AU652831B2 - RNA delivery vector - Google Patents

Description

V ERS iC.ON under INID Number (71) "Applicants (for all COIGE14 j designated States except replace PCTf ORG Vaccins 58, avenue Leclerc, F-69348 Lyon JELLE CUdex 07 by "PASTEUR MERIEUX DEMANDE INTERNATIONALE P SERUMS VACCINS S.A. IFRIFRI; 58, avenue EN MATIEl Leclerc, F-69348 Lyon C6dex 07 (51) Classification internationale des brevets 5 Num~ro de publication internationale: C12N 15/88, A61K 9/127 Al(4)Dtdepbiaonnertoal:1 A61 K 31/70, C07K 15/00(4)Dtdepbiainnertial:1 D1 RE DE BREVETS (PCT') WO 92/19752 iovembre 1992 (12.11.92) (21) Num~ro de la demande internationale: PCT/FR92/00393 (22) Date de d&p6t international 30 avril 1992 (30.04.92) Donn~es relatives At ]a priorit6: 91/05465 3 mai 1991 (03.05.9 1) (74) Mandataire: SCHRIMPF, Robert; Cabinet Regimbeau, 26, avenue Kh~ber, F-751 16 Paris (FR1).

(31) Etats d~sign~s: AT (brevet europ~en), AU, BE (brevet europ~en), CA, CH (brevet europ~en), DE (brevet europ~en), DK (brevet europ~en), ES (brevet europ~en), FR (brevet europ~en), GB3 (brevet europ~en), GR (brevet europ~en), IT (brevet europ~en), JP, LU (brevet europ~en), MC (brevet europ~en), NL (brevet europ~en), SE (brevet europ~en), US.

(71) Ddposants (pour tous les Etats ddsign~s sauf US): TRANSOENE S.A. IFR/FRJ; 11, rue de Molsheim, F- 67000 Strasbourg PASTEUR MERIEUX SERUMS VACCINS S.A. [FR/FR!; 58, avenue Leclerc, F-69348 Lyon C,6dex 07 (FR).

(72) Inventeurs; et 1nventeurs/DWposants (US seulemenzt) MEULIEN, Pierre [FR/FR]; 15, place Paty, F-69690 La Tour-de-Salvagny KRISHNAN, Shivadasan [ML/FR]; 21, rue des Aqueducs, F-69005 Lyon MARTINON, Fr~d~ric [FR/FR]; 26 bis, avenue de la R~publique, F-92120 Montrouge (FR).

Avec rapport de rechierche iniernauionale.

0 5283 1 (54) Title: RNA DELIVERY VECTOR (54)Titre: VECTEUR DE DELI VRANCE D'ARN Sca (57) Abstract An RNA delivery vector including a liposome and at least one RNA fragment coding for an antigenic determinant! which characterizes a tumor or a pathogenic agent, said at leastf one RNA fragment being encapsulated in said liposome.

(57) Abrig6 Un vecteur de d~livrance d'ARN qui comprend un liposome et au momns un fragment W'ARN codant pour un d~terminant antig~nique caract~ristique d'une tumneur ou d'un agent pathog~ne, ledit au momns un fragment d'ARN 6tant encapsu16 dans ledit liposome.

0"pr/

ISTART

23 26 32 36 39 48 54 56 69 P~lwde 1.3Transcription 7 /START OF TRANSCRIPTIONi T7 IGIAA T1C0A CTCAC TA GGCGA ATTCG AGCTC GGIAC CCGGG GATC P~aoerEcoRI ScI Kpn I Aya T BamHl Depart de la Transcription SP6 START OF TRANSCRIPTION SP6 TCIAG AGICG ACCIG CAGGC AIGCA AGCTT GAGTA 11ClA IAGIG I I I 1 11Promot eur/'mTR MalI Sal Pit I Sph I HindIll, 5P6 4cc I TCAO TAAAT (Voir to Gazetiu du PCT' No. 09/1993, Section 11) WO 92/19752 PCT/FR92/00393 RNA delivery vector The present invention relates to means intended for the transfer inside a cell of a RNA fragment encoding an antigenic determinant characteristic of a tumor or of a pathogenic agent as well as to the pharmaceutical compositions containing them. The present invention applies in particular to the field of vaccines.

Generally, traditional vaccination consists in sensitizing the immune system of an individual to an infectious agent (bacteria, virus or parasite). To this end, three types of vaccines have been proposed and developed depending on the case, in a more or less empirical manner: Inactivated (or killed) vaccines obtained from whole bacteria or viruses which have lost their infectivity by virtue of chemical treatments; Live vaccines which consist of infectious bacteria or viruses whose virulence has been attenuated by mutagenesis or by passages in various media which cause mutations; and Subunit vaccines, based on bacte.rial toxins or on antigens of purified infectious agents.

Moreover, it has recently been proposed to apply the principle of vaccines to the prevention of malignant tumors. Indeed, most tumor cells express at their surface antigens which differ either qualitatively or quantitatively from the antigens present at the surface of the corresponding normal cells. These antigens are said to be specific when they are expressed only by tumor cells.

When they are present both on normal and tumor cells, these antigens are said to be associated with the tumor; in this case, they are present either in a higher amount, or in a different form in the tumor cells.

Once the vaccine has been administered, the cells of the immune system recognize the antigens of the foreign germ, react specifically to this intrusion and S retain these antigens in memory; they will protect the WO 92/19752 2 PCT/FR92/00393 organism during a subsequent infection.

Generally, there are two main types of immune response: the humoral type response which is characterized by the production of antibodies by the B lymphocytes, and the cell-mediated immune response which involves effector cells, i.e. essentially the T8 lymphocytes (cytotoxic lymphocytes). These responses are initially activated by antigen-presenting cells and controlled by regulatory cells, i.e. the T4 lymphocytes (helper T lymphocytes) and the suppressor T lymphocytes.

In very broad terms, the immune response functions as follows: The antigen-presenting cells (monocytes, macrophages and B lymphocytes) capture the antigen, digest it and reexpose fragments thereof at their surface, in association with molecules of the class I or II major histocompatibility complex (MHC).

The T4 lymphocytes stimulate the proliferation of the antibody-producing B lymphocytes and that of the T8 lymphocytes (cytotoxic T lymphocytes or CTL) when they "see" the fragments of antigens associated with the class II major histocompatibility complex.

The B lymphocytes produce antibodies which will interact with the circulating antigens so as to neutralize them.

Finally, the T8 lymphocytes destroy the infected cells when they recognize the fragments of antigens associated with the class I major histocompatibility complex.

It is currently thought that vaccines should probably induce both a humoral and cell-mediated response in order to confer a substantial and lasting immunity.

Among the types of vaccines mentioned allvi. live vaccines are often the most effective: they simultaneously activate the B, T 4 and T, lymphocytes by conferring a good level of immunity. Furthermore, as they multiply in the organism, they act at low doses and Io not generally require a booster. Unfortunately, to WO 92/19752 3 PCT/FR92/00393 remain alive, these vaccines should generally be preserved in the cold. Maintaining the cold chain during transportation is a factor which substantially increases the cost of these vaccines. Finally, their virulence, which is attenuated, is not zero and they sometimes induce secondary effects in immunosuppressed subjects.

Even more serious, they can regain their virulence following reverse mutations, which is extremely rare but absolutely intolerable.

The subunit vaccines do not have these drawbacks but they generally stimulate the immune cells less well and require adjuvants (molecules which enhance their immunogenicity). The vaccine against hepatitis B, consisting of the major surface antigen of the virus, obtained by recombinant DNA technology, is an example of a subunit vaccine developed successfully. However, in other cases, the results have been disappointing.

It is thought that one factor limiting the success of subunit vaccines lies in the fact that they are not capable of inducing a sufficiently high immune response of the cellular type. This probably results from the impossibility for certain antigens to be correctly processed and/or for their fragments to come into contact with the molecules of the class I major histocompatibility complex (MHC).

Indeed, the association between the class I MHC molecules (which participate in the cell type immune response) and the peptide fragments takes place in the endoplasmic reticulum of the cell. For that, it is therefore necessary, first, that the antigen reaches the inside of this cellular compartment. Generally, entry into this compartment takes place from the cytosol where proteins are synthesized by translation of the corresponding messenger RNAs. The passage from the cytosol to the endoplasmic reticulum occurs by virtue of two types of mechanisms: either a secretion mechanism when the protein is synthesized in the form of a precursor (involvement WO 92/19752 4 PCT/FR92/00393 of a signal peptide), or a peptide "pump" mechanism.

The types of vaccines known up until now do not make it possible at all to control this important parameter which is the association of the class I MHC molecules and the peptide fragments. Most often, the infectious elements (bacteria, viruses, parasites or antigens) are in fact absorbed by the phagocytic cells according to the endocytosis (or phagocytosis) mechanism.

The endocytic vesicles fuse with lysosomes whose enzymatic content ensures degradation of the phagocytized material. These endocytic and lysosomal vesicles form a whole distinct from the endoplastic reticulum and are not in contact with the latter.

Consequently, even if an antigen is capable of inducing a production of antibodies which are neutralizing towards it, it is not'certain at all that it will subsequently prove to be effective for the development of a subunit vaccine.

It has now been found, surprisingly, that the synthesis of an antigen could be performed directly in the antigen-presenting cells of the individual to be immunized, when the RNA encoding this antigen was administered in an appropriate form, for example in the form of a lyposomal composition. The fate of the RNA thus injected was in fact highly uncertain given its very short half-life. Furthermore, it was not obvious at all that the RNA could be correctly delivered into the cytosol and that it could be taken over by the cellular machinery responsible for the translation process.

This new method of vaccination greatly enhances the association of the class I MHC molecules with the peptide fragments derived from the digestion of the antigen since it has been shown that the individual "hus treated was capable of developing an immune response involving the cytotoxic T lymphocytes (CTL).

Consequently, the invention proposes: WO 92/19752 5 PCT/FR92/00393 An RNA delivery vector comprising a liposome and at least one RNA fragment encoding an antigenic determinant characteristic of a tumor or of a pathogenic agent, the said at least one RNA fragment being encapsulated in the said liposome; (ii) A pharmaceutical composition intended for the treatment of a tumor or of a disease induced by a pathogenic agent, for preventive or curative purposes, comprising as therapeutic agent an RNA delivery vector according to the invention; (iii) The use of a RNA delivery vector according to the invention for treating in a preventive or curative manner a tumor or a disease induced by a pathogenic agent; (iv) The use of a RNA delivery vector according to the invention for the preparation of a medicinal product intended for the preventive or curative treatment of a tumor or of a disease induced by a pathogenic agent; A method for the curative or preventive treatment of a tumor or of a disease induced by a pathogenic agent comprising the act of administering a sufficient amount of an RNA delivery vector according to the invention to a patient requiring such a treatment.

An RNA fragment useful for the purposes of the present invention is by nature a non-infectious RNA fragment exclusively of the messenger type; that is to say capable of being directly translated into protein by the cellular machinery without having to be first replicated or transcribed into DNA. By definition, it does not contain the elements which might enable it to replicate inside a cell. Similarly, it does not contain the genetic information required for the reconstitution of a substantially complete pathogenic agent (for example a bacterium, a virus or a parasite).

"Antigenic determinant" is understood to mean any peptide containing at least one epitope characteristic of WO 92/19752 6 PCT/FR92/00393 a tumor antigen or a pathogenic agent. This antigenic determinant can therefore be the complete native antigen, a precursor or an analog thereof, a native antigen fragment or an analog of this fragment. "Analog" is understood to mean a molecule having an amino acid sequence which is substantially different from that of the native molecule, for example whose amino acid sequence has a degree of homology of not less than about preferably of not less than 90%, most preferably of not less than 95% with the sequence of the native molecule.

Generally, the antigenic determinant can be characteristic of any type of tumor or of any pathogenic agent.

To illustrate the above, the following is mentioned by way of example: The nucleocapsid protein (nucleoprotein or NP) of the influenza virus type A affecting humans, as defined by the mRNA sequence corresponding to it.

This sequence has been published in Huddleston Brownlee, Nucl. Ac. Res. (1982) 10 1029.

The fusion protein of the measles virus A peptide comprising the epitope of sequence: Thr-Tyr-Glu-Arg-Thr-Arg-Ala-Leu-Val-Arg. This epitope is characteristic of the nucleoprotein of influenza viruses type A.

A peptide comprising the sequence: Thr-Tyr-Glu-Arg- Thr-Arg-Ala-Leu-Val-Thr.

The tumor antigen H23-ETA associated with breast cancer in humans, as described in Wreschner et al, J. Biochem. (1990) 189: 463.

A peptide comprising the major epitope of the antigen H23-ETA, having the sequence: Pro-Gly-Ser- Thr-Ala-Pro-X-Ala-His-Gly-Val-Th Ser-Ala-Pro-Asp- Y-Arg-Pro-X, in which X is Iro or Ala and Y is Thr or Asn.

An RNA delivery vector according to the invention may contain various RNA fragments; each of these WO 92/19752 7 PCT/FR92/00393 fragments encoding a specific antigenic determinant. For example, an RNA delivery vector according to the invention, intended for the preventive treatment of influenza, may contain both: An RNA fragment encoding the nucleoprotein of influenza viruses type A and an RNA fragment encoding the nucleoprotein of influenza viruses type B, or alternatively, An RNA fragment encoding the nucleoprotein of influenza viruses type A and one or more RNA fragment(s), each of the latter encoding the hemagglutinin of a specific strain of the influenza virus.

For the purposes of the present invention, an RNA fragment can be obtained in a conventional manner, for example by chemical synthesis or by transcription in vitro of the corresponding DNA fragment.

"Liposome" is' understood to mean a vesicle essentially made up of a membrane consisting of lipids in a double layer. Such a vesicle can have one or more membrane layers. In the first case, the vesicle is said to be unilamellar while in the second case, the vesicle is oligo- or plurilamellar. Typically, the membrane of the liposomes consists of amphiphilic lipids such as phospholipids in association or otherwise with other lipid constituents. Suitable phospholipids are for example phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cardiolipin, phosphatidylinositol, phosphatidic acid and phosphatidyl glycerol. Furthermore, the use of synthetic phospholipids derived or otherwise from the abovementioned phospholipids, containing for example various groups such as hydroxyl, imidazol, amine, amide, sulfidryl groups and the like, may also be envisaged.

Preferably, other lipids such as steroids, cholesterol and aliphatic amines may be mixed with the phospholipids. Such lipids are in particular useful as stabilizing agents or antioxidants.

WO 92/19752 8 PCT/FR92/00393 For the purposes of the present invention, a first advantageous lipid mixture consists of phosphatidylcholine (PC) and cholesterol (CH\ in variable proportion. It should be stated however that satisfactory PC:CH proportions are of the order (in terms of portion) of 5:1 to 5:5. Such a mixture in equal portion is particularly suitable. A second advantageous mixture consists of phosphatidylcholine, cholesterol and phosphatidylserine (PS) in variable proportion, for example CH/PC/PS in the proportion 5:4:1.

The preparation of the liposomes as well as the packaging of the RNA can be carried out using known techniques. In particular, DNA packaging techniques which are commonly used, are applicable in the present case.

Moreover, the membrane may also contain various proteins inserted into the membrane, attached through covalent bonding to a membrane lipid, directly or indirectly via a bonding agent, or simply interacting with a phospholipid. When a protein is bound to a lipid through covalent bonding, it is preferably a lipid possessing an amine functional group such as, for example, phosphatidylethanolamine. Advantageously, these proteins can be used as agent for targeting liposomes at a specific category of cells. They are for example monoclonal antibodies or lymphokines.

For the purposes of the present invention, the RNA fragment(s) encoding an antigenic determinant for a tumor or a pathogenic agent is (are) advantageously accompanied by one RNA fragment encoding oie interleukine-1, one RNA fragment encoding one interleukine-4 or one RNA fragment encoding one interleukine-2, the latter being most particularly preferred.

In conformity with the objectives pursued by the present invention, it should be understood that an antigenic determinant or an interleukine-encoding RNA fragment comprises, in addition to the coding sequence, all the elements required for translating the latter.

WO 92/19752 9 PCT/FR92/00393 When various RNA fragments compose a vector or a pharmaceutical composition according to the invention, they may be partially or completely linked to each other, so as to form at least one polycistronic RNA fragment.

Finally, a pharmaceutical composition according to the invention can be manufactured in a conventional manner. In particular, the therapeutic agent(s) according to the invention are associated with a pharmaceutically acceptable diluent or carrier. A composition according to the invention may be administered by any conventional route in use in the field of vaccines, in particular by the subcutaneous route, by the intramuscular route or by the intravenous route, for example in the form of a suspension for injection. It should be stated that the subcutaneous route is in particular very suitable for administering a composition according to the invention.

The administration may be performed in a single dose or in a dose repeated once or several times after a certain interval of time. The appropriate dosage varies according to various parameters, for example the individual treated or the mode of administration.

The invention is illustrated below with reference to the following figures: Figure 1 represents the plasmid pGEM-3Z.

Figure 2 schematically represents the inserts for the plasmids pTG3003 (base pGEM-3Z), pPM2 (base pUC18), pPM3 (base pUC18), pPM4 (base pUC18), pPM5 (base pGEM-3Z) and pPM6 (base pGEM-3Z). NP nucleoprotein; IL-2 interleukine-2; S. signal signal sequence of the precursor of IL-2; 3'NTR6G untranslated 3' end of the rabbit p-globin gene.

Figure 3 schematically represents the inserts for the plasmids pPM9, pPMIO, pPM11 and pPM12 (each based on pGEM-4Z). 5'NTR3G untranslated 5' end of the rabbit p-globin gene.

WO 92/19752 10 PCT/FR92/00393 EXAMPLE 1: Preparation of liposomes loaded with RNA encoding the nucleoprotein of the influenza virus type A.

1A. Preparation of the RNA.

An EcoRI-Sall fragment comprising the cDNA encoding the nucleoprotein of the influenza virus type A, strain A/NT/60/68 (Huddleston Brownlee, Nucl. Ac. Res. (1982) 1029) is obtained by digestion of the plasmid pNP28 (Jones Brownlee, Gene (1985) 35: 333).

This EcoRI-Sall fragment is inserted into the EcoRI and Sail-digested plasmid pGEM-3Z (Promega Corp; Figure 1) so as to place the nucleoprotein-encoding cDNA under the control of a promotor recognized by the T7 phage RNA polymerase. The plasmid pTG3003 is thus obtained.

The plasmid pTG3003 is then linearized by digesting with Sal; then transcribed using an in vitro transcription kit (Stratagene; catalog reference 200 341) according to the instructions of the supplier. The RNA thus obtained is capped by adding, in the transcription buffer, 10 pl of a 5 mM solution of m7G(5')ppp(5')G (Pharmacia; product no. 27-4635).

lB. Preparation of the liposomes.

A cholesterol solution is prepared by dissolving the powdered product (Sigma) in chloroform in an amount of 100 mg/ml. Then in a 30-ml Corex tube, 58 pl of the cholesterol solution and 110 pl of a phosphatidylcholine solution at 100 mg/ml (Sigma). The final mixture contains about 30 pmol of lipids.

This mixture is vigorously stirred on a vortex.

Then the solvent is allowed to evaporate at 40 0 C. The drying operation is completed by freeze-drying for about 1 h.

The lipid layer deposited at the bottom of the tube is taken up in 1 ml of water. The mixture is homogenized on a vortex and sonicated'at the minimum frequency using a Braun Labsonic L sonicator. The operation is carried out for 10 min by intermittent passages of seconds, separated by 30 seconds of standing in the WO 92/19752 11 PCT/FR92/C0393 cold.

The suspension thus obtained is centrifuged at 16,000 rpm, at 4"C for 15 min in order to sediment the titanium particles and the largest vesicles (Biofuge/Heraeus in an eppendorff tube). Then the supernatant containing most of the unilamellar vesicles, having a diameter of about 50 microns, is recovered in Corex tubes.

To the vesicular suspension obtained in are added 135 pl of the RNA preparation obtained in A); equivalent to about 40 pg of RNA. The mixture is slowly immersed in liquid nitrogen, while rolling between the fingers the tube maintained in a vertical position. When the mixture is completely frozen, it is freeze-dried overnigLt.

The freeze-dried product is progressively rehydrated in 100 pl of distilled water. Then there is added dropwise 0.9 ml of Hepes buffer pH 7.05 of composition: 140 mM NaC1, 5 mM KC1, 0.75 mM Na 2

HPO

4 2H0O 25 mM Hepes. The vesicular suspension is then calibrated by successive extrusions through a fi rst and second filter whose pores have a diameter of 400 nm and 200 nm respectively. The suspension thus obtained contains most of the oligolamellar vesicles which have encapsulated the

RNA.

In order to substantially remove the nonencapsulated RNA, the suspension is loaded on a Sepharose 4B column (10 ml; column with a cross section of 1 um) preequilibrated in Hepes buffer. The elution is carried out in Hepes buffer. The eluted fractions, white in appearance, which contain the vesicles are collected together; this corresponds to a volume of about 2 ml.

EXAMPLE 2: Induction of a CTL response initiated by the liposomes loaded with RNA encoding the nucleoprotein of the influenza virus type A.

Three series of BALB/c mice respectively corresponding to the test, (ii) positive control and WO 92/19752 12 PCT/FR92/00393 (iii) to the negative control, are prepared as follows: Test: the mice receive by the intravenous route 200 pl of the liposome preparation obtained in Example 1.

(ii) Positive control: the mice receive by the intraperitoneal route 130 hemagglutinating units of the influenza virus type A, strain Caen (A-Caen).

The various type A strains sometimes differ from each other for certain proteins such as hemagglutinin or neuraminidase but never for the nucleoprotein. On the other hand, variations exist between the type A and B viruses with respect to the nucleoprotein.

(iii) Negative control: the mice receive by the intravenous route 200 pl of a preparation of liposomes prepared as in Example 1, the addition of RNA having been omitted.

days later, the mice and (iii) receive an injection identical to the first and under the same conditions.

days after the second injection, the spleen of the mice is removed and dilacerated. The red blood cells are removed by osmotic shock. Then the splenic cells are cultured in multiwell plates in an amount of 5.10 6 cells/well in a volume of 2 ml, in an DMEM culture medium (Gibco) supplemented with 10 fetal calf serum, 2 mM of L-glutamine, 50 yM of f-mercaptoethanol, 10 mM of Hepes, 1 mM of sodium pyruvate, 10 units/ml of penicillin, 10 pg/ml of streptomycin, 2.5 pg/ml of amphotericin and non-essential amino acids (Flow labs).

This medium additionally contains 5 pM of the peptide NP 14 7 -158R- of formula: Thr-Tyr-Glu-Arg-Thr-Arg- Ala-Leu-Val-Thr-Gly. This peptide corresponds to an epitope systematically recognized by the CTLs of BALB/c mice when they are immunized with the influenza virus type A (Bodu.er et al, Cell (1988) 52: 253).

The culture is carried out at 37 0 C under an atmosphere containing 7 of CO 2 After 7 days, the WO 92/19752 13 PCT/FR92/00393 initial culture medium is replaced with fresh medium. In each well, are additionally added 5 106 splenic cells of BALB/c mice not subjected to immunization, these cells having been irradiated by 4000 Rad of gamma radiation.

On the 12th day of culture, the activity of the CTLs is detected by the conventional test of 5 Cr release described in particular by Martinon et al, J. Immunol.

(1989) 142: 3489. Details are given as follows: 1 to 10 x 106 mastocytpma cells of DBA/2 mice (H-2d) histocompatible with the BALB/c mice (P815 cells), in DMEM medium, are incubated in the presence of 100 pCi of Na 2 5 CrO, (CEA, France) for 1 h at 37"C. The cells are washed twice, then taken up in DMEM medium.

The operation is repeated using P815 cells infected with the influenza virus type A, strain Bangkok (P815/A-Ban) or with the influenza virus type B, strain Yamagata (P815/B-Yam). Infection of the P815 cells is carried out beforehand as follows: 106 cells, in 0.5 ml of DMEM medium, are infected with 100 hemagglutinating units of virus. After 90 min at 37 0 C, the cells are washed in 20 ml of DMEM medium supplemented with 10 of FCS in order to stop the infection. Expression of the virus proteins is carried out for 3 h at 37 0 C before the cells are used in the cytolysis test.

The P815 cells (target cells) are then dispersed into the wells of a microtiter plate in an amount of 3000 calls per well. In the three cases (ii) and (iii), the splenic cells (effector cells), in DMEM medium, are added to each well so as to produce series forming a range of effector cells/target cells ratio of between approximately 100/1 and 0.3/1. The peptide NP 147-158R- is finally added to the final concentration of 2.5 pM. The final volume is 200 pl in each well.

The plate is then incubated for 4 h at 37 0 C and then centrifuged. 100 pl of supernatant are removed from each well. The radioactivity of each sample is measured and the results are expressed in the table below, in percentage of chromium release due to the CTL activity: WO 92/19752 14 PCT/FR92/00393 (observed release spontaneous release) 100 x (total amount of chromium incorporated spontaneous release) Infection Effectors P815/- P815 P815 P815 /targets /NP /A-Ban /B-Yam Positive 40 <5 71 63 control 13 <5 52 46 (A-Caen) 4.4 <5 45 46 <5 32 29 9 Negative 22 <5 10 11 8 control 7.4 <5 <5 7 <5 <5 8 0.8 <5 <5 10 Test 22 10 53 50 7.4 <5 39 28 <5 18 20 0.8 <5 <5 12 EXAMPLE 3: Second preparation of liposomes loaded with RNA encoding the nucleoprotein of the influenza virus type A.

3A. The RNA is obtained as previously described in 1A.

3B. Preparation of the liposomer.

A cholesterol solution is prepared by dissolving the powdered product in chloroform in an amount of 100 mg/ml. Then, in a 30-ml Corex tube, are mixed 58 pl of the cholesterol solution, 176 pl of a dipalmitoyl phosphatidylcholine solution at 50 mg/ml and 219 pl of a phosphatidylserine solution at 10 mg/ml. The final mixture contains about 30 pmol of lipids.

This mixture is vigorously stirred on a vortex.

Then the solvent is allowed to evaporate at 40 0 C. The drying operation is completed by freeze-drying for 1 h.

WO 92/19752 15 PCT/FR92/00393 The lipid layer deposited at the bottom of the tube (about 30 pmol) is taken up in 300 pmol of octylp-glucoside. The solution should be clear.

About 50 fg of the RNA prepared in 3A are added to this preparation. In order to remove the detergent, this mixture is dialyzed against 10 mM Hepes buffer, pH 7.05, containing 150 mM NaCl and 2.7 g of adsorbent Biobeads-SM2 (9 mg of adsorbent/pmole of detergent). The dialysis is carried out with stirring for 16 h at room temperature.

The vesicular suspension is then calibrated by three successive extrusions at 40 0 C through membranes whose pores have a diameter of 200 nm; then finally eluted in Hepes buffer on a Sepharose CL4B column.

EXAMPLE 4: Preparation of liposomes loaded with RNAs encoding the nucleoprotein of the influenza virus type A and (ii) human interleukine-2.

4A. Preparation of the RNA.

The plasmid pTG3003 described in 1A is partially digested with Sphl and treated with Klenow polymerase. It is religated by inserting a MTul linker and a plasmid is selected which lost the SphI site situated in 3' of the NP-encoding sequence, with replacement with Mlul; that is to say the plasmid pPM1.

On the other hand, the IL-2-encoding sequence is recovered in the form of the EcoRI Xbal fragment from a phage M13 marketed by British Biotechnology under the reference BBG3. This fragment is inserted into pUC18 (Viera Messing, Gene (1982) 19: 259) to give the plasmid pPM2.

A Xbal HindIII fragment containing the untranslated 3' end of the rabbit p-globin gene (Kafatos et al, PNAS (1977) 77: 5618) is synthesized by PCR using the primers OPM1 and OPM2.

WO 92/19752 16 PCT/FR92/00393 OPMl XbaI TTrTTTCTAGAGCCCTGGCTCACAAATACCACTGAC 31' OPM2 IHindIII Miul AAAAAAGMATCGCGTTTTTTT± .L m zGCAATGAAAATAAATTTCC 3' This fragment is inserted into pPIA2, previously digested with XabI and HindIll. The plasmid pPM3 is thus obtained.

A synthetic DNA fragment, containing the sequence encoding the signal peptide of human IL-2, is inserted into pPN3 previously digested with EcoRI and XhoI to give the plasmid pPM4.

2his synthetic DNA fragment is formed by hybridization of the following oligonucleotides: OPM3: EcoRI Sal AATTCGCGCGTCGACATAGGCCTATCCACC TAC AGG ATG CAA CTC GTG TCA TGC ATT GCA CTA AGT CTT GCA CTGTC ACA AAC AGT GCT CCT ACT AGC 3' XhoI OPM4: XhoI TCQOCT AGT AGG AGC ACT GTT TGT GAC AAG TGC AAG ACT TAG TGC AAT GCA TGA CAC GAG TTG CAT CCT GTA CAT GGTGGATAGGCCTATOTCGACGCGCG 3' SalI EcoRI Finally, the unit encoding the IL-2 precursor and the untranslated 3' region of the rabbit fi-globin gene is recovered from pPM4 in the form of a Sall Miul fragment L for insertion into pPM1 previously digested with Sall and WO 92/19752 17 PCT/FR92/00393 Mlul to give the plasmid The plasmid pPM5 is then linearized by Mlul digestion, then transcribed using an in vitro transcription kit (Megascript from Ambion). The RNA thus obtained is capped by adding, in the transcription buffer, 10 pl of a 5 mM solution of m7G(5')ppp(5')G (Pharmacia; product no. 27-4635).

4B. The preparation of the liposomes is carried out as previously described in 3B.

About 66 pg of the RNA obtained in 4A are pmol of lipids.

EXAMPLE 5: Third preparation of liposomes loaded with RNA encoding the nucleoprotein of the influenza virus type A.

5A. Preparation of the RNA.

The plasmid pPM5 is digested with Stul and Hpal so as to remove practically the entire region encoding the IL-2 precursor; then religated to give the plasmid pPM6.

pPM6 is then linearized by MIul digestion, then transcribed using an in vitro transcription kit (Megascript from Ambion). The RNA thus obtained is capped by adding, in the transcription buffer, 10 pl of a 5 mM solution of m7G(5')ppp(5')G (Pharmacia; product no. 27-4635).

The preparation of the liposomes is carried out as previously described in 3B.

About 66 pg of the RNA obtained in 5A are pmol of lipids.

EXAMPLE 6: Preparation of liposomes loaded with RNA encoding the fusion protein of the measles virus.

6A. Preparation of the RNA.

The plasmid pTG2148, described in Patent Application EPA 305 209, contains the DNA fragment encoding the fusion protein (Buckland et al, J. Gen.

Virol. (1987) 68: 1695). pTG2148 is digested with HindIII WO 92/19752 18 PCT/FR92/00393 and Hpal in order to remove the untranslated 5' region of the gene encoding the fusion protein. It is replaced by the untranslated 5' region of the rabbit p-globin gene reconstructed by hybridization of the oligonucleotides OPM5 and 6. The plasmid pPM7 is thus obtained.

HindIII

AGCTTACACTTGCTTTTGACACAACTGTGTTTACTTGCAATCCCCCAAAACAGC

CACCATGGGTCTCAAGGTGAACGTCTCTGCCATATTCATGGCAGTACTTT 3' HpaI OPM6 HpaI

AACAGTACTGCCATGAATATGGCAGAGACGTTCACCTTGAGACCCATGGTGG

CTGTTTTGGGGGATTGCAAGTAAACACAGTTGTGTCAAAAGCAAGTGTA 3' HindIII On the other hand, the plasmid pGEM-4Z (Stratagene) is digested with EcoRI, and then treated with Klenow polymerase. It is religated by inserting an Miul linker to give the plasmid pPM8.

Finally, the untranslated 5' region of the pglobin gene and the sequence encoding the fusion protein are recovered from pPM7 in the form of a HindIII SadcI fragment. The latter is inserted in pPM8 previously digested with Hindll and Sad. The plasmid pPM9 is thus obtained in which the sequence encoding the fusion protein is placed under the control of the T7 promoter.

pPM9 is linearized by M7ul cdigestion; then transcribed using an in vitro transcription kit (Megascript from Ambion). The RNA thus obtained is capped by adding, in the transcription buffer, 10 pl of a 5 mM solution of m7G(5')ppp(5')G (Pharmacia; product no. 27-4635).

6B. The preparation of the liposomes is carried out as previously described in 3B.

About 60 pg of the RNA obtained in 6A are used/30 pmol of lipids.

EXAMPLE 7: Second preparation of liposomes loaded with RNA encoding the, fusion protein of the measles .7 ap WO 92/19752 19 PCT/FR92/00393 virus.

7A. Preparation of the RNA.

There is prepared a synthetic DNA fragment of sequence (double stranded): EcoRI XbaI MIul GAATTCCACTCTAGACACA 3' 3' TCGACTTAAGGTGAGATCTGTGTGCGC Sall sticky end This DNA fragment is inserted into pPM9 previously digested with Sad and M7ul to give the plasmid which no longer contains a Sad site.

The Xbal Mlul fragment of pPM5 which contains the untranslated 3' end of the p-globin gene is recovered, and then inserted into pPM10 previously digested with Xbal and MIul to give the plasmid pPM11.

pPM11 is then linearized by Mlul digestion, then transcribed using an in vitro transcription kit (Megascript from Ambion). The RNA thus obtained is capped by adding, in the transcription buffer, 10 Al of a 5 mM solution of m7G(5')ppp(5')G (Pharmacia; product no. 27-4635).

7B. The preparation of the liposomes is carried out as previously described in 3B.

Approximately 60 pg of the RNA obtained in 7A are pmol of lipids.

EXAMPLE 8: Preparation of liposomes loaded with RNAs encoding the fusion protein of the measles virus and (ii) human interleukine-2.

8A. Preparation of the RNA.

The unit encoding the IL-2 precursor and the untranslated 3' region of the p-globin gene of the plasmid pPM4 is recovered in the form of an EcoRI M7uI fragment. This fragment is inserted into pPM11 previously digested with EcoRI and MIul to give the plasmid pPM12.

pPM12 is then linearized by Mlul digestion, then transcribed using an in vitro transcription kit (Megascript from nAbion). The RNA thus obtained is capped by adding, WO 92/19752 20 PCT/FR92/00393 in the transcription buffer, 10 pl of a 5 mM solution of m7G(5')ppp(5')G (Pharmacia; product no. 27-4635).

8B. The preparation of the liposomes is carried out as previously described in 3B.

87 pg of the RNA obtained in 8A are used/30 pmol of lipids.

EXAMPLE 9: Induction of a CTL response initiated by the liposomes prepared in Examples 3, 4 and The CTL response is detected and analyzed as described in Example 2, except for 2 modifications: it should be specified that 500 pl of each of the liposomal preparations obtained in Examples 3, 4 and 5 is used to inject a mouse (first injection as well as the booster) and that the injections are carried out by the subcutaneous route.

Some tests are carried out 15 days after the first injection.

On the other hand, experiments carried out in parallel make it possible to test the RNA mixed with the liposomes but not encapsulated and (ii) the pure RNA.

In case there are injected in a volume of 0.5 1 ml, 50 pg of RNA prepared in 1A, mixed with empty liposomes prepared according to the process described in 3B except for the addition of RNA, corresponding to about 30 pmol of lipids. In case 50 pg of the RNA prepared in IA are injected in a vo ume of about 0.5 1 ml.

The results are prese.ed t, che table below.

WO 92/19752 21 PCT/FR92/00393 Injection Effectors P815/- P815 P815 P815 /target /NP /A-Ban /B-Yam Positive 40 <5 71 63 control 13 <5 52 46 (A-Caen) 4.4 <5 45 46 <5 32 29 9 Negative 22 <5 10 11 8 control 7.4 <5 <5 7 2.5 <5 <5 8 0.8 <5 <5 10 Tests 130 18 79 31 Liposomes 44 8 47 21 8 Ex.3 15 5 36 9 2 (2 injections) 3 11 5 80 2 57 15 Liposomes 27 3 31 16 2 Ex.4 9 0 22 9 0 (1 injection) 3 0 11 5 3 67 9 12 5 3 Liposomes 22 4 6 0 2 7 2 3 0 0 (1 injection) 3 5 2 1 3 140 1 5 5 Liposomes 47 1 2 3 1 CH/PC/PS 16 1 1 2 1 +RNA Ex.lA 5 1 0 1 0 (2 injections) 140 0 2 3 2 RNA Ex.1A 47 0 2 6 (2 injections) 16 1 2 1 3 5 2 0 2 2 These results show in particular that.

RNA alone is ineffective for inducing an immune response; RNA mixed with liposomes but not encapsulated is ineffective for inducing an immune response; RNA encoding NP alone, encapsulated in liposomes, is capable of inducing an immune response only after a booster (Comparison Tests nos. 1 and and WO 92/19752 22 PCT/FR92/00393 RNA encoding NP and IL-2, encapsulated in liposomes, is capable of inducing an immune response after a single injection (Comparison Tests nos. 2 and 3).

EXAMPLE 10: Immunization of mice against the measles virus using the liposomes prepared in Examples 6, 7 and 8.

The animal model which is used is substantially as described in Drillien et al, PNAS (1988) 85: 1252.

batches of 8 BALB/c mice are formed.

One batch is reserved for the positive control.

These mice receive 4 x 107 plaque-forming units of the vaccinia virus VVTGFM1173 by the intraperitoneal route in a single injection. VVTGFM1173 contains the fusion protein gene of the measles virus. It has been described as an active immunogenic agent (Drillien et al, supra).

One batch is reserved for the negative control.

These mice receive by the subcutaneous route, about mol of lipids in the form of empty liposomes prepared according to the process described in 3B (except for the addition of RNA) in the form of a first injection and as a booster 15 days later.

The other 3 batches are reserved for the tests.

The mice receive by the subcutaneous route a first injection and a booster 15 days later. The first injection and the booster each correspond to about 0.4 0.6 ml of the liposomal preparations of Examples 6, 7 and 8.

About 15 days after the booster, the mice are tested by intracerebral injection of 50 1 of a 10 suspension of brain cells of newborn mice previously infected with the SSPE isolate of the measles virus (Wild et al, J. Med. Virol. (1979) 4: 103).

This test indicates that the liposomes of Examples 6, 7 and 8 have an immunogenic action similar to that of VVTGFM1173.

0

N

Claims (8)

1. Ai RNA delivery ve. tor comprising a liposome and at least one messenger RNA fragment encoding an antigenic determinant characteristic of a tumor or of a pathogenic agent, the said at least one RNA fragment being en- capsulated in the said liposome.

2. An RNA delivery vector according to claim 1, comprising a liposome, at least one RNA fragment encoding an antigenic determinant characteristic of a tumor or of a pathogenic agent and one RNA fragment encoding an interleukine-2; the said at least one RNA fragment and the said RNA fragment encoding an interleukine-2 being encapsulated in the said liposome.

3. An RNA delivery vector according to claim 2, in which the said at least one RNA fragment and the said RNA fragment encoding an interleukine-2 being linked to each other so as to form a polycistronic RNA fragment.

4. An RNA delivery vector according to one of RN6A claims 1 to 3, in which the said at least one-BNA- frag- ment encodes an antigenic determinant characteristic of an influenza virus which is selected from the nucleo- capsid protein of the said virus and the hemagglutinin of the said virus.

An RNA delivery vector according to claim 4, in which a first RNA fragment encodes the nucleocapsid protein of the influenza virus and a second RNA fragment encodes the hemagglutinin of the influenza virus; the said first and second RNA fragments being linked to each other so as to form a polycistronic RNA fragment which is encapsulated in the said liposome.

6. A pharmaceutical composition intended for the treatment or the prevention of a tumor or of a disease induced by a pathogenic agent, which comprises as thera- peutic agent an RNA delivery vector according to one of claims 1 to 5, with a pharmaceutically acceptable diluent or carrier. 24

7. An RNA delivery vector substantially as hereinbefore described with reference to any one of Examples 1 or 3 to 8.

8. A method for the treatment or prophylaxis of disease induced by a pathogenic agent in a patient requiring said treatment or prophylaxis which method comprises administering to the said patient ai effective amount of at least one RNA delivery vector according to any one of claims 1 to 5 or 7 or of a composition according to claim 6. Dated 20 June, 1994 Transgene S.A. Pasteur Merieux Serums Vaccins S.A. Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON i 0 i [N:\LIBT101607:GSA