CA2065346C - Tumor necrosis factor-.alpha. and-.beta. receptors - Google Patents

Tumor necrosis factor-.alpha. and-.beta. receptors Download PDF

Info

Publication number
CA2065346C
CA2065346C CA 2065346 CA2065346A CA2065346C CA 2065346 C CA2065346 C CA 2065346C CA 2065346 CA2065346 CA 2065346 CA 2065346 A CA2065346 A CA 2065346A CA 2065346 C CA2065346 C CA 2065346C
Authority
CA
Canada
Prior art keywords
amino acids
protein
sequence
tnf
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CA 2065346
Other languages
French (fr)
Other versions
CA2065346A1 (en
Inventor
Craig A. Smith
Raymond G. Goodwin
M. Patricia Beckmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Immunex Corp
Original Assignee
Immunex Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US40324189A priority Critical
Priority to US403,241 priority
Priority to US40537089A priority
Priority to US405,370 priority
Priority to US421,417 priority
Priority to US42141789A priority
Priority to PCT/US1990/004001 priority patent/WO1991003553A1/en
Application filed by Immunex Corp filed Critical Immunex Corp
Publication of CA2065346A1 publication Critical patent/CA2065346A1/en
Application granted granted Critical
Publication of CA2065346C publication Critical patent/CA2065346C/en
Anticipated expiration legal-status Critical
Application status is Expired - Lifetime legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7151Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Abstract

Tumor necrosis factor receptor proteins, DNAs and expression vectors encoding TNF receptors, and processes for producing TNF receptors as products of recombinant cell culture, are disclosed.

Description

TITLE
Tumor Necrosis Factor-a and -/3 Receptors BACKGROUND OF THE INVENTION
The present invention relates generally to cytokine receptors and more specifically to tumor necrosis factor receptors.
Tumor necrosis factor-a (TNFa, also known as cachectin) and tumor necrosi:~ factor-p (TNFp, also known as lymphotoxin) are homologous mammalian endogenous secretory proteins capable of inducing a wide variety of effects on a large number of cell types. The great similarities in the structural and functional characteristics of these two cytokines have resulted in their collective description as "TNF". Complementary cDNA clones encoding TNFa (Pennica et al., Nature 312:724, 1984) arid TNF/3 (Gray et al., Nature 312:721, 1984) have been isolated, permitting further structural and biological characterization of TNF.
TNF proteins initiate their biological effect on cells by binding to specific TNF receptor (TNF-R) proteins expressed on the plasma membrane of a TNF-responsive cell.
TNFa and TNF(3 were first shown to bind to a common receptor on the human cervical carcinoma cell line ME-180 (Aggarwal et al., Nature 318:665, 1985). Estimates of the size of the TNF-R determined by affinity labeling studies ranged from 54 to 175 kDa (Creasey et al, Proc, Natl. Acad. Sci. USA 84:3293, 1987; Stauber et al., J. Bio7.. Chem. 263:19098, 1988; Hohmann et al., j. Biol. Chem. 264:14927, 1989). Although the 20 s53,~ s relationship between these ThfF-Rs of different molecular mass is unclear, Hohmann et al. {J. Biol. Chem. 264:14927, 1989) reported that at least two different cell surface receptors for TNF exist on different cell types. These receptors have an apparent molecular mass of: about 80 kDa and about 55-60 kDa, respectively. None of t;he above publications, however, reported the purification to homogeneity of cell surface TNF
receptors.
In addition to cell. surface receptors for TNF, soluble proteins from human urine capable of binding TNF have also been identified (Peetre et al., Eur. J. Haematol. 41:414, 1988; Seckinger et al., J. E~;p. Med. 167:1511, 1988; Seckinger et al., J. Biol. Chem. 264-17.966, 1989; UK Patent Application, Publ. No. 2 218 101 A to Seckinger et al.; Engelmann et al., J. Biol. Chem. 264:11974, 19ft9). The soluble urinary TNF
binding protein disclosed by UK 2 218 101 A has a partial N-Terminal amino acid sequence of Asp-Ser-Val-Cys-Pro-, which corresponds to the partial sequence disclosed later by Engelmann et al. (1989). They relationship of the above soluble urinary binding proteins was further elucidated when Engelmann et al. reported the' identification and purification of a second distinct soluble urinary TNF binding protein having an N-terminal amino acid sequence of Val-Ala-Phe-Thr-Pro (J. Biol. Chem. 265:1531,. 1990). The two urinary proteins disclosed by the UK 2 218 10.1 A and the Engelmann et al.
publications were shown to be' immunochemically related to two apparently distinct cell suri:ace proteins by the ability of ~~R
'~1,~~

2o x534 6 antiserum against the bindings proteins to inhibit TNF binding to certain cells.
More recently, two separate groups reported the molecular cloning and expression of a human 55 kDa TNF-R
(Loetscher et al., Cell 61:3G~1, 1990; Schall et al., Cell 61:361, 1990). The TNF-R of both groups has an N-terminal amino acid sequence which corresponds to the partial amino acid sequence of the urinary binding protein disclosed by UK 2 218 101 A, Engelmann et al. (1989) and Engelmann et al.
(1990).
In order to elucidate the relationship of the multiple forms of TNF-R and soluble urinary TNF binding proteins, or to study the structural and biological characteristics of TNF-Rs ancL the role played by TNF-Rs in the response of various cell populations to TNF or other cytokine stimulation, or to use TNF-R:. effectively in therapy, diagnosis, or assay, purified compositions of TNF-R are needed. Such compositions, however, are obtainable in practical yields only by cloning and expressing genes encoding the receptors using recombinant DNA technology. Effort to purify the TNF-R molecule fox' use in biochemical analysis or to clone and express mammalian genes encoding TNF-R, however, have been impeded by lack of a suitable source of receptor protein or mRNA. Prior to tree present invention, no cell lines were known to express high levels of TNF-R
constitutively and continuou:cly, which precluded purification a ' x o.

._ 20 6534 g 3a of receptor for sequencing or construction of genetic libraries for cDNA cloning.
SUHHARY Ol? THE INVENTION
The present invention provides isolated TNF receptors and DNA sequences encoding mammalian tumor necrosis factor receptors (TNF-R), in particular, human TNF-Rs whose native forms have molecular weights of about 80 kilodaltons. Such DNA sequences include (a) cDrfA clones having a nucleotide sequence derived from the coding region of a native TNF-R
gene; (b) DNA sequences which are capable of hybridization to the cDNA clones of (a) under moderately stringent conditions (50oC, 2 x SSC) and which encode biologically active TNF-R
molecules; or (c) DNA sequences which are degenerate as a result of the genetic code to the DNA sequences defined in (a) and (b) and which encode biologically active TNF-R molecules.
In particular, the present invention provides DNA sequences which encode soluble TNF receptors. In a preferred embodiment amino acid residue 46 is selected from the group consisting of Ile and Thr and amino acid residue 118 is selected from the group consisting of Val and 7:1e.
The present invention also provides recombinant expression vectors comprising the DNA sequences defined above, recombinant TNF-R molecules ~>roduced using the recombinant expression vectors, and processes for producing the recombinant TNF-R molecules using the expression vectors.

w , ., ~; r 3b The present invention also provides isolated or purified protein compositions comprising TNF-R, and, in part icular, soluble forms of '.CNF-R. The invent ion also provides an isolated DNA sequE~nce as defined above which encodes a soluble human TNF-R protein which has an amino acid sequence comprising an amino <~cid sequence 1 to x, wherein x is selected from the group consisting of amino acids 163-235 of Figure 2.
The present invention also provides compositions for use in therapy, diagnosis, assay of TNF-R, or in raising antibodies to TNF-R, comprising effective quantities of soluble native or recombinant receptor proteins prepared according to the foregoing processes. The invention therefore also provides a pharmaceutical composition comprising a purified biologically active mammalian TNF receptor (TNF-R?
protein comprising an amino acid sequence 1 to x, wherein x is selected from the group consi:~ting of 165-235 of Figure 2 together with a pharmaceutically acceptable carrier or diluent.
Because of the ability of TNF to specifically bind TNF receptors (TNF-Rs), purified TNF-R compositions will be useful in diagnostic assays for TNF, as well as in raising antibodies to TNF receptor fo:r use in diagnosis and therapy.
In addition, purified TNF receptor compositions may be used directly in therapy to bind or scavenge TNF, thereby providing a means for regulating the immune activities of this cytokine.

The invention provides the use of mammalian TNF-R
protein comprising an amino acid sequence 1 to x, wherein x is selected from the group consisting of 163-235 of Figure 2 in preparing a pharmaceutical composition suitable for parenteral adminstration to a human patiE~nt for regulating immune responses.
The invention also Z~rovides an assay method for detection of a tumor necrosis factor (TNF) or a tumor necrosis factor receptor (TNF-R) molecule comprising an amino acid sequence 1 to x, wherein x is selected from the group consisting of 163-235 of Figure 2 which assay method comprises reacting a sample suspected o:E containing TNF or TNF-R with labelled TNF-R or labelled TNIi and detecting binding of TNF to labelled TNF-R or binding of 'TNF-R to labelled TNF.
These and other aspects of the present invention will become evident upon reference to the following detailed description.
BRIEF DPSCRIPT:CON OF THE DRAWINGS
Figure 1 is a schem~~tic representation of the coding region of various cDNAs encoding human and murine TNF-Rs. The leader sequence is hatched and the transmembrane region is solid.
Figures 2-3 depict the partial cDNA sequence and derived amino acid sequence of the human TNF-R clone 1.
Nucleotides are numbered from the beginning of the 5' untranslated region. Amino acids are numbered from the beginning of the signal peptide sequence. The putative signal .~_ 3d peptide sequence is represented by the amino acids -2 to -1.
The N-terminal leucine of the mature TNF-R protein is underlined at position 1. The predicted transmembrane region from amino acids 236 to 265 i;s also underlined. The C-termini of various soluble TNF-~Rs are marked with an arrow (t).
Figures 4-6 depict 'the cDNA sequence and derived amino acid sequence of murine TNF-R clone 11. The putative signal peptide sequence is re~~resented by amino acids -22 to -1. The N-terminal valine of ithe mature TNF-R protein is underlined at position 1. The predicted transmembrane region from amino acids 234 to 265 i;~ also underlined.

WO 91 /03553 2 ~ 6 5 3 4 ~ PCT/US90/04001 DETAILED DESCRIPTION OF THE INVENTION
Definitions As used herein, the terms "TNF receptor" and "TNF-R" refer to proteins having amino acid sequences which are substantially similar to the native mammalian TNF receptor amino acid sequences, and which are biologically active, as defined below, in that they are capable of binding TNF molecules or ti-ansducing a biological signal initiated by a TNF
molecule binding to a cell, or cross-reacting with anti-TNF-R antibodies raised against TNF-R from natural (i.e., nonrecombinant) sources. The mature full-length human TNF-R is a glycoprotein having a molecular weight of about 80 kilodaltons (kDa). As used throughout the specification, the term "mature" means a protein expressed in a form lacking a leader sequence as may be present in full-length transcripts of a native gene.
Experiments using COS cells transfected with a cDNA encoding full-length human TNF-R showed that TNF-R
bound 125I_TNFa with an apparent Ka of about 5 x 109 M-1, and that TNF-R bound 1251_ TNF~i with an apparent Ka of about 2 x 109 M-1. The terms "TNF receptor" or "TNF-R"
include, but are not limited to, analogs or subunits of native proteins having at least 20 amino acids and which exhibit at least some biological activity in common with TNF-R, for example, soluble TNF-R constructs which are devoid of a transmembrane region (and are secreted from the cell) but retain the ability to bind TNF. Various bioequivalent protein and amino acid analogs are described in detail below.
The nomenclature for TNF-R analogs as used herein follows the convention of naming the protein (e.g., TNF-R) preceded by either hu (for human) or mu (for murine) and followed by a D (to designate a deletion) and the number of the C-terminal amino acid. For example, huTNF-80235 refers to human TNF-R having Asp235 as the C-terminal amino acid (i.e., a polypeptide having the sequence of amino acids 1-235 of Figure 2). In the absence of any human or murine species designation, TNF-R refers generically to mammalian TNF-R.
Similarly, in the absence of any specific designation for deletion mutants, the term TNF-R
means all forms of TNF-R, including mutants and analogs which possess TNF-R
biological activity.
"Soluble TNF-R" or "sTNF-R" as used in the context of the present invention refer to proteins, or substantially equivalent analogs, having an amino acid sequence corresponding to all or part of the extracellular region of a native TNF-R, for example, huTNF-R~235, huTNF-80185 and huTNF-80163, or amino acid sequences substantially similar to the sequences of amino acids 1-163, amino acids 1-185, or amino acids 1-235 of Figure 2, and which are biologically active in that they bind to TNF ligand. Equivalent soluble TNF-Rs include polypeptides which vary from these sequences by one or more substitutions, deletions, or additions, and which retain the ability to bind TNF or inhibit TNF signal transduction activity via cell surface bound TNF receptor proteins, for example huTNF-ROx, su~~ ~w sH~~

WO 91 /03553 PC'f/US90/04001 wherein x is selected from the group consisting of any one of ammo acids 163-235 of Figure 2. Analogous deletions may be made to~ muTNF-R. Inhibition ~ TNF signal transduction activity can be determined by transfecting cells with recombinant TNF-R DNAs to obtain recombinant receptor expression. The cells are then contacted with TNF and the resulting metabolic effects examined. If an effeca results which is attributable to the action of the ligand, then the recombinant receptor has signal transduction activity.
Exemplary procedures for determining whether a polypeptide has signal transduction activity are disclosed by Idzerda et al., J. Exp. Med. 171:861 (1990); Curtis et al., Proc. Natl. Acad.
Sci. USA
86:3045 ( 1989); Prywes et al., EMBD J. 5:2179 ( 1986) and Chou et al., J.
Biol. Chem.
262:1842 (1987). Alternatively, primary cells or cell lines which express an endogenous TNF receptor and have a detectable biological response to TNF could also be utilized.
The term "isolated" or "purified", as used in the context of this specification to define the purity of TNF-R protein or protein compositions, means that the protein or protein composition is substantially free of other proteins of natural or endogenous origin and contains less than about 1 % by mass of protein contaminants residual of production processes. Such compositions, however, can contain other proteins added as stabilizers, carriers, excipients or co-therapeutics. Tl'vTF-R is isolated if it is detectable as a single protein band in a polyacrylamide gel by silver staining.
The term "substantially similar," vvhen used to define either amino acid or nucleic acid sequences, means that a particular subjeca sequence, for example, a mutant sequence, varies from a reference sequence by one or more substitutions, deletions, or additions, the net effect of which is to retain biological activity of the TNF-R protein as may be determined, for example, in one of the TNF-R binding assays set forth in Example 1 below. ~
~natively, nucleic acid subunits and analogs are "substantially similar" to the specific DNfi sequences disclosed herein if: (a) the DNA sequence is derived from the coding region of a native mammalian TNF-R gene; (b) the DN~~ sequence is capable of hybridization to DNA
sequences of (a) under moderately stringent conditions (50'C, 2x SSC) and which encode biologically active TNF-R molecules; or DNA sequences which are degenerate as a result of the genetic code to the DNA sequences defined in (a) or (b) and which encode biologically active TNF-R molecules.
"Recombinant," as used herein, means that a protein is derived from recombinant (e.g., microbial or mammalian) expression systems. "Microbial" refers to recombinant proteins made in bacterial or fungal I;e.g., yeast) expression systems. As a product, "recombinant microbial" defines a protein produced in a microbial expression system which is essentially free of native endogenous substances. Protein expressed in most bacterial cultures, e.g., E. coli, will be free of glycan. Protein expressed in yeast may have a glycosylation pattern different from that expressed in mammalian cells.
Sins?rr~ sH~E1-W091/03553 ~ ~ ~ ~ ~ ~ ~ PC1'/US90/04001 "Biologically active," as used throughout the specification as a characteristic of TNF
receptors, means that a particular molecule shares sufficient amino acid sequence similarity with the embodiments of the present invention disclosed herein to be capable of binding detectable quantities of TNF, transmitting a TNF stimulus to a cell, for example, as a component of a hybrid receptor construct, or cross-reacting with anti-TNF-R
antibodies raised against TNF-R from natural (i.e., nonrecombinant) sources. Preferably, biologically active TNF receptors within the scope of the present invention are capable of binding greater than 0.1 nmoles TNF per nmole receptor, and most preferably, greater than 0.5 nmole TNF
per nmole receptor in standard binding assays (see below).
"Isolated DNA sequence" refers to a DNA polymer, in the form of a separate fragment or as a component of a larger DNA construct, which has been derived from DNA
isolated at least once in substantially pure form, i.e., free of contaminating endogenous materials and in a quantity or concentration enabling identification, manipulation, and recovery of the sequence and its component nucleotide sequences by standard biochemical methods, for example, using a cloning vector. Such sequences are preferably provided in the form of an open reading frame uninterrupted by internal nontranslated sequences, or introns, which are typically present in eukaryotic genes. Genomic DNA containing the relevant sequences could also be used as a source of coding sequences. Sequences of non-translated DNA
may be present 5' or 3' from the open reading frame, where the same do not interfere with manipulation or expression of the coding regions.
"Nucleotide sequence" refers to a heteropolymer of deoxyribonucleotides. DNA
sequences encoding the proteins provided by this invention can be assembled from cDNA
fragments and short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic gene which is capable of being expressed in a recombinant transcriptional unit.
Isolation of cDNAs Encoding TNF-R
The coding sequence of TNF-R is obtained by isolating a complementary DNA
(cDNA) sequence encoding TNF-R from a recombinant cDNA or genomic DNA library.
A
cDNA library is preferably constructed by obtaining polyadenylated mRNA from a particular cell line which expresses a mammalian TNF-R, for example, the human fibroblast cell line WI-26 VA4 (ATCC CCL 95.1) and using the mRNA as a template for synthesizing double stranded cDNA. The double stranded cDNA is then packaged into a recombinant vector, which is introduced into an appropriate E. coli strain and propagated. Murine or other mammalian cell lines which express TNF-R may also be used. TNF-R sequences contained in the cDNA library can be readily identified by screening the library with an appropriate nucleic acid probe which is capable of hybridizing with TNF-R cDNA.
Alternatively, DNAs encoding TNF-R proteins can be assembled by ligation of synthetic oligonucleotide subunits su~as~~ s~~~' ~_.. 2o s534 s corresponding to all or part of the sequence of Figures 2-3 or Figures 4-6 to provide a com~~lete coding sequence.
The human TNF receptor cDNAs of the present invention were isolated by the method of direct expression cloning. A cDNA library was constructed by first isolating cytoplasmic mRNA from the hu~r~an fibroblast cell line WI26 VA4. Polyadenylated RNA was isolated and used to prepare double-stranded cDNA. Purified cDNA fragments were then ligated into pCAV/NOT vector DNA which uses regulatory sequences derived from pDC201 (a derivative of pMLSV, previously described by Cosm~in et al., Nature 312:768, 1984), SV40 and cytomegalovirus DNA, described in detail below in Example 2. pCAU/NOT has been deposited with the American Type Culture Collection under Accession No. ATCC 68014 on June 19th, 1989. The pCAV/NOT vectors containing the WI26-VA4 cDNA fragments were transformed into E. colj strain DHSa.
Transformants were plated to provide approximately 800 colonies per plate. The resulting colonies were harvested and each pool used to prepare plasmid DNA for transfection into COS-7 cells essentially as described by Cosman et al. (Nature 312:768, 1984) and Luthman et: al. (Nucl. Acjd Res. 11:1295, 1983). Transformants expres:~ing biologically active cell surface TNF receptors were identified by screening for their ability to bind 1251-TNF. In this screening approach, transfected COS-7 cells were incubated with medium containing 1251-TNF, the cells washed to remove unbound labelled TNF, and the cell monolayers contacted with X-ray film to detect 7a concentrations of TNF binding, as disclosed by Sims et al, Scjence 241:585 (1988). Transfectants detected in this manner appear as dark foci against << relatively light background.
Using this approach, approximately 240,000 cDNAs were screened in pools of ap~~roximately 800 cDNAs until assay of one transfectant pool indicated positive foci for TNF
binding. A frozen stock of bacteria from this positive pool was grown in culture and plated to provide individual colonies, which were screened until a single clone (clone 11) was identified which was capable of directing synthesis of a surface protein with detectable TNF binding activity. The seguence of cDNA clone 11 isolated by the above method is depicted in Figures 4-6.
Additionally cDNA clones can be isolated from cDNA
libraries of other mammalian species by cross-species hybridization. For use in h~rbridization, DNA encoding TNF-R
may be covalently labeled wit:h a detectable substance such as a fluorescent group, a radioF~ctive atom or a chemiluminescent group by methods well known t:o those skilled in the art. Such probes could also be used for jn vjtra diagnosis of particular conditions.
Like most mammalian genes, mammalian TNF receptors are presumably encoded by mu:Lti-exon genes. Alternative mRNA
constructs which can be attr:Lbuted to different mRNA splicing events following transcription, and which share large regions of identity or similarity with the cDNAs claimed herein, are considered to be within the scope of the present invention.
Other mammalian TNF-R cDNAs are isolated by using an appropriate human TNF-R
DNA sequence as a probe for screening; a particular mammalian cDNA library by cross-species hybridization.
Proteins and Analogs The present invention provides isolated recombinant mammalian TNF-R
polypeptides. Isolated TNF-R polypepti~des of this invention are substantially free of other contaminating materials of natural or endogenous origin and contain less than about 1 °!o by mass of protein contaminants residual oi" production processes. The native human TNF-R
molecules are recovered from cell lysates as glycoproteins having an apparent molecular weight by SDS-PAGE of about 80 kilodaltons (kDa). The TNF-R polypeptides of this invention are optionally without associated native-pattern glycosylation.
Mammalian TNF-R of the present invention includes, by way of example, primate, human, murine, canine, feline, bovine, ovine, equine and porcine TNF-R.
Mammalian TNF-Rs can be obtained by cross species hybridization, using a single stranded cDNA derived from the human TNF-R DNA sequence as a hybridization probe to isolate TNF-R
cDNAs from mammalian cDNA libraries.
Derivatives of TNF-R within the ;.cope of the invention also include various structural forms of the primary protein which retain biological activity. Due to the presence of ionizable amino and carboxyl groups, for example;, a TNF-R protein may be in the form of acidic or basic salts, or may be in neutral form. Individual amino acid residues may also be modified by oxidation or reduction.
The primary amino acid structure may be modified by forming covalent or aggregative conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like, or by creating amino acid sequence mutants. Covalent derivatives are prepared by linking particular functional groups to TNF-R amino acid side chains or at the N-or C-termini. Other derivatives of TNF-R within the scope of this invention include covalent or aggregative conjugates of TNF-R or its fragments with other proteins or polypeptides, such as by synthesis in recombinant culture as N-terminal or C-terminal fusions. For example, the conjugated peptide may be .a a signal (or leader) polypeptide sequence at the N-terminal region of the protein which co-translationally or post-translationally directs transfer of the protein from its site of synthesis to its site of function inside or outside of the cell membrane or wall (e.g., the yeast a-factor leader). TNF-R protein fusions can comprise peptides added to facilitate purification or identification of TNF-R (e.g., poly-His). The amino acid sequence of TNF receptor c.an also be linked to the peptide Asp-Tyr-Lys-Asp-suB~ sHE~

WO 91/03553 2 ~ 6 5 ~ 4 6 PCT/US90/04001 Asp-Asp-Asp-Lys (DYKDDDDK) (Hopp et al., BioITechnology 6:1204,1988.) The latter sequence is highly antigenic and provides an epitope reversibly bound by a specific monoclonal antibody, enabling rapid assay and facile purification of expressed recombinant protein. This sequence is also specifically cleaved by bovine mucosal enterokinase at the residue immediately following the Asp-L,ys pairing. Fusion proteins capped with this peptide may also be resistant to intracellular degradation in E. coli.
TNF-R derivatives may also be used as immunogens, reagents in receptor-based immunoassays, or as binding agents for affinity purification procedures of TNF
or other binding ligands. TNF-R derivatives m~ty also be obtained by cross-linking agents, such as M-maleimidobenzoyl succinimide ester and N-hydroxysuccinimide, at cysteine and lysine residues. TNF-R proteins may also be covalently bound through reactive side groups to various insoluble substrates, such as c:yanogen bromide-activated, bisoxirane-activated, carbonyldiimidazole-activated or tosyl.-activated agarose structures, or by adsorbing to polyolefin surfaces (with or without glutaraldehyde cross-linking). Once bound to a substrate, TNF-R may be used to selecti~rely bind (for purposes of assay or purification) anti-TNF-R antibodies or TNF.
The present invention also includes TNF-R with or without associated native-pattern glycosylation. TNF-R expressed in yeast or mammalian expression systems, e.g., cells, may be similar or slightly different in molecular weight and glycosylation pattern than the native molecules, depending upon the expression system. Expression of TNF-R DNAs in bacteria such as E. coli provides non-glycosylated molecules. Functional mutant analogs of mammalian TNF-R having inactivated N-glycosylation sites can be produced by oligonucleotide synthesis and ligation or by site-specific mutagenesis techniques. These analog proteins can be produced in a homogeneous, reduced-carbohydrate form in good yield using yeast expression systems. N-glycosylation sites in eukaryotic proteins are characterized by the amino acid triplet Asn-A1-Z, where A1 is any amino acid except Pro, and Z is Ser or Thr. In this sequence, asparagine provides a side chain amino group for covalent attachment of carbohydrate. Such a site can be eliminated by substituting another amino acid for Asn or for residue Z, deleting Asn o:r Z, or inserting a non-Z amino acid between A1 and Z, or an amino acid other than Asn between Asn and A1.
TNF-R derivatives may also be obtained by mutations of TNF-R or its subunits.
A
TNF-R mutant, as referred to herein, is a polypeptide homologous to TNF-R but which has an amino acid sequence different from native TNF-R because of a deletion, insertion or substitution.
Bioequivalent analogs of TNF'-R proteins may be constructed by, for example, making various substitutions of residues or sequences or deleting terminal or internal residues or sequences not needed for biological activity. For example, cysteine residues can be deleted suBS~n~E~r 206~~46 i0 (e.g., Cysl~g) or replaced with other amino acids to prevent formation of unnecessary or incorrect intramolecular disulfide bridges upon renaturation. Other approaches to mutagenesis involve modification of adjacent dibasic amino acid residues to enhance expression in yeast systems in which KEX2 protease activity is present.
Generally, S substitutions should be made conservatively; i.e., the most preferred substitute amino acids are those having physiochemical characteristics resembling those of the residue to be replaced. Similarly, when a deletion or insertion strategy is adopted, the potential effect of the deletion or insertion on biological activity should be considered.
Substantially similar polypeptide sequences, as defined above, generally comprise a like number of amino acids sequences, although C-terminal truncations for the purpose of constructing soluble TNF-Rs will contain fewer arriino acid sequences. In order to preserve the biological activity of TNF-Rs, deletions and substitutions will preferably result in homologous or conservatively substituted sequences, meaning that a given residue is replaced by a biologically similar residue. Examples of conservative substitutions include substitution of one aliphatic residue for another, such as Ile, Val, Leu, or Ala for one another, or substitutions of one polar residue for another, such as between Lys and Arg; Glu and Asp; or Gln and Asn.
Other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known. Moreover, particular amino acid differences between human, murine and other mammalian TNF-Rs is suggestive of additional conservative substitutions that may be made without altering the essential biological characteristics of TNF-R.
Subunits of TNF-R may be constructed by deleting terminal or internal residues or sequences. Particularly preferred sequences include those in which the transmembrane region and intracellular domain of TNF-R are deleted or substituted with hydrophilic residues to facilitate secretion of the receptor into the cell culture medium. The resulting protein is referred to as a soluble TNF-R molecule which retains its ability to bind TNF.
A particularly preferred soluble TNF-R construct is TNF-R~235 (the sequence of amino acids 1-235 of Figure 2), which comprises the entire extracellular region of TNF-R, terminating with Asp235 immediately adjacent the transmembrane region. Additional amino acids may be deleted from the transmembrane region while retaining TNF binding activity. For example, huTNF-R0183 which comprises the sequence of amino acids 1-183 of Figure 2, and TNF-which comprises the sequence of amino acids 1-163 of Figure 2, retain the ability to bind TNF ligand as determined using the binding assays described below in Example 1. TNF-R0142, however, does not retain the ability to bind TNF ligand. This suggests that one or both of Cysls~ and Cys163 is required for formation of an intramolecular disulfide bridge for the proper folding of TNF-R. Cysl~g, which was deleted without any apparent adverse effect on the ability of the soluble TNF-R to bind TNF, does not appear to be essential for st~s~~ sH~t 206534fi proper folding of TNF-R. Thus, any deletion C-terminal to Cys163 would be expected to result in a biologically active soluble TNF-R. The present invention contemplates such soluble TNF-R constructs corresponding to all or part of the extracelluar region of TNF-R terminating with any amino acid after Cys163. ether C-terminal deletions, such as TNF-Fe157, may be made as a matter of convenience by cutting TNF-R cDNA
with appropriate restriction enzymes and, if necessary, reconstructing specific sequences with synthetic oligonucleotide linkers. They resulting soluble TNF-R
constructs are then inserted and expressed in appropriate expression vectors and assayed for the ability to bind TNF, as described in Example 1. Biologically active soluble TNF-Rs resulting from such constructions are also contemplated to be within the scope of the present invention.
Mutations in nucleotide sequences constructed for expression of analog TNF-R must, of course, preserve the reading frame phase of the coding sequences and preferably will not create complementary regions that could hybridize to produce secondary mRNA structures such as loops or hairpins which would adversely affect translation of the receptor mRNA.
Although a mutation site may be predetermined, it is not necessary that the nature of the mutation per se be predetermined. For example, in order to select for optimum characteristics of mutants at: a given site, random mutagensis may be conducted at the targE~t codon and the expressed TNF-R
mutants screened for the des~~red activity.

2p 6534 6 11a Not all mutations i.n the nucleotide sequence which encodes TNF-R will be expres:ced in the final product, for example, nucleotide substitutions may be made to enhance expression, primarily to avoid secondary structure loops in the transcribed mRNA (see EPP~ 75,444A) or to provide codons that are more readily translated by the selected host, e.g., the well-known E. coli preference codons for E. coli expression.
Mutations can be introduced at particular loci by synthesizing oligonucleotide:c containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion.
Alternatively, olic~onucleotide-directed site-specific mutagensis procedures can be employed to provide an altered gene having particular codons altered according to the substitution, deletion, or insertion required. Exemplary methods of making the alterations set forth above are disclosed by Walder et al. I;Gene 42:133, 1986); Bauer et al.
(Gene 37:73, 1985); Craik (B~LoTechniques, January 1985, 12-19); Smith et al. (Genetic H ngineering: Principles and Methods, Plenum Press, 1981);; and U.S. Patent Nos. 4,518,584 and 4,737,462 disclose suitable techniques.
Both monovalent forms and polyvalent forms of TNF-R
are useful in the compositions and methods of this invention.
Polyvalent forms possess mull:iple TNF-R

I
t WO 91/03553 .,- . 2 0 6 5 3 4 6 P~/US90/04001 binding sites for TNF ligand. For example, a bivalent soluble TNF-R may consist of two tandem repeats of amino acids 1-235 of Figure 2, separated by a linker region.
Alternate polyvalent forms may also be constructed, for example, by chemically coupling TNF-R to any clinically acceptable carrier molecule, a polymer selected from the group consisting of Ficoll, polyethylene glycol or dextran using conventional coupling techniques.
Alternatively, TNF-R may be chemically coupled to biotin, and the biotin-TNF-R conjugate then allowed to bind to avidin, resulting in tetravalent avidin/biotin/TNF-R molecules. TNF-R
may also be covalently coupled to dinitrophenol (I~NP) or trinitrophenol (TNP) and the resulting conjugate precipitated with anti-DNP or anti-TNP-IgM, to form decameric conjugates with a vaaency of 10 for TNF-R binding sites.
A recombinant chimeric antibody molecule may also be produced having TNF-R
sequences substituted for the variable domains of either or both of the immunoglubulin molecule heavy and light chains and having unmodified constant region domains.
For example, chimeric TNF-RlIgGI may be produced from two chimeric genes -- a TNF-Rlhuman x light chain chimera (TNF-RICK) and a TNF-RJhuman Yl heavy chain chimera (TNF-R/C71). Following transcription and translation of the two chimeric genes, the gene products assemble into a single chime;ric antibody molecule having TNF-R
displayed bivalently. Such polyvalent forms of TIvTF-R may have enhanced binding affinity for TNF
ligand. Additional details relating to the construction of such chimeric antibody molecules are disclosed in WO 89/09622 and EP 3150152.
Expression of Recombinant TNF-R
The present invention provides recombinant expression vectors to amplify or express DNA encoding TNF-R. Recombinant expression vectors are replicable DNA
constructs which have synthetic or cDNA-derived DNA fragments encoding mammalian TNF-R or bioequivalent analogs operably linked to suitable transcriptional or translational regulatory elements derived from mammalian, microbial, viral or insect genes. A
transcriptional unit generally comprises an assembly of (1) a genetic element or elements having a regulatory role in gene expression, for example, transciiptional promoters or enhancers, (2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and (3) appropriate transcription and translation initiation and termination sequences, as described in detail below. Such regulatory elements may include an operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants may additionally be incorporated. DNA
regions are operably linked when they are functionstlly related to each other. For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed WO 91/03553 ~ ~ ~ ~ ~ ~ 6 PCT/US90/04001 as a precursor which participates in the secretion of the polypeptide; a promoter is o~ferably linked to a coding sequence if it controls the transcription of the sequence;
or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked means contiguous and, in the case of secretory leaders, contiguous and in reading frame. Structural elements intended for use in yeast expression systems preferably include a leader sequence enabling extracellular secretion of translated protein by a host cell. Alternatively, where recombinant protein is expressed without a leader or transport sequence, it may include an N-terminal methionine re~.due. This residue may optionally b~ ubsequently cleaved from the expressed recombinant protein to provide a final product.
DNA sequences encoding mammalian TNF receptors which are to be expressed in a microorganism will preferably contain no introns that could prematurely terminate transcription of DNA into mRNA; however, premature termination of transcription may be desirable, for example, where it would result in mutants having advantageous C-terminal truncations, for example, deletion of a transmembrane region to yield a soluble receptor not bound to the cell membrane. Due to code degeneracy, there can be considerable variation in nucleotide sequences encoding the same amino acid sequence. Other embodiments include sequences capable of hybridizing to the sequences of the provided cDNA under moderately stringent conditions (50°C, 2x SSC) and other sequences hybridizing or degenerate to those which encode biologically active TNF receptor polypeptides.
Recombinant TNF-R DNA is e;rpressed or amplified in a recombinant expression system comprising a substantially homogeneous monoculture of suitable host microorganisms, for example, bacteria such as E. coli or yeast such as S.
cerevisiae, which have stably integrated (by transformation or transfection) a recombinant transcriptional unit into chromosomal DNA or carry the recombinant transcriptional unit as a corn lent of a resident plasmid. Generally, cells constituting the system are the progeny ~~
a single ancestral transformant. Recombinant expression systems as defined herein will express heterologous protein upon induction of ~:he regulatory elements linked to the P' ' A sequence or synthetic gene to be expressed.
Transformed host cells are cells which have been transformed or transfected with TNF-R vectors constructed using recombinant DNA techniques. Transformed host cells ordinarily express TNF-R, but host cells transtc ~~ed for purposes of cloning or amplifying TNF-R DNA do not need to express TNF-R. Expressed TNF-R will be deposited in the cell membrane or secreted into the culture supernatant, depending on the TNF-R DNA
selected.
Suitable host cells for expression of mammalian TNF-R include prokaryotes, yeast or higher eukaryotic cells under the control of appropriate promoters. Prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli. Higher eukaryotic cells S~J~3~~"n'f~~T"~ Sff~l~'~"

2o s5~4 s include established cell lines of mammalian origin as describ-ed below. Cell-free translation systems could also be employed to produce mammalian TNF-R using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, arid mammalian cellular hosts are described by Pouwels et al. (Cloning Vectors: A Laboratory Manual, Elsevier, New York, 1985).
Prokaryotic express>ion hosts may be used for expres-sion of TNF-R that do not require extensive proteolytic and disulfide processing. Prokaryotic expression vectors gene-rally comprise one or more phenotypic selectable markers, for example a gene encoding protESins conferring antibiotic resist-ance or supplying an autotrophic requirement, and an origin of replication recognized by the host to ensure amplification within the host. Suitable prokaryotic hosts for trans-formation include E. coli, Bacillus subtilis, Salmonella typhimurium, and various spe~:ies within the genera Pseudomonas, Streptomyces, and Staphyolococcus, although others may also be employed .as a matter of choice. .
Useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison, WI, USA). These pBR322 B

20 fi534 6 14a "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed. E. coli is typically transformed using derivatives of pBR322, a plasmid derived from an E. coli species (Bolivar et al., Gene 2:95, 1977). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides simple means for identifying transformed cells.
Promoters commonly used in recombinant microbial expression vectors include the (3-lactamase (penicillinase) and lactose promoter system (Chang et al., Nature 275:615, 1978;
and Goeddel et al., Nature 2F31:544, 1979), the tryptophan (trp) promoter system (Goeddel et al., Nucl. Acids Res.
8:4057, 1980; and EPA 36,776) and tac promoter (Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, p. 412, 1982). .A particularly useful bacterial expression system employs the phage ~. PL promoter and cI857ts thermolabile repressor. Plasmid vectors available from the American Type Culture Collection which incorporate derivatives of the ~, PL promoter include plasmid pHUB2, resident in E.
coli strain JMB9 (ATCC 37092) and pPLc28, resident in E. coli RR1 (ATCC 53082).
Recombinant TNF-R proteins may also be expressed in yeast hosts, preferably from the Saccharomyces species, such as S. cerevisiae. Yeast of other genera, such as Pichia or Kluyveromyces may also be employed. Yeast vectors will generally contain an origin of replication from the 2u yeast plasmid or an autonomously replicating sequence (ARS), -. 20 653 6 promoter, DNA encoding TNF-R, sequences for polyadenylation and transcription termination and a selection gene. Preferably, yeast vectors will include an origin of replication and selectable marker permitting transformation of both yeast and E. coli, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae T'RP1 or URA3 gene, which provides a selection marker for a mutant strain of yc;ast lacking the ability to grow in tryptophan, and a promoter derived from a highly expressed yeast gene to induce transcription of a structural sequence downstream. The presence of the TRP1 or URA3 lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan or uracil.
Suitable promoter sequences in yeast vectors include the promoters for metallothionein, 3-phosphoglycerate ki.nase (Hitzeman et al., J. Biol. Cycem.
255:2073, 1980) or other glycolytic enzymes (He;ss et al., J. Adv. Enryme Reg. 7:149, 1968; and Holland et al., Biochem. 17:4900, 197~B), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycc:rate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPA
73,657.
Preferred yeast vectors can be assembled using DNA sequences from pUCl8 for selection and replication in E. coli (Arripr gene and origin of replication) and yeast DNA
sequences including a glucose-repressible: ADH:2 promoter and a-factor secretion leader. The ADH2 promoter has been described by Russell et al. (J. Biol. Chem. 258:2674, 1982) and Beier et al. (Nature 300:724, 1982). The yeast a-factor leader, which directs secretion of heterologous proteins, can be inserted between the promoter and the structural gene to be expressed. See, e.g., Kurjan et al., Cell 30:933, 1982; and Bitter et al., Proc. Natl. Acad.
Sci. USA 81:5330, 1984. The leader sequence may be modified to contain, near its 3' end, one or more useful restriction sites to facilitate fusion of the leader sequence to foreign genes.
Suitable yeast transformation protocols are known to those of skill in the art; an exemplary technique is described by Hinnen et al., Proc. Natl. Acad. Sci. USA
75:1929, 1978, selecting for Trp+ transformants in a selective medium consisting of 0.67% yeast nitrogen base, 0.5% casamino acids, 2%~ glucose, 10 ~g/ml adenine and 20 ug/ml uracil or URA+ tranformants in medium consisting of 0.67% YNB, with amino acids and bases as described by Sherman et al., Laboratory Course Manual for Methods in Yeasr Generics, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1986.
Host strains transformed by vectors comprising the ADH2 promoter may be grown for expression in a rich medium consisting of 1% yeast extract, 2% peptone, and 1% or 4%
glucose supplemented with 80 ug/ml adenine and 80 pg/ml uracil. Derepression of the ADH2 'SU~'.~T1~°iL9T'E S~"ff~' 2o s~~4 ~

promoter occurs upon exhaustion of medium glucose. Crude yeast supernatants are harvested by filtration and held at 4°C prior to further purification.
Various mammalian or insect cell culture systems are also advantageously employed to express recombinant protein. Expression of recombinant proteins in mammalian cells is particularly preferred because such proteins are generally correctly folded, appropriately modified and completely functional. Examples of suitable mammalian host cell lines include the COS-7 lines of monkey kidney cells, described by Gluzman (Cell 23:175, 1981 ), and other cell lines capable of expressing an appropriate vector including, for example, L cells, C127, 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines. Mammalian expression vectors may comprise nontranscribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other 5' or 3' flanking nontranscribed sequences, and 5' or 3' nontranslated sequences, such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences. Baculovirus systems for production of heterologous proteins in insect cells are reviewed by Luckow and Summers, BioITechnology 6:47 (1988).
The transcriptional and translational control sequences in expression vectors to be used in transforming vertebrate cells may be provided by viral sources. For example, commonly used promoters and enhancers are derived from Polyoma, Adenovirus 2, Simian Virus 40 (SV40), and human cytomegalovirus. DNA sequences derived from the SV40 viral genome, for example, SV40 origin, early and late promoter, enhancer, splice, and polyadenylation sites may be used to provide the other genetic elements required for expression of a heterologous DNA sequence. The early and late promoters are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature 273:113, 1978). Smaller or larger SV40 fragments may also be used, provided the approximately 250 by sequence extending from the Hind 3 site toward the Bgll site located in the viral origin of replication is included. Further, mammalian genomic TNF-R promoter, control and/or signal sequences may be utilized, provided such control sequences are compatible with the host cell chosen.
Additional details regarding the use of a mammalian high expression vector to produce a recombinant mammalian TNF receptor are provided in Examples 2 and 7 below. Exemplary vectors can be constructed as disclosed by Okayama and Berg (Mol. Cell. Biol. 3:280, 1983).
A useful system for stable high level expression of mammalian receptor cDNAs in C127 murine mammary epithelial cells can be constructed substantially as described by Cosman et al. (Mol. Immunol. 23:935, 1986).
In preferred aspects of the present invention, recombinant expression vectors comprising TNF-R cDNAs are stably integrated into a host cell's DNA. Elevated levels of expression product is achieved by selecting for cell lines having amplified numbers of vector SU~~~'!~'t~Tg S~~~"~' 20 fi534 fi DNA. Cell lines having amplified nurr~bers of vector DNA are selected, for example, by transforming a host cell with a vector comprising a DNA sequence which encodes an enzyme which is inhibited by a known drug. The vector may also comprise a DNA
sequence which encodes a desired protein. Alternatively, the host cell may be co-transformed with a second vector which comprises the DNA sequence which encodes the desired protein. The transformed or co-transformed host cells are then cultured in increasing concentrations of the known drug, thereby selecting for drug-resistant cells. Such drug-resistant cells survive in increased concentrations of the toxic iirug by over-production of the enzyme which is inhibited by the drug, frequently as a result of amplification of the gene encoding the enzyme.
Where drug resistance is caused by an increase in the copy number of the vector DNA
encoding the inhibitable enzyme, there is a concomitant co-amplification of the vector DNA
encoding the desired protein (TNF-R) in the host cell's DNA.
A preferred system for such co-arnplification uses the gene for dihydrofolate reductase (DHFR), which can be inhibited by the drug methotrexate (MTX). To achieve co-amplification, a host cell which lacks an active gene encoding DHFR is either transformed with a vector which comprises DNA sequence encoding DHFR and a desired protein, or is co-transformed with a vector comprising a DNA sequence encoding DHFR and a vector comprising a DNA sequence encoding the desired protein. The transformed or co-transformed host cells are cultured in media containing increasing levels of MTX, and those cells lines which survive are selected.
A particularly preferred co-amplification system uses the gene for glutamine synthetase (GS), which is responsible for the synthesis of glutamate and ammonia using the hydrolysis of ATP to ADP and phosphate to drive the reaction. GS is subject to inhibition by a variety of inhibitors, for example methionine sulphoximine (MSX). Thus, TNF-R can be expressed in high concentrations by co-amplifying cells transformed with a vector comprising the DNA sequence for GS and a desired protein, or co-transformed with a vector comprising a DNA sequence encoding GS and a vecoor comprising a DNA sequence encoding the desired protein, culturing the host cells in media containing increasing levels of MSX
and selecting for surviving cells. The GS co-amplification system, appropriate recombinant expression 3(? vectors and cells lines, are described in the following PCT applications:
WO 87/04462, WO
89/01036, WO 89/10404 and WO 86/05807.
Recombinant proteins are preferably expressed by co-amplification of DHFR or GS in a mammalian host cell, such as Chinese Hamster Ovary (CHO) cells, or alternatively in a murine myeloma cell line, such as SP2,/p-Ag 14 or NSO or a rat myeloma cell line, such as YB2/3.0-Ag20, disclosed in PCT applications WO/89/10404 and WO 86/05807.
A preferred eukaryotic vector for expression of TNF-R DNA is disclosed below in Example 2. This vector, referred to as hCAV/NOT, was derived from the mammalian high SIJBSTIT~"'T'~ SIfE~'~' 'O 91 /03553 PCh/ USA 4001 21~ fi534 fi 18, expression vector pDC201 and contains regulatory sequences from SV40, adenovirus-2, and human cytomegalovirus.
Purification of Recombinant TNF-R
Purified mammalian TNF receptors ~or analogs are prepared by culturing suitable host/vector systems to express the recombinant translation products of the DNAs of the present invention, which are then purified from culture media or cell extracts.
For example, supernatants from systems which secrete recombinant protein into culture media can be first concentrated using a commercially available protein concentration filter, for example, an Amicon*or Millipore Pellicon*ultrafiltration unit.
Following the concentration step, the concentrate can be applied to a suitable purification matrix. For example, a suitable affinity matrix can comprise a TNF or lectin or antibody molecule bound to a suitable suppot~t. Alternatively, an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylarr,~inoethyl (DEAE) groups. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification. Alternatively, a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred.
Finally, one or more reversed-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-IEiPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed tv further purify a TNF-R
composition.
Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a homogeneous recombinant protein.
Recombinant protein produced in bacterial culture is usually isolated by initial extraction from cell pellets, followed by one or more concentration, salting-out, aqueous ion exchange or size exclusion chromatography steps. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps. Microbial cells employed in expression of recombinant mammalian TNF-R can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
Fermentation of yeast which express mammalian TNF-R as a secreted protein greatly simplifies purification. Secreted recombinant protein resulting from a large-scale fermentation can be purified by methods analogous to those disclosed by Urdal et al. (J.
Chromatog.
296:171, 1984). This reference describes two sequential, reversed-phase HPLC
steps for purification of recombinant human GM-CSF on a preparative HPLC column.
Human TNF-R synthesized in recomhinant culture is characterized by the presence of non-human cell components, including proteins, in amounts and of a character which depend *Trade-mark 72249-30 upon the purification steps taken to recover human TNF-R from the culture.
These components ordinarily will be of yeast, :prokaryotic or non-human highew eukaryotic origin and preferably are presen~ in innocuous contaminant quantities, on the order of less than about 1 percent by weight. Further, recombinant cell culture enables the production of TNF-R free of proteins which may be normally associated with TNF-R as it is found in nature in its species of origin, e.g. in cells, cell exudates or body fluids.
Therataeutic Administration of Recombinant Soluble TNF-R
The present invention provides methods of using therapeutic compositions comprising an effective amount of soluble TNF-R proteins and a suitable diluent and carrier, and methods for suppressing TNF-dependent inflammatory responses in humans comprising administering an effective amount of soluble TNF-R prntein.
For therapeutic use, purified soluble TNF-R protein is administered to a patient, preferably a human, for treatment in a manner appropriate to the indication.
Thus, for example, soluble TNF-R protein compositions can be administered by bolus injection, continuous infusion, sustained release from implants, or other suitable technique. Typically, a soluble TNF-R therapeutic agent will be administered in the form of a composition comprising purified protein in conjunction with physiologically acceptable carriers, excipients or diluents. Such carriers will be nontoxic to recipients at the dosages and concentrations employed. Ordinarithe preparation of such compositions entails combining the TNF-R
with buffers, antioxidants such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDT,A, glutathione and other stabilizers and excipients.
Neutral buffered saline or saline mixed with conspecific serum albumin are exemplary appropriate diluents. Preferably, product is formulated as a lyophilizate using appropriate excipient solutions (e.g., sucrose) as diluents. Appropriate dosages can be determined in trials. The amount and frequency of administration will depend, of course, on such factors as the r~ ire and severity of the indication being treated, the desired response, the condition of the I,..~ient, and so forth.
Soluble TNF-R proteins are administered for the purpose of inhibiting TNF-dependent responses. A variety of diseases or conditions are believed to be caused by TNF, such as cachexia and septic shock. I~- ,ddition, other key cytokines (IL-1, IL-2 and other colony stimulating factors) can also i: :e significant host production of TNF.
Soluble TNF-R compositions may therefore be used, for example, to treat cachexia or septic shock or to treat side effects associated with cytokine therapy. Because of the primary roles 1L-1 and IL-2 play in the production of TNF, cornbination therapy using both IL-1 receptors or IL-2 receptors may be preferred in the treatment of T'NF-associated clinical indications.

WO 91103553 ~ PC1'/U~ 040x1 The following examples are offered by way of illustration, and not by way of limitation.

Example 1 in in Assays A. Radiolabeling of TNFa and TNF~B. Recombinant human TNFa, in the form of a fusion protein containing a hydrophilic octapeptide at the N-terminus, was expressed in yeast as a secreted protein and purified by affinity chromatography (Hopp et al., BioITechnology 6:1204, 1988). Purified recombinant human TNF~i was purchased from R&D Systems (Minneapolis, MN). Both proteins were radiolabeled using the commercially available solid phase agent, IODO-GEN*(Pierce). In this procedure, 5 ug of IODO-GEN were plated at the bottom of a 10 x 75 mm glass tube and incubated for 20 minutes at 4'C with 75 ~1 of 0.1 M
sodium phosphate, pH 7.4 and 20 ~l (2 mCi) Na 125I. This solution was then transferred to a second glass tube containing 5 pg TNFa (or TNFp) in 45 ~1 PBS for 20 minutes at 4'C.
The reaction mixture was fractionated by gel filtration on a 2 ml bed volume of Sephadex 6-(Sigma) equilibrated in Roswell Park Memorial Institute (RPMI) 1640 medium containing 2.5% (w/v) bovine serum albumin (BSA), O.:Z% (w/v) sodium azide and 20 mM
Hepes pH

7.4 (binding medium). The final pool of ~251i-TNF was diluted to a working stock solution of 1 x 10-7 M in binding medium and stored for up to one month at 4'C without detectable 25 loss of receptor binding activity. The specific activity is routinely 1 x 106 cpm/mmoIe TNF.
B. Binding to Intact Cells. Binding assays with intact cells were performed by two methods. In the first method, cells were first grown either in suspension (e.g., U 937) or by adherence on tissue culture plates (e.g., WI26-VA4, COS cells expressing the recombinant TNF receptor). Adherent cells were subsequently removed by treatment with 5mM
ED'~'A
treatment for ten minutes at 37 degrees centigrade. Binding assays were then performed by a pthalate oil separation method (Dower et al., J. lmmunol. 132:751, 1984) essentially as described by Park et al. (J. Biol. Chem. 26i!:4177, 1986). Non-specific binding of ~25I-TNF was measured in the presence of a 200-fold or greater molar excess of unlabeled TNF.
Sodium azide (0.2%) was included in a binding assay to inhibit internalization of 1251-TNF
by cells. In the second method, COS cells transfected with the TNF-R-containing plasmid, and expressing TNF receptors on the surface,. were tested for the ability to bind 1251_TNF by the plate binding assay described by Sims et ttl. (Science 241:585, 1988).
C. Solid Phase Binding Assays. The ability of TNF-R to be stably adsorbed to nitrocellulose from detergent extracts of humt~n cells yet retain TNF-binding activity provided *Trade-mark W(7 9t ~ .3553 2 0 6 5 3 4 s ~/US90/04001 2'l a means of detecting TNF-R. Cell extracts were prepared by mixing a cell pellet with a 2 x volume of PBS containing 1% Triton X-101*and a cocktail of protease inhibitors (2 mM
phenylmethyl sulfonyl fluoride, 10 ~.iM pepstatin, 10 ~Nl leupeptin, 2 mM o-phenanthroline and 2 mM EGTA) by vigorous vortexing. The mixture was incubated on ice for 30 minutes after which it was centrifuged at 12,OOOx g fcrr 15 minutes at 8'C to remove nuclei and other debris. Two microliter aliquots of cell extracts were placed on dry BA85/21 nitrocellulose membranes (Schleicher and Schuell, Keene, NH) and allowed to dry. The membranes were incubated in tissue culture dishes for 30 minutes in Tris (0.05 M) buffered saline (0.15 M) pH 7.5 containing 3% w/v BSA to block nonspecific binding sites. The membrane was then covered with 5 x 10-1 i M 125I_TNF in PBS + 3% BSA and incubated for 2 hr at 4'C with shaking. At the end of this time, the membranes were washed 3 times in PBS, dried and placed on Kodak X-Omat AR film for 18 hr a.t -70'C.
Example 2 i5 Isolation of Human TNF-R cDNA by Direca Expression of Active Protein in COS-7 Cells Various human cell lines were screened for expression of TNF-R based on their ability to bind 1251-labeled TNF. The humor fibroblast cell line WI-26 VA4 was found to express a reasonable number of receptors per cell. Equilibrium binding studies showed that the cell line exhibited biphasic binding of 1~-51-TNF with approximately 4,000 high affinity sites (Ka = 1 x 101 M-1) and 15,00 low affinity sites (Ka = 1 x 10g M-1) per cell.
An unsized cDNA library was constructed by reverse transcription of polyadenylated mRNA isolated from total RNA extracted from human fibroblast WI-26 VA4 cells grown in the presence of pokeweed mitogen using standard techniques (Gubler, et al., Gene 25:263, 1983; Ausubel et al., eds., Current Protocol: in Molecular Biology, Vol. 1, 1987). The cells were harvested by lysing the cells in a guanidine hydrochloride solution and total RNA
isolated as previously described (Ma.rch et al., Nature 315:641, 1985).
Poly A+ RNA was isolated by oligo dT cellulose chromatography and double stranded cDNA was prepared by a methodl similar to that of Gubler and Hoffman (Gene 25:263, 1983). Briefly, the poly A+ RN~~ was convened to an RNA-cDNA hybrid by reverse transcriptase using oligo dT as a prinner. The RNA-cDNA hybrid was then converted into double-stranded cDNA using RNAase H in combination with DNA polymerase I.
The resulting double stranded cDNA was blunt-ended with T4 DNA polymerase. To the blunt-ended cDNA is added EcoRI linker-adapters (having internal Notl sites) which were phosphorylated on only one end (Invitrogen). The linker-adaptered cDNA was treated with T4 polynucleotide kinase to phosphorylate the 5' overhanging region of the linker-adapter and unligated linkers were removed by running the cDNA over a Sepharose CLAB
column. The linker-adaptered cDNA was ligated to an equimolar concentration of EcoR 1 cut and *Trade-mark 72249-30 WO 91/03553 2 0 6 5 3 4 ~ P~T/US90/04001 dephosphorylated arms of bacteriophag;e 7~gt10 (Huynh et al, DNA Cloning: A
Practical Approach, Glover, ed.; IRL Press, pp. 49-78). The ligated DNA was packaged into phage particles using a commercially available lkit to generate a library of recombinants (Stratagene Cloning Systems, San Diego, CA, USA). Recombinants were further amplified by plating phage on a bacterial lawn of E. coli strain c600(hfl-).
Phage DNA was purified from the: resulting 7~gt10 cDNA library and the cDNA
inserts excised by digestion with the restriction enzyme Notl. Following electrophoresis of the digest through an agarose gel, cDNAs grf:ater than 2,000 by were isolated.
The resulting cDNAs were ligated into the eukaryotic expression vector pCAV/NOT, which was designed to express cDNA sequences inserted at its multiple cloning site when transfected into mammalian cells. pCAV/NOT was assembled from pDC201 (a derivative of pMLSV, previously described by Cos:man et al., Nature 312: 768, 1984), SV40 and cytomegalovirus DNA and comprises, in sequence with the direction of transcription from the origin of replication: (1) SV40 sequence; from coordinates 5171-270 including the origin of replication, enhancer sequences and early and late promoters; (2) cytomegalovirus sequences including the promoter and enhancer regions (nucleotides 671 to +63 from the sequence published by Boechart et al. (Cell 41:52:1, 1985); (3) adenovirus-2 sequences containing the first exon and part of the intron between ~:he first and second exons of the tripartite leader, the second exon and pan of the third exon of the tripartite leader and a multiple cloning site (MCS) containing sites for Xhol, Kpnl, Smal, Notl and Bgll; (4) SV40 sequences from coordinates 4127-4100 and 2770-2533 that include the polyadenylation and termination signals for early transcription; (5) sequences derived from pBR322 and virus-associated sequences VAI and VAII of pDC201, with adenovirus sequences 10532-11156 containing the VAI and VAII genes, followed by ~pBR322 sequences from 4363-2486 and 1094-containing the ampicillin resistance gene ~~nd origin of replication.
The resulting WI-26 VA4 cDNA library in pCAV/NOT was used to transform E. coli strain DHSa, and recombinants were plated to provide approximately 800 colonies per plate and sufficient plates to provide approximately 50,000 total colonies per screen. Colonies were scraped from each plate, pooled, and plasmid DNA prepared from each pool.
The pooled DNA was then used to transfect a sub-confluent layer of monkey COS-7 cells using DEAE-dextran followed by chloroquine treatment, as described by Luthman et al.
(Nucl.
Acids Res. 11:1295, 1983) and McCutchan et al. (J. Natl. Cancer Inst. 41:351, 1986). The cells were then grown in culture for three days to permit transient expression of the inserted sequences. After three days, cell culture supernatants were discarded and the cell monolayers in each plate assayed for TNF binding as follows. Three ml of binding medium containing 1.2 x 10-11 M 125I_labeled FLAG~-TNF~ was added to each plate and the plates incubated at 4°C for 120 minutes. This medium wa.s then discarded, and each plate was washed once St~~3STl T ;ATE SNEE'~

with cold binding medium (containing no labeled TNF) and twice with cold PBS. The edges of each plate were then broken off, leaving a flat disk which was contacted with X-ray film for 72 hours at -70oC using an intensifying screen. TNF binding activity was visualized on th,e exposed films as a dark focus against a relatively uniform background.
After approximately 240,000 recombinants from the library had been screened in this manner, one transfectant pool was observed to provide TNF binding foci which were clearly apparent against the background exposure.
A f rozen st ock of bact a r is f rom t he pos it ive poo 1 was then used to obtain plates of approximately 150 colonies.
Replicas of these plates were made on nitrocellulose filters, and the plates were then scraped and plasmid DNA prepared and transfected as described above to identify a positive plate.
Bacteria from individual colonies from the nitrocellulose replica of this plate were grown in 0.2 ml cultures, which were used to obtain plasmid DNA, which was transfected into COS-7 cells as described above. In this manner, a single clone, clone 1, was isolated which was capable of inducing expression of human TNF-R in COS cells. The expression vector pCAV/NOT containing the TNF-~~ cDNA clone 1 has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD 20852, tJSA (Accession No. 68088) under the name pCAV/NOT-TNF-R on SE~ptember 6th, 1989.

_. _.- ..~. ~ __._ 2o s5.34 s 23a Bxample 3 Construction of cDNAs Encoding Soluble huTNF-R~235 A cDNA encoding a soluble huTNF-R~235 (having the sequence of amino acids 1-235 of Figure 2) was constructed by excising an 840 by fragment from pCAV/NOT-TNF-R with the restriction enzymes Notl and Pvu2. Notl cuts at the multiple cloning site of pCAV/NOT-TNF-R and Pvu2 cuts within the TNF-R
coding region 20 nucleotides 5' of the transmembrane region.
In order to reconstruct the ~I' end of the TNF-R sequences, two oligonucleotides were synthe:;ized and annealed to create the following oligonucleotide linker:
Pvu2 BamHI Bgl2 CTGAAGGGAGCAC7.'GGCGACTAAGGATCCA
GACTTCCCTCGTGFICCGCTGATTCCTAGGTCTAG
AlaGluGlySerThrGlyAspEnd This oligonucleotide linker has terminal Pvu2 and Bgl2 restrictions sites, regenerates 20 nucleotides of the TNF-R, followed by a termination codon (underlined) and a BamHI
restriction site (for convenjLence in isolating the entire soluble TNF-R by Notl/BamHI digestion). This oligonucleotide was then ligated with the 840 by Notl/Pvu2 TNF-R insert into 8g12/Notl cut pCAV/NOT to yield psolhuTNF-R~235/CAVNOT, which was 2o s5~~

transfected into COS-7 cells as described above. This expression vector induced expression of soluble human TNF-R which was capable of binding TNF.
Example 4 Construction of cDNA~~ Encoding Soluble huTNF-80185 A cDNA encoding a soluble hu'I'NF-80185 (having the sequence of amino acids 1-185 of Figure 2) was constructed by excising a 640 by fragment from pCAV/NOT-TNF-R
with the restriction enzymes Notl and Bgl2. Notl cuts at the multiple cloning site of pCAV/NO-TNF-R and Bgl2 cuts within the TNF-R coding region at nucleotide 637, which is 237 nucleotides 5' of the transmembrane region. The following oligonucleotide linkers were synthesized:
Bgl2 1S 5'-GATCTGTAACGTGGTGGCCATCCCTGGGAATGCAAGCATGGATGC-3' ACATTGCACCACCGGTAGGGACCCTTACGTTCG
IleCysAsnValValAlaIleProGlyAsnAlaSerMetAspAla Note 5'- AGTCTGCACGTCCACGTCCCCCACCCGGTGAGC -3' TACCTACGTCAGACGTGCAGGTGCAGGGGGTGGGCCACTCGCCGG
ValCysThrSerThrSerProThrArgEnd The above oligonucleotide linkers reconstruct the 3' end of the receptor molecule up to nucleotide 708, followed by a termination codon (underlined). These oligonucleotides were then ligated with the 640 by Notl TrfF-R insert into Notl cut pCAV/NOT to yield the expression vector psoITNFR~185/CA'VNOT, which was transfected into COS-7 cells as described above. This expression vector induced expression of soluble human TNF-R which was capable of binding TNF.
Example 5 construction of cDNA,s Encoding Soluble huTNF-80163 A cDNA encoding a soluble huTNF-80163 (having the sequence of amino acids 1-163 of Figure 2) was constructed by excising a 640 by fragment from from pCAV/NOT-TNF-R with the restriction enzymes Notl and Bgl2 as described in Example 4.
The following oligonucleotide linkers were ~,ynthesized:
Bgl2 Notl 5' -GATCTGTTGAC;C -3' ACAACTCGCCGG
IleCysEnd ~uss~rer;~ ~H~E,~.
.___ This above oligonucleotide linker reconstructs the 3' end of the receptor molecule up to nucleotide 642 (amino acid 163), followed by a termination codon (underlined).
This oligonucleotide was then ligated with the 640 by Notl TNF-R insert into Notl cut 5 pCAV/NOT to yield the expression vector psoITNFR0163/CAVNOT, which was transfected into COS-7 cells as described above. This expression vector induced expression of soluble human TNF-R which was capable of binding TNF in the binding assay described in Example 1.
F;xample 6 Construction of cDNAs Encoding Soluble huTNF-R~142 A cDNA encoding a soluble huTNF-R~142 (having the sequence of amino acids 1-142 of Figure 2) was constructed by excising a 550 by fragment from from pCAV/NOT-TNF-R with the restriction enzymes Notl and AlwNl. AlwNl cuts within the TNF-R
coding region at nucleotide 549. The following oligonucleotide linker was synthesized:
Bgl2 Notl 2O 5'-CTGAAACATCAGACGTGGTGTGCAAGCCCTGT~A-3' CTTGACTTTGTAGTCTGCACf~ACACGTTCGGGACAATTTCTAGA
End This above oligonucleotide linker reconstructs the 3' end of the receptor molecule up to nucleotide 579 (amino acid 142), followed by a termination codon (underlined).
This oligonucleotide was then ligated with the 550 by Notl/AlwNl TNF-R insert into Not1Bg12 cut pCAV/NOT to yield the expression vector psoITNFR~142/CAVNOT, which was transfected into COS-7 cells as described above. This expression vector did not induced expression of soluble human TNF-R which was capable of binding TNF. It is believed that this particular construct failed to expreas biologically active TNF-R because one or more essential cysteine resi3ue (e.g., Cysls~ or Cys163) required for intramolecular bonding (for formation of the proper tertiary structure of the TNF-R molecule) was eliminated.
Example 7 3$ ~x~ession of SolulZle TNF Receptors in CHO Cells Soluble TNF receptor was expressed in Chinese Hamster Ovary (CHO) cells using the glutamine-synthetase (GS) gene amplification system, substantially as described in PCT
patent application Nos. W087/04462 and W089/01036. Briefly, CHO cells are transfected with an expression vector containing gE;nes for both TNF-R and GS. CHO cells are selected !~UIBSTIT~TE SH~L~

2 0 6 5 3 4 6 P~/US90/04001 for GS gene expression based on the ability of the transfected DNA to confer resistance to low levels of methionine sulphoximine (MSX). GS sequence amplification events in such cells are selected using elevated MSX concentrations. In this way, contiguous TNF-R
sequences are also amplified and enhanced TNF-R expression is achieved.
The vector used in the GS expression system was psoITNFR/P6/PSVLGS, which was constructed as follows. First, the vector pSVLGS.l (described in PCT
Application Nos. W087/04462 and W089/01036, and available from Celltech, Ltd., Berkshire, UK) was cut with the BamHl restriction enzyme and dephosphorylated with calf intestinal alkaline phosphatase (CIAP) to prevent the vector from religating to itself. The BamHl cut pSVLGS.l fragment was then ligated to a 2.4 kb BamHl to Bgl2 fragment of pEE6hCMV
(described in PCT Application No. W089/01036, also available from Celltech) which was cut with Bgl2, BamHl and Fspl to avoid two fragments of similar size, to yield an 11.2 kb vector designated p6/PSVLGS.l. pSVLGS.I contains the glutamine synthetase selectable marker gene under control of the SV40 later promoter. The BamHl to Bgl2 fragment of pEE6hCMV contains the human cytomegalovirus major immediate early promoter (hCMV), a polylinker, and the SV40 early polyadenylation signal. The coding sequences for soluble TNF-R were added to p6/PSVLGS.1 by excising a Notl to BamHl fragment from the expression vector psoITNFR/CAVNOT (made according to Example 3 above), blunt ending with Klenow and ligating with SmaI cut dephosphorylated p6/PSVLGS.1, thereby placing the soITNF-R coding sequences under the control of the hCMV promoter. This resulted in a single plasmid vector in which the SV40/GS and hCMB/soITNF-R transcription units are transcribed in opposite directions. This vector was designated psoITNFR/P6/PSVLGS.
psoITNFR/P6/PSVLGS was used to transfect CHO-K1 cells (available from ATCC, Rochville, MD, under accession number CCL 61) as follows. A monolayer of CHO-K
1 cells were grown to subconfluency in Minimum Essential Medium (MEM) lOX (Gibco: 330 1581AJ) without glutamine and supplemented with 10% dialysed fetal bovine serum (Gibco:
220-6300AJ), 1 mM sodium pyruvate (Sigma), MEM non-essential amino acids (Gibco: 320-1140AG), 500 ~M asparagine and glutamate (Sigma) and nucleosides (30 ~.M
adenosine, guanosine, cytidine and uridine and 10 N.M thymidine)(Sigma).
Approximately 1 x 106 cells per 10 cm petri dish were transfected with 10 ug of psoITNFR/P6/PSVLGS by standard calcium phosphate precipitation, substantially as described by Graham & van der Eb, Virology 52:456 (1983). Cells were subjected to glycerol shock (15% glycerol in serum-free culture medium for approximately 1.5 minutes) approximately 4 hours after transfection, substantially as described by Frost & Williams, Virology 91:39 (1978), and then washed with serum-free medium. One day later, transfected cells were fed with fresh selective medium containing MSX at a final concentration of 25 uM.
Colonies of MSX-resistant surviving cells were visible within 3-4 weeks.
Surviving colonies RUBS SHEET

were transferred to 24-well elates and allowed to grow to confluency in selective medium. Conditioned medium from confluent wells were then as=rayed for soluble TNF-R activity using the binding assay described in Example 1 above. These assays indicated that the colonies expressed biologically active soluble TNF-R.
In order to select for GS gene amplification, several MSX-resistant cell lines are transfected with psoITNFR/P6/PSVLGS and grown in various concentrations of MSX.
For each cell line, approximE~tely 1x106 cells are plated in gradually increasing concentrations of 100 uM, 250 uM, 500 uM
and 1 mM MSX and incubated far 10-14 days. After 12 days, colonies resistant to the hic3her levels of MSX appear. The surviving colonies are assayed for TNF-R activity using the binding assay described above' in Example 1. Each of these highly resistant cell lines contains cells which arise from mult iple independent amplif ic:at ion events . From these cell lines, one or more of the mo:~t highly resistant cell lines are isolated. The amplified cel7.s with high production rates are then cloned by limiting dilution cloning. Mass cell cultures of the transfectants secrete active soluble TNF-R.
E~:amp 1 a 8 Expression of Soluble Human TNF-R in Yeast Soluble human TNF-R was expressed in yeast with the expression vector pIXY432, which was derived from the yeast expression vector pIXY120 and plasmid pYEP352. pIXY120 is identical to pYaHuGM (ATCC 5.3157, deposited June 19th, 1985), 27a except that it contains no cDNA insert and includes a polylinker/multiple cloning rite with a NcoI restriction site.
A DNA fragment encoding TNF receptor and suitable for cloning into the yeast e~:pression vector pIXY120 was first generated by polymerase chain reaction (PCR) amplification of the extracellular portion of the full length receptor from pCAV/NOT-TNF-R (ATCC 68088). The following primers were used in this PCR amplification=
5' End Primer 5'-TTCCGGTACCTTTGGATAAAAGAGACTACAAGGAC
Asp718->ProLeuAspLysF,rgAspTyrLysAsp GACGATGACAAGTTGCC'.CGCCCAGGTGGCATTTACA-3' AspAspAspLys<----~---TNF-R---------->
3' End Primer (antisensEl 5'-CCCGGGATCCTTAGTCGCCAC~TGCTCCCTTCAGCTGGG-3' BamHI>End<-------------TNF-R------->

W091/03553 2 0 6 5 3 4 6 P~/US90/04001 _. 2g The S' end oligonucleotide primer used in the amplification included an Asp718 restriction site at its 5' end, followed by nucleotides encoding the 3' end of the yeast a-factor leader sequence (Pro-Leu-Asp-Lys-Arg) and those encoding the 8 amino acids of the FLAG~
peptide (AspTyrLysAspAspAspAspLys) fused to sequence encoding the 5' end of the mature receptor. The FLAG~ peptide (Hopp et al., BioITechnology 6:1204, 1988) is a highly antigenic sequence which reversibly binds the monoclonal antibody M1 (ATCC HB
9259).
The oligonucleotide used to generate the 3' end of the PCR-derived fragment is the antisense strand of DNA encoding sequences which terminate the open reading frame of the receptor after nucleotide 704 of the mature coding region (following the Asp residue preceding the transmembrane domain) by introducing a. TAA stop codon (underlined). The stop codon is then followed by a BamHl restriction site. The DNA sequences encoding TNF-R
are then amplified by PCR, substantially as described by Innis et al., eds., PCR
Protocols: A Guide ro Methods and Applications (Academic Press, 1990).
The PCR-derived DNA fragment encoding soluble human TNF-R was subcloned into the yeast expression vector pIXY120 bar digesting the PCR-derived DNA fragment with BamH 1 and Asp718 restriction enzymes, digesting pIXY 120 with BamH 1 and Asp718, and ligating the PCR fragment into the cut vector in vitro with T4 DNA ligase. The resulting construction (pIXY424) fused the open reading frame of the FLAG~-soluble TNF
receptor in-frame to the complete a-factor leader sequence and placed expression in yeast under the aegis of the regulated yeast alcohol dehydrogenase (ADH2) promoter. Identity of the nucleotide sequence of the soluble TNF receptor carried in pIXY424 with those in cDNA
clone 1 were verified by DNA sequencing using the dideoxynucleotide chain termination method. pIXY424 was then transformed into E. coli strain RR1.
Soluble human TNF receptor was also expressed and secreted in yeast in a second vector. This second vector was generated by recovering the pIXY424 plasmid from E. coli and digesting with EcoRl and BamHl restriction enzymes to isolate the fragment spanning the region encoding the ADH2 promoter, the a-factor leader, the FLAG~-soluble TNF
receptor and the stop codon. This fragmf;nt was ligated in vitro into EcoR 1 and BamH 1 cut plasmid pYEP352 (Hill et al., Yeast :?:163 ( 1986)), to yield the expression plasmid pIXY432, which was transformed into E.~coli strain RR1.
To assess secretion of the soluble human TNF receptor from yeast, pIXY424 was purified and introduced into a diploid yeast strain of S. cerevisiae (XV2181 ) by electroporation and selection for acquisition of the plasmid-borne yeast TRP1+
gene on media lacking tryptophan. To assess secretion of the receptor directed by pIXY432, the plasmid was introduced into the yeast strain PB1~49-6b by electroporation followed by selection for the plasmid-borne URA3+ gene with growth on media lacking uracil. Overnight cultures were grown at 30°C in the appropriate selective media. The PB 149-6b/pIXY434 SUaSTI i s.!'~''~ SH~Z'1' ' V4'O 9' 3553 , 2 ~ ~) 5 3 4 ~ P~/US90/040C
2!~
transformants were diluted into YEP-1% glut:ose media and grown at 30'C for 38-40 hours.
Supernatants were prepared by removal of cells by centrifugation, and filtration of supernatants through 0.45p filters.
The level of secreted receptor in the supernatants was determined by immuno-dotblot.
Briefly, 1 ul of supernatants, and dilutions of the supernatants, were spotted onto nitrocellulose filters and allowed to dry. After blocking non-specific protein binding with a 3% BSA solution, the filters were incubated with diluted M1 anti-FLAG~
antibody, excess antibody was removed by washing and then dilutions of horseradish peroxidase conjugated anti-mouse IgG antibodies were incubated with the filters. After removal of excess secondary antibodies, peroxidase substrates were added and color development was allowed to proceed for approximately 10 minutes prior to removal of the substrate solution.
The anti-FLAG~ reactive material found in the supernatants demonstrated that significant levels of receptor were secreted by both expression systems.
Comparisons demonstrated that the pIXY432 system secreted approximately 8-16 times more soluble 1 S human TNF receptor than the pIXY424 system. The supernatants were assayed for soluble TNF-R activity, as described in Example 1, by their ability to bind 1251-TNFa and block TNFa binding. The pIXY432 supernatants were found to contain significant levels of active soluble TNF-R.
Example 9 Isolation of Murin~F-R cDNAs Murine TNF-R cDNAs were isolated from a cDNA library made from murine 7B9 cells, an antigen-dependent helper T cell linE; derived from C57BL/6 mice, by cross-species hybridization v~~ith a human TNF-R probe. The cDNA library was constructed in ,ZAP
(Stratagene, San Diego), substantially as described above in Example 2, by isolating polyadenylated RNA from the 7B9 cells.
A double-stranded human TNF-R cDNA probe was produced by excising an approximately 3.5 kb Notl fragment of tht: human TNF-R clone 1 and 32P-labeling the cDNA using random primers (Boehringer-Mannheim).
The murine cDNA library was amplified once and a total of 900,000 plaques were screened, substantially as described in Example 2, with the human TNF-R cDNA
probe.
Approximate v 21 positive plaques were purified, and the Bluescript plasmids containing EcoRl-linke:;:d inserts were excised (Stratal;ene, San Diego). Nucleic acid sequencing of a portion of murine TNF-R clone 11 indicated that the coding sequence of the murine TNF-R
was approximately 88% homologous to the: corresponding nucleotide sequence of human *Trade-mark 72249-30 WO 91/03553 ~ PCT/US90/04001 '2~ 6534 f TNF-R. A partial nucleotide sequence of murine TNF-R cDNA clone 11 is set forth in Figures 4-S.
Example 10 5 Preparation of Mon~xlonal Antibodies to TNF-R
Preparations of purified recombinant TNF-R, for example, human TNF-R, or transfected COS cells expressing high levels of TNF-R are employed to generate monoclonal antibodies against TNF-R using conventional techniques, for example, those disclosed in 10 U.S. Patent 4,411,993. Such antibodies are likely to be useful in interfering with TNF
binding to TNF receptors, for example, iin ameliorating toxic or other undesired effects of TNF, or as components of diagnostic or research assays for TNF or soluble TNF
receptor.
To immunize mice, TNF-R immunogen is emulsified in complete Freund's adjuvant and injected in amounts ranging from 1Ci-100 ~.g subcutaneously into Balb/c mice. Ten to 15 twelve days later, the immunized animals are boosted with additional immunogen emulsified in incomplete Freund's adjuvant and periodically boosted thereafter on a weekly to biweekly immunization schedule. Serum samples are periodically taken by retro-orbital bleeding or tail-tip excision for testing by dot-blot assay (antibody sandwich) or ELISA
(enzyme-linked immunosorbent assay). Other assay procedures are also suitable. Following detection of an 20 appropriate antibody titer, positive animals are given an intravenous injection of antigen in saline. Three to four days later, the animals are sacrificed, splenocytes harvested, and fused to the murine myeloma cell line NS 1. H~~bridoma cell lines generated by this procedure are plated in multiple rnicrotiter plates in a HAT selective medium (hypoxanthine, aminopterin, and thymidine) to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell 25 hybrids.
Hybridoma clones thus generated can be screened by ELISA for reactivity with TNF-R, for example, by adaptations of the techniques disclosed by Engvall et al., Immunochem.

8:871 (1971) and in U.S. Patent 4,703,004. Positive clones are then injected into the peritoneal cavities of syngeneic Balb/c mi~;,e to produce ascites containing high concentrations 30 (>1 mg/ml) of anti-TNF-R monoclonal antibody. The resulting monoclonal antibody can be purified by ammonium sulfate precipitation followed by gel exclusion chromatography, and/or affinity chromatography based on binding of antibody to Protein A of Staphylococcus aureus.
~ven~ sH~r y.....~~._ ._.._ _ ~ ~.. ~a~ __ __ .

Claims (118)

1. An isolated DNA sequence selected from the group consisting of:
(a) a DNA sequence that encodes a polypeptide having an amino acid sequence selected from the group consisting of amino acids 1 to X of Figure 2 and amino acids 1 to 233 of Figure 4, wherein X is an amino acid from 163 to 235; and (b) a DNA sequence capable of hybridization to the complement of the DNA sequence of (a) under moderately stringent conditions (50°C, 2 × SSC) and which encodes a polypeptide that is capable of binding to TNF and which is at least 88% identical to a polypeptide encoded by the DNA of (a).
2. An isolated DNA sequence selected from the group consisting of:
(a) a DNA sequence that encodes a polypeptide having an amino acid sequence selected from the group consisting of amino acids 1 to X of Figure 2 and amino acids 1 to 233 of Figure 4, wherein X is an amino acid from 163 to 235; and (b) a DNA sequence capable of hybridization to the complement of the DNA sequence of (a) under moderately stringent conditions (50°C, 2 × SSC) and which encodes TNF-R protein that is capable of binding greater than 0.1 nmoles TNF per nmole TNF-R and which is at least 88% identical to a polypeptide encoded by the DNA of (a).
3. An isolated DNA sequence selected from the group consisting of:

(a) a DNA sequence that encodes a polypeptide having an amino acid sequence selected from the group consisting of amino acids 1 to X of Figure 2 and amino acids 1 to 233 of Figure 4, wherein X is an amino acid from 163 to 235; and (b) a DNA sequence capable of hybridization to the complement of the DNA sequence of (a) under moderately stringent conditions (50°C, 2 × SSC) and which encodes TNF-R protein that is capable of binding greater than 0.5 nmoles TNF per nmole TNF-R and which is at least 88% identical to a polypeptide encoded by the DNA of (a).
4. A recombinant expression vector comprising the DNA
sequence according to any one of claims 1 to 3.
5. A host cell transformed or transfected with the vector according to claim 4.
6. An isolated DNA sequence selected from the group consisting of:
(a) a DNA sequence that encodes a polypeptide having an amino acid sequence selected from the group consisting of amino acids 1 to X of Figure 2 and amino acids 1 to 233 of Figure 4, wherein X is an amino acid from 163 to 235; and (b) a DNA sequence that encodes a polypeptide identical to the polypeptide encoded by the DNA
of (a) except for modification(s) to the amino acid sequence selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; (iii) conservative amino acid substitutions;
(iv) substitution or deletion of cysteine residues; and (v) combinations of modifications (i)-(iv); wherein such polypeptide is capable of binding TNF.
7. An isolated DNA sequence selected from the group consisting of:
(a) a DNA sequence that encodes a polypeptide having an amino acid sequence selected from the group consisting of amino acids 1 to X of Figure 2 and amino acids 1 to 233 of Figure 4, wherein X is an amino acid from 163 to 235; and (b) a DNA sequence that encodes a polypeptide identical to the polypeptide encoded by the DNA
of (a) except for modification(s) to the amino acid sequence selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; (iii) conservative amino acid substitutions;
(iv) substitution or deletion of cysteine residues; and (v) combinations of modifications (i)-(iv); which encoded polypeptide is capable of binding greater than 0.1 moles TNF
per nmole of such polypeptide.
8. An isolated DNA sequence selected from the group consisting of:
(a) a DNA sequence that encodes a polypeptide having an amino acid sequence selected from the group consisting of amino acids 1 to X of Figure 2 and amino acids 1 to 233 of Figure 4, wherein X is an amino acid from 163 to 235; and (b) a DNA sequence that encodes a polypeptide identical to the polypeptide encoded by the DNA
of (a) except for modification(s) to the amino acid sequence selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; (iii) conservative amino acid substitutions;
(iv) substitution or deletion of cysteine residues; and (v) combinations of modifications (i)-(iv); which encoded polypeptide is capable of binding greater than 0.5 moles TNF
per nmole of such polypeptide.
9. A recombinant expression vector comprising the DNA
according to any one of claims 6 to 8.
10. A host cell transformed or transfected with the vector according to claim 9.
11. A DNA sequence that encodes a polypeptide having an amino acid sequence selected from the group consisting of:
(a) amino acids 1-235 of Figure 2; and (b) a DNA sequence capable of hybridization to the DNA sequence of (a) under moderately stringent conditions (50°C, 2 × SSC) and which encodes a polypeptide that is capable of binding to TNF and which is at least 88%
identical to a polypeptide encoded by the DNA of (a).
12. A recombinant expression vector comprising the DNA
sequence according to claim 11.
13. A host cell transformed or transfected with the vector according to claim 12.
14. An isolated DNA molecule encoding a protein comprising a sequence of amino acids selected from the group consisting of amino acids 1-163 of Figure 2 and amino acids 1-233 of Figure 4, wherein said protein is capable of binding TNF.
15. The isolated DNA molecule according to claim 14, wherein said protein comprises amino acids 1-163 of Figure 2.
16. The isolated DNA molecule according to claim 14, wherein said protein comprises amino acids 1-185 of Figure 2.
17. The isolated DNA molecule according to claim 14, wherein said protein comprises amino acids 1-235 of Figure 2.
18. A recombinant expression vector comprising the DNA
molecule according to any one of claims 14 to 17.
19. A host cell transformed or transfected with the recombinant expression vector according to claim 18.
20. The host cell according to claim 19, wherein said host cell is selected from the group consisting of microbial cells and mammalian cells.
21. The host cell of claim 20, wherein said mammalian cells are selected from the group consisting of L cells, C127 cells, 3T3 cells, CHO cells, BHK cells and COS-7 cells.
22. The host cell of claim 21, wherein said mammalian cells are CHO cells.
23. A process for producing a protein capable of binding TNF, said process comprising culturing a host cell according to any one of claims 19 to 22 under conditions suitable to effect expression of said protein.
24. An isolated DNA molecule encoding a soluble TNF
receptor protein comprising a sequence of amino acids selected from the group consisting of from about amino acid 1 to about amino acid 163 of Figure 2 and from about amino acid 1 to about amino acid 233 of Figure 4, wherein said soluble TNF receptor protein is capable of binding TNF
protein.
25. The isolated DNA molecule according to claim 24, wherein said soluble TNF receptor protein comprises from about amino acid 1 to about amino acid 163 of Figure 2.
26. The isolated DNA molecule according to claim 24, wherein said soluble TNF receptor protein comprises from about amino acid 1 to about amino acid 185 of Figure 2.
27. The isolated DNA molecule according to claim 24, wherein said TNF soluble receptor protein comprises from about amino acid 1 to about amino acid 235 of Figure 2.
28. An isolated DNA molecule encoding a soluble TNF
receptor protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising from about amino acid 1 to about amino acid 163 of Figure 2;
(b) a TNF receptor polypeptide having a sequence of amino acids comprising from about amino acid 1 to about amino acid 233 of Figure 4; and (c) a TNF receptor polypeptide identical to the TNF receptor polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said soluble TNF receptor protein is capable of binding TNF.
29. A recombinant expression vector comprising the DNA
molecule according to any one of claims 24 to 28.
30. A host cell transformed or transfected with the recombinant expression vector according to claim 29.
31. The host cell of claim 30, wherein said host cell is selected from the group consisting of microbial cells and mammalian cells.
32. The host cell of claim 31, wherein said mammalian cells are selected from the group consisting of L cells, C127 cells, 3T3 cells, CHO cells, BHK cells and COS-7 cells.
33. The host cell of claim 32, wherein said mammalian cells are CHO cells.
34. A process for producing a protein capable of binding TNF, said process comprising culturing a host cell according to any one of claims 30 to 33 under conditions suitable to effect expression of said protein.
35. An isolated DNA molecule encoding a soluble TNF
receptor protein comprising a sequence of amino acids selected from the group consisting of from amino acid 1 to amino acid 163 of Figure 2 and from amino acid 1 to amino acid 233 of Figure 4, wherein said soluble TNF receptor protein is capable of binding TNF protein.
36. The isolated DNA molecule according to claim 35, wherein said soluble TNF receptor protein comprises from amino acid 1 to amino acid 163 of Figure 2.
37. The isolated DNA molecule according to claim 35, wherein said soluble TNF receptor protein comprises from amino acid 1 to amino acid 185 of Figure 2.
38 38. The isolated DNA molecule according to claim 35, wherein said soluble TNF receptor protein comprises from amino acid 1 to amino acid 235 of Figure 2.
39. An isolated DNA molecule encoding a soluble TNF
receptor protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising from amino acid 1 to amino acid 163 of Figure 2;
(b) a TNF receptor polypeptide having a sequence of amino acids comprising from amino acid 1 to amino acid 233 of Figure 4; and (c) a TNF receptor polypeptide identical to the TNF receptor polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said soluble TNF receptor protein is capable of binding TNF.
40. A recombinant expression vector comprising the DNA
molecule according to any one of claims 35 to 39.
41. A host cell transformed or transfected with the recombinant expression vector according to claim 40.
42. The host cell of claim 41, wherein said host cell is selected from the group consisting of microbial cells and mammalian cells.
43. The host cell of claim 42, wherein said mammalian cells are selected from the group consisting of L cells, C127 cells, 3T3 cells, CHO cells, BHK cells and COS-7 cells.
44. The host cell of claim 42, wherein said mammalian cells are CHO cells.
45. A process for producing a protein capable of binding TNF, said process comprising culturing a host cell according to any one of claims 41 to 44 under conditions suitable to effect expression of said protein.
46. An isolated DNA molecule encoding a protein comprising a sequence of amino acids selected from the group consisting of amino acids 1-163 of Figure 2 and amino acids 1-233 of Figure 4, wherein said protein lacks amino acids 236-265 of Figures 2 and 3 and amino acids 234-265 of Figures 4 and 5, respectively, and wherein said protein is capable of binding TNF.
47. The isolated DNA molecule according to claim 46, wherein said protein comprises amino acids 1-163 of Figure 2.
48. The isolated DNA molecule according to claim 46, wherein said protein comprises amino acids 1-185 of Figure 2.
49. The isolated DNA molecule according to claim 46, wherein said protein comprises amino acids 1-235 of Figure 2.
50. An isolated DNA molecule encoding a protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising amino acids 1-163 of Figure 2, wherein said polypeptide lacks amino acids 236-265 of Figure 2 and 3;
(b) a TNF receptor polypeptide having a sequence of amino acids comprising amino acids 1-233 of Figure 4, wherein said polypeptide lacks amino acids 234-265 of Figure 4 and 5; and (c) a TNF receptor polypeptide identical to the TNF receptor polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said protein is capable of binding TNF.
51. A recombinant expression vector comprising the DNA
molecule according to any one of claims 46 to 50.
52. A host cell transformed or transfected with the recombinant expression vector according to claim 51.
53. The host cell of claim 52, wherein said host cell is selected from the group consisting of microbial cells and mammalian cells.
54. The host cell of claim 53, wherein said mammalian cells are selected from the group consisting of L cells, C127 cells, 3T3 cells, CHO cells, BHK cells and COS-7 cells.
55. The host cell of claim 53, wherein said mammalian cells are CHO cells.
56. A process for producing a protein capable of binding TNF, said process comprising culturing a host cell according to any one of claims 52 to 55 under conditions suitable to effect expression of said protein.
57. An isolated DNA molecule encoding a protein comprising a sequence of amino acids selected from the group consisting of amino acids 1-163 of Figure 2 and amino acids 1-233 of Figure 4, wherein said protein lacks a functional transmembrane region, and wherein said protein is capable of binding TNF.
58. The isolated DNA molecule according to claim 57, wherein said protein comprises amino acids 1-163 of Figure 2.
59. The isolated DNA molecule according to claim 57, wherein said protein comprises amino acids 1-185 of Figure 2.
60. The isolated DNA molecule according to claim 57, wherein said protein comprises amino acids 1-235 of Figure 2.
61. An isolated DNA molecule encoding a protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising amino acids 1-163 of Figure 2;
(b) a TNF receptor polypeptide having a sequence of amino acids comprising amino acids 1-233 of Figure 4; and (c) a TNF receptor polypeptide identical to the TNF receptor polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein the protein lacks a functional transmembrane region;
and wherein the protein is capable of binding TNF.
62. A recombinant expression vector comprising the DNA
molecule according to any one of claims 57 to 61.
63. A host cell transformed or transfected with the recombinant expression vector according to claim 62.
64. The host cell of claim 63, which is selected from the group consisting of microbial cells and mammalian cells.
65. The host cell of claim 64, wherein the mammalian cells are selected from the group consisting of L cells, C127 cells, 3T3 cells, CHO cells, BHK cells and COS-7 cells.
66. The host cell of claim 64, wherein the mammalian cells are CHO cells.
67. A process for producing a protein capable of binding TNF, which comprises culturing a host cell according to any one of claims 63 to 66 under conditions suitable to effect expression of the protein.
68. An isolated and purified protein comprising a sequence of amino acids selected from the group consisting of amino acids 1-163 of Figure 2 and amino acids 1-233 of Figure 4, wherein the protein is capable of binding TNF.
69. The protein according to claim 68, which comprises a sequence of amino acids 1-163 of Figure 2.
70. The protein according to claim 68, which comprises a sequence of amino acids 1-185 of Figure 2.
71. The protein according to claim 68, which comprises a sequence of amino acids 1-235 of Figure 2.
72. An isolated and purified protein selected from the group consisting of:
(a) a polypeptide having a sequence of amino acids comprising amino acids 1-163 of Figure 2;
(b) a polypeptide having a sequence of amino acids comprising amino acids 1-233 of Figure 4; and (c) a polypeptide identical to the polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein the protein is capable of binding TNF.
73. A pharmaceutical composition comprising the protein according to any one of claims 68 to 72, and a pharmaceutically acceptable diluent or carrier.
74. A protein free of conspecific proteins comprising a sequence of amino acids selected from the group consisting of amino acids 1-163 of Figure 2 and amino acids 1-233 of Figure 4, wherein the protein is capable of binding TNF.
75. The protein according to claim 74, which comprises a sequence of amino acids 1-163 of Figure 2.
76. The protein according to claim 75, wherein said protein comprises amino acids 1-185 of Figure 2.
77. The protein according to claim 76, wherein said protein comprises amino acids 1-235 of Figure 2.
78. An isolated and purified protein comprising a polypeptide identical to a polypeptide having a sequence of amino acids comprising amino acids 1-163 of Figure 2 or identical to a polypeptide having a sequence of amino acids comprising amino acids 1-233 of Figure 4, except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said protein is capable of binding TNF.
79. A pharmaceutical composition comprising a protein according to any one of claims 74 to 78, and a pharmaceutically acceptable diluent or carrier.
80. An isolated and purified soluble TNF receptor protein comprising a sequence of amino acids selected from the group consisting of from about amino acid 1 to about amino acid 163 of Figure 2 and from about amino acid 1 to about amino acid 233 of Figure 4, wherein said soluble TNF
receptor protein is capable of binding TNF protein.
81. The isolated and purified soluble TNF receptor protein according to claim 80, wherein said soluble TNF
receptor protein comprises from about amino acid 1 to about amino acid 163 of Figure 2.
82. The isolated and purified soluble TNF receptor protein according to claim 81, wherein said soluble TNF

receptor protein comprises from about amino acid 1 to about amino acid 185 of Figure 2.
83. An isolated and purified soluble TNF receptor protein comprising from about amino acid 1 to about amino acid 235 of Figure 2.
84. An isolated and purified soluble TNF receptor protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising from about amino acid 1 to about amino acid 163 of Figure 2;
(b) a TNF receptor polypeptide having a sequence of amino acids comprising from about amino acid 1 to about amino acid 233 of Figure 4; and (c) a TNF receptor polypeptide identical to the TNF receptor polypeptides of (a) or (b) except for one or more modifications) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said soluble TNF receptor protein is capable of binding TNF.
85. An isolated and purified soluble TNF receptor protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising from about amino acid 1 to about amino acid 235 of Figure 2; and (b) a TNF receptor polypeptide identical to the TNF receptor polypeptide of (a) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said soluble TNF receptor protein is capable of binding TNF.
86. A pharmaceutical composition comprising a soluble TNF receptor protein according to any one of claims 80 to 85, and a pharmaceutically acceptable diluent or carrier.
87. An isolated and purified soluble TNF receptor protein comprising a sequence of amino acids selected from the group consisting of from amino acid 1 to amino acid 163 of Figure 2 and from amino acid 1 to amino acid 233 of Figure 4, wherein said soluble TNF receptor protein is capable of binding TNF protein.
88. The isolated and purified soluble TNF receptor protein according to claim 87, wherein said soluble TNF
receptor protein comprises from amino acid 1 to amino acid 163 of Figure 2.
89. The isolated and purified soluble TNF receptor protein according to claim 87, wherein said soluble TNF
receptor protein comprises from amino acid 1 to amino acid 185 of Figure 2.
90. The isolated and purified soluble TNF receptor protein according to claim 87, wherein said soluble TNF
receptor protein comprises from amino acid 1 to amino acid 235 of Figure 2.
91. An isolated and purified soluble TNF receptor protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising from amino acid 1 to amino acid 163 of Figure 2;
(b) a TNF receptor polypeptide having a sequence of amino acids comprising from amino acid 1 to amino acid 233 of Figure 4; and (c) a TNF receptor polypeptide identical to the TNF receptor polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said soluble TNF receptor protein is capable of binding TNF.
92. A pharmaceutical composition comprising a soluble TNF receptor protein according to any one of claims 87 to 91, and a pharmaceutically acceptable diluent or carrier.
93. An isolated and purified protein comprising a sequence of amino acids selected from the group consisting of amino acids 1-163 of Figure 2 and amino acids 1-233 of Figure 4, wherein said protein lacks amino acids 236-265 of Figures 2 and 3 and amino acids 234-265 of Figures 4 and 5, respectively, and wherein said protein is capable of binding TNF.
94. The isolated and purified protein according to claim 93, wherein said protein comprises amino acids 1-163 of Figure 2.
95. The isolated and purified protein according to claim 93, wherein said protein comprises amino acids 1-185 of Figure 2.
96. The isolated and purified protein, according to claim 93, wherein said protein comprises amino acids 1-235 of Figure 2.
97. An isolated and purified protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising amino acids 1-163 of Figure 2, wherein said polypeptide lacks amino acids 236-265 of Figures 2 and 3;
(b) a TNF receptor polypeptide having a sequence of amino acids comprising amino acids 1-233 of Figure 4, wherein said polypeptide lacks amino acids 234-265 of Figures 4 and 5; and (c) a TNF receptor polypeptide identical to the TNF receptor polypeptides of (a) or (b) except for one or more modifications) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said protein is capable of binding TNF.
98. A pharmaceutical composition comprising a protein according to any one of claims 93 to 97, and a pharmaceutically acceptable diluent or carrier.
99. An isolated and purified protein comprising a sequence of amino acids selected from the group consisting of amino acids 1-163 of Figure 2 and amino acids 1-233 of Figure 4, wherein said protein lacks a functional transmembrane region, and wherein said protein is capable of binding TNF.
100. The isolated and purified protein according to claim 99, wherein said protein comprises amino acids 1-163 of Figure 2.
101. The isolated and purified protein according to claim 99, wherein said protein comprises amino acids 1-185 of Figure 2.
102. The isolated and purified protein, according to claim 99, wherein said protein comprises amino acids 1-235 of Figure 2.
103. An isolated and purified protein selected from the group consisting of:
(a) a TNF receptor polypeptide having a sequence of amino acids comprising amino acids 1-163 of Figure 2;
(b) a TNF receptor polypeptide having a sequence of amino acids comprising amino acids 1-233 of Figure 4; and (c) a TNF receptor polypeptide identical to the TNF receptor polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said protein lacks a functional transmembrane region; and wherein said protein is capable of binding TNF.
104. A pharmaceutical composition comprising a protein according to any one of claims 99 to 103, and a pharmaceutically acceptable diluent or carrier.
105. A recombinant microbial protein comprising a sequence of amino acids selected from the group consisting of amino acids 1-163 of Figure 2 and amino acids 1-233 of Figure 4, wherein said protein is capable of binding TNF.
106. The recombinant microbial protein according to claim 105, wherein said protein comprises amino acids 1-163 of Figure 2.
107. The recombinant microbial protein to claim 105, wherein said protein comprises amino acids 1-185 of Figure 2.
108. The recombinant microbial protein according to claim 105, wherein said protein comprises amino acids 1-235 of Figure 2.
109. A recombinant microbial protein selected from the group consisting of:
(a) a polypeptide having a sequence of amino acids comprising amino acids 1-163 of Figure 2;
(b) a polypeptide having a sequence of amino acids comprising amino acids 1-233 of Figure 4; and (c) a polypeptide identical to the polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, wherein said protein is capable of binding TNF protein.
110. A pharmaceutical composition comprising a recombinant microbial protein according to any one of claims 105 to 109, and a pharmaceutically acceptable diluent or carrier.
111. A protein produced by a process comprising culturing non-human host cells which have been modified by the introduction of a nucleic acid molecule encoding a protein comprising the sequence of amino acids 1-163 of Figure 2 under conditions suitable to effect expression of the introduced nucleic acid molecule; wherein said protein is capable of binding TNF protein.
112. The protein to claim 111, wherein said protein comprises amino acids 1-185 of Figure 2.
113. The protein according to claim 111, wherein said protein comprises amino acids 1-235 of Figure 2.
114. A protein produced by a process comprising culturing non-human host cells which have been modified by the introduction of a nucleic acid molecule encoding a protein selected from the group consisting of:
(a) a polypeptide having a sequence of amino acids comprising amino acids 1-163 of Figure 2;
(b) a polypeptide having a sequence of amino acids comprising amino acids 1-233 of Figure 4; and (c) a polypeptide identical to the polypeptides of (a) or (b) except for one or more modification(s) to the sequence of amino acids selected from the group consisting of: (i) inactivated N-linked glycosylation sites; (ii) altered KEX2 protease cleavage sites; and (iii) substitution or deletion of cysteine residues, under conditions suitable to effect expression of the introduced nucleic acid molecule; and wherein said protein is capable of binding TNF.
115. The protein according to any one of claims 111 to 114, wherein said non-human host cells are selected from the group consisting of L cells, C127 cells, 3T3 cells, CHO
cells, BHK cells and COS-7 cells.
116. The protein according to any one of claims 111 to 114, wherein said non-human host cells are CHO cells.
117. A pharmaceutical composition comprising a protein according to any one of claims 111 to 116, and a pharmaceutically acceptable diluent or carrier.
118. A multimer having the ability to interfere with the binding of tumor necrosis factor to its receptors and to block the effects of tumor necrosis factor, wherein the multimer comprises two or more monomers, each of the monomers consisting of a soluble form of a tumor necrosis factor receptor comprising amino acids 1 to 235 of Figure 2.
CA 2065346 1989-09-05 1990-07-17 Tumor necrosis factor-.alpha. and-.beta. receptors Expired - Lifetime CA2065346C (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
US40324189A true 1989-09-05 1989-09-05
US403,241 1989-09-05
US40537089A true 1989-09-11 1989-09-11
US405,370 1989-09-11
US42141789A true 1989-10-13 1989-10-13
US421,417 1989-10-13
PCT/US1990/004001 WO1991003553A1 (en) 1989-09-05 1990-07-17 TUMOR NECROSIS FACTOR-α AND -β RECEPTORS

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CA002485553A CA2485553A1 (en) 1989-09-05 1990-07-17 Tumor necrosis factor - .alpha. and - .beta. receptors

Publications (2)

Publication Number Publication Date
CA2065346A1 CA2065346A1 (en) 1991-03-06
CA2065346C true CA2065346C (en) 2005-03-29

Family

ID=46201946

Family Applications (2)

Application Number Title Priority Date Filing Date
CA 2065346 Expired - Lifetime CA2065346C (en) 1989-09-05 1990-07-17 Tumor necrosis factor-.alpha. and-.beta. receptors
CA002485553A Expired - Lifetime CA2485553A1 (en) 1989-09-05 1990-07-17 Tumor necrosis factor - .alpha. and - .beta. receptors

Family Applications After (1)

Application Number Title Priority Date Filing Date
CA002485553A Expired - Lifetime CA2485553A1 (en) 1989-09-05 1990-07-17 Tumor necrosis factor - .alpha. and - .beta. receptors

Country Status (3)

Country Link
AU (1) AU630497B2 (en)
CA (2) CA2065346C (en)
WO (1) WO1991003553A1 (en)

Families Citing this family (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6552170B1 (en) 1990-04-06 2003-04-22 Amgen Inc. PEGylation reagents and compounds formed therewith
AT289350T (en) * 1989-04-21 2005-03-15 Amgen Inc Tnf-receptor, tnf binding proteins and encoding it dnas
US6221675B1 (en) 1989-04-21 2001-04-24 Amgen, Inc. TNF receptors, TNF binding proteins and DNAs coding for them
US7264944B1 (en) 1989-04-21 2007-09-04 Amgen Inc. TNF receptors, TNF binding proteins and DNAs coding for them
IL95031A (en) 1989-07-18 2007-03-08 Amgen Inc Method for the production of a human recombinant tumor necrosis factor inhibitor
US6143866A (en) * 1989-07-18 2000-11-07 Amgen, Inc. Tumor necrosis factor (TNF) inhibitor and method for obtaining the same
DK0939121T4 (en) 1989-09-12 2008-02-04 Ahp Mfg B V TNF binding proteins
WO1992017583A1 (en) * 1991-03-29 1992-10-15 Immunex Corporation Isolated viral protein cytokine antagonists
WO1993006128A1 (en) * 1991-09-16 1993-04-01 Peptide Technology Limited Tnf antagonist peptides
DE69230862D1 (en) * 1991-10-15 2000-05-04 Michael F Mullarkey Receptors to treat inflammation of the delayed type
AU670125B2 (en) * 1992-09-15 1996-07-04 Immunex Corporation Method of treating tnf-dependent inflammation using tumor necrosis factor antagonists
NZ263102A (en) * 1993-03-19 1997-05-26 Immunex Corp Pharmaceutical compositions comprising a ligand protein such as interleukin-4 and a soluble receptor protein that binds thereto
NZ278607A (en) * 1994-02-07 1999-05-28 Knoll Ag Use of tnf antagonists for treating disorders involving elevated serum levels of il-6 wherein the serum levels are 500pg/ml or above
CA2539273C (en) 1996-02-09 2014-02-04 Amgen Inc. A fusion protein comprising an interleukin-1 receptor antagonist and uses thereof
TW555765B (en) 1996-07-09 2003-10-01 Amgen Inc Low molecular weight soluble tumor necrosis factor type-I and type-II proteins
WO1998024477A1 (en) 1996-12-06 1998-06-11 Amgen Inc. Combination therapy using an il-1 inhibitor for treating il-1 mediated diseases
AU5696198A (en) 1996-12-06 1998-06-29 Amgen, Inc. Combination therapy using a tnf binding protein for treating tnf-mediated diseases
US6893838B1 (en) 1998-04-07 2005-05-17 Genetics Institute Llc DADD, death activator death domain protein
US20080213778A1 (en) 1998-12-30 2008-09-04 Millennium Pharmaceuticals, Inc. Novel genes encoding proteins having prognostic, diagnostic, preventive, therapeutic, and other uses
US7041474B2 (en) * 1998-12-30 2006-05-09 Millennium Pharmaceuticals, Inc. Nucleic acid encoding human tango 509
EP1176194B1 (en) * 1999-05-10 2005-07-20 Chugai Seiyaku Kabushiki Kaisha Method of cell cultivation
US6808902B1 (en) 1999-11-12 2004-10-26 Amgen Inc. Process for correction of a disulfide misfold in IL-1Ra Fc fusion molecules
AU7292501A (en) 2000-05-26 2001-12-11 Immunex Corp Use of interleukin-4 antagonists and compositions thereof
PL222211B1 (en) 2001-06-26 2016-07-29 Amgen Fremont Inc. Antibodies to opgl
US9028822B2 (en) 2002-06-28 2015-05-12 Domantis Limited Antagonists against TNFR1 and methods of use therefor
AU2003267999B2 (en) 2002-07-19 2010-03-11 Abbvie Biotechnology Ltd Treatment of TNFalpha related disorders
TWI556829B (en) 2004-04-09 2016-11-11 Abbvie Biotechnology Ltd Multiple-variable dose regimen for treating tnfα-related disorders
GB0414054D0 (en) 2004-06-23 2004-07-28 Owen Mumford Ltd Improvements relating to automatic injection devices
NZ591701A (en) 2005-05-16 2012-11-30 Abbott Biotech Ltd Use of tnf inhibitor for treatment of erosive polyarthritis
US20070041905A1 (en) 2005-08-19 2007-02-22 Hoffman Rebecca S Method of treating depression using a TNF-alpha antibody
US7919264B2 (en) 2005-11-01 2011-04-05 Abbott Biotechnology Ltd. Methods and compositions for determining the efficacy of a treatment for ankylosing spondylitis using biomarkers
US8007790B2 (en) 2006-04-03 2011-08-30 Stowers Institute For Medical Research Methods for treating polycystic kidney disease (PKD) or other cyst forming diseases
CA2564435A1 (en) 2006-04-10 2007-10-10 Abbott Biotechnology Ltd. Methods for monitoring and treating intestinal disorders
EP2666479A3 (en) 2006-04-10 2014-03-26 Abbott Biotechnology Ltd Uses and compositions for treatment of juvenile rheumatoid arthritis
US9605064B2 (en) 2006-04-10 2017-03-28 Abbvie Biotechnology Ltd Methods and compositions for treatment of skin disorders
EP2007426A4 (en) 2006-04-10 2010-06-16 Abbott Biotech Ltd Uses and compositions for treatment of psoriatic arthritis
WO2008005315A2 (en) 2006-06-30 2008-01-10 Abbott Biotechnology Ltd. Automatic injection device
JP2010501623A (en) 2006-08-28 2010-01-21 アレス トレーディング ソシエテ アノニム Purification of Fc-containing protein
US7833527B2 (en) 2006-10-02 2010-11-16 Amgen Inc. Methods of treating psoriasis using IL-17 Receptor A antibodies
EP2165194A4 (en) 2007-05-31 2010-09-08 Abbott Lab BIOMARKERS PREDICTIVE OF THE RESPONSIVENESS TO TNF-alpha INHIBITORS IN AUTOIMMUNE DISORDERS
WO2008154543A2 (en) 2007-06-11 2008-12-18 Abbott Biotechnology Ltd. Methods for treating juvenile idiopathic arthritis
BRPI0923806A2 (en) 2008-12-30 2015-07-14 Centocor Ortho Biotech Inc Serum markers for predicting the clinical response to anti-TNF antibodies in patients with ankylosing spondylitis
US8636704B2 (en) 2009-04-29 2014-01-28 Abbvie Biotechnology Ltd Automatic injection device
TW201117824A (en) 2009-10-12 2011-06-01 Amgen Inc Use of IL-17 receptor a antigen binding proteins
AU2010330907A1 (en) 2009-12-16 2012-06-14 Bosch, Phillip Methods of treating interstitial cystitis
EP2523688B1 (en) 2010-01-15 2017-10-11 Kirin-Amgen, Inc. Antibody formulation and therapeutic regimens
CA2789168A1 (en) 2010-02-02 2011-08-11 Abbott Biotechnology Ltd. Methods and compositions for predicting responsiveness to treatment with tnf-.alpha. inhibitor
RU2573042C2 (en) 2010-04-21 2016-01-20 Эббви Байотекнолоджи Лтд. Worn device for automatic injection for controlled supply of therapeutic agents
WO2011146727A1 (en) 2010-05-19 2011-11-24 Philip Bosch Methods of treating interstitial cystitis
ES2685607T3 (en) 2010-06-03 2018-10-10 Abbvie Biotechnology Ltd Uses and compositions for treating hidradenitis suppurativa (HS)
EP2490024A1 (en) 2010-12-22 2012-08-22 Proteomika, S.L. Method to optimize the treatment of patients with biological drugs
RU2016139357A (en) 2011-01-24 2018-12-13 Эббви Байотекнолоджи Лтд. Automatic injection devices having over molded gripping surface
AU2012231178B2 (en) 2011-03-18 2015-11-05 Abbvie Inc. Systems, devices and methods for assembling automatic injection devices and sub-assemblies thereof
US9956353B2 (en) 2011-03-29 2018-05-01 Abbvie Inc. Shroud deployment in automatic injection devices
CN107096098A (en) 2011-04-21 2017-08-29 艾伯维公司 Wearable automatic injection device
WO2013016220A1 (en) 2011-07-22 2013-01-31 Amgen Inc. Il-17 receptor a is required for il-17c biology
JP2016511747A (en) * 2013-01-04 2016-04-21 マサチューセッツ インスティテュート オブ テクノロジー Delivery of drugs tissue based on the nanoparticle surface binding
AU2015241373A1 (en) 2014-03-31 2016-10-06 Amgen K-A, Inc. Methods of treating nail and scalp psoriasis
BR112017013269A2 (en) 2014-12-22 2018-02-27 Ares Trading Sa ? Liquid pharmaceutical composition?
CA3019003A1 (en) 2016-04-08 2017-10-12 Gilead Sciences, Inc. Compositions and methods for treating cancer, inflammatory diseases and autoimmune diseases

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL83878A (en) * 1987-09-13 1995-07-31 Yeda Res & Dev Soluble protein corresponding to tnf inhibitory protein its preparation and pharmaceutical compositions containing it
GB8806339D0 (en) * 1988-03-17 1988-04-13 Hoffmann La Roche Monoclonal antibodies
GB8807803D0 (en) * 1988-03-31 1988-05-05 Glaxo Group Ltd Biochemical product

Also Published As

Publication number Publication date
AU630497B2 (en) 1992-10-29
CA2065346A1 (en) 1991-03-06
WO1991003553A1 (en) 1991-03-21
AU6178190A (en) 1991-04-08
CA2485553A1 (en) 1991-03-21

Similar Documents

Publication Publication Date Title
Labow et al. Absence of IL-1 signaling and reduced inflammatory response in IL-1 type I receptor-deficient mice.
ES2227513T3 (en) New cytokines.
EP1407017B1 (en) Human tumor necrosis factor receptor
CA2395539C (en) Soluble interleukin-20 receptor
EP1436003B1 (en) Taci-immunoglobulin fusion proteins
US4965195A (en) Interleukin-7
US6087329A (en) CD40 ligand polypeptide
DE60027564T2 (en) Tek antagonists
EP0474727B1 (en) Her2 extracellular domain
US20070049735A1 (en) Antibodies that bind both bcma and taci
US5738844A (en) Cytokines that bind the cell surface receptor hek
ES2306480T3 (en) DcR3 polypeptide, a homolog of TNFR.
EP0433900B1 (en) Expression of the recombinant tumor necrosis factor binding protein I (TBP-I)
ES2249770T3 (en) Oncostatin M receptor.
US5981724A (en) DNA encoding CD40 ligand, a cytokine that binds CD40
US8053233B2 (en) Host cells expressing IL-18 receptors
AU705114B2 (en) Fas antagonists and uses thereof
CA2078689C (en) Chimeric antibodies with receptor binding ligands in place of their constant region
US20110250200A1 (en) Soluble lymphotoxin-beta receptor fusion protein and methods for inhibiting lymphotoxin beta-receptor signaling
EP2371962A2 (en) Receptor activator of NF-KAPPA B, receptor is member of TNF receptor superfamily
AU666388B2 (en) Novel cytokine that binds CD30
JP3155024B2 (en) Type ii interleukin-1 receptor
DE69936382T2 (en) Therapeutic uses of il-17 homologous polypeptide
EP1229047B1 (en) IL-1 Receptor fusion proteins used as antagonists and methods of making and using
US5892001A (en) Epithelium-derived T-cell factor antibodies

Legal Events

Date Code Title Description
EEER Examination request
MKEX Expiry