 8 Process A-3 consists of Step 7 to Step ~.

Step 7:

This step i~ for preparing Compound ~8) by reacting Compound (6) with Compound (12) in an inert solvent and in the presence of a base.

The halide portion of Compound (11) includes chlorine, bromine and iodine, preferably chlorine and bromine.

The solvent to be used preferably includes aromatic hydrocarbon~, such as benzene, oluene and xylene;
halogenated hydrocarbons, such as methylene chloride, chloroform, carbon tetrachloride, dichloroethane, -chlorobenzene and dichlorobenzene; esters, such as ethyl formate, ethyl acetate, propyl acetate, butyl acetate and diethyl carbonate; ethers, such as diethyl ether, dii~opropyl ether, tetrahydrofuran, dioxane, dimethoxyethane and diethylene glycol dimethyl ether; -~
ketones, such as acetone, methyl ethyl ketone, methyl isobutyl ketone, isophorone and cyclohexanone; nitro compounds, such as nitroethane and nitrobenzene; nitriles, ~uch as acetonitrile and isobutyronitrile; amides, such as formamide, dimethylformamide, dimethylacetamide and ~-hexamethylphosphorotriamide; sulphoxides, such as dimethyl sulphoxide and sulpholane; more preferably ketones (particularly acetone), halogenated hydrocarbons `~
(particularly methylene chloride) and amides (particularly DMF).
,~
The base to be used preferably includes organic bases (particularly triethylamine, pyridine, N-methylmorpholine, DBU, etc.) and alkali metal carbonates (particularly~
sodium carbonate and lithium carbonate).

W~ile the reaction temperature is not particularly ':
';. ' ' 9s - ~9~
limited, it is usually 0C to 100C, and the reaction i9 carried out preferably at 50C.

While the reaction time is usually from 5 minutes to 30 hours, the reaction completes in 10 hours when the reaction is carried out at 50C.

After completion of the reaction, the reaction mixture is, for example, appropriately neutralised or, if insolubles exist therein, they are removed by filtration. ; ~ -Then, an organic water-immiscible solvent ~uch as ethyl acetate i9 added to the filtrate, followed by washing with water. The organic layer containing the desired compound is separated and dried over anhydrous magnesium sulphate, followed by evaporation of the solvent to give the desired compound.
.
The desired compound obtained in this manner can further be purified by con~entional procedure such as recrystallisation, reprecipitation, chromatography, etc., if desired. `, ~ ~''' .
Step 8:

This step is for preparing Compound (9) by reacting Compound (8) with Compound (11) in an inert solvent and in the presence of a base. The ba~e employable preferably includes organic bases (particularly triethylamine, pyridine, N-methylmorpholine, DBU, etc.) and alkiali metal carbonates (particularly sodium carbonate and lithium carbonate).

While the reaction temperature is not particularly limited, it i9 usually 0C to 100C, and the reaction i9 carried out preferably at 50C.

While the reaction time is usually from 5 minutes to o 1 2 7 ~ - 96 -2~9~6~8 -30 hours, the reaction completes in 10 hours ~hen the reaction is carr.ied out at 50C.

After completion of the reaction, the reaction mixture i9, for example, appropriately neutrali3ed or, if insolubles exist therein, they are removed by filtration.
Then, an organic water immiscible solvent such as ethyl acetate is added to the filtrate, followed by washing with ~-water. The organic layer containing the desired compound -is separated and dried over anhydrous magnesi~n sulphate, followed by evaporation of the solvent to give t`he desired ~
compound. ~ ;

The desired compound obtained in this manner can ; ~`
further be purified by conveDitional procedure such as recrystallisation, reprecipitation, chromatography, etc., if desired. ~ ~
. ' - . .'~ ~ :
Step 9:
~ , . .
This step i8 for preparing Compound (2) by reacting a ;
deprotecting agent with Compound (9) in an inert solvent, and i8 carried out in the same manner a~ in Step 5 of Process A~
' ~

: ' .

.: .
' ' ~
: . -:

209~6~ -Process A-4 i-D
HZ

HO
: (3) ~.
~ ..
(1 2) step 10 ~:~
. .
, . . .
H~Y 3, ~ CH3~2~

(1 O) ' :', HO :.
step 11 ¦

R3-C~Y~ CR~

: (2) :- .
HO ~ ~:

:: Process A-4 consi~ts of Step 10 and Step 11. ::
:::
: Step 10: .

This 3tep is for preparing Compound (10) by reacting Compound (12) (in the fonmula Hal reprenents a halogen r ., , atom) with Compound (3) in an inert solvent and in the pre3ence of a base. Thi9 ~tep i9 carried out in the same manner as in Step 7 of Proces~ A-3.
:: ' :, "~ "~ 3i ~: 3 , ~

O ~ 2 7 ` - 98 -~ O ~
Step 11:

This s~ep is for preparing Compound (2~ by reacting -Compound (12) (wherein Hal represents a halogen atom) with : -Compound (10) in an inert solvent and in the presence of a base. This step is carried out in the same manner as in Step 8 of Procesis A-3.
" ':
.
`:`: ~ ,' ~ ' ':` ' ,'~'', ' ' :
' ',''' ~'"'~' .'"' :' ' , . ~

M&C FOLIO: P67164 - FP-9135 2~66.~ W~NGDOC

Process B
Rl ( 2 ) ~R2--c~y~cH2~z-cH
Step 12 R3 . k ~ D

O ( 1 4 ) :
V-P-U .::
, H !

Step 13 ~0~, ~ :
~ :
_ :
O--P--O ~. ~
~' O ,.
~ . I n ~ ~ C\~ 0, ' ~

R2-C~y~CN2~z-c~

., '~ ' .
- P=O : ' O .' CH~
\~ ~ B : :
~)~ .
O
O--P= ~
O ~ ..
C~2 ( 1 ) ~ B
HO

.. " . , .. . . " , ,. ., ~.

., , ,,. .. . . ., , . ,, , . ~ ;. .... , :., ,.; . . .

~ . :

209~65~
Process B can be performed according to Step 12 and Step 13 indicated below. An explanation o~ each of these .~ .
steps i~ given below.

Step 12:
.. .. :
This step is for preparing a 3'-phosphorous acid derivative ~Compound (14)] by reacting chloropho~phoramidite [Compound (13)], a phosphitylating agent, with Compound (2) in an inactive ~olvent and in the presence of an acid acceptor~ A dialkylamino gx~up, such as a dimethylamino group and dii30propylamino group J or a heterocyclic group having 1 or 2 oxygen atoms and/or ~;
nitrogen atoms in it3 ring, such a~ a morpholino group, is used for U of Compound (13). While any group can be u~ed for V o~ Compound (13), provided that it can be removed following formation of a phosphodiester group in Step 13, lower alkyl groups, such as a methyl group, and cyanoalkyl group~, such a~ a cyanoethyl group, are preferably u~ed.
Examples of Com~ound (13) include phosphines, such a~
chloromorpholinomethoxyphosphine, chloromorpholino-cyanoethoxyphosphine, chlorodimethylaminomethoxyphosphine, chlorodimethylaminoethoxyphosphine, chlorodiisopropyl-aminomethoxyphosphine and chlorodii~opropylaminoethoxy-phosphine; preferably chloromorpholinomethoxyphosphine, chloromo~pholinocyanoethoxypho~phine, chlorodiiso-propylamlnomethoxyphosphine and chlorodii~opropyl-aminocyanoethoxypho~phine.

While the solvent-u~ed is not particularly limited, provided that it does not affect the reaction, preferred solvent~ include ethers, such as tetrahy~rofuran, diethyl ether and dioxane. ~
.'~, While examples of the deoxidlser used include heterocyclic amines, ~uch as pyridine a~d dimethylamino-pyridine, and aliphatic amines, ~uch as trimethylamine, . .
, ' ' ,1 . . ~ ,.
.

~ o 9 ~ 5 3 ~

triethylamine and diisopropylethylamine~ aliphatiC amines (particularly dlisopropylethylamine) are preferably used.

While the reaction temperature is not particularly limited, it is usually -50C ~o 50C, preferably room temperature.

While the reaction time varies depending on the starting material, reagent and temperature employed, it is usually 5 minutes to 30 hours, preferably 30 minute~ when the reaction i9 carried out at room temperature. The reaction mixture is then, for example, appropriately neutrali~ed or, if insolubles exist, they are removed by filtxation. Then, an organic water-immiscible ~olvent euch as ethyl acetate is added thereto, followed by washing with water. The organic layer containing the de~ired compound is separated and dried over anhydrou~
magnesium sulphate, followed by evaporation of the ~olvent to give the desired compound.

The desired compound obtained in this manner can further be purified by con~entional procedure such as recrystallisation, reprecipitation, chromatography, etc., if de~ired.

Step 13:

In this step:
(i) Compound (14) obtained in Step ~12); and (ii) ~1] a~ ODN synthe3i~ed with a DNA sy~the~iser and coupled to CPG, wherein only the 5~-terminal ;-dimethoxytrityl group i~ eliminated and the ba~e portion i9 protected with a protecting group such a3 an acyl group, or [2] an ODN syntheeised by a liquid phase technique having a free hydroxy group at it~ 5~-terminal, wherein the base portion is protected with a protecting group, such a~ an acyl group;

, .

.

., :. ., ,, . .. -, "

0 4 2 ~

2~965;~
(iii) are [1] condensed using a guitable condensing agent to form a triphosphite bond, followed by [2] oxidation using a suitable oxidi~ing agent to convert to the phosphotriester, and severing the ODN from the CPG when the ODN is coupled to CPG, followed by elimination of the protecting group to;
(iv~ obtain the final product after following a purification procedure.

The ODN of the desired nucleotide ~equence, in which a free hydroxy group at the 5'-terminal is protected, can be synthesised using a DNA ~ynthesiser such as the Model 380-B of Applied Biosystem~ Inc. applying the phosphoro-amidite method, according to any variation of the Stek method described in the J. Am. Chem. Soc., 106, 6077-6089 (1984). ,~

In addition, a base protected with an acyl group i9 u~ed for base in ~he material of ODN synthesis. A benzoyl group i9 preferably used for the acyl group when the base portion i9 A or C, while an isobut~yryl group i9 used for ~ -the acyl group when the base i~ G.
. .
Furthermore, in the case of a free ODN not coupled to CPG, it i9 preferred that qaid ODN be purified in order to be used in the following reaction. Said ODN can be purified with a purification procedure used in ordinary purification of nucleic acids, including various types of '~
chromatography such as re~erse phase and ion exchange chromatography (including high-performance liquid chromatography).

While examples of acidic substances used for the catalyst in the condensation reaction of this step include acidic substances, such as mesitylene sulphonylnitrotriazolide and tetrazole, tetrazole is used preferably.

., , O ~ 2 8 ~ - 103 -2 0 ~ 8 While the 901vent employable i9 not particularly , -limited unless it inhibitS the reaction, it preferably includes ni.triles.

While the reaction temperature may be in the range of -30 to 50C, the reaction i9 usually carried out at room temperature.

While the reaction time i9 in the range of 1 minute to 20 hours, and it may vary depending on the reaction -.
temperature, the reaction completes in 10 minutes when the :
reaction is carried out at room temperature.
:::
While there are no particular limitations on the ' .:
~hoice of oxidising agent used in the oxidation reaction of ~his proce~s, provided that it is an oxidising agent usually used in oxidation reaction~, it can.preferably be exemplified by inorganic metal oxidising agents including mangane~e oxides, such as potassium penmanganate and manganese dioxide; ruthenium oxide~, such as ruthenium tetraoxide; selenium compounds, such as selenium dioxide;
iron compound~, such a~ iron chloride; osmium compound~, ~uch as osmium tetraoxide; ~ilvex compoun~s, ~uch as ~il~er oxide; mercury compound~, such as mercury ace~ate;
lead oxide compound~, such as lead oxide and lead tetraoxide; chromic acid compound~, such as potas~ium chromate, chromic acid-sulphuric acid complex and chromic acid-pyridine complex; and cerium compounds, such as cerium ammonium nitrate (CAN~; inorganic oxidising agents including halogen molecules, such aQ chlorine molecules, bromine molecules and iodine molecules; periodic acids, ~uch as sodium periodate; ozone; aqueous hydrogen ~ -peroxide; ni~rous acid compound~, such as nitrous acid;
perchlorate compounds, such a8 pota~sium chlorite and sodium chlorite; chlorous acid compound~, such as pota~sium perchlorat~ and ~odium perchlorate; and persulphuric acid compounds, such as potassium persulphate , - 104 -2~9g~8 , and sodium persulpha~e as well as organic oxidising agents including reagentS uged in DMSO oxidation (complexes of :~
dimethyl sulphoxide and dicyclohexylcarbodiimide, oxalyl chloride, acetic anhydride or phosphorus pentoxide, and complexe~ of pyridine and sulphuric anhydride); peroxides, such as t-butylhydroperoxide; stable cations, such as triphenylmethyl cation; succinimides, such as N-bromo~uccinimide; hypochlorous acid compounds, such as :
t-butylhypochlorite; azo-dicarboxylic acid compounds, such as azo-dicarboxylic acid ester~; disulphides and triphenyl pho~phine~, ~uch as dimethyl disulphide, dipheny~ :
disulphide and dipyridyl di~ulphide; ~ulphites, such as methyl sulphite; tetrahalogenated carbon such a~ methane tetr~bromide; and quinone compounds, such as 2,3-dichloro-5,6-dicyano-p-benzoguinone (DDQ), particularly preferably iodine. ;.;~

The choice of solvent to be used in the reaction is ~ .
not particularly limited, provided that it does not :-interfere with the reaction and can dissolve the starting materials to some extent, and it preferably includes aromatic hydrocarbons, i~uch as benzene, toluene and xylene; halogenated hydrocarbon~ 3uch as methylene chloride and chloroform; ethers, such as ether, ~: -tetrahydrofuran, dioxane and dimethoxyethane; amides, such as dimethylformamide, dimethylacetamide and hexamethylphosphorotriamide; sulphoxide~, such as dimethyl sulphoxide; alcohols, such ais methanol, ethanol, propanol, isopropanol, butanol, isobutanol and i~oamyl alcohol;
diluted acids, ~uch a~ aqueou~ sulphuric acid; dilllted baises, such as agueous sodium hydroxide; water; acetone;
ketones, ~uch as methyl ethyl ketone; heterocyclic amines, such as pyridine; and nitriles, such as acetonitrile, pre~erably nitriles (particularly acetonitrile), eth~rs ~. ;
(particularly tetrahydrofuran) and halogenated hydrocarbon~ (partisularly methylene chloride).
' ; .

. . . , . " ~ . , -. .. , " , . . . . . ... . ..... ... . . . . . . . .

'' ~ '' :: , , : , , ' ' ' "

~ - 105 -209~6-~'g The reaction is carried out at a temperature of -50 to 100C. While the reaction time varies depending on the reaction temperature, raw material compounds and type of solvent used, it i5 u5ually 30 minutes to 15 hours.
Furthermore, in the a~tove-mentioned oxidation reaction, the reaction is accelerated by the addition of a layer migrating catalygt 5uch as triethylbenzylammonium chloride and tributylbenzylammorlium bromide.

Severing the ODN from the CPG whPn the ODN is coupled to the CPGI as well as removal of the protecting~group~
other than those sub3tituted at the 5'-tenminal, can be -~
carried out according to k~own method~ ~J. Am. Chem. Soc., 103, 3185 (1981)~.

By purifying the compound of the general formula (1) obtained in this manner with a purification procedure u~ually u~ed for purification of nucleic acids, includi~
various type~ of chromatography such as reverse phase and j ion exchange chromatography (including high-performance liquid chromatography), the compound having the above-mentioned general formula (1) can be obtained.

:

~' .

:
, ~' t s ., ~

0~2a . - 106 -2~9665~ :

Process C

R
( 2 ) --~ RZ- C ~ Y J 1 CHz 1 Z~ C~

- ( 1 1 ) `:

~ O - P= O
S~ep 15 . OAr HO
:~ C~}
~''-O
~ O - P= O ,' ' ' ~ D n Rl ~B ' ZZ-C~Y~CN2~Z-C~ W (I S) O :.

J I ., ', . ~ '.
'. CH2 o .''; ~`

,, . ~
-O--P=O .'~ ,:

~, CH

( 1 ) ~B
' ~ HO .

O ~ 2 ~

2 0 9 ~ 6 :~ 8 Process C can be performed according ~o Step 14 and Step 15 indicated below. An explanation of each of these steps is given below.

Step 14:

In this step, after reacting a phosphating reagent such as ditriazolide (16) with Compound (2) in an inactive solvent, the reaction mixture i9 treated following addition of water to obtain a mononucleotide (17) to serve as the intermediate.

While the choice of solvent is not paticularly limited, provided that it doe~ not interfere with the reaction, it usually includes aromatic amines, such as pyridine. While there are also no particular limitations on the Ar group of the phosphating reagent, provided that it can be eliminated under conditions for eliminating the protecting group of the base portion following completion of the conden~ation reaction of Step 15, an ortho-chlorophenyl group i~ usually used.

While the reaction temperature ie not particularly limited, provided that it i9 within a range of -20 to 100C, the reaction is usually carried out at room temperature. While the reaction time varies depending on the solvent used and the reaction temperature, the reaction ~ime i~ 1 hour when u~ing pyridine for the reaction solvent and carrying out the reaction at room temperature.
~ .
Step 15:
-In thi~ ~tep, the mononucleotide (17) obtained i~ St~p 14, and [1] an ODN sy~the~ised with a DN~ ~ynthesi~er and coupled to CPG, wherein only the 5'-terminal dimethoxytrityl group i8 eliminated and the base portion . :
..
-..... , . . . . . .. . . " ... . . ., . . . .. " . , .. . ... .. ,., .. " . ... - , , .... . , , , . . - . - .. , . ,,., ., , ~

oq 2a 20966~
and phosphate portion are protected with protecting group~, or [2] an ODN synthesised with a liquid phase technique and having a free hydroxy group at the 5'-terminal, wherein the base portion and phospha~e portion are protected with protecting groups, are condensed using a conden~ing agent to form phosphotriester bonds, followed by severing the ODNi from the CPG when the ;
ODN is coupled to CPG, and elimination of the protecting groups to obtain final product (1) after following a purification procedure. While the solvent used in this tep i3 not particularly limited, provided that it does not interfere with the reaction, it preferably includes aromatic amines, 3uch as pyridine.
~.: . .
While ex~mples of the conden~ing agent used for conden~ation iniclude dicyclohexylcarbodiimide (DCC), me~itylene sulphonyl chloride (M~-Cl), triisopropylbenzenesulphonyl chloride, mesitylene ~ulphonyl triazolide (MST), mesitylene sulphonyl-3-nitrotriazolide (MSNT), triisopropylbenzenesulphonyl tetrazolide (TPS-Te), triiYopropylbenzenesulphonyl nitroimidazolide (TPS-~I) and triisopropylbenzene~ulphonyl pyriclyltetrazolide, MSNT, TPS-Te and TPS-NI are preferably used.

While the reaction temperature is not particularly limited as long as it is in the range of -10 to 100C, the reaction i9 usually carried out at room temperature.
While the reaction time varies depending on the solvent and the reaction tempera~ure employed, it i~ 30 mi~utes when pyridine i9 used a~ the reactive solvent and the reaction i9 carried out at room temperature.
.
After completion of the reaction the reaction mi~ture i9, for example, appropriately neutralised or, if in~olubles exist therein, they are removed by filtration.
Then, an organic water-immiscib1e solvent such as ethyl ''i . .

1~ ' , ~ , , .

0 4 2 ~I
` - 109 -2~9~3 acetate i8 added to the filtrate, followed by washing with water. The organic layer containing the desired compound is separated and dried over anhydroug magnesium sulphate, followed by evaporation of the sol~ent to give the desired compound.

The desired compound obtained in this manner can further be purified by conventional procedure such as recrystalli~ation, reprecipitation, chromatography, etc., if desired.

:.:
..

~ , t~

2 ~ 8 Process D

R l - :
( i' ) _~ R2--C ~ Y~ CH2 ~ Z CH2 .:
Step 16 R3 . k \~>_ D' ( 1 9) 0~ ' ~' H- P--O

HO
, . I , .
Step 17 , ~B' ~

- O- P= O '~
~ ~ 1- n :

Ra-C~Y 1, 1Cl2~Z-C~ W~I S ~

-o-P=o ' :' ~ . .
~a ~ ~

- o- P--o . . .

(1)' . ~ "
HO , O ~ 2 2 0 9 ~ & ~ ~
Proces8 D is indicated below. It can be performed according to Step 16 and Step 17. An eXplanation of each of these steps i9 given below.

Step 16:

In Step 16, after reacting, for example, tris~ 2~4-triazolyl)phosphite (18), prepared in advance from phosphoru~ trichloride and 1,2,4-triazole according to the literature [B.C. Freohler, P.~. Ng and M.D.
Matteucci, Nucleic Acid Req., 14, 5399 (1986)], with ~ -Compound (2) in an inactive aolvent, wa~er is added to the reaction mixture to stop the reaction followed by po~-treatment to obtain 3'-H-phosphonate nucleo~ide (~9). While the choice of solvent u~ed is not particularly limited, provided that it does not interfere with the reaction, a preferred 901Yent i9 a halogenated hydrocarbon, such as methylene chloride. ~hile there are no particular limitation~ on the reaction temperature, provided that it i9 within a range of -20 to 100C, the reaction i8 u~ually carried out at room temperature. -~ - .
While the reaction time varie~ depending on the :-~olvent and reaction temperature employed, it is 30 ~.
minu~es in the case where the reaction is carried out in .
methylene chloride at room temperature.
'.
Step 17 .
In this step, the 3'-H-pho~phonate nucleoside (19) ;~
obtained in Step 16~ and an ODN synthe-~ised with a DNA -i ~ynthe~iser and connec~ed with CPG and wherein only the 5'-terminal dimethoxytrityl group ia eliminated and the : :
~a~e portion i9 protected with a protecting group [~.C.
Froehler, P.G. Ng and M.D. Matteucci, Nucleic Acid ReR., ~ :
14, 5399 (1986)], are condensed in the pre~ence of a~.
condensing agent, such as pivaloyl chloride and an acid .

acceptor to form H-phosphonic die9ter bond~, followed by conversion of the H-phosphate bonds to phosphodiester bonds using an oxidising agent and removal of the -~
protecting group of the base portion at the same time as severing the ODN from the CPG under basic conditions, to -~
obtain the final product (1) [after ~ollowing a purification procedure]. While the choice of solvent u~ed in this procesg is not particularly limited, provided that it does not interfere with the reaction, anhydrous acetonitrile is u~ed preferably. While acid chlorides of carboxylic acids or phosphoric acid are used as the conden3ing agent, pivaloyl chloride i~ preferably used.

While there are no particular limitations on the choice of oxidising agent used for oxidi~ing the H-phosphonic acid ODN to the ODN containing phosphodiester bonds, provided tha~ it i8 an oxidising agent usually used in such oxidation reaction~, it can be exemplified by inorganic metal oxidising agents including manganese oxides, such as potas~ium permanganate and manganese ~ -dioxide; ruthenium oxide~, ~uch as ruthenium tetraoxide;
selenium compounds, such as selenillm dioxide; iron compounds, such as iron chloride; osmium compounds, ~uch as osmium tetraoxide; silver compound~, such as silver oxide; mercury compound~, such as mercury acetate; lead : .
oxide compounds, ~uch as lead oxide and lead tetraoxidei chromic acid compounds, ~uch as potas~ium chromate, chromic acid-sulphuric acid complex and chromic acid-pyridine complex; and cerium compounds, such as ::~
cerium ammonium nitrate (CAN), inorganic oxidising agents :~
including halogen molecules, ~uch as chlorine molecules, bromine molecules and iodine molecules; periodic acids, such as sodium periodate; ozone; aqueous hydrogen peroxide; nitrous acid compound~, such as nitrous acid;
chlorite compound9, such a3 pota~sium chlorite and sodium chlorite; and per~ulphuric acid compounds, such as pota~sium persulphate and ~odium persulphate as well as .': , ., I ' ' , " ,','~.',,, .. , ,';' . ' . .

O ~ 2 8 ~096~8 organic 0xidising agents including reagents used in DMS0 oxidation (complexes of dimethyl sulphoxide and dicyclohexylcarbOdiimidel oxalyl chloride, acetic anhydride or phosphorus pentoxide, and complexes of pyxidine and sulphuric anhydride); peroxides, such as t-butylhydroperoxide; stable cationg, guch as triphenylmethyl cation; succinimides, such as N-bromosuccinimide; hypochlorous acid compounds, such as t-butylhypochlorite; azo-dicarboxylic acid compounds, such as methyl azo-~icarboxylate; disulphides and triphenyl phosphines, such as dimethyl disulphide, diphenyl disulphide and dipyridyl disulphide; sulphites, such as methyl sulphite; tetrahalogenated carbon~, ~uch as methane tetrabromide; and quinone compounds, such as 2,3-dichloro-5,6-dicyano-p-benzoquinone (DDQ), and particularly preferably iodine molecule.

While examples of the acid acceptor used include heterocyclic amines, ~uch as pyridine and dimethylamino-pyridine, and aliphatic amine~, such as trimethylamine, triethylamine and diisopropylethylamine, aliphatic amines (particularly diisopropylethylamine) are preferably used. ~ -~ :.
While the reactlon temperature is not particularly limited, it i8 usually -50 to 50C, preferably room temperature.

While the reaction time varies depending on the starting material, reagent and temperature employed, it is ~ -u~ually 5 minutes to 30 hour~. When the reaction is ~ -carried out at room temperature, the reaction time is preferably 30 minutes. After completion of the reaction the reaction mixture is, for example, appropriately neutrali~ed or, if insolubles exist therein, they are removed by filtra~ion. Then, an organic water-immiscible solvent such as ethyl acetate is added to the filtrate, followed by wa~hing with water. The organic layer ~-, ~'~

~" ,' . ', , : : , . : , ' , ' ' ~: . ,' ~.. ' .. ' , 'i I . ' ' ' ' ' ' ' 04 2a 9~a~ :

containing the degired compound is separated and dried over anhydrou9 magnesium sulphate, followed by evaporation of the solve~t to give the desired compound.

The desired compound obtained in thi~ manner can further be purified by conventional procedure such as.
recrystallisation, reprecipitation~ chromatography, etc., if de~ired.

'' ' ' ',:
;i ":

' ~':,'.
., . ' , ~
'~'.
, ' , ;
'.'', ;~ .

O ~ 2 ~
- r ~^.
~ ~ 115 2a9 v~ 8 Proce~39 E

Rl .
(2) --~ R2--C~Y~cH2 l Z-C~D ' O ( 2 2 ~ -= P--N~N
CH3 . -HO
Step 19 \ O ~ .': '.
`~ ~B ' ~ . ~
. 0/~ ' ','"'', H3 C - P= O . : :
n RI ~ ~--0 R3 CH2 ~ z- ~H2 W~J ( 2 3 ) D
0/~' ."', , 3 ~ :
- O , . ':: ' C~y . , ~

( 2 4 ) O
,~
H3C-P--o .
O - : .
~_ I , ~ 0 HO

~c - 1l6 -2~6~
Process E ca~ be performed according to Step 18 and Step 19 indicated beloW-Step 18:

In this ~tep, methylphOsphonic bis-imidazolide (22), synthesised in advance by reacting methylphosphonic dichloride and imidaæole in the presence of, for example, ~ -imidazole, i9 reacted with Compound (2) in an innert solvent to obtain 3'-methylphosphonic imidazolide (22~.
~Reference: P.S. Miller, M.P. Reddy, A. Murak~mi, K.R.
~lake, S.B. Lin and C.H. A~ri3, Biochem., 25, 5092 (1986)].

While the choice of solvent to be used is not particularly limited, provided that it does not interfere with the reaction, tetrahydrofuran i~ preferably used.
While the reaction temperature i~ not particularly limited and it i9 in the range of -20 to 100C, the reaction is , preferably carried out at room temperature. The reaction time varieis depending on the solvent and reaction temperature employed and it ie 6 hours when the reaction i9 carried out at room temperature in tetrahydrofuran.
', "
Thii3 step can be al80 carried out using ~econdary amines, such a~ diisopropylamine in place of imidazole to aynthesise 3'-methylphosphonic diisopropylamidite (22') and Compound (2) according to the re~erence S. Agrawal and J. Goodchild, Tetrahedron ~ett., 28 3539 (1987), and the resulting compound can be used in the subsequent Step 19.
lP. Bhan and P.S. Miller, Bioconjugate Chem., 1 82 (1990)].
. ..
Step 19:
' ,,' ':
In this ~tep, Compound (22) obtained in Step 18, and a methylphosphonate ODN (23) synthesised according to the above-mentioned reference and coupled to CPG, wherein only the 5'-terminal dimethyoxytrityl group is eliminated and i 0 4 2 ~
-~~r ~ 117 -2 Q ~
the base portion i5 protected with a protecting group, are condensed in the presence of tetrazole to form methylphosphonic diester bonds, ~ollowed by elimination of the protecting group of the base portion at the 9ame time a~ severing the ODN from the CPG under basiC conditions, to obtain the final product (24) [after following a purification procedure]. While the aolvent used in this procesg i9 not paxticularly limited provided that it does not interfere with the reaction, acetonitrile is used preferably. While there are no particular limitations on the reagent used for the condensing agent, provided that -it causes protonation of the imidazole and diisopropylamino groups of Compound (22) or ~22') to form methylphosphonic diester bonds between the hydroxy groups of a compound having hydroxy group~, such as Compound (23) when iaid compound i3 present, tetrazole is preferably used.

While the reaction temperature i9 not particularly limited, it i~ usually -50 to 50C, preferably room temperature.
: ' While the reaction time varies depending on the ~tarting material, reagent and temperature employed, it is usually 5 minute3 to 30 hours. When the r~action i9 carried out at room temperature, the reaction time i~
preferahly 30 minute~. After completion of the reaction the reaction mixture i~, for example, appropriately neutrali~ed or, if in~olubles exist therein, they are removed by filtration. Then, an organic water-immiscible solvent such as ethyl acetate is added to the filtrate, followed by wa~hing with water. The organic layer con~aining the desired compound i9 separated and dried over anhydrous magnesium sulphate, followed by evaporation of the ~olvent to give the desired compound.

The de~ired compound obtained in this manner can ~.

O ~ 2 8 - 118 - . .
2~9~
further be purified by conventiOnal procedure such as recrystalli~ation, reprecipitatiOn, chromatography, etc., ::
if desired.
.

`
; :
' ;' .~
~".' '. ' .
.:

'~
. .

;i ' ~: ...... , ., . ~ .. ... . . . . . . .

.,, :. I .. .. . : ' . . ~ . ` - .

!

2 Q ~
Process F

R
R2--C~Y~cH2 l Z-CH~
Step 16 13 ~ ~ ~D ;
(1 9) o : ,~
H P= O . : ~ ~
O- ` . ` ~
HO
, ~ ; . ~ .
CH2 .-:
Step 2 0 \~~ ~ ~
~ . ":
O . ~ ~
e S - P= O ~ ~
O , ' ~
' CH2 ' n ~ 1 ~ B ' R~--C~Y~CIlz~Z-C~ W (~

O '' .:
.j 9$--p=O
' O '.

. C~ B
,~
i, o .
3S P O ' . ::.
. n n ( 2 5 ) 2 0 ~ .
S \< ~a . :
Y
, . . HO

~ . .
.
~ ~ .

0 4 2 ~
_ - - 120 - 2 ~

Procegs F is composed of Step 20 wherein thioate ODN
(15), coupled to CPG and having a free hydroxy group only at i~s 5'-terminal, is reacted wit~ compound (19), obtained in Step I6, as indicated in ProCe~s D.

S~ep 20:

In thi~ step, Compound (19) obtained in Step 16 -according to, for example, the method described in the literature ~M. Matsukura, G. Zon, K. Shinozuka, C.A. :-Stein, H. Mitsuya, J.S. Cohen and S. Broder, Gene, 72, 343 (1988)], and thioate ODN (15) synthesised on a DNA
synthesiser and coupled to CPG wherein the 5'-terminal dimetho~ytrityl group is eliminated to form diphosphonate bonds are reacted in the same manner as in Step 17 in Process D u~ing pivaloyl chloride or 1-adamantane carbonyl chloride as the conden~ing agent, followed by reacting sulphur di~sOlved in carbon disulphide in the presence of triethylamine using pyridine as the reaction solvent, ` -~
converting the dipho phonate bonds into pho~phoric thioate bonds, and eliminating the protecting group of the base portion at the ~ame time a~ severing the ODN from the CPG, under basic conditions, to obtain t:he final deYired compound [after following a puri~ication procedure].
While the choice ~olvent u~ed for thioation of thi~
process is not particularly limitecl, provided that it does not inter$ere with the reaction, pyridine is used preferably, and carbon disulphide is u~ed preferably as the ~ulphur solvent. In addition, although there are no particular limitation~ on the amine used, tertiary amines, such as triethylamine are preferable.

Severing of the thioate ODN from the CPG, as well as elimination of the protecting group of the base porti-on, -can be performed according to U~er Bulletin of Model 381A
(1987) available from Applied Biosystems Inc.
, . , ~,.: . :; . ~ : , ,: . .. . . . , . ,: , . ...

, .: ' ' - ; : :

2 ~ 8 :;
Proce3s G
., .
R~
( 2 ) > R2 - C~ Y~ CH2 l --- Z- CH2 step 12 R3 J k \~D
O~ ( l 4 ) ~ .~
VO- P- U ' :; '~ :
HO
_. . ~ . .

\~ ~tB
step 15 0~/

VO- P= o ', O .

~/--B
Rl W (1 5) R2--C ~ y ~ CH2 ~ O
R3 \~ ~D
~J .....
O ~',' :.
~O- P= O . :~
O ::-.
C~O
>~
O
RO--P= O

( 2 6 ) ~ B
HO

2Q96~8 :
Process G is the sulphiting agent employed in Step 12 of Process B. Triester ODN derivative (26~ is obtained by carrying out Step 12 and Step 13 u9ing a reagent (13) including an alkyl group ~uch as a lower alkyl group, e.g.
ethyl, propyl and butyl, that is not eliminated during severing of ODN, 9ynthe9i3ed with a DMA synthesiser, wherein V i8 a methyl group or cyanoethyl group, from CPG, as well as under ba9ic conditions for elimination of the protecting group from the base portions.

O ~ 2 8 ~ - ~ 23 : ~
2 V ~
ProCess H ..
R I
( 2 ) --> R2- C~ Y~ C~2~ Z-CH2 S-ep 16 k o (19) , ,.

- Ste~ /7 H- P--O
HO
CH2 o ~;
: . \~ ~ B
,,, ' 0~/ ~'' R- HN--P= O
Q

RZ-C~Y~CN2~2-C~ W ( I 5') '~,' .'i ' .
RHN- P= O - !: : :
O
_~ .
C,~o ' "'i' R--HN--P= O

( 2 1~ ~K n \< ~ B
HO

0 4 2 ~ , 20~6~
I~ Process H, the H-phosphonate e~ter (19) synthesised in Step 16 o~ Proce5S D, and an alkylphOgphoramidate ODN
(synthesised with a DNA synthesiser according to the method degcri~ed in the literature [s. Agrawal, J-Good-child, M.P. Civeira, A.H. Thornton, P.S. Sarin and P.C. Zamecni~, Proc. Na~l, Acad. Sci., ~5, 7079 (1988)]) and Connected with CPG, from which the s~-terminal dimethoxytrityl group wa~ remo~ed, were condensed in the pre~ence of of pivalic chloride in the ~ame manner as in the condensation reaction of step ~7, followed by treatment of the regulting ODN with a S'-terminal hydrogen phosphate-die~ter group with an appropriate amine in tetrachloromethane at room temperature for 1.5 hours. At the end of thia time, the ODN was separated from the CPG, and treated with aqueous concentrated ammonia to eliminate the protecting group of the base portion, either at 55C
for 5.5 hours or at room temperature for 2 days or more, ~o obtain Compound (27).

An antiviral agent or antitumor agent having the compound represented by the general formula (1) of the present invention a~ its active ingredient can be prepared by u3ing ~aid compound in the form of a pharmacologically acceptable non-toxic salt.

In the preeent invention, viral di~ea~e~ and infection or tumour g~nerically refer to all types of diseases that are induced by cellular changes due to the action of internal or external viruses or tumour genes. Antiviral agents or antitumour age~t~ refer to alI drugs that are used to prevent and/or treat these diseases.
, Pharmaceutical preparations of these drugs can be manufactured by well known methods in ~aid field. Such preparations can be administered by, for example, oral administration in the form of tablets, capsules, granules, powders and syrups, or parenteral administration in the . ' , , , ~ ' , , ~ ' ' ' -' , ' ' ' . ' ' ' ' .' ' ' , ' . . '"" '', ' " ', ' 2 ~ 8 foxm of injectiOn preparations (intravenous, intramuscular and Subcutaneous)l intravenous drip preparations and ~UppoSitorie8. water-~oluble solvent~, such as phygiological galine, sterilized water and Ringer's solution, water-in90luble solvents, isotonic agents, stabilizers, preservativesl SUSpending agents, buffers and emulsifiers, and 60 ~orth, can be arbitrarily used for preparing injection preparations and intravenOus drip preparations. Each of the3e types of preparations can be prepared using known adjuvants that can usually be used in technical fieldg of preparation formulation, such as excipient 8, binders, disintegrators, flavourings, fragrances, solubility assistants, suspending agents and coating agents, according to conventional method~. While the dose used varie~ according to ~ymptom~, a~e, body weight and 80 forth, ~he dose given to adults i9 about 10 mg to 1000 mg per day in the case of oral administration, with this dose to be administered once or in several portions. In addition, in the case of parenteral administration, 10 mg to 500 mg per daily admi~istration can be gi~en by subcutaneous injec~ion, intramuscular injection or intravenou~ injection.

The present invention is specifically described below by way of Example~, Comparati~e examples, Test examples and Preparation examples, but the invention is not limited thereto.

Tr-AGGTGGGTCTGAAAC
'De~y (la) ~ 5'-O-trityl-N6-ben~oyladenosine 2.60 g (7.31 mmol) of ~-benzoyladenosine were dissolved in 50 ml of dry pyridine, and the resulting solution was subjected to azeotropic distillation to ';

209~6~3 dryness by evaporating the pyridine under reduced pressure. The residue was dissolved in 70 ml of dry pyridine, followed by the additiOn o~ 2.24 g (8.05 mmol) of trityl chloride and stirring at sOC in an atmosphere of argon. After 3,5 hours, an additional 2.24 g of trityl chloride were added t~ereto, followed by stirring at 50C
for 6.5 hour~. After allowing to stand overnight at room temperature, the mixture wa~ diluted with 500 ml of methylene chloride, wa9hed three times with 200 ml of a saturated aqueousi solution of NaHC03, and dried o~er anhydrous MgS04. After removing the drying agen~ by filtration, the residue obtained by distilling off the solvent under reduced pressure was applied to a 120 g silica gel column (70-230 me3h) and eluted with methylene chloride containing 1 to 3~ methanol to obtain 2.27 g of the desired subitance.

H-NMR(60MHz, CDC13) ~ppm: ;

9072 (lH, b9, NH); 8.70 (lH, S, H-8); 8.16 (lH, g, H-2); 8.12-7.84 (2H, m, ortho-H of Bz); 7.6Z-~.92 (18H, m, Tr and m, p-H of Bz); 6.46 (lH, t, J=6Hz, H-l'); 4.84 (lH, b8, OH); 4.73 (lH, bs, H-3'); 4.22 (lH, b~, E-4'), 3.33 (2H, bs, H-5'); 2.84-2.30 (2H, m, ,~ ~H~;2') (2a) ~ 5'- ~ -N -benzoyladenosine 3~-0-(2-cyano-ethyl-N,N-diisopropyl)phosphoroamidite deo)~y 1.195 g (2 mmol) of~5'-O-trityl~ benzoyladeno9ine were dis801ved i~ 10 ml of dry pyridine, and the resulting solution was sub~ected to azeotropic di3tillation to dryness by evaporating the pyridine under reduced pressure. The residue was di~solved in 10 ml of dry-tetrahydrofuran, followed by addition of 1.39 ml (8 mmol~
of diisopropylethylamine and stirring at room temperature in an atmo~phere of argon. 0.892 ml (4 mmol) of " ' ' ' .: `. . , '. . , : " ' , ~ ' '"'. ',. ,' .' ~. ' ,. . . ': .'' ' , ` :

:. ' ' ' ' . ' ., ' ' '' '' ;' ';" '~ '; '' ' .. ''; -.' ~ - 127 -2~9~6 2 - cyanoethyl N N diisopropylchlorOphOsphoroamidite wa~
added to the mixture, followed by 9tirring at room temperature ~or 30 minutes. After reaction, the precipitate wa~ removed by filtration, and the solvent was distilled off under reduced pressure. The residue was dissolved in 100 ml of ethyl acetate and washed twice with 50 ml of ice-cooled 10~ aqueous Na2C03. After drying the organic layer over anhydrouq Na2CO3, the drying agent wa~ removed by filtration, and the solvent was distilled off under reduced pre~sure. The re~idue was a~plied to a 40 g ~ilica gel column (70-230 mesh) and the desired substance waa eluted with a solution of ethyl acetate, methylene chloride and triethylamine (45:45:10).
After distilling off the ~olvent, the desired ~ubstance wa~ dissolved in 4 ml of toluene. This ~olution was then dropped into 200 ml of vigorously stirred hexane. The resulting precipitate was then collected by filtration.
The precipitate obtained in thia manner wa~ then dissolved in methylene chloride, followed by distilling off the solvent to obtain 1.04 g of the desired product in an amorphoua state.
, . ,'.

lH-NMR (60MHz, CDC13) ~ppm: ~-, ','~'' .
9.82 (lH, bs/ NX); 8.66 (lH, 8, ~-8); 8.18 (lH, 9, H-2); 8.12-7.84 (2H, m, ortho-H of Bz); 7.62-7.05 (18H, m, Tr and m, p-H of Bz~; 6.48 (lH, t, J=6Hz, l'-H); 7.80 (lH, bs, 3'-H); 4.35 (lH, bs, 4'-H);
3.90-3.20 (6H, m), 3.05-2.23 (4H, m); 1.40-0.95 (12H, m, (~3)2CH).

(3~ Tr-AGGTGGGTCTGAAAC
l ~ e~y ~ 6 25 mg (30 mol) of~5'-O-trityl-~-benzoyladenosine were dissolved in 1 ml of dry pyridine, and the resulting ~olution was aubjected to azeotropic distillation to dryness by distilling of$ the solvent under reduced .. . .

.. .

1282~ 9 ~

pressure. The residue was dissolved in 150 ~1 of dry acetonitrile. Separately, 35 mg of lH-tetrazole were dissolved in 1 ml of dry pyridine and the xegulting solution was subjected to azeotrOpic di9tillation to dryness by distilling off the solvent under reduced pressure, and the residue was dissolved in 1 ml of dry acetonitrile. 180 ~1 of ~ eso/ution wa ~added to the above-mentioned solution of~5~-o-trity~ benzoyl-adenosine in acetonitrile, and this mixture was added to a solid phase carrier (1 ~mol scale) supporting a DNA
derivative, having the sequence of GGTGGGTCTGAAAC from the 5' end and having a free hydroxy group at it~ 5' terminal, ;
prepared in advance using an automated DNA synthesiser.
After stirring this mixture of a non-uniform system for 10 minutes, the solid was collected by filtration, and the solid was the~ washed with acetonitrile and pyridine. At this point, 1 ml of a previously prepared ~olution of acatic anhydride and pyridine (1:9, v/v) containing 0.1 M
dimethylaminopyridine was added, followed by stirring for 1 minute. After collecting the solid by filtration and washing with pyridine and methylene chloride, 1 ml of a previously prepared solution of tetrahydrofuran, lutidine and water (2:2:1, v/v/~) containing 0.1 M iodine was added, followed by stirring for 1 minute. After collecting the solid by filtration, washing with pyridine and methylene chloride, and drying under reduced pre~ure, 20 ml of concentrated aqiueous ammonia was added to the residue, followed by stirring for 1 day at room temperature and then fo~ 5 hours at 50C. After removing the ~olid by filtration, concentrating the filtrate under reduced pressure, removing the ammonia and washing three time~ with 10 ml of diethyl ether, the resulting aqiueous 301ution was freeze-dried. The residue was then di~solved in 5 ml of water and then applied in several separate applications to preparative reverse pha~e HP~C (Inertsil PREP-ODS, 20 x 250 mm, 0.1 M NH40Ac (pH 7.0), 0-50~
CH3CN/50 min.: linear gradient) to obtain a fraction ' ' ' .' ' ' '. . ' . ' . , ': ' ,: . , .,. ` .. , ! , `: : . ., . ,, " " , . ..

O ~ 2 ~
~6~8 ha~ing a primary peak that eluted at 2~.5 minute~. After applying this to Sep-pak and wa3hing with 20 ml of water, a desalting procedure was performed by eluting with 10 ml of a mixture of methanol and water (1:1, v/v) to obtain the desired ~ub8tance Tr-AGGTGGGTcTG~Ac having an optical density of 28 OD (260 nm) ~approximately 1 mg).

The de~ired substance obtained in this manner, Tr-AGGTGG&TCTGAAAC, was ~ubjected to high-performance liquid chromatography resulting in the confirmation of a single peak.
~; .
The conditions are de~cribed below:
~' Flow rate: 1 ml/min.
Column: Inertsil ODS 2 4.6 x 150 mm Sol~ent: 0.1 M N~40AC (pH 7) Gradient: 0-40~ CH3CN/40 min. (linear) Retention Time: 29.1 min.
' W: Max. 256 nm, Min. 229 nm (~olvent: H20) , '~,~ .

;~
Dimethoxy-Tr-TCG ~ TTGGGAGGT -Dimethoxy (hereina~ter abbreviated a~
~Dm"3-Tr-TcqGGGT~GAGGT wa~ synthesised following the pho~phoroamidite method described in the operation manual of Applied Bio3ystems Inc. and using model 394.
Purification of the compound was performed wikh ;~
preparative C18 reverse phase HPLC.

" .
- The behaviour of this compound under the analysis ' conditions indicated below are a~ follows. - ~ ;
, :1 .
Colum~ used ASAHI PAC ODP-50 Flow rate: 1 ml/min.
., .

'i ' ' ~ .

~ 130 ~96~

Solvent: 0.1 M triethylamine-acetic acid (pH 7.0) acetonitrile 15 to 30~ min.
Retention time: 14.9 minutes ~XAMPLE 3 Dm-Tr-TGGG~GGTGGGTCTG wa~ obtained according to the method of Example 2. The beha~iour of this compound, as determined by reverse phase liquid chromatography, was a~
indicated below.

Column u~ed: ASA~I PAC ODP-50 Flow rate: 1 ml/min.
Solvent: 0.~ M triethylamine-acetic acid (pH
7.0) acetonitrile 15 to 30~/18 min.
Reten~ion time: 15.4 minutes Dm-Tr-TTGGGAGGTGGGTCT waa obtained according to the method of Example 2. The behaviour of thi~ compound, as determined by reverse phase liquid chromatography, was as indicated below. -~

Column u~ed: ASAHI PAC ODP- 50 Flow rate: 1 ml/min.
Solvent: 0.1 M riethylamine-acetic acid (pH ;
7.0) acetonitrile 15 to 30~/18 min.
Retention time: 15.4 minutes ....
,: .:

, Dm-Tr-AGGTGGGTCTGAA~C wa~ obtained accordi~g to the ,~ method of Example 2. The behaviour of this compound, as ~ determined by reverse phase liquid chromatography, wa~ a~ ;
~.' ..

. .
:s ,~-:

2096~
indicated below. ;

Column used: ASAHI PAC ODP-50 Flow rate: 1 ml/min.
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0) acetonitrile 15 to 30~/18 min.
Retention time: 13.2 minutes i' Dm-Tr-ATACTCAGTC~TTTTTAGCA~ was obtained according to the method of Example 2. The behaviour of this compound, a~ determined by reverse pha~e liquid chromatography, was ~ -a~ i~dicated below. `~

Column u~ed: ASAHI P~C ODP-50 Flow rate: 1 ml/min.
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0) :
acetonitrile 20 to 40~/20 min.
Retention time: 14.3 minutea ~ ~
'~ ~ '~"':' EXAMPI~E 7 Dm-Tr- TGC GGGGTGTTCGGGC was obtained according to the ~ ;
method of ~xample 2. The beha~iour of this compound, as determined by reverse phase liquid chromatography, was as indicated below.

Column u~ed: Senshu pak VP-304-4251 Flow rate: 5 ml/mln.
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0) acetonitrile 18 to 30~/15 min.
Retention time: 10.8 minutes -,;.. . , . , . , , ... , , . ".. . . ~ . . . ... , .. ~ . ... . . . . . . . . -O ~ 2 8 E ~ ~-~ 8 Dm-Tr-TG~GTCTGAAACGAT was obtained according to the method of Example 2. The behaviour of thi~ compound, a~
determined by re~erse phase liquid chromatography~ was as indicated below.

Column u~ed: Senshu pak VP-304-~251 Flow rate: 5 ml/min.
Sol~ent: 0.1 M triethylamine-acetic acid (pH
7.0) acetonitrile 18 to 30%/15 min.
Retention time: 11.2 minute,s f Dm-Tr-TAGGTGGGTCTGA~A was obtained according to the method o~ Example 2. The behaviour of this compound, as --determined by reverse phase liquid chromatography, was as indicated below.
~ ~.
Column used: Sen~hu pak VP-304-4251 i Flow rate: 5 mltmin.
Solve~t: 0.1 M triethylamine-acetic acid (pH
7.0) ~ acetonitrile 18 to 30~/15 min.
i Retention time: 12.5 minutes ^' ~' .:
` EXAMPLE 10 ~ ~ `
,, . '', '~
Dm-Tr-~GT~GGTCTGAAACG wa3 obtained according to the method of Example 2. The behaviour of this compound, as determined by reverse phase liquid chromatography, was as indicated below.

Column l-sed: COSMOSIL 5C18-AR (20 mm x 250 mm) , Flow rate: 5 ml/mi~. ~

. . . ;.
.~ .. . .

042 a 2Q96~8 Solvent: 0.1 M triethylamine acetic acid (pH ~ -7.0) acetonitrile 20 to 45~/15 min.
Retention time: 11.2 minute~
.- .
EXI~MPLE 1 :L
.
Dm-Tr-GGTGGGTTGCTTTGA was obtained according to the method o~ Example 2. The behaviour of this compound, as determined by reverse phage liquid chromatoyraphy, was as indicated below.

Column used: COSMOSIh 5C18-AR (20 mm x 250 mm) Flow rate: 5 ml/min.
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0) acetonitrile 20 to 45%/15 min.
Retention time: ~0.8 minute~ ~ -EXAMPLE 1_ `;
~, :- .,, Dm-Tr-~GAGGTGGGTCTGAA wa~ obtained according to the method of Example 2. The behaviour of thi~ compound, as determined by reverse phase liquid chromatography, wa~ as i~dicated below.

Column used: COSMOSIL 5C18-AR (20 mm x 250 mm) Flow rate: 9 ml/min.
Solvent: 0.1 M triethylamine-ace~ic acid (pH
7.0) acetonitrile 20 to 45~/15 min.
Retention time: 11.2 minutes .

Dm-Tr-GGGAGGTGGGTCTGA wa~ obtained according to the method o~ Example 2. The behaviour o~ this compound, as 042a .~ - 13~ -2~9~
determined by reverse pha3e liquid chromatography~ wa9 as indicated below.

Column used Sen~hU pak Vp-3o4-42 Flow rate: 5 ml/min.
Solvent: o.l M triethylamine-acetic acid (pH
7.0) acetonitrile 18 to 30~/15 min.
Retention time: 10.9 minutes Dm-Tr-GTTGGGAGGTGGGTC was obtained according to the method of Example 2. Thie behaviour of this compound, as determined by re~erse phase li~uid chromatography, was as indicated below.

Column used: Senshu pak VP-304-4251 Flow rate: 5 ml/min. :
Solvent: 0.1 M triethylc~ine-acetic acid (pH ::
7~0) : :
acetonitrile 18 to 30~/15 min. ~ : -Retention time: li.5 minutes i i-. ~ .
EX~MPLE lS :~

Dmi-Tr-GGGTTGG~AGGTGGG was obtained according to the method of Example 2. Th~ behaviour of this compound, as determined by reverse pha~e liqiuid chromatography, was a~ :
indicated below.
.i:: :
Column uYed: Senshu pak VP-304-4251 :.::
Flow rate: 5 ml/min. :
Solvent: 0.1 M triethylamine-acetic acid (pH
7.0) ::
acetonitrile 18 to 30~/15 min.
Retention time: 12.7 minuteY : .

1352~9~&-~g .
s~-o-Benzyl ODN-14~ 16CL

It should be noted that ODN-40 represents an Et3N
salt of D~A having a sequence of TGGGAGGTGGGTCTG ~rom the 5~ terminal.

(16a) 5'-0-Lenzylthymidine 3'-0-[(1,1-dimethylethyl)diemthyl~ilyl]thymi`dine was synthesised in the ~ame manner as described in Can. J.
Chem., 56, 2768 (1978). 713 mg (2 mmol) of 3'-0-[tl,I-dimethylethyl)dimethylsilyl] thymidine were dis~olved in 4 ml of tetrahydrofuran, after which 175 mg (4 mmol) of 5S~ NaH were added, whilst keeping the mixture in an atmosphere of argon and whil~t stirring at 60C for `
2 hours. After allowing the temperature to return to room temperature, a solution of 0.238 ml (2 mmol) of benzyl chloride dissolved in 1 ml of tetrahydrofuran wa~ added dropwise thereto, followed by addition o~ 149.9 mg (1 mmol) of NaI and stirring at room temperature. After 21 hours, the solvent was distilled off under reduced pre~sure, and the re~idue wa~ dissolved in 50 ml o~ ethyl acetate. After the resulting 301ution had been washed twice with 50 ml of O.lN HCl, the solution was dried over anhydrous magnesium sulphate. After the solvent had been distilled o~ under reduced`pre~sure, the residue was applied to a 30 g (70-230 me~h) ~ilica gel column and eluted with a 1 ~ methanol-methylene chlori~e solution to obtain 592 mg o~ 3'-0-[(1,1-dime~hylethyl)dimethylsilyl]-5'-0-(benzyl)thymidine.

H-NMR t270MEZ, CDC13) 6ppm~

9.99 (lH, 8), 7.59 (lH, 8), 7.38-7.26 (5H, m), 6.35 (lH, t, J=5.94Hz), 4.58 (2H, 3), g.~7 (1~, m), 3.98 .' ' ,`'~ ` .

. ~

136 - 2 ~9 ~6 ~

(lH, bs), 3.8~-3.60 (2E, mj, 2.32-2.08 (2H, m, H2'), 1.60 (3X, s, CH ), 0.88 (9H, s, (cH3)3c)~ 0-07 (6H, s, CH3-Si) Next, the whole of the compound obtalned as described above was di9solved in 2.64 ml of ~etrahydrofUran, and 2.64 ml of a solution (lM) of tetrabutylammonium fluoride in te~rahydrofuran were added to the resulting solution, followed by stirring at room temperature. After 30 minutes, the ~olve~t was distilled off under reduced pressure, and the re~idue wa~ dissolved in S0 ml of ethyl -acetate, followed by washing twice with 50 ml of a saturated aqueou solution of sodium chloride. After the resulting mixture had been dried over anhydrous magnesium sulphate, the solvent was distilled off under reduced pre3sure, and the residue was applied to a 30 g (230-400 i mesh) silica gel column and eluted with a 2 to 3 ~
solution of methanol-methylene chloride to obtain 392 mg ~ -of (16a) as crystals. ;~

~-NMR (270MHz, CDC13, TMS) ~ppm:
7.59 (lH, 9, H6), 7.35-7.22 (5H, m, Ph), 6.42 (lH, t, -Hl'), J=6.59Hz), 4.56 (2H, s, PhC~2), 4.51 (lH, bs, -H3'), 4.13 (lH, bs, H4'), 3.80-3.65 (2H, m, H5') -2.42-2.12 (2H, m, H2'~, 1.58 (3H, g, CH3) '".`'.
(16b) 5~-0-Benzylthymidine-3~-0-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite 166 mg (0.5 mmol) of the compound 16a in pyridine was subjected to azeotropic diistillation three times to drynesa, after which it waY dissolved in 2.5 ml of tetrahydrofuran. 0.348 ml (2 mmol) of diisopropyl-ethylami~e and 0.223 ml (1 ml) of 2i-cyanoethyl N,N-diisopropylchloropho~phoroamidite were then added to the resulting solution, followe~ by stirring at room temperature in an atmosphere of argon. A~ter 30 minutes, :

2~95~
precipitates were removed by filtration and the solvent was distilled off under reduced pressure. The residue was dissolved in 50 ml of ethyl acetate and washed twice with 50 ml of ice-cooled 10~ aqueous Na2C03, followed by drying over anhydrous sodium ~ulphate. After the solvent ;:
had been distilled off under redu~ed pressure, the residue was applied to a 30 g silica gel column (70-230 mesh) and eluted with methylene chloride : ethyl acetate :
triethylamine (45 : 45 : 10, v/v/v) to obtain 271 mg of 16b.

H-NMR (270MXz, CDC13, TMS) ~ppm:

7.53, 7.56 (lH, 2~, H6), 7.38-7.26 (SH, m, Ph), 6.40 (lH, t, Hl', J=7.32Hz), 4.68-4.55 (lH, m, H3'), 4.60, 4.59 (2~, 29, PhCH23, 4.24, 4.18 (lH, 2m, H4') :~ :
- 3.90-3.55 (6H, m, H5', POCH2, PNCH), 2.65, 2.58 (2H, 2t, CH2CN), 2.52-2.15 (2H, m, ~2'), 1.63 (3H, 9, CH3), 1.18 (12H, d, (C_3)2CH) ~:

(16c) 5'-O-benzyl ODN-12 ;~

A completely protected oligodeoxynucleotide ~ .
derivative, having the sequence of GGGAGGTGGGTCTG from the 5'-terminal and formed on a controll~d pore glass (CPG), and which wa~ synthesised using an automatic synthesiser (CycloneTM Plus), was purchased from Nippon Millipore ~, himited-Milligen/Biosearch.

After immersing 135 mg (approximately 5 ~mol) of the abo~e-mentioned compound in 2 ml of a 3~ solution of dichloroacetic acid and methylene chloride for 1 minute, the compound was ~iltered with a glass filter, and the CPG
beads were collected and wa~hed with methylene chloride. :;~
These CPG bead~ were then dried by azeo~ropic distillation in pyridine.

. ~ .

~ . ~ . : . .. , . . -. , 2 0 9 6 6 _~? 8 Separately, o.g ml of a Solution of 42 mg of lH-tetrazole, drled in advance by azeotropic distillation with pyridine, dis30lved in 1.2 ml of acptonitrile~ were added to a solution i~ which 80 mg (0.15 mmol) of compound 16b, above, were subiected to azeotropic distillation to dryness with pyridine and then dissolved in O.75 ml of acetonitrile. The resulting ~olution was then added to the above-mentioned dried CPG beads and stirred at room -temperature in an atmosphere of argon. AftPr 30 minutes, `--the mixture was filtered with a glass filter and the CPG
beads were collected, and washed with pyridine. 2 ml of a tetrahydrofuran ~olution containing 5~ acetic anhydride, 5% 2,6-lutidine and 3~ N-methylimidazole were added to the ;~
beads obtained in this manner, followed by stirring at room temperature. After 1 minute, the CPG bead~ were collected by filtering with a gla~s filter and then washed with pyridine. 2 ml of a solution of tetrahydrofuran, pyridine and water (40:20:1) containing 0.1 M iodine were ;
added to the resulting CPG beads, followed by additional stirring at room temperature. After 1 minute, the CPG
beads were collected by ~iltering with a glass ~ilter, i`
wa~hed with pyridine and methylene chloride, and then dried under reduced pressure. Approximately 10 ml of concentrated aqueous ammonia was added to the resulting CPG beads followed by ~tirring overnight at room ~-temperature and then stirring for 3 hours at 50C. A~ter this reaction, the CPG beads were removed by filtration and washed twice with 10 ml of water. After combining the filtrate and washing~, the mixture was washed three times with 30 ml of diethylether, and the ammonia and diethylether were removed under reduced pressure. The ;~
re~ulting aqueous ~olution was freeze dried. The residue was dissolved in about 5 ml of 0.1 M an aqueous solution of triethylammo~ium acetate (TEAA) (pH 7.3), and insoluble~ were removed with a 0.45 micron millipore filter. The resulting ~olution was applied in three portion~ to reverse pha~e HPLC (Intertsil PREP-ODS, 20.0 x ,.

, .

0~2a 139 2~96~18 25~ mm, 0.1 M TEEA, pH 7.3; 10-40% CH3cN/30 min-, linear gradient; 9 ml/min.; 254 nm). The fraction that eluted at 14.1 minutes was collected. A~ter removing the acetonitrile under reduced pre~sure and ~reeze drying, the residue was dis~olved in SO ml of water, followed again by freeze drying to obtain amorphous compound 16c having an optical den9ity of 126 OD (260 nm).

UV max: 256 nm 5'-0-Benzhydryl ODN-12 ~17c) (17a) 5'-O-Benzhydrylthymidine , 1.426 g (4 mmol) of 3'-0-[(1,1-dimethylethyl)dimethyl-8ilyl] thymldine were dissolved in 8 ml of tetrahydrofuran, after which 350 mg of 55% NaH were added, in an atmo~phere of argon, whilst stirring at 60C for 2 hour~. After allo~ing the temperature to return to room -temperature, a solution of 988 mg (4 mmol) of Ph2CHBr di~solved in 2 ml of tetrahydrofura~ was added dropwiise thereto, followed by addition of 300 mg (2 mmol) of NaI
and stirring at room temperature. After 17 hour~, the solve~t was distilled off under reduced pressure a~ter which the residue wa~ dis~olved in 50 ml of ethyl acetate. After the resulting ~olution had been wa~hed twice with 50 ml of a ~aturated aqueous sodium chloride, the ~olution was dried over anhydrous magnesium ~ulphate.
After the ~olvent had been distilled off under reduced pre~sure, the rei~idue was dis~olved in 4 ml of tetrahydrofuran followed by addition of 4 ml of a solution (1 M) of tetrabutylammonium fluoride in tetrahydrofuran and stirring at room temperature. After 2 hours, the solvent wa~ distilled off under reduced pressure, the re3idue wa~ di~solved in 50 ml of ethyl acetate, and then f." ~ ,"" ~ "~"'"~ "~ " '`' ~''' ~ 140 - 2~966~g 0~28 washed twice with 50 ml of a saturated aqueOU~ sodium chloride. After the organic layer had been dried over anhydrou9 magne9ium sulphate, the ~olvent was distilled off under reduced pre~sure and the regidue was applied to a 60 g (230-400 mesh) silica gel column to obtain 377.7 mg (23 ~) of compound 17a by elution with a 1 to 2.5%
metha~ol-methylene chloride 901ution. ;~

NMR (270MHz, CDCl3, TMS) ~ppm:
~ ' .
9.85 (lH, bs, NH), 7.56 (lH, ~, H6), 7.38-7.20 (lOH, m, Ph), 6.45 (lH, tl Hl', J=6.92Hz), 5.40 ~1~, 9, :
Ph2CH), 4.62-4.58 (lH, m, H3'), 4.17-4.15 (1~, m, ~--H4'), 3.75-3.58 (2H, m, H5'~, 2.47-2.22 (2H, m, H2'), 1-36 (3H, ~, CH3~
..' ~, (17b) 5'-0-Benzhydrylthymidine-3'-0-(2-cyanoethyl-N,N-dii~opropyl)phosphoramidite ':'.
The procedure of Example 16 was repeated analogously using 204.2 mg (0.5 mmol) of the Compound 17a to give 213.4 mg (70~) of compound 17b.

H-NMR (270MHiz, CDC13, TMS) ~ppm: ~ ~
', :
7.55, 7.51 (lH, 29, Hi6), 7.43-7.22 (lOH, m, Ph), 604a-6.42 (lH, m, Hl'), 5.44, 5.42 (lH, 2s, Ph2CH), 4.73-4.64 (lH, m, ~3'), 4.25, 4.19 (lH, 2bs, H4'), 3.90-3.55 (6H, m, H5', POCH2, PNCH~, 2.68-2.24 (4H, m, H2', NCCH2), 1-.39 (3H, 9, CH3), 1.30-1.10 (12H, ;-m, (C~)2CH) (17c) 5'-0-~enzhydryl ODN-12 -! -This compound, 17c, was synthesised according to the ~ame procedure a~ described in Example 16 using 91 mg (0.15 mmol) of the Compound 17b, above. For purification, . . .

`.,. ': :,. , ., ... ,. , : ` , ., . - ' .: : ' " , .. ~ ', , .. , ., ' , : , ';";'"' i' ','' ' '' "' 'i,'.. "~ '' ' ' "' ,, O ~ 2 8 -~ - 141 ~ 20966~8 Compound 17c was applied in three portion9 to reverse phase HPLC (Inertsil PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3; 0-40% CH3CN/40 min., linear yradienti 9 ml/min.;
254 nm), and the fraction was collected that was eluted at ~ ~-29.2 minutes. After the acetonitrile had been distilled off under reduced pre~sure, the residue wa~ freeze-dried, and it wa9 di9901ved in 50 ml of water, followed again by freeze drying, to obtain amorphous compound 17c having an optical den9ity of 130 OD (260 nm).

W max: 265 nm 5'-O-Trityl ODN-12 (18c) (18b) 5'-O-Tritylthymidine-3'-0-(2-cyanoethyl-N,N-diisopropyl)pho~phoramidite ' 5'-O-tritylthymidine (18a) wa~ ~ynthesised in the same manner a~ described in J. Am. Chem. Soc., 80, 6212 (1958). The procedure of Example 16 was repeated analogously u~ing 969 mg (2 mmol) of Compound 18a to obtain 1.35 g (99 ~) of compound 18b.

H-NMR (270MEz, CDC13, TMS) ~ppm:
7.62, 7.57 (lH, 28, H6), 7.46-7.20 (15H, m, Ph), 6.46-6.37 (lH, m, H1'), 4.68 (lH, bs, H3'), 4.19 and 4.15 (lH, 2bs, H4'), 3.90-3.30 (6H, m, H5', POCH2, PNCH), 2.63-2.28 (4H, m, H2', NCCH2), 1.47 (3H, s, CH3), 1.23-1.00 (12H, m, (CH3)CH) -(18c) 5'-O-Trityl ODN-12 This compound, 18c, was synthesised in the ~ame manner a~ described in Example 16 on a scale of 15 ~mol, but usi~g 308 mg (0.45 mmol) of Compound 18b. For .

, . : ,.: ; . . - . . : i, . :, : :., ~, ,, ~ ;. . : :, .

O ~ 2 8 20~5~
purification~ compound 18c was applied in ten portions to reverse pha9e HPLC (Inertsil PREp-oDs~ 20.0 x 250 mm; 0.1 M TEAA, pH 7.3; 20-50~ CH3CN/20 min., linear gradient; 9 -ml/min.; 2sg nm), and the fraction that eluted at 12.6 minutes wa~ collected. After the ace~onitrile had been distilled off under reduced pressure and the residue was freeze-dried, it was di5901ved in 50 ml of water, followed again by freeze drying, to obtain amorphou~ compound 18c --having an optical density of 464 OD (260 nm).
..'' ~':
Wmax: 256 nm . , 5'-0-(4-Methoxytrityl) ODN-12 (19c) (19b) 5'-0-(4-Methoxytrityl)thymidine-3'-0-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite 5'-0-(4-Methoxytrityl)thymidi~e (compound l9a) was synthe~iSed in the ~ame manner as de cribed in J. Am.
Chem. Soc., 85, 3821 (1963). The procedure of Example 16 was repeated analogou ly, but u~ing 257.3 g (0.5 mmol) of Compound l9a to obtain 261.9 mg (73 ~) of the compound l9b.

H-NMR (270MEz, CDC13, TMS) ~ppm:
7.64, 7.59 (lH, 2s, H6), 7.46~7.20, 6,88-6.82 (14H, m, ;-Ph), 6.46-6.39 (lH, m, H1'), 4.73-4.62 (lH, m, H3'), 4.19, 4.15 (lH, 2bs, H4'), 3.90-3.30 (6H, M, H5', POCH2, PNCH), 3.78 (3H, 9, C~30), 2.66-2.29 (4H, m, H2', NCC~2), 1.46 (3H, 8j CH3), 1.17 (12H, d, ! ''.. ''' '.
(CH3)2CH, ~=7.26Hz) -:.
(19c) 5'-0-(4-Methoxytrityl) ODN-12 ~;

This compound, l9c, was synthe~ised according to the ~ame method as described in Example 16, but using 107 mg ., ~ .: . ,.

,. .

.

O ~ 2 8 - 143 - 2 0 ~ 6 (0.15 mmol) of compound l9b. For purification~ Compound l9c was applied in three portions to reverse phase HPLC-(Inert3il PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
20-53% CH3CN/30 min., linear gradient; 9 ml/min.; 254 nm), and the fraction that eluted at 14.4 minutes was collected. After the acetonitrile had been di~tilled off under reduced pre~3ure, the re~idue wa3 freeze-dried, and it was dissolved in 50 ml of wa~er, followed again by freeze drying, to obtain amorphous compound l9c having an optical density of 91 OD (260 nm).

Wmax: 256 nm 5'-0-(~,5-Dibenzyloxy)benzyl ODN-12 (20c) (20a) 51 0 (3,5-Dibenzyloxy)benzylthymidine 3,5-(Dihenzyloxy)benzylbromide was synthesi~ed by the method described in Chem. ~er., 02, 2887 (1969). The procedure de~cribed i~ Exampl~ 17 was repeated analogously, but using 713 mg (2 ~Imol) of 3'-O-[(l,l-dimethylethyl)dimethylsilyl]thymidine and 767 mg (2 mmol) of 3,5-(dibenzyloxy)benzylbromide to obtain 258.5 mg (23~) of compound 20a.

H-NMR (270 MXz, CDC13, TMS) ~ppm:

7.87 (lH, 9, NH), 7.52 (lH, s, H6), 7.43-7.27, 6.59-6.52 (13H, m, Ph), 6.37 (lH, t, Hl', ~=6.75Hz), 5.03 (4H, 9, PhCH2), 4.51 (2H, d, PhCH20CH2, J=3.30Hz), 4.50-4.44 (lH, m, H3'), 4.06-4.03 (lH, m, H4'), 3.77-3.63 (2H, m, H5'), 2.32-2.12 (2H, m, H2'), 1.67 (3H, 9, CH3) .,.. , .. ... , . .. . , ,, . ............... . . . - , .

,: ~. . ~ . . . .
;, , .. . . : . . , 2096~
(20b) 5~-o-(3/5-Dibenzyloxy)ben~ylthymidine-3J-o-(2-cyano-ethyl-N/N-diisopropyl)phogphoramidite ~

The procedllre of ~xample 17 wa9 rep~ated analogou~ly, but using 258.5 mg (0.475 mmol) of Compound 20a to give 307.7 mg (87~) of compound 20b. -~

H-NMR (270 M~iz, CDC13, TMS) ~ppm 7.56, 7.53 (lH, 2g, H6), 7.42-7.28, 6.56 (13H, m, Ph), 6.40 (lH, t, H1~, J=6.60Hz~, 5.02 (4H, 8, PhCH2), 4.67-4.58 (lHi m, H3'), 4.53, 4.51 (2~i, 2~, PhCH2OCH2), 4~23, 4.17 (lH, 2bs, H4~), 3.90-3.52 (6H, m, ~5~ POCH2, PNC~), 2.68-2.53 (2H, m, NCC_2), 2.49-2.12 (2H, m, H2'), 1.65 ~3H, ~, CH3), 1.1~ (12H, d, (CHi3)2C~, J=5.g4Hz) `;~
~.
(20c) 5'-0-(3,5-Dibenzyloxy)benzyl ODN-12 .

Thi9 compound, 20c, waR synthesised according to the same procedure as de3cribed in Example 17, butfusing 112 m~ (0.15 mmol) of Compound 20b. For purification, Compound 20c wa~ applied in 3 3eparate applications to reverse phase HPLC (Inertsil PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3; 20-50% CH3CN/30 min., linear gradient; 9 ml/min.; 254 nm), and the fraction was collected that eluted at 15.7 minutes. After the acetonitrile had been di~tilled off under reduced pressure, the residue was freeze-dried, and it wa3 di~olved in 50 ml of water, -followed again by freeze drying, to obtain amorphous compound 20c having-a~ optical density of 85 OD (260 nm).
~. .. ..
Wrnax: 256 nm , .
, ' .: .
.

;,, ' ,, : :, . , . ,; . ,, ! " ,, .

209G6~8 ~ EXAMP~LE 21 ~ , , 5'-0-{3,5-gig~3,5- (dihenzyloxy~benzvloxylbenzy--l} ,;
ODN-12 (21c) (21a) 5l-o-{3/5-~ 3~5-(dibenzyloxy)benzyloxy]benzyl}
thymidine 3~5-Bis~3~s-(dibenzyloxy)benzyloxy]benzylbromide was i3ynthesised by ~he method descr.ibed in Chem. Ber., 10~, 2887 (1969). The procedure of Example 17 wai~ repeated `~-analogouisly, but using 713 mg (2 mmol) of 3'-O-[(1,1-dimethylethyl~dimethyl~ilyl]thymidine and 1.61 g (2 mmol) of 3,5-bis[3,5-(dibenzyloxy)benzyloxy]-benzylbromide to obtain 381 mg (20~) of compound 21a.
~ ~ .
- l~ NMR (270 MHz, CDC13, TMS) ~ppm:

7.86 (lH, g, NH), 7.52(1H, 5, H6), 7.45-7.2a, 6.68-6.50 (29H, m, Ph), 6.35 (lH, t, Hl', J=8.10Hz), 5.03 (8H, 8, PhCH2), 4.98 (4H, 8, PhCH2), 4.50 (2H, dd, PhCH2), 4.42-4.3a (lH, m, H3'), 4.03-3.98 (lH, m, H4'), 3.73-3.59 (2H, m, H5'), 2.30-2.09 (2H, m, H2'), 1.70 (3H, 9, CH3) ~' (21b) 5'-0-{3,5-~i~[3,5-(dibenzylo~rt)benzyloxy]benzyl}
thymidine-3'-0-(2-cyanoethyl-N,N-diisopropylJ-pho3phoramidite , ....
The procedure of Example 18 w~s repeated analogously, but u~ing 242 mg (0.25 mmol) of Compound 21a, to gi~e -146 mg (50~) of compound 21b.

~H-NMR (270 MHz, CDCl3, TMS) ~ppm: -7.56, 7.53 (lH, 25, H6), 7.45-7.28, 6.66, 6.5~-6.52 (29H, m, Ph), 5.01 (8H, 9, PhCH2), 4.95 (4H 9, ~` - 146 2~g66~ 0~2g .

PhC_2), 4.66-4.57 (lH, m, H3'), 4.52, 4-51 (2H, 29, PhCH2), 4.22, 4.16 (lH, 2bs, H4'), 3.83-3.34 (6H, m, H5', POCH2, PNCH), 2.69-1.77 (~ m, H2~, NCCH2), 1.66 (3H, ~, CH3), 1.30-1.08 (12H, m, (CH3)2CH) (21c) s~-o-{3~s-Bis[3~5-(dibenzyloxy)benzyloxy]benzyl}

This compound, 21c, was synthesised according to the ~ame procedure as described in Example 18 using 146 mg (0.125 mmol) of Compound ~lb. For purification, Compo~nd `~
21c was applied in two portions to reverse pha~e HPLC
(I~ert~il PRE~-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
20-70i~ CH3CN/50 min., linear gradient; 9 ml/min.; 254 nmi), and the fraction that eluted at 36.6 minute~ was collected. After the iacetonitrile had been di~tilled off und~r reduced pressurei, the residue was freeze-dried, and it was dis~olved in 50 ml of water, followed again by freeze drying, to obtain amorphou~ compound 21c having an optical density of~g9 OD (260 nm).
, UVmax: 256 nm "' 5'-0-(2-Na~hthylmethylL ODN-12 (22c) (22a) 5'-0-(2-Naphthylmeth~l)thymidine The procedure of Example 17 wa3 repeated analogously, but using 480.5 mg (1.35 mmol) of 3'-0-~(1,1-dimethyl- ; `
ethyl)dimethyl~ilyl]thymidine and 298 mg (1.35 mmol) of `~
2-bromomethylnaphthalene, to obtain 179.5 mg (35%) of compound 22a.

H-NMR (270 iMHz, CDC13-CD30D, TMS) ~ppm:
7.88-7.77, 7.53-7.43 (7H, m, naphtyl), 7.61 (lH, 9, - 147 - 209~6~

H6~, 6.35 (lH, t, Hl~, J=6.60Hz), 4.76 (2H, s, CH2), 4.52-4.~7 (lH, m, H3'), 4.11-4.09 (lH, m, H4 ), 3.89-3.71 (2H, m, H5'), 2.38-2.14 (2H, m, H2'), 1-54 :~
(3H, s, CH3) (22b) 5~-0-(2-Naphthylmethyl)thymidine-3~-0-(2-cyano-ethyl-N,N-diisopropyl)phogphoramidite The procedure of Example 16 was repeated analogously, but using 179.5 mg (0.47 mmol) of Compound 22b, to give 165 mg (60~) of compound 22h.

H-NMR (270 MHz, CDCl3, TMS) ~ppm:

7.~8-7.77 and 7.52-7.42 (7E, m, naphtyl), 7.60, 7.57 tlH, 2~, H6), 6.40 (lH, t, Hl~, J=5.94Hz), 4.81-4.71 (2H, m, CH23, 4.67-4.58 (lH, m, H3~), 4.24, 4.18 (lH, 2bs, H4'), 3.90-3.50 (6H, m, H5'~ POC_2, PNCH), 2.68-2.15 (4H, m, H2~, NCCH2), 1.5~, 1.56 (3H, 2e, ; :
CH3) 1.17 (12H, d, (CH3)2C~, J=6.60Kz) (22c) 5'-0-(2-Naphthylmethyl) ODN-12 -This compound, 22c, was synthe~i~ed according to the same procedure as described in Example 16, but u~ing 87 mg (0.15 mmol) of Compound 22b. For purification, Compound 22c wa~ applied in two portion~ to rever~e phase HPLC
(Inertsil PR~P-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
10-40~ CH3CN/30 min., linear gradient; 9 ml/min.; 254 nm3, and the fraction that eluted at 17.6 minutes was collected. After th~ acetonitrile had been distilled off under reduced pressure, the re~idue wa~ freeze-dried, and.
it was dissolved in 50 ml of water, followed again by ~reeze drying, to obtain amorphous compound 22c having an optical den~ity of 141.6 OD (260 nm).

W max: 256 nm :

"~ . , '.~, ~ ' ;.. ' ',"' . ' . ' ". , - 148 - 20~6~ 0~28 5'-BenzylthiO-5'-deoxy ODN-12 (23c) (23a) 5~-~enzylthio-5~-deOxythymidine .
: 5'-deoxy-s~-mercapto- ~ -thymidine (775 mg, 3.0 mmol) was di~solved in acetone (20 ~`
ml), follow~d by addition of benzylbromide (564 mg, 3.3 :
mmol) and ~odium carbonate ~660 mg, 6.6 mmol) and stirring at room temperature for 17 hours in a drying atmosphere.
After any insoluble ~alt had been removed by filtration, the solvent was distilled off under reduced pressure. The ~ `
residue wa~ disaolved in methylene chloride (40 ml), and the resulting solution was washed twice with 2~ ml of water, followed by drying over anhydrous magnesium : sulphate. The solvent was distilled off under reduced pressure to obtain a caramel-like residue. This was ~`
dissolved in 10 ml of ethanol and left to stand in a !`
refrigerator overnight to g~ive 451 mg of the desired compound in white prism crystals.

H-NMR (270 ~Hz, DMSO-d6) ~ppm~

11.28 (lH, 9, NH), 7.46 (lH, s, H6), 7.46-7.21 (5H, m, : Ph) 6.61 (lH, t, J=6.8, 7.3Hz, H1'3, 5.32 (lH, d, .
4.4Hz, OH,), 4.15 (lH, m, H3'~, 3.83 (lH, m, H4'), 3.78 (2H, s, PhCH2), 2.78-2.59 (2H, m, H5'), :.
2.25-2.00 (2H, m, H2'), 1.77 (3H, ~, C~3 .
(23b) 5'-Benzylthio-5'-deoxythymidine-3'-0-(2-cyano~
ethyl-N,N-diisopropyl)phosphoramidite ~ :

The procedure of Example 16 was repeated analogously, but ueing 174 mg (0.5 mmol) of Compound 23a to give 262 mg (95%) of compound 23D.

''': ' ~ - 149 2096~8 H-NMR (270 MXz, CDcl3/ TMS) ppm 7.37 (lH, g, H6), 7.34-7.20 (sH~ m, Ph), 6.32-6.25 (lH, m, Hl'), ~,49-4.38 (lH, m, H3~), 4.18-4.08 (lH, m, H4'~, 3.90-3.50 (6H, m, PhC~2, POCH2, PNCH), 2.87-2.68 (2H, m, H5'), 2.67-2.56 (2H, m, NCCH2), 2.55-2.12 (2H, m, H2'), 1.91 (3H, s, CH3), 1.20-1.15 (12H, m, (C~3)CH~

(23c) 5'-Benzylthio-5'-deoXy ODN-12 This compound, 23c, was ~ynthesi~ed according to the same procedure as described in Example 16, but using 82 mg (0.15 mmol) of Compound 23b. For purification, Compound 23c was applied in three portion3 to reverse phase HPLC
(Inertsil PR~P-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
0-40~ CH3CN~40 min., linear gradient; 9 ml/min.; 254 nm), and the fraction that eluted at 25.8 mlnutes was collected. After the acetonitrile had been distilled off under reduced pres~ure, the residue wa~ freeze-dried~ and it was dissolved i~ 50 ml of water, followed again by freeze drying, to obtain amorphou~ compound 23c having an optical den~ity of 46 OD (260 nm).

W max: 256 nm ~XAMPLE 24 5'-Diphenylmethylthio-5'-deoxy ODN-12 (24c) - - ~
(24a) 5~-Diphenylmethylthio-5'-deoxythymidine 5'-deoxy-5'-mercaptothymidine (516 mg, 2.0 mmol) was dis~olved in acetone (320 ml), followed by addition Of diphenylmethyl bromide (741 mg, 3.0 mmol) and ~odium carbonate (1.0 g) and refluxing for 5 hours in a dxying -, , atmosphere. After confirming the ab3ence of the starting .

, ~, , : , .

~- - 150 - 209&6~8 substance with TLC (using methylene chloride containing 10~ metha~ol as the developer), any insolubles were removed by filtration. After distilling off the solvent undex reduced pressure and dissolvlng the residue in a small amount of me~hylene chloride, the solution was applied to a silica gel column and purified by allowing to ~low off with methylene chloxide containing 5~ methanol.
The re~idue obtained by collecting the major peak and concentrating to dryness was crystallised from ethanol to obtain 334 mg of the desired product in the form of a - -colorless powdery crystal.

H NMR (270 MHz, DMSO-d6) ~ppm:

11.28 (lH, s, NH)/ 7.47-7.20 (llH, m, H6, Bzh-ph), 6.15 (lH, t, J=6.8Hz, H1'), 5.37-5.32 (2H, m, OH, Ph2CH), 4.16-4.12 (lH, m, H3'), 3.85-3.79 (lH, m, H4'), 2.71-2.50 (2H, m, H5'), 2.21-2.00 (2H, m, H2'), 1.79 (3H, s, C_3) , . ...
(24b) 5'-Diphenylmethylthio-5'-deoxythymidine-3'-O-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite The procedure of Example 16 was repeated analogously, but using 212 mg (0.5 mmol) of Compound 24a, to ~ive 253.7 -mg (81~) of compound 24b.

H-NMR (270 MHz, CDCl3, TMS) ~ppm:

7.47-7.17 (llH, m, Ph, H6), 6.35-6.27 (lH, m, H1'), 5.29, 5.27 (lH, 2s, Ph2CH), 4.50-4.40 (lH, m, H3'), 4.19-4.10 (lH, m, H4'), 3.92-3.50 (4H, m, POCH2, PNCH), 2.80-2.10 (6H, m, H2', H5', NCC_2), 1.77 (3H, ~, CH3), 1.20-1.15 (12H, m, (CH3)CH) , .

2~9~6~8 (24c) 5~-Diphenylmethylthio-5'-deoxy ODN-12 This compound, 24c, was synthesised according to the ~ame procedure as described in Example 16, but using 94 mg (0.15 mmol) of Compound 24b. For purification) Compound 24c was applied in three portions to reverse phase HPLC
(Inertsil PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
0-50% CH3CN/50 min., linear gradient; 9 ml/min.; 254 nm), and the fraction that eluted at 30.3 minutes was collected. After the acetonitrile had been distilled off under reduced pressure, the residue was freeze-dried, and it wais dissolved in 50 ml of water, followed again by freeze drying, to obtain amorphous compound 24c having an optical density of 73 OD (260 nm).

W max: 256 nm 5'-Triphenylmethylthio-5'-deoxy ODN-12 (25cJ

(25a) 5'-Triphenylmethylthio-5'-deoxythymidine 5'-deoxy-5'-mercaptothymidine (775 mg, 3.0 mmol) was dis~olved in dry pyridine (20 ml), and the resulting solution was dissolved in trityl chloride (920 mg, 3.3 mmol), followed by ~tirring at 50C for 2 hours. After water (1 ml) had been added to the solution and the resulting mixture stirred at room temperature for 15 minutes, the solvent was distilled off under reduced pressure. The residue was then dissolved in methylene chloride (50 ml) and then washed with 40 ml each of a saturated aqueous sodium chloride, 0.2 N HCl and a saturated aqueous sodium chloride. Each of the aqueous layers was then wa3hed in ~equence with 20 ml of methylene chloride, and then combined with the organic layer and dried over anhydrous magnesium sulphate. The solvent was . . ~ ; ~ . , , . ; .

O ~ 2 B
. ~ ` 2 ~

then concentrated to dryness to obtain a yellowish-white residue. This residue was dissol~ed in a small amount of methylene chloride and applied to silica gel column chromatography packed with methylene chloride. After eluting with a mixed solvent of cyclohexane and ethyl acetate in a ratio of 2:1, the ma~or peak was collected and concentrated to dryness to obtain 437 mg of the desired substance in the form of a caramel-like substance producing a single spot in TLC (using methylene chloride containing 5~ methanol a~ the developer).
. ...
H-~MR (270 MHz, DMSO-d6) ~ppm: ~

11.28 (lH, s, NH), 7.40-7.20 (16H, m, H6, Ph3C), , 6.07 (lH, dd, J=6.84, 7.32Hz, H1'), 5.26 (lH, d, J=4.40Hz, OH), 3.99-3.94 (lH, m, H3'), 3.60-3.55 (lH, m, H4'), 2.50-2.30 ~2H, m, H5'), 2.18-1.94 (2H, m, H2'), 1.75 (3H, s, CH3) (25b) 5'-Triphenylmethylthio-5'-deoxythymidine-3'-0-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite The procedure of Example 16 was repeated analogously, but using 250 mg (0.5 mmol) of Compound 25b, to give 231 -~-mg (66~) o~ compound 25b.

H-NMR (270 MHz, CDC13, TMS) ~ppm~

7.48-7.15 (16H, m, H6, Ph3C), 6.27-6.17 (lH, m, H1'), 4.22-4.19 (lH, m, H3'), 4.06, 4.00 (lH, 2bs, H4'), 3.85-3.40 (4H, m, POCH2, PNCH), 2.67-1.95 (6H, m, H2', H5', NCCH2), 1.83 (3H, e, CH3), 1.20-1.10 (12H, m, CH ) CH) (25c) 5'-Triphenylmethylthio-5'-deoxy ODN-12 This compound, 25c, was synthesised according to the .
, .

... . .. . . . . . ~ . . . . ... . . . . . . . .

~ 153 - 2~9~

same procedure as described in Example 1 on a scale of 2 ~mol using 42 mg (0.06 mmol) of Compound 25b. For purification, Compound 25c was applied in two portions to reverse phase HPLC (Inertsil PREP-ODS, 20.0 x 250 mm; 0.1 M TEf~A, pH 7.3; 20-50% CH3CN/20 min., linear gradient; 9 ml/min.; 254 ~m), and the fraction that eluted at 13.1 minutes was collected. After the acetonitrile had been distilled off under reduced pre~sure, the residue was freeze-dried, and it was di~solved in 50 ml of water followed again by freeze drying to obtain amorphous 25c having an optical density of 38 OD (260 nm).

W max: 256 nm E~AMPLE 26 5'-Hexadecylthio-5'-deoxy (ODN)-12 (26b) (26a) 5 J -Hexadecylthio-5'-deox~ffthymidine 5'-deoxy-5'-mercaptothymidine (258 my, 1 mmol) was dissolved in acetone (20 ml), and hexadecyl bromide (457 mg, 1.5 mmol) and sodium carbonate (500 mg) were added to the resulting solution, followed by refluxing for 3 hours in a dryfing atmosphere.

I~soluble~ were removed by filtration and the solvent was distilled off under reduced preYsure. The residue was dissolved in a small amount of methylene chloride and the solution wa~ applied to silica gel column chromatography packed with methylene chloride and eluted with methylene chloride containing 5~ methanol. The major peak was collected, and the solvent was distilled off to obtain 303 mg of the desired product in the form of a colorless caramel-like substance.

lH-NMR (270 MHz, DMSO-d6) ~ppmo .~ ' .
.~, ~ ., . . . ,, , . , ....... . .... . . . ~ , - . . . . .. .. .... . . ...

; ~ ~ f ; ;

_~ 154 2 0 9 6 ~ ~ 8 11.28 (lH, s, NH3, 6.61 (lH, dd, J=6.35, 7.82Hz, H1'), 5.31 (lH, d,- J=4.40Hz, OH), 4.19-4.12 (lX, m, H3'), 3.84-3.79 (lH, m, H4'), 2.83-2.68 (2H, m, H5'), 2.58-2.47 (2H, m, CH2), 2.25-2.00 (2H, m, H2'), 1.79 (3H, s, 5CH3), 1.57-1.45 (2H, m, CH2), 1.30-1.23 (26H, s, CH2), 0.85 (3H, t, J=6.83Hz, CH3) (26b) 5'-Hexadecylthio-5'-deoxythymidine-3'-0-(2-cyano-ethyl-N,N-diisopropyl)phosphoramidite , The procedure of Example 16 was repeated analogously, but using 241 mg (0.5 mmol) of Compound 26a, to give 193 mg (56~) of compound 26b.
,,.
H-NMR (270 MHz, CDCl3, TMS) ~ppm:

7.46-7.41 (lH, 28, H6), 6.29 (lH,-t, H1', J=7.26Hz), 4.55-4.g5 (lH, m, H3'), 4.22-4.12 (lH, m, H4'), 3.92-3.54 (4H, m, POCH2, PNCH), 2.93-2.17 (6H, m, H2', H5', NCCH2), 1.93 (3H, s, CH3), 1.60 (2H, bs, CH2S), 1.26 (30H, 9, CH2), 1.20 (12H, d, ~ -(C_l)2CH, J=6.60Hz), 0.88 (3H, t, CH3, J=7.00Hz) ;;~;;

(26c) 5'-Hexadecylthio-5'-deoxy ODN-12 This compound, 26c, was synthesised according to the same procedure as described in Example 16 using 102 mg (0.15 mmol) of Compound 26b. For purification, Compound 26c wa3 applied in three portions to reverse phase HP~C
(Inert~il PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
10 70~ CH3CN/60 min., linear gradient; 9 ml/min.; 254 nm), and the fraction that eluted at 42.3 minutes was collected. A~ter the acetonitrile had been distilled off under reduced pressure, the residue was freeze-dried, and ~.
it was dissolved in 50 ml of water, followed again by freeze drying, to obtain amorphous compound 26c having an optical den~ity of 81 OD (260 nm).
:: `

~ , - 15S
2~9~
Wmaxo 256 nm .

$'-(12-Tri~henylmethyloxydodecylthio)-S'-deoxy ODN-122 (27a) (27a) 5'-(12-Triphenylmethyloxydodecylthio)-5'-deoxy-thymidine 51-deoxy-5'-mercaptothymidine (516 mg, 2.0 mmol) were dissolved in acetone (30 ml), followed by addition of 12-hydroxydodecyl bromide (1.06 g, 4 mmol) and sodium carbonate (2 g) and heating under reflux for 3 hours in a drying atmosphere. After confirming that the starting substance was no longer present with TLC (using methylene ~ ~-chloride containing 5~ methanol as the developer) and filtering out insolubles, the solvent was distilled off under xeduced pressure. The residue was applied to silica gel column chromatography packed with methylene chloride ~ -and eluted with methylene chloride containing 3 methanol. The major peak was collected and the solvent was distilled off to obtain 712 mg of 5'-deoxy-5'-(12-hydroxydodecylthio)thymidine in the form of a colourless cari~mel-lik~ substance. This caramel-like substance ~589 mg, 1.30 mmol) was dissolved in anhydrous pyridine (30 ml) followed by addition of trityl chloride (541 mg, 1.95 mmol) and stirring at 70C for 4 hourY in a drying atmosphere. The solvent was then distilled off under reduced pressure and the residue was dissolved in methylene chloride (30 ml), and the resulting solution was wa~hed with 30 ml each of a saturated aqueous solution of sodium chloride, 0.2 N HCl, a saturated aqueous solution of ~odium chloride and a saturated aqueous solution ~f sodium hydrogencarbonate. The aqueous layers were then ~;~
washed in sequence with 20 ml of methylene chloride, combined with the organic layer and dried over anhydrous -~, ~
:'.
': .

~ 156 -209g6:~8 magnesium sulphate. The ~olvent was then concentrated to dryness under reduced pressure. The re~idue was di3solved -in a 9mall amount of methylene chloride and applied to ~ilica gel column chromatography packed with methylene ~ -chloride and eluted with methylene chloride containing 5~ ~-methanol. The major peak wa~ collected and ~he 301vent was distilled off. The re~idue wa~ then freeze dried with cyclohexane to obtain 757 mg of the desired compolmd in the form of a yellowish-white powdery substance.

H-NMR (270 MHz, DMSO-d63 ~ppm: ~

11.28 (lH, 8, NH), 7.50 (lH, ~, 6H), 7.38-7.21 (15H, m, Ph~, 6.16 (lH, t, J=6.34Hz, H1'), 5.31 (lH, d, J=4.4Hz, 0_), 4.17-4.14 (lH, m, H3'~, 3.83-3.80 (lH, m, H4'), 2.95 (2H, t, J=6.35, CH2), 2.77-2.73 (2H, m, H5'), 2.20-2.05 (2H, m, H2'), 1.78 ~3H, s, CH3), 1.10-1.60 (20H, m, CH2) .
~27b) 5'-(12-Triphenylme~hyloxydodecylthio)-5'-deoxy-thymidine-3'-0-(2-cyanoethyl-N,N-dii30propyl)-phosphoramidite ~. .
The procedure of Example 16 wa~ repeated a~alogously, but using 342 mg (0.5 mmol) of Co~ound 27a, to give 423.8 '~ mg (96%) of compound ~b H-NMR (270 MHz, CDCl3, TMS) ~ppm:

7.55-7.22 (16H, m, H~, Ph3C), 6.3~ ~lH, t, H1', J=6.60Hz), 4.61-4.51 (lH, m, H3), 4.30-4.12 (lH, m, ;
H4'), 3.97-3.55 (4H, m, POC_2i PNCH), 3.10 (2H, t, CH2, J=6.40Hz), 2.99 2.20 (8H, m, H2', H5', NCCH2, ¦ CH2S), 1.97 (3H, 8, CH3), 1.72-1.25 (lOH, m, CH2), 1.25 (12H, d, (C~)2CH, J=7.26Hz), 1.09 (3H, t, CH3, ~=7.26Hz) , O ~ 2 ~
-- - 157 - 2 ~ ~6 (27c) 5'-(12-Triphenylmethyloxydodecylthio)-5'-deoxy This compound, 27c, was synthesised according to the same procedure as described in ~xample 16 using 133 mg (0.15 mmol) of Compound 27b. For purification, Compound 27b was applied in three portions to reverse phase HPLC
(Iner~sil PREP-ODS, 20.0 x 250 mm; 0.1 M TEAA, pH 7.3;
20-70~ CH3CN/50 min., linear gradient; 9 ml/min.; 254 nm), and the fraction was collected that elute~ at 36.0 minute~. After the acetonitrile had been disti~led off ~i under reduced pressure, the residue was freeze-dried, and it was dissolved in 50.ml of water, followed again by freeze drying to obtain amorphous compound 27c having an optical density of 48 OD (260 nm).

Wmax: 256 nm -Phosphorothioate type DmTrODN-12 of the compound of Ex~mple 3 -~
. .
The phosphorothioate type DmTrODN-12 was synthesised using the model 394 according to the phosphoroamidite method available from Applied Bio~ystems Inc. following the User's Manual. Purification of the compound was performed using the preparative C18 reverse phase HPLC.
The conditions are as follows.

Flow rate: 9 ml Column: COSMOSIL 5C18-AR (20 x 250 mm) Solvent: 0.1 M triethylamine acetic acid (pH 7.0) `
acetonitrile 15 to 30 ~ ~
Retention time: 14.04 min, 14.63 min.
'' ,.', ' '' ' ' ' ' ~
.. ' ' '~;
' ' .' ~

O ~ 2 8 - 158 ~ 209~

Dm-Tr-CAA~GTCTGGGTGGA (comparative compound No. 1) was obtained following the procedure of Ex~mple 2. The behaviour of this compound in rever~e phase liquid chromatography was as follows.

Column used: Waters Microbondapack C18 Flow rate : 1 ml/min Solvent: O.l M triethylamine-acetic acid (pH 7.0) acetonitrile 15 to 30 i%/20 min Retention time: 16.6 min :

COMP~RATIVE EXAMPLE 2 ' .

Dm-Tr-GTCTGGGTGGAGGGT was synthesised in the same manner as in Comparative example 1.

COMPARATIV~ EXAMPLE 3 Dm-Tr-ACCCTCCACCC~GAC was synthesised in the ~ame manner as in Comparative example 1. -~
'' COMPARATIVE EXAMP~E 4 :

Dm-Tr-TTTTTTTTTTTTTTT was synthesised in the same manner as in Comparative example 1. :~
.: .
TEST EXAMPLE 1 ~ .
Inhibitory Effects on HIV Replication .

The anti-HIV activity of unmodified naturally occurring anti-sense oligonucleotides having a base sequence homologous to the compound of the present invention, a~ well as corresponding non~en~e , - . , , . - . - , - . .. . .. , . .. " , . . .. ... . . .

O ~ 2 ô
- 159 - 2~9~8 oligonucleotides was determined with respect to the vicinity of the splicing acceptor site of pre-mRNA of HIV
tat and rev.

Anti-HIV activity was determined according to conventional methods [R. Pauwel et al., J. Virological Methods 20, 309-321 (1988)].

More specifically, cell pellets obtained by centrifuging MT-4 cells in the logarithmic growth phase for 5 minutes at 150 x g were infected with HIV at 37C
for 1 hour at a concentration of ~4 CCID50. :
HIV-infected MT-4 cells were then obtained by centrifuging the cells in 10~ fetal bovine serum containing RPMI-1640 medium (to be referred to as "~erum medium") and washing. -~
., The HXV-infected MT-4 cells as well as mock-infected MT-4 cells were suspe~ded in serum medium at a concentration of 4 x 105 cells/ml, respectively.
100 ~l each of previously stepwise-diluted solutions of -the specimen compounds (suspended in serum medium) were placed in each of the wells of a 96-well plastic ~ ~
microtiter plate. Next, 100 ~1 each of the ;
abo~e-mentioned cell suspensions was placed in each of the wells, followed by ~ulturing while allowing ~he plate to ~;-stand at 37~C for ~days in the presence of 5~ carbon dioxide gas. ~
:: -HIV-infected MT-4 cells to which the ~pecimen compound had been added, as well as mock-infected MT-4 cells to which the specimen compound had not been added were cultured in the same manner.
I
After completion of culturing, the cells were assayed based on the MTT 13-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] method lh.M. Green et al., J.
Immunolo. Methods, 70, 257-268 (1984)] to determine the '~' 0 4 2 ~

': ' .
HIV-induced cytocidal activity. The concentration of specimen that i~hibited 50~ of the HIV-induced cytocidal activity in HIV-infected MT-4 cells (effective dose, ED50) was determined by taking the activity of HIV-infected MT-4 cells to which the specimen compound was added to be 100~, and taking the cytotoxic activity of non-HIV-infected MT-4 cells to which the specimen compound ~:
was not added to be 0~.

a In addition, ~he concentration that suppressed the proliferation of~HIV-infected MT-4 cells to 50~ (CD50) was determined as an indication of the cytotoxic activity :. .
of the specimen compound, and the value of CD50/ED50 ~ -waY taken to be the selectivity index (S. I.) of anti-HIV
activity.
:, Tho~e results are indicated in Table 1. : :
;

.
~ .

; . ~ ., O ~ 2 8 6 3 ~

.
Test compounds and their HIV activity , ,:
Example ~ase sequence ED50 CD50 Selectivity : No. (~g/ml)(~g/ml) index :. . ;. , ,:
1 AGGTGGGTCTGAAAC 6.5 >100 >15 :.
2 TCGG~GTT&GGAGGT 7.0 >100 ~14.3 .;~
3 TGGGAGGTGGGTCTG 4.0 ~100 ~25 ;
4 TTGGGAGGTGGGTCT 2.2 ~100 ~45 ;
AGGTGGGTCTGAAAC 7.2 ~100 ~13 `
8 TGGGTCTGA~ACGAT 4.0 ~100 ~25 9 TAGGTGGGTCTGAAAC .12.5 ~100 ~8 .~:~
GGTGGGTCTGAAACG 11.0 ~100 ~9.1 .
12 GGAGGTGGGTCTGAA 18.0 ~100 ~5.6 .. :. :
13 GGGAGGTGGGTCTGA 9.O ~100 ~11.1 :
14 GTTGGGAGGTGGGTC 10.0 ~100 >10 GGGTTGGGAGGTGGG 8.5 >100 ~11.8 ~ .
.:: .
17 TGGGAGGTGGGTCTG 6.2 ~100 ~16.6 18 TGGGAGGTGGGTCTG 5.2 ~400 ~76.5 ~.
19 TGGGAGGTGGGTCTG 8.0 ~100 ~12.5 ::
TGGGAGGTGGGTCTG 4.3 90 ~20.9 :.
22 TGGGAGGTGGGTCTG 7.4 ~100 ~13.S
24 TGGGAGGTGGGTCTG 2.5 ~100 ~40 TGGGAGGTGGGTCTG 7.2 ~100 ~13.8 26 TGGGAGGTGGGTCTG 12.5 ~100 ~8 ' :
27 TGGGAGGTGGGTCTG 34 ~100 ~2.9 .:
28 TGGGAGGTGGGTCT5.5~100 ~18.2 29 TGGGAGGTGGGTC4.6 >100 ~21.7 TGGG~GGTGGGT4.5 ~100 ~22.2 31 TGGGAGGTGGG 4.6 ~100 ~21.7 ~:
32 TGGGAGGTGG 5.0 ~100 ~20 33 TGGGAGGTG 5.5 ~100 ~18.2 ~.
....

~, ''-' .

'; ~
O ~ 2 a ~`\ - 162 -2 0 9 ~

~ll of the compounds of the present invention were observed to demonstrate inhibitory effects on HIV
proliferation at concentrations of 100 ~g/ml or less.
On the other hand, those corresponding compounds in which the 5' terminal was not modified were not observed to demonstrate anti-HIV activity over the range of ~-concentrations investigated (c600 ~g/ml). In addition, even when modified, those sequences not complementary to HIV gene (compounds of Comparative Examples 1 to 4) did not demonstrate inhibitory effects (c100 ~g/ml). These result~ indicate that modifying the 5' terminal~of the oligonucleotide molecule enhances the action of the anti-sense sequence. -Action on tumor ~ene ras It was also confirmed that, in the method pertaining to the present invention, modified anti-sense ollgonucleotides, which are anti-sense to the oncogene ras, are able to inhibit proliferation of DT cells at a concentration at which unmodified anti-sense oligonucleotides do not demonstrate efficacy.

A$ter twice infecting NIH3T3 cells with Carsten's mouse sarcoma viru9, DT cells wer~ produced coniisting of r a non-virus-producing transformed cell strain that is cloned according to the agar colony method, incorporating two copies of activated ras gene (v-Ki-ras) in the form of chromosomes [Noda et al., Proc. Natl. Acad. Sci. USA, 80, 5602 (1988)]. Consequently, DT cell~ differ from the parent NIH3T3 cells in that they have remarkably low adhesion, they do not exhibit contact inhibition, ana they proliferate in multi-layer form, with said proliferation not limited to single layers.

.

`;

",,~ ",, . . ,,, ", ;". ;,, . ~ ".-, " ~ ` " , , ,~ " , ,,-- 163 - 209~8 The action of an anti-sense sequence (the compound of Example 6) corresponding to 21 bases from the 9th bai3e up~tream from the trani~lation initia~ion site to the 12th base down~tream from the initiation codon of this v-Ki-ras gene was investigated for the purpo~e of inhibiting expresi3ion of thisi gene. The~ ~ are indicated in Table 2: -- -Title: Oligonucleotide Structure (5~-3~

DmTr-ODN-4 DmTr-ATACTCAGTCATTTTTAGCAG
(Compoundof Example 6) -., '~ "
ODN-4 -ATACT QGTC~TTTTTAGCAG
'" " ' ' The ability of the above mentioned sequ~nec to inhibit proliferation of DT cells was measured a~ described below. DT celli~ were 3uspended in DMEM medium containing 10~ serum to a concentration of 5 x 103 cells/ml.
500 ~l of this i~uspension was added to each well of a ~;
48-well plastic microtiter plate together with 20 ~g of specimen. Ihe plate was then cultured while allowing to stand in the presence of 5~ CO2. rrhe medium was replaced with fresh medium every three days, and the ~peci~en wa~ al~o added at that time. The numher of cells was counted after lO days, and the actiYity in inhibiting proliferation was determined by comparing with a group to which specimen had not been added. A~ indicated in the result~ of Fig. 1, ~trong activity in inhibition of cell proliferation was demonstrated only for the compound of Example 6, wherea~ activity in inhibiting proliferation was not ohserved for homologou~ naturally occurring anti-~en~e oligonucleotides. In addition, morphological change~ were al~o observed in the cells to which the compound of Example 6 had been added. More i~peci~ically, . - 164 -2 ~ 8 there was an increaaed proportion of flat cells iaimilar to the morpholog~ of the parent NIH3T3 cells (Fig. 1).
TEST EXAMPL~ 3 :, ,. ~
Action on tumor gene c-myb .

It has been reported that expression of the tumour gene c-myb i~ over-expressed in HL60 premyelocytlc leukaemia cells, and that cell proliferation i9 - interrupted by suppression of its expres~ion with an anti-sense oligonucleotide [Anfossi e al., Proc. Natl.
Acad. Sci. USA, ~6, 3379 3383 (1989~]. ~he compound of Example 7 was also confirmed to demonstrate strong activity in inhibiting proliferation on compariiaon with a homologous unmodified anti-sen3e oligonucleotide.

The effect of inhibitlon of proliferation on H~60 cells was measured in the manner described below for a compound in which a DmTr group wa~ bonded to the 5' , ~ terminal of the 18mer sequence of 5'-GTGCCG5$GTCTTC~GGC~
i complementary to the mRNA of c-myb, for which inhibitory activity has been observed in the report of Anfossi et al.
(DmTr-ODN-4: compound of Example 7), as ~ell as ~or the corresponding unmodified oligonucleotide. After suspending the HL60 cells in ~erum medium to a ~-j co~centration of 2 x 104 cells/ml, and adding specimen to each to a concentration of 20 ~g/ml, 500 ~l aliquot~ of tho~e cell suspenaion~ were added to each of the wells of a 48-well pla~tic microtiter plate ~ollowed ' by cul~uring while allowing to stand for 5 days in the .~ presence of 5% CO2. The number of cell~ was counted on the 4th and 5th days of culturing. A~ a result, the i compound of Example 7 demonstrated approximately double the activity in inhibition of pro~iferation of the homologou~ unmodified compound~ tFig. 2).

., ~

.' , 1 . ' . ' :': ' i ' , ' ' . ,; ' . ' , ~ ., , ' .~' , '' ' : ' .:
" ' ' -: ' '':',: ': ', " ': . , ' .,: ' ' ~ ' : ' ' ' '~ ' ' ' ,' .' . ' , . ' ' ,'; ' , '; , ' ' ; ' ;; " ' ' ' 'i", ,;~,- ' , " ' ' O ~ 2 ~
~ - 165 2 0 ~ ~ ~ 5 8 .
TEST EXAMPLE_4 .
Suppression of_Production of Viral Antigen ln HIV-Infected Cells It was confirmed by the following two types of experiments that treatment of HIV-l infected cells with an anti-sense oligonucleotide suppresses synthesis of viral proteins.
.
(1) Inhibition of the Amount of Viral Reverse~
Transcriptase Released in Media ~. .
MT-4 cells were infected with HIV-l in the same manner as described in Test Example 1. Various concentrations of the compound of Example 3 were then added, followed by culturing at 37C for 6 days in a carbon dioxide gas incubator. Following culturing, the activity of the rever~e transcripta~e contained in the viral particles released into the culture supernatant was assayed using the method of Somogyi et al. [Somogyi et al., J. Virol.
Methods, 27, 269 (1990)]. Those results are indicated in Fig. 3. The activity of reverse transcriptase relea~ed by ~IV-l infected cells decrea3ed with dependence on the amount of the compound of Example 3 added to the medium.
The concentration that resulted in 50~ inhibition was 4.7 ~g/ml, and virus-cau3ed cell damage, assayed at the same time, was nearly equal to the oligonucleotide concentration resulting in 50~ inhibition (7 ~g/ml).
~a~ed on the above results, it became clear that the compound of Example 3 inhibits the production of viral reverse transcriptase in HIV-l infected cells.
: :
(2) Inhibition of Production of viral Antigen in HIV-l Infected Cells Next, the amount of viral antigen produced in HIV-l '', , ~ .
., :

" ,; , , : .; r, , ~ ' l : ' ~ ' " ; ' ' - 1~6 -2~9~ 8 ~
in~ected cells treated with various concentrations of the compound of Example 3 was investigated in order to determine the action of ~aid compound of Example 3 on the production of vixal antigen other than reverse transcripta~e. After adding the sample preparation solution, described by Laemmli et al., containing SDS and the reducing agent mercaptoethanol [Laemmli, Nature, 227, 680 (1970)] to virus infected cells obtained according to the method indicated in Test Example 1 and control non-infected cells, and treating at 100C for S minutes, SDS-PAGE electrophoresis was per~ormed using a 12.5 polyacrylamide gel. After the electrophoresis, the protein was transferred to a nitrocellulose filter, and the viral antigen was specifically labelled using anti-~IV
human serum prepared from HIV-1 infected patients, and anti-human goat antibody labelled with peroxiclase. The labelled protein was then developed using the immunostaining kit manufactured by Konica. As indicated in lane 1 of Figs. 4A and 4B, various viral antigen~
including env (pl60, pl20) and gag (p55, p29, p24) are produced in viru~ infected cells [Petteway, et al., TiPS, 12, 28 (1991)]. However, when the compound of Example 3 is added, production of viral antigens is inhibited dependent on the concentration of the compound added. At a concentration of 12 ~g/ml or more, essentiall no viral antigen is observed. On the other hand, when the compound corresponding to Example 3 in which the 5' terminal is not modified, despite having an identical base sequence, production of viral antigen is not inhibited at all even when added to a concentration of 100 ~g/ml (Fig. 4B~.
Based on the above results, compounds in which the 5' terminal is modified were confirmed strongly to inhibit biosynthesis of all viral antigens in HIV-1 infected cells.

::: , .. .. , ~: : :

0~2a 2~6~8 :

, Inhibition of Viral RNA Synthesis in HIV-1 Infected Cells As previously described, the compound of Example 3, in which anti-HIV-1 activity was observed a~ shown in Table 1, i9 designed to inhibit the splicing of mRN~ which is essential for production of TAT and REV proteins of the ~:
HIV-1 gene. Thus, it is predicted that, if this compound ~:
inhibits biosynthesis of these viral proteins within virus infected ceIls, this would result in a shortage`of TAT
protein required for synthesis of viral RNA, thus also resulting in inhibition of synthesis of viral RNA. ~ .
Synthesis of viral RNA in HIV-1 infected cells treated with the compound of Example 3 was analyzed by Northern `~
blotting. : :
`':
A~ MT-4 cells were infected with HIV-1, according to . ``
the method de~cribed in Example 1, the compound of Example .
3, and a compound corresponding to Example 3 that was not modifled, were added to a ~i~al concentration of 20 : -~g/ml. The cells were then cultured at 37C for 5 days in a carbon dioxide gae incubator. After removing the culture supernatant, the cells were wa~hed with ::~
physiological saline solution and total cellular RNA was isolated by the guanidine thiocyanate method (Chirgwin et al., Biochemistry, 18, 5294 (1979)). 20 ~g of RNA were : ;
subjected to electrophore~is on a formaldehyde/agarose !.
gel, transferred to a nitrocellulose filter and then ~`
hybridised at 42C for 24 hours with synthetic 32p labeled oligonucleotide probes complementary to HIV-1 RNA S'-GAGGTGGGTCTGAAACGAT-3' and ``
5'-GAGGTGGGTCATTTGTACA-3'. After washing the filter twice for 15 minuteR each at room temperature in 1 X SSC ~
containing 0.1~ SDS, the filter was again washed twice for 15 minutes each in 0.2 X SSC containing 0.1% SDS. The :~
signa~ specific for HIV-1 viral RNA was then detected by ;`

'.'~ ~ ` -'.

O ~ 2 8 - - 168 ~ 209~8 autoradiography As indicated in Fig. 5, in addition to a clear signal fox genomic RNA of 9.2 kb coding for the gag and pol proteins, weaker signals were also detected for viral RNA
of 4.3 kb coding for the splicing product of env, as well as 2.0 kb coding for the proteins tat and rev in MT-4 cells infected with HIV-l (Fig. 5, lane 1). On the other hand, these signals were not detected in those cells not infected with HIV-l (Fig. 5, lane 2).

No viral RN~ was detected in HIV-l infected cells treated with 20 ~g/ml of the compound of ~xample 3 (Fig.
5, lane 4). On the other hand, there was no inhibition of viral RN~ synthe~is ob~erved at all in cells to which the compound corre~ponding to Example 3, in which the 5' terminal wa~ not modified, was added, despite having an identical base sequence (Fig. 5, comparison between lanes 1 and 3).

The result~ shown above suggest that compounds in which the 5' terminal is modified also strongly inhibit of ;
~iral RNA synthe~is in HIV-l infected cells.

TE~T EXAMPLE 6 :...
Stabili~ation of Oligonu _eotides by 5'_Terminal Modification `~

All of the above test examples indicate that modification of the 5' terminal of oligonucleotides with a ~ubstituent is a prerequisite for expres~ion of anti-HIV-l activity. One of the reasons that can be considered for this expression of anti-HIV-l activity is that ~aid modification increa~es the stability of the oligonucleotide in the serum. In other word~, although unmodified oligonucleotides are rapidly degraded due to ~ - 169 -20966~ :
the various kinds of nuclease contained in the serum, it is predicted that the oligonucleotides modified with substituents demonstrate higher stability. After labeling the 3' terminal of the compound of Example 3 as well as the unmodified compound corresponding to Example 3 with 32p, using the 3'-end labeling kit manufactured by Amersham, fixed amounts of those compounds were incubated at 37C for 30 hours in either RPMI-1640 medium containing 30% fetal bovine serum which is not inactivated, or the same medium, but without the serum, for the purpose o~
verifying this possibility. After the incubation, those oligonucleotides that were still present and had not been degraded were detected with 20~ polyacrylamide gel electrophoresis. As indicated in Fig. 6, when serum was not added, both oligonucleotides were not degraded, regardless of whether modified with substituents at the S' terminal. However, when serum was added, more than 90~ of the unmodified compQund corresponding to Example 3 was degraded. On the other hand, the compound of Example 3 was still present and resistant to degradation (comparison of lanes 2 and 4 of Fig. 6). This result suggests that, in contrast to the unmodified compound corresponding to Example 3 being unstable and rapidly degraded in serum, oligonucleotide~ like the compound of Example 3, which has been modified with substituent such as DmTr, demonstrate improved stability making them less susceptible to degradation~ Thus, it was strongly suggested that this is one of the factors of ~he increase in anti-HIV-l activity.
.. ..

'''",'',''' ":,:'''''"'"'.'.'",' ' "''',''"''.' "

042a 209~5a8 TEST EXAMPLE 7 ~ :

Assay of Anti-HIV Activity against Fresh, Clinically Isolated _Strains 1) HIV-1 Separation Method [Method for Separating HIV-1 from HIV-1 Infected Peripheral Blood Monocytes (PBMC)]

10 ml of blood from HIV-1 infected patients to which heparin was added was layered on a heucoprep tube (manufactured by Becton Dickinson). A white layer containing peripheral blood monocytes (PBMC) was collected after 30 minutes centrifuging at 2000 x g~ The resulting PBMC suspension was washed twice with PBS(-) (manufactured by Nissui Seiyaku) and suspended in 0.5 ml of PBS. After counting ~he number of viable cells in the PBMC
suspension, anti-human CD8 antibody-bound magnetic beads (Dynabeads; Dynal Inc., N.Y., USA) were added to the PBMC
suspension in an amount 20 to 40 fold relative to the number of PBMC. The suspension was allowed to stand for 1 ~-;
hour in an ice bath while repeating stirring 2 to 3 times. To the above-mentioned centrifuge tube was then added 5 ml of RPMI-1640 medium containing 10~ inactivated fietal bovine serum, and the tube was then mounted on an MPC (Magnetic Particle Concentrator; Dynal Inc.). The Dynabead~ (demonstrating a red color) adhered to the inside of the centrifuge tube within 1 minute due to the application of magnetic force. The PBMC serum medium suspen~ion was then collected from the centrifuge tube while being careful not to suck any of the Dynabeads.

PBMC separated from the blood of suitable healthy persons to which heparin was added was stimulated in advance for 3 days with PHA (10 ~g/ml). Equal amounts ~-of the juvenile PBMC obtained in this manner and the PBMC
separated from HIV-1 infected patients, from which the above-mentioned CD8 positive cells were removed, were .

2 0 ~
mixed into separa~ion serum medium (serum medium containing the additives of 20 IU/ml of IL-2, 10 ~g/ml of PHA and 2 ~g/ml of polybrene) to a final concentration of 5 x 105 to 1 x 106 cells/ml. Mixed culturing was then performed at 37C in a 5% carbon dioxide gas incubator. Mixed culturing was continued for approximately 14 days while replacing half the amount of juvenile PBMC with fresh juvenile PBMC of suitable healthy person~ every 3 to 4 days. The amount of p24 antigen in the culture supernatant and viral titer (Focal immunoassay) were assayed when syncytium demonst~rating well-defined ~loon-like forms were observed microscopically.

2) Drug Sensitivity Test on Clinically Isolated Strains by a Focus Formation Inhibition Assay (Slightly Modified MPthod of B. Chesbro et al.) '" ~
Infection Procedure: Recombinant HeLa cells (1022 cells), which express CD-4 after inroduction of the CD-4 gene, were prepared to a density of 5 x 104/ml in serum medium.
'..~ ,:, . .
0.5 ml aliquots of the 1022 cell suspension was inoculated into each of the wells of a 48-well plate (manufactured by Coa~ter) using an Eppendorf pipette (so that cells are uniformly adhered to the cùlturing surface of each well). The 1022 cell~ were cultured overnight at 37C in a 5~ carbon dioxide gas incubator using a 48-well plate. On the following day, the serum medium in the 48-well plate for proliferation of 1022 cells was removed by suction with an aspirator. Next, DEAE dextran solution diluted with 250 ~l of RPMI-1640 medium (8 ~g/ml) was added and the plate was allowed to stand at 37C in a 5% -carbon dioxide gas incubator ~or exactly 20 minutes.
Immediately after removing the DEAE dextran solution by ~;
suction with an aspirator, 100 ~1 of diluted virus ~` ~ - 172 2 09 ~ 8 solution (diluted with serum medium) was added having a titer allowing the formation of 50 to 80 foci. The plate was then allowed to stand at 37C in a 5% carbon dioxide gas incubator for 90 minutes to infect the 1022 cells with virus. After completion of infection, 0.5 ml each of semi-logarithmically stepwise-diluted anti-HIV-containing serum medium was added to each of the wells followed by culturing at 37C for at least 3 days in a 5~ carbon dioxide gas incubator.
' Enzyme-Antibody Staining Procedure: After completion of culturing, the serum medium in the 48-well plate for proliferation of 1022 ce~ls was completely remo~ed by suction with an aspirator followed by addition of 250 ~1 of methanol to fix the cells at room temperature for exactly 5 minutes. Immediately after the 5 minutes had elap~ed, the methanol was completely removed by suction and the plate was washed twice with PBS(-) containing 1~
F~S. Next, 100 ~1 of serum from an AIDS patient diluted by a factor of 800 with PBS(-) containing 1% FBS were added as the primary antibody, ancl allowed to react for about 30 minutes at room temperature. The added serum from the AIDS patient was then removed by suction and the plate was washed twice with PBS(-) containing 1~ FBS. 100 ~1 of horseradi8h peroxidase-labelled anti-human F(ab)2 diluted by a factor of 200 with PBS(-) were added, and allowed to react for at least about 45 minutes at room temperature. After washing the plate three times with PBS(-), 250 ~1 of enzyme substrate solution (0.2 mg/ml of 3-amino-9-ethyl-carbazole and 0.015~ hydrogen peroxide/0.05 M ~odium acetate buffer (pH 5.0)) was added to perform enzyme activity staining at room temperature for 20 minutes.

After completion of staining, excess substrate solution was washed from the-plate with PBS(-), and the number of foci that .stained red was counted 7i . .

~ ~ 0 ~ 8 microscopically (10 x 4).

, Results: HIV-1, the pathogen of AIDS, is a h~pervariable virus that demonstra~es a high rate of -mutation even within the same host. Thus, it is necessary to investigate the effects of the compound of the present invention against virus infected cells originating in AIDS
patients actually infected with HIV at its various infection stages (AC, ~RC and AIDS). A study was conducted regarding the sensitivity of clinically isolated ~IV strains, isolated from HI~ patients at various infection stages (AC, ARC and AIDS), ~o the compound of the present invention. More specifically, a focus formation inhibitory test (focus reduction assay~ was performed to investigate the drug sen3itivity of 12 virus strains with respect to the compound of Example 3.
Sensitivity to the compound of Example 3 was confirmed for 10 standard laboratory strains and isolated strains.
Moreover, this compound demonstrated uniform effects against clinically isolated strains from the various infection stages (~C, ARC and AIDS) of ~IV patients.

" '' ' '"' ' ,''. , ', ' ;, ' ' ' ' ,' " ' . ' " ', . ' ' " ' ', ', ' ' ' ~ ' ' ' ~' 1 ' , ~ "

'~ ~ - 174 - 2~66~8 Various HIV-I infected clinically isolated strain Sensitivity to the compound of Example 3 HIV isolated strain Clinical symptom ICso (~g/ml) : HTLVIIIB* - ~1.4 HTLVIIIRF* - 2.3 GOT9156 AC 2. a SAS91817 AC 7.2 . S~T91817 ARC 6.8 FUJ91725 ARC 8.6 FUJ91811 ARC ~.2 YU6a AIDS 13.1 ICH91513 AIDS 7.8 SAI9166 AIDS 5.6 IKE AIDS ~ 3.3 SUE AIDS 16.0 ~

* Te3t standard ~train -~: AIDS (Acquired immunodeficiency syndrome) ARC (AIDS-related complex) -:
AC (Asymptomatic Carrier) Acute toxicity was determined according to conventional methods. More specifically, 150 mg/kg of the ~::
compound of ~xample 3 was orally administered to five ddy mice (males). The mice were observed for 5 days, and it was found that all were viable after that time period.
~,,; ' ~

O ~ 2~

2 ~
PREPARPATION EXAMPLE 1 , ~:

Inlectible Preparation The injectible preparation i9 provided for use in the formi of ampules containing a ~terile solution or suspen~ion with water or other pharmaceutically acceptable liguid, or a sterile powder preparation (preferably that .:-resulting from freeze drying of the anti-sense compound) is filled into ampules and it may be ~imultaneously :~
diluted with a pharmaceutically acceptable liquid.

PREPA.RATION EXAMPLE 2 Tablet~
..
1) Compound of Example 3 200 ~ :
2) Sodium ialt of pyro-acid S
3) ~erosil~200 5 ~) ~ i stearate 5 5) Lactose 495 ~:
6) Corn ~tarch 154 :~ ~:
7) Avicel 123 8) HPL(L) 10 997 g ~ ~:

: A crushed mixture of above-me~tioned ingredients 1) to ..
4) were added to pre-production granule~ consi~ting of a granulated mixture of above-mentioned ingredients 5) to ..
8). Next, the mixture wa~ formed into tablets, using a :~
tablet m~king machine, to obtain tablets containing 100 mg per tablet. Sugar coating ca~ be applied to the~e tablets, a~ necessary.

'' ," ~

,, ,, ~ :'.

, ,~".,.. . .. " .. , ,, . ... , , , ,, ,, ~, ., . ". , . . . .. , , .. , , ., , , , ,, , . , :

O ~ 2 ~
~ 176 -2~9~8 ' Capsules 1) Compound of Example 3 200 2) Calcium hydrogenpho phate 200 3) Aluminum silicate 345 4) Crystal cellulose 250 5~ Magnesium stearate 2 .
997 g '.

The ingredient~ 1) to 5) listed above were mixed and crushed. Further, after the mixture had been passed through a ~ieve and blended well, the ingredients were formed into 200 mg capsule~ in accordance with conventional methods.

The compound~ of the present invention posses~
~peci~ic activity that damage~ virus infected cells and ~`
tumour cells, activity that suppresses the characteristic ~-~
morphological change~ as~ociated with the occurrence of viral di3eases or cancer, and further possess the ability to inhibit, specifically, proliferation, etc.. Thus, the compou~ds of the present inve~tion are useful a~ a therapeutic and preventive drug for viral diseases and cancer.

Fig. 1 indicates a microphotograph representing the action on DT cells.
'' `:-..
- Fig. 2 indicate3 the effect~ on proliferation o~ ~L ~D
4~ cell~.

Fig. 3 indicates suppression of production o~ reverse tran~cripta~e.

.,'' ;~ , 0 4 2 a ~ - 177 -2 ~ 9 ~
Fig. 4 indicates suppression of production of viral antigen in HIV-l infected cells.

Fig. 5 indicates inhibition of viral RNA synthesis in HIV-l infected cells.

Fig. 6 indicates stabilization of oligonucleotides by modification of the S' terminal.

.

.

' : . .
, ,~

,: ' ;::.
'; ~
,..

,, .' ' , ' .

0 4 2 ~
~ - l7a -209~6~
SEOUENCE LISTING

INFORMATION FOR SEQ ID NO.: 1 Sequence length: 15 Sequence type: Nucleic acid Strandness: single Topology: Linear Hypothetical: No Anti-sense: Yes Sequence: .
AGGTGGGTCT GAAAC

INFORMATION FOR SEQ ID NO.: 2 ..
Sequence length: 15.
Sequence type: Nucleic acid ~;
Strandness: single Topology: Linear Hypothetical: No Anti-sense: Yes Sequence:
TCGGGGTTGG G~GGT

INFORMATION FOR SEQ ID NO.: 3 :-~
Se~uence length: 15 ~.
Sequence type: Nucleic acid Strandness: single Topology: Linear : :-Hypothetical: No ~;
Anti-sense: Yes : :
Sequence: :
TTGGGAGGTG GGTCT ` ;

.:
'' :, .:~

: : , - 179 -2~96~
.
-.::- .
INFORMATION FOR SEQ ID NO.: 4 :
Sequence length~ 21 Sequence type: Nucleic acid Strandness: single ~I'opology: Linear Sequence:
ATACTCAGTC ATTTTTAGCA G

INFORM~TICN FOR SEQ ID NO.: 5 Seguence length: 18 Sequence type: ~ucleic acid ~:
Strandness: single Topology: Linear Sequence:
GTGCCGGGGT CTTCGGGC

INFORMATION FOR SEQ ID NO.: 6 ;
Sequence length: 15 Sequence type: Nucleic acid Strandness: single Topology: Linear Sequence:
TGGGTCTGAA ACGAT ~ .

INFORMATION FOR SEQ ID NO.: 7 ; ~.
Se~uence length: 16 Sequence type: Nucleic aci,~
S,trandness,: single Topology: Linear Sequence:
TAGGTGGGTC TGAAAC
:

. ~, : j . ... , . , ,, :i., . . : : . .:, : ; , .. . . .. . . . .. . ..

0 4 2 1~

2~9~S~,~
INFORMATION FOR SEQ ID NO.: 8 Sequence length: 15 Sequence type: Nucleic acid Strandness: single Topology: Linear Sequence:
GGTGGGTCTG AAACG

INFORMATION FOR SEQ ID NO. 9 Sequence length: 15 Seguence type: Nucleic acid Strandness: single Topology: Linear Sèquence:
GGTGGGTTGC TTTGA .
.-INFORMATION FOR SEQ ID NO.: 10 : I
Sequence length: 15 : ~ .
Sequence type: Nucleic acid : Strandness: single Topology: Linear ::
Sequence:
GGAGGTGGGT CTG~A
.: :: .:
INFORMATION FOR SEQ ID NO.: 11 :
Sequence length: 15 ~ :
Sequence type: Nucleic acid . :
Strandness: single :~
Topology: Linear Sequence~
; GGGAGGTGGG TCTGA
I' :
, , ~ .

. .
:, .

O ~ 2 1~
~~ - 181 -20~658 INFORMATION FOR SEQ ID NO.: 12 Sequence length: 15 Sequence type: Nucleic acid Strandness: single Topology: Linear :
Sequence:
GTTGGGAGGT GGGTC

INFORMATION FOR SEQ ID NO.: 13 :-Sequence length: 15 Sequence type: Nucleic acid Strandness: single ~
Topology: ~inear . i .
Sequence:
GGGTTGGGAG GTGGG

INFORMATION FOR SEQ ID NO.: 14 Sequence length: 15 . --.
Se~uence type: Nucleic acid Strandness: single :~ :
Topology: Linear Sequence~
TGGGAGGTGG GTCTG
.:
INFORMATION FOR SEQ ID NO.: 15 : -Sequence length; 14 , :
Sequence type: Nucleic acid .:
Strandness: single Topology: Linear Sequence: ;~
TGGGAGGTGG GTCT

'. , , : . . . . ' ' ' . ' ,', ~ . ' ' , i '. ' i ': ' . ~ ' ' i , ;", 1 ,,,, " ",~ ,, ,,," , ,,,~ ",,, , "~ "; , ~ , " ~

` ' 2~9~g58 INFORMATION FOR SEQ ID NO.: 16 Sequence length: 13 `
Sequence type: Nucleic acid Strandness: single Topology: Linear Sequence:
TGGGAGGTGG GTC
, INFORMATION FOR SEQ ID NO.: 17 Sequence length: 12 Sequence type: Nucleic acid Strandness: single Topology: Linear -Sequence:
TGGGAGGTGG GT : :

INFORMATION FOR SEQ ID NO.: 18 .--~
Sequence length: 15 ;: ~ `
Sequence type: Nucleic acid :~ :~
Strandness: single `:
Topology: Linear : .
Sequence:
TGGGA~GTGG G
....
., INFORMATION FOR SEQ ID NO.: 19 :.:
....
Sequence length: 10 ~
Sequence type: Nucleic acid : ~ :
Strandness: single `.::' .
Topology: Linear : :
Sequence:
TGGGAGGTGG

'' , ':`.
. ', 2~9~

INFORMATION FOR SEQ ID NO.: 20 Sequence length: 9 Se~uence type: Nucleic acid Strandness: single Topology: Linear Sequence:
~ TGGGAGGTG
`:~
, : ' ' ':, . , :'~
: ' ' ':

: ~ .. : ,,; -

Claims (97)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. A compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a hydroxy group, a methyl group, a mercapto group, alkoxy group having 1 to 4 carbon atoms or a monoalkylamino group having 1 to 6 carbon atoms;
Y and Z individually represent an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents a; and D and B each represents a residue independently selected from the following group of substituents .beta.
in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a tumour gene or a virus gene:

or a salt thereof;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T).
2. A compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a hydroxy group;
Y and Z individually represent an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents a; and D and B each represents a residue independently selected from the following group of substituents in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a tumour gene or a virus gene:

or a salt thereof;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T).
3. A compound represented by the general formula (1):

(1) wherein:
k represents 0-or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a methyl group;
Y and Z individually represent an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents a; and D and B each represents a residue independently selected from the following group of substituents in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a tumour gene or a virus gene:

or a salt thereof;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T).
4. A compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a mercapto group;
Y and Z individually represent an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents .beta.
in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a tumour gene or a virus gene;

or a salt thereof, Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl groups having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituent .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T).
5. A compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents an alkoxy group having 1 to 4 carbon atoms;
Y and Z individually represent an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents .alpha.
in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a tumour gene or a virus gene;

or a salt thereof;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T).
6. A compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a monoalkylamino group having 1 to 6 carbon atoms;
Y and Z individually represent an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a tumour gene or a virus gene:

or a salt thereof;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T).
7. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence complementary to a tumour gene or a virus gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;
8. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms or a monoalkyl group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence complementary to a tumour gene or a virus gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
9. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence complementary to a tumour gene or a virus gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
10. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence complementary to a tumour gene or a virus gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
11. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence complementary to a tumour gene or a virus gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
12. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.'; and the base sequence containing B is a base sequence complementary to a tumour gene or a virus gene;

Substituents .alpha.':

hydroxy groups, alkyl groups having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.
13. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."; and the base sequence containing B is a base sequence complementary to a tumour gene or a virus gene;

Substituents .alpha.":

methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
14. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groupss with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
15. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl groups having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
16. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequnece including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
17. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene:

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
18. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequnece including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
19. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6-to 10 carbon atoms and aralkyloxy groupss with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
20. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having l to 4 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.'; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;
Substituents .alpha.':

hydroxy groups, alkyl groups having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.

16) A compound wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;
Substituents .alpha.":

methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
21. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
22. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
23. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
24. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
25. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
26. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
27. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.'; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;

Substituents .alpha.':

hydroxy groups, alkyl groups having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.
28. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;
Substituents .alpha.":
methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
29. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
30. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected-from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 19 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atom and an alkyl moiety having 1 or 2 carbon atoms.
31. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;
Substituents .alpha.:
hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
32. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
33. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0, n is 13 to 18, X is a hydroxy group, methyl group, mercapto group, alkoxy group having 1 to 4 carbon atoms, or monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
34. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is.
less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
35. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.'; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 5 nucleotides spanning a particular nucleotide which is less than 30 nucleotides in front of and in back of the translation initiation site in a tumour gene;

Substituents .alpha.':

hydroxy groups, alkyl groups having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.
36. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;
Substituents .alpha.":
methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
37. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
38. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
39. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
40. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site is a tumour gene;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy-groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
41. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having l or 2 carbon atoms.
42. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
43. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.'; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;
Substituents .alpha.':

hydroxy groups, alkyl groups having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.

40) A compound wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the base or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;
Substituents .alpha.":

methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
44. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
45. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene:

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
46. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
47. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy-groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
48. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
49. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
50. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.' and, the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene;
Substituents .alpha.':

hydroxy groups, alkyl groups having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.
51. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in a tumour gene;
Substituents .alpha.":

methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
52. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
53. The compound according to Claim 1 wherein:
k is 0 to 20, m is 0 or 1, n is 4 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
54. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl-group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha., and the base sequence containing B is a base sequence of 14 to 19 bases complementary to A part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 5 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
55. The compound according to Claim 1 wherein:
k is 0 to 15, m is 0 or 1, n is 8 to 29, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
56. The compound according to Claim 1 wherein:
k is o to 12, m is 0, n is 13 to 18, X is a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
57. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen or a sulphur atom, Z is an oxygen or a sulphur atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes;

Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atom and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.
58. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.'; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes;

Substituents .alpha.':

hydroxy groups, alkyl groups having 1 to 4 carbon atoms, alkoxy groups having 1 to 4 carbon atoms, phenyl groups, naphthyl groups, phenyloxy groups, phenylmethyloxy groups and naphthylmethyloxy groups.
59. The compound according to Claim 1 wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2, and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."; and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a single base site in ras and c-myb tumour genes, Substituents .alpha.":

methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
60. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha." '; and the base sequence is :

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
61. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is :

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
62. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is :

Substituent .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
63. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is :

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
64. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is :
Substituents .alpha."':
methoxy groups.
65. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents a"'; and the base sequence is :

Substituents a"':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
66. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents a"'; and.
the base sequence is ;

Substituents a"':

methoxy groups.
67. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents a"'; and the base sequence is ;

Substituents a"':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
68. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents a"'; and the base sequence is ;

Substituents a"':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
69. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents a"'; and the base sequence is ;

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
70. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;
Substituents .alpha."':
methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
71. The compound according to Claim wherein:
k is 0, m is O, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent group selected from the following group of substituents .alpha."'; and the base sequence is ;
Substituents .alpha."':
methoxy groups.
72. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
73. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
74. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
75. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
76. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;

Substituents .alpha."';

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
77. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
78. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;

Substituents .alpha."';

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
79. The compound according to Claim wherein:
k is 0, m is 0, X is a hydroxy group, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha."'; and the base sequence is ;

Substituents .alpha."':

methoxy groups, ethoxy groups, propoxy groups and t-butoxy groups.
80. An antiviral agent comprising a compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms;
Y and Z each represents an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents .beta.
in respective nucleotide units;

provided that m = 0 when k - 0, and the base sequence containing B in the formula is the base sequence complementary to a virus gene;

or a salt thereof, together with a pharmaceutically acceptable carrier or excipient;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituents .beta.:
adenine (A), guanine (G), cytosine (C) and thymine (T).
81. An anti-AIDS agent comprising a compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms:
Y and Z individually represent an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a virus gen;

or a salt thereof togehter with a pharmaceutically acceptable carrier or excipient;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;
Substituents .beta.:
adenine (A), guanine (G), cytosine (C) and thymine (T).
82. An antitumour agent comprising a compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a hydroxy groups a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms;
Y and Z each represents an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a tumour gene;

or a salt thereof, together with a pharmaceutically acceptable carrier or excipient;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituents .beta.:
adenine (A), guanine (G), cytosine (C) and thymine (T).
83. An anti-AIDS agent comprising an effective dose of a compound selected from the following compounds or a pharmacologically acceptable salt thereof, together with a pharmaceutically acceptable carrier or excipient;
5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTCTG, 5'-O-(4-methoxytrityl)-TGGGAGGTGGGTCTG, 5'-O-trityl-TGGGAGGTGGGTCTG, 5'-O-diphenylmethyl-TGGGAGGTGGGTCTG, 5'-O-phenylmethyl-TGGGAGGTGGGTCTG, 5'-O-(2-naphthylmethyl)-TGGGAGGTGGGTCTG, 5'-O-[(3,5-dibenzyloxy)benzyl]-TGGGAGGTGGGTCTG, 5'-S-diphenylmethyl-TGGGAGGTGGGTCTG, 5'-O-(4,4'-dimethoxytrityl)-AGGTGGGTCTGAAAC, 5'-O-(4,4'-dimethoxytrityl)-TCGGGGTTGGGAGGT, 5'-O-(4,4'-dimethoxytrityl)-TTGGGAGGTGGGTCT, 5'-O-(4,4'-dimethoxytrityl)-TGGGTCTGAAACGAT, 5'-O-(4,4'-dimethoxytrityl)-GGGAGGTGGGTCTGA, 5'-O-(4,4'-dimethoxytrityl)-GTTGGGAGGTGGGTC, 5'-O-(4,4'-dimethoxytrityl)-GGGTTGGGAGTGGGG, 5'-O-trityl-TGGGAGGTGGGTCTG, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTCT, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTC, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGGT, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGG, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGG, and 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTG.
84. An antitumour agent comprising an effective dose of a compound selected from the following compounds or a pharmacologically acceptable salt thereof, together with a pharmaceutically acceptable carrier or excipient;
5'-O-(4,4'-dimethoxytrityl) -ATACTCAGTCATTTTTAGCAG.
85. A treatment or preventive method wherein a compound represented by the general formula (1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms;
Y and Z each represents an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents .beta.
in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a virus gene;

or a salt thereof is administered to mammals suffering from a viral disease;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.

Substituent .beta.:
adenine (A), guanine (G), cytosine (C) and thymine (T).
86. A treatment or preventive method wherein a compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms;
Y and Z each represents an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents .beta.
in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a virus gene; or a salt thereof is administered to mammals suffering from an anti-AIDS viral disease;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;
Substituents .beta.:
adenine (A), guanine (G), cytosine (C) and thymine (T).
87. A treatment or preventive method wherein a compound represented by the general formula (1):

(1) wherein:
k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
n represents an integer of 4 to 29;
X represents a hydroxy group, a methyl group, a mercapto group, an alkoxy group having 1 to 4 carbon atoms, or a monoalkylamino group having 1 to 6 carbon atoms;
Y and Z each represents an oxygen or a sulphur atom;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D and B each represents a residue independently selected from the following group of substituents .beta.

in respective nucleotide units;

provided that m = 0 when k = 0, and the base sequence containing B in the formula is the base sequence complementary to a tumour gene;

or a salt thereof is administered to mammals suffering from a cancer;
Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;
Substituents .beta.:
adenine (A), guanine (G), cytosine (C) and thymine (T).
88. A treatment or preventive method wherein an effective dose of a compound selected from the compounds indicated below, or a pharmacologically acceptable salt thereof, is administered to mammals suffering from an AIDS viral disease;
5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTCTG, 5'-O-(4-methoxytrityl)-TGGGAGGTGGGTCTG, 5'-O-trityl-TGGGAGGTGGGTCTG, 5'-O-diphenylmethyl-TGGGAGGTGGGTCTG, 5'-O-phenylmethyl-TGGGAGGTGGGTCTG, 5'-O-(2-naphthylmethyl)-TGGGAGGTGGGTCTG, 5'-O-[(3,5-dibenzyloxy)benzyl]-TGGGAGGTGGGTCTG, 5'-S-diphenylmethyl-TGGGAGGTGGGTCTG, 5'-O-(4,4'-dimethoxytrityl)-AGGTGGGTCTGAAAC, 5'-O-(4,4'-dimethoxytrityl)-TCGGGGTTGGGAGGT, 5'-O-(4,4'-dimethoxytrityl)-TTGGGAGGTGGGTCT, 5'-O-(4,4'-dimethoxytrityl)-TGGGTCTGAAACGAT, 5'-O-(4,4'-dimethoxytrityl)-GGGAGGTGGGTCTGA, 5'-O-(4,4'-dimethoxytrityl)-GTTGGGAGGTGGGTC, 5'-O-(4,4'-dimethoxytrityl)-GGGTTGGGAGTGGGG, 5'-O-trityl-TGGGAGGTGGGTCTG, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTCT, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGGTC, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGGT, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGGT, 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTGG, and 5'-O-(4,4'-dimethoxytrityl)-TGGGAGGTG.
89. A treatment or preventive method wherein an effective dose of a compound selected from the compounds indicated below, or a pharmacologically acceptable salt thereof, is administered to mammals suffering from a cancer;
5'-O-(4,4'-dimethoxytrityl)-ATACTCAGTCATTTTTAGCAG.
90. A process for preparing the compound described in Claim 2, wherein said compound is obtained by condensing using, in the presence of a condensing agent, (iii):

(1) a compound represented by the general formula:

[wherein: k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.;
Y and Z each represents an oxygen atom or sulphur atom;
V represents a dialkylamino group;
U represents a heterocyclic group having a dialkylamino group or 1 or 2 oxygen atoms and/or nitrogen atoms within its ring; and D' represents a residue selected from the following group of substituents or homologous protected residue;

provided that m = 0 when k = 0, Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms.

Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)];

with an oligonucleotide represented by the general formula:

[wherein: each B' represents a residue independently selected from the following group of substituents .beta. in the respective nucleotide units, or a protected homologous residue;
W represents a lower acyloxy group, an arylacyloxy group or a controlled pore glass; and n is an integer of 4 to 29;

provided that the base sequence containing B' is a base sequence complementary to a tumour gene or a virus gene;
Substituents .beta.;

adenine (A), guanine (G), cytosine (C) and thymine (T)], (ii) [1] which oligonucleotide is synthesised with a DNA
synthesiser and is bonded to said controlled pore glass whole dimethoxytrityl group at the 5' terminal only is eliminated, with the base portion thereof being protected with a protecting group such as an acyl group, or [2]

which is synthesised by a liquid phase method, and has a free hydroxy group at the 5' terminal, with the base portion thereof being protected with a protecting group such as an acyl group, to form triphosphite bonds; and (2) oxidising the resulting product to the triphosphate using an oxidising agent and, when said oligonucleotide is bonded to the controlled pore glass, removing the protecting group after severing from the controlled pore glass .
91. A process for preparing the compound described in Claim 2 wherein said compound is obtained by condensing, in the presence of a condensing agent, a compound represented by the general formula:

[wherein: k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.;
Ar represents an aryl group; and D' represents a residue selected from the following group of substituents .beta., or a homologous protected residue;

provided that m = 0 when k = 0, Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;

Substituents .beta.:

adenine (A), guanine (g), cytosine (C) and thymine (T)];

with an oligonucleotide represented by the general formula:

[wherein: each B' representss a residue independently selected from the following group of substituents .beta. in respective nucleotide units, or a protected homologous residue;
W represents a lower acyloxy group, an arylacyloxy group or a controlled pore glass; and n is an integer of 4 to 29;

provided that the base sequence containing B' is a base sequence complementary to a tumour gene or virus gene, Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)), [1] which oligonucleotide is synthesised with a DNA
synthesiser and is bonded to said controlled pore glass whose dimethoxytrityl group at the 5' terminal only is eliminated with the base portion, and with the phosphate portion thereof being protected with a protecting group, or [2] which is synthesised by a liquid phase method, and has a free hydroxy group at the 5' terminal, with the base portion and phosphate portion thereof being protected with a protecting group, to form triphosphate bonds, and eliminating the protecting group after severing from the controlled pore glass when the oligonucleotide is bonded to the controlled pore glass.
92. A process for preparing the compound described in Claim 2 wherein said compound is obtained by condensing a compound represented by the general formula:

[wherein: k represents 0 or an integer of 1 to 20;
m represents 1 or 1;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D' represents a residue selected from the following group of substituents .beta.;
provided that m = 0 when k = 0, Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;
Substituents .beta.:
adenine (A), guanine (G), cytosine (C) and thymine (T)];
with an oligonucleotide represented by the general formula:

[wherein: each B' represents a residue independently selected from the following group of substituents .beta. in the respective nucleotide units or protected homologous residue;
W represent a lower acyloxy group, an arylacyloxy group or a controlled pore glass; and n is an integer of 4 to 29;

provided that the base sequence containing B' is a base sequence complementary to a tumour gene or a virus gene;
Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)];

which oligonucleotide is synthesised with a DNA
synthesiser and is bonded to said controlled pore glass whose dimethoxytrityl group at the 5' terminal only is eliminated, with the base portion being protected with a protecting group; in the presence of a condensing agent and a deoxidiser, to form H-phosphonic diester bonds, followed by converting the H-phosphonic acid bonds to diphosphate bonds using an oxidising agent, and removing the protecting group of the base portion at the same time as severing the oligonucleotide from the controlled pore glass under basic conditions.
93. A process for preparing the compound described in Claim 3 wherein said compound is obtained by eliminating only the dimethoxytrityl group at the 5' terminal of a compound represented by the general formula:

[wherein: k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.;
Y and Z each represents an oxygen or a sulphur atom; and D' represents a residue selected from the following group of substituents .beta.;

provided that m = 0 when k = 0, Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;
Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)];

carrying out a condensation reaction in the presence of tetrazole on a methylphosphonate oligonucleotide represented by the general formula:

[wherein: each B' represents a residue independently selected from the following group .beta. in respective nucleotide units, or a protected homologous residue;
W represents a lower acyloxy group, an arylacyloxy group or a controlled pore glass; and n is an integer of 4 to 29;

provided that the base sequence containing B' is a base sequence complementary to a tumour gene or a virus gene;
Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)];

that is bonded to said controlled pore glass with the base portion thereof being protected with a protecting group, to form methylphosphonic diester bonds, followed by eliminating the protecting group of the base portion at the same time as severing the oligonucleotide from the controlled glass beads under basic conditions.
94. A process for preparing the compound described in Claim 4 wherein said compound is obtained by forming phosphonic diester bonds in the presence of a condensing agent and oxidising agent using a compound represented by the general formula:

[wherein: k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D' represents a residue selected from the following group of substituents .beta.
or a protected homologous residue;
provided that m = 0 when k = 0, Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;
Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)]; and, a thioate oligonucleotide represented by the general formula:

[wherein: each B' represent a residue independently selected from the following group of substituents .beta. in respective nucleotide units, or a protected homogous residue;
W represents a lower acyloxy group, an arylacyloxy group or a controlled pore glass; and n is an integer of 4 to 29;

provided that the base sequence containing B' is a base sequence complementary to a tumour gene or a virus gene;
Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)], which is synthesised with a DNA synthesiser and is bonded to said controlled pore glass whole dimethoxytrityl group at the 5' terminal only is eliminated; followed by reacting sulphur dissolved in carbon disulphide in the presence of a base, and removing the protecting group of the base portion at the same time as severing the oligonucleotide from the controlled pore glass under basic conditions.
95. A process for preparing the compound described in Claim 6 wherein said compound is obtained by eliminating the 5-position dimethoxytrityl group of a compound represented by the general formula:

[wherein: k represents 0 or an integer of 1 to 20;
m represents 0 or 1;
R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, or an aryl group having 6 to 10 carbon atoms optionally substituted by a substituent selected from the following group of substituents .alpha.; and D' represents a residue selected from the following group of substituents .beta.;
provided that m = 0 when k = 0, Substituents .alpha.:

hydroxy groups, alkyl groups having 1 to 6 carbon atoms, alkoxy groups having 1 to 6 carbon atoms, methylenedioxy groups, nitro groups, azide groups, halogen atoms, aryl group having 6 to 10 carbon atoms, aryloxy groups having 6 to 10 carbon atoms and aralkyloxy groups with an aryl moiety having 6 to 10 carbon atoms and an alkyl moiety having 1 or 2 carbon atoms;
Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)]; and an alkylphosphoric amidate oligonucleotide represented by the general formula:

[wherein: each B' represents a residue independently selected from the following group of substituents .beta. in respective nucleotide units;
R represents a lower alkyl group;
W represents a lower acyloxy group, an arylacyloxy group or a controlled pore glass; and n is an integer of 4 to 29;

provided that the base sequence containing B' is a base sequence complementary to a tumour gene or a virus gene, Substituents .beta.:

adenine (A), guanine (G), cytosine (C) and thymine (T)];

which is synthesised with a DNA synthesiser and is bonded to said controlled pore glass;

and reacting with a desired amine in the presence of a condensing agent, followed by eliminating the oligonucleotide from the controlled pore glass and treating with a base.
96. A compound according to Claim l, wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R2 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substitutents .alpha."; and the base sequence containing B is a base sequence of 9 to 30 bases complementary to all or a part of a nucleotide sequence including base number 7947 to base number 7975 of the HIV gene;
Substituents .alpha.":
methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
97. A compound according to Claim 1, wherein:
k is 0 to 12, m is 0 or 1, n is 13 to 18, X is a hydroxy group, Y is an oxygen atom, Z is an oxygen atom, R1, R7 and R3 are the same or different and each represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, or a phenyl group optionally substituted by a substituent selected from the following group of substituents .alpha.": and the base sequence containing B is a base sequence of 14 to 19 bases complementary to a part of a region of 30 nucleotides spanning a particular nucleotide which is less than 5 nucleotides from a translation initiation site in a tumour gene;
Substituents .alpha.":
methyl groups, ethyl groups, propyl groups, t-butyl groups, methoxy groups, ethoxy groups, propoxy groups, t-butoxy groups and phenylmethyloxy groups.
CA002096658A 1990-11-20 1991-11-18 Anti-sense nucleic acid derivative Abandoned CA2096658A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP31500790 1990-11-20
JP2-315007 1990-11-20

Publications (1)

Publication Number Publication Date
CA2096658A1 true CA2096658A1 (en) 1992-05-21

Family

ID=18060297

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002096658A Abandoned CA2096658A1 (en) 1990-11-20 1991-11-18 Anti-sense nucleic acid derivative

Country Status (6)

Country Link
EP (1) EP0558749A1 (en)
JP (1) JPH05213986A (en)
KR (1) KR930702374A (en)
CA (1) CA2096658A1 (en)
HU (1) HUT64554A (en)
WO (1) WO1992008729A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2114355A1 (en) * 1993-01-29 1994-07-30 Hidehiko Furukawa Modified oligodeoxyribonucleotides, their preparation and their therapeutic use
US5994320A (en) * 1995-02-06 1999-11-30 Regents Of The University Of Minnesota Antisense oligonucleotides and methods for treating central nervous system tumors
CN105524104B (en) * 2015-12-03 2018-10-02 清华大学 Phosphorothioate derivative and excessive bromine ethyl ketone base aromatic ring object react and product
EP3966219A2 (en) * 2019-05-08 2022-03-16 Biogen MA Inc. Convergent liquid phase syntheses of oligonucleotides

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5276019A (en) * 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
DE68925278T2 (en) * 1988-02-26 1996-09-19 Worcester Found Ex Biology INHIBITION OF HTLV-III BY EXOGENE OLIGONUCLEOTIDES
DE68929304T2 (en) * 1988-04-27 2002-04-25 Isis Pharmaceutical Inc Oligoribonucleotide derivatives and their use as antiviral drugs

Also Published As

Publication number Publication date
JPH05213986A (en) 1993-08-24
EP0558749A4 (en) 1995-07-05
HUT64554A (en) 1994-01-28
HU9301453D0 (en) 1993-09-28
WO1992008729A1 (en) 1992-05-29
KR930702374A (en) 1993-09-08
EP0558749A1 (en) 1993-09-08

Similar Documents

Publication Publication Date Title
EP0339842B1 (en) Novel oligoribonucleotide derivatives and application thereof to antiviral agents
Shibahara et al. Inhibition of human immunodeficiency virus (HIV-1) replication by synthetic oligo-RNA derivatives
US5789562A (en) Nucleotide monomers containing 8-azapurin bases or a derivative thereof, their preparation and their use in making modified olignonucleotides
WO2002018388A1 (en) Novel nucleoside analogs and oligonucleotide derivatives containing these analogs
WO1989009221A1 (en) Oligonucleotide n-alkylphosphoramidates
JPH06505704A (en) Modified internucleoside linkages
US5646261A (en) 3&#39;-derivatized oligonucleotide analogs with non-nucleotidic groupings, their preparation and use
JPH06189753A (en) Oligoribonucleotide having terminus 3&#39;-3&#39; and/or 5&#39;-5&#39; chain and ribosime affinous body
JPH0787982A (en) Modified oligodeoxyribonucleotide
JPH03240795A (en) New oligonucleotide derivative and use as antiviral agent
EP0611075B1 (en) Modified oligodeoxyribonucleotides, their preparation and their therapeutic use
WO1997046569A2 (en) 2&#39;-substituted nucleosides and oligonucleotide derivatives
EP0739899B1 (en) Novel oligoribonucleotide derivatives and application thereof to antiviral agents
CA2096658A1 (en) Anti-sense nucleic acid derivative
PL211566B1 (en) Novel 2&#39;,5&#39;-oligoadenylic acid analogues
CA2036287A1 (en) Polynucleotide phosphorodithioate as therapeutic agents for retroviral infections
JP3911703B2 (en) Antisense nucleic acid congeners
US6509459B1 (en) Base protecting groups and rapid process for oligonucleotide synthesis
WO1996018640A9 (en)
CA2122470A1 (en) Oligonucleotides having aminohydrocarbon phosphonate moieties

Legal Events

Date Code Title Description
EEER Examination request
FZDE Dead