CA2080355C - Isolated viral protein cytokine antagonists - Google Patents

Abstract

Isolated viral proteins, and pharmaceutical compositions made therefrom, are disclosed which are capable of binding to cytokines, thereby functioning as cytokine antagonists. Also disclosed are processes for preparing isolated viral protein cytokine antagonists.

Description

1 2 0 8 ~ 3 5 5 72249-33 TITLE
Isolated Viral Protein Cytokine Antagonists BACKGROUND OF THE INVENTION
The present invention relates generally to the field of viral proteins, and more specifically to viral proteins having immunoregulatory activity.
Viruses are infectious particles which contain genetic elements that enable the virus to replicate within a living host cell. By sequencing the genes of viruses and analyzing the DNA
sequence, it has been possible to identify many open reading frames (ORFs) comprising long stretches of triplet codons beginning with a translation-initiation codon (preceded by a ribosomal binding site) and uninterrupted by a translational stop codon. Most ORFs in viruses, however, have not been shown to code proteins. For example, the genomic organization and DNA sequence of several ORFs from the telomeric region of Shope fibroma virus (SFV) have recently been characterized (Upton et al., Virology 160:20 ~1987)). Although it has been shown that these ORFs are transcriptionally active and code for mRNAs , no proteins encoded by these mRNAs have yet been identified or isolated, nor has any biological function for the putative proteins (as surmised from the ORF) been identified. Similarly, the DNA sequence of telomeric region of the myxoma virus has been obtained and several ORFs identified; however, no protein encoded by these ORFs has been identified, isolated or characterized.
The present invention identifies a specific class of viral proteins having immunosuppressive activity, and provides a method for identifying and isolating such viral proteins. The ,~

20~355 invention also provides pharmaceutical compositions for regulating immune responses.
SUMMARY OF THE INVENTION
The present invention provides isolated and substantially homogeneous viral proteins capable of binding tumor necrosis factor ~TNF) having cytokine antagonist activity and encoded by a T2 open reading frame of a poxvirus, and pharmaceutical compositions comprising such viral proteins for regulating immune responses together with a pharmaceutically acceptable diluent or carrier. The present invention also provides processes for preparing isolated viral proteins having cytokine antagonist activity.
The isolated viral proteins of this invention are similar to cytokine binding proteins, such as the extracellular region of a cytokine receptor, and are capable of binding a cytokine and preventing the cytokine from binding to its receptor.
The ability of such viral proteins to mimic the activity of a cytokine receptor (and thereby downregulate specific immune responses) enables the viral protein to circumvent the anti-viral defense mechanisms of the host organisms and confers a selective advantage to the virus. The viral proteins of the present invention can be used to regulate immune responses in a therapeutic setting.
The present invention specifically provides isolated Shope fibroma virus (SFV) T2 protein, which is an expression product of the SFV T2 open reading frame, and isolated myxoma virus (MV) T2 protein, which is an expression product of the ~8~5 2a 72249-33 myxoma T2 open reading frame. Both SFV T2 protein and myxoma T2 protein have TNF antagonist activity.
These and other aspects of the present invention will become evident upon reference to the following detailed description of the invention.
BRIEF DESCRIPTION OF THE SEQUENCES
SEQ ID NO:1 and SEQ ID NO:2 depict the cDNA sequence and derived amino acid sequence of the Shope fibroma virus (SFV) T2 open reading frame ~ORF). The SFV T2 ORF extends from nucleotide 1332 to 2306 and encodes an amino acid sequence designated as the c-phase reading frame. A preferred embodiment of the invention comprises the Shope Fibroma Virus T2 protein having the sequence of amino acids 1-325 of SEQ ID NO:1.
SEQ ID NO:3 and SEQ ID NO:4 depicts the cDNA sequence and derived amino acid sequence of the myxoma virus T2 ORF.
The myxoma T2 ORF extends from nucleotide 2 to 979 and encodes an amino acid sequence designated as the b-phase reading frame.
A preferred embodiment of the invention comprises the Myxoma Virus T2 protein having the sequence of amino acids 1-326 of SEQ ID NO:3.
DETAILED DESCRIPTION OF THE INVENTION
The immune system protects the human body from infection and disease through the interaction of specialized white blood cells which recognize and destroy invading microbes and diseased cells. White blood cells, including T cells, B cells, granulocytes and macrophages, are controlled and coordinated by specific proteins known as cytokines, which direct the development, proliferation, function and effectiveness of these .~

2~8~3~
2b 72249-33 cells. Cytokines act upon immune cells by contacting and attaching (i.e., binding) specific proteins called cytokine receptors which are located on immune cell surfaces. The binding of a cytokine to its specific receptor initiates a complex series of events within the responsive cell which translates the cytokine's signal to that cell. This signal can then stimulate cell division or production of antibodies, enzymes or other cytokines, thereby controlling and coordinating the function of immune cells located throughout the body. In their native configuration, receptor proteins are present as intact human plasma membrane proteins having an extracellular region which binds to a ligand, a hydrophobic transmembrane region which causes the protein to be immobilized within the plasma membrane lipid bilayer, and a cytoplasmic or intracellular region which interacts with proteins and/or chemicals within the cell to deliver a biological signal to effector cells via a cascade of chemical reactions within the cytoplasm of the cell. The extracellular region thus ~.
~. ~

wo 92/17583 PCr/US91/02207 3 2 ~ 8 ~ 3 5 S

defines a ~omqin of the ~ ol mo1ec!11P, to which a ligand can bind to transduce a biological signal.
The nçrmal ;.. ~n~ ~Q~G can be wP~I~Pnp~l by u.~l~1.t~ .. ;ng infection or other immllno~up~l~ssi~re conditions ~soçi~tp~d with the development of cancer. Immune5 system malfunction can also result in avln;~ e ~lice~es such as arthritis and diabetes, which result when a tnisdh~ct~l ;..... ~.-e l~ on~ d~ lu~s joint tissues or pancl~alic cells.
Tr~n~l~nt ~ L~u~,ntl~ suffer organ reje~tiQn~ in which the immnnP, system attacks the tr~n~1~nt~P~ organ as a foreign body. In other ;~ r, disorders, the imm~lne system OV~l~ to n~mal e nc~ , with foreign ~ub~-n~-es, resn1ting in allergic conditions or ~thm~ By~l~ucls of severe ;....... ~.. ne l~ seS can also be h~rmfi-1, for example, in the infl~ o.y con~litinn~ know as cachexia and septic shock. Furthe~ e, cytokine-directed: ~um~ *nn of white blood cells in l5i,~..~e to infection can lead to infl~ l"i1lt)~ ~
conditions which can exacerbate the severity of lung ~lise~se conditions such as Such misdil~t~,d or in~~ ,pliate immune l~onses may be coulltelacted by cytokine ~nt~gonistc~ which bind to the cytokine and pl~_nt the cytokine from binding to its l~c~ll~l, thereby inhibi*ng the in;~ ;ol- ûf an ;1~ 7~1~
The present invention relates to viral proteins which are c~rahle of m~~ ting the activity of cytokines by acting as ~;ylu~h~e ~nt~gonict~ The viral protdns of the present invêntion have a se~uence of amino acids which is similar to the ligand-binding region of a Cy~ i"e lCCel)lOl (e.g., the eAll~.ce~ r region of the receplor) or to a soluble cytokine ~ceplor and is c~p?ble of binding to the cytokine and pl~ ng the cytokine from binding to its l~C~pt~r.

Definition~
As used herein, the term "viral protein" refers to ~lV~eins encoded by RNA, DNA,mRNA or cDNA icol~ cl or otherwise derived from a viral source.
"Isolated", as used in the context of the present invention to define the purity of viral proteins, refers to proteins which are ~ubs~ ti~lly free of other human or viral proteins of natural or endogenous origin and contains less than about 1% by mass of protein co~ ul~ residual of ~l~luclion pç~cesses Such CC.n~pOSilionS, however, can contain other proteins added as stabilizers, carriers, ex~irientc or co-thel~ ;cs Isolated viral plote;ns are detectable as a single protein band in a polyacrylamide gel by silver st~ining A "cytokine" is a specific protein which directs the develo~ ent, proliferation,function and effectiveness of cells of the immune system. Specific examples of "cytokines" include, but are not limited to, the interleukins (e.g., IL-l, IL-2, IL-3, IL-4, _ 4 _ ~n~55 IL-5, IL-6, IL-7, IL-8), interferon ~IFNa and IFN~), tumor necrosis factor (TNFa and TNF~) and varlous growth factors, such as GM-CSF, G-CSF, and CSF-l. Each of the above cytokines transduces a blologlcal slgnal by blndlng to a receptor molecule speciflc to the cytoklne.
A vlral proteln havlng "cytoklne antagonlst actlvlty" lnhlblts, counteracts or neutralizes the blologlcal actlvlty of a cytoklne. Cytoklne antagonist activity may be effected by means of the viral protein sterically hindering the bindlng of a cykotine to lts receptor, thereby preventlng cytoklne signal transductlon. For example, a viral proteln can sterically hinder the binding of a cytoklne to its receptor by bindlng the cytoklne or its receptor at or near a slte requlred for cytoklne/receptor blndlng. The vlral proteln thus physlcally prevents cytokine and receptor from lnteracting and transduclng a blological slgnal. Specific examples of viral proteins having cytoklne antagonist actlvity lnclude polypeptldes encoded by the SFV T2 open readlng frame and the myxoma virus T2 openlng readlng frame, deslgnated hereln as SFV T2 proteln and myxoma vlrus T2 proteln, respectively. The DNA sequence of the open readlng frame encoding SFV T2 protein and the amlno acld sequence of SFV T2 protein is set forth in SEQ ID NO:l. The DNA sequence of the open reading frame encoding myxoma T2 protein and the amlno acld sequence of myxoma T2 proteln ls set forth ln SEQ ID
NO:3.
SFV T2 and myxoma T2 are TNF antagonlsts. Tumor _ 5 - 2 ~ 5 ~
necrosis factor-a (TNF~, also known as cachectin) and tumor necrosls factor-~ (TNF~ also known as lymphotoxin) are homologous mammalian endogenous secretory protelns capable of lnduclng a wlde varlety of effects on a large number of cell types. The great similarltles in the structural and functional characterlstics of these two cytoklnes have resulted ln their collectlve descriptlon as "TNF."
Complementary DNA clones encodlng TNFa (Pennica et al. ,Nature 312 724,1984) and TNF~(Gray et al.,Nature 312 721, lg84) have been isolated.
TNF initlates its blologlcal effect on cells by blndlng to speclflc TNF receptor proteln expressed on the plasma membrane of a TNF-responsive cell. It is believed that TNFa and TNF~ share a common receptor. The amino acld sequences of SFV T2 and myxoma T2 are simllar to the extracellular region of the receptor to which TNF blnds, and mimlc the TNF receptor by bindlng to TNF. SFV T2 and myxoma T2 thus lnhlblt blndlng of TNF to TNF receptor. Because of its ability to inhibit bindlng of TNF to TNF receptor, isolated SFV T2 and myxoma T2 protein compositions will be useful ln dlagnostlc assays for TNF, as well as ln raislng antibodies to SFV T2 and myxoma T2 for use ln dlagnosls and therapy. In addltlon, purified SFV T2 and myxoma T2 compositions may be used dlrectly ln therapy to bind or scavenge TNF, thereby providing a means for regulating the lmmune actlvities of TNF. In order to study the structural and blological characterlstlcs of SFV T2 and myxoma T2 and the - 6 - ~ 0 ~ ~ 3 ~ ~
roles played by SFV T2 and myxoma T2 ln the responses of varlous cell populatlons to vlral lnfectlon by SFV and MV, or to use SFV T2 and myxoma T2 effectlvely in therapy, diagnosis, or assay, purlfied compositions of SFV T2 and myxoma T2 are needed. Such compositions, however, are obtainable in practical ylelds only by clonlng and expresslng genes encoding the receptors using recombinant DNA technology.
The terms "TNF receptor" and "TNF-R refer to protelns havlng amlno acid sequences of the natlve mammallan TNF receptor amino acld sequences.
A "soluble cytokine receptor", as used in the context of the present inventlon, refers to a protein, or a substantlally equivalent analog, having an amino acid sequence corresponding to the extracellular region of a native cytokine receptor, for example polypeptldes having the amlno acid sequences substantially equlvalent to the extracellular reglon of TNF receptor. ~ecause soluble protelns are devold of a transmembrane reglon, they are secreted from the host cell ln whlch they are produced. Viral proteins havlng an amlno acld sequence sufflclently slmllar to the extracellular reglon of a cytoklne receptor or to a soluble cytoklne receptor wlll retaln the abllity to blnd the cytoklne and lnhlblt the ablllty of the cytoklne to transduce a signal vla cell surface bound cytokine receptor protelns. When admlnistered in therapeutic formulations, the viral proteins circulate in the body and bind to circulating cytokine molecules, preventing interaction of the cytokine with natural cytokine receptors 2~8~35~

and inhibiting transductlon of cytokine-mediated biological signals, such as immune or inflammatory responses.
A viral protein has "cytokine antagonlst activity"
lf the viral protein has a sequence of amlno acids "sufficiently similar" to either the extracellular region of a cytokine receptor or to a soluble receptor that the viral protein is capable of inhlblting bindlng of the cytoklne receptor to its ligand, thereby lnhlbltlng cytoklne slgnal transduction. Assays for determinlng cytokine binding inhibition are described below in Example 1. Inhibition of cytokine slgnal transductlon can be determined by transfecting cells with recombinant receptor DNAs to obtain recombinant receptor expression. The cells are then contacted with the cytoklne llgand and the resulting metabollc effects examined.
If an effect results which is attributable to the action of the ligand, then the recombinant receptor has signal transducing activity. Exemplary procedures for determinlng whether a polypeptide has signal transducing activity are disclosed by Idzerda et al., J. Exp. Med. 171:861 (1990);
Curtis et al., Proc. Natl . Acad . Scl . U. S. A 86 3045 (1989);
Prywes et al., EMBO J. 5:2179 (1986); and Chou et al.,J. Biol .
Chem. 262:1842 (1987). Alternatively, primary cells of cell lines which express an endogenous cytokine receptor and have a detectable blologlcal response to the cytokine could also be utilized. Such procedures are used as controls for assaying lnhlbltion of signal transductlon by the vlral proteln cytokine antagonlsts of the present lnventlon.

- 7a - 2 ~

"Recomblnant," as used herein, means that a protein is derived from recombinant (e.g., microbial or mammalian) expression systems. "Microbial" refers to recombinant proteins made in bacterial or fungal (e.g., yeast) expression systems. As a product, "recombinant microbial" defines a protein produced in a mlcrobial expression system whlch is essentially free of native endogenous substances. Protein expressed in most bacterial cultures, e.g., E. col ~, will be free of glycan. Protein expressed in yeast may have a glycosylatlon pattern different from that expressed in mammalian cells.
"Biologically active," as used throughout the specification as a characteristic of a cytokine or a cytokine receptor, means that a particular molecule shares sufficient amlno acid sequence similarity with the cytoklne or receptor to be capable of binding detectable quantities of the cytoklne, or cross-reactlng with anti-cytokine antibodies raised against the cytokine from natural (i.e., nonrecombinant) sources.
"DNA sequence" refers to a DNA polymer, in the form of a separate fragment or as a component of a larger DNA
construct, which has been derived from DNA isolate at least once in substantially pure form, i.e., free of contaminating endogenous materials and in a quantity or concentration enabling identification, manipulation, and recovery of the sequence and its component nucleotide sequences by standard biochemical methods, for example, using a cloning vector.

C 7224~-33 2 ~
- 7b -Such sequences are preferably provided ln the form of an open reading frame uninterrupted by internal nontranslated sequences, or introns, which are typically present in eukaryotic genes. Genomic DNA containing the relevant sequences could also be used. Sequences of non-translated DNA
may be present 5'or 3' from the open reading frame, where the same do not interfere with manipulation or expression of the coding reglons.
The viral protelns of the present lnventlon having cytokine antagonist activity are identified by isolating and then analyzlng a viral protein, RNA, DNA, mRNA or cDNA to provide an amino acid sequence of the viral protein. The amino acid sequence of the viral protein is then compared with the amino acid sequence of a cytokine or cytokine receptor and those viral proteins are selected and isolated which have a sequence of amino acids sufficiently similar to an extracellular region of a cytokine receptor or a soluble cytoklne receptor that the viral protein is capable of inhibiting binding of the cytokine receptor to its ligand.
Alternatively, viral proteins can be selected and isolated which have a sequence similar to a cytokine and are capable of binding to a cytoklne receptor (without transducing a cytokine signal) and inhibiting binding of the cytokine to its receptor.
Alternative methods for identlfying viral proteins having cytokine antagonist activity include selecting a viral RNA, DNA, mRNA or cDNA capable of hybridization under - - 7c - 2 ~
moderately stringent conditions (50~C, 2x SSC) to DNA or cDNA
clones encodlng a cytokine blndlng proteln and isolatlng the protein. DNA or RNA sequences capable of hybridization to DNA
clones encoding a cytokine blndlng proteln under such condltlons would be expected to be sufflciently similar to the cytokine binding protein to be capable of bindlng to the cytokine and inhlbltlng blnding of the cytokine to lts receptor.
Proteins and Analoqs The present inventlon provides isolated proteins having cytoklne antagonlst actlvlty. Such proteins are substantially free of contaminating endogenous materials and, optlonally, without associated native-pattern glycosylation.
Derivatives of the viral proteins within the scope of the invention also include various structural forms of the prlmary protein whlch retaln biological actlvity. Due to the presence of ionizable amino and carboxyl groups, for example, a protein ~ may be in the form of acidic or basic salts, or may be in neutral form. Individual amino acid residues may also be modified by oxidation or reduction.
The primary amino acid structure may be modifled by forming covalent or aggregative con~ugates wlth other chemical moietles, such as glycosyl groups, lipids, phosphate, acetyl groups and the like, or by creatlng amlno acid sequence mutants. Covalent derlvatlves are prepared by linklng particular functional groups to amino acid slde chains or at the N- or C-termini. Other derivatlves of the proteln wlthin 7224g-33 - 7d - 2 ~
the scope of thls lnvention include covalent or aggregative conjugates of the protein or its fragments wlth other protelns or polypeptldes, such as by synthesis ln recomblnant culture as N-termlnal or C-terminal fusions. For example, the coniugated peptide may be a signal (or leader) polypeptide sequence at the N-terminal region of the protein which co-translationally or post-translationally directs transfer of the protein from its site of synthesis to its site of function inside or outside of the cell membrane or wall (e.g., the yeast a-factor leader). Protein fusions can comprise peptides added to facilitate purification or identification of viral proteins (e.g.,poly-HIS). The amino acid sequence of the viral proteins can also be linked to the peptide Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (DYKDDDDK) (Hopp et al., B~o/Technology 6:1204,1988.) The latter sequence is highly antigenic and provides an epitope reversibly bound by a specific monoclonal antibody, enabling rapid assay and facile purification of expressed recombinant protein. This sequence is also specifically cleaved by bovine mucosal enterokinase at the residue immediately following the Asp-Lys palring. Fusion proteins capped with this peptide may also be resistant to intracellular degradation in E. col i .
Protein derivatives may also be used as immunogens, reagents in receptor-based immunoassays, or as binding agents for affinity purification procedures of cytokines or other binding ligands. Viral protein derivatlves may also be obtalned by cross linking agents, such as M-malelmidobenzoyl 2 ~
- 7e -succinlmlde ester and N-hydroxysuccinlmlde, at cystelne and lyslne residues. Protelns may also be covalently bound through reactive side .

wo 92/17583 Pcr/uS9l/02207 8 2~
groups to various incoluble substrates, such as ~,~anGgen bromide-activated, bisoxirane-activated, call,G"yldiimirlq7Qle-aclivalcd or tosyl-activated agarose structures, or by adsorbing to polyolefin surfaces (with or without glutaraldehyde cross-linking). Once bound to a substrate, proteins may be used to selectively bind (for purposes of assay or S p~1rifir~tion) ~ntiwies raised against the viral protein or against cytokine l~,C~)lOrS which are sirnilar to the viral protein.
The present invention also ii.c1~dGs viral proteins with or WilhUUI acsoc;~l~d native-pattern glyco~ylation. I~ot~,;ns eA~,ess~ in yeast or ...~ n eA~ ,ssion systems, e.g., COS-7 cells, may be similar or slightly dirr~ .-t in mo1e~ r weight and glycosylation 10 pattern than the native molecules~ ~pe~d;ng upon the eA~r~ssion system. Expression of viral DNAs in bacte i~ such as E. coli provides non-glycosylated molecules. Functional mutant analogs of viral protein having inactivated N-gly~o~ylation sites can be produced by oligonucleotide synthesis and ligation or by site-~l~e~-;r~c mutagenesis techniques. These analog proteins can be produced in a ho.llogeneous, reduced-carbohydrate form in good 15 yield using yeast eA~l~ssion sy~."s. N-~;lycosylation sites in eukaryotic proteins are Chal .Ch- ;7f~ by the amino acid triplet Asn-Al-Z, where Al is any amino acid except Pro, and Z is Ser or Thr. In this s~u~nce, asparagine provides a side chain amino group for covalent attachment of calbohyd,ale. Such a site can be ç1i..~ ~ by subs~ ;ng another amino acid for Asn or for residue Z, deleting Asn or Z, or inserting a non-Z amino acid between Al and Z, or an s~mino acid other than Asn between Asn and Al.
Viral protein derivatives may also be ob~ ~ by mut~tions of the native viral proteins or its subunits. A viral protein m.1t~nt, as referred to herein, is a polypeptide homologous to a viral protein but which has an amino acid sequence dirr~,~nt from the native viral protein because of a deletio~ ins.,llion or substitution.
Bioequivalent analogs of viral p ote;ns may be constructed by, for example, making various substitutions of residues or se-luences or deleting lel.l~nal or internal residues or s~c~-ces not needed for biological activity. For example, cysteine residues can be deleted or l~,l,lac~d with other amino acids to prevent fnrmation of i lcc,ll~~ le. ~ r ~ 11fi~1e bridges upon renaturation. Other approaches to mnt~genesi~ involve modification of a~ cent dibasic amino acid residues to enhance eA~l~ssion in yeast systems in which KEX2 protease activity is present. Generally, subsLilulions should be made conservatively;
i.e., the most preferred substitute amino acids are those having physicochemicalCh~CIf ~ ;SI;CS resembling those of the residue to be replaced. Similarly, when a deletion or insertion strategy is adopted, the potential effect of the deletion or insertion on biological activity should be considered. Subunits of viral proteins may be constructed by deleting t~min~1 or intern~l residues or sequences.

2 ~ 5 j 72249-33 Mutations in nucleotide sequences constructed for expression of analog viral proteins must, of course, preserve the reading frame phase of the coding sequences and preferably will not create complemçnt~ry regions that could hybridize to produce secondary mRNA structures such as loops or hairpins which would adversely affect translation of the 5 receptor mRNA. Although a mutation site may be predetermined, it is not necessary that the nature of the mutation per se be predetermined. For example, in order to select for optimum characteristics of mutants at a given site, random mutagenesis may be conducted at the target codon and the expressed viral protein mutants screened for the desired activity.
Not all mutations in the nucleotide sequence which encodes a viral protein will be 10 expressed in the final product, for example, nucleotide substitutions may be made to enhance expression, primarily to avoid secondary structure loops in the transcribed mRNA
- (see EPA 75,444A) or to provide c~odons that are more readily translated by the selected host, e.g., the well-known E. coli preference codons for E. coli expression.
Mutations can be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion.
Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered gene having particular codons altered according to the substitution, deletion, or insertion required. Exemplary methods of making the alterations set forth above are disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic En8ineering: Principles and Me~f7ods, Plenum Press, 1981); and U.S. Patent Nos.

4,518,584 and 4,737,462 disclose suitable techniques, Expression of Recombinant Viral Protein Cvtokine Anta~onists The proteins of the present invention are preferably produced by recombinant DNA30 methods by inserting a DNA sequences encoding viral protein into a recombinant expression vector and expressing the DNA sequence in a recombinant microbial expression system under conditions promoting expression.
DNA sequences encoding the proteins provided by this invention can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of 35 oligonucleotides, to provide a synthetic gene which is capable of being inserted in a recombinant expression vector and expressed in a recombinant transcriptional unit.

Wo 92/17583 pcr/us91/o22o7 1 0 ~

Recombin~nt e~piession vectors inclurle synthetic or cDNA-derived DNA
fr~gnn~ntc encotling viral plot~,;ns or bioequivalent analogs operably linked to suitable tran~ ional or ll ~)Cl~l;onsl re~ t~?ry el~ t~ derived from .. ~.. ~li~n, microbial, viral or insect genes. Such regulatory c4 ~nl~ include a transcriptional promoter, an S option~l o~,~lol s~l~ ncc to control t~,..-C~ ;nn a s~uence e-~co~ suitable mRNA
ribGso~al bin~ling sites, and se~en~es which control the ~ I;on of ~ s~;lip~ion and l~n~Cl~l;nn, as ~es~ibe~ in detail below. The ability to l~plif ~t in a host, usually conf~ d by an origin of reFlir~tinn, and a s~ ;o~- gene to facilitate recognition of ~ Ç~ n may -~liti~nslly be incc.l~ulaled. DNA l~,gions are operably linked when they are 10 ~ ;on~lly related to each other. For ~ Tte~ DNA for a signal peptide (se~ ,tuly leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor which participates in the secretion of the polypeptide; a ~lulllOt~,l is operably linked to a coding sequcnce if it controls the l-ans~ ion of the sequence; or a ribosoll.c binding site is operably linked to a coding sequence if it is positioned so as to permit translation.
15 Generally, operably linked means contiguous and, in the case of sec~toly leaders, conti~lous and in reading frame.
DNA sequences encoding viral proteins which are to be expressed in a micloolganism will preferably co~t~in no introns that could prematurely ~l,llillate c., ;p~;on of DNA into mRNA. Due to code degen-, acy, there can be considerable 20 variation in nucleotide sequences enco~ling the same amino acid sequence. Other embo l;.... l.t~ include sequcnces capable of hybridi~ing under moderately stringent conAitinns (50 C, 2x SSC) to the DNA sequences el~co~ g viral proteins, and other se~u~ es which are de~"-~ t~ to those which encode the viral proteins.
Tl~,srulllled host cells are cells which have been ll~u,sÇul,lled or transfected with 25 ~;A~ ,s:,ioll vectors consllucl~d using l~o~ ânt DNA tecl~niques and which contain se~u~,nces c-.~l;.-g the viral plu~ins of the present invention. Tl~l~rul,lled host cells may express the desired viral protein, but host cells ll~n~rulllled for ~ul~oses of cloning or amplifying viral DNA do not need to eA~l~,ss the viral protein. EA~l~ssed viral proteins will pl~,f~,.ably be ~l~,t~l into the culture ~u~lla~lt, d~ ;..g on the DNA selected, but 30 may be A~e~osi~ed in the cell membrane. Suitable host cells for eA~ssion of viral proteins include prok~u~oles, yeast or higher eukaryotic cells under the control of ~r~p,iate pl~ut~ . Prokaryotes include gram negative or gram positive org~nism~ for example E.
coli or bacilli. Higher eukaryotic cells include est~bli~h~ cell lines of ~ n origin as described below. Cell-free translation systems could also be employed to produce viral 35 proteins using RNAs derived from the DNA constructs disclosed herein. Appropriate cloning and tA~lession vectors for use with bacterial, fungal, yeast, and m~mm~ n cellular hosts are described by Pouwels et al. (Cloning Vectors: A Laboratory Manual, 2 ~ 7224g-33 Elsevier, New York, 1985)..

Prokaryotic expression hosts may be used for expression of viral proteins that do not require extensive proteolytic and disulfide processing. Prokaryotic expression vectors 5 generally comprise one or more phenotypic selectable markers, for example a gene encoding proteins conferring antibiotic resistance or supplying an autotrophic requirement, and an origin of replication recognized by the host to ensure amplification within the host.
Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium, and various species within the genera Pseudomonas, Streptomyces, and lO Staphylococcus, although others may also be employed as a matter of choice.
Useful expression vectors for bacterial use can comprise a selectable marker andbacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chernicals, Uppsala, 15 Sweden) and pGEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone"sections are combined with an appropriate promoter and the structural sequence to be expressed. E. coli is typically transformed using derivatives of pBR322, a plasmid derived - from an E. coli species (Bolivar et al., Gene 2:95, 1977). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides simple means for identifying transformed cells.
Promoters commonly used in recombinant microbial expression vectors include the ~-lactamase (penicillinase) and lactose promoter system (Chang et al., Nature 275:615, 1978; and Goeddel et al., Nature 281:544, 1979), the tryptophan (trp) promoter system (Goeddel et al., Nucl. Acids Res. 8:4057, 1980; and EPA 36,776) and tac promoter(Maniatis, Molecular Cloning: A Labora~ory Manual, Cold Spring Harbor Laboratory, p.
412, 1982). A particularly useful bacterial expression system employs the phage ~ PL
promoter and cI857ts thermolabile repressor. Plasrnid vectors available from the American Type Culture Collection which incorporate derivatives of the ~ PL promoter include plasmid pHUB2, resident in E. coli strain JMP.9 (ATCC 37092) and pPLc28, resident in E. coli RR1 (ATCC 53082).
Recombinant viral proteins may also be expressed in yeast hosts, preferably fromthe Saccharomyces species, such as S. cerevisiae. Yeast of other genera, such as Pichia or Kluyveromyces may also be employed. Yeast vectors will generally contain an origin of replication from the 211 yeast plasrnid or an autonomously replicating sequence (ARS), promoter, DNA encoding the viral protein, sequences for polyadenylation and transcription termination and a selection gene. Preferably, yeast vectors will include an origin of replication and selectable marker permitting transformation of both yeast and E. coli, e.g., WO 92/17583 PCr/USgl/02207 12 2 Q ~
the qmp;cillin ~ ce gene of E. coli and S. cere~,~isiae trpl gene, which provides a s ~ rna~er for a mutant strain of yeast lacking the ability to grow in ~ ,tu~,hall, and a promoter derived from a highly e.~ SSed yeast gene to induce ~ n~ ;c~n of a ,llu;~
se~luencc do. nsl,~. The ~l~sence of the trpl lesion in the yeast host cell genome then 5 provides an effective envuu.~nt for ~1e~ g l-~,sr~lmation by growth in the absence of tryptophan.
Suitable p~moter sequcnces in yeast vectors include the plo.-,oters for metall~ n-~ ;n, 3-phc,s~hQ~,lyc~,~te kinase (TT;I,~ n et al., J. Biol. Chem. 255:2073, 1980) or other glycolytic e.lLylllcs (Hess et al., J. Adv. Enyme Reg. 7:149, 1968; and 10 Holland et al., Biochem. 17:4900, 1978), such as enol-q-ce~ glyceraldeh~de-3-phosphate dehydrogenase, he~ nq~e~ pyruvate decalbo~ylase, phosph~-fructokinase, glucose-6-phosphqte ison~ sc, 3-phosphoglyce,~ate mutq-~e~ pyluvale kinase, triosephosphate isomerase, lJho*,hoglucG3e iso,l.~,.ase, and glucokinase. Suitable vectors and promoters for use in yeast ~ ssion are further des~ibe~l in R. 1~ n et al., EPA 73,657.
I~,f~ d yeast vectors can be !q-~sc .. bl~ using DNA se~lucnces from pBR322 forS-'lf~;OI~ and replic~qtion in E. coli (Ampr gene and origin of replic-q-tion) and yeast DNA
se~ ,nces inc~ in~ a ~llJcose~ s;ble ADH2 l"~"l,ot~ and ~-factor secretion leader.
The ADH2 pl~lllOt~ has becn ~les~ibe~ by Russell et al. (J. Biol. Chem. 258:2674, 1982) and Beier et al. (Nature 300:724, 1982). The yeast ~-factor leader, which directs 20 secrction of heterologous proteins, can be i~,h~ .~n the ~l.,llloll,, and the structural gene to be ~,A~ ,SS~l. See, e.g., Kurjan ct al., Cell 30:933, 1982; and Bitter et al., Proc.
Natl. Acad. Sci. USA 81:5330, 1984. The leader se~ - ~ce may be mo-lified to contain, near its 3' end, one or more useful restrictiQn sites to fp~ilit~te fusion of the leader sequence to foreign genes.
Suitable yeast ~ sr(~ ;on prolocols are known to those of skill in the art; an eYemrl~ry technique is ~lescribe~ by Hinnen et al., Proc. Natl. Acad. Sci. USA 75:1929, 1978, s~le~ -g for Trp+ tl~tl-Sr~ in a selecdve ,~ ., consicting of 0.67% yeast n i~ n base, 0.5% c~c .~..;no acids, 2% glncose, 10 llg/ml n1rnine and 20 llg/ml uracil.
Host strains t,~.sro.-.,ed by vectors comprising the ADH2 plv..lot~r may be grown 30 for e~ ssion in a rich .~5A;,...~ consisting of 1% yeast extract, 2% peptone, and 1%
glucose supplr-..F ~led with 80 llg/ml ~clçnine and 80 ~lg/ml uracil. D~ ,pl~ssion of the ADH2 pl~t~l occurs upon rYh~l~stion of .nf-l;-- -- g1UCQSe. Crude yeast ~up~ -atants are harvested by filtrati~n and held at 4 C prior to further p~.. ;r~ ;on Various l.~.. ~li~n or insect cell culture systems can be employed to express 35 recombin~nt protein. Baculovirus s~sle.l~s for production of heterologous proteins in insect cells are reviewed by Luckow and Sullllll.,l~, BiolTechnology 6:47 (1988).
FYAmpl~s of sl~it~hle .~u~"~Ali~n host cell lines include the COS-7 li les of monkey kidney 2 ~

cells, described by Gluzman ( Cell 23:175, 1981), and other cell llnes capable of expresslng an appropriate vector including, for example, L cells, C127, 3T3, Chinese hamster ovary (CH0), Hela and BHK cell lines. Mammalian expression vectors may comprise nontranscribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other 5' or 3' flanking nontranscribed sequences, and 5' or 3' nontranslated sequences, such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences.
The transcriptlonal and translational control sequences in expression vectors to be used in transforming vertebrate cells may be provided by vlral sources. For example, commonly used promoters and enhancers are derived from Polyoma, Adenovrius 2, Simian Virus 40 ~SV40), and human cytomegalovirus. DNA sequences derived from the SV40 viral genome, for example, SV40 origin, early and late promoter, enhancer, splice, and polyadenylation sites may be used to provide the other genetic elements required for expression of a heterologous DNA sequence. The early and late promoters are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature Z73:113, 1978). Smaller or larger SV40 fragments may also be used, provided the aproximately 250bp sequence extending from the Hlnd III site toward the BglI site located in the viral origin of 3 ~ ~
- 13a -repllcatlon is included. Further, viral genomic promoter, control and/or signal sequences may be utlllzed, provlded such control sequences are compatible wlth the host cell chosen.
Exemplary vectors can be constructed as disclosed by Okayama and Berg (Mol. Cell. ~iol. 3:280, 1983).
A useful system for stable high level expresslon of mammalian receptor cDNAs in C127 murine mammary epithellal cells can be constructed substantlally as descrlbed by Cosman et al. (Mol. Immunol. Z3 935, 1986).
A partlcularly preferred eukaryotic vector for expression of viral protein DNA is diclosed below in Examples 2 and 6. This vector, referred to as pCAV/NOT, was derived from the mammalian high expression vector pDC201 and contains regulatory sequences from SV40, adenovirus-2, and human cytomegalovirus.
Purified viral proteins or analogs are prepared by culturing sultable host/vector systems to express the recombinant translatlon products of the DNAs of the present lnventlon, which are then purified from culture media or cell extracts.
For example, supernatants from systems which secrete recombinant protein into culture media can be first concentrated using a commercially available protein ~C

2~8~3~
- 13b -concentratlon filter, for example, an Amicon* or Millipore Pellicon~ ultrafiltratlon unit. Following the concentration step, the concentrate can ~e applied to a suitable purification matrix. For *Trade-mark W O 92/17583 PC~r/US91/02207 2 ~
~h...l.le a suitable affinity matrix can comprise a viral protein or lectin or antibody molecule bound to a suitable ~uppu~ ternqtively~ an anion eYchqnge resin can be employed, for c~ le, a matrix or s-lb ,~.~t~ having ~ ...i~ diethyl~ h-o ll.yl (DEAE) groups. The mqtriGes can be ~l~ e~ agarose, dextran, cellulose or other types c~... nly employed in protein ~.. ;r.~ ternq~tively~ a cation eYchqnge step can be employed. Suitable cation eYchqn~ers include ~ ious insoluble ...~I~;ces comprising sulro~l ap~l or C~bUA~ 1 grwps. Sulro~lu~ l groups are pl~fe,~
Finally, one or more l~ ed-phase high ~.Ç~,l~al ce liquid c~u~&lugraphy (RP-HPLC) steps employing h~dr~hobic RP-HPLC media, e.g., silica gel having pendant 10 methyl or other aliphatic groups, can be employed to further purify a viral protein cQ~.l o~;l;on Some or all of the Çc,l~ing purtfi~qti~n steps, in various combin~tions, can also be 5:- rlv~cd to provide a h~ ~us 1~..~l.;.,-..l protein.
Recu...l.;..~l viral protein l!luluc~ in bacterial culture is usually isol-q-t~A by initial eytr~ctio~ from cell pellets, followed by one or more col~ce~ t~ ;Qn~ salting--out, aqueous ion eYchqn~ or si~ exclusion cL~ o~.i.ph~ steps. Finally, high ~lr~.. ~nre liquid chnomalography (HPLC) can be employed for final pllrificAtion steps. Microbial cells employed in ~;A~l~ssion of l~colllbil~ l viral protein can be disTupted by any convenient methQd inclu~ling freeze-thaw cycling, sonir~tion~ ...ech~nirAl disruption, or use of cell lysing agents.
Fe~ ;Qn of ycast which CA~ S viral protein as a sccl~,ted protein greatly simplifies pnrifir~tion. Secreted recûn-hil-Al-l protein resnl ing from a large-scale Ç~.,,.f nlAI;on can be purified by ...- ll.Q~s analogous to those ~i~close~l by Urdal et al. (J.
Chromatog. 296:171, 1984). This l~Çe.~,.ce describes two seq~fntiAl~ reversed-phase HPLC steps for pllrific~tion of recombinant human GM-CSF on a ~ tive HPLC
25 colllrnn Viral protein syntheci7ed in l.co~hil-~nl culture is cha~ .t ;~ by the presence of non-viral cell com~oncllts, inchl~ling plut~ns, in ~...o.-nl~ and of a cll~dct,l which depend upon the pnnfir~tion steps taken to recover the viral protein from the culture. These c~...ponel.t~oldill~ilywillbeofyeast,prokaryoticornon-humanhighereukaryoticorigin 30 and preferably are present in innocllollc conl~ ;nAnl qll~ntities~ on the order of less than about 1 percent by weight. Further, leu-...h;nAnt cell culture enables the pluduclion of viral protein free of other ~lol~ills which rnay be nt~rmAlly AccociAted with the viral protein as it is found in nature in its species of ~igin, e.g. in cells, cell eY-ldAtes or body fluids.

35 Administration of Viral Protein Coll"~ilions The present invention provides methods of using therapeutic compositions com~icing an effective Amollnt of a viral protein and a suitable diluent and carrier, and W O 92/17583 PC~r/US91/02207 15 2 ~ ~ ~ 3 ~ 5 meth~1~ for re~ ting an ;.. ~ e ~ se. The use of SFV T2 and myxoma T2 proteins in co~ clirm with soluble cytokine l~cep~ , e.g., TNF l~ ol, is also co~ pl~t~A
For Ihe~ ;c use, pllfified viral protein is ~ h~;n;cr~ .~d to a patient, preferably a human, for ~ nl in a ~c, al,~,lu~liate to the inrlir~ti- n Thus, for exarnple, SFV
S T2 and myxoma T2 protein c~ os;l;nnc s l~ t~ ~.,d to ~u~ SS ;~ -e function can be given by bolus inje.,lion, continnous infusion, s ~ e~ release from impl~nt~, or other sllit~ble DccLi ique. Typically, a th~.a~e.llic agent will be ~1min;~r~ d in the form of a co..~ ;l;nn co~ -g pllfifi~A protein in conj~nc!;nn with physiologically acceptable c~ffie~S excipients or r~ ]ent~ Such carfiefs will be nol~" - ;c to recipients at the ~los~ges 10 and c~--c~-nl-~t;Q--s e~plG~l. Ordinarily, the l,.~a.alion of such c~.-l~s;tions entails ccl---h;f~ g the viral protein with buffers, ~ntioyi~ t~ such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, p~vt~,ins, arnino acids, carbohydrates illcluding ~luc~se~ ~uclose or ~extfin~ Çl-P~ g agents such as EDTA, glutathione and other stabili~rs and excip;enls. Neutral burrel~d saline or saline mixed with con~pec-ific 15 serum albumin are eYempl~ry a~lvpl;ate ~lilventc Preferably, pl~lucl is fornn~llatYl as a lyophili7~te using a~lo~l;ate excipient solutions (e.g., sucrose) as rlilvent~ Appropriate ~los~çs can be ~ete....;n~.d in trials. The s~ t and Ll~u.,ncy of admillisl,~tion will depe-n-l, of course, on such factors as the nature and severity of the ;. ,.1;~ ~ ;OI~ being treated, the desired l~ once~ the con-lition of the patient, and so forth.
SFV T2 and myxoma T2 proteins are a~1min;~t~ d for the pUl~,ose of inhil~iting TNF de~ ~o~ces. TNF is used clinirally as an ant;n..no~ agent and results in severe to~icitiçs~ The toYiCities a~soc;~ with the ~ l..,;n;~ of TNF are idçntical to the effects that the cytokine ...~,-;r.,~ when it is l)loduced in normal or ov~ e immlme l~;,ponses. It is believed that TNF produced as a result of the illll~ nc response to 25 mali~nant dssue is a causatdve factor of cachexia. In addidon, TNF is produced in the course of other ;..~.~....-e re-~çtions such as the body's 1~ s~n~ to severe b~cttorial infection where TNF ~ cl;on can contrib~lte to the devlopment of sepdc shock. The production of other key c~kil~es (IL-1, IL-2 or a .-~....~,r of colony stimlllatin~ factors) can also induce ~ nific~nt host ~lollJcl;on of TNF. Thus, the side effects of these cytokines at certain doses a~lminictered to human l,~t;----ls have been athibuted to the in~ ction of TNF
pro~lvction. nec~se TNF binds to a specific TNF l~,ceplor ~l~,sent on the surface of n,s~nsei~e cells, viral TNF antagoni~t~ such as SFV T2 and myxoma T2 may be useful as a lLel~" for cacheyia or sepdc shock or to treat side effects associated with cytokine therapy.
The following examples are offered by way of illustration, and not by way of .

llmitatinn, - 16 - a ~
EXAMPLES

Bindlnq AssaYs A . Radiolabel lng of TN~a and TNF~. Radlolabeled TNFa and TNF~ (used in varlous assays for TNF antagonists) was derived as follows. Recomblnant human TNFa, ln the form of a fuslon protein containing a hydrophlllc octapeptlde at the N-termlnus, was expressed ln yeast as a secreted proteln and purified by afflnity chromatography (Hopp et al., Bio/Technology 6:1204, 1988). Purlfled recomblnant human TNF~
was purchased from R&D Systems (Mlnneapolis, MN). Both proteins were radiolabeled to a speclfic activity of 2 x 1015 cpm/mmole using the commerclally avallable solld phase agent, Iodogen*(Pierce). In this procedure, 5 ~g of Iodogen was plated at the bottom of a 10 x 75 mm glass tube and incubated for 20 minutes at 4~C wlth 75 ~1 of O.lM sodium phosphate, pH
7.4 and 20 ~1 (2 mCi) Na 125I. Thls solution was then transferred to a second glass tube containlng 5 ~g TNFa (or TNF~) in 45 ~1 PBS for 20 mlnutes at 4~C. The reaction mixture was fractionated by gel filtratlon on a 2ml bed volume of Sephadex G-25* (Sigma) equillbrated ln Roswell Park Memorial Institute (RPMI) 1640 medlum contalnlng 2.5% (w/v) bovlne serum albumin (BSA), 0.2% (w/v) sodlum azlde and 20 mM
Hepes pH 7.4 (blnding medium). The flnal pool of 125I-TNF was diluted to a working stock solution of 1 x 10 7 M in binding *Trade-mark 2 ~

medium and stored for up to 3 weeks at 4~C without slgnificant loss of receptor blnding activlty.
B. Detection of SFV T2 ~inding to TNF Receptors.
Two separate bindlng assays were used to measure T2 proteln binding to TNF receptors. In the first method, the presence of SFV T2 ln COS-7 cell supernatants was measured by inhibitlon of 125I-TNFa blndlng to U937 cells. Supernatants from COS cells transfected wlth recomblnant SFV T2 ORF
constructs were harvested three days post-transfectlon.
Serial two-fold dilutions of this supernatant were pre-incubated wlth 0.3nM 125I-TNFa (speclflc actlvlty 1 x 1015 cpm/mmole) for two hours at 4~C prior to the addit ion of 2 x 106 U937 cells. The cells are incubated for an additional two hours at 4~C, after whlch free and cell bound human 125I-TNFa were separated using a pthalate oil separation method (Dower et al., J. Immunol .132: 751, 1984) essentially as described by Park et al. (J. Biol. Chem. 261:4177, 1986). Non-specific llgand blndlng in all assays was determined by the lncluslon of a 200 molar excess of unlabeled llgand.
In the second method, 125I-TNF bindlng of T2 protein was detected directly by nitrocellulose dot blots. The abllity of TNF receptor or T2 to be stably absorbed to nitrocellulose from detergent extracts of human cells yet retaln bindlng activity provided a means of detecting T2.

- 17a - 2 ~
Cell extracts were prepared by mixing a cell pellet with a 2 x volume of PBS contalnlng 1% Trlton X-100* and a cocktail of protease inhibltors (2mM phenylmethyl sulfonyl fluoride, 10~M
pepstatin, 10~M leupeptin, 2 mM o-phenanthroline and 2 mM
EGTA) by vlgorous vortexing. The mixture was incubated on ice for 30 mlnutes after whlch lt was centrlfuged at 12,000 x g for 15 minutes at 8~C to remove nuclei and other debris.
Alternatlvely, recomblnant T2 proteln in the form of COS
supernatants were mlxed with an equal volume of PBS/1% Triton X-100 and a cocktall of the same protease lnhlbltors. Two mlcroliter aliquots of cell extracts or T2 protein extracts were placed on dry BA85/21* nitrocellulose membranes (Schleicher and Schuell, Keene, NH) and allowed to dry. The membranes were incubated in tissue culture dishes for 4 hours in Tris (0.05 M) buffered saline (0.15 M) pH 7.5 containing 3%
w~v BSA to block nonspecific bindlng sites. The membrane was then covered with 5 x 10 11 M 125I-TNF in PBS + 3% BSA and incubated for 2 hr at 4~C with shaking. At the end of this time, the membranes were washed 3 times ln ice-cold PBS, dried and placed on Kodak X-Omat AR* film for 18hr at -70~C.
B~ample 2 Expression of the SFV T2 ORF
A vector (pKTH-l) containing the Shope Fibroma Virus T2 opening reading frame (SFV T2 ORF) cloned lnto pUCl9 was obtained from Dr. Grant McFadden of the University of Alberta, *Trade-mark 2~8~3~
- 17b -Edmonton, Canada. A SpeI/BamHI restrlctlon fragment contalnlng a ma~orlty the SFV T2 open readlng frame was exclsed from pKTH-l by dlgestlng wlth SpeI and BamHI
restrlctlon enzymes, resultlng ln a partlal SFV T2 ORF cDNA
fragment from whlch had been deleted the flrst 7 codons lincludlng the ATG initiatlon codon) of the 5' terminus. The 5' terminal coding sequence was reconstructed by llgating to the partial SFV cDNA fragment the following synthetic oligonucleotide, which incorporated a consensus sequence for optimum translation initiation and contained a 5' terminus compatible with an Asp718 restriction site:

Asp718 SpeI

GTACCGCCACCATGCTTCGTTTAATTGCACTA
GCGGTGGTACGAAGCAAATTAACGTGATGATC

The resulting cDNA was ligated into the eukaryotic expression vector pDC302 which was digested with the Asp718 and BglII
restriction enzymes. pDC302 has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD 20842, USA, under the name pCAV/NOT-IL-7R, Accession Number 68014. The resultlng wo 92/17S83 PCr/US91/02207 ,s~ion vecto~ was ~lrci~qt~ pDC302-SFVT20RF. pDC302 was q~sembled from pDC201 (~escrihed by Sims et al., Science 241:585, 1988 and derived from pMLSV, ~es~~ by l'~osmqn et al., Na~ure 312: 768, 1984), SV40 and c~lv~ virus DNA and cu.~ ;~s, in s~u~ce with the di,~~ n of ~ ;nn from the ongin of replication: (1)S SV40 s~ucnce,S from co<,ldill~t~s 5171-270 ;n.jh~.l;ng the origin of l~l;ration~ enh-q-ncer se~l.,e~ces and early and late p~lllole,s; (2) ~ lo~eE~ ovirus sequences including the ,l.,lllot~r a nd enhqnri~r regions (n.~r~ es 671 to +63 f~m the se~lue~-r,e published by Roeçh~rt et al. (Cell 41:521, 1985); (3) ad~,nuvilus-2 ~u~ nceS conl~ il-g the first exon and part of t-h-e intron ~h. _en the first and second exons of the l,ipal~it~ leader, the second exon and part of the third exon of the ~ it~ leader and a mllltipEP c1c~nin~ site (MCS) conlAi~-ing sites for XhoI, KpnI, SmaI, NotI and BglI; (4) SV40 sequences from cooldinates 4127~100 and 2770-2533 that include the polyadenylation and terminatio signals for early ll~ns~lip~on; (5) se~lu~ ~CGS derived from pBR322 and virus-Acsoçi~t~
se~ v.-ces VAI and VAII of pDC201, with adenovirus se~lu~,. ces 10532- 11156 containing the VAI and VAII genes, followed by pBR322 se4u~,nces from 4363-2486 and 1094-375 c~ ;nillg the ampicillin re~ ee gene and origin of replir~tion.
SFV T2 protein was then ~ e".~ e,.~ ssed in monkey COS-7 cells as follows.
A subcQ~nll~ nt layer COS-7 cells was ll~u.sr~l~ with pDC302-SFVT20RF using DEAE-dextran followed by c~,or~quine L~ nt, as described by l uthm~n et al., Nucl. Acids Res. 11:1295 (1983) and McC'u~çh~n et al., J. Nad. Cancerlnst. 41:351 (1968). The cells were then grown in culture for three days to permit ~ C:~n~ c~pl~ ion of the inserted SFV
T2 ORF se~ n~es After three days, cell culture ~u~.,.atants and the cell monolayers were assayed as ~escribe~ in F.~ e 1, and TNF binding and TNF/I NF l~ce plol binding inhibition was co~r~ COS cells are then buL~ed up in sllffirient 4~ntilies to yield 25 several liters of con~l;l;on~~ 1;.--cc~ ;ning miclu~a~ t;l;es of SFV T2 protein.

Example 3 Pu,ifica~,on of SFV T2 Pro~ein by TNF Affinitv Ch-~ atûpTaphy SFVT2 protein is purified from COS cell ~ n~ of Example 2 using TNF as an affinity ligand. To obtain large ~ounls of l~coll,bi~ TNF for ~ ~alion of a TNF
affinity matrix, a ~;lag~9-TNF fusion protein co.~t~ g the "Flag~" oc~p~lide Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys fused to the amino terminus of TNF was constructed and expressed. This o~ lide sequence does not alter the biological activity of TNF,is highly antigenic and provides an epil~e reversibly bound by a specific monoclonal antibody, enablin~ facile puliftcation of the eAp~ssedTNF(Hopp et al., BiolTechnology 6:1204 (1988).

2 ~ s ~

The Flag~-TNF fusion protein is coupled to Affigel-10* (Bio-Rad) or CnBr-actlvated Sepharose 4B* (Pharmacla LKB
Biotechnology, Inc.) according to the manufacturer s suggestions and as previously described by Urdal et al., J.
Blol. Chem. 263:2870 (1988). COS cell conditioned medium from Example 2 is harvested and centrifuged and the resulting conditioned medium (RPMI 1640) is ad~usted to 1% BSA, 0.1%
sodium azide, 20 mM HEPES, pH 7.4. To the conditioned medium is added a cocktail of protease inhibitors (2mM PMSF, 2 mM O-phenanthroline, 1 mM pepstatln, 1 mM leupeptin). The resulting medium is applied to a Flag~-TNF afflnity column equilibrated with PBS, pH 7.4. The column is then washed with 10 column volumes of PBS, pH 7.4, after which bound protein ls eluted with O.lM glycine-HCl, pH 3Ø Eluate containlng SFV
T2 proteln is immediately neutralized with 80 ml of l.OM
HEPES, pH 7.4 and aliquots removed for blnding assays (described in Example 1, above) and analysls by SDS-PAGE as previously descrlbed by Urdal, J. Biol. CAem. 263 2870 (1988).
Example 4 Purification of SFV T2 Protein Uslnq Reversed-Phase HPLC
SFV T2 proteln ls also purlfied by conventional methods using Flag~-TNF binding as a biological assay for detectlon of SFV T2 actlvlty. Flag~-TNF is produced as described in Example 3 above. COS cell conditloned medlum from Exampie 2 ls harvested and centrlfuged and the resulting conditioned medium (RPMI 1640) ls adjusted to 1% BSA, 0.1%
*Trade-mark 3 ~ ~
-19a-sodium azide, 0.5 M CaCl2 and 20 mM HEPES, pH 7.4. To the conditioned medium is added a cocktail of protease inhibitors ~2mM PMSF, 2 mM 0-phenanthrollne, 1 mM pepstatln, 1 mM
leupeptln). SFV T2 protein is purified from the resulting medium by Gonventlonal purification methods, includlng lon-exchange, hydrophobic interaction, gel exclusion and reversed-phase HPLC.
Example 5 Preparatlon of Monoclonal Antibodies to SFV T2 Protein Preparatlons of purlfied recombinant SFV T2, for example, or transfected COS cells expressing hlgh levels of SFV T2 are employed to generate monoclonal antlbodies agalnst SFV T2 uslng conventional techniques, for example, those disclosed in U.S Patent 4,411,993. Such antlbodies are likely to be useful in interfering with TNF binding to TNF receptors, for example, in ameliorating toxic or other undesired effects of TNF, or as components of diagnostic or research assays for TNF or soluble TNF receptor.
To lmmunize mlce, SFV T2 lmmunogen is emulsifled in complete Freund's ad~uvant and ln~ected ln amounts ranglng from 10-lO0 ~g subcutaneously lnto Balb~c mlce.

WO g2/17583 Pcr/US9l/02207 20~3~5 Ten to twelve days later, the ;.. ~ rlim~l~ are boosted with additional immunogen c~ ied in inCQmr~ Freund's adjuvant and ~ . ;~li~lly boosted II.~.~f~ on a weekly to bi~.~e~ly ;-.... ---~ ;on sçh~llle. Serum s~mrles are periodically taken by retro-orbital blee~lin~ or tail-tip excision for testing by dot-blot assay (antibody sandwich) or ELISA
S (enzyme-linked immllnosoll,cnt assay). Other assay procedures are also suitable.
Following cletection of an apl)l~liate antibody dter, positive ~nim~l~ are given an intravenous injection of antigen in saline. Three to four days later, the ~nim~ls are sacrificed, splenocytes harvested, and fused to the murine myeloma cell line NS1.
Ilyb. ;dc....~ cell lines k. ~ t~ d by this ,u~ are plated in mllhirle microtiter plates in a 10 HAT selective ~P~l;U~ ~o.~ , A~n;i~Jt~ -, and ~ dine) to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids.
Hyhridcm~ clones thus gen~atcd can be screened by ELISA for reactivity with SFV T2 or TNF l~c.~,lor, for example, by ~art~ti~ns of the techniques disclosed by Engvall et al., Immunochem. 8:871 (1971) and in U.S. Patent 4,703,004. Positive clones 15 are then injected into the peritoneal cavities of syngeneic Balb/c mice to produce ascites cont~ining high concentrations (>1 mg/ml) of anti-S-Fv T2 monoclonal antibody. The res~llting ....~ ol-Al antibody can be pmified by ~ - sulfate ~ ation followed by gel eYc11lsion chromatography, and/or affinity cl~ .alography based on binding of antibody to Protein A of Staphylococcus aureus.
F.Y~n~ le 6 E~ ;ssion of the Myxoma Virus T2 ORF
A vector (pMTN-6) cont~ining the Myxoma Virus T2 opening reading frame (MYXOMA T2 ORF) was obtained from Dr. Grant McFadden of the University of 2S Alberta, F~ oll~ C~n~d~ This vector was constructed by inserting a Myxoma BamHI
fragment (see Russell & Robbins, Virology 90:147) into the BamHI site of pUC19. A
Nlam fr~nent c~nl;~in;.~g the entire coding region of the MYXOMA T2 OR-F was isolated from pMyBT-5 and cloned into the SphI site of pMH21p to create pMTN-6.
The MYXOMA T2 ORF was excised from pMTN-6 by digesting with Hin(l~TI and PstI restriction erl~yll~es, resl-lting in a complete MYXOMA T2 ORF cDNA fr~grnçnt The resulting cDNA was blunt-ended and ligated into the eukaryotic e~ ,ssion vector pDC302 which was ~li~st~:d with the SmaI lGslliclion enzyme. The resllltin~ e~ ssion vector was ~e~ t~d pDC302-MVT20RF-1.
SFV T2 protein was then tran~iently tA~l~ssed in monkey COS-7 cells as follows.
A ~ubcolllluçnt layer COS-7 cells was transfected with pDC302-MVT20RF using DEAE-dextran followed by chor~quil,e ~ l."~t, as described by ~ llthm~n et al., Nucl. Acids Res. 11:1295 (1983) and Mc~ut~h~n et al., J. Natl. Cancer-nst. 41:351 (1968). The cells were then grown in culture for three days to permit transient eA~lGssion of the inserted 2 ~

MYXOMA T2 ORF sequences. After three days, cell culture supernatants and the cell monolayers are assayed as described in Example 1. The cell culture supernatants dld not inhibit binding of TNF to TNF-receptor, possibly because the HindIII/PstI restriction fragment did not contain specific sequences 5' of the coding region which are required for expression. Accordingly, MYXOMA T2 ORF cloned into the mammalian expression vector pDC302 utilizing the polymerase chain reaction ( PCR) technique. This method inserts a CACC
nucleotide sequence upstream of the initiation codon which is important for optimum initiation of translation (Kozak, Mol.
Cell . ~o. 8:2737 (1988)). The following primers are used in this construction:
5' End Primer 5'-CCTTGCGGCCGCCACCATGTTTCGTTTAACGCTACTACT-3' NotI site Initiation Codon 3'End Primer 5'CCTTAGATCTGTAATCTATGAAACGAGTCTACAT-3' BglII site The PCR product thus contains NotI and ~glII restriction sites at the 5' and 3' termini, respectively. These restrictlon sites are used to clone into pDC302. The template for the PCR
reaction is the clone myxoma T2 clone, described above, whlch contains the myxoma T2 ORF ( pMTN-6). The DNA sequences encodlng the myxoma T2 ORF (lncludlng the upstream Kozak sequences) are then amplified by PCR, substantially as described by Innls et al., eds., PCR Protocols: A Gulde to Methods and Appl icatl ons (Academic Press, 1990~. The - 22 - 2 ~ ~ ~ 3 5 5 resulting amplified clone ls then isolated and llgated into pDC302 and translently expressed ln monkey COS-7 cells as descrlbed above. COS cells are then bulked up ln sufficient ~uantltles to yleld several llters of condltloned medlum contalnlng mlcrogram quantltles of SFV T2 proteln.
Example 7 Purlflcation of Myxoma T2 Proteln by TNF AfflnltY
ChromatographY
Myxoma T2 protein is purified from COS cell supernatants of Example 6 using TNF as an afflnity ligand. To obtaln large amounts of recomblnant TNF for preparatlon of a TNF afflnlty matrlx, a Flag0-TNF fuslon proteln containlng the "Flag~" octapeptlde Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys fused to the amino termlnus of TNF was constructed and expressed. This octapeptide sequence does not alter the biological activity of TNF, is highly antlgenlc and provides an epitope reversibly bound by a speciflc monoclonal antibody, enabling facile puriflcatlon of the expressed TNF (Hopp et al., Bl o/TecAnol ogy 6:1204 (1988).
The Flag~-TNF fusion proteln ls coupled to Afflgel-lO* (Blo-Rad) or CnBr-actlvated Sepharose 4B* (Pharmacla LKB
Blotechnology, Inc.) accordlng to the manufacturer's suggestlons and as prevlously descrlbed by Urdal et al., ~.
Blol. Chem 263:2870 (1988). COS cell condltloned medium from Example 6 ls harvested and centrifuged and the resultlng conditloned medlum (RPMI 1640) ls adjusted to 1% BSA, 0.1%
*Trade-mark - 22a -sodlum azlde, 20 mM HEPES, pH 7.4. To the conditioned medium ls added a cocktall of protease lnhlbltors (2mM PMSF, 2 mM O-phenanthrollne, 1 mM pepstatln, 1 mM leupeptin). The resulting medlum ls applied to a Flag~-TNF affinity column equlllbrated wlth PBS, pH 7.4. The column is then washed with 10 column volumes of PBS, pH 7.4, after which bound protein ls eluted wlth 0.1 M glycine-HCl, pH 3Ø Eluate contalnlng myxoma T2 proteln ls immedlately neutrallzed with 80 ml of 1.0 M HEPES, pH 7.4 and allquots removed for binding assays (described in Example 1, above) and analysis by SDS-PAGE as previously described by Urdal, J. ~iol. Chem. 263:2870 (1988).
Example 8 Purification of SFV T2 or Myxoma T2 Protein Uslnq Reversed-Phase HPLC
Myxoma T2 protein is also purified by conventional methods using Flag~-TNF binding as a biological assay for detection of myxoma T2 activity. Flag~-TNF is produced as described ln Example 3 above. COS cell condltloned medium from Example 6 ls harvested and centrifuged and the resulting conditloned medium (RPMI 1640) is ad~usted to 1% BSA, 0.1%
sodium azide, 0.5 M CaCl2 and 20 mM HEPES, pH 7.4. To the condltloned medlum ls added a cocktall of protease lnhlbitors (2mM PMSF, 2 mM O-phenanthroline, 1 mM pepstatin, 1 mM
leupeptin). Myxoma T2 proteln ls purlfled from the resultlng medlum by conventional puriflcatlon methods, including lon-exchange, hydrophoblc lnteraction, gel exclusion and reversed-phase HPLC.

- 22b - 2 ~ 8 ~
Example 9 Preparatlon of Monoclonal Antibodies to Myxoma T2 Protein Preparatlons of purlfled recomblnant myxoma T2, for example, or transfected COS cells expressing high levels of myxoma T2 are employed to generate monoclonal antibodles against myxoma T2 uslng conventional techniques, for example, those dlsclosed ln U.S Patent 4,411,993. Such antlbodles are llkely to be useful ln interfering wlth TNF binding to TNF
receptors, for example, in amelloratlng toxic or other undesired effects of TNF, or as components of diagnostic or research assays for TNF or soluble TNF receptor.

W O 92/17583 2 Q 8 ~ ~ 5 ~ US91/02207 To ;~ ni7e mice, myxoma T2 i~ ogcn is emul~ifie~l in complete Freund's adjuvant and inj~;l~d in allvulllS ~n~ing from 1~100 llg s~ P,o~ly into Balb/c mice.
Ten to twelve days later, the ;....n.~ nimqlc are boo~teA with additional immllnogen e~ ;r~d in ;~.co..~l.lete Freund's adjuvant and pf . ;cylir~lly bo~l IL~,l~t~,l on a weekly S to bi.. ~l~; .. --i-;,~l;on sch~lllp Serum s-~.q~k.s are p~rioflir~lly taken by retro-orbital blee~ling or tail-tip excision for testing by dot-blot assay (antibody sandwich) or ELISA
(enzyme-linked immunosoll,cnt assay). Other assay yroceduie~s are also suitable.Following ~etection of an appl~liate antibody titer, positive ~nim~l~ are given an inlla~.~enous injection of antigen in saline. Three to four days later, the ~nim~l~ are 10 sacrificed, splenocytes harvested, and fused to the murine myeloma cell line NSl.
Hybridom~ cell lines ~n~làt~d by this pl~cedu,~ are plated in mllltiple microtiter plates in a HAT selective nuA;...n (h~yox~ e~ aminopterin, and thymidine) to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids.
Hybrirlom~ clones thus gen~latcd can be screened by ELISA for reactivity with 15 myxoma T2 or TNF ~,ceytor~ for e~ )le, by adaptations of the techniques disclosed by Engvall et al., Immunochem. 8:871 (1971) and in U.S. Patent 4,703,004. Positive clones are then injected into the p-,~ ;lol-e~l cavities of ~yllgeneic Balb/c mice to produce ascites Co~ g high col~cf nl~ a~ions (>1 mglml) of anti-myxoma T2 monoclon~l antibody. The resnlting ~onorlc!n~l antibody can be pllrified by ~ - sulfate p~ip l;on followed 20 by gel eYclll~ion chromatography, and/or affinity chr~ldtography based on binding of antibody to Protein A of Staph~lococcus aureus.

WO 92/17S83 pcl~/us9l/o22n7 2 0 8 0 3 5 5 _ SEQ OE NCE LISTING

~1 ) GT~N~RAT INFORMATION:
(i) APPLICANT: Smith, Craig A.
Goodwin, Raymond G.
(ii) TITLE OF lNv~h.ION: I~olated Viral Protein Cytokine Antagonists (iii) NUMBER OF SEQUENCES: 4 (iv) COR~T~'SPONDENCE ~nDPT'-~S:
~A ~nD~T'S~T'T' T --Y Co,~G,ation B STREET: 51 Univer~ity Street C, CITY: Seattle D STATE: Washington E COUh~KY: USA
,F, ZIP: 98101 (v) COMPUTER pR~n~RT,T.~ FORM:
'A' MEDIUM TYPE: Floppy di~k B cc~ ru~K: IBM PC compatible ,C OPERATING SYSTEM: PC-DOS/MS-DOS
,D/ SOFTWARE: PatentIn R~lea~e ~1.24 (vi) ~u~k~h~ APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) A..O}iN~ /AGENT 1NrOh~sATION:
(A) NAME: Wight, Christopher L.
(B) REGISTRATION NUMBER: 31,680 (C) REFERENCE/DOCKET NUMBER: 2602 (ix) TT~'TT~'C~MUNICATION INFORMATION:
(A) TELEPHONE: (206) 587-0430 (B) TELEFAX: (206) 587-0606 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
'A', LENGTH: 1200 base pairs B TYPE: nucleic acid CI sT~NnT~n~Fss: single ,,D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~YrO,~.ICAL: N
(iv) ANTI-SENSE: N
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Rabbit fibroma virus (vii) IMMEDIATE SOURCE:
(B) CLONE: T2 ORF

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 192..1169 WO 92/17583 PCr/US91/02207 a~s~3ss ~i ( D ) OTHER INFORMATION:
( ix ) FEATURE:
(A) NAME/~Y: mat peptide ( B ) LOCATION: 192. .1166 ( D ) O$HER INFORMATION:

(xi) SEQUENCE D~C~'~TPTION: SEQ ID NO:1:
GTGATTGAGT TGTTCATGAG GTTGATCGCG GATTATGAGA TTT~t~ATAT CAG61CC;~,~G 60 ATCAATATTC GTTTACAATG ~;~.CG~ ct~AAAAA-r-Tc GTAACATCTA AATTGGCTCT 120 CTCA.~CGG. TATAATTGAT ,C~.;.. ~;.. - .~;.~.~ACAA AAATATAAAA ATAATTACAA 180 Met Leu Arg Leu Ile Ala Leu Leu Val Cys Val Val Tyr Val Tyr Gly Asp A~p Val Pro Tyr Ser Ser Asn Gln Gly Lys Cys Gly Gly His Asp Tyr Glu Lys Asp Gly Leu CYB CYS Ala Ser Cys His Pro Gly Phe Tyr Ala Ser Arg Leu Cys Gly Pro Gly Ser Asn Thr Val Cys Ser Pro Cys Glu Asp Gly Thr Phe Thr Ala Ser Thr Asn His Ala Pro Ala Cys Val Ser Cy5 Arg Gly Pro Cys Thr Gly His Leu Ser Glu Ser Gln Pro Cys Asp Arg Thr His Asp Arg Val Cys Asn Cys Ser Thr Gly Asn Tyr Cy5 Leu Leu Lys Gly Gln Asn Gly Cys Arg Ile Cys Ala Pro Gln Thr Lys Cy5 Pro Ala Gly Tyr Gly Val Ser Gly His Thr Arg Ala Gly Asp Thr Leu Cys Glu Lys Cys Pro Pro His Thr Tyr Ser Asp Ser Leu Ser Pro Thr Glu Arg Cy8 Gly Thr Ser Phe Asn Tyr Ile Ser Val Gly Phe Asn Leu Tyr Pro Val Asn Glu Thr Ser Cys Thr Thr Thr Ala W O 92/17583 PC~r/US91/022 ~ J ~ ~ ~

GGA CAC AAC GAA GTG ATC AaA ACG AAG GAG TTT ACA GTT ACG TTA AAT 806 Gly His Asn Glu Val Ile Lys Thr Ly~ Glu Phe Thr Val Thr Leu Asn Tyr Thr Asp Cy~ Asp Pro Val Phe His Thr Glu Tyr Tyr Ala Thr Ser GGA AaA GAA GGA GCT GGT GGA TTC TTC ACG GGA ACA GAT ATA TAC CAG 902 Gly Lys Glu Gly Ala Gly Gly Phe Phe Thr Gly Thr Asp Ile Tyr Gln Asn Thr Thr LYB Val Cys Thr Leu Asn Val Glu Ile Gln Cys Ser Glu Gly Asp Asp Ile His Thr Leu Gln Lys Thr Asn Gly Gly Ser Thr Met Pro His Ser Glu Thr Ile Thr Val Val Gly Ser Cys Leu Ser Asp Val Asn Val Asp Ile Met Tyr Ser Asp Thr Asn His Pro Gly Glu Val Asp Asp Phe Val Glu Tyr His Trp Gly Thr Arg Leu Arg Phe Phe Pro Leu CCC AaA CGA TGT ACC CCA GTC TCG TAG GG.......... ~-.CG.. AAT - 1189 Pro Ly~ Arg Cys Thr Pro Val Ser TTCTTAA~AA A 1200 (2) INFORMATION FOR SEQ ID NO:2:
~Q~N~ C~CTERISTICS:
(A) LENGTH: 325 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: protein (Xi) S~:yU~N~ DESCRIPTION: SEQ ID NO:2:
Met Leu Arg Leu Ile Ala Leu Leu Val Cys Val Val Tyr Val Tyr Gly Asp Asp Val Pro Tyr Ser Ser Asn Gln Gly Lys Cys Gly Gly H~ Asp 2û 25 30 Tyr Glu Lys Asp Gly Leu Cys Cys Ala Ser Cys His Pro Gly Phe Tyr Ala Ser Arg Leu Cys Gly Pro Gly Ser Asn Thr Val Cys Ser Pro Cys WO 92/17583 PCI'/US91/02207 2~8~355 Glu Asp Gly Thr Phe Thr Ala Ser Thr Asn His Ala Pro Ala Cys Val ~er Cys Arg Gly Pro Cys Thr Gly His Leu Ser Glu Ser Gln Pro Cys ~sp Arg Thr Hi~ Asp Arg Val Cys Asn Cys Ser Thr Gly Asn Tyr Cys Leu Leu Lys Gly Gln Asn Gly Cys Arg Ile Cys Ala Pro Gln Thr Lys Cys Pro Ala Gly Tyr Gly Val Ser Gly His Thr Arg Ala Gly Asp Thr Leu Cys Glu Lys CYB Pro Pro His Thr Tyr Ser Asp Ser Leu Ser Pro ~hr Glu Arg Cys Gly Thr Ser Phe Asn Tyr Ile Ser Val Gly Phe Asn ~eu Tyr Pro Val Asn Glu Thr Ser Cy8 Thr Thr Thr Ala Gly His Asn Glu Val Ile Lys Thr Lys Glu Phe Thr Val Thr Leu Asn Tyr Thr Asp Cys Asp Pro Val Phe His Thr Glu Tyr Tyr Ala Thr Ser Gly Lys Glu Gly Ala Gly Gly Phe Phe Thr Gly Thr Asp Ile Tyr Gln Asn Thr Thr ~ys Val Cys Thr Leu Asn Val Glu Ile Gln Cys Ser Glu Gly Asp Asp ~le His Thr Leu Gln Lys Thr Asn Gly Gly Ser Thr Met Pro His Ser Glu Thr Ile Thr Val Val Gly Ser Cys Leu Ser Asp Val Asn Val Asp Ile Met Tyr Ser Asp Thr Asn His Pro Gly Glu Val Asp Asp Phe Val Glu Tyr His Trp Gly Thr Arg Leu Arg Phe Phe Pro Leu Pro Lys Arg ~ys Thr Pro Val Ser ~2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CH~RACTERISTICS:
'A'l LENGTH: 1064 base pairs B TYPE: nucleic acid CI STR~Nn~nNESS: double D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ~iii) ~Y~O~ ICAL: N

W O 92/17583 P ~ /US91/022~-2 ~ 5 (iv) ANTI-SENSE: N
(~i) ORIGINAL SOURCE:
(A) ORGANISM: Myxoma virus (~ii) IMMEDIATE SOURCE:
(B) CLONE: T2 ORF
(ix) FEATURE:
'A' NAME/XEY: mat peptide B LOCATION: 2..979 Dl OTHER INFORMATION:
(ix) F-ATURE:
(A) NAME/XEY: CDS
(B) LOCATION: 2..982 (D) OTHER INFORMATION:

(xi) ~yu~ DESCRIPTION: SEQ ID NO:3:

Met Phe Arg Leu Thr Leu Leu Leu Ala Tyr Val Ala Cys Val Tyr Gly Gly Gly Ala Pro Tyr Gly Ala A~p Arg Gly Ly~ Cy~ Arg Gly Asn Asp Tyr Glu LYB Asp Gly Leu Cy5 Cys Thr Ser Cys Pro Pro Gly Ser Tyr Ala Ser Arg Leu Cy~ Gly Pro Gly Ser Asp Thr Val Cy8 Ser Pro Cy~ Ly~ A~n Glu Thr Phe Thr Ala Ser Thr Asn Hi~ Ala Pro Ala Cy~

Val Ser Cy8 Arg Gly Arg Cys Thr Gly His Leu Ser Glu Ser Gln Ser Cys Asp Lys Thr Arg Asp Arg Val Cy~ Asp Cys Ser Ala Gly Asn Tyr TGT CTG TTG AAA GGA CAG GAG GGG TGT AGG ATA TGC GCT CCC A~A ACG 382 Cys Leu Leu Lys Gly Gln Glu Gly Cys Arg Ile Cy~ Ala Pro Lys Thr Ly~ Cys Pro Ala Gly Tyr Gly Val Ser Gly His Thr Arg Thr Gly A~p Val Leu Cy~ Thr Lys Cys Pro Arg Tyr Thr Tyr Ser Asp Ala Val Ser Ser Thr Glu Thr Cys Thr Ser Ser Phe Asn Tyr Ile Ser Val Glu Phe ''VO 92/17~83 PCI/US91/02207 a~3ss ~, Asn Leu Tyr Pro Val Asn Asp Thr Ser Cy8 Thr Thr Thr Ala Gly Pro AAC GAA GTG GTT A~A ACG TCG GAG TTC TCG GTT ACG CTA AAT CAC ACG 622 Asn Glu Val Val Lys Thr Ser Glu Phe Ser Val Thr Leu Asn His Thr Asp Cy~ A~p Pro Val Phe His Thr Glu Tyr Tyr Gly Thr Ser Gly Ser Glu Gly Ala Gly Gly Phe Phe Thr Gly Met Asp Arg Tyr Gln Asn Thr Thr Lys Met Cys Thr Leu Asn Ile Glu Ile Arg Cys Val Glu Gly Asp Ala Val Arg Thr Ile Pro Arg Thr Ser Asp Gly Val Gly Val Leu Ser His Ser Glu Thr Ile Thr Val Ile Gly Gly Cys Leu Ser Asp Val Asn Val Asp Ile Glu Tyr Ser Asp Ser Asn His Pro Glu Glu Val Asp A~p Phe Val Glu Tyr His Trp Gly Thr Arg Leu Arg Leu Phe Pro Ser Pro AAA CGA TGT AGA CTC GTT TCA TAG ATTACGGATT ~ AGT TAAATTCTTA 1012 Lys Arg Cy~ Arg Leu Val Ser AAAAAAAGTC GAATTATAAT AAAACGTGGG CGTATA~-~A~- AACTCTATCA TG 1064 (2) INFORMATION FOR SEQ ID NO:4:
( i ) S~Q~h~ CHARACTERISTICS:
(A) LENGTH: 326 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear ( ii ) MnT T''CUT-T~ TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
~et Phe Arg Leu Thr Leu Leu Leu Ala Tyr Val Ala Cys Val Tyr Gly ~ly Gly Ala Pro Tyr Gly Ala Asp Arg Gly Lys Cys Arg Gly Asn Asp ~yr Glu Lys Asp Gly Leu Cys Cys Thr Ser Cys Pro Pro Gly Ser Tyr WO 92/17583 30 PCI/US91/022~'-Ala Ser Arg Leu Cys Gly Pro Gly Ser Asp Thr Val Cys Ser Pro Cys Lys Asn Glu Thr Phe Thr Ala Ser Thr Asn His Ala Pro Ala Cys Val Ser Cy~ Arg Gly Arg Cys Thr Gly His Leu Ser Glu Ser Gln Ser Cys ABP Ly~ Thr Arg Asp Arg Val Cy~ Asp Cy~ Ser Ala Gly Asn Tyr Cy~

Leu Leu Ly~ Gly Gln Glu Gly Cys Arg Ile Cys Ala Pro Lys Thr Lys Cys Pro Ala Gly Tyr Gly Val Ser Gly Hi~ Thr Arg Thr Gly Asp Val Leu Cys Thr Lys Cys Pro Arg Tyr Thr Tyr Ser Asp Ala Val Ser Ser Thr Glu Thr Cys Thr Ser Ser Phe Asn Tyr Ile Ser Val Glu Phe Asn Leu Tyr Pro Val Asn Asp Thr Ser Cys Thr Thr Thr Ala Gly Pro Asn Glu Val Val Lys Thr Ser Glu Phe Ser Val Thr Leu Asn His Thr Asp Cys Asp Pro Val Phe His Thr Glu Tyr Tyr Gly Thr Ser Gly Ser Glu Gly Ala Gly Gly Phe Phe Thr Gly Met Asp Arg Tyr Gln Asn Thr Thr Lys Met Cys Thr Leu Asn Ile Glu Ile Arg Cys Val Glu Gly Asp Ala Val Arg Thr Ile Pro Arg Thr Ser Asp Gly Val Gly Val Leu Ser His Ser Glu Thr Ile Thr Val Ile Gly Gly Cys Leu Ser Asp Val Asn Val Asp Ile Glu Tyr Ser Asp Ser Asn His Pro Glu Glu Val Asp Asp Phe Val Glu Tyr His Trp Gly Thr Arg Leu Arg Leu Phe Pro Ser Pro Lys Arg Cys Arg Leu Val Ser

Claims (3)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:

1. An isolated and substantially homogeneous soluble viral protein capable of binding tumor necrosis factor (TNF) and encoded by a T2 open reading frame of a poxvirus, wherein the viral protein is selected from the group consisting of Shope Fibroma Virus T2 protein having the sequence of amino acids 1-325 of SEQ ID NO:1, and the Myxoma Virus T2 protein having the sequence of amino acids 1-326 of SEQ ID NO:3.

2. A pharmaceutical composition comprising a viral protein according to claim 1, and a pharmaceutically acceptable diluent or carrier.

3. A process for preparing an isolated viral protein having TNF antagonist activity according to claim 1, comprising:
(a) selecting a clone comprising a nucleotide sequence of SEQ ID NO:1 or SEQ NO:3 that encodes a viral protein capable of binding to TNF and preventing TNF from binding to TNF receptors; and (b) culturing the selected clone and isolating the viral protein.