CA2096013A1 - Nucleic acid amplification by two-enzyme, self-sustained sequence replication - Google Patents

Abstract

Novel methods are provided for nucleic acid amplification by continuous, substantially isothermal, self-sustained sequence replication ("3SR") utilizing RNA-dependent DNA polymerase activity, DNA-dependent DNA polymerase activity, RNAse H activity and DNA-dependent RNA polymerase activity. In one of the methods, before enzymatic activities can be provided by only two enzymes, a reverse transcriptase and a DNA-dependent RNA polymerase. The methods may employ two or three enzymes to provide the necessary enzymatic activities. Thus, in certain of the methods, an exogenous source of RNAse H, such as E. coli RNAse H, is employed in combination with a reverse transcriptase and a DNA-dependent RNA polymerase. In other of the methods of the present invention, reaction media are employed in which the inherent RNAse H activity of retroviral reverse transcriptases is effective to provide high levels of amplification so that only two enzymes, reverse transcriptase and DNA-dependent RNA polymerase, are required. Novel compositions for carrying out the methods of the present invention are also provided.

Description

2 ~ 1 3 NUCLEIC ACID AMPLIFICATIO~ BY TWO-ENZYME, SELF-SUSTAINED SEQUENCE REPLICATION

TECHNICAL FIELD
5The present invention relates generally to methods and kits for amplifying target nucleic acid segments in samples of nucleic acids. The-invention also concerns applications of the methods and kits in molacular biology, molecular genetics and nucleic acid probe hybridization assays, including such assays employed in diagnoses of diseases.

BACKGROUND OF THE INVENTIO~
Much of the work in molecular biology, molecular genetics and applications thereof, such as use of nucleic acid probe hybridization assays for diagnosing diseases by detecting blood-borne pathogens or de~ective genes, involves the detection or isolation of a particular nucleic acid sequence (i.e., a nucleic acid segment with a particular sequence) from a background of a very large number of different, but sometimes similar, se~uences o~ the same or nearly the same length. A
fundamental problem in such work is to detect or isolate, and if possible quantitate, a particular nucleic acid sequence of interest in such a background. The problem has been a di~ficult one because b~ological materials, such as cell cultures, tissue specimens and blood samples, which provide the mixtures of nucleic acids, in which a particular seg~ent needs to be detected or from which a particular segment needs to be isolated, typically are comprised of a complex mixture of RNAs and DNAs, of which at most only a minuscule ~raction has a segment of interest.
Two fundamentally different approaches have ~een taken to address the problem of detecting, or isolating after cloning, a nucleic acid segment of .

:' :

W092/~8800 PCT/VS91/0~88 2 ~ 2-, interes~("target segment"), that is pr~sen~ at a low level in a complex mixture of nucleic acids.
In the first approach, the amount of nucleic acid (including the tarye~ segment) in a sample of nucleic acid subjected ~o analysis is not altered;
instead, a signal-generating system is associated with the target segment and produces a detectable signal representative of the presence or the number of copies of target segment in the sample. For example, a nucleic acid probe, with a sequence complementary of that of at least a subsegment of the target s~gment and lin~ed to an enzyme, such as alkaline phosphatase, is mixed with sample under hybridization conditions, that effect hybridization between the probe and target segment but not appreoiably between probe and other nucleic acid segments in the sample. A~ter re~oving probe that fails to hybridize, a substrate for ~he enzyme (e.g., a chromogenic substrate for alkaline phosphatase) is added under conditions whi~h allow catalysis by the enzyme to proceed and, in principla, a large number of detectable molecules is rapidly produced in the enzyme-catalyzed reaction (visibly colored in the case of a chromoge~ic substrate with alkaline phosphatase) for each probe molecule hybridized to target 8egm2nt.
~5 Numerous other ~ystems ~or detecting nucleic acid seg~ents without altering the amount o~ target nucleic acid in the sample are known to the art. For example, target nucleic acid ~egments have been detected on the basis of hybridization w~th a probe labelled with ` a radioactive isotope (e.g., 3ZP) or a fluorescent moiety.
Alternatively, it is known to use a probe which comprises or is linked to an autocatalytically replicatable RNA
molecule (e.g., an RNA that is a substrate ~or the RNA-dependent RNA polymerase of Q~ phage or brome mosaic virus (BMV, see Miele et al., J. Mol. Biol. 171, 281 (1983)) and, after hybridization of probe with nucleic .

:.

' W092/08800 PCT/~S9l/0~88 2~9~

acid of a sample and then washing unhybridized probe from the sample, to induce replication of the replicatable RNA
with the corresponding RNA polymerase and, finally, detect replicated RNA molecules. A system in which probe for a target segment is linked to a RNA capable of being replicated by Q~ replicase is described by Chu et al., Nucl. Acids Res. 14, 5591 ~1986) and United States Patent No. 4,957,858 and by BMV replicase by Marsh et al., Positive Strand RNV Viruses (Proceedings of 1986 UCLA
Symposium), Alan R. Liss Publ. Co., New York, New York (1987).
This first approach, of amplifying signals associated with a target, has two serious draw~acks.
First, in many instances, the copy number of ~arge~
segment in a sample of practical size is so low that, even for reasonably rapid signal-generating ~ystems, the time required to generate detectable signal that is significantly above background is impracticably long.
Second, in any assay for a target segment, a signal due to "background" is unavoidable. In a system where signal is amplified, signal generation and amplification occur at essentially the same rates ~rom "background"
signal-generating molecules (e.g., probe molecules hybridized to segments with sequences nearly the same but not identical to the sequance of target segment, probe molecules adhering to glass, plastic or other components of a system, etc.~ as from si~nal-generating molecule~
actually associated with target. Thus, the sensitivity of assays using the first approach is fundamentally limited by unavoidable "background" signal-generating molecules.
The second approach is fundamentally different.
It involves increasing the copy number of the target segment itself, preferably to an extent greater than that of other segments in a sample, particularly those that might erroneously be detected as target segments because . .
' .
, ~ .

Wo 92~08800 PCr/US91/08488 of similarities in sequences.
Examples of this second approach include various culture techniques in which cells that harbor the target segment are caused to increase in number, sometim~s more rapidly than other cells, or in which particular nucleic acids (e.g., plasmids, RNAs), which comprise target se~ment, are caused to increase in nu~ber.
Another example of this second approach is amplification of a DNA target segment in a so-called ~Ipolymerase chain reaction" ( "PCR" ) . This technique is an adaptation of long known, naturally occurring processes in the replication of, for example, genomes of certain single-stranded DNA viruses and, in all events, is akin to DNA preparation following Hong, Bioscience Reports 1, ~43 (1981); Cooke et al., J. Biol. Chem. 255, 6502 (1980); and Zoller at al., Methods in Enzymology 100, 468-500 (1983). By the PCR technigue, a particular segment increases in copy num~er exponentially with a number of cycles, each of which entails (1) annealing to the 3'-terminal subsegment of each of the target segment and its complement (i.e., the segment of sequence complementary to that of target segment) a DNA primer, ~2) extending each of the primers with a DNA polymerase, and (3) rendering single-stranded by thermal denaturation the duplexes resulting from step (2). The PCR technique is described in Saiki et al., Science 230, 135 (1985) and Mullis et al., European Patent Application Publication Nos. 0 200 362 and 0 201 184 and US Patent Nos. 4,683,195 and 4,683,202.
Another technigue for carrying out the second approach to detecting a target segment present at a low level in a complex mixture of nucleic acids is by employing the so-called transcription-based amplification system ("TAS"). TAS employs an RNA-transcript-production step from a DNA synthesized to incorporate a se~ment with ' ~ , ;

WO 92/0~800 PC~r/US91/08488 2~9~ ~3 the sequence of target and a promoter positioned, with respect to the targe~ sequance~containing segmen~, to enable ~ranscription from the segment o~ a RNA with the sequence complemen~ary to that of target. Multiple cycl~s can be carried out, as the RN~ made in the tra~scription step can sexve as template for making similarly transcribable D~A, which, in turn, can be transcribed to yield additional RNA. ~mplification proceeds very rapidly with each cycle, as between about lo 10 and about 1,ooo copies of RNA comprising the sequence of target segment or the sequence complementary thereto are produced rapidly ~rom each double-stranded DNA which incorporates a promoter driving transcription of a se~ment comprising target segment. The TAS method is described in commonly owned United States Patent Application Serial Nos. 064,141, filed June 19, 1987, and 202,978, filed June 6, 1988 (published in Int2rnational Patent Application Publication No. W088/10315), the disclosures of which are hereby incorporated by reference. The TAS method of target nucleic acid amplification provides a rapid increase in copy number of a selected target segment by making use of two properties of DNA-dependent RNA polymerases: (1) appreciable initiation of transcription from only a small num~er of sequences specific for each polymerase, see, e.g., Brom et al., NUG1. Acids Res. 14, 3521 ~1986); and (2) rapid production of a large number of transcripts (typically 10~-104 per hour) from each copy of a promoter recognized ~by an RNA polymerase. ~ee Milligan et al., Nucl. Acids Res. 15, 8783 (1987). In addition, by employing a standardization technique, use of the TAS system makes possible unambiguous measurement of the amount of target nucleic acid segment present in a sample.
~he TAS method utilizes RNA-dependent DNA
polymerase activity and DNA-dependent DNA polymerase activity, both of which can be provided by a reverse .
.

W092/08800 ~ PCT/~S91/084~8 transcriptase, as well as DNA-dependent ~NA poly~erase activity and primers. The primers define the ends of the target segment to be amplified. At least one of the primers7 typically that which hybridizes to the 3'-end of the target segment, includes a segment which has the sequence of the sense strand of a promoter and is operatively linked for transcription to the segment of the primer with the sequence complementary to ~hat of the 3'-end of the target se~ment, to initiate transcription in the double-stranded DNA, which comprises the promoter and target segment. Exemplary promoters employed in the TAS method are those recognized by the RNA polymerases of T7 phage, T3 phage, and SP6 phage.
Th~ TAS method can be employed to amplify an RNA target segment. In such ampli~ications, the primers are employed to make from the RNA comprising the target segment a double stranded DNA which incorporates a promoter driving transcription o~ a DNA which comprises a segment with the sequence of target segment, to yield RNA
comprising a segment with the sequence complementary to that taryet segment.
The TAS method can also be employed to amplify a target segment of a double-stranded nucleic acid.
Brie~ly, the double-stranded nucleic acid of a sample is denatured and ~he primers are allowed to hybridize to their respective strands, one primer (the "antisense"
primer) hybridizing to the 3'-end o~ target segment and the other (the "sense" primer) to the 3'-end of the complement of target segment. The primers are then extended with a suitable polymerase and the resulting duplexes are thermally denatured and cooled to allow th~
respective primers to hybridize again, to not only the strands of double-stranded sample nucleic acid which comprise target segment but also to the extension products made in the initial primer extension reaction.
~he hybridized primers are again extended in a reaction - . .
- ,, - ~'"' -' , WOg2/08~00 PCT/US91/0848~
2~96D1 3 catalyzed by a suitable polymerase and, with the primers hybridized to extension products of the initial primer extension, two types of double-stranded DNA are formed, at least one of which comprises a promoter operatively linked for transcription to a segment which comprises target segment. The double-stranded DN~s, which comprise such promoters, are transcribed by a DNA dependent RNA
polymerase which recognizes the promo~er, to yield RNA
comprising a segment complementary to that of target segment and, thereby, in effect, to amplify target segment itself. The above process of hybridization, extension, thermal denaturation, hybridization, extension and transcription may be repeated using both the strands of the newly produced double-stranded DNAs and the resulting RNA transcripts as templates.
The TAS method of amplification, unl~ss autocatalytic replication of RNAs made in the process is employed, yields, inter alia, a first single-stranded RNA
trans~ript, which comprises a segment with the ~equence ~O of either target segment or the complement thereo~, and which is in large excess relative to a second RNA of sequence complemen~ary to that of the ~irst RNA. Thus, TAS provides an abundance of single-stranded ~NA which can be detected without the necessity of cumbersome, repeated PCR thermal cycling or strand separation.
It would be desirable to provide a form of transcription based ampli~ication which eliminates the need for a thermal denaturation step during PaCh round of ~mpli~ication such that multiple rounds of amplification may proceed without thèrmal denaturation. Thus, it would be very desirable to provide a form of transcription based amplification which is self-sustained and proceeds isothermally.

S~MMARY OF THE INVENTION
The present invention entails the surprising , ~ .

.

W092~08800 P~T/~9ltO848~

~Q~

discovery of a method o~ substa~tially continuous, self-sustained, target nucleic acid amplification which pr~ceeds spontaneously and isothermally. This method for self sustained sequence replication (hereinafter It3SR' provides for amplification of an RNA t~rget segm~nt utilizing RNA-dependent DNA polymerase activity, DNA-dependent DNA polymerase activity, RNAse H activity and DNA-dependent RNA polymerase activity, and primers which are capable of hybridizing to the target seg~ent or complement thereof and priming a primer extension reaction utilizing, as the template, the targe~ segment or complement thereof. At least one of the primers provides a promoter sense sequence. The RNAse H activity obviates the need for thermal cycling by enzymatically catalyzing the digestion of an RNA ~trand of an RNA-DNA
duplex rendering single stranded the ~NA strand of said duplex which was synthesized in a primer extension reaction utilizing said RNA strand as template. The four enzymatic activities may be provided by a combination of reverse transcriptase and DNA dependent RNA polymerase~
The present invention entails methods of 3SR
amplification wherein the inherent RNAse H activity of reverse transciptase provides the required RNAse H
activity and methods wherein the RNAse H activity of reverse transcriptase is supplemented with another source o~ RNAse H activity, such as E. coli RNAse H, whereby increased levels of amplification of from about 105- to 10S-fold may be achi~ved.
The present invention also entails the surprising discovery that, under certain reaction conditions, reverse transcriptases have sufficient RNAse activity to provide extremely sensitive 3SR
amplification reactions which are capable of amplifying an RNA target segment from about 105-fold to about 109-fold in less than 4 hours without supplementing the reaction medium with a source of RNAse H activity other :, :
;

W092~08800 2~ 9 ~ PC~/US91/08488 _9_ than the reverse ~ranscriptase. In ~he absence of said certain reaction conditions 3SR amplification levels greater than about 103- to 104-fold are no~ attainable unless the RNAse H activity of reverse transcriptase is supplemented with RNAse H acti~ity from, for example, E.
coli RNAse H. Thus, in another of its aspects, the present invention relates to 2-enzyme 3SR methods of target nucleic acid segment amplification which enable a target nucleic acid segment to be amplified from about 105-~old to about 109-fold within 4 hours, typically in f rom 1/ 2 hour to 2 hours.
The present invention is further eoncerned with novel improvements in 3SR amplification methods. These improvements entail improved reaction media and other react:on conditions, which enable target segment amplification by 3SR to proceed with only two enzymes, and provide for increased levels o~ amplification in both 2-enzyme 3SR and 3-enzyme 3SR reactions.
The present invention alsD provides methods for 2-enzyme 3SR amplification, wher by relatively large target segments, in excess of about 70o bases, may be ampli~ied to levels otherwise achievable with only smallar target segments.
The present invention provides kits for amplification by 3SR of target nucleic acid segments and ~or assays of samples for the presence of target nucleic acids by methods comprising amplificat~on by 3SR, said kits comprisiny improved reaction media ~or 3-enzyme 3SR
~amplification or components for 2-enzyme 3SR
amplification.

BRIEF DESCRIPTION OF ~E_DRAWINGS
Figure 1 is a schematic representation of an embodiment o~ the present invention. Figure 1 depicts the process of self-sustained sequence replication (3SR) as a step-by-step process, although it will be understood wo 92/08~00 ~3~ PC~/U~91/08q88.-that in practice all of the various steps occur simultaneously in a highly interactive fashion. The enzyme activities necessary for the 3SR amplification reaction are RNA-dependent DNA polymerase activity (RT
activity 1), DNA-dependent DNA polymerase activity (RT
activity 2), RNAse H activity (RT activity 3), and DNA-dependent RNA polymerase activity. The darkened rectangular blocks represent promoter-providing segments of the first primer (designated "A") and the second primer (designated "B").
Figures 2a and 2b depict a detailed schematic representation of the various steps of an embodiment of the present invention which shows the various subsegments which comprise the nucleic acid species stably or transiently present during the 3SR amplification reaction, as described hereinafter.

DETAILED DESCRIPTION OF THE_I~VENTION
Commonly owned United States Patent Application Serial No. 285,467, filed December 16, 1988, which is incorporated, in its entirety, herein by reference, d1scloses a method of substantially continuous, self-sustained, target nucleic acid amplification which proceeds spontaneously and isothermally. This method advantageously avoids the need for thermal denaturation of hybridized nucleic acids. Because this amplification method proceeds spontaneously and isothermally in the presence of target RNA ~egment, the required primers, the enzymes providing the necessary enzymatic activities, and nucleoside triphosphate substrates, the method is named "self-sustained sequence replication," hereinafter abbreviated as "3SR".
Self-sustained sequence replication can be made to proceed to completion because, as was discovered surprisingly, it is possible to maintain a reaction mixture, including enzymes for providing the four .. ~,, .......... ' .

., . . - . . .
, ~ :

W092/08800 2 ~ g ~ ~ ~ 3 PCT/US91/08488 nec~ssary enzymatic acti~ities, primers, ribonucleoside triphosphates and 2'-deoxyribonucleoside triphosphates, and RNA, under reaction conditions suitable for both hybridization of primers and, at suitable levels, the four necessary enz~matic activities.
The 3SR method employs two DNA primexs, which prime chain-exte~sion reactions using the target segment or complement thereof, respectively, as template. At least one of the primers incl~des the sense strand of a promoter. Amplification by the 3SR method, whiCh iS
continuous and substantially isothermal, requires four enzymatic activities provided by at least two enzymes -reverse transcriptase (to provide RNA-dependent DNA
polymerase actiYity and DNA-d~pendent DNA polymerase activity, and RNAse H activity) and a DNA-dependent RNA
polymerase. The RNAse H activity amployed in 3S~ is used to render single-stranded a DN~ extension product when an RNA segment acts as template ~or making the extension product, unlike TAS, which requires a denaturation st~p.
The RNAse H activity of a rever~e transcriptase used in the 3SR reactions of the invention may optionally be supplemented with a source of RNAse H activity other than the reverse transcriptase, such as E. coli RNAse H.
However, because E.coli RNAse H has its own optimal reaction conditions which differ from the optimal reaction conditions of the othar two enzymes, and because E. coli RNAse H is not easily isolated in acceptably pure form, and is considerably more expensive than the other ~two enzymes required for 3SR amplification, it is highly desirable to eliminate the requirement for an enzyme separate from a reverse transcriptase to provide an amount o~ RNAse H activity effective for high sensitivity amplification which is necessary to detect nucleic acid target segments present, before amplification, at very low concentrations.
Reference is made to standard textbooks of . . . .

W092/08800 ~ PCT/US91/0848~-~9 -12-molecular biology that con~ain definitions and methods and means for carrying out basic techniques of the present invention such as: DNA probe or primer preparation, including DNA synthesis; hybridization methodology including variations in stringency conditions for producing more or less hybridization specificity depending upon the degree of homology of a primer to a target DNA segment; RN~- and DNA-dependent DNA
polymerization reactions and synthesis of cDNAs;
identification, isolation, sequencing or preparation of promoters, or more specifically, promoters or sites recognized by bacteriophage DNA-dependent RNA polymerases for binding preparatory to catalysis of transcription, or, in the employment of eukaryotic systems, such promoters or sites recognized by viral DNA- and RNA-dependent RNA polymerases, for example, adenovirus-encoded RNA polymerase and brome mosaic virus RNA polymerase; conditions conducive to the production of RNA transcrip~s, including so-called transcription enhancer sequences; polymerase chain reaction methods including the reagents used therèin; and so forth. See, for example, Maniatis et al., ~ole~ular Cloninq: A
Laboratory ~nual, Cold Spring Harbor Laboratory, New York, (1982), and the various references cited therein:
U.S. Patent 4683195; U.S. Patent 4683202; Beaucage et ~1~, TQtrahedron ~e~ers 22, 1859 (1981): Caruthers et al., Meth. ~nZYm~ , 287 (1985): Lee et al., 9cience 239. 1288 (1988); Milligan et al., Nucleic Acids Res.~15, 8783 (1987); Miller et al., Viroloov 125, 236 (~983), Ahlquist et al., J. Mol. Biol. 153, 23 (1981); ~iller et al., Nature 313, 68 (1985); Ahlquist et al., J. Mol.
Biol. 172, 369 (1984): Ahlquist et al., Plan.t Mol. Biol.
3, 37 (1984); Ou et al., PNAS 79, 5235 (1982); Chu et al., ucl. Acids Res. 1~, 5591 (1986).; European Patent Application Publn. No. (EPA) 194809; Marsh ~
Positive Strand R~A Viruses, p. 327-336, Alan R. Liss .

WO9?/08~00 2 g ~ O 1 ~ PCT/~'S91/08488 (publ.; New York) (19~7; Proceedings of U~LA Sy~posium, 1986); Miller et al., J. Mol. Biol. 187~ 537 (1986), Stoflet et al., Science 239, 491 (1988): and Murakawa et al., DNA 7, 287 ~1988).
All of the aforecited publications are by this reference hereby incorporated by reference herein.
By the term "primer" in the present context is meant a single-stranded ~ucleic acid tha~ has a segment at its 3~-end with suf~icient homology to a segment of the target segment or complement thereof such that, under suitable hybridization conditions, it is capable of hybridizing to the target segment (or complement thereof) and priming a primer extension reaction in which a nucleic acid having the sequence ~ the target segment (or complement thereof) is the template. A hybridizing segment of a typical primer is at least about 10 nucleotides in length, more preferably 15-50 nucleotides, and most preferably approximately 15-25 nucleotide bases in length. A "primer" is preferably a DNA.
As used herein an "antisense primer" means a primer which has a sequence sufficiently complementary to a sequence at the 3'-end of the ~arget segment to be extended in a chain-extension reaction using target segment as template; a "sense primer" means a primer which has a sequence similarly sufficiently homologous to a sequence at the 5'-end of such target segmen~. The primers define the ends of the target segment to be amplified. In the most preferred embodiments, the sense ~nd antisense primers, respectively, have segments, which include at least their 3'-ends, that share identity or very high homology with the 5'-end of the target segment and the complement of ~he 3'-end of the target segment, respectively. See, for example, EPA 128042 (publd. 12 Dec 84).
At least one, optionally both, of the primers comprise a segment with a promoter sense sequence. By .

W092/08800 ~ PCT/US91/O~B~--~4-.

the term "promoter sense strand" is meant a single stranded nucleic acid which, when hybridi~ed with its complement to be i~ its double-stranded form (i.e., as a double-stranded pro~oter), is speci~ically recognized by an RNA polymerase, which binds to a polymerase-binding sequence of the promoter and initiates the process of transcription whereby an RNA transcript is produced. In principle, any sense promoter sequence may be employed for which there is a known and available polymerase that is ~apable of recognizing the sequence. Typically, ~nown and useful promoters are those that are recognized by certain bacteriophage RNA polymerases, such as those from bacteriophage T3, T7 or SP~. See Siebenlist et al., Cell 20~ 269 (1980). These are but examples of the RNA
polymerases which can be employed in the practioe of the present invention in conjunction with their associated promoter sequences. Also, a "promoter sens~ strand," as used herein, preferably comprises one or more nucleotides, more preferably about 4 to a~out 10 or more nucleo~ides, adjoining the 5'-most nucleotide of the promoter (sense-strand) consensus sequence (i.e., the sense sequence of the consensus polymerase-binding site).
As used herein, a "promoter sense ~equence" must be of su~icient length such that, upon completion of a cDNA
incorporating said sequence, the consensus sequence of the promoter is complQtely double-stranded. In these cDNAs, transcription occurs from the promoter when an RNA
pol~merase that recognizes the promoter is present under conditions suitable for transcription from the promoter.
Bacteriophage promoters are preferred because of their high specificity for their cognate RNA
polymerases. Other promoters and their corresponding DNA-dependent RNA polymerases which have similarly high specificity could be employed in accordance with the invention in place o~ the bacteriophage promoter polymerases, and the invention is intended to cover such ., ....... . - "
, .

~092/0~800 PC~/~S91/08~8~
~ - 2D9~

.
other promoters and RNA polymerases as well, proYided that said promoter shows 2 high deyree of specificity for said polymerase.
The preferred of the bacteriophage promoter sense sequences are the (~) strands of T7, T3 and SP~
promoters which include the segment to which the corresponding RNA polymerase binds and at least one, and preferably about 4 up to about 10, nucleotides 5~ from the 5'-end of this polymerase-binding segment. Pre~erred promoters and their corresponding RNA polymerases are described in the examples and claims, ~ut numerous other promoters and RNA polymerases are known in the art and can be employed as well.
The "variabl~ subsegments" that are optiona~ly included in the DNA primers serve one or more functions.
First, for the primer(s) which include(s) a promoter ~equence, the variable subsegments preferably include transcription initiation se~uences that are preferred by the RNA polymerase corresponding to the promoter. While the bacteriophage T7 transcription initiation sequence 5'-GGGA-3', which is located adjacent to the 3' end of the 17 nucleotide T7 promoter consensus sequence, is believed to be important to n vivo transcription, it does not appear to be crucial for transcription during 3SR amplification. Example IX, below shows the efrect on amplification levels caused by mutations (nucleotide changes or deletions) in the transcription initiation sequence immediately downstream from the 17 nt consensus ~sequence of the T7 promoter. The transcription initiation sequence is optional for primers having a promoter-providing segment. Such primers having the 3'-most nucleotide of the promoter consensus sequence adjoining a target hybridization segment may provide high levels of amplification comparable to those attainad where the transcription initiation sequence ~'-GGGA-3' is present. It is preferred, however, to include a segment ~16-of at least one t~ about four, preferably f~ur, nucleotides adjoining the 3~most nucleotide of the promoter consensus sequence. An example of a preferred sequence for inclusion at the site of the transcription 5 initiation sequence adjoining the 3'-most nucleotide of the T7 consensus sequence is the sequence 5'-GAAA-3l.
Second, for all of the primers, a variable subsegment can optionally contain a particular non-target segment whereby RNA product from the amplification can be detected in a nucleic acid probe hybridization assay.
Indeed, amplification (and assay) can occur for several different target segments simultaneously by using sets of primers that differ in their recognition ("anti-target~' or "anti-target complement") segments, at their 3'-ends but include a common variable subsegment. The variable subsegment may also contain a polylinker sequence that conveniently contains a plurality of restriction sites for ease of subsequent cloning. Further, the variable subsegment may contain the sequence of a self-replicatable RNA, such as QB virus, which, in the presence of its corresponding replicase (e.g., Q~
replicase), can multiply and autoreplicate an RNA
transcript having such variable subsegment.
The term "operably linked" in particular in connection with the linkage of a promoter sequence of a primer to a hybridizing (anti-target or anti-target complement~ sequence of said primer, refers to the ~unctionality of the ultimate "double-stranded nucleic acid template" or "cDNA" synthesized in the amplification meth.ods of the present inventiorl ~nd incorporating the primer. cDNAs so produced are capable of producing RNA
transcripts in the presence of a DNA-dependent RNA
polymerase that recognizes the promoter, when the promoter sense-strand segment of a primer is "operably linked for transcription" to the primer 3'-segment, which hybridizes to target or complement of target.

., :' ~ . ' ., ' ~ .- ' . -.

~"~92/088D0 ~ ~ 9 ~ 3 PCT/US91/08488 The primer extension reaction to produce a DNA-RNA or DNA DNA duplex is well known. Re~erse transcriptases, particularly from retroviruses, are known to be useful for pro~iding DNA-dependent-DNA polymerase and ~NA-dependent-DNA polymerase activity.
By a "high sensitivity amplification-effective amount of RNAse H actiYity" is meant an amount of RNAse H
activity which, in a reaction mixture containing appropriate primers (for 3SR amplification of an RNA
target sPgment) and RNA-dependent DNA polymerase activity, DNA-dependent DNA polymerase activity and DNA-dependent RNA polymerase (and substrates therefor), and which is incubated in a ~emperature range a* which the latter three enzymatic activities are active, is 15 capable of amplifying said RNA target segment at least about 105-~old in 2-4 hours. The term "high s~nsitivity ampli~ication-effective amount of RNAse ~ as used herein is meant to relate to the level of amplification necessary in a 3SR reaction to detect, using known nucleic acid hybridization assay techniques, a nucleic acid target segment which is present, prior to ampli~ication, in a reaction medium at a level of 1 to 10,000 moleculas (e.g., in a reaction volume of about 0.05 to about 1 ml). ~n amount of RNAse ~ activity which is effective for 3SR amplification reaction may be less than a "high sensitivity amplification-effective amount"
of RNAse H activity, and in such cases may be sufficient to amplify, in a 3SR amplification reaction, a targAt ~nucleic acid segment which is present at a concentration 30 such that the level of amplification needed fsr detection is less than about 102-fold to about 104-fold.
The RNAse H activity known to be possessed by retroviral reverse transcriptases, is known under certain conditions, to digest the RNA strand of an RNA-DNA duplex into small oligonucleotides te.g., oligoribonucleotides of less than about 5-10 bases in length) while leaving , , the DNA strand intact. However, under reaction condi~ions which are described in the aforementioned, herein incorporated U.S. Serial No. 285,467, the RNAse H
activity inherent in reverse transcriptases is insufficlent to provide high sensitivity 3SR
amplification. Under reaction conditions described in Serial No. 285~467, the addition of E.coli RNAse H
supplements the inherent RNAse H activity of a reverse transcriptase and allows 3SR amplification levels necessary ~or detection, by nucleic acid hy~ridization, of a nucleic acid target segment present at a concentration of about lO attomole/ml before amplification.
The four ribonucleoside triphosphates, rATP, rUTP, rCTP and rGTP, are referred to collectively herein as "rNTPs" or "rXTPs."
The techniques for forming a detectable signal, such as via radioactive labeling or chromogenic means using an enzyme to catalyze a chromogenic reaction, are also well known and documented in the art.
In one of its aspects, the invention entails a method for 3SR amplification of a target RNA segment of a target RNA molecule which segment comprises a 5'-subsegment, which includes a 5'-terminal nucleotide and extends at least 9 nucleotides in the 3'-direction from the 5'-terminal nucleotide of the target segment, and a 3'-subsegment, which does not overlap the 5'-subsegment and which includes a 3'-terminal nucleotide and extends at least 9 nucleotides in the 5'-direction from the 3'-terminal nucleotide of the target segment (see, e.g., Figure 2a, s~ep 1), which method comprises incubating in a reaction medium:
(a) (1) a first DNA primer which is a single stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first t~
1 i~

W092/08~00 2 0 9 ~ D ~ 3 PCT/U~91/08488 subsegment of said firs~ primer being of the sam~ length as the 3'-suhsegment of the target segment and having a sequence sufficiently complementary to that of the 3l~subsegment of the target segment to prime, in the reaction medium, a primer extension reaction in which a nucleic acid with ~he sequence of the target segment is the template, and (2) a second DNA primer, which is a single-stranded DNA which comprises at its 3l-end a first subsegment having a 3~-terminal nucleotide and extending at least 9 nucleotides in the 5~-direction, said first subsegment of said second primer being of the same length as the s~-subsegment of the targat segment and having a sequence sufficiently homologous to that of the s~-su~segment of the target segment to prime, in the r~action medium, a primer extension reaction in which a nucleic acid with the sequence complementary to that of the target seg~ent is the template, provided that at least one of said primers further comprise~ a promoter-providing subseg~ent, which comprises the sense strand of a ~irst promoter, said sense strand being joined to the ~irst subsegment of the primer, which comprises said promoter-providing segment, operably for transcription from said first promoter of a cDNA
comprising the extension products of said two primers, and provided further that, where said first primer lacks such a promoter-providing subsegment, then the 5'-terminal nucleotide of said 5'-subsegment o~ said target RNA æegment is the 5'-terminal nucleotide of the ~ target RNA molecule;
~b) at least two enzymes which exhibit in said reaction medium DNA-dependent DNA polymerase activity, RNA-dependent DNA polymerase activity, ~NAse H activity and a DNA-dependent RNA polymerase, said DNA-dependent RNA polymerase in said reaction medium, being capable of catalyzing transcription from said first promoter; and (c) nucleoside triphosphates reguir~d as W092/08~00 ~ PCT/~S91/08~88 substrates for the DNA-dependent DNA polymerass, ~NA-dependent DNA polymerase, and DNA-dependent RNA
polymerase activities:
wherein said incubation occurs in a range of temperatures at which said enzym~s in said reac~ion medium are active in providing said DNA-dependent DNA
polymerase, RNA~dependent D~A polymerase, RN~se H, and DNA-dependent RNA polymerase ac~ivities.
In another of its aspects, the invention entails a method for highly sensitive, highly productive, 2-enzyme 3SR amplification of a target RNA segment of a target RNA molecule which segment comprises a 5~-subsegment, which includes a s~-terminal nucleotide and extends at least g nucleotides in the 3'-direction from the 5'-terminal nucleotide of the target segment, and a 3'-subsegment, which does not overlap the 5'-subsegment and which includes a 3'-terminal nucleotide and extends at least 9 nucleotides in the 5'-direction from the 3'-terminal nucleotide of the target segment (see, e.g., Figure 2a, step 1), which method comprises incubating in a reaction medium:
(a) (1) a first DNA primer which is a single stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first subsegment of sai~ first primer being of the same length as the 3'-subsegment of the target segment and having a sequence sufficiently co~plementary to that of the 3'-subsegment of the target segment to prime, in the reaction medium, a primer extension reaction in which a nucleic acid with the sequence of the target segment is the template, and (2) a second DNA primer, which is a single-stranded DNA which comprises at its 3' end a first subsegment having a 3'-terminal nucleotide and extending at least g nucleotides in the 5'-direction, said ~irst subsegment of said second primer being of the same length - ~ .

.

WO 92/08800 2 ~ e9 6 ~ 1 ~ pcr/us91/o8488 --21~

as the 5~-subseg~ent of the target segment and having a sequence sufficientl~ homologous to that of the 5'-subsegment of the target segmen~ to prime, in the reaction medium, a primer extension reaCtion in which a nucleic acid with the sequence complementary to that of the target egment is the template, provided that at least one of said primers further comprises a promoter-providing subsegment, which comprises the sense strand of ~ first promoter, said sense strand being joined to the first subsegme~t of the primer, which comprises said promoter-pro~iding segment, operably f or transcription from said f irst promoter of a cDNA
comprising the extension products of said tw~ prim~rs, and provided further that, where said first primer lacks such a promoter-providing subsegment, then the 5~-terminal nucleotide of said 5~-s~bsegment of said target RNA segment i~ the S'-terminal nucleotide of the target RNA molecule;
(b) (1) a reverse transcriptase which exhibi~s in said reaction medium DN~-dependent DNA polymerase activity, RNA-dependent DNA polymerase activity and a high sensitivity ampli~ication-effective amount of RNAse H activity, and (2) a DNA-dependent RNA polymerase which, in said reaction medium, catalyzes transcription from said first promoter; and ~c) nucleoside triphosphates required as substrates for the DNA-dependent DNA polymerase, RNA-dependent DNA polymerase, and DNA-dependent RNA
~olymerase activities;
wherein said incubation occurs in a range of temperatures at which said enzymes in said reaction medium are active in providing said DNA-dependent DNA
polymerase, RNA-dependent DNA polymerase, RNAse H, and DNA-dependent RNA polymerase activities.
3SR amplification methods require at least one promoter-provi~ing primer, which is a primer which ~.

W0~2/088~0 ~9~3 PCTtU~9~/0~8~

comprises a segment with the sense sequence of a pr~moter, which segment is linked operably for transcription to the 39-segment of the primer, through which the primer hybridizPs to the target segment or complement of target segment. The first primer and the second primer are also referred to herein as the "antisense primer" and "sense primer," respectively.
The antisense primer is the preferred primer to include a promoter sequence, although as will become clear from the dascription of the present invention, the antisense and the sense primers may each include a promoter sequence, and in certain instances, amplification may proceed where only the sense primer includes such a promoter sequence.
The latter embodiments, in which only the sense primer comprises a sense strand of a promoter, require an RNA
target segment wherein the 5' terminal nucleotide of the 5'-subsegment is also the 5'-end of the entire target RNA
molecule.
Certain subscripts are employed to define the various nucleic acids stably or transiently presant during 3SR amplification. ~hese subscripts hava the ~ollowing meanings: "1" -- a sequence associated with a ~irst primer; "2" -- a sequence associated with a second primer: "t" -- a portion of the target segment; "c" - a sequence complementary to a portion of the target segment "r" -- RNA; and "d" -- DNA. For example, the segment designated hereinafter as (3'-subsegmenttc~) is a DNA (d) sequence which is complementary (c) to the 3' subsegment (i.e., primer hybridizing segment) of the RNA target (t) segment, which hybridizing segment is designated (3'-subsegment5r).
2-enzyme 3SR amplification methods of the present invention wherein the antisense primer includes a promoter sense sèquence will now be described. The following description assumes the presence of an RNA
target segment in the reaction medium. Also described ~ .

' W092/08~00 2 ~ ~ 6 ~ 1 ~ PCT/US91/08~

thereafter is the production o~ an RNA targe~ segmen~
from a double-stranded DNA, which includes a segment with the same sequence as the target RNA segment (substituting ribonucleotides for 2'-deoxyribunucleotides and U for T), for situations where a targ~t RNA ~egment may not b~
present initially in a biological sample or other sample of nucleic acid to which the method of the invention is to be applied.
With reference to Figure 1, 2-enzyme 3SR
amplification, in accordance with the present invention, is initiated with a target RNA segment of Formula I:

5'-(5'-subsegmenttr)-(intermediate subsegmenttr)-(3'-subsegmenttr)-3'.

I

The subsegment designated (5~-subse~menttr) is an RNA
segment o~ known sequence having at least lO nucleotides, includin~ the 5~-most nucleotide of tha RNA target segment and extending in the 3' ~irection therefrom at least g nucleotides. The (3'-subsegmenttr) ls an RNA
segment o~ known sequence of at least lO nucleotides, including the 3'-most nucleotide of the ~NA target segment and extending in the 5' direction therefrom at least 9 nucleotides. The (intermed~ate subsegmenttr) is an RNA segment of 0 or more nucleotides which adjoins the (3'-~ubsegmenttr) and the (5'-~ubsegmentt,). I~
(intermediate subsegmenttr) has 0 nucleotides, then the 3'-terminus of (S'-subsegmenttr) adjoins the 5'-terminus of (3'-subsegmentt,).
The first step in the 3SR amplification prooess involves hybridization of the first {antisense) primer to the 3'~subsegment of the RNA target ~3'-subsegmenttr) and extension thereof by the RNA-dependent DNA polymerase activity of a reverse transcriptase using the target RNA
as a template to form a DNA-RNA duplex. The so-formed ~, .

WO92/08B00 ~96~ PCT/US9]/08488 DNA-RNA duplex extends at least to the 5l-terminal nucleotide of the (5'-subsegmenttr). see Figure 2a, step 3.
The first primer is a sin~le-stranded DNA which comprises the nucleic acid segment of Formula II:

5'-(promoter~d)-(variable subseqment (3l~subsegmenttrd)-3l II

The segment designated ~promoter1d) is a single-stranded DNA segment with the sequence of the sense strand of a first promoter, preferably one recognized by a bacteriophage DNA-dependent RNA pol~merase;
(3'-subsegmenttcd) is a single-stranded DN~ segment having the same num~er of nucleotidas as, and a sequen~e which i~ ~ufficiently complementary to, (3~-subseg~enttr) to hybridize to and prime an extension reaction using the target RNA as template: (variable subsegment~d) is a single-stranded DNA segment of 0 to 50 nucleotides adjoining the 3~-terminal nucleotide of (promoter1d). If said (variable subsegment1d) has 0 nucleotides, the 3'-end of the promoter sense strand~ (promoter1d), adjoins the 5'-terminus of said (3'-subsegmenttcd). (Variable subsegmentld) may comprise~ for example, a native transcription-initiation segment recognized by the RNA
polymerase which recognizes the promoter; in the case of bacteriophage T7 polymerase, this native transcription-initiation segment would have the sequence 5'-GGGA-3'. A
presently preferred transcription initiation segment comprises the sequence 5 ~-GAAA-3 ' .
The improved reaction media of the present invention enable the 2-enzyme 3SR amplification methods of the present invention because such reaction media enable the expression of inherent RNAse H activity of . .~ , ' ':

WO 92/08~00 2 ~ 9 1~ 0 t 3 PCl/US91/08488 reverse ~ranscriptase~ This RNAse H activity of reverse transcriptase degrades the RNA strand o~ a DNARNA duplex yielding a firs~ complementary DNA strand comprising the DNA segm~nt o~ Formula III.

5 1 - (promoter1d) -(variable subseyment1d)-(3~--subsegmentt~d~--(intermediate subsegmentt~d)--(5'-subsegmenttcd)-3~.

III

The segments (intermediate ~ubsegmenttcd) and (5'-subsegmenttcd) are the DNA segments complementary to . (intermediate subsegmentt,) and (5'-subsegmentt,), respectively. ~he segments (promoter1d), (variable subsegmentld) and (3'-subsegmenttcd) are defined in Formula II. .
Where the RNA target molecule is not identical in length to the RNA target~segment, DNA-RNA duplex may include a DNA-RNA duplex segment which extends (relative to the RNA strand) in the 5'-direction beyond the 5'-subsegment of the target and/or single stranded RNA
sequence which extends in the 3'-direction from the 3'-subsegment.
A second DNA primer ("sense primer") hybridizes to the single-stranded first complementary DNA and primes a primer extensio~ reaction on this first complementary DNA. The second DNA primer is a single-stranded DNA
comprising a sequence of at least lO nucleotides and corresponds to Formula IV (promoter-less primer) or Formula IV(a), a promoter-containing primer:

5'-(variable subsegment2d)-(5'-subsegmenttd)-3 IV

. . "
~ . - . . . .
.: ~ ,, 5'-(promoterzd)(variable subsegment2d)-(5~-subsegment~d)~3' IV(a) The segment designated (s~-subsegm2nttd) is a DNA with a sequence which is sufficiently homologous to the sequence of (5~-subsegmenttr~ to hybridize to a first complementary DNA (at (5'-subsegmenttcd)) and prime a primer extension o reaction using a first complementary DNA of Formula III
as template. The segment designated (variable subsegment2d) is a segment of 0 to 100 nucleotides which adjoins the 5'-terminus of (5'-subsegmenttd). The second promoter sense sequence is designated (promoter2d). As with the segment designated (variable subsegmentld), (variable subsegment2d) may comprise, for example, a native transcription-ini.tiation segment recognized by the RNA polymerase Which recognizes the promoter; in the case of bacteriophage T7 polymerase, this native transcription-initiation se,gmént would have the sequence 5'-GGGA-3'. A presently preferred transcription initiation segment comprises the sequence S'-GAAA-3'.
The second promoter sense sequence, if present, may be the same or different from the first promoter sequence.
Where the first promoter and second promoter are different (i.e., where the first and second promoters are not recognized by the same DNA-dependent RNA polymerase) the reaction medium may optionally include a second DNA-dependent RNA polymerase which recognizes the second promoter.
Inasmuch as the segment designated (variable subsegment2d) is an optional segment of a pro~oter-less sense primer of Formula IV (although it will be understood that inclusion of such subsegment may ~e : 35 desirable for example to provide a non-target sequence ~ for hybridizatlon assay purposes), this optional segment . ~ ~

- - . . .::

will be omitted ~om the description which follows which pertains to embodiments of the present invention employing a promoter-less sense primer.
The DNA-dependent DNA polymerase activity of reverse transcriptase extends the second primer using the first complementary DNA as a template to form a first double stranded cDNA (hereinafter cDNA I) which comprises , ~ , i: ' '. - ~- :. ~ , .

W092/08800 2 ~ ~ 6 0 ~ ~ PCT/US91/0~4~8 a promoter operatively linked for transcription to a cDNA
segment that is the complement of the RNA target segment (i.e., has khe sequence exactly complementary to tha~ of the target segment~. See Figure 2a, step 6. ~he CDNA
comprises the first complementary DNA strand, as defined a~ove in Formula III, and second complementa~y DNA strand comprising the DNA of ~ormula V or V(a):
5 ' - ( 5 ~ -subsegmenttd) - ( intermediate subsegment.td) -( 3 ' -subsegmenttd) - (variable subsegment~cd) -10 (promoter1cd)-3 ~, 5'--(promoter2d)--(~ariable subsegment2d)--(5'-subsegmenttd) -(intermediate subsegm2nttd)-(3'-subsegmenttd)-(variable subsegment1cd)-(promoter1cd)-3'.

V(a) The segments (intermediate subsegmenttd), (3~-subsegmenttd), ~variable subsegment1cd) and (promoter1ed) are segments which are complementary to (intermediate subsegmenttcd), (3'-subs~gmenttcd), (variable subse~men~1d) and (promoter~d), respectively. The segments (promoter2d), (variable subsegment2d) ~nd (5'-subse~menttd) are de~ined as in Formula~ IV and IV(a);
CDNA I consisting of the first and second complementary DNA strands is transcribed from the first promoter in the presence of corresponding DNA-dependent RNA polymerase to produce multiple copies of an RNA
transcript of Formula VI or Formula VI(a) (See Figure 2b, step 7):
5'-(variable subsegmentlr)-(3'-subsegmenttc,)-(intermediate subsegment~cr)-(5'-subsegmenttc,)-3' VI

W~92/08~00 ~ ~9 ~3 P~T/US91/~88 5'-~variable subsegment1r)- (3'-subsegmenttc~)-(intermediate subsegmenttcr)-(5'-subsegmenttcr) (variablf~ subsegmentzcr)--(promoter2cr) -3 ' .

~I ( a ) The segment (variable subsegmentl,) is an ~NA segment correspon~ing to (variable subsegment1d); the segments (3~-subsegmenttcr), ~intermediate subsegmenttc,), (5~ subse~menttc,), (variable subsegment2~r), and (promoter2cr) are complementary ~o (3'-subsegmentSr), (intermediate subsegmenttr), (5'-subsegmenttr~, (variable subsegment2d) and (promoter2d), respectively.
Each of the multiple copies of the RNA
transcript of Formula VI or VI(a) is capable of hybridizing with second primer of Formula IV or IV(a), respectively, and functioning a~ tsmplate ~or a primer extension reaction to ~o~m a DNA-RNA duplex. see Figure 2b, steps ~ and 9. The inherent RNAse H activity of reverse transcriptase digests the RNA transcript strand of the DNA-RNA duplex, thus rendering single stranded the third complementary DNA of Formula VII or Formula VII(a):

(5~-subsegmenttd)-tintermediate subsegmenttd)-(3'-subsegmenttd)-(variable subsegment1cd~-3' VII

5'-(promoter2d)-(variable subsegment2d)-(5'-subsegmenttd)-(intermediate subsegmenttd)-(3'-subsegmenttd)-(variable subsegment1cd)-3'.

VII(a) Each of the segments is de~ined as in Formulae V or V(a) W092/08800 2 0 9 ~ ~ 1 3 PCT/US91/08q88 .

above.
Next, a first primer of Formula II hybridizes with this third complementary DNA strand and is extended to form a fourth complementary DNA. See Figure 2b, step 12. The fourth complementary DNA is a segment of Formula VIII:

3'-~5l-subse~menttcd)-(intermediate subsegmenttcd)-(3'-subsegmenttcd)-(variable subsegment1d)- (promoterld)-5 VIII

or of Formula VIII (a) 3'-(promoter2cd)-tvariable subsegment2cd)-~5'-subsegmenttcd)-(intermediate subsegmenttcd~-t3'-subsegmenttcd)-(variable subsegment~d)-(promoter1d)-5' VIII~a) Each of the segments is defined in ~ormula III above.
The ov~rhanging end of the four~h complementary DNA, the promoter-encoding sequence, acts as a templa~e for extension of the third complementary DNA to complete a cDNA II, Formula X, which consists of a third complementary DNA strand of Formula VII and a fourth complementary strand of Formula VIII (or Pormulae VII~a) and VIII(a)).
In the just-described embodiment of the present invention transcription produces either antisense transcripts (where only the antisense primer contains a promoter sense strand) or both sense and antisense transcripts (where each primer contains a promoter sense strand).
Sense transcripts are of Formula IX:

. .

w092/0$8~0 . PCT/US91/0~88 ~, Q ~
5'-(variable subsegment2r)-(5' subse~menttr)-(inte~mediate subse~menttr) (3'-subse~menttr) (~ariable subsegment~c,)- (promoter~cr)-3' IX
The segments designated (5'-subsegmenttr), (intermediate subsegmenttr) and (3~-subs~gmenttr) are identical to or substantially homologous to the RNA target segment of Formula I. The segments (variable subsegmentlcr) and (pr~moter1cr), respectively, are the RNA sequences complementary to (~ariable subsegment1d) and (promoter1d).

The antisense transcripts reenter the antisense amplification loop as tQmplate to produce additional copies of cDNA II. Fi~ure 2b, steps 7-12.
The sense transcripts of Formula IX enter a di5crete sense amplification loop analogous to the just-described antisense loop. Briefly, each of the multiple copie~ o~ the ~ense transcript is capable of hybridizing with first primer of Formula II and functioning as template for an extension product to form a DNA-RNA duplex comprising a fifth complementary DNA
which is rendered single-stranded by inherent RNAse H
activity of reverse transcripta~e. See Figure 2b, steps 7a-lOa. A second primer of Formula IV(a) hybridizes therewith and is extended to form a double stranded cDNA
II which is identical to the cDNA II which consists of DNA strands of Formulae VII(a) and VIII(a). cDNA II has a completely double stranded promoter at each of its ends. (Figure 2b, steps lla-12). Transcription may : proceed ~rom each of the two DNA strands, to produce multiple copies of sense transcripts (i.e., transcripts comprising a segment with sequence of target segments) and antisense transcripts (i.e., transcripts comprising a æegment with the sequence complementary to that of target segment) to feed the two complementary amplification I, ~ - -. .

.. :; - . . . .

W092/08800 2 ~ 9 ~ ~ :i 3 PCT/US91/08488 loops.
Through the above-described reaction cycle one or more molecules of ~NA containing a target segment may be amplified within 2 hours to lo6 copies or more of an RNA transcript having a segment with the sequence of the target segment or the complement thereo~ with~ut the need for thermal cycling or the repeated addition of enzymes.
The 3SR reaction of the present invention, carried out in the improved reaction media of the present invention, requires only two enzymes, reverse transcriptase and DNA-dependent RNA polymPrase, to provide the necessary four enzyme activities.
Although the foregoing description o~ the process was step-by-step, it will be understood that in practice all of the various steps occur simultaneously in a very complex, highly interactive fashion.
While the above descri~ed ampli~ication mechanism employs an antisense primer containing a promoter-providing segment (i.e., includes a promo~er sense sequence), 3SR amplification may also be carried out where the sense primer comprises a promoter-providing segment and the antisense primer does not. In this embodiment the RNA target molecule should not extend in the 5'-direction beyond the 5'-nucleotide of the RNA
target segment (i.e., the 5'-nucleotide of the subsegment designated ~5'-subsegmenttr) should be the 5'-nucleotide of the target molecule). Where the 5'-terminal nucleotide of the target segment is thè 5'-terminal nucleotide of the entire target RNA molecule, amplification will proceed by steps which are analogous to those depicted in Figures 2a and 2b, but the transcripts produced will be sense transcripts which will directly enter the amplification lcop depicted by steps 7a-12. No antisense transcripts will be produced.
3~ one way to ensure that the 5'-terminal nucleotid~ of the RNA target molecule is the 5'-terminal , . ~. ~ . . .

: . ~ ,;.

W092/08800 2 ~ 9 ~ ~3 PCT/US91/0~8g nucleotide of the RNA target segment is to amplify an RNA
target segment of predetermined nucleic acid sequence which segment is at the 5'-end of the ~NA target molecule. In this way a suitable sequence for the promoter-providing sense primer may be provided: For example, a suitable sense primer may comprise a DNA
~egment which includes a promoter sense strand operatively linked for transcription to a segment having a sequence homologous to e.g., the 20 nucleotide segment at the 5'-end of the RNA target molecule including ~he 5'-terminal nucleotide of the RNA target molecule and extending l9 nucleotides in the 3'-direction therefrom.
The antisense primer may consist of a DNA segment having a sequence which is complementary to a segment at the 3'-end of the target segment.
A second way to provide an RNA segment meeting the limitation that the 5~-terminal nucleotide o~ the karget RNA molecule is the 5'-te~inal nucleotide of the target segment is to produce such an RNA target molecule, from a DNA segment which encodes the target sequence, by conducting a cycle of TAS amplification. An appropriate target RNA segment thus may be generated from ~ double stranded DNA (or single stranded DNA or RN~) known to encode the taryet sequence. For example, where a double stranded DNA encodes the target segment of interes~, the ~irst and second DNA primers are added to the reaction solution and the solution is heated at about 94-C - lOO-C
~or l minute and is then cooled to 42-C over the course of 1 minute. This heating and then holding at 42 C, in combination with the composition of the solution, provides conditions of strin~Pncy sufficient to provide hybridization of the first primer and the second primer to the two complementary strands of said double-stranded DNA, with sufficient stability to prime a primer extension reaction. Reverse transcriptase or DNA-dependent DNA polymerase (and the necessary - - ~ - . .

~: : .

W09~/08~00 2 ~ PCT/US91/08488 nucleoside triphosphates, if not previously added) is added to polymerize the extension reactlon. ~he heat-stable DNA polymerase from 'rhermus aquaticus (see Chien et al. J. Bacteriol. 127, 1550 (1976)), SequenaseTM
brand recombinant T7 DNA polymerase from the U. S.
Biochemicals Corp., Cleveland, Ohio, U.S.A., and the well known Klenow Fragment of E. coli DNA polym~rase I, and calf thymus DNA polymerase alpha, may be used.
The nucleic acid containing solution is again heated to lOO~C ~or l minute and cooled to 420 for minute during which step first and second primers hybridize with the extension products of the prior primer extension reaction. In the case of 2-enzyme 3SR, reverse transcriptase and DNA-dependent RNA polymerase are then added such that the hybridized primers are extended to complete the cDNA synthesis and the cDNA is transcribed to produce target RNA transcripts. 3SR amplification is thereby initiated.
The target RNA segment provided by such a cycle of TAS amplification has its 5'-end and 3' end defined by the two primers utilized. Such an RNA therefore satis~ies the requirement that the 5'-terminal nucleotide o~ th~ RNA target molecule is the ~'-terminal nucleotide of the 5'-subsegment of the target RNA. I~ should also be clear, however, that such a cycle of TA5 amplification may virtually always be used to produce an RNA target segment suitable for 3SR amplification, without regard to which primer(s) include(s) a promoter sequence. see Example II.
In preferred embodiments of the present invention, the amplifiable target segment of a nucleic acid of interest has an (intermediate su~se~mentt,) including ~t least 20, and more preferably at least about 50, nucleotides to permit, optionally, the use of a second round of 3SR amplification u~ing third and fourth DNA primers to amplify the (intermediate subsegmenttr)) in W092/08800 ~ ~9 ~ ~ PCT/US~1/08~88 a further re~inement of the amplification method. Also, the tintermediate subsegmenttr) may be ~sed for detecting 3SR-produced transcripts by a nucleic acid hybridlzation assay, where the (variable subsegm~nt) does not have a non~target segment which may be used for this purpose.
In several of its aspects, the present invention involves the discovery that two enzymes, a retroviral reverse trans~riptase and a DNA-dependent RNA
polymerase by themselves and in the absence of an exogenous any source o~ RNAse H activity other than the reverse transcriptase, can provide the four enzyme activities necessary for high sen~itivity 3SR
amplification, which requires a high sensitivity amplification effective amount of RNAse H activity. One such method for augmenting the endogenous ~NAse H
activity of the reverse transcriptase entails carrying out the reaction in a reaction ~edium comprising about 20 to 40 mM of a magnesium-containing salt such as magnesium chloride, magnesium sulfate and the like; about 1 to 25 mM of an alkali metal chloride such as XCl or NaCl and the like; about O to 20 mM of a sulfhydryl reducing agent such as dithiothreitol ~DTT), beta mercaptoethanol and the like; about O to 10 mM sp~rmidine; about 1 to 8 mM
ribonucleoside triphosphates; about 1 ~M to 8 mM
2'-deoxyribonucleoside triphosphates and about O to 25 vol~me percent of a sul~oxide compound such as dimethylsulfoxide.
Preferred reaction media comprise:
20 - ~O mM MgCl2 1 - 25 mM KCl 1 - 10 ~M Spermidine 1--20 mM DTT
: 1 - 7 mM rNTPs 0.01 - 2 mM dNTPs 3S O - 15% dimethylsulfoxide (by volume) '' .-~-; . ,- . , . '. - :
. . ~ ~, .. ~ . .
- .

W092/08~00 ~ ~ 6 ~ PCT/US91/0~8 ~35~

and an appropriate buffer (Tris, HEPES, etc.) such that said reaction medium has a pH of between abo~t 7.5 and about 8.5, preferably pH 8.1. The DMSO is required when AMV reverse transcriptase is the source of RNAse H
activity.
Prior to the present invention, 3SR reactions were believed to be unsupportable using as a source of the four required enzymatic activiti8s only a retroviral revers~ transcriptase, such as AMV r~verse transcriptase, and DNA-dependent RNA polymerase, where amplification levels greater than about 103 were desired. It has been found by the in~entors that improved reaction media, surprisingly, allows the inherent RNAse H activity of retroviral reverse transcriptases to function to support such levels of 3SR amplification even in the absence of other sources of RNase H activity, such as E. coli RNAse ~.
It has also been discovered by the inventors that supplementing such reaction media with from about l to about 25 percent by weight of a hydroxyl containing compound surprisingly increases the level of amplification which is attainable. Hydroxyl containiny compounds include, but are not limited to C1-C10 al~ohols such as methanol, ethanol, propanol, isopropanol, butanol, isobutanol, and the like; glycols su~h as ethylene glycol, diethylene glycol, triethylene glycol and polyethyl2ne glycols having an average molecular weight of up to about 20,000 daltons which are aqueous soluble; mono-, di- and trisaccharides such as glucose, galactose, mannosef fructose, sucrose, maltose, raffinose and the like; and sugar alcohols such as ~orbitol, glycerol, glucitol, mannitol, inositol and the like.
The improved reaction media of the present invention therefore preferably include one or more of the following compounds: ~i) a Cl-ClO alcohol; (ii) a compound of the formula HOCH2[CHOH)XCH20H, wherein x is W092/08~00 ~ PCT/US91/08~
q ~
3~-0-20; (iii) a polyethyle~e glycol compound of the formula H~OCHz-CHz)nOH, wherein n is 2-600, or a mixture of such compounds with an average m~lecular weight of about 1,000 to about 20,000, pre~erably about 6,000 to about 10,000, and (iv) a sugar from the group of mono-, di- and tri-saccharides and derivatives thereof. Preferred compounds of the above-defined formulae include ethanol, glycerol, sorbitol, su~rose and PEG-8000. Several of the examples below show the effect of ~ulfoxide and hydroxyl containing compounds on the levels of amplification attainable with 2-enzyme 3SR or 3-enzyme 3SR.
~ost preferred of the reverse transcriptases (RTs) are AMV reverse transcriptase, recombinant ~LV
reverse transcriptase and HIV-1 reverse transcriptase, which lack 5'-to-3' exonuclease acti~ity.
The improved reaction media should be supplemented with a sulfoxide compound of t~e formula R1-(SO)-R~, wherein Rl and R~ are independently cl-c4 alkyl and wherein R1 and R2 can be joined as part of a saturated cyclic moiety (preferably 10% dimethylsulfoxide (DMSO) by volume) where AMV reverse transcriptase is employed ~or 2-enzyme 3SR, but such a sul~oxide compound may be omitted where a reverse transcriptase derived from MMLV, HIV-l, or other retrovirus is utili2ed.
The improved reaction media further improves amplification lev~ls in 3SR reactions carried out in the presence of E. coli RNAse H. Again, DMSO or other sulfoxide containing compound may be used to-increase amplification levels in such 3-enzyme 3SR reactions utilizing AMV reverse transcriptase.
The reaction media should be supplemented with 0.1 - 10 mM MnC12 or similar manganese salt where MMLV
reverse transcriptase is employed in the 2-enzyme 3SR
rea~tions of the present invention.
For 2-enzyme 3SR the concentration of rNTPs in the improved reaction media of the present invention . ' : , ' ' - ::

should be most preferably about 6mM although lesser concentrations of rNTPs in the improved reaction media may be employed for 3-enzyme 3SR. U~expected increases in amplification levels of up to 10-fold or more are obtained in 2-enzyme 3SR reactions whDre rNTP
concentration is increased from 4mM to 6mM in the improved reaction media, even though the lower concentration of rNTPs represents a large molar excess of substrate. Concentrations of rNTPs greater than about 8mM or 9mM tend to reduce the levels of amplification which may be obtained in two-enzyme 3SR reactions.
Example III, below, demonstrates the capacity of an improved reaction medium of the inven~ion, but not a prior art reaction medium reported to support 3-enzyme 3SR, to sustain 2-enzyme 3SR.
Presently, it is preferred to use approximately 10 units of AMV reverse transcriptase and 20 units or T7 RNA polymerase per amplification reaction (loo ~1) in 2-enzyme 3SR reacti~ns. Interestingly, 3-enzyme 3SR
amplification requires not only E. coli RNAse H, but also significantly higher concentrations of reverse transcriptase (30 units) and RNA polymerase (60-100 units).
With respect to the length of a target segment, inter-primer distances of less than 1500 nucleotides are favored, presumably due to the lack of stringency under which the 3SR reactions are carried out. Generally, target segments longer than about 200 nucleotides in length may be more effectively amplified where the reaction medium is supplemented with about 1 to about 25 weight percent of an alcohol or polyhydroxy compound using either the 2-enzyme or 3-enzyme methods. It is expecially preferred to supplement the improved reaction media of the present invention with between about 5 and about 15 weight percent of sugar alcohol of the formula HOCH2(CHOH)XCH20H, wherein x is 0-20, more preferably, .

, . :

W092/08~00 PCT/US91/08488.

~ 38-wherein x is 0-5, and most pre~erably where the compound is sorbitol or glycerol.
A preferred reaction medium of the present in~ention for carrying ouk 2-enzyme 3SR amplification is an aqueous solution eomprising:

BUFFER: Tris pH 8.1, 40 mM.
MgCl2, 30mM, KCl, 20 mM, D~T, lOmM
Spermidine, 4mM.

NUCLEOTIDES. rNTPs, 6m~, dNTP5, lmM.
PRIMERS:
0.25 ~g sence primer comprising a 15-base target binding region; and ~0 0.25 ~g antisense primer comprising a 15-base target binding r~gion opera~ively linked to a promoter sequence (of about ~0 bases).

ENZYMES: AMV Reverse Transcriptase, lO units/100~1 reaction solution (reaction solution comprising 10% dimethyl sulfoxide (DMSO) and 1~% sorbitol) or MMLV Reverse Transcriptase, lO00 Units/lOO ~l reaction solution (reaction solution comprising 1 mM MnCl2 and 15~ sorbitol) .

W092/~8800 2 ~ .1 3 PCT/U~911~8~8 and T7 RNA Polymerase, 20 units/100~1 reaction s~lution.

Temperature o~ the reaction mixture during 2-enzyme or 3-enzyme 3SR ampli~ication also has a marked ef~ect on the level of amplification achieved. While amplification may be carried out at temperatures between about 5C and about 50C, more preferably amplification is carried out at between about 37C and about 47~C and most preferably at about 42^C. ~eaction temperature is particularly important in the 2-enzyme 3SR methods of the present invention, with amplifica~ion at 42-C being approximately 100-fold more eff~ctive than at 37 c.
Also, amplification rates are 2- to 3-~old greater in the 42~C - 45 C temperature range in the presence of an alcohol or polyhydroxyl-containing additive such as sorbitol, glycerol, ethanol and the like, and additionally DMSo, or like sulfoxide compound where AMV
reverse transcriptase is util~zed.
The 3SR reaction may be more efficient in one amplification loop than in the other. l'here~ore, where both the sense and the anti~ense primers include a 2$ promoter encoding segment, either the sense or the antis~nse product may predominate, presumably because : sequences downstream from the double stranded promoter segment of the cDNA may have a significant effect on : transcription rates.
In another of its aspects the present in~ention ; : concerns D~A primers capable of,priming a chain : , elongation reaction which primers compris a promoter sense strand having at least one to ten nucleotides extending 5' from and adjoining the 5~-most n~cleotide of the segment with the sense strand of the promoter's polymerase binding site (pre~erably with the sequence of , ~

.. . . .
. ~ : ~ . .

" :
- ., ~ ~ . . .
. , .. . . . - ~ - .......... ~

the promoter~s consensus sequence). The inventors have surprisingly discovered that the length and sequence of the promoter-providing segment o~ a primer having a promoter sense strand has a marked effect on the level of amplification in 3SR. It has been found that primers truncated at their s~-end with the s~-nucleotide of the promoter consensus sequence (i.e.; the s~-end of the primer is the 5 ~-most nucleotide of the consensus sequence) exhibit less than about 105-fold amplification in 1 hour at 42C in the improved reaction media of the present invention. As understood in the art, a promoter has a number of parts. First, it has a polymerase bi~ding segment, which is the segment of double-stranded DNA to whiCh the polymerase binds in initiating lS transcription. A promoter must have at least a polymerase binding segment to function in transcription.
It is thought that the consensus sequence is the minimum sequence necessary, in completely double-stranded ~orm, which is necessary for the binding of ~NA polymerase in the process of initiating transcription Optionally, it may be desirable to include a segment referred to herein as the transcription initiation sequence immediately adjacent (downstream) to the consensus sequence. The consensus sequence for the T7 promoter is disclosed herein. Other promoter consensus sequences are well-known in the art. For example, ~he sense strand of the T3 consensus sequence is 5'-ATTAACCCTCACTAAA-3' and the T3 transcription initiation seguence is 5'-GGGA-3'.
Also, two versions of the SP6 promoter are well-known.
The consensus sequence of the sense strand of the SP6 promoter (version 1) is 5'-ATTTAGGTGACACTATA-3' and the consensus sequence of the sense strand of the SP6 promoter (version 2) is 5'-AATTAGGGGACACTATA-3'; the transcription initiation sequence for both version 1 and version 2 of the SP6 promoter is 5'-GAAG-3l. Where the initial concentration of target segment is in the . .

,~

. .. _......................... .

~ -,:

wo 92/08800 2 0 ~ ~ ~ P~/US~1/08~88 --4~--concentration range of about 0.01 - 1 attomole in a loo~
aliquot - a concentration which is not unusual f or detection of the presence of, for example, ~IV-l virus or a defective gene characteristic of a disease state - such a lev~l of amplification is not detectable by standard nucleic acid hybridization assays. However, promoter-providing primers which have as ~ew as 1 additional nucleotide adjoining the 5'-end of the promoter consensus sequence surprisingly show about a 10-fold increase in amplification: and for each additional nucleotide up to a 4-nucleotide sequence added ~o the 5~-end of the consensus sequence an additional 7-to 10 fold increase is achiev~d. Extending an oligonucleotide from its 5'-end mor~ than 4 nucleotides, and up to about 10 nucleotides, relative to a promoter consensus sequence may improve amplification over the level achieved with l to 4 nucleotides, as shown in the following Table.
The following Table demons~rates the unexpected results relating to 3SR amplification levels obtained after modifying the length and nucleotide sequence upstream from (5'-from) the promoter sense sequence of a DNA primer.

-.~- , ~ ' '' ' ' ' WO 92/08800 C~ 42- PCl/US91/084X8 ~

~ ,.
_ ~ C ~:

a~ ; .e~ a ~ ~I x x x x x x x ~ x x x ~o ~o ~ 8 ~ ~o ~ c ~ o N It~ v V ~ c o P O ~ o~
U ~ U ~_ U U ~ ~ W ~Z ~ 0 a ~ ~ 5 5 5 5 5 5 5 ~ ~ ~ ~ s o ~ o--Y 8 ¦ ~ U U U ~ a o, W ,8 ~ L o 14 ~ ~ ~ ~Y ~ Y ~ o ~ 0 g Q

o ~ 3 3 n ~ ~ 2 , o ~ 4 ~S ~ K

~ ~ ~ ~ ~ N -- '- ~ ~ C ~ U ~

U ~ ~
~4 o o~ 0 ~ ~ ~ Y ~ Y u ~ c o ~ X ~ u~ 0 ~ g ~ o 3~, x ~ o _ ~1 O Z 0~ 0 O~ O~ O~ O~ O~ O ~1 ~ o o a~

W092/0~800 2 0 ~ P~T/US91/~488 Amplification carried out under the abo~e described conditions showed that, where the T7 consensus sequence was not ~lank2d on the 5~-end by at least one nucleotide adjoining-the 5'-most nucleotide of the consensus sequence, amplication was not detected at a level greater than lO5-fold. The promoter-containing primers of the present invention having 1-10 nucleotides, and preferably 1-4 nucleotides, adjoining the 5l-terminal nucleotide of the consensus sequence ~isnificantly enhance amplification levels relative to promoter-providing primers described in the prior art.
While not intending to be bound by theory, it is believed that the one to ten nucleotide sequence adjoining the 5'-end of the consensus saquence ensures that the reverse transcriptase remains associated with the DNA template strand at least until a cDNA having a completely double stranded promoter segment is completed.
~ he complete double-strandedness of the promot~r segment comprising the consensus ~equence (presumably the polymerase-binding se~ment) is presumably important for efficient transcription ~rom the promoter.
The oligonucleotide primers used in the Examples which follow, unless otherwise noted, have the nucleotide sequence corresponding to the indicated region of ~he HIV-l genome as disclosed in Ratner et al., Nature (London) 313, 277-284 (1985)~ Which is incorpcrated herein by reference. Unless otherwise indicated, an asterisk (*) denotes a promoter-providing oligonucleotide primer comprising the segment 5'-AATTTAATAC GACTCACTAT
AGGGA-3' (SEQ ID NO: lS), wherein the underlined sequence is the 17-nucleotide con~ensus sequence of the promoter recognized by the T7 b~cteriophage DNA-dependent RNA
polymerase. The 4 nt seque~ce (5'-AAT~-3') at the 5'-end of the consensus sequence is de~ined herein to be included within the term ~'promoter sense strand~ and the 4 nt segment (e.g., 5'-GGGA-3' or 5'-GAAA-3', etc.) at ~ , ' W0~2/0880~ ~ ~ PCT/US91/0~488_ the 3'-end o~ the consensus se~uence is the T7 transcription initiation segment, which, in the parlance adopted above, is a ~variable subsegment" o~ the primer.
sequence corresponding to this variable subsegment will occur in transcripts made from the promoter correspo~ding to the promoter sense strand. For example, the promoter-containing oligonucleotide probe designated 88-347 consists of a segment which is the complement of the segment o~ the HIV-1 genome corresponding to nucleotides, 6661-6631 (inclusive) the 4 nt variable subsegment corresponding to the transcription initiation sequence 5'-GGGA-3', and the 21 nt promoter sense strand with the sequence given above, and has the following complete sequence:

5'-AATTTAATAC GACTCACTAT AGGGATGTAC TATTATGGTT
TTAGCATTGT CTGTGA-3'. ~SEQ ID NO: 2) The nucleotide sequences of the following oligonucleotide primers (designated by primer #) are disclosed in accordance with the above convention. Several of thase oligonucleotides are referred to in the specification and examples herein. A designation o~ "sense" means that the primer comprises a segment with the same sequence as the indicated segment ~rom the HIV-l genome. A designation o~ "Antisense" means that the primer comprises a segment that is complementary in sequence to the indicated segment ~rom the HIV-l genome.

. . , . ~ :

W092/08800 _45_ PCT/US91/0~488 Oligonucleotide ENV REGION OF HIV-l - Primer ~ SENSE OR ANTISENSE Nucl~otide Positions 88-211~ 1J (sense) 6450 - 6479 89-255 (SEQ ID NO: 14) (sense) 6450 - 6479 88-299 (sense) 6486 6515 89~332 (sense) 6494 - 6508 lo 88-33 (sense) 6419 - 6440 90-106~ (sense) 6419 - 6446 88-348~ (sense) 6419 - 6446 88-347 (SEQ ID N0: 2) (antisense) 6661 - 6631 89-263~ ~antisense) 6830 - 6801 86-274 (antisense) 6691 - 6661 88-346 (antisen~ 6830 - 6801 90-66 ~antisense) 6918 - 6891 90-69 (antisense) 7101 - 7070 85-237 (antisense) 7255 - 7226 85-235 (antisense) 7335 - 7306 90-72~ (anti ense) 7255 - 7226 90-71~ (antisense) 7335 - 7306 90-187~ (antisense) 7899 - 7870 86-273 (sense) 6591 - 6620 87-81 (sense) 6551 - 6577 87-79 (sense) 6419 - 6443 In Primer# 88-211, the variable subsegment corresponding to the transcription initiation site has the sequence is 5'-GGGATC-3', instead of 5'-GGGA-3'.

In another of its aspects the invention concerns methods useful for detection of at least one specific RNA
target segment in a sample containing nucleic acid, comprising amplifying said RNA target se~ment according to the above-recited methods and detecting the presence : ~

W092/0~8~0 ~ PCT/US91/0848 of RNA transcripts which comprise a sequence that is ~he same as or complementary to that of said target ~egment.
Detecting amplified nucleic acid products may be - accomplished by well known nucleic acid hybridization techniques. Example II describes the bead-based sandwich hybridization tachnique, which is the preferred method for detecting amplification products. Among oth~r detection methods are performing amplification using ribonucleoside triphosphates which have been labe.lled with a radioisotope, or a chromogenic or fluorescent substrate, or a group such as biotinyl, capable of being bound by a complex comprising an enzyme capable of catalyzing a chromogenic reaction, as well ~nown in the art, and detecting the presence in a hybridization assay of RNA transcripts which have incorporated such labelled rN~PS.
As noted above, the invention also entails kits for carrying out the amplification methods of the invention. A kit of the invention may comprise one sense and one antisense primer (one or both including a promoter sense strand), components of a reaction medium enabling 2-enzyme 3SR amplification, and only the bacteriophage DNA-dependent RNA polymerase(s) corresponding to the promoters of the primers, and a reverse transcriptasa. Alternatively, a kit of the invention may include components for 3-enzyme 3SR, including an enzyme that provides RNAse H activity but is not a reverse transcriptase, and an aqueous solution to provide an improved reaction medium of the invention or compound (e~g., salts, buffers, hydroxy compounds, DMSO~
nucleoside triphosphates) to prepare such an improved reaction medium.
The invention also encompasses the improved reaction medium.
Methods and kits for carrying out nucleic acid hybridization probe assays (by amplifying a target : .

wos2/o8~oo 2 ~ PCT/~S91/08~8 segment in accordance with the invention) may entail, in addition, steps and components necessary for dete~ting the RNA product resulting from amplification according to the invention. The skilled understand the various additional steps and components, respectively, that are required to detect RNA from an amplification process by any of the numerous nucleic acid probe hybridization a~say methods known in the art. A prefarred nucleic acid probe hybridization assay method, involving bead-capture of labeled amplified RNA, is illustrated in Example II
below.
The invention will now be described in greater detail by way of Examples.

1~ EX~MPLE I
PREPARATION OF TRISACRYL BEAD-BOUND
OLIGONUCLEOTIDE PROBES
A 5'-aminohexyl phosphoramidate oligonucleotide derivative was prepared by reacting 5'-phosphorylated 88-297 (5l-TGGcrTAATTccATGTGTAcATTGTAcTGT-3~) (SEQ ID
NO: 16) with 1,6 diaminohexane in the presence of 0.25 M
l-ethyl-3-(3-dimethylaminopropyl) carbodiimide in O.1 M
methylimidazole, pH 6.0, as previously described by Chu et al., Nucleic Acids Res. 11, 6513-6529 (1983). It is essential to carry out this reaction in freshly silanized Eppendorf tubes to prevent nonspecific adsorption of nucleic acids to the walls of the tubes. The amine deri~ative was isolated by precipitating twice with ~tOH/LiCl. Typically, a 150-~1 aliquot of a 10-mg/ml solution of N-succinimidyl bromoacetate (see Bernatowicz, et al. Anal. Biochem. 155, 95-102 (1986)) in N,N-dimethylformamide was added to 2.S nmol of 5'-aminohexyl phosphoramidate oligonucleotide derivative in 1.1 ml of 0.2 N HEPES, pH 7.7. After a reaction ~ime of 1 h, the oligonucleotide was precipitated twice with ethanol/LiCl.
.

W092/08800 " PCT/US91/08488-Derivatization of Trisacryl GF2000 (RQactifs IBF, Pointet Girard, France) with amino groups was performed using a 20-ml suspension of the resin, which was pipetted into a sintered glass funnel, washed with 200 ml H2O, and sucked dry for lO min. The dried sample (-ll g) was added slowly to 20 ml of distilled 2thylenediamine that had pr0viously been heated to 90-C in an oil bath. After 1 h at 90C, the reaction mixture was cooled by the addition o~ 30 ml of crushed ice. Excess ~thylenediamine was removed by successive washes of the resin in a funnel with 400 ml each o~ 0.2 M NaCl, 0.001 M HCl, and finally with 500 ml 0.1 M NaCl. The washes were continued until the filtrate gave a negatiYe test with 2,4,6-trinitrobenzene sulfonic acid reagent~
con~ersion of the Trisacryl-amine supports to Trisacryl-sulphydryl was carried out by first eguili-brating the beads (lO g wet weight) with 0.5 M NaHCO3, pH
9.7. The volume was adjusted to 40 ml in a 50-ml Sarstedt conical tube, solid N-acetyl homocysteine thiolactone (2.5 g) was added, and the tube was agitated at room temperature ~or 1 h. Subsequently, another gram of reagent was added, and the sample was shaken over-night. The beads were washed with 250 ml 0.1 M NaCl and then filtered using a sintered glass funnel. A 10-g sample of Trisacryl-sulphydryl was then equilibrated in 30 ml 0.1 M NaOAc, pH 6.0, and treated with 200 mg solid succinic anhydride. After shaking for 30 min, an addi-tional 200 mg of anhydride was added to the suspension, and the capping reaction was allowed to proceed for a further 30 min. The beads were then equilibrated in 50 ml 0.1 M Tris, pH 8.5, to hydrolyze the thioester linkages. After 1 h, the support was washed with TE, pH
8.0, and stored at 4 c. The sulphydryl group concen-tration in the support was estimated by titrating with 5,5'-dithiobis(2-nitrobenzoic acid) and monitoring the release of 3-carboxylate-4-nitrothiophenolate at 412 nm.

.''''.-':

W092/08800 9 6 ~ 1 ~ PCT/US91/0~88 Finally, ths covalent atta~hment of 5'-bromoacetyl-derivatized oligonucleo~ides to sulphydryl Trisacryl was performed by the ~ollowing procedure. The Trisacryl-sulphydryl 6Upport (1 g)~ obtained from the above reaction, was reduced wi~h 30 ml 20 mM DTT in 0.05 ~HPQ4, pH 8.0, and 1 mM EDTA for 1 h. The support was then washed ~our times with 25 ml of 0.05 M K~HPO4, pH
8.0, 1 mM EDTA~ followed by two washes with 25 ml of 0.1 M triethylammonium phosphate (TEAP), 1 mM EDTA, pH 9Ø
Five nanomoles of bromoacetyl- derivatized oligonucleotide dissolved in 7 ml of 0.1 M TEAP, 1 mM
EDTA, pH 9.O, was added to the support, and the tube was purged with Nz and sealed. After overnight agitation on a rotary mixer, 200 mg of iodoacetic acid was added and th~
mixture was left at room temperature for 1 h. The beads were washed twice with 35 ml of 0.1 M Tris, pH 8~0, 0.1 M
NaCl, 1 mN ED~A, and 0.1~ SDS, four times wi~h 45 ~1 of 0.1 ~ Na2P207, pH 7.5, followed by two washes with 45 ml of TE, pH 8.0, and storad at 4-C.
EXAMPL~
DETE~TABLE LEVELS OF AMPLIFICATION OBSERVED WITH
~NZ~E 3SB AMPLIFICATION OF A DNA TARGET
T~is example shows that detectable levels of amplification are observed with a 3-enzyme 3SR
amplification o~ a DNA target.
Nucleic acids from 2.5 x 105 PBMC from both normal patients and patients with cystic fibrosis were extracted ~s in Example 1. The precipitated nucleic acids were pelleted by centrifugation. The pellet was drained, ` rinsed with 70% ethanol one time, dried and then resuspended in 100~1 containing:
40mM Tris-HCl, p~ 8.1 10% DNSO
10% Glycerol .

W092/08800 ~ PCT/US91/0848~-33mM MgC12 20mM KCl 4m~ Spermidine lOmM Dithiothreitol lmM each dATP, dGTP, dCTP and dTTP
7mM each rATP, rCTP, rGTP and rUTP
250ng each of oligonucleoctide primers ~5'AATTTAATACGACTCACTATAGGGAAATGCTTTGATGACGCTTCTG

TA- ') (SEQ ID NO: 17) 90-161(5'-TTCACTTCTAATGATGATTATGGGAGAA-3') (SEQ
ID NO: 18) The samples were vortexed until the pellet was completely resuspended. As a control, water was used in place of the nucleic acid pellet in the above buffer.
The samples were hea~ed a~ lOO C for 1 minute, cooled to 42C for 1 minute and lO units A~V reverse transcriptase (~T) (Life Science, Inc.) were added. The ~amples were incubated at 42C for 15 minutes then heated to lOO-C for 1 minute. Thirty units of AMV RT, lOO units T7 RNA polymerase (Stratagene) and 4 units E. coli Rnase H (Bethesda Research Labs) were added. The samples were incubated at 42-C. for 1 hour. The samples were then frozen at -20-C. The samples were then analyzed by bead-based sandwich hybridization using OligobeadsT~
90-294 (5~-GTTCTCAGTTTTCCTGGATTATGC-3') (SEQ ID NO: 19) and 32P-labeled detection oligon~cleotides 90-165 (5~- AAGAAAATATCATCTTTGGTGTTTCCT-3') (SEQ ID NO: 20) which detects the wild-type cystic fibrosis gene or 90-166 (5' AAAGAAAATATCATTGGTGTTTCCTA-3') tSEQ ID NO: 21) which detects a 3 base-deletion mutation within the cystic ~ibrosis gene.
In a typical bead-based sandwich hybridization ~BBSH) procedure a 25mg aliquot of bead suspension is .
::: . . .

W092/08800 2 ~ 9 ~ 3 PCT/US91/08488 added to a 2 ml micro-column (2S-GS, Isolab) and the TE
solution is removed by ~rcing it thr~ugh the column with a syringe. The target, in 20~1 of TE, is added to the column, along with 10~1 of 2x hybridization solution (20%

dextran sulfate, 20x SSPE, 0. 2% SDS) which had been warmed to ~2C. The micro-columns are vortexed and incubated with occasional agitation at 42DC for two hours. The beads are washed six times with lml each o~
2x SSC which had been equilibrated at 420C. Cer~nkov counting of the columns and washes is used to determine the amount of target detected. Counter background is subtracted from all samples and the fm of target detected is calculated as follows:

15_ c~m on beads X fm probe added (cpm on beads ~ cpm washes) SEQ
Detection oliao ID NO fm/ul 3SR
~a no target 90-165 20 0.016 2.5 x 105 wild-type pBMC 90-165 20 0 .113 w/w no target 90-166 21 0.018 2.5 x 105 mutant pBMC 90-166 21 2.243 ~/~
EXAMPLE III
COMPARISON OF LEVELS OF AMPLIFICATION OBSERVED
WITH THE 2-ENZYNE 3SR REACTION AT 37'C
WITH A PREFERRED REACTION MEDIU~ OF THE PRESENT
INVENTION AND WITH A PRIOR ART ~EACTION MEDIUM

This Example shows that detectable levels of amplification are observed with the 2-enzyme 3SR reaction at 37-C with a preferred reaction medium of the present invention but not with a prior art reaction medium suitable for 3-enzyme 3SR reactions.
0.1 attomoles of HIV-l RNA was ampli~ied in 2-enzyme 3SR or 3-enzyme 3SR reactions at 37-C under ~, . . . -, W092/088~0 ~ ~f PCT/US91/08488 prior art reaction conditions and under improved reaction conditions of the invention. Under improved conditions, but not under prior art conditions, 2-enzyme 3SR
amplification yielded a detectable amount of amplification product. Higher levels of amplification in the 3-enzyme reactions were observed with the improved reaction media, such as the preferred medium described below in this Example.
Each reaction solution~ con~ained 0.25 ~g each of o oligonucleotide primers 88-211- and 88-347 , lo units AMV
reverse transcriptase and 20 units T7 RNA polymerase.
Total reaction volume was 100 ~1. A "+" in the "Exogenously added RNAse H" column denotes the presence of 4 U E. coli RNAse H in the reaction medium, while a "~" in the "DMSO/PEG-8000" column denotes that the reaction medium was supplemented with 10 dimethylsulfoxide and 5% PEG-80000 Prior Art 3SR Preferred 3SR
Reaction~Medium Reaction Medium 40 mM Tris, pH 8.1 40 mM Tris, pH 8.1 20 mM MgCl2 30 mM MgCl2 25 mM NaCl 20 mM KCl 5 mM DTT 10 mM DTT
2 mM spermidine 4 mM spermidine 80 ug/ml BSA 0 mg/ml BSA
1 mM dNTPs 1 mM dNTPs 4 mM rNTPs 7 ~M rNTP

The reaction products were detected by bead-based sandwich hybridization (Example II) using OligobeadsTM
derivatized with oligonucleotide #86-273 and oligonucleotide #87-81 as probe.

2~9~
W092/0~800 PCT/US91108488 3SR Reactions on env Region at 37 C.
Exogeno4sly ~
Buf~r/~ucleotides ~NAse H DM9o/PEG-8000 Fold Am~.
Prior &rt I - 3.5XlC7 Prior nr~ 10 0 Prior art q c 104 Preferred I - 1 7X1~8 Preferred - ~ ~ 10 Preferred - ~ l.lX105 EXAMPLE IV
EFFECT OF SUPPLEMENTING THE PRESENTLY PREFERRED
REP.CTION MEDIUM OF THE INVENTION WITH 10% DMSO, 10% GLYCEROL, AND/OR 5% PO~YETHYLENE GLYCOL
(PEG--800p)_ON 2--ENZ~IE OR 3--ENZYME 3SR REA~TIONS
This example demonstrates the ef~ect of supplementing the presently preferred reac~ion medium of the invention (See Example I~I) wi~h 10% D~SO, 10%
Glycerol, and/or 5% polyethylene glycol (PEG-8000) on the level of amplification obtainable in 2-enzyme or 3-enzyme 3S~ reactions.
The reaction conditions used for the 3SR
reactions were the same as the "Pre~erred 3SR Reaction Medium" disclosed in ~xample III except that reactions were carried out at 42-C for l hour.
The 3SR reactions were carried out using O.l attomoles HIV-l RNA as target and the primer pair `88-29/89-263 (approximately 400 bases apart). The products of amplification were detected by bead-based sandwich hybridization (Example II) using OligobeadTU
derivatized with oligonucleotide 86-273 and oligonucleotide 87-81 as probe. As shown below, enhanced levels of amplification are obtained in the presence of 10% D~SO and lO~ glycerol.

:

. : :

W092/08800 ~ PCT/US91/084 ~; ~

ON THE ENV REGION OF HIV-l.

- Primers~Hase HDMSOG~Ycerol PEG Fold AT;?.

88-299/89 263 - 10X 5X 1x105 88-299/ô9 263 ~ 10~ 7 88~211 /88-3~7 4U - - 2.8X108 88 211~/88-347~ 4U 10X - 2.0x10~
88-211 /88-347 4U 1 OX 10X - 3.9x108 88-211 /88-347 - - - - N.D.
88-211 /88-347 - - 10X - ~I.D.
88-211 /88-347 - lOX 10X - 1.3x107 N.D.: tlo product detected Z en~yme reactions: 10 U A~IV RT, 20 U ~7 R~IA Polymerase 30 3-enzyme reqctions: 30 U AHV RT, 100 U T7 RN~ Pol~marDse, 4 U E. coli R~e H

EXAMPLE V

10% DMSo AND 5~ PEG-8000 IN

This example compares the levels of 2-enzyme 3SR
amplification and 3-enzyme 3SR amplification ~0.1 at~omoles of HIV-l RNA target and primer pair 88 211~/83-347~ in each case) in the presence and absence of 10~ DMSO and 5% PEG-8000 in the preferred 3SR reaction medium. The products were detected by bead-based sandwich hybridization as in Example II using OligobeadsTM
derivatized with oligonucleotide 86-273 and using oligonucleotide B7-81 as probe.

, .
, w092/08800 2 0 9 ~ PCT/uS9l/Og4~8 EFFECT OF ADDITIVES ON THE 2-ENZYME 3sR REACTION
Temp. Enzymes pMSo PEG-8000 Fold AmP.
42C All 3 - - s.ox1o7 42-C RT/T7 -- -- < 104 42 C RT/T7 + -- l . lX107 42 C RT/T7 ~ + 5 . OX107 45 C RT/T7 + + 1. 7X107 30 U AMV RT, lOO U T7 RNA Polymerase and, when present (i.e., "all 3"), 4 U E. coli RNase H were used in the reaction media.

... , .. - -WO 92/0880V ~ c, PCl/US9~/0~488_ ~ 5 6 ~

EXAMPLE VI
2-ENZYME 3SR R~:ACTIONS WITH REVERSE TRANSCRIPTASES
FROM MOI.ONEY MURINE LEUKEMIA VI~US, 5HIV-1 A.ND AVIAN MYELOBI~STOSIS VIRUS
This Example shows 2-enzyme 3SR reactions with reverse transcriptases (R'rs) from Moloney murine leukemia vims (MMLV), HIV-l and avi~n myeloblastosis virus (AMV).
10 MMLV reverse transcriptase has a requirement for manganese ion to provide an effective amount of inherent RNAse H activity.

3SR system: env region 88 211/88-347 comparison of Revar~e Transcriptases From Different Sources RT T7 Pol R~sse HD~SCGlYcerol XnCI2 Fold A~p.
2 0 M-MLV 1000U oCU 4U SX - - 3X106 H-MLV 1000U o4U - SZ - 1~M 3x107 2 5 H-MLV 1000U oOU - - 1mM 2x107 HIV 5ul1/ 64U - - - - tx10 NIV 10ul60U 4U - - - 9x105 3 0 AMV 30U~OOU 4U 10% lOX - 4x108 ~MV 10U 20U - 10X 10X 1x108 3 5 Renctlon Timc: 1 hour. Temp.: 42-C. Template: 0.1 ~moles HIV Rh~
1/ Tho specit~c actiYity ot the HIV-l roverso tr nscriptaso preparatlon ~a8 unknoun.

:~ ` `- `' . ~ , wo 92~08800 ~ c3 PCr/US91/08488 MPI~E VII .
INCREASED AMPLIFICATION IEEVLS ACHIEVED
IN 3--ENZY~IE 3SR REACTIONS, IN THE PRESENCE
5AND ABSENCE OF 5% PEG-8000/10% DMSO
WITH INCUBATION AT 42C or 45C
~his Exampl~ demonstrates increased amplification levels achieved in 3-enZyme 3SR reactions, in ~he presence and absence of 5~ PEG-8000/10~ DMSO With incubation at 42C or 45C.
0.1 attomoles of HIV-1 RNA was mplified in 3-enzyme 3SR reactions With 30 Units A~V reverse transcriptase, 100 Units T7 DNA-dependent RNA polymerase, 4 Units RNAse H, at 42 C for 1 hour in the preferred reaction medium disclosed in Example III using one of the following sets of env primer pairs: 88-211~/88-347~ or 87-79/88-347 .

INFLUENCE OF REACTION ~EMPERA~URE ON
AMPLFICATION OF ENV ~EOEON OF HIV-l Fold AmPlification Pri~er_Pair PEG-8000/DM$Q 42-C 45~C.
88-211*/88-347* - 4.4x107 8.4x106 ~ 2.3X108 1.5x108 87-79/88-347* - 4.5X10 1.5x10 + 1.7x108 5.6x108 .
, ~
;

:
. ~ .

W092/088~0 pcT/us91/os48s æ~
EX~MPLE VIII
EFFECT OF TEMPERATURE ON 3-EN2YME ~SR AMPLIFICATION
IN THE PREFERRED REACTION ~EDIUM IN THE
5PRESENCE AND ABSENCE OF 10% DMSO
This Example demonstrates the effect of .
temperature on 3-enzyme 3SR amplification in the preferred reaction medium (See Example III) in the presence and absence of 10~ D~SO. The target was 0.1 attomoles of HIV-l RNA. Each 100~1 reaction mixture had 30 U AMV RT, 100 U T7 RNA Polymerase and 4 U E. coli RNase ~.

15Temperature Dependence of 3SR Reaction In Presence or Absence of DMSO
Primers 88-211~ and 88-347~ (env region) Reaction TemP. -DMSO +DMSO

42 C 9 . lX107 2.7xlO8 45 C 8.7x107 l.6x108 47-c 7. 4X104 C104 50 C <104 ~104 . ~ ~ ,: , W092/08800 2 ~ 3 PCT/US91/0848X

-59~

EXAMPLE IX
EFFECT OF NUCLEOTIDE ALTERATIONS AT 5' AND 3' ENDS OF OLIGONUCLEOTIDE PRIMERS CONTAINING THE
5CONSENSUS SE~UENCE OF THE T7 PROM_TER
This example show~ the effect of nucleotide alterations at 5î and 3' ends of oligonucleotide primers containing the consensus sequence of the T7 promoter.
103SR reactions were performed in 50~1 containing O.05 attomoles (-1,000 molecules) of HIV-l RNA target, 30U T7 RNA polymerase, 2U E. coli RNAseH, 15U AMV RT, 40mM Tris, pH 8.1, 30mM ~gC12, 20mM RCl, lOmM DTT, 4mM
spermidine, lmM dXTP, 7mM rXTPs, and 0.125~g of olignoncleo~ide primers for 1-2 hours at 42-C. The same companion primer, 89-255 (5'TTATTGTGCCCCGGCTGGTTTTGCGATTCTA3') (SE~ ID NO: 14) (Ratner et al. 1985) was used for each primer listed in this table. The listed primers encode the cannonical 17 nt T7-promoter sequence (except #90-206, having the 5' nucleotide thereof deleted) and have varying length~ and compositions respecting the 5' and 3' flanking sequences to the consensus 17 nt T7-promoter sequence. The RNA
product made is 214 nucleotides long. Amplified targets were quantitated using beadbased sandwich hybridization (BBSH) employing 25mg of beads containing capture oligonucleotide 86-273 and 100 fmoles of 32P-labeled detection of olignonucleotides 87-81 (Guatelli et al.
1990). All amplification values, except for 88-347~, are the average of two 3SR reactions and each o~ these amplification reaction was analyzed by duplicate BBSH
reactions. The 3SR amplifications performed with 88-347 represent the average of six 3SR reactions.
v ;. ~ :, . ,. ~ . ;

W092/08800 PCT/us91/0848~
2 ~

EFFECT ON 3SR A~PLIFICATIONS OF NUCIT~OTIDE
A~ THE TRANSCRIPTION INITIATION
SEQUENCE OF OLIt;ONUCIEOTIDE PRIM~:RS

SE0 ID Oligo- L~thSequerlce1 Fold AmD.
N0: Hucleotide ~L
5~ -17 Il 3' 0 2 88-347 56 MTTTAATACGACTCACTATAGGCATGTACTATTrlGGTTTTAGCATTGTCTGTGA zx1o8 22 90-4Z6 56 MTTrAATAcGAcTcAcT~TAGAAATGTAcTATTATGGTTTTAGCATTGTcTGTGA 2.4x109 1523 90-199 56 AATTTMTACGdCTCACTATAGGTATGTACTATTATGGTTTTAGCATTGTCTGTGA 1.1x109 24 90-200 56 MTTTAATACGACTCACTATAGGAATGTACTATTATGGTTTTAGCATTGTCTGTGA 2.2x109 25 90-201 56 MTTTAATACGACTCAcTATAGGCATGTACTATTATGGTTTTAG~TTGTCTGTGA 1.8x109 2026 90-202 55 AATTTAATACGACTCACTATAGG ATGTACTATTATGGTTTTAGCATTGTCTGTGA 2.0x109 27 90-203 54 AATTTAATACGACTCACTATAG ATGTACTATTATGGTTTTAGCATTGTCTGTGA 2 5x109 2528 90-204 53 AATTTAATACGACTCACTATAG TGTACTATTATGGTTTTAGCATTGTCTGTGA 1.9x109 29 90-430 52 MTTTAATACGACTCACTATA TGTACTJlTTATGGTTTTAGCATTGTCTGTGA 2.8x109 1/ Coding strsr~ sequonce i5 displ~yed. The v~rlinod 8eqencl~ corr~sponds to ~he csr~onical 17 nt T7-prr~noter l~oquence end th~ initistion of R~ transcription i~ dcnoted by ~1. The sequenc~ GGGA is fran the T7 eq~nce; Ihe I5 m cleotides on~rd i8 the HIV-l l~e~ence. Only the 5~ end portion ofe~ch oliaonucleotid~ pr~alted; sub4eq~ent sequenco8 cro identic~l for esch oli~onucleotide Olil~nonucleo~ides ~re ~ ned to di~pl~y differences ~ng the primers.

:,.~:: ,.

~, ~

W092/0X800 2 ~ ~ al ~ PCT/US91/~8~8 EXAMPLE X
EFFECT OF ~ARIO~S COMBINATIONS OF ADDITIVES ON
THE AMPLIFICATION OF A REGION OF THE
5POL GENE FROM HIV-l . This example demonstrates the effect of various combinations of additives on the amplification of a 707-base region of the ~1 gene ~rom HIV-l. Reactions were performed at 42C for two hours with o.1 attomoles of HIV-l RNA as the target and su-249 (sense) 5'-GAAAAAATAAAAGCATTAGTAGA-3' (SEQ ID NO: 30) and 89-391 - (antisense) 5'-AATTTAATACGACTCACTATAGGGATTTCCCCACTAACTTCTGTATGTCATTGA
CA-3' ~SEQ ID No: 31) as the priming oligonucleotides.
~hree-enzyme reactions contained 30 U AMV RT, 100 U T7 RNA polymerase and 2 U E.Coli RNase H. Two-enzyme reactions contained 10 U AMV RT and 20 U ~7 RNA
polymerase. The probe and OligobeadT~ sequences were 89-534 5'-AGGATCTGACTTAGAAATAGGGCAGCA-3l (SEQ ID NO: 32) and 89-419 5~-AGAACTCAAGACTTCTGGGAAGTTC~3l tSEQ ID
NO: 33), respectively.

EFFECT OF ADDITIVE COMBINATION ON

OF THE POL REGION OF HIV-l Additives Fold Amplification 3-enzvme 2-enzvme none 7.9 x 104 n~d.
10%D~SO/10%Glycerol 8.4x106 1.2x105 10%DMSO/5~ PE5-8000 4.6x104 n.d.
` 10%DMSO/15% Sorbitol 7.0x106 1.3x106 n~d~ ~ ~o product d~t~ctad by 2~Qadoba~d 8a~d l~ydridi~ation While the invention has been described with some specificity, modifications apparent to those with ., ~, , WO 92/08800 PCI/I)S91/08'188 Q~3 -62-ordinary skill in the ar~ may be made without departing from the spirit o~ the in~entionO
various features of the invention are set for~h in the ~ollowing claims.

:" , w0~2/08~00 2 ~ 9 ~ O .1 ~ PCT/U~9l/08488 SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: Fahy, Eoin D.
Kwoh, Deborah Y.
Gingeras, Thomas R.
Guatelii, John C.
Whitfield, Kristina M.
(ii) TITLE OF INVENTION: Nucleic Acid Amplification by Two-Enzyme Sel~-Sustained Sequence Replication (iii) NUMBER OF SEQUEN OE S: 33 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Fitch, Even, Tabin & Flannery (B) STREET: 135 S. LaSalle (C) CITY: Chicago (D) STATE Illinois (E) C0UNTRY: USA
(F) ZIP: 60603-4277 (v) COMPUTER READABLE FORM:
(A) MEDI~M TYPE: Floppy disk (B) COMPUTER: IBM PC compatibl~
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.24 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NU~BER:
(B) FI~ING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Feder, Scott B.
(C) REFERENCE/DOCKET NUMBER: 50101 (ix) TELECOMMnNICATION INFORNATION:
(A) TELEPHONE: 312-372-7842 (B) TELæFAX: 312-372-7848 (2) }N~ ICN FOR SEQ ID NO:l:
(i) S~NOE CKWU~IER~ICS:
(A) IENGIH: 59 hase pQIrs (B) TYPE: ~eic acid (C) SrRAM~IEBS: single (D) TOPOIDGY: u~hx~n (ii) MDL~X~E IYPE: ~N~ (g~x~c) WO 92/OB800 pcr/us9l/o8488 --6~--(Viii) pos:moN IN OENr~:
(A) Q~E/SE~: 90~425 (~) S~ÆNOE ~CR~ON: SEQ ID NO:l:

(2) ~FOR~ON F~R SE;Q ID NO:2:

(A) IE~: 56 base palrs (B) T~: ~mcleic acid (c) S~s: sirgle (D) IOEOIOGY: ur~
(ii) ~TE T~: ~ (gencanic) (A) a~/sl~ 88--347 AA~C G~T A= ~ ~r CrGrG~ 56 (2) ~E~CN F~R SEQ ID N~:3:
(i) Æ~ENOE C~RACTER~rCS:
(A) IE2~: 56 base pairs (B) T~: ~leic acid (C) S~N~S: single (D) IOPOI~GY: urd~

(A) t~/S =: 9~578 GEm~k~C G~ A~aT~C l~T ~ 6 (2) lN~rCYN E~R ~EQ ID N~:4:
(i) SES~CE ~CS:
(A) ~: 56 base (B) TY}~: ~cle~c acid (C) æRP~: sir~le (D) TOPOI~Y: ur~ma~

, . . . . .
.

WO92/0~800 ~ PCI/US91/08488 (viii) POSIllO~ IN OENC~E:
(A) a~5E/SE~: 9~575 G~aI~C G~C~I~CI~ ~C ~[T ~q~ I~ 56 tA) IENG~: 56 ~ase pairs (B) ~ nucleic acid - (C) S~aN~ s~le (D) IOPOI~GY: t~
(ii) Ml~IE~LE T~: 1~ (g~ic) (A) a5~E/SEX~MENT: 90--577 GC~C G~ AG~C D~ ~ CrOEGA 56 (2) lNE~N F~ ÆQ m ~:6:
(i) SE~OE 0~A~C~;:
(A) IENG~: 56 base (B) TYE~ eic acid (C) S~AN~: sir~le (D) IOPOI~GY: ur~
(ii) M~IE~IE TY~E: ~ (ge~ic) (viii) PosmaN IN OEN~E-(A~ ~E/SEGME2~: 9~574 (xi) ~OE ~CR~CN: SEQ ID NO:6:
Gt~C G~CrC~ U~C ~T q~ CrGrG~ 56 (2) ~ 7:
(i) SE~OE C~?AC~Sl~CS:
(A) ~: 55 base pairs (B) TY~E: rmcle~c acid (C) SliAN~S: sir~le WO 92/0~800 PC~/VS91/0~8~
2~3~3 -66-(D) I~PO~ ur~
(ii) MD~:CE T~: 1~ (genamic) (viii) ~smcN IN ~E:
(A) . C~:CWE/S}~: 90--247 A~G A~AC[~ GGG~I~Cr ~m q~IC ~ 55 (2) ~ON ~R SE;Q ID N~:8:

(A) IEt~I: 54 base (B) TY~: rn~leic acid (C) S~N~S: s~ngle (D) IOPOIDGY: ur~
(ii) MOIECUIE TY~: ~ (gena;nic) (A) a~/s~: 9~248 ~ACG~ C~CI~G GGPI~A~A ~ml! U:C~ C~ 54 (2) INE~N P~R SEQ ID N~:9:

(A) IE~I: 54 base pa~rs (B) Iq~: nucleic acid (C) ~5: s~le (D) TOPOll~GY: ur~
(ii) MOT~lTE T5/~: ~. (geIx8nic) (A) ~E/SEX;M~: 90-576 G~D cl~a GG~C~ ~ AG~llt~ t~ 54 (2) ~NE~ON ~R Sl~)Q ID N~:10:
ti) SE~ÆN~E ~;
(A) IE~: 54 base pa (B) ~: ~cleic acid :
.
- ~

WO 92/08800 2 ~ PCr/US91/~848 (C) S~N~S: s~le (D) TOPOI~GY: ur~n (A) a~ME/SEX~: 90-579 (xi) SE~ENOE ~CN: Sl~Q ID NO:10:

(A) IEN~X: 53 base (B) T~: ~mcleic acid (C) S~S: single (D) TOPOIOGY: ur~
(ii) ~qD~ T~: ~ (ger~}nic) (viii) P05:mCN :CN OEN~E:
(A) ~/SE~: 90-249 q~Aa~C ~ ~5~C~T ~n5~ GC~ G:~. 53 (A) ~: 52 base pairs (B) q~æ: rmcleic acid (C) g~a211~: sin~le (D) TOPOI~GY: ur~

(A) a~E/SE~: 9~205 q~CG~Cr C~ Al~A~Tl~ ~lq~: C~IG 1~ 52 (i) S~NOE ~Alqr;K~~
(A) ~: 51 bas~ pairs , . - . - -- ; ~ , - , . ~

WO 92/08800 pcr/us91/o84æ8 (B) ~E~ cleic acid (~) SrR~S: single (D) lOPO~Gy: ~
- (ii) MMEalIE TYPE: ~ (genam~c) (viii) P~smQN l:N OEN~E:
(~) a~/s~: 90-206 AP~CIC AFI~a I~C~l~ I~GC A~r G~ 51 (2) INE~ICN P~R ÆQ ID N~:14:

(A) ~: 31 base ~s (B) I~: r~cleic acid (C) g~N~S: s~le (D) TOPOI~GY: ur~
(ii) ~DIEa~lE T~E: I~ (gel~tic) (A) (~/SEGM~T: 89-255 (xi) æ5~E ~N: SE~ ID No:14:
~GCC ~r Tl~Cr A 31 (2) IN}~C~N E~R SEQ ID NO:~5:
(i) SE~ENCE C CS:
(A) ~I: 25 base pairs (B) ~ r~cleic acid (C) SI~UN~S: single (D) TOPOLOGY: unknw,n (A) ~IE/ =T: T7 Native E~ with llS
.
(xi) S~OE ~CN: SEQ ID ~0:15:
AD~C G~CrC~ Ai;GGA 25 (2) IN~CN ~R SEQ ID NO:16:

.

'~ ' . . ~:

WO 92/08800 ~ ~ 9 ~ Pcr~US9l/08488 (A) IE~: 30 base (B) T~: ~ucleic acid (C) S~N~: single (ii) ~D~EalLE ~: nN~ (ger~m~c) tviii) F~;moN :CN OENa~::
(A) a~/S~: 88--297 ~ rGT 30 (2) INFO~CN E~R S~;Q ID NO:17:

(A) ~: 48 base pa:irs (B) T~: In~leic acid (C) S~IIE3~: sin~le (D) IOPOLOGY: ur~

(A) ~/S~: 90-159 (xi) SEQlENOE I~CN: SEQ ID NO:17:
~C G~I~T Al;GC~ q~Ll~OG CIrl~I~I~ 48 (2) INE~ R SEQ ID Ne):18:
(i) SE~CE C~RACrE%~CS:
(A) IEtæ~: 28 base pairs (B) T5~E: I~eic acid (C) SIRP=~S: siT~le (D) TOPOLOGY: ur~n ~a6m~ :rN OEN~E:
(A) ~/SE~: 90-161 T~C~ ~ ~A 28 :

.: :

WO ~2/0880~) P~/US91/0848 3 _70-~A) IEN~ 24 base (B) T~ nucleic acid (C) gl~aNI~: sir~le (ii) ~IEa~IE q~: ~ (ge~c) (viii) PO61'1'1~N IN ~5E:
(A) ~IE/Sl~qENT: 90-294 (xi) S}~NOE ~CPIICN: S~Q ID NO:l9:

(2 ) INF~RMP~IC~ EOR S13Q ID NO: 20:

(A) IEt~l~: 27 base (B) T~: nucleic acid (C) Sl ~ 5: sir~le (D) IOPOI~GY: ur~

viii) ~06mc~ :CN OEN~æ:
(A) ~611E/SEGMI~: 90-165 (xi) SE~UENCE l~aN: SEQ ID NO:20:

(2) INF~RM~ICN ~R SEQ ID N~:21:
(i) OE5~CE ~CS:
(A) ~: 26 ba~;e pairs (B) TYlæ: ~eic acid (C) SI~ANC } : single (D) TOPOLOGY: urd~

(viii) P06~C~ IN GENOE:
(A) al~lX;QOE/SEX~: 90-166 (Xi) ~OE I~ESCKtl~ll~N: SEQ ID N~):21:
a~ ~1~1~ TI~ 26 W0 92/08800 ~ a.9 ~ PCI /US91/01:488 (2) ~LION ~R SE)Q ID N0:22:

(A) ~: 56 base pairs (B) q~PE: s~cleic acid (C) S~NI~, s~r~le (D) TOPOIDGY: urdcn~1n (Yiii) P061'1~1~ IN OEN~!E;
(A) a~/SEX~: 90--426 (s~) Sl~ENOE ~ SEQ ID N0:22:
M~A~C G~ a~C ~ TlP~l~ (~IGI~ 56 (2) ~RM~C~ ~R SEQ ID NO:23:

(A) ~: 56 base pairs (B) TYÆ: r~cleic acid (C) SrR=~: sir~le (~) TOPO~: ~

(A) a3E~D3/sEx~: 90-199 ~xi) SE~OE l~[plIaN: ~2 ID N~:23:
A?~C G~C~ AK~eaC ~T~G~T Tl~l~ CI~ 56 ~2) ~NE~llO~a E~R SEQ ID Nt):24:

(A) ~: 56 bas~
(B) ~: ~n~leic acid (C) 51~5: sir~le (D) ~O~GY: ur~
(ii) ~IE01E ~ E: INA (ge~c) (viii) E~61'1'1C~N IN OEN~E:
(A) a~CME/SE~: 9~200 (x~) SEX;~OE IBa~ON: SEQ m N0:24:
AA'rl~C Ga~T A3~ ~ ~ CI~ 56 .
, .

WO 92/08800 PCr/U~91/084~t~

~ -72 (2) INF~ON E~R SEQ ID N~):25~

(A) ~I~I: 56 base pair5 (B) TY~: ~ucleic acid (C) Sl~: sin~le (A~ (~E/SEX~: 9~201 (xi) SE~UENOE DESCRIPlION: SEQ ID NO:25:
A~q~A~C G~CI~CI~ 2GG~I~C ~ ~tq~ I~ 56 (2) ~NFOR~l'ICN ~R S~Q ID NO:26:

(A) ~I: 55 bas8 (B) T~: nu~leic acid (C) S~ANI~S: s~n~le (D) TOPOIDGY: ur~
(ii) MDIE0IE TS~ (ger~c) (viii) ~t61~CCCN IN OEN~ME:
(A) ~IIE/~: 90-202 (xi) æ~OE I~ESC;L~ 26:
AP~C 62~CI~CC~ A~C~ A~lTr ~5OEC I~I~ 55 (2) INE~l~CN ~)R SEQ ID N~:27:
(i) SEt~tENOE ~rE~OE:
(B) T5~E: ~leic acid (C) ~ANI~S: single (D) q~OPOLOGY: urdmo~

(viii) Pa~r~aN IN OENCME:
(A) C~=/S}~ENT: 90-203 (xi) SE~OE =E~CN: SEQ ID NO:27:
AATl~C G~CI~ A~CIA ~Gl~ ~ca~l~ GIGA 54 WO 92/08800 2 ~ PCr/US91/084~8 ~73--(2) :~FO~rION ~R SEQ ID NO:28:

(A) IEt~H~ 53 base pa~rs (B) IY~: ~ucleic acid (C) S~AN~S: sir~le (D) IOPOLOGY: ur~wn (viii) PO61'1'1C~ IN OEN~E:
(A) ~ME/SEX;MENr: 90-204 (xi) SEX~ENOE ~ES~CN: Sl~Q ID NO:28:
AAm~C ~C!ICAC~ AGT~CI~ ~11~ G~Tl~CIG 1~ 53 (2) INE~RMP.lICN ~R SOQ ID NO:29:

(A) ~: 52 base (B) T~ cleic acid (C) gl~S: single (D) I~POI~: urdmown (ii) M~)IE~IE TYE~: riNA tger~ LC) (viii) ~sm~N IN OEN~E:
(A) C9~$/SE~: 90-430 (xi) SE~OENOE ~CN: SEQ ID NO:29:
A~Fr~C G~Cl~ A~5T AI~T~ C~IGI~I~ G~ 52 (2) IN}~N F~ SEQ ID N~:30:
(i) SE~OE aiAF~CS:
. . (A) ~: 23 base pairs (B) TY~: ~leic acid (C) SW.N = 5: siT~le (D) TOPOI~GY: urdma~

(A) a~/SEX;MENr: 90-249 (xi) s~OE l~E;CRI~lICN: SEQ ID NO:30:
AP&~ P.G~. 23 `

,, , WO 92/08800 Pcr/us91 /08488 2D~ 3 -74-(2) INE~CN E~ SEQ l~ 31:
(i) S~NCE c~AcrER~cs:
(A) I~: 56 base ~s (B) 1~: rlucleic acid (C) S~S: s~r~le (D) TO~t)lQGY: ~
(ii) ~IEa)T~ T~: 1~ (gencanic) (A) ~6~/sE~r: 89-391 (xi) S~NCE DE~rI~: SE)Q ID N0:31:

(2) INFORM~lICN E~R SEQ ID NO:32:

(A) IENt~I: 27 base (B) T~: ~cle~c acid (C~) g~: single (D) le)POlOGY urdc (Viii) POSl'l'lCN IN OEN~E:
(A) (;~E/SE~: 89-534 (xi) SEQ~ENOE I~N: SEQ ID N~:32:
A~C l~Aa~ GG~ 27 (2) INFORM~qON E~ SE~ :33:

(~) IEt~lX: 25 base pairs (B) T5E~: Tn~eic acid (C) S~: sir~le (D) TOPOIDGY: urdma~ . i (ii) N~I~E TY~: INA (genamic) (viii) ~sm:aN IN OEN~E:
(A) C~Y;OE/S~: 89-419 .,. . . :::

.. ~i WO 92/08800 2'~ 3 ~Cr/US91/084~x (X:L) 5Ex~cE ~aN: SE)Q ID NO:33:
AE~ACI~AG AC~GGGA A~JllC 25

Claims (33)

WE CLAIM:

1. A method for amplifying a target RNA
segment which comprises a 5'-subsegment, which includes and extends at least 9 nucleotides in the 3'-direction from the 5'-terminal nucleotide of the target segment, and a 3'-subsegment, which does not overlap the 5'-subsegment and which includes and extends at least 9 nucleotides in the 5'-direction from the 3'-terminal nucleotide of the target segment, which method comprises incubating in an aqueous solution comprising the target RNA segment:
(a) (1) a first DNA primer which is a single stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first subsegment of said first primer being of the same length as the 3'-subsegment of the target segment and having a sequence sufficiently complementary to that of the 3'-subsegment of the target segment to prime, in the aqueous solution, a primer extension reaction in which a nucleic acid with the sequence of the target segment is the template, and (2) a second DNA primer, which is a single-stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least g nucleotides in the 5'-direction, said first subsegment of said second primer being of the same length as the 5'-subsegment of the target segment and having a sequence sufficiently homologous to that of the 5'-subsegment of the target segment to prime, in the aqueous solution, a primer extension reaction in which a nucleic acid with the sequence complementary to that of the target segment is the template, provided that at least one of said primers further comprises a promoter-providing subsegment, which comprises the sense strand of a first promoter, said sense strand being joined to the first subsegment of the primer, which comprises said promoter-providing segment, operably for transcription from said first promoter of a cDNA
comprising the extension products of said two primers, and provided further that, where said first primer lacks such a promoter-providing subsegment, then the 5'-terminal nucleotide of said 5'-subseqment of said target RNA segment is the 5'-terminal nucleotide of the target RNA molecule;
(b) (1) a reverse transcriptase which exhibits in said aqueous solution DNA-dependent DNA polymerase activity, RNA-dependent DNA polymerase activity and a high sensitivity amplification-effective amount of RNAse H activity, and (2) a DNA-dependent RNA polymerase which, in said aqueous solution, catalyzes transcription from said first promoter; and (c) nucleoside triphosphates required as substrates for the DNA-dependent DNA polymerase, RNA-dependent DNA polymerase, and DNA-dependent RNA
polymerase activities;
said incubation occurring in a range of temperatures at which said enzymes in said solution are active in providing said DNA-dependent DNA polymerase, RNA-dependent DNA polymerase, RNAse H, and DNA-dependent RNA polymerase activities.

2. A method according to Claim 1 wherein the aqueous solution comprises 20-40 mM MgCl2, 1-25 mM KCl, 1-20 mM dithiothreitol, 1-10 mM spermidine, 1-7 mM rNTPs, 0.1-2 mM dNTPs, and an effective amount of buffer to maintain the aqueous solution at about pH 8.

3. A method according to Claim 2 wherein the target segment is fewer than about 1500 nucleotides in length, wherein both the 5'-subsegment and the 3'-subsegment of the target segment have about 15-50 nucleotides, and wherein said incubation occurs between about 37°C and about 47°C.

4. A method according to Claim 3 wherein the reverse transcriptase is a retroviral reverse transcriptase.

5. A method according to Claim 4 wherein the concentration of rNTPs is about 6 mM and wherein the aqueous solution further comprises between about 1 and about 25 weight percent of at least one compound from the group consisting of (i) a C1-C10 alcohol; (ii) a sugar alcohol of the formula HOCH2(CHOH)xCH2OH, wherein x is 0-20; (iii) a polyethylene glycol compound of the formula H(OCH2-CH2)nOH, wherein n is 2-600; (iv) a sugar from the group of mono-, di- and tri- saccharides; and (v) a sulfoxide compound of the formula R1-(SO)-R2, wherein R1 and R2 are independently C1 - C4 alkyl, wherein R1 and R2 may be joined as part of a saturated cyclic compound.

6. A method according to Claim 5 wherein said at least one compound is selected from the group of sorbitol, glycerol, ethanol, sucrose, polyethylene glycol and dimethylsulfoxide.

7. A method according to Claim 6 wherein the DNA-dependent RNA polymerase activity is provided by the RNA polymerase of a bacteriophage selected from the group consisting of T7, T3 and SP6.

8. A method according to Claim 7 wherein the aqueous solution comprises 30 mM MgCl2, 20 mM KCl, 10 mM
dithiothreitol, 4 mM spermidine, 6 mM rNTPs, 1 mM dNTPs.

9. A method according to Claim 8 wherein the RNA target segment has a length of at least 50 nucleotides and the target hybridizing segments of the two DNA primers are each about 15 nucleotides in length.

10. A method according to Claim 9 wherein the sequence of the first subsegment of the first primer is exactly complementary to the sequence of the 3'-subsegment of the target segment and wherein the sequence of the first subsegment of the second primer is the same as the sequence of the 5'-subsegment of the target segment.

11. A method according to Claim 10 wherein the first DNA primer comprises said promoter-providing segment and the second primer lacks a promoter-providing segment.

12. A method according to Claim 11 wherein the promoter-providing segment is from the T7 promoter.

13. A method according to Claim 12 wherein, after the incubation to amplify the target RNA segment, said target RNA segment or the RNA segment with the sequence complementary to that of said target RNA segment is detected in a nucleic acid probe hybridization assay.

14. A method according to Claim 8 wherein the first primer comprises a first promoter-providing subsegment, to provide a first promoter to initiate transcription of a cDNA comprising the extension products of the two primers, and the second primer comprises a second promoter-providing subsegment, to provide a second promoter to initiate transcription of a cDNA comprising the extension products of the two primers, said first promoter, in the aqueous solution, being recognized by a first DNA-dependent RNA polymerase for catalysis of transcription and said second promoter, in the aqueous solution, being recognized by a second DNA-dependent RNA
polymerase for catalysis of transcription, said first and second DNA-dependent RNA polymerases being the same or different; and wherein the aqueous solution comprises said second DNA-dependent RNA polymerase.

15. A method according to Claim 14 wherein at least one of the first and second promoter providing segments is from the T7 promoter.

16. A method according to Claim 15 wherein said first DNA-dependent RNA polymerase is different from said second DNA-dependent RNA polymerase, wherein, in the aqueous solution, said second DNA-dependent RNA
polymerase but not said first DNA-dependent RNA
polymerase recognizes said second promoter; and wherein the aqueous solution comprises said second DNA-dependent RNA polymerase.

17. A method according to Claim 16 wherein, after the incubation to amplify the target RNA segment, said target RNA segment or the RNA segment with the sequence complementary to that of said target RNA segment is detected in a nucleic acid probe hybridization assay.

18. A method as in any of Claims 4-17 wherein the reverse transcriptase is AMV reverse transcriptase and the aqueous solution further comprises between about 1 and about 25 weight percent of a sulfoxide compound of the formula R1-(SO)-R2, wherein R1 and R2 are independently C1 - C4 alkyl, wherein R1 and R2 can be joined as part of a saturated cyclic compound.

19. A method according to Claim 18 wherein the aqueous solution comprises dimethylsulfoxide.

20. A method according to Claim 19 wherein the aqueous solution is supplemented with 10% DMSO and 15%
sorbitol and wherein the RNA target segment has a length less than about 700 nucleotides.

21. A method as in any of Claims 4-17 wherein the reverse transcriptase is Moloney murine leukemia virus reverse transcriptase and wherein the aqueous solution comprises between about 0.1 mM to about 10 mM
manganese ions.

22. A method as in any of Claims 4-17 wherein the aqueous solution further comprises E. coli RNAse H.

23. A method according to Claim 22 wherein the aqueous solution further comprises a sulfoxide compound of the formula R1-(SO)-R2, wherein R1 and R2 are independently C1 - C4 alkyl, wherein R1 and R2 can be joined as part of a saturated cyclic compound.

24. A method according to Claim 23 wherein the sulfoxide compound is DMSO.

25. A method according to Claim 24 wherein the reverse transcriptase is a retroviral reverse transcriptase selected from the group of AMV reverse transcriptase, MMLV reverse transcriptase and HIV-1 reverse transcriptase.

26. A method according to Claim 25 wherein the reverse transcriptase is AMV reverse transcriptase, wherein the RNA target segment has a length greater than about 400 nucleotides and wherein the aqueous solution further comprises 10% DMSO and 15% sorbitol.

27. A kit useful for the detection of at least one specific RNA target sequence in a sample containing nucleic acid, which kit consists essentially of:
(a) (1) a first DNA primer which is a single stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first subsegment of said first primer being of the same length as the 3'-subsegment of the target segment and having a sequence sufficiently complementary to that of the 3'-subsegment of the target segment to prime, in the aqueous solution, a primer extension reaction in which a nucleic acid with the sequence of the target segment is the template, and (2) a second DNA primer, which is a single-stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first subsegment of said second primer being of the same length as the 5'-subsegment of the target segment and having a sequence sufficiently homologous to that of the 5'-subsegment of the target segment to prime, in the aqueous solution, a primer extension reaction in which a nucleic acid with the sequence complementary to that of the target segment is the template, provided that at least one of said primers further comprises a promoter-providing subsegment, which comprises the sense strand of a first promoter, said sense strand being joined to the first subsegment of the primer, which comprises said promoter-providing segment, operably for transcription from said first promoter of a cDNA
comprising the extension products of said two primers, and provided further that, where said first primer lacks such a promoter-providing subsegment, then the 5'-terminal nucleotide of said 5'-subsegment of said target RNA segment is the 5'-terminal nucleotide of the target RNA molecule;
(b) (1) a reverse transcriptase which exhibits in said aqueous solution DNA-dependent DNA polymerase activity, RNA-dependent DNA polymerase activity and an amplification-effective amount of RNAse H activity, and (2) a DNA-dependent RNA polymerase which, in said aqueous solution, catalyzes transcription from said first promoter, wherein the only enzyme container has both said reverse transcriptase and said DNA-dependent RNA
polymerase together; and (c) nucleoside triphosphates required as substrates for the DNA-dependent DNA polymerase, RNA-dependent DNA polymerase, and DNA-dependent RNA
polymerase activities.

28. A kit according to Claim 27 which further comprises:
(d) an aqueous medium comprising from about 20 to 40 mM MgCl2; about 1 to 25 mM KCl; about 1 to 20 mM
dithiothreitol; about 1 to 10 mM spermidine; about 1 to 8 mM rNTPs; about 0.1 to 2 mM dNTPs; and an amount of buffer effective to maintain the medium at about pH 8.

29. A kit according to Claim 28 wherein the aqueous solution comprises 30 mM MgCl2, 20 mM KCl, 10 mM
dithiothreitol, 4 mM spermidine, 6 mM rNTPs, 1 mM dNTPs, and 40 mM Tris-HCl and wherein the pH is about pH 8.1.

30. A kit useful for the detection of at least one specific RNA target sequence in a sample containing nucleic acid, which kit comprises:
an aqueous medium comprising from about 20 to 40 mM MgCl2; about 1 to 25 mM KCl; about 1 to 20 mM
dithiothreitol; about 1 to 10 mM spermidine; about 1 to 8 mM rNTPs; about 0.1 to 2 mM dNTPs; and an amount of buffer effective to maintain the medium at about pH 8.

31. A kit according to Claim 30 wherein the aqueous solution comprises 30 mM MgCl2, 20 mM KCl, 10 mM
dithiothreitol, 4 mM spermidine, 6 mM rNTPs, 1 mM dNTPs, and 40 mM Tris-HCl and wherein the pH is about pH 8.1.

32. A pair of DNA primers for amplifying, in a transcription based amplification system, a target nucleic acid segment which comprises a 5'-subsegment, which includes and extends at least 9 nucleotides in the 3'-direction from the 5'-terminal nucleotide of the target segment, and a 3'-subsegment, which does not overlap the 5'-subsegment and which includes and extends at least 9 nucleotides in the 5'-direction from the 3'-terminal nucleotide of the target segment, said DNA
primers comprising:
(1) a first DNA primer which is a single stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first subsegment of said first primer being of the same length as the 3'-subsegment of the target segment and having a sequence sufficiently complementary to that of the 3'-subsegment of the target segment to prime, in the aqueous solution, a primer extension reaction in which a nucleic acid with the sequence of the target segment is the template, and (2) a second DNA primer, which is a single-stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first subsegment of said second primer being of the same length as the 5'-subsegment of the target segment and having a sequence sufficiently homologous to that of the 5'-subsegment of the target segment to prime, in the aqueous solution, a primer extension reaction in which a nucleic acid with the sequence complementary to that of the target segment is the template, provided that at least one of said primers further comprises a promoter-providing subsegment, which promoter-providing subsegment comprises (i) at its 5'-end a DNA segment having between one and ten nucleotides, said one to ten nucleotide segment being joined through a single phosphodiester linkage to (ii) the 5'-nucleotide of a polymerase binding segment of a sense strand of a T7 promoter, said polymerase binding segment having the same length as the consensus sequence of said sense strand of said T7 promoter being joined to the first subsegment of the primer, which comprises said promoter-providing segment, operably for transcription from said T7 promoter of a cDNA comprising the extension products of said two primers, further provided that said promoter-providing segment either has no transcription initiation sequence or has a segment having between one and four nucleotides which is joined through a single phosphodiester linkage to the 3'-nucleotide of the promoter consensus sequence and which is selected from the group consisting of: 5'-GAAA-3'; 5'-GGTA-3'; 5'-GGAA-3'; 5'-GGCA-3'; 5'-GGA-3';
5'-GA-3'; and G.

33. A pair of DNA primers according to Claim 32 wherein said one to ten nucleotide segment is 5'-AGTAATT-3'.