WO 92/1975 WO 92/1975
2 pcr/FR92soo393 .. :
.
Vecteur de délivrance d'AE~N
. . _ La présente invention concerne des moye~s dest~nés au transfert à
l'intérieur d'une cellule d'un fragment d'ARN codant pour un détern~nant antig~nique caractéristique d'une tumeur ou d'un agent pathogène ailLsi qu'aux compositions pharmaceutiques les comprenant. La présente in-~ention s'applique en particulier au domaine des vaccins.
D'une man~ère générale, la vaccination traditionnelle consiste à
sensibiliser le système immunitaire d'un ind;vidu à un agent in~ectieux (bactérie~
virus ou parasite). A cette fin, trois types de vaccins ont été proposes et développés selon les cas, de manière plus ou moins empirique 2 5 s - Les vaccins inactivés (ou tues) obtenus à pastir de bact~ries ou de virus entiers qui ont perdu leur infectivité grâce à des traitements chirniques;
- Les vaccins vivarlts qui sont constitués par des bactéries ou des virus infectieux dont la vin~lence a éte atténuée par mutagénèse ou par passages dans divers milie~ ui provoquent des mutations; et - Les vaccins sous-un~tés, à base de ~ox~nes bac~ér~eMes ou dantiènes d'agents infectieux purifiés.
~ : . - ' -wo 92/19752 PCr/FR92/00393 D'autre part, on a récemunent propos~ d'appliquer le principe des vacc}ns à la prévention des tumeurs malignes. En effet~ la plupart des cellules tumorales expriment à leur surface des antigènes qui dif~èrent soit qualitativement, soit ?
quantitativement des antigènes présents à la surface des cellules normales s correspondantes. Ces antigènes sont dits spécifiques lorsqu'ils sont uni~uement exprimés par des cellules tumorales. Lorsqu'ils sont présents ~ la fois sur des cellules normales et tumorales, ces antigènes sont dits associés ~ la tumeur;
dans ce cas, ils sont présents soit en plus grande quantité, soit sous une formediff~rente dar~, les cellules tumorales.
Une fois le vaccin administré, les cellules du système imrnunitaire reconnaissent les antigènes du genne étranger, réagissent spécifiquement à
cette intrusion et gardent ces antigènes en mémoire; elles protègeront l'organisme lors d'une infection ultérieure.
D'ùne manière générale il existe de~u~ grands types de réponse irnmunita~re: la réponse de type humoral qui est caractérisée par la production d'anticorps par les Iymphocytes B et la réponse irnmur~taire à médiation cellulaire qui met en jeu des cellules effectrices i.e., essentiellement les lymphocytes T8 (lyrnphocytes cytotoxiques). Ces réponses sont initialement activées par les cellules présentatrices d'asltigènes et modulées par les cellules régulatAces i.e., les Iymphocytes T4 (lyrnphocytes T helper~ et les lymphocytes T
suppresseurs. ~ `
25 , Dans ses très grandes lignes, la réponse immunitaire fonctionne ainsi:
- Les cellules présen~atrices d'antigène (monocytes, macrophages et lyrnphocytes B) capturent l'antigène, le digèrent et en réexposen~ des fragments à leur surface, en association avec des molécules du complexe .3 o majeur d'histocompatibilité (MHC) de slasse I ou II.
- Les lymphocytes T4 stimulent la prolifération des lymphocytes B producteurs ~ ~ -d'anticorps et celle des Iymphocytes T8 (lymphocytes T cytotoxiques ou Cl L) quand ils "voient" les fragments d'antigè~es associ~s au complexe majeur d'histocompatibilité de classe II.
~ .
A ~ . ' ` ' ' : . ' ' : ' : ' wo 92/19752 pcrJFRs2/oo3s3 ~3~Aao - Les Iymphocytes B produisent les anticorps qui vont interagir avec les antigènes circulants de manière à les neutraliser.
Enfin les Iymphocytes T8 détruisent les cellules infectées quand ils reconnaissent les fragmenss d'antig~nes associés au complexe majeur d'histocompatibilité de classe 1.
On pense actuellement que les vaccins doivent probablement induire à la fois une réponse humorale et à mediation cellulaire pour conféreF une immunité ~ lide et durable.
Parmi les types de vaccins cit~s ci-dessus, les vaccins vivants scnt souvent les plus efficaces: ils activent simultanément les Iymphocy~es B, T4 e~ T8 en conférant un bon rliveau d'lmmunité. De plus, comme ils se multiplient dans I'organisme, ils agissent à fai~les doses et n'ex~gent généralement pas de rappel.
Malheureusement, pour demeurer v~vants, ces vaccins ~oivent généralemer~t être conserv~s au froid. Le maintien de la cha~ne du froid lors des transports est un facteur qui grève de façon non-n~gligeable le coût de ces vaccins. Enfin, leur virulence qui est att~nuée n'est pas nulle et ils Lnduisent parfois des effets secondaires chez des sujets immunod~plimés. Plus grave encore, ils peuvent recouvrer leur virulence à la suite de mutations inverses, ce qui est rar~ssime mais proprement intolérable.
Les vaeeins sous-unités n'ont pas ces défauts ma~s ils stimulent ~5 ~ gén~ralement moins bien les cellules irnmuI~itaires et nécessitent des adju~ants (des mol~cules qu~ rer~orcent leur pouvoir immlmogène). L~ vaccin contre l'hépatite B, constitué par l'antigène rnajeur de surface du virus, obtenu par la technologie de }'ADN recombinant, est un exemple de vaccin sous-unité
développé avec succès. Toutefois, dans d'autres cas, les résultats ont été 2 pcr / FR92soo393 ..:
.
AE ~ N delivery vector . . _ The present invention relates to ~ s hubs ~ born to transfer to inside a cell of an RNA fragment encoding a deternant antig ~ nique characteristic of a tumor or a pathogen ailLsi that pharmaceutical compositions comprising them. This int ~ ention applies in particular to the field of vaccines.
In general, traditional vaccination consists of sensitize the immune system of an ind; vidu to an in ~ ectieux agent (bacteria ~
virus or parasite). To this end, three types of vaccines have been proposed and developed depending on the case, more or less empirically 2 5 s - Inactivated (or killed) vaccines obtained from bacteria or viruses whole people who have lost their infectivity thanks to surgical treatments;
- vivarlts vaccines which are made up of bacteria or viruses infectious whose wine ~ lence was attenuated by mutagenesis or by passages in various milie ~ ui cause mutations; and - Vaccines under one ~ tees, based on ~ ox ~ bac nes ~ er ~ eMes or dantiènes purified infectious agents.
~:. - '-wo 92/19752 PCr / FR92 / 00393 On the other hand, we have recently proposed ~ to apply the principle of vacc} ns prevention of malignant tumors. Indeed ~ most tumor cells express antigens on their surface which differ either qualitatively or?
quantitatively of antigens present on the surface of normal cells s corresponding. These antigens are said to be specific when they are only expressed by tumor cells. When present ~ both on normal and tumor cells, these antigens are said to be associated with the tumor;
in this case, they are present either in greater quantity, or in a different form ~ rent dar ~, the tumor cells.
Once the vaccine is given, cells in the immune system recognize the antigens of the foreign genus, react specifically to this intrusion and keep these antigens in memory; they will protect the body during a subsequent infection.
Generally there are ~ u ~ broad types of response immunity ~ re: the humoral type response which is characterized by the production of antibodies by B lymphocytes and the immune response mediated cell which involves effector cells ie, essentially T8 lymphocytes (cytotoxic lyrnphocytes). These responses are initially activated by the cells presenting asigen and modulated by the cells regulatAces ie, T4 lymphocytes (helper T lymphocytes ~ and T lymphocytes suppressors. ~ `
25, Broadly speaking, the immune response works as follows:
- Antigen-attracting cells (monocytes, macrophages and lyrnphocytes B) capture the antigen, digest it and re-expose it fragments on their surface, in association with molecules of the .3 o major histocompatibility complex (MHC) of slasse I or II.
- T4 lymphocytes stimulate the proliferation of producer B lymphocytes ~ ~ -antibodies and that of T8 lymphocytes (cytotoxic T lymphocytes or Cl L) when they "see" the fragments of antigens associated with the major complex class II histocompatibility.
~.
A ~. '''':.'':':' wo 92/19752 pcrJFRs2 / oo3s3 ~ 3 ~ Aao - B lymphocytes produce antibodies which will interact with circulating antigens so as to neutralize them.
Finally the T8 lymphocytes destroy the infected cells when they recognize the fragments of antigens associated with the major complex class 1 histocompatibility.
It is currently believed that vaccines are likely to induce times a humoral and cell-mediated response to confer a ~ lid and lasting immunity.
Among the types of vaccines cited above, live vaccines are often the most effective: they simultaneously activate the B lymphocytes, T4 e ~ T8 in giving a good level of immunity. In addition, as they multiply in The organism, they act at low ~ doses and generally do not ~ reminder.
Unfortunately, to stay alive, these vaccines generally have to be be kept cold. Maintaining the cold chain during transport is a factor which strikes in a non-negligible way the cost of these vaccines. Finally, their virulence which is att ~ cloud is not zero and they sometimes cause effects secondary in immunod ~ plimés subjects. Worse still, they can recover their virulence following reverse mutations, which is rare ~ ssime but properly intolerable.
The sub-unit vaeeins do not have these faults ma ~ s they stimulate ~ 5 ~ generally not so well the immune cells and it requires adjuvants (molecules ~ rer ~ orcent their immlmogenic power). The vaccine hepatitis B, consisting of the surface antigen of the virus, obtained by recombinant DNA technology is an example of a subunit vaccine successfully developed. However, in other cases, the results have been
3 o décevants.
On penso qu'un facteur lim~tant le suc~s des vaceins sous-unités réside dans le fait qu'ils ne sont pas capables d'induire une réponse irnrnuni~aire de type rellulaire suffisamment for~e. Ceci résulte vr~usemblablement de I'impossibilité pour certains antigènes d'~tre correctement processés et~ou pour , .
, . ~ .
~, , ' , wo 92/l9~5~ PCI/FRg2/00393 $~
leurs fragments, d'entrer en contact avec les molécules du complexe majeur d'histocompatibilité (MHC) de classe I.
En effet, l'association entre les molécules du MHC de classe I (qui participent à la réponse irnmunitaire de type cellulaire) et les fragments peptidiques a lieu dans le reticulum endoplasm:ique de la cellule. Pour cela, ilfaut dons, au préalable, que l'antigène panienne jusque dans ce compartiment cellulaire. D'une façon générale, l'entrée dans ce com~artiment se fait à partirdu cytosol où les protéines sont synth~tis~es par traductio~ des ARN messagers correspondants. Le passage du cytosol au reticulum endoplasmique s'effectue grâce à dew~ ~pes de mécanismes:
- soit un mécanisme de sécrétior~ lorsque la protéine est synthétisée sous fonne de précurseur (rnis en jeu d'un peptide signal), - soit un mécanisme de "pompe" à peptides.
Les types de vacciILs connus jusqu'à présent ne permettent absolument pas de maîtriser cette donnée importante qu'est l'associa~ion des molécules du MHC
2 0 de classe I et des fragments peptidiques. Le plus souvent~ les éléments -infectieux (bacténes, virus, parasites ou antigènes) sont en e~et absorbés par les cellules phagocytaires selon le mécanisme d'endocytose (ou phagoc~nose). Les vésicules d'endocytose fusionnent avec des Iysosomes dont le contenu ~: enzymatique assure la dégradation du maténel phagogrté. Ces vésicules ~: 25, endocytaires et Iysosomales forment un ensemble distinct du réticulum endopl~smique et~ne sont pas en contact avec ce den~ier.
Par conséquen~, même si un antigène est capable d'induire une production d'anticorps neutralisants à son encontre, il n'est absolument pas cenain qu'il se ~:
révèlera au bout du compte efficace pour la mise en oeuvre d'un vaccin sous-unité.
On a ma~ntenant trouvé de marJ~ère surPrenante que la synthèse d'un an~igène pouvait être réalisée directement dan~s les cellules presen~a~rices d'antigènes de l'individu à immun~ser, lorsque l'ARN codant pour cet antigène était adn~inistré sous forme apropriée e.g., sous ~rme de composilion ~.
'~' ;~ ' ` ~ .:
WO 92/19752 PCI`/FR92/00393 liposomale. Le destin de l'ARN ainsi injecté était en effet hautement incertain compte-tenu de sa très courte demi-vie. De p,lus, il n'~tait absolument pas évident que l'ARN soit correctement délivré dans le cytosol et qu'il soit pns encharge par la machinerie cellulaire assurant le processus de traductiorl.
Ce nouveau mode de vaccination favorisla nettement l'association des molécules MHC de classe I avec les ~ragmen~. peptidiques issus de la digestion de l'antigène puisqu'il a ét~ montré que l'indi~idu ainsi traité était capable de d~velopper une réponse immunitaire mettant en jeu les Iymphocytes T
0 cytotoxiques (CIL).
En conséquence, I'invention propose:
(i) Un vecteur de délivrance d'ARN qui comprend un liposome et au moins.
un fragment d'ARN codant pour un d~ternainant antigénique caract~ristique d'une tumeur ou d'un agent pathogène, ledit au moins un fragment d'ARN étant encapsulé dans Iedit liposome;
(ii) Une composition pharrnaceutique destinée au traitement d'une tbmeur ou d'une maladie induite par un agent pathog~net ~ des fins préventives ou curatives, qui comprend à titre d'agent thérapeu~ique un vecteur de délivrance d'ARN selon l'invention;
- ~iii) L'usage d'un vecteur de délivrance d'ARN selon l'invention pour traiter de 2 5 ~ manière préventive ou curative, une tumeur ou une maladie induite par un ageht pathogène;
: .
~iv~ L'usage d'un vecteur de délivrance d'ARN selon l'invention, pour la préparation d'un médicament destine au trai~ement préventif ou curatif 3 o d'une tumeur ou d'une maladie induite par url agent pathogène;
:.
(v) Une méthode de traitement curatif ou préventif d'une tumeur ou d'une maladie induite par un agent pathogène qui cornprend l'acte d'admirlistrer une quantité suffisante d'un vecteur de délivrance d'ARN selon l'invention ,~
3 5 à un patient ayant besoin d'un tel traitement.
, . , :
WO 92/19~52 PCll/FR92/00393 Un fragment d'ARN utile aux fins de la présente invention est par rlature un fragment d'ARN non-infectieu~ exclusivement de type rnessager; c'est-à-dire capable d'atre directement traduit en protéim~ par la machinene cellulaire sans devoir etre d'abord répliqué ou transcrit en ADN. Par définition, il ne contient pas les éléments qui lui perrnettraient de se répliquer à Itintérieur d'une cellule. De m~me il ne contient pas l'information génétique nécessaire à
la reconstitution d'un agent pathogène (e.g., une bactérie, un virust ou un parasite) substantiellement complet.
0 Par "déterminant ~ntig~nique", on enterld ntimporte quel peptide comportant au moins un épitope caractéristique d'un antiBène de tumeur ou dtun agent pathogène. Ce déterminant antigén~que peut donc être Itantigène natif complet, un précurseur ou un analogue de celui-ci, un fragment de I'antigène natif ou un analogue de ce fragment. Par "analogue", on entend une molécule ayant une séquence en acides arn~n~s sensiblement différente de celle de la molé ule native e.g., dont la séquence en acides aIDinés présente un degréd'homologie au moins d'environ 80%, de préférence d'au moins 90%, de manière tout à fai~ préf~rée d'au moins 95~o a~rec la séqllence de.la molécule native. ~`
~
D'une manière génerale, le détem~inant antigér~ique peut etre ~ -caratéristique de n'importe quel type de tumeur ou de n'importe quel agent -`
pathogène.
25 , Afin d'illustrer ce qui précède, on rite à titre d'exemple:
., ~ .
- La protéine de la nucléocapside (nucléoprotéine ou NP) du virus de la grippe de type A affectant les humains telle que définie par la séquence àe l'ARNm qui lui correspond. Cette séquence a été publiée dans Huddleston Brownlee, Nucl. Ac. Res. (1982) lQ (3): 1029.
,:
- La protéine de fusion ~F) du virus de la rougeole ~. .
- Un peptide comportant l'épitope de séquence: ~hr-Tyr-Glu-Arg-Thr Arg-~la-Leu-Val-Arg. Cet épitope est cara~éristique de la nucléoprotéine des virus de la gnppe type A.
::
:~ :
wo 92~197$2 PCr/FR92/0û393 ~ 3~.~'fi~
- Un peptide comportant la séquence: Thr-Tyr-GIIl-Arg-Thr-Arg-Ala-Leu-Val-l~r.
- L;antigène de tumeur H23-ETA assoc~é au cancer du sein chez les humains, tel que décri~ dans Wreschner et al, J. Biochern. ( 1990)1~2: 463.
- Un peptide comportant l'épitope majeur de l'antigène H23-ETA, ayant la séquence: Pro-Gly-Ser-Thr-Ala-Pr~X-AI2-His-Gly-Val~ Ser-Ala-Pro-0 Asp-Y-Arg Pro-X dans laquelle X est Pro ou Ala et Y est Thr vu Asn.
Un vecteur de délivran e d'ARN selon l'invendon peut conten~r diff~rents fragments d'ARN; chacuns de ces fragments codant pour un déterminant amtigénique particulier. Par e~ernple, un vec~eur de délivra~sce d'ARN selon 5 I'invention destiné au traiternent préventif de la grippe peut contèn~r à la fois:
- Un fragment d'ARN codant pour la nucléoprotéine des virlls de la grippe de type A et un fragment d'ARN codant pour la nucléoprotéine des virus de la grippe de type B ou bien, - Un fragment d'~N codallt pour la nucléoprot~ine des Yirus de la grippe de type A et un ou plusieurs f~a~ent(s) d'ARN, chacun de ~es den~iers codant pour l'hémaglutil~ne d'une souche particulière du virLs de la gripp~
Aux ffns de la présente invention, Im fragment d'ARN peut être obtenu de manière conventiormelle e.g., par synthèse chimlque ou par transcription in vitro du fragment d'ADN correspondant.
:
3~ Par "liposome", on entend une vésicule essentiellement formée dune membrane constituée de lipides en doubie couche. Une telle vésicule peut présenter une ou plusiours strates membranaires. Dans le premier cas, on parle d'une vésicule unilamellaire tandis que dans le delLxième cas il s'agit d une vésicule oligo- ou plurilamellaire. De maDièrç typique, la membrane des 35 liposomes est cons~ituée de lipides amphiphyliques tels que les phospholipides, en associasion ou non avec d'autres consituants lipidiques. Des phospholipides :: ~. , .
WO 9~/19752 PCTiFR92/00393 ;~$'r.~
appropriés sont par exemple, la phosphatidylcholine, la phosphatidylsérine, la phosphatidyléthanolamine, les sphingolipicles, la cardiolipine, le phosphatidylinositol, l'acide phosphatidique et le phosphatidylglycérol. I:)e plus, on peut aussi prévoir d'utiliser des phospholipides synthétiques dérivés ou nvn 5 des phospholipides mentionnés ci-dessus, contenant par exernple, des groupements variés tels que des groupement hydroxyles9 imidæoles, amine, arn~des, sulphydryles, etc.
De préférence, d'autres lipides tels que des stéroides, le cholestétol, des 10 amines alipbatiques, peuvent être mélang~s aux phospholipides. De tels lipides sont en particulier utiles à titre d'agents stabilisants ou anti-oxydants.
AILY ~ins de la présente invention, un premier méla~ge lipidique avantagelLx est constitué de phosphatidylcholine ~PC) et de cholestérol (CH) en 5 proportion variable. On indique toutefois que des proportiorls PC: CH
satisfaisantes sont de l'ordre (en terme de part) de 5: 1 à S: 5. Un tel mélange à
part égale convient particulièrement. Un deuxi~me m~lange avantage~ est corlstitué de phosphatidylcholine, de cholest~rol et de phosphatidylsérine (PS) en proportion variable, par exernple CH/PC/PS e~ proportion 5:4:1.
la préparation des liposomes ainsi que l'encapsidation de l'ARN peut être rnises en oeuvre sel~ des techniques con~ues. En particulier, les terhniques d'encapsidation de l'ADN qui sont couramment utllisées, sont applicables dans le cas présent.
25, E~l outre, la membrane peut aussi conte~ir diverses protéines insérées dans la membrane, at~achées par lia~son covalente à un l;pide de la membrane, directement ou indirectement via un agent de liaison, ou simplement en interaction avec un phospholipide. Lorsque'une protéine est liée par liaison 30 covalente à un lipide, ce dernier est de préf~re~ce un lipide possédant une foaction amine tel que par exemp}e, la phosphatidyléthanolarnine Avantageusement ces protéines peuven~ etre utilisées comme agerlt de ciblage des liposomes sur une classe particulière~ de cellules. Ce sont par exemple, desanticorps msnoclonaul~ ou des lymphokines.
: ~ : , . , : , .: . : , :: :
wo 92/197~2 PCr/FRg2/~0393 ~$i~:9~
AIL~ fins de la pr~sente invention, le (ou les) fragment(s) d'ARN sodant pour un déterminant antigér~que d'une tumeur ou d'un agent pathogène est (sont) avantageusement accompagné(s) d'un fragment d'ARN codant pour une interleukine-1, d'un fragment d'ARN codant pour une interleukine^4 ou d'un 5 fragment d'ARN codant pour une interleukine-2; ~e dernier étant tout particulièrement préféré.
Conformément aux buts poursuivis par la présente invention, il doit être entendu qu'un fragment d'ARN codant pour un détermmant ant;gén~que ou lo une interleukine comporte outre la séquence codante, tous les élésnents nPcéssaires à la traduction de cette den~ière.
Lorsgue différents fragments d'~N composent un vecteur ou une composition pharmaceutique se}on l'invention, ceux-ci peuvent être 5 par~iellement ou totalement liés les uns aux autres, de manière ~ former au moins un fragment d'ARN polycistronique.
Er~in, Ime composition pharmaceutique selon l'inverltion peut être fabri~uée de manière conventionnelle. En particulier on asso~e le ou les agents 2 o therapeutiques selon l'invention avec un diluant ou ~ suppo~t aceeptable d'un point de vue pharmaceutique. Une compositio~ selon l'imention peut être administrée par n'importe quelle voie corlventionnelle en usage dans le domaine des vaccins, en par~iculler par voie sous-cutanée, par voie intra-musculaire ou par voie intra-veineuse, par exemple sous forme de suspension 25 ~ injectable. 0~ indique que la voie sOus-cueanée est particuli~remen~ bien adaptée~ pour ~I'adrninistration d'urle composition selon l'invention.
L'administration peut avoir lieu en dose unique ou répétée une ou plusieurs foisaprès un certain délai d'intervalle. Le dosage approprié varie en fonction de divers paramètres, par exemple, de l'individu traité ou du mode 3 0 d'adrni~istration.
.
L'invention est illustrée ci-après en se référant alLx ~Igures suivantes:
La figure 1 représente le plasmide p~EM-3Z.
.
.
WO 92/19752 PCr/FR9~2/00393 r~ LO
gure 2 sch~matise les inserts des plasmides pTG3003 (base pGEM-3Z), pPM2 (base pUC18~, pPM3 (base pUC18), pPM4 (base pUC18), pPM5 (base pGEM-3Z) e~ pPM6 (base pGEM-3Z~. NP ~ nucléoproté~ne; IL-2 =
interleukine-2; S. signal = séquence signal du précurseur de l'I~2; 3~NTRsG
5 = extrémité 3'non-traduite du gene de la B-globine de lapin.
~ '' gure 3 schématise les inserts des plas~ides pPM9, pPM10, pPM11 et pPM12 (chaclm à base de pGEM~7). S'MTRBG = extrérnité 5'non traduite du gene de la ~-globine de lapin.
~.
.. ..
.' .
~, .~ ~
:':
~`
,: :
"
.. :
~'''~ .
. . . . ~ . :
.. ..
.. . .
WO 92tl97S2 PCl`/FR92/00393 , LQ
~: Préparation de liposomes charg6s en ARN eodant pour la nucléoprotéine du virus de la grippe de type L~ Pr~paration dc I~ARN.
Un fragment EcoRI - SalI comprenant le cDNA codant pour la nueléoprotéine du v~rus de la grippe de type A, souche A/NT/6û/68 (Huddleston ~ Br~wnlee, Nucl. Ac. Res. (1982) lQ (3): 1029) est obtenu par digestion du plasmide p~8 ~Jones & Brownlee, Gene ~198S~ ~: 333).
Ce fragITIent EcoRI - SGII est inséré dans le plasn~ide pGEM-3i~ ~Promega Corp; ~igure 1) digéré par EcoRl et SalI de ma~ière à placer le cDNA codant pour la nucléoprotéine sous l~ eontrôle d'un promoteur reeonnu par la RNA
polymérase du phage 17. On obtient ainsi le plasmide pTG3003.
Le plasmide pTG3~3 est ensuite linéarisé par digestion avec Sall; puis transc t en utilisant un kit de transcription in vib~ (Stratag~ne; re catalogue200 341~ selon les instructions du foumisseur. I,'ARN ainsi obtenu est cappé paradjonction dans le ta npon de transcription de 10 $~1 d'une solution de m7G(5')ppp(5')G 5 mM (Pharmacia; n produit 27~635).
. .
lB. Pr~pal~tio~a des liposomes.
C)n prépare une solution de cholestérol en dissolva~t le produit en poudre 25 ~ (Sigma) dans du chloroforme à raison de 100 mg/ml. Puis dans un tube Corex de 30 rnI~ on m~larlge 58 1~l de la solution de cholest~rol et 110 ~ 1 d'une solution de phosphatidylcholine à 100 mg/rnl (Sigma). Le mélange Snal con~ient environ 30 ~moles de lipides.
3v Ce rnélange est agité vigoureusement au vonex. Puis on laisse le soivants'évaporer à 40~C. L'opération de séchage est complétée par Iyophilisation pendant environ 1 hr.
La couche lipidique déposée au fond du tube est reprise dans 1 ml ~`eau.
Le mélange est homogénéisé au vortex et soni~ué à la ~équence minim~le en utilisant un sonicateur Labsonic L de E~raun. L'operation s'Fffec~e pend~nt 10 .. . ..
: . .
~3$S~@3 min. par passages intermittents de lS secondes, espacés par 3û secondes de repos au froid.
I a suspension ainsi obtenue est centnfugée à 16~00 rpm, à 4C pendant 15 5 min. pour sédimenter les particules de titane et les vésicules les plus grandes (Biofuge/Heraeus en tube eppendorff3. Puis le surnageant contenant une majorité de vésicules unilamellaires ayant pour diamètre 50 microns environ, est récupéré dans des tubes Corex de 15 ml.
0 A la suspension vésiculaire obte~ue en B), on ajoute 135 ~1 de la préparation d'ARN obtenue en A); soit 40 ~g d'ARN environ. Le mélange est plongé doucement dans l'azote liquide, en roulant entre ses doigts le tube maintenu vertical. Lorsque le mélange est complètement congel~, on le Iyophilise pendant toute une nuit.
Le Iyophilisat est réhydraté progressivement dans lOO,ul d'eau distillée.
Puis on ajoute goutte à goutte 0,9 rnl de tampon Hepes pH 7,05 de composition ~ aCI 140 mM, KCI S mM, Na2HPO4 2~2O Q75 mM, Hepes 25 mM. La suspension vésiculaire est erLsuite calibrée par extrusions successives au travers d'un prernier et deuxième ~lltre dont les pores ont respe~tivement un diamètre de 40ûnm et de 2ûOnm. I~ suspension ainsi obtenue contient une majorité de vési~les oligolamellaires qui ont encapsulé l'ARN.
, ~ :
Afin d'éliminer de manière substantielle l'ARN non-encapsulé, la 25 , suspension est d~posée sur llne colonne de Sepharose 4B (10 rnl; colonne de; section 1 cm) prééquilibrée en tampon Hepes. L'élution est poursuivie en tampon Hepes. Les fractions éluées d'aspect blanc qui contie~ent les vésicules sont collectées ensemble; ceci correspond à un volume d'environ 2 rnl.
.
, .
.
wo 92/ 1 97s2 PCT/FR92/003s3 EXEMP~2: Induction d'une réponse CI'3L in~ti~e par des liposomes chargés en ARN codant pour la nucléoprotéine du virus de la grippe de type ~
Trois series de souris BALB/c correspondant respectivement (i) au test, (ii) contr~le positif et (iii) au controle négatif sont pr~parées comme suit:
(i) Test les souns recoivent par voie intra-veineuse 200 ,ul de la préparation de liposomes obtenue à l'exemple 1.
(ii) Contrdle positif: les souris reçoivent par Yoie intra-p6Atongale 130 un~téshémaglutinantes du virus de la grippe de type A, souche Caen (A-Caen).
Les différentes souches de type A diff~rent parfois entre elles pour certaines protéines comrne l'hémaglutil~ine ou la neuraminidase mais jamais pour la nucléoprotéine. Par contre il existe des variations en ce qui concerne la nuclénprotéine entre les ViA~us de type A et B.
~iii) Contrôle néga~if: les souris reçoivent par voie intra-veineuse 200 ~I d'une préparation de liposomes préparées comme à l'exemple 1, l'addition 2 o d'ARN ~yant 6té ommise.
15 jours apr~s, les souris de (i) et (iii) recoivent une injection identique à
; ~ la première et dans les mêmes corlditlons.
25 ~ 15 jours après la deuxième injectio~ la rate des souris est prélevée etdilacérée. ~es hématies sont élirninées par choc OSn~AOdqUe. Puis les cellules spléniques sont n~ses en culture dans des plaques ~ godets ~ raison de 5106 cellules/godets sous un volume de 2 ml en milieu de culture DMEM (Gibco) complémenté à 10 5~o de sérum de veau fétal, 2 mM de L,glutamine, S0 ~M de 3 o B-mercaptoethanol, 10 mM d'Hepes, 1 mM de pyruvate de sodiurn. 10 unités/rnl de pénicilline, 10 ~gÇml de strep~ornyci~e, 2,5 ~g/ml d'arnphotéricine et des acides aminés non-essentiels (Flow labs).
Ce milieu contient en outr 5 ~M du peptide NP 147-lSBR- de formule:
Thr-Tyr-&lu-A~rg-Thr-Arg-Ala-Leu-Val-Thr-Gly. Ce peptide correspond à un epitope systématiquement reconnu par les Cll, des souris BALB/c lorsqu'elles :' ~, :. . . .
WO 92/19752 PCl/FR92JOû393 ;~?l~ ~ S ~
sont imsnurlisées avec le virus de la grippe de ty~pe A (Bodmer et al, Cell (1988) 52: 253).
La culture est poursuivie à 37C sous atmosphère à 7 % de CO2 Au bout 5 de 7 jours, le milieu de culture imtial est remplacé par du n~ilieu frais. Dans chaque godet, on ajoute, de plus, 5 106 cellules dle rate de souris BALB/c non soum~ses à imrnun~sation, ces cellules ayant étC~ irradiées par 4000 Rad de rayonnement gamma.
0 Au 12ième jour de culture, l'activité des ~L est détectée par le test classique de relargage du SICr notamment décrit par M~rtinoIl et al, J.
Immunol. (1989) l~: 34B9. Des précisions sont données comme suit à lOx106 cellules de masto~tome de souris DBA/2 (H-2d) histocompatible avee les souris BALB/c (cellules P815), en mîlieu DMEM, sont inc lbées en présence de 100 ~Ci de Na~ S~rO4 (CEA, ~rance) pendant 1 hr à
37C. Les cellules sont lavées deux fois, puis reprises:en miliell DMEM.
L'opération est répétée en utilisant des cellules P815 infectées par le vims de la grippe de type A, souche Bangkok (P815/A-Ban) ou par le virus de la grippe de type B souche Yamagata:(P815/B-Yam) L'ir~ctio~ des cellules P8:15 est au préalable menée~ con~me suit: 106 cellules da~s û,S ml de rnilieu DMEP~
sont infectées par 100 unités hémaglutina~tes de virus. Apras ~0 n~in à 37C, les celluhs sont lav~es dans 2Q ml de milieu DMEM compléme~té avec 10 % de 25 ~ SVF pour stopper l'infection. L'expression des pro~é~nes du virus est poursuivie 3 hr à 37C aYant que les cellules soient utilisées dans le test dc cytolyse.
Les cellules P81~ (cellules cibles) sont alors distri~uees dans les puits d'une plaque de microtitration à raison de 3000 cellules par pllits. Dans I s trois 30 cas (i), (ii) et (iii), les cellules spléniquGs (cellules efEectrices), en rnilieu DMEM, sont ajoutées dans chaque puit de mani~:à coDstituer des series formant une gamme de rapport cellules effectrices / cellules cibles comprise entre 100/1 et 0,3/1 approximativement. Le peptide NP 147-158R- est enfin ajouté à la concentration finaie de 2,5 ~M. Dans chaque puit, le volulT e final est 3s de200~1.
, . ::: ' ~ . : ,, ~
WO 9tt19752 P~JFR92/00393 z; ~ r~ o La plaque est ensuite ineubée 4 hr ~ 37C puis centrifug6e. I:)ans chaque puit, on prélève 100 ~I de surnageant. I~ radioactivité de cha~ue pré}èvement est mesur~e et les résultats sont exprim~s clans le tableau ci-dessous, en pourcentage du relargage du chrome d~ à l'activit6 des CIL:
(relargage observe - relargage sponta:né) :
(quantité totale de ehrome incorporée - relargage spontané~ :
` .
InfectionEffectrices P815/- P815 P815 :Pgl5 /cibles /NP IA-Ban /~s-Yam Contrôle 40 <5 71 63 <5 po~itif 13 <5 5~ 46 <5 (A-Caen) 4,4 <5 45 46 <5 :~ 20 1,5 ~5 32 29 9 ContrBle æ <5 10 11 8 ;:
` ~ négatif 7,4 cS <5 7 <5 : 2,5 ~5 ~5 8 ~5 25. 0,8 ~5 ~ 10 <5 , Test ~ 2~ 10 53 50 10 7,4 <5 39 2~ 5 ~,5 < 5 18 20 5 0,8 ~5 ~5 12 <5 ~ , ."
~ ' ~
. -- .
' .:~:; . ' " , ' WO 92/197~2 P~/FRg2/00393 5 2.
k~L~: Deuxième préparation de liposomes chargés en ARN codant pour la nucléoprotéine du v~rus de la gnppe de type A.
3A. L'ARN es~ obtenu comme pr~édemment d~crlt en lA.
3B. Pr~paration des liposomes.
On prépare une solution de cbolestérol en dissolYant le produit en poudre dans du chlorofonne à raison de 100 mg/ml. Puis, dans u~ tube Corex de 30 ml, 0 on mélange ~8 ~LI de la solution de cholest~rol, 176 ~LI d'une solution de dipalm~toyl phosphatidylcholine ~ 50 mg/ml et 219 ~l d'une solution~de phosphatidylsérine à 10 mg/ml. Le mélange final contient environ 30 ,umoles de lipidGs. ~:
Ce mélange est vigoureusement agité au vortex. Puis on laisse le solvant s'évaporer à 40C. L'opération de séchage est compl~tée pa} Iyophilisation pendant 1 hr.
La couche lipidique déposée au forld du tube (environ 30 ~moles) est 2 o repnse par 300 S~moles d'octyl-B-glucoside. La solut;on doit être limpide.
'~
A cette préparationf on ajoute environ 50 ~g d'ARN préparé en 3A. Afin d'éliminer le détergent, ce mélange est dialys~ contre du tampon Hepes 10 mhi pH 7,05 eontenant lS0 mM NaCI et 2f7 g d'adsorbant Biobeads-SM2 (9 mg ~ d'adsorba~t/,umole de détergent). La dialyse est poursuivie sous agitation pendant'16 hr à température ambiante.
La suspension vésiculaire est ensuite ealibrée par trois extrusions successives ~ 4~C au travers de membranes dont les pores ont un diam~tre de 200 r~n; puis enfin éluée en tamp~n Hépès sur ulle colonne de Sépharose CL4B.
:
17 - .
E~k~LE~: Préparation de liposomes chargés en ARNs codant pour (i) la nucléoprotéine du v~rus de la grippe de type A et (ii) I'interleukine-2 humaine.
5 4A. Pr~paration del'ARN.
Le plasmide pTG3003 décrit en lA est partiellement digér~ par Sphl et traité à la polymérase Klenow. On religue en irlsérant u~ }inker Mlul et on s~lectiorme un plasmide ayant perdu le site SphI situ~ en 3' de la séquence 0 codarlt pour NP, a~ec remplacement par Mlul; soit le plasmlde pPMl.
D'autre part, on récup~re la séquel~e codant pour 1'1L,2, sous ~orme du fragment ~;coRI - Xbal d'un phage M13 cornmercialisé par Bntish Biotechnolo~y sous la référellce BBG3. Ce ~agment est i~éré dans pUC18 lS (Viera & Messing, Gene (1982) 19: 259) pour donner le plasmide pPM2.
Un fragment Xbal ~ HindlII comportant l'extrémit~ 3' ~on-traduite du gène de la B-globine de lapin (Kafatos et al, PNAS (1977~ 5618 est synthétisé par PCR en utilisant les amorces OPM1 et QP~. ~ :
:, :
:)PMl:
XbaI
5 ' TTTT~C~ AGCCCTGGCTCACAAATACCACTGAC 3 ' 2 5 ~ OPM2 :
HindIII MluI
5' AAAA~aGC~AC~CG~TTTTTTTTTTTTTTT~CAATGAAAATAAATTTCC 3' Ce fra~nent est inséré dans pPM~, préalablemerlt dig6ré par Xbal et 3 o Hindlll. On obtient ainsi le plasmide pPM3.
~ :.
IJn fragment d'ADN synthétique comportant la séquence codant pour le peptide signal de l'IL-2 humaine est inséré dans pPM3 préalablemen~ ~igéré :~
par Eco~I et XhoI pour dormer le plasm~de pPM4.
WO~2/19752 PCT/FR92~00393 $~
Ce fragment d'ADN synthétique est fonn6 par hybndation des oligonucléotides suivants:
.
OPM3 :
EcoRI SalI
: 5' ~T~CGCGCG~CGACATAGGCCTATCC~CC ~ TAC AGG ATG CAA
CTC GTG TCA TGC ATT GCA CTA AGT C$T GCA CTT GTC ACA AAC
AGT GCT CCT ACT AGC 3' XhoI
OPM4 :
XhoI
5' TC~SCT AGT AGG AGC ACT GTT TGT GAC AAG TGC AAG
15 ACT TAG TGC AAT GCA TGA CAC GAG TTG CAT CCT GTA CAT ~: :
GGTGGATAGGCCTATGTCGACGCGCa 3' SalI EcoRI -.
Enfin l'ensemble codant pour le précurseur de 1'IL-2 et la région 3' non-20 traduite du gène de la B-globine de lapin est récupéré ~ partir de pPM4 sous forme d'un~ fragment SalI:- Mlul pour être inséré dans pPMl pr~alablement digéré par Sall et MluI pour donner le plasn~ide pPM5.
Le plasmide pPM5 est ensuite lin6aris6 par digestion MII~I; puis transcrit ~ ~:
en utilisant un kit de transcription in vitro (Megascript de ~nbion). L'ARN ~
ainsi obtenu est cappé par adjonction dans le tampon de transcription de 10 ,ul ;:
d'une solution de m~C;(S')ppp(S')G S mM (Pharmacia; D. produit 27 4635).
., 4B. La pr~paration des liposomes est r~alis~e comme pr~c~demm~n~ décrit en 3 0 3B.
:
On utilise environ 66~g d'ARN obtenu en M / 30 ,umoles de lipides.
~; -: ~ :
;
.. :
.
.
~ ~ '' ' ' WO 92/197~2 Pcr/FRg2/oo3s3 ,S~
~k~: Troisième pr~paration de liposomes charg6s en AlRN codantpour la nucléoprot~ine du vims de la grippe de type A.
SA. Pr~par~ion d'ARN.
Le plasm~de pPM5 est dig~ré par StuI et ~paI de manière à éliminer la qua~i-totalité de la région codant pour le précurseur de l'ILr2; puis religué pour donner le plasmide pPM6.
pPM6 est ensuite lin~aris~ par digestion Mlul; puis transcrit en utilisant un kit de transcription in vitro (Megascript de Ambion3. L'ARN ainsi obtenu est cappé par adjonction dans le tampon de trarlscription de 10 ~I d'lme solution de m7G~S')ppp~5')G S mM (Pha~acia; n produit 274635).
SB. La prépar~tion de liposomes est r~81is4e comme pr~cédemment d~crit en 3B. :~
On utilise erlviron 66,ug d'ARN obtenu en SA/30 ~moles de lipides.
::
i3~k~: Préparation de liposomes char~s en ~ codant pour la protéine de fusion du virus de la rougeole.
6~t lPr~p~ration del'ARN.
25 ~ :
1~ plasrnide~ pTG2148 decnt dans la demande~ de brevet EPA 305 209 ~ :~
comporte le fragment dtADN codant pour la prot6ine de fusion (Buckland et al, ~:
J. Gen. Virol. (1987) ~: 1695). pTG2148 e~t dig~ré par HindIII et Hpal de :;
man~ère à éliminer la rég~on S' non-traduite du gène codaIlt pour la pro~eine defusio~. Celle-ci est remplac~e par la région S' non~traduite du gène de la ~- `
globine de lapin reconstruite par hybrid~tion des oligonucl~otides OPMS et 6.
On obtient ainsi le plasm~de pPM7.
~, ~
;
, .
. ', ' . :
W0~2J19~52 PCr/FR92/00393 OPM5 :
HindIII
5' A~CT~ACACTTGCTTTTGACACAACTGTGTTTACTTGCAATCCCCCAAAACAGC
CACCATGGGTCTCAAGGTGAACGTCTCTGCCATATq'CATGGC~GTACTqT~ 3' HpaI
OPM6 :
HpaI
5' ~CAGT~CTGCCATGAATATGGCAGAGACGTTCACCTTGAGACCCATGGTGG
CTGTTTTGGGGGATTGCAAGTAAACACAGTTGTGTCAAAAGCAAGTGTA 3' HindIII
D'autre part, le plasm~de pGEM4Z (Stratag~ne~ est dig~ par E~oRI, puis traité à la polymérase Klenow. On religue en insérant un linker MluI pour obtenir le plasrnide pPM8.
Enfin, la r6gion 5' non-traduite du gène de la B-globine et la séquence codant pour la protéine de fusion sont récupér~es à partir de pPM7 sous fonne d'un fragment HindIII - Sacl. Celui-ci est ins~r~ :dans pPM8 préalablernent dig~éré par ~WIII et SacI. On obtient:ainsi le plasII~ide pPM9 dans lequel la séquence sodant pour la protéine de fusion est plac6e sous le contrôle du -; promoteur T7.
; pPM9 est li~éarisé par digestion Mlul; puis ~ranscrit en utilisant un ht de eranscription in vi~no (Megascript de Ambion). L'~N: aLnsi obtenu est cappé
~ par adjonction dans le tampon de transcr~ptio4 de 10 ,ul diulle solution de ~ :
;~ m7(~(5')ppp~5')G S `rnM (Phannacia; n produit 27 1635).
,~ .
6B. La p~paration dle liposomes est r~alis~e co~e pr~e~demmealt d~r~t en ; 3B.
3 o On u~ilise environ 60 ,ug d'ARN obtenu en 6A/30 ,umoles de lipides.
~ : :
:~
., ~.
,.. ~ , ..
-~:
:, . ~, , wo 92~19752 pcr/FRg2/oo393 EXEMPI~ 7: De~L~ème préparation de liposomes char~s en ARN codantpour la protéine de fusion du vims de la rougeole.
7A. Pr~paratiorl del'AR~l.
On prépare un fragment d'ADN synthétique, de séquence (en double brin): ;
EcoR~ XbaI Mlu~ ::
5 ' ~ TCCACTl::TAGP.CAC~ 3 ' 3 ' q!C~ACTTAAGt;TGAGA~!CTGTGT~ C 5 ' extremite c:oh~sive SalI
Ce fragment d'ADN est inséré dans pPM9 préalablement digéré par SacI
et ~lul pour donner le plasn~ide pPM10 qui ne comporte plus de site Sacl.
Le fragment XbaI Mlul de pPM5 qui comporte l'extrémité 3' non-traduite du gène de la B-globine est récup~ré, puis ins~r~ dan~s pPM10 préalablement digéré par Xbal ot Mlul pour donner le plasmide ~pPMI 1. ~ :
pPM11 est ensuite linéarisé par digestion MlllI; puis transcnt en utilisant `
un kit de transcription in vitro (Megas~ipt de Ambion). :L'ARN ainsi obtenu est cappé par adjonction dans le tampon de transcription9 de 10 ,ul d'une solution : ~:
de m7G(S')ppp(5'~G 5 rnM ~Pharmacia; n produit 27~4635).
2 5 ~ 7B. La pr~paration des liposomes est r~alis~e commle prkc~demment d~crit en 3B.
On utilis- en~iron 60 /Ig d'ARN obtenu c~ 7A/30 ,umoles de iipides ' . . ~ , .. .
WO 92/lg752 PCI'/FR92/003g3 l~lEMPLE ~: Préparation de liposomes charg~s en ARNs eodarlt pour (i) la protéine de fusion du virus de la rougeole et (ii~ l'interleukine-2 humaine.
8A. Préparation dei'~RN.
L'ensemble eodant pour le préeurseur de l'IL-2 et la région 3' non-traduite du gène de la B-globine du plasmide pPM4 est récupéré sous forme d'un ~.
fragment EcoRI - MI~lI. Ce fragment est inséré dans pPM11 préalablement 0 digéré par EcoRI et Mlul pour donner le plaslT.ude pPM12.
pPM12 est ensuite linéarisé par digestion Ml~l; puis transcrit en utilisant un kit de transeription in vitro (Megascript de Am~lon). L'ARN ainsi obtenu est cappé par adjonction dans le tampon de transcription, de 10 ~LI d'une solution de m7G(5')ppp(5')G S mM (Pharmaeia; n produit 27 4635).
8B. La pr~paration de liposomes est ~alis~e comme p~c~dellnmellt d~crit en 31~. :
2 o On utilise env~ron 87 I g d'ARN obtenu e~ 8A/3û ~moles dc iipides.
: .:
XEMPI~: Induction d'une r~ponse CIL initiée par les liposomes préparés dans ies exemples 3, 4 et 5. ~ :
La réponse ~IL est mise en oeuvre et an iysée comme décrit dans l'Exemple 2, à 2 modifications près: on precise que l'on utilise 500 ~l de chacune des pr~parations liposomales obte3ues dans les exemples 3, 4 el ~ pour injecter une souris (prernière injection ainsi que rappel) et que l'on effectue les 3 o injections par voie sous-cutanée.
~ :
Certains tests sont effectués I5 jours après la première injection. ~ -D'autre part, des expénences parall~les permRtent de tester (i) i ARN
3~ mélangé à des liposomes mais non encapsulé et (ii) i'ARN pur. Dans le c~s ~i), on injecte sous un volume de 0,5 - 1 ml, 50 ~g d'ARN pr~aré en lA mél~ngé à
,, - , . .. . ..
.
WO 92~19ïS2 PCI/FR92/00393 des liposome5 vides pr~par~s selon le proc~d~ d~crit en 3EI à 19exception de l'addition d'ARN, correspondant à environ 30 ~moles de lipides. Dans le cas ~ii), on injecte 50 ~g d'ARN préparé en lA sous un volume d'environ 0,5 - 1 ml.
Les résultats sont présent~s dans le tableau li-dessous.
Injèction Effecteurs P815/- P81S P~15 P815 /cible /NP /A-Ban /B-Yam Contrôle 40 < S 71 63 < S
oositif 13 <5 52 ~6 <5 ~A-Caen) 4,4 < S 45 46 < 5 : :- :
1,5 < S 32 29 9 Contrôle 22 <5 ln 11 8 négatif 7 4S < 5 ~ 5 8 < S
o,~ ~S <5 10 <5 #l:Liposomes Ex 3 130 18 79 31 15 ~2 injections) M 8 47 21 8 : S 3 II 5 S ~;
:: :
#2:I,iposomes Ex.4 80 2 57 lS ~ 5 (1 injection) 27 3 31 16 9 0 2~ 9 0 ~o 3 0 11 S 3 #3:Liposomes Ex S 67 9 12 5 8 (1 injection) 22 4 6 0 2 ~4:Li~osomes 140 I S S S
~/PC/PS ~7 1 2 3 ~ARN Ex.lA 16 1 1 2 1 (2 injections) 5 1 0 1 0 ~S:ARN Ex.lA 140 0 2 3 2 (2 injections~ 47 0 2 6 5 ~6 1 2 1 3 S 2 0 ~ ~
WO 92/19752 PC~'/FR92/û0393 ~5~ 0 Ces résultats montrent en particulier que:
- l'ARN seul est inefficace pour induire une r,~ponse ~mmun~taire;
- l'ARN m~lang~ à des liposomes mais non encapsulé est inef~lcace pour induireuneréponse immunitaire;
- l'AI2N codant pour NP seul, encapsulé dar~ des liposomes, est capable d'induire une réponse immur~itaire seulement après rappel (comparaison tests #let3);et - l'ARN codant pour NP et IL-2, encapsulé dans des liposomes est capable 0 d'induire une réponse irnmunitaire apr~s une seule inJection (comparaison tes~s # 2et3).
E~ IPI,E 10: Irnmun~sation des souris ~ I'encontre du v~rus de la rougeole en utilisant les liposomes préparés dans les exemples 6, 7 et 8.
.
Le modèle animal qui est m~s en oeuvre est substa;lltiellement tel que décrit dans Drillien et al, PNAS (1988) ~: 1252.
2 o On consti~ue S lots de 8 souris BAl~/c Un lot est résené au contrôle positif. ~es souris reçoivent 4 x 107 u ~tés -formant plages du virus de la vaccine VVTGFM1173 par voie intra-péritonéale en une seule injection. YVTGFM1173 contient le gène de la proteine de fusion , du virus de la rougeole. Il a été décrit comme un agent ir~nunogène a~if (Drillien et al, supra~.
:
Un lot est r~servé au contr61e négatif. Ces souris reçoivent par voie sous-cutanée, environ 30 moles de lipides s~us forme de liposomes vides préparés selon le procédé décrit en 3B (~ l'exception de l'addition d'ARN) en première injection et en rappel 15 jours après.
Les 3 a~tres lots sont réservés aux tests. Les souris reçoivent par voie sous-cutanée une première injection et un rappel lS jours après. La première injection et le rappel corresponden~ cha~n à environ 0,4 -~ 0,6 ml des préparations llposomales des exemples 6, 7 et 8.
~ , .
,: ~
.
WO 92/19752 Pcr~FR92/00393 Environ 15 jours apr~s le rappel, les souns sont test6es par injection intracérébrale de 50 I d'une suspension ~ 10 % de cellulcs dc cerveau de sounceaux nouveau-n~s pr~alableme~t in~ect~s par l'isolat SSPE du vin~s de la rougeole (Wild et al, J. Med. V~rol. (1979) 4: 1~).
Ce test indique que les liposomes des exemples 6, 7 et 8 ont une action immuno~ène similaire à celle du VVTÇFM1173.
,; :~
:
.
:.
, , ~ . . . .
. ' . -: 3 o disappointing.
It is thought that a factor limiting both the success of the subunit vines is in the fact that they are not capable of inducing an irnrnuni response ~ area of sufficient rellular type. This is usually due to The impossibility for certain antigens to be correctly processed and ~ or for , .
, . ~.
~, , '' , wo 92 / l9 ~ 5 ~ PCI / FRg2 / 00393 $ ~
their fragments, to come into contact with the molecules of the major complex Class I Histocompatibility (MHC) Indeed, the association between MHC class I molecules (which participate in the cell-type immune response) and the fragments Peptides take place in the endoplasmic reticulum of the cell. For this, it is necessary donations, beforehand, that the panian antigen even in this compartment cellular. In general, entry into this com ~ artiment is from cytosol where proteins are synth ~ tis ~ es by traductio ~ messenger RNA
correspondents. The passage from the cytosol to the endoplasmic reticulum takes place thanks to dew ~ ~ pes mechanisms:
- either a secretior mechanism ~ when the protein is synthesized in the form of a precursor (rnis in play with a signal peptide), - either a peptide "pump" mechanism.
The types of vacciILs known until now absolutely do not allow master this important data which is the association of MHC molecules Class I and peptide fragments. Most often ~ the elements -infectious (bacteria, viruses, parasites or antigens) are e ~ and absorbed by phagocytic cells according to the endocytosis mechanism (or phagoc ~ nose). The endocytosis vesicles fuse with Iysosomes whose contents ~: enzymatic ensures the degradation of the phagogrté material. These vesicles ~: 25, endocytic and Iysosomal cells form a distinct whole of the reticulum endopl ~ smique and ~ are not in contact with this den ~ ier.
Consequently, even if an antigen is capable of inducing production neutralizing antibodies against him, it is absolutely not impossible that he should be ~:
ultimately prove effective for the implementation of an under-unit.
We have now found some surprising things that the synthesis of a year ~ igene could be performed directly dan ~ s cells presen ~ a ~ rices antigens of the individual to be immunized, when the RNA coding for this antigen was adn ~ registered in appropriate form eg, under ~ rme of composilion ~.
'~'; ~ '' ~.:
WO 92/19752 PCI` / FR92 / 00393 liposomal. The fate of the RNA thus injected was indeed highly uncertain given its very short half-life. Furthermore, it was absolutely not obvious that the RNA is correctly delivered in the cytosol and that it is not charged by the cellular machinery ensuring the process of translation.
This new mode of vaccination clearly favors the association of MHC class I molecules with ~ ragmen ~. peptides from digestion of the antigen since it has been ~ shown that the indi ~ idu thus treated is capable of to develop an immune response involving T lymphocytes 0 cytotoxic (CIL).
Consequently, the invention proposes:
(i) An RNA delivery vector which comprises a liposome and at least.
an RNA fragment coding for an antigenic destructant characteristic of a tumor or a pathogenic agent, said at least one RNA fragment being encapsulated in said liposome;
(ii) a pharmaceutical composition intended for the treatment of a patient or a disease caused by a pathogenic agent for preventive purposes or curative, which includes as a therapeutic agent a vector of delivery of RNA according to the invention;
- ~ iii) The use of an RNA delivery vector according to the invention to treat 2 5 ~ preventively or curatively, a tumor or a disease induced by a pathogenic ageht;
:.
~ iv ~ The use of an RNA delivery vector according to the invention, for the preparation of a drug intended for preventive or curative treatment 3 o a tumor or a disease induced by a pathogenic agent;
:.
(v) A method of curative or preventive treatment of a tumor or disease caused by a pathogen that includes the act of admitting a sufficient amount of an RNA delivery vector according to the invention, ~
3 5 to a patient in need of such treatment.
, . , :
WO 92/19 ~ 52 PCll / FR92 / 00393 A fragment of RNA useful for the purposes of the present invention is by ligature a non-infectious RNA fragment ~ exclusively of the rnessager type; that is to say capable of being directly translated into proteim ~ by the cellular machinery without having to be first replicated or transcribed into DNA. By definition, it does not does not contain the elements which would allow it to replicate inside of a cell. Likewise, it does not contain the genetic information necessary to the reconstitution of a pathogenic agent (eg, a bacterium, a virust or a parasite) substantially complete.
0 By "determinant ~ ntig ~ nique", we enter any peptide comprising at least one epitope characteristic of a tumor antiBene or of a pathogen. This antigen determinant ~ that can therefore be Itantigen complete native, a precursor or analog thereof, a fragment of The native antigen or an analogue of this fragment. By "analog" is meant a molecule having an arn ~ n ~ s acid sequence significantly different from that native mole ule eg, whose amino acid sequence has a degree of homology of at least about 80%, preferably at least 90%, of so very weak ~ pref ~ rée at least 95 ~ oa ~ rec the sequence of the molecule native. ~ `
~
In general, the detem ~ inant antigér ~ ique can be ~ -characteristic of any type of tumor or any agent -`
pathogenic.
25, In order to illustrate the above, we rite by way of example:
., ~.
- The nucleocapsid protein (nucleoprotein or NP) of the influenza virus type A affecting humans as defined by the mRNA sequence which corresponds to him. This sequence was published in Huddleston Brownlee, Nucl. Ac. Res. (1982) 1Q (3): 1029.
,::
- The fusion protein ~ F) of the measles virus ~. .
- A peptide comprising the epitope of sequence: ~ hr-Tyr-Glu-Arg-Thr Arg-~ la-Leu-Val-Arg. This epitope is characteristic of the nucleoprotein of influenza A virus.
::
: ~:
wo 92 ~ 197 $ 2 PCr / FR92 / 0û393 ~ 3 ~. ~ 'Fi ~
- A peptide comprising the sequence: Thr-Tyr-GIIl-Arg-Thr-Arg-Ala-Leu-Val-l ~ r.
- The H23-ETA tumor antigen associated with breast cancer in humans, as described in Wreschner et al, J. Biochern. (1990) 1 ~ 2: 463.
- A peptide comprising the major epitope of the H23-ETA antigen, having the sequence: Pro-Gly-Ser-Thr-Ala-Pr ~ X-AI2-His-Gly-Val ~ Ser-Ala-Pro-0 Asp-Y-Arg Pro-X in which X is Pro or Ala and Y is Thr seen Asn.
A vector of RNA deliverer according to the invendon can contain different RNA fragments; each of these fragments coding for a determinant particular non-native. By e ~ ernple, a vector of RNA delivery according to 5 the invention intended for the preventive treatment of influenza may contain ~ r both:
- A fragment of RNA coding for the nucleoprotein of influenza viruses type A and an RNA fragment encoding the virus nucleoprotein type B flu or - A fragment of ~ N codallt for the nucleoprot ~ ine of influenza viruses type A and one or more f ~ a ~ ent (s) of RNA, each of ~ es den ~ iers coding for hemaglutil ~ ne of a particular strain of the virLs of the flu ~
For the purposes of the present invention, an RNA fragment can be obtained from conventional manner eg, by chemical synthesis or by in vitro transcription of the corresponding DNA fragment.
:
3 ~ By "liposome" is meant a vesicle essentially formed of a membrane consisting of double layer lipids. Such a vesicle can present one or more membrane strata. In the first case, we speak of a unilamellar vesicle while in the delLxth case it is a oligo- or plurilamellar vesicle. In typical maDièrç, the membrane of 35 liposomes is made up of amphiphylic lipids such as phospholipids, in association or not with other lipid constituents. Phospholipids :: ~. ,.
WO 9 ~ / 19752 PCTiFR92 / 00393 ; ~ $ 'r. ~
suitable are, for example, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipicles, cardiolipin, phosphatidylinositol, phosphatidic acid and phosphatidylglycerol. I:) e plus, we can also plan to use synthetic phospholipids derived or nvn 5 of the above-mentioned phospholipids, for example, containing various groups such as hydroxyl groups9 imidæoles, amine, arn ~ des, sulphydryles, etc.
Preferably, other lipids such as steroids, cholestetol, 10 alipbatic amines, can be mixed ~ s phospholipids. Such lipids are in particular useful as stabilizing or antioxidant agents.
AILY ~ ins of the present invention, a first lipid mixture advantageelLx consists of phosphatidylcholine ~ PC) and cholesterol (CH) in 5 variable proportion. It is however indicated that proportional PC: CH
satisfactory are of the order (in terms of share) from 5: 1 to S: 5. Such a mixture equal share is particularly suitable. A second ~ mixed advantage ~ is consisting of phosphatidylcholine, cholest ~ rol and phosphatidylserine (PS) in variable proportion, for example CH / PC / PS e ~ 5: 4: 1 proportion.
the preparation of the liposomes as well as the packaging of the RNA can be rnises implemented salt ~ techniques designed. In particular, terhnics DNA packaging which are commonly used, are applicable in the present case.
25, In addition, the membrane can also contain various inserted proteins.
in the membrane, at ~ supplied by lia ~ its covalent to an l; pide of the membrane, directly or indirectly via a liaison officer, or simply by interaction with a phospholipid. When a protein is linked by bond 30 covalent to a lipid, the latter is pref ~ re ~ this a lipid having a amine foaction such as, for example, phosphatidylethanolamine Advantageously, these proteins can be used as targeting agerlt.
liposomes on a particular class of cells. These are, for example, msnoclonaul ~ antibodies or lymphokines.
: ~:,. , :,.:. :, :::
wo 92/197 ~ 2 PCr / FRg2 / ~ 0393 ~ $ i ~: 9 ~
AIL ~ for the purposes of the present invention, the fragment (s) of soda RNA
for an antigenic determinant ~ that a tumor or pathogen is (are) advantageously accompanied by an RNA fragment coding for a interleukin-1, an RNA fragment coding for an interleukin ^ 4 or a 5 RNA fragment encoding an interleukin-2; ~ e last being everything particularly preferred.
In accordance with the aims of the present invention, it must be understood that an RNA fragment coding for an ant determinant; gen ~ that or where an interleukin comprises, in addition to the coding sequence, all the elements nPcéssaires the translation of this den ~ ière.
When different fragments of ~ N compose a vector or a pharmaceutical composition according to the invention, these can be 5 by ~ iellement or totally linked to each other, so ~ form at minus a polycistronic RNA fragment.
Er ~ in, Ime pharmaceutical composition according to the invltion can be made ~ uée conventionally. In particular we associate the agent (s) 2 o therapeutic according to the invention with a diluent or ~ suppo ~ t aceeptable a pharmaceutical point of view. A composition ~ depending on the dimension can be administered by any of the alternative routes used in the field of vaccines, by ~ iculler by subcutaneous route, by intra-muscle or intravenously, for example as a suspension 25 ~ injectable. 0 ~ indicates that the sOus-cueanée way is particuli ~ remen ~ bien suitable for ~ ~ administration of urle composition according to the invention.
The administration can take place in single or repeated dose one or more times after a certain interval of interval. The appropriate dosage varies depending on various parameters, for example, of the individual treated or the mode 3 0 adrni ~ istration.
.
The invention is illustrated below with reference to the following alLx ~ Igures:
Figure 1 shows the plasmid p ~ EM-3Z.
.
.
WO 92/19752 PCr / FR9 ~ 2/00393 r ~ LO
gure 2 schematizes the inserts of the plasmids pTG3003 (base pGEM-3Z), pPM2 (base pUC18 ~, pPM3 (base pUC18), pPM4 (base pUC18), pPM5 (base pGEM-3Z) e ~ pPM6 (base pGEM-3Z ~. NP ~ nucleoproté ~ ne; IL-2 =
interleukin-2; S. signal = signal sequence of the precursor of I ~ 2; 3 ~ NTRsG
5 = 3 'untranslated end of the rabbit B-globin gene.
~ '' gure 3 shows diagrams of the plas ~ ides pPM9, pPM10, pPM11 and pPM12 (chaclm based on pGEM ~ 7). S'MTRBG = 5 'untranslated end of gene of ~ rabbit globin.
~.
.. ..
. ' .
~, . ~ ~
: ':
~ `
,::
"
..:
~ '''~.
. . . . ~. :
.. ..
... .
WO 92tl97S2 PCl` / FR92 / 00393 , LQ
~: Preparation of liposomes loaded with RNA eoding for the influenza virus type nucleoprotein The Preparation of RNA.
An EcoRI - SalI fragment comprising the cDNA coding for the nüleoprotein of influenza A virus type A, strain A / NT / 6û / 68 (Huddleston ~ Br ~ wnlee, Nucl. Ac. Res. (1982) lQ (3): 1029) is obtained by digestion of the plasmid p ~ 8 ~ Jones & Brownlee, Gene ~ 198S ~ ~: 333).
This EcoRI - SGII fragITIent is inserted in the plasn ~ ide pGEM-3i ~ ~ Promega Corp; ~ igure 1) digested with EcoRl and SalI in order to place the coding cDNA
for the nucleoprotein under the control of a promoter recognized by the RNA
phage 17 polymerase. Plasmid pTG3003 is thus obtained.
The plasmid pTG3 ~ 3 is then linearized by digestion with SalI; then transc using a transcription kit in vib ~ (Stratag ~ ne; re catalog200 341 ~ according to the instructions of the supplier. I, the RNA thus obtained is capped paradjunction in the transcription ta npon of $ 10 ~ 1 of a solution of m7G (5 ') ppp (5') G 5 mM (Pharmacia; n product 27 ~ 635).
. .
lB. Pr ~ pal ~ tio ~ has liposomes.
C) n prepares a solution of cholesterol in dissolva ~ t the powdered product 25 ~ (Sigma) in chloroform at a rate of 100 mg / ml. Then in a Corex tube 30 rnI ~ on m ~ larlge 58 1 ~ l of cholest solution ~ rol and 110 ~ 1 of a solution phosphatidylcholine 100 mg / rnl (Sigma). The Snal mixture contains approximately 30 ~ moles of lipids.
3v This mixture is vigorously agitated with the vonex. Then the soivants are allowed to evaporate at 40 ~ C. The drying operation is completed by freeze drying for about 1 hr.
The lipid layer deposited at the bottom of the tube is taken up in 1 ml ~ of water.
The mixture is homogenized with a vortex and soni ~ ue at the ~ minimum equency ~ the using a Labsonic L sonicator from E ~ raun. The operation ends up hanging 10 ... ..
:. .
~ 3 $ S ~ @ 3 min. by intermittent passages of lS seconds, spaced by 3û seconds of rest in the cold.
I A suspension thus obtained is centnfugée at 16 ~ 00 rpm, at 4C for 15 5 min. to sediment titanium particles and larger vesicles (Biofuge / Heraeus in eppendorff3 tube. Then the supernatant containing a majority of unilamellar vesicles having a diameter of approximately 50 microns, is collected in 15 ml Corex tubes.
0 To the vesicular suspension obtained ~ ue in B), 135 ~ 1 of the RNA preparation obtained in A); or 40 ~ g of RNA approximately. The mixture is gently immersed in liquid nitrogen, rolling the tube between his fingers kept vertical. When the mixture is completely frozen, it is Iyophilize overnight.
The lyophilisate is gradually rehydrated in 100 μl of distilled water.
Then 0.9 ml of Hepes buffer pH 7.05 is added dropwise.
composition ~ aCI 140 mM, KCI S mM, Na2HPO4 2 ~ 2O Q75 mM, Hepes 25 mM. The vesicular suspension is then calibrated by successive extrusions at through a first and second ~ lltre whose pores have respectively a diameter of 40ûnm and 2ûOnm. I ~ suspension thus obtained contains a majority of vesi ~ the oligolamellars which have encapsulated the RNA.
, ~:
In order to substantially eliminate non-encapsulated RNA, the 25, suspension is placed on a column of Sepharose 4B (10 ml; column of; section 1 cm) pre-balanced in Hepes buffer. Elution is continued in Hepes stamp. Eluted fractions of white appearance which contain the vesicles are collected together; this corresponds to a volume of around 2 rnl.
.
, .
.
wo 92/1 97s2 PCT / FR92 / 003s3 EXEMP ~ 2: Induction of a CI'3L response in ~ ti ~ e by liposomes loaded with RNA encoding the nucleoprotein of the virus flu type ~
Three series of BALB / c mice corresponding respectively (i) to the test, (ii) positive control and (iii) negative control are prepared as follows:
(i) Test the souns receive intravenously 200 μl of the preparation of liposomes obtained in Example 1.
(ii) Positive control: the mice receive via intra-p6Atongale 130 a ~ temhemaglutinants of the influenza virus type A, strain Caen (A-Caen).
The different type A strains sometimes differ from each other for some proteins like hemaglutil ~ ine or neuraminidase but never for nucleoprotein. However, there are variations in relates to nuclenprotein between ViA ~ us type A and B.
~ iii) Negative control if: the mice receive intravenously 200 ~ I of preparation of liposomes prepared as in Example 1, the addition 2 o of RNA ~ y being 6 ommise.
15 days later, the mice of (i) and (iii) receive an injection identical to ; ~ the first and in the same corlditlons.
25 ~ 15 days after the second injection, the mouse spleen is removed and dilated. ~ Red cells are eliminated by shock OSn ~ AOdqUe. Then the cells spleen are born in its culture in plates ~ pots ~ reason of 5106 cells / wells in a volume of 2 ml in DMEM culture medium (Gibco) supplemented with 10 5 ~ o of fetal calf serum, 2 mM L, glutamine, S0 ~ M
3 o B-mercaptoethanol, 10 mM Hepes, 1 mM sodium pyruvate. 10 units / ml of penicillin, 10 ~ g / ml of strep ~ ornyci ~ e, 2.5 ~ g / ml of arphotericin and non-essential amino acids (Flow labs).
This medium also contains 5 ~ M of peptide NP 147-lSBR- of formula:
Thr-Tyr- & lu-A ~ rg-Thr-Arg-Ala-Leu-Val-Thr-Gly. This peptide corresponds to a epitope systematically recognized by Cl1, BALB / c mice when they : ' ~, :. . . .
WO 92/19752 PCl / FR92JO393 ; ~? l ~ ~ S ~
are immunized with influenza A virus (Bodmer et al, Cell (1988) 52: 253).
The culture is continued at 37C in an atmosphere at 7% CO2 At the end 5 of 7 days, the imtial culture medium is replaced by fresh n ~ ilieu. In each well, additionally 5,106 cells of the spleen of BALB / c mice not subm ~ its to imrnun ~ sation, these cells having been C ~ irradiated by 4000 Rad of gamma radiation.
0 On the 12th day of culture, the activity of ~ L is detected by the test classic release of SICr notably described by M ~ rtinoIl et al, J.
Immunol. (1989) l ~: 34B9. Details are given as follows to 10x106 mast cell cells of mouse DBA / 2 (H-2d) histocompatible with BALB / c mice (P815 cells), in the middle of DMEM, are inc lbées in the presence of 100 ~ Ci of Na ~ S ~ rO4 (CEA, ~ rance) for 1 hr at 37C. The cells are washed twice, then taken up: in miliell DMEM.
The operation is repeated using P815 cells infected with vims type A influenza, strain Bangkok (P815 / A-Ban) or by the virus influenza type B Yamagata strain: (P815 / B-Yam) The ir ~ ctio ~ of P8 cells: 15 is carried out beforehand ~ con ~ follows me: 106 cells da ~ s û, S ml of rnilieu DMEP ~
are infected with 100 haemaglutina units ~ your virus. After ~ 0 n ~ in at 37C, the cells are washed ~ es in 2Q ml of DMEM medium compléme ~ tee with 10%
25 ~ SVF to stop the infection. The expression of the virus's pro ~ é ~ nes is continued 3 hr at 37C until the cells are used in the cytolysis test.
P81 ~ cells (target cells) are then distributed in the wells of a microtiter plate at the rate of 3000 cells per pllit. In I s three 30 cases (i), (ii) and (iii), spleen cells (efector cells), in the middle DMEM, are added in each well of mani ~: to coDstitute series forming a range of effector / target cell ratios included between 100/1 and 0.3 / 1 approximately. The peptide NP 147-158R- is finally added to the final concentration of 2.5 ~ M. In each well, the final volume is 3s of 200 ~ 1.
, . ::: '~. : ,, ~
WO 9tt19752 P ~ JFR92 / 00393 z; ~ r ~ o The plate is then inoculated for 4 hr ~ 37C and then centrifuged. I:) years each well, we take 100 ~ I of supernatant. I ~ radioactivity of each sample is measured and the results are expressed in the table below, in percentage of chromium release due to CIL activity:
(observed release - spontaneous release: born):
(total amount of incorporated ehrome - spontaneous release ~:
`.
P815 / - P815 P815: Pgl5 / targets / NP IA-Ban / ~ s-Yam Control 40 <5 71 63 <5 po ~ itif 13 <5 5 ~ 46 <5 (A-Caen) 4.4 <5 45 46 <5 : ~ 20 1.5 ~ 5 32 29 9 Control <5 10 11 8;:
`~ negative 7.4 cS <5 7 <5 : 2.5 ~ 5 ~ 5 8 ~ 5 25. 0.8 ~ 5 ~ 10 <5 , Test ~ 2 ~ 10 53 50 10 7.4 <5 39 2 ~ 5 ~, 5 <5 18 20 5 0.8 ~ 5 ~ 5 12 <5 ~,. "
~ '~
. -.
'' .: ~ :; . '",' WO 92/197 ~ 2 P ~ / FRg2 / 00393 5 2.
k ~ L ~: Second preparation of liposomes loaded with RNA encoding for the nucleoprotein of type A gnppe virus.
3A. The RNA is obtained as previously from crlt in lA.
3B. Preparation of liposomes.
A solution of cbolesterol is prepared by dissolving the powdered product in chloroform at a rate of 100 mg / ml. Then, in a ~ 30 ml Corex tube, 0 is mixed ~ 8 ~ LI of the cholest solution ~ rol, 176 ~ LI of a solution of dipalm ~ toyl phosphatidylcholine ~ 50 mg / ml and 219 ~ l of a solution ~ of phosphatidylserine 10 mg / ml. The final mixture contains about 30, umoles of lipidGs. ~:
This mixture is vigorously stirred with a vortex. Then let the solvent evaporate at 40C. The drying operation is completed by drying.
for 1 hr.
The lipid layer deposited in the forld of the tube (about 30 ~ moles) is 2 o repnse with 300 S ~ moles of octyl-B-glucoside. Solut; you have to be crystal clear.
'~
To this preparation is added approximately 50 ~ g of RNA prepared in 3A. To to remove the detergent, this mixture is dialys ~ against Hepes 10 mhi buffer pH 7.05 containing lS0 mM NaCl and 2f7 g of Biobeads-SM2 adsorbent (9 mg ~ adsorba ~ t /, umole of detergent). Dialysis is continued with agitation for 16 hr at room temperature.
The vesicular suspension is then released by three extrusions successive ~ 4 ~ C through membranes whose pores have a diameter of 200 r ~ n; then finally eluted in tamp ~ n Hepes on a Sepharose column CL4B.
:
17 -.
E ~ k ~ LE ~: Preparation of liposomes loaded with RNAs coding for (i) the influenza A type nucleoprotein and (ii) Human interleukin-2.
5 4A. Preparation of RNA.
The plasmid pTG3003 described in lA is partially digested with Sphl and treated with Klenow polymerase. We religion by irculating u ~} inker Mlul and we selectively a plasmid having lost the SphI site located at 3 'of the sequence 0 codarlt for NP, a ~ ec replacement by Mlul; or the plasmid pPMl.
On the other hand, we recover the aftereffect coding for 1'1L, 2, under ~ elm of fragment ~; coRI - Xbal of a phage M13 marketed by Bntish Biotechnolo ~ y under the reference BBG3. This ~ agment is i ~ ered in pUC18 lS (Viera & Messing, Gene (1982) 19: 259) to give the plasmid pPM2.
A fragment Xbal ~ HindlII comprising the extremity ~ 3 '~ has been translated from rabbit B-globin gene (Kafatos et al, PNAS (1977 ~ 5618 is synthesized by PCR using the primers OPM1 and QP ~. ~:
:,:
:) PMl:
XbaI
5 'TTTT ~ C ~ AGCCCTGGCTCACAAATACCACTGAC 3' 2 5 ~ OPM2:
HindIII MluI
5 'AAAA ~ aGC ~ AC ~ CG ~ TTTTTTTTTTTTTTT ~ CAATGAAAATAAATTTCC 3' This fra ~ nent is inserted in pPM ~, priorablemerlt dig6ré by Xbal and 3 o Hindlll. The plasmid pPM3 is thus obtained.
~:.
IJn synthetic DNA fragment comprising the sequence coding for signal peptide of human IL-2 is inserted into pPM3 beforehand ~ ~ igerated: ~
by Eco ~ I and XhoI to sleep the plasm ~ of pPM4.
WO ~ 2/19752 PCT / FR92 ~ 00393 $ ~
This synthetic DNA fragment is formed by hybridization of following oligonucleotides:
.
OPM3:
EcoRI SalI
: 5 '~ T ~ CGCGCG ~ CGACATAGGCCTATCC ~ CC ~ TAC AGG ATG CAA
CTC GTG TCA TGC ATT GCA CTA AGT C $ T GCA CTT GTC ACA AAC
AGT GCT CCT ACT AGC 3 ' XhoI
OPM4:
XhoI
5 'TC ~ SCT AGT AGG AGC ACT GTT TGT GAC AAG TGC AAG
15 ACT TAG TGC AAT GCA TGA CAC GAG TTG CAT CCT GTA CAT ~::
GGTGGATAGGCCTATGTCGACGCGCa 3 ' SalI EcoRI -.
Finally, the assembly coding for the precursor of IL-2 and the 3 'non-region 20 translated rabbit B-globin gene is recovered from pPM4 under form of a ~ SalI fragment: - Mlul to be inserted into pPMl beforehand digested by Sall and MluI to give the plasn ~ ide pPM5.
The plasmid pPM5 is then linearized by digestion MII ~ I; then transcribed ~ ~:
using an in vitro transcription kit (Megascript from ~ nbion). RNA ~
thus obtained is capped by adding to the transcription buffer of 10 ul:
of a solution of m ~ C; (S ') ppp (S') GS mM (Pharmacia; D. product 27 4635).
., 4B. The preparation of the liposomes is carried out as pr ~ c ~ demm ~ n ~ described in 3 0 3B.
:
About 66 ~ g of RNA obtained in M / 30, umoles of lipids are used.
~; -: ~:
;
..:
.
.
~ ~ '''' WO 92/197 ~ 2 Pcr / FRg2 / oo3s3 , S ~
~ k ~: Third preparation of liposomes loaded with AlRN coding for the nucleoprotope of influenza A virus.
HER. Pr ~ per ~ RNA ion.
The plasmid of pPM5 is dig ~ re by StuI and ~ paI so as to eliminate the qua ~ i-all of the region coding for the precursor of ILr2; then religious for give the plasmid pPM6.
pPM6 is then lin ~ aris ~ by digestion Mlul; then transcribed using an in vitro transcription kit (Megascript from Ambion3. The RNA thus obtained is cappé by adding in the trarlscription buffer 10 ~ I of lme solution of m7G ~ S ') ppp ~ 5') GS mM (Pha ~ acia; n product 274635).
SB. The preparation of liposomes is r ~ 81is4e as previously described in 3B. : ~
Erlviron 66, ug of RNA obtained in SA / 30 ~ moles of lipids are used.
::
i3 ~ k ~: Preparation of char liposomes by coding for measles virus fusion protein.
6 ~ t lPr ~ p ~ ration of RNA.
25 ~:
1 ~ plasrnide ~ pTG2148 decnt in the application ~ of patent EPA 305 209 ~: ~
contains the DNA fragment coding for the fusion protein (Buckland et al, ~:
J. Gen. Virol. (1987) ~: 1695). pTG2148 e ~ t dig ~ ré by HindIII and Hpal from:;
man ~ era to eliminate the reg ~ on S 'untranslated codaIlt gene for pro ~ eine defusio ~. This is replaced by the untranslated region S 'of the gene for ~ - `
rabbit globin reconstructed by hybridization of oligonucleotides otides OPMS and 6.
The plasm ~ of pPM7 is thus obtained.
~, ~
;
, .
. ','. :
W0 ~ 2J19 ~ 52 PCr / FR92 / 00393 OPM5:
HindIII
5 'A ~ CT ~ ACACTTGCTTTTGACACAACTGTGTTTACTTGCAATCCCCCAAAACAGC
CACCATGGGTCTCAAGGTGAACGTCTCTGCCATATq'CATGGC ~ GTACTqT ~ 3 ' HpaI
OPM6:
HpaI
5 '~ CAGT ~ CTGCCATGAATATGGCAGAGACGTTCACCTTGAGACCCATGGTGG
CTGTTTTGGGGGATTGCAAGTAAACACAGTTGTGTCAAAAGCAAGTGTA 3 ' HindIII
On the other hand, the plasmid ~ of pGEM4Z (Stratag ~ ne ~ is dig ~ by E ~ oRI, then treated with Klenow polymerase. We religion by inserting a MluI linker for get the plasrnide pPM8.
Finally, the 5 'untranslated region of the B-globin gene and the sequence coding for the fusion protein are recovered ~ es from pPM7 in the form of a HindIII - Sacl fragment. This is ins ~ r ~: in pPM8 beforehand dig ~ ered by ~ WIII and SacI. We obtain: thus the plasII ~ ide pPM9 in which the soding sequence for the fusion protein is placed under the control of the -; T7 promoter.
; pPM9 is li ~ erected by digestion Mlul; then ~ transcribe using a ht of eranscription in vi ~ no (Megascript de Ambion). The ~ N: aLnsi obtained is capped ~ by adding to the transcr buffer ~ ptio4 of 10, ul diulle solution of ~:
; ~ m7 (~ (5 ') ppp ~ 5') GS `rnM (Phannacia; n product 27 1635).
, ~.
6B. The preparation of the liposomes is carried out by means of a demmealt in ; 3B.
3 o We ~ ~ ilise about 60, ug of RNA obtained in 6A / 30, umoles of lipids.
~::
: ~
., ~.
, .. ~, ..
-~:
:,. ~, , wo 92 ~ 19752 pcr / FRg2 / oo393 EXEMPI ~ 7: De ~ L ~ th preparation of liposomes char ~ s in RNA coding for the fusion protein of the measles virus.
7A. Preparation of AR ~ l.
A synthetic DNA fragment, of sequence (in duplicate) is prepared strand): ;
EcoR ~ XbaI Mlu ~ ::
5 '~ TCCACTl :: TAGP.CAC ~ 3' 3 'q! C ~ ACTTAAGt; TGAGA ~! CTGTGT ~ C 5' end c: oh ~ sive SalI
This DNA fragment is inserted into pPM9 previously digested with SacI
and ~ lul to give the plasn ~ ide pPM10 which no longer has a Sacl site.
The XbaI Mlul fragment of pPM5 which comprises the 3 'non-terminus translated from the B-globin gene is recovered ~ re, then ins ~ r ~ dan ~ s pPM10 previously digested with Xbal ot Mlul to give the plasmid ~ pPMI 1. ~:
pPM11 is then linearized by MlllI digestion; then transcnt using `
an in vitro transcription kit (Megas ~ ipt from Ambion). : The RNA thus obtained is cappé by adding to the transcription buffer 9 of 10 μl of a solution: ~:
m7G (S ') ppp (5' ~ G 5 rnM ~ Pharmacia; n product 27 ~ 4635).
2 5 ~ 7B. The preparation of the liposomes is carried out as previously described in 3B.
We use ~ iron 60 / Ig of RNA obtained c ~ 7A / 30, umoles of iipids '' . . ~, ...
WO 92 / lg752 PCI '/ FR92 / 003g3 I ~ SAMPLE: Preparation of liposomes loaded with eodarlt RNAs for (i) measles virus fusion protein and (ii ~ interleukin-2 human.
8A. Preparation of ~ RN.
The whole eodant for the pre-precursor of IL-2 and the 3 'region not translated of the B-globin gene from the plasmid pPM4 is recovered in the form of a ~.
EcoRI - MI ~ III fragment. This fragment is inserted in pPM11 beforehand 0 digested with EcoRI and Mlul to give the plaslT.ude pPM12.
pPM12 is then linearized by digestion Ml ~ l; then transcribed using an in vitro transeription kit (Megascript from Am ~ lon). The RNA thus obtained is cappé by adding 10 ~ LI of a solution to the transcription buffer m7G (5 ') ppp (5') GS mM (Pharmaeia; n product 27 4635).
8B. The preparation of liposomes is carried out as a dellnmellt described in 31 ~. :
2 o We use approx ~ ron 87 I g of RNA obtained e ~ 8A / 3û ~ moles dc iipides.
:.:
XEMPI ~: Induction of a CIL response initiated by the prepared liposomes in examples 3, 4 and 5. ~:
The response ~ IL is implemented and analyzed as described in Example 2, with 2 modifications: we specify that we use 500 ~ l of each of the liposomal preparations obtained in Examples 3 and 4 for inject a mouse (first injection as well as booster) and perform the 3 o subcutaneous injections.
~:
Some tests are carried out 15 days after the first injection. ~ -On the other hand, parallel experiences allow them to test (i) i RNA
3 ~ mixed with liposomes but not encapsulated and (ii) pure RNA. In c ~ s ~ i), is injected in a volume of 0.5 - 1 ml, 50 ~ g of RNA pr ~ ar in lA mel ~ ngé to ,, -,. ... ..
.
WO 92 ~ 19ïS2 PCI / FR92 / 00393 empty liposome5 pr ~ by ~ s according to the process described in 3EI except 19 the addition of RNA, corresponding to approximately 30 moles of lipids. In the case ~ ii), 50 ~ g of RNA prepared in lA are injected in a volume of approximately 0.5 - 1 ml.
The results are presented in the table below.
Injector Effectors P815 / - P81S P ~ 15 P815 / target / NP / A-Ban / B-Yam Control 40 <S 71 63 <S
positive 13 <5 52 ~ 6 <5 ~ A-Caen) 4.4 <S 45 46 <5:: -:
1.5 <S 32 29 9 Control 22 <5 ln 11 8 negative 7 4S <5 ~ 5 8 <S
o, ~ ~ S <5 10 <5 #l: Liposomes Ex 3 130 18 79 31 15 ~ 2 injections) M 8 47 21 8 : S 3 II 5 S ~;
:::
# 2: I, iposomes Ex. 4 80 2 57 lS ~ 5 (1 injection) 27 3 31 16 9 0 2 ~ 9 0 ~ o 3 0 11 S 3 # 3: Liposomes Ex S 67 9 12 5 8 (1 injection) 22 4 6 0 2 ~ 4: Li ~ osomes 140 ISSS
~ / PC / PS ~ 7 1 2 3 ~ RNA Ex.lA 16 1 1 2 1 (2 injections) 5 1 0 1 0 ~ S: RNA Ex.lA 140 0 2 3 2 (2 injections ~ 47 0 2 6 5 ~ 6 1 2 1 3 S 2 0 ~ ~
WO 92/19752 PC ~ '/ FR92 / û0393 ~ 5 ~ 0 These results show in particular that:
- RNA alone is ineffective in inducing a r ~ ~ response ~ mmun ~ taire;
- RNA m ~ lang ~ to liposomes but not encapsulated is ineff ~ lcace for induce immune response;
- AI2N coding for NP alone, encapsulated in ~ liposomes, is capable to induce an immoral response only after recall (test comparison # let3); and - the RNA coding for NP and IL-2, encapsulated in liposomes is capable 0 to induce an immune response after a single injection (compare your tests # 2and3).
E ~ IPI, E 10: Immunization of mice against the measles virus in using the liposomes prepared in Examples 6, 7 and 8.
.
The animal model which is m ~ s implemented is substa; lltiellement such that described in Drillien et al, PNAS (1988) ~: 1252.
2 o We constitute S lots of 8 BAl mice / c A batch is reserved for the positive control. ~ the mice receive 4 x 107 u ~ tees -Vaccine virus VVTGFM1173 plaques forming intraperitoneally in a single injection. YVTGFM1173 contains the fusion protein gene , the measles virus. It has been described as an ir ~ nunogenic agent a ~ if (Drillien et al, supra ~.
:
One batch is reserved for negative control. These mice receive sub-cutaneous, approximately 30 moles of lipids s ~ us form of empty liposomes prepared according to the method described in 3B (~ except the addition of RNA) first injection and booster 15 days later.
The other 3 lots are reserved for testing. The mice receive sub-a first injection and a booster lS days later. The first one injection and booster corresponden ~ cha ~ n to about 0.4 - ~ 0.6 ml of llposomal preparations of Examples 6, 7 and 8.
~,.
,: ~
.
WO 92/19752 Pcr ~ FR92 / 00393 About 15 days after the recall, the souns are tested by injection 50 I intracerebral suspension ~ 10% brain cells newborn sows pr ~ alableme ~ t in ~ ect ~ s by the isolate SSPE of wine ~ s Measles (Wild et al, J. Med. V ~ rol. (1979) 4: 1 ~).
This test indicates that the liposomes of Examples 6, 7 and 8 have a immuno ~ ene action similar to that of VVTÇFM1173.
,; : ~
:
.
:.
,, ~. . . .
. '. -: