CA2068888A1 - Method for measuring t-cell surface antigens in humans - Google Patents

Abstract

The invention teaches a method for determining levels of T-cell surface antigens in humans, specifically, V.beta. molecules.
Measurement of such levels allows for diagnosis of pathological conditions, such as infections.

Description

~ ~ WO 91/07508 2 ~ ~ g ~ ~ ~ PCT/US90/06613 hET~OD FOR MEASURI~G T-CELL SURFACE
ANTIGENS IN HUMANS

RELATED APPLICATION

This application is a continuation-in-part o-~ U.S.
Patent Application Serial No. 437,370, filed November 15, 1989.

FIELD OF THE INVENTION

This invention relates to a method 'or diagnosing a pathological condition, via assaying or measuring particular T-cell subtypes in a sample taken from a patient suspected of having the pathological condition.
In particular, it relates to measuring cell surface antigens of ~-cells which are characteristic of particular T-cell subtypes.

RELATED P~TBLICATION
:
Portions of the invention described herein have been presented in Kappler, et al., Science 244: 811-813 (May 19, 1989), the inventors' publication and the disclosure ~-of which is incorporated by reference herein.

BACKGROUND AND PRIOR ART

In recent years, the mechanism by which mammalian im~une systems, such as human and murine systems react to infections, foreign antigens, and to so-called "self antigens" in connection with autoimmune diseases has begun to be established. See, in this regard, Grey, et al., Scientific American 261(5): 56-64 (1989); Male, et al., Advanced Immunology (J.P. Lippincott Company, 1987), especially chapters 6 through 10.

WO91~07508 2 0 6 ~ PCT/US90/066 Well known, both to the skilled artisan and to the general public is the role of antibodies, sometimes referred to as "immunoglobulin" or the less correct and older "gammaglobulin" in response to infection.
Antibodies are protein molecules which are produced by s cells in response to infection. It is well known that these antibodies act to "disable" or to inactivate infectious agents in the course of combating the infection.
In order for antibodies to be produced, however, preceding events must occur which lead to stimulation of the B cells which produce the antibodies. One of the key e~ents involved in the processes leading to antibody production is that of antigen recognition. This aspect of the immune response requires the participation of so-called "T-cells", and is less well known than the antibody response commented on supra.
Briefly, and in outline form, antigen recognition requires interaction of an "antigen presentation cell", a "processed antigen", and a T-cell. See Grey and Male, supra. The "processed antigen", in an infection, is a molecule characteristic Or the pathogen which has been ~-treated, i.e., "processed", by other cells which are a part of-the immune system. The processed antigen interacts with a receptor on the surface O r an antigen presented in a manner not unlike a lock fitting into a key hole or, perhaps more aptly, two pieces of a jigsaw puzzle.
The configuration of the complex of processed antigen and receptor on antigen presentation cell allows the participation of T-cells. T-cells do not join the complex unless and until the processed antigen has fit into the receptor on the antigen presentation cell. This receptor will hereafter be referred to by its scientific name, the major histocompatibility complex (MHC), or the human leukocyte antigen (HLA). Generally, MHC is used to refer to murine systems, and EILA to humans.

... , . . ~.. ,.. . , ~ . . :

. . . - : . .- ,.. . . ~ , WO91/07508 ~ PCT/US90/06613 ~ 3 These receptors fall into two classes. MHC~
molecules are lnvolved in most responses to pathogens.
In contrast, MHC-I molecules are involved when the pathogen is a virus, or a malignant cell is involved.
When MHC-I participation is involved, there is no antibody stimulation; rather, the interaction of MHC-I, processed antigen and T-cell leads to lysis of cells infected with the pathogen.
The foregoing discussion has focused on the events involved in responding to "infection", i.e., the presence of pathogenic foreign material in the organism. Similar mechanisms are involved in autoimmune diseases as well.
In these conditions, the organism treats its own molecules as foreign, or as "self-antigens". The same type of complexing occurs as described supra, with an antibody response being mounted against the organism itself. Among the diseases in which this is a factor are rheumatoid arthritis, diabetes, systemic lupus erythromatosus, and others.
The ability of the T-cell to compleY. with the processed antigen and MHC/HLA complex is dependent on what is referred to as the T-cell antigen receptor, referred to as "TCR" hereafter. The TCR is recognized as a heterodimer, made up of alpha (oG) and beta (~
chains. Five variable elements, coded for by germline DNA and known as "V~, J~, V~, D~, and J~" as well as non-germline encoded amino acids contribute to the TCR. ;
See, in this regard, Marrack, et al., Immunol. Today 9:
308-315 (1988); Toyonaga, et al., Ann. Rev. Immunol 5:
30 585-620 (1987); Davis, Ann. Rev. Immunol 4: 529-591 (1985); Hendrick, et al., Cell 30: 141-152 (1982). ~ith respect to the binding of TCR with processed antigen and ~HC, see Babbitt, et al., Nature 317: 359-361 (1985);
Buus, et al., Science 235: 1353-1358 (1987); Townsend, et al., Cell 44: 959-968 (1986); Bjorkman, et al., Nature 329~i 506-512 (1987).

- -- , , ~ . . . . . .
:, : - : , - . -:

- 4 ~

Generally, both the alpha and beta subunits are involved in recognition O r the ligand formed by processed antigen and MHC/HLA molecule. This is not always the case, however, and it has been found that so-called "superantigens" stimulate T-cells with a particular V~
element, regardless of anv other element. See Kappler, et al., Cell 49: 273-280 (1987); Kappler, et al., Cell 49: 263-271 (1987); MacDonald, et al., Nature 332: 40-45 (1988); Pullen, et al., Nature 335: 796-801 (1988);
Kappler, e, al., Nature 332: 35-40 (1988); Abe, et al., J. Immunol 140: 4132-4138 (1988); White, et al., Cell 56:
27-35 (1989); Janeway, et al., Smmunol. Rev. 107: 61-88 (1989); Berkoff, et al., J. Immunol 139: 3189-3194 (1988), and Kappler, et al., Science 244: 811-813 (1989).
This last reference discloses information which is also incorporated into the subject patent application.
The "superantigens" mentioned supra, while generally stimulating T-cells as long as they possess a V~
element, are somewhat specific in terms of the particular form of the V~ moiety which is present on the stimulated T cell. This feature is one aspect of the invention, i.e., the ability to assay for particular subtypes or subclasses of T-cells, based upon the cell surface antigens presented by these subclasses.
Staphylococcus aureus has long been implicated in morbidity and mortality in humans. See Bergdoll, in Feed Bourne Infections and Intoxications (Riemann and Bryan, ed., Acad. Press, N.Y.) pp. 443-494 (1979). The various toxins presented by S. aureus are responsible for most food poisoning cases, as well as severe shock, and other life threatening pathological conditions. The mechanism of action of the toxins associated with S. aureus is unknown. The primary structure of the toxins, while showing some relationship, also show some great differences in primary structure. See Betley, et al., J.
Bacteriol 170: 34-41 (1988); Jones,- et al., J. Bacteriol 166:- 29-33 (1986); Lee, et al., J. Bacteriol 170:

. , ... . . . .. . ... .. , . ..... , ., . . . . ~ . . .
., ~ -, .
' ' ' , ~ . ' ~ ' .

WO9l/07508 2 Q ~ 3 ~ PCT/US90/06613 2954-2960 (1988); Blomster-Hautamaa, et al., J. Biol.
Chem. 261: 15783-15786 (1986). For the time being, it cannot be said with any certainty whether the various S.
aureus antigens function in the same way in terms of the immunologicai response they generate.
The ability of S. aureus to stimulate powerful T
cell proliferative responses in the presence of mouse cells bearing MHC-II type molecules is taught by, e.g., Carlson, et al. ~. Immunol 140-2848 (1988); White, et al., Cell 56 27-35 (1989); Janeway, et al., Immunol. Rev.
107: 61-~8 (1989). White, et al., and Janeway, et al.
showed that one of these proteins is not mitogenic, in that it selectively stimulates murine cells which bear particular V~ elements. These papers, however, did not extend the study to human cells. It has now been shown, however, that certain antigens do selectively stimulate speci.ic V~ subclasses of human T cells, making it -possible to diagnose pathological conditions by assaying for particular V~ subtypes.
~0 Hence, it is an object of 'he invention to describe a method for diagnosing a pathological condition in a human by assaying a biological sample from the subject being tested for levels of particular V~s subtypes.
These levels are then compared to normal levels, where difference between the two is indicative of a pathological condition.
It is a further object o~ the invention to carr, out the assaying using antibodies which are specific for the particular V~. subtype. Especially preferred are monoclonal antibodies.
It is still another object of the invention to perform the above described assay by measuring DNA coding for specific V~ molecules. This can be done via utilizing, e.g., the polymerase chain reaction.
How these and other objects of the invention are achieved are detailed in the disclosure which follows.

': . : . ~ . ., . '.
: -: ~ . : . . - . , -W091/0~508 2 Q ~ 8 ~ ~ 3 6 PCT/US90/066 ~

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the results of staphylococcal toxin stimulation of human T cells.

Figure 2 depicts studies showing V~ specific stimulation of T cells by toxins is donor independent.

Figure 3 depicts a standard curve used to normalize polymerase chain reaction values (PCRs) to percentages of T cells carrying particular V~s in mixed populations.

Figure 4 shows autoradiograms of coamplified cDNA of human TCR transcripts following stimulation with anti-CD3 antibody or a S. aureus toxin.

Figure 5 presents in bar graph form V~ specific stimulation caused by S. aureus toxins in three individuals.

Figure 6 shows autoradiograms of T cell receptor transcripts amplified by polymerase chain reaction from cells Patient 1 (P) and control individual (C).

Figure 7 shows longitudinal changes in T cell repertoire in 2 patients studied serially after toxic shock syndrome.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

Exam~le 1 This experiment used monoclonal antibodies directed against V~5, V~6, V,~8 and V~12, as taught by Yssel, et al., Eur. J. Immunol. 16: 1187 (1986); Borst, et al., J.
Immunol. 139: 1952 (1987); Posnett, et al., Proc. Natl.
Acad. Sci. USA 83: 7888 (1986); Carrel, et al., ~ . . , - , , .: - - : . :, . . :

,. .
- ~ .

WO 91/07508 2 ~ ~ 8 ~3~ PCT/US90/06613 Eur. J. Immunol 16: 649 (1986), and Bigler, et al., J.
Exp. Med. 158: 1000 (1983).
T cells of a human individual were first isolated from that individual's peripheral blood. These T cells were then examined before and after stimulation with one of (i) anti-CD3 antibody, (ii) SEC2; (iii) SED, or (iv) SEE. Items (ii), (iii) an~ (iv) are known S. aureus molecules which act as toxins.
The anti-CD3 antibodies had been rendered stimulatory by adherence to plastic bottles. The protein was incubated on plastic surfaces for 8 hours at 4C.
Extensive washing removed non-adherent antibody.
Following this, either adherent antibody or a S. aureus antigen was used to stimulate peripheral blood T cells.
Stimulation took place in the presence of irradiated, autologous, non T-cells as described by Kotzin, et al., J. Immunol. 127: 931 (1981), the disclosure of which is incorporated b~ reference herein.
Three days after stimulation, live cells were ~Q collected and cultured for 24 hours in recombinant human IL-2 (25 units/ml). This allows regeneration of potentially modified receptors. Of the surviving cells, about 10% were true blast cells.
The blast cell ractions were then incubated with one of (i) purified antibody to CD3 or with a monoclonal antibody to ~ii) V~5 (mAb lC1); (iii) V~6 (mAb OT145);
(iv) V~8 (mAb MX6~, or (v) V~12 (mAb S511). Following incubation with the mAb, the cells were stained with fluoroscein-conjugated goat anti mouse IgG, following Kappler, et al., Cell 49: 173 (1987). The staining pattern was then studied on an EPICS C device, uslng a forward angle and 90~ light scatter pattern to gate large blast cells, which were easily distinguished from small lymphocytes, and constituted 50~ or more of all surviving cells in culture.
The results of the staining patterns are shown in Figure 1. Panels A-D shows the degree of staining using the m~bs before stimulation. Panels E-H show it after W09t~07508 2 0 ~ PCT/US90/066 stimulation with anti-CD3. Finally, panels I-L show the pattern following stimulation with SED, SEE, and SEC2.
Each anti-V~ stained a definable percentage of the peripheral resting T cells from this donor (Fig. 1). The percentage stained ranged from 5.2% with anti-V~6 to 1.5%
with anti V~12 (Fig. 1, A to D). Culture with anti-CD3 and interleukin-2 hardly changed the percentage stained with each an.i-V~ (Fig. 1, E to H), indicating that this combination of T cell stimuli affected T cells bearing different ~ receptors similarly. Culture with the toxins had variable effects on the percentage of T cells stained with each anti-V~ (Fig. 1, I to L).
Staphylococcal entertoxin (SE) D, for example, greatly increased the percentage of T cells bearing V~5 in the blast population and nearly excluded cells bearing V~6.
In contrast, T cells blasts stimulated with SEC2 were depleted of V~6- and V~8 bearing T cells and were greatly enriched in V~12 bearing T cells. Finally, SEE
stimulated V~8 T cells, while excluding cells bearing V~12. Reciprocal results for each of the tox ns were found if the resulting T cells contaminating the blast populations were analyzed for V~ usage. After SEE
stimulation, for example, the resting T cells were selectively depleted of V~ 8 cells. This result indicates that the toxins are stimulating most of the T
cells bearing the appropriate V~s, nor a minor population of these cells.
Five different donors were used in the experiments.
These donors were HLA-typed by standard serological techniques, and their restring peripheral T cells were stained with anti-CD3 and the anti-V~s. Each of the anti-V~s reacted with a low but measurable percentage of peripheral blood T cells from each of the individuals (Table 1). For a particular individual these percentages were extremely reproducible from one day to another. The percentages of T cells that bore the different V~s varied somewhat among individuals.

- ~ .- j, , . ~ -, -. - ' -, .. . ..

- - .~: . - . . .
, . . :, ,,, - - . - . : ~ ,,- . -g WO9l/07508 PCTtUS90/06613 Table 1. V~ expression o~ unstimulated human peripheral T cells.

Cell HLA type Percentage of T cells bearing donor A s C DR DQ v~5 v~6 V~8 V~12 BR 26 14 1.4 wl 3.9 3.3 3.2 1.3 28 38 ws3 w3 cw 24 7 3 4.6 w3 2.7 2.0 4.0 1.5 31 60 7 w52,w53 LS 2 8 w7 3.6 wl 2.6 5.2 3.6 1.5 62 w52 RC 1 35 w4 1.7 wl 3.2 6.1 6.5 1.2 11 37 w53 w2 SL 1 8 w7 3.6 wl 3.1 4.4 3.7 1.8 63 w52 w2 -Exam~le 2 Cells from the different donors were stimulated with anti-CD3 or the staphylococcal toxins and analyzed for CD3 and Vp expression (Fig. 2). For each individual, results were calculated as the percentage of T cell blasts bearing a particular V~ after stimulation divided by the percentage of T cells bearing that V~ before stimulation. This calculation was designed to correct for variations in VA expression from one person to another. As before, anti-CD3 stimulated T cells bearins the different V~ s uniformly; the ratio of T cells bearing a particular V~ before and after CD3 stimulation was close to 1. In contrast, it was clear that the staphylococcal toxins varied markedly in their ability to stimulate T cells bearing different V~ s. For example, T
cells bearing V~ 5 and V~ 12 were ~uite rich in blasts produced by challenge with SEC3, whereas T cells bearing V~ 8 were specifically excluded from the SEC3 blasts.
One or more of the toxins was a stimulus for T cells positive for each of the V~ families (albeit weakly for V~ 6), indicating that a toxin superantigen had been identified for each of the V~ families. Conversely, :

- . ~ . - ~ , . . . - ~, ,: : . .. - . ,.: , .:: . ~ , . ,: . :

wo 91/07508 2 0 ~ 8 ~ ~ ~ PCT~US90/066 toxins could be identified which specifically failed to stimulate T cells bearin~ each of the V~ s.
It is remarkable that a characteristic stimulation pattern could be identified for almost each toxin. SEC2, for example, stimulated T cells bearing V~ 12 and excluded cells bearing V~ s from the other three families. This pattern was not seen with any of the other toxins. SED stimulated T cells bearing V~5 and V~
12, had marginal effects on T cells bearing V~ 8, and excluded cells bearing V~ 6. Again, this pattern was unique to this toxin.
In some cases, stimulation with a given enterotoxin yielded blasts that were neither enriched nor depleted for expression of a given V~ by comparison ~-ith the starting population. Starting and ending percentages of V~ 5-bearing cells were similar, for example, in responses to toxic shock toxin (TSST). Such a result might indicate that only some Vp 5-bearing T cells were stimulated by TSST. Perhaps the other variable components of the receptor, VcG, JoG, or J~ , could quite often prevent interaction of this toxin with V~ 5, a phenomenon that has been noticed before for superantigen reaction with mouse T cell receptor V~ s. Alternatively, TSST may react with only one member of the V ~5 family.
Thus, in responses to TSST, the increase in blasts bearing this member may be offset by a disappearance of T
cells bearing other members of the family, but also reactive with lCl. Discrimination by superantigens among different members of V~ families has been seen in mice, where the self superantigen Mls-1 stimulates T cells positive for V~ 8.1 but not those bearing Vp 8.2 or V~ 8.3 (Kappler, et al. Nature 332: 35 (1988), and SEC1 stimulates T cells bearing V~ 8.2 but not those bearing V~ 8.1 or V~ 8.3.
In some experiments, the percentages of T cells that stained with anti~CD4 or anti CD9 were checked before and after stimulation. The starting percentages were .. ~ ,.. , .. .... . ., ..... ., :

.:. .~ ,' ~' ' ., ' : ' ' : ' .: . '' .

. ` WO 91/07S08 ~ 3 ~ PCT/US90/06613 ; ~,., -- 1 1 --vlrtually unchanged by toxin stimulation. T cells from one donor, for example, were initially 78~ CD4+ and 23%
CD8 . After stimulation with the nine different toxins the percentages in the blast of CD4 cells ranged from 74~ to 79~, and of CD8 cells from 20g to 25%, suggesting that all these stimuli affected CD4 and CD8 cells equally. It might have been expected that the toxins, which are dependent on class lI MHC for presentation would have preferentially stimulated CD4 cells, but such is not the case.
One of the most striking features o the data in Fig. 2 is the consistency of the results from one individual to another. Thus, although the five people tested had dirferent HLA types and different starting pexcentages of T cells bearing the various V~ s (Table l), the proportional changes n V~ expression in blasts -~
stimulated by each toxin were almost the same from one individual to another. Although the superantigens - -require class II MHC for presentation, the allele of class II has much less impact on superantigen presentation than it does on recognition of conventional -~
antigens plus MHC by T cells.
These results show that the staphylococcal toxins are not indiscriminate mitogens for human T cells, but are, in fact, V~ -specific. This result accounts for the previously noted clonal specificity for such toxins.
Although each toxin is able to stimulate only a subpopulation of all T cells in humans, they are still powerful T cell stimulants, active at low concentrations.
Some or all of the toxic effects of these proteins in humans may be mediated by their ability to stimulate large numbers of human T cells. For example, the ability of these toxins to induce secretion of large quantities of lymphokines is probably secondary to their ability to stimulate, in a V~ - specific way, a sizable percentage of T cells. It is also possible that the ability of these and other microbial-derived superantigens to WO~1/07508 2 ~ PCT/US90/066 stimulate populations of T cells bearing particular V~ s may be related to the dirferential resistance of different individuals to the effects of these toxins and also to the ability of microbial attac~ to induce immune consequences, such as autoimmunity, in certain individuals.

Example 3 -The foregoing examples demonstrated a method for quantifying T cell subsets having particular cell surface phenotypes, using antibodies. This methodology calls for interaction between the antibody and its binding partners, i.e., the cell surface antigen, which is the V~
molecule.
Enhanced presence of the V~ molecules means that there has been enhanced expression o the DNA coding for the particular molecule. Thus, the following experiments deal with the measurement of the aforementioned T-cell subsets via analysis of the DNA expressing a particular V~
subtype.
Among the methods available to the skilled artisan for analyzing DNA is the so-called polymerase chain reaction, or "PCR" as used hereafter. PCR methodology is well known to the art, as may be seen in, e.e.g, U.S.
Patent Nos. 4,683,195, 4,683,202 and 4,800,159, Saiki, et al., Science 239: 487-491 (1988), and Chelly, et al., Nature 333: 858-860 (1988). Given that the PCR
methodology is known to the art, only the modifications to the technology used are elaborated upon.
Total RNA was prepared from anti-CD3 stimulated peripheral T cells as described supra. Two ~g of total RNA was used for the synthesis of first strand cDNA using reverse transcriptase (Amersham) and random hexanucleotides~ The reaction was stopped by heating for 5 minutes at 95C before polymerase chain reaction.
One twentieth of each cDNA samples was co-amplified using a V ~-specific primer with a C~ primer and two C~
primers as set forth at Table 2 with final concentration , ...... . ,, .. ,,, . ................. .- - ., . .. . . -: ........ : . - .. , . . . : : :- . . -, . ~ . . : .

. ., .. .: . ., , . . , . : :

~ WO91/07508 - l3 - PCT/US90/06613 ,,. ~

of 0.3 ~M in each reaction. The amplification was performed with 2.5 U o Taq polymerase (Per~in-Elmer) and a Cetus Perkin Elmer thermocycler under the following conditions; 95C melting, 55C annealing, and 72C
extension for l minute each. For quantification of amplified products, coamplification was performed with 5' P-labelled reverse primers (about 5x105 cpm each). The amplified products were separated on 2~ agarose gels, dried and exposed to X-ray film. The autoradiograms were used to identify and cut out the V~ -C~ and C~ bands.
Each band was counted by liquid scintilation counter. In control experiments, the relative amplification ef.iciency was calculated essent~ally as described by Chelly et al., supra. -Table 2. Sequences of primers used for PCR
, ., ~r~ ~egu-nc~ ~e~Dbes-a 5~ ~
~P~ GcAc~cAGTTcccTGACrTGcAc l.l~ 1.2 ~CATCAACCATGCAAGCCTGACC~ 2.l~ 2.2~ 2.3 CTCTCTAGAGAGAAG~GGAGCGC 3.l~ ~.2 ~CA~ATGAGAGTGGAT~GTCAT,T 4.1, ~ .S
~5-~ ~TACTTCAGTGAGACACAGAGAA~C 5.l Y~5.2/3 ~TCCCTAACTATAGC~C~CAGCIG 5.2~ ~.3 Y~6 aGGCCTGA5GCATCCGTC~C 6.~ 6.2~ 6.3 ~7 CCI~AAIGACCCAACAGC~CTC~ ~ 7.~
~8 A m ~C~r~AACAACAACG~CCG ~ 8.2~ t.j~ ~.4 ~9 . CCTAAATC2CC~GACAAAGCTCAC 9.1 V~10 CTCCAAAAAC~CATCCTGTACC5T lO.l~ lO.2 V~li ~CAACAGTCTCCAGAA~AAGGACG l~.l, 1l.2 ~12 AAAcGAGAAGTcTcAe~ 12.l 12-2 V~13.l CAAGeAGAAGTCCCCAAT 13~ lb ~13.2 CGTGAGGGTAC~CTCCC l~.2C
V~l~ GTC~C~CGAAAAGAGAAGAGGA~ l~-lC
~15 ~C~GTC~C~CGACAGGCACAGGC~ . lS.l, Y~16 ~A~GACTCI~A~C~GG~TGAGTCC 16.l V~l7 cAGArAe~AA~GAc~s~cAG 17.l CAT¢AGTCACGA~TGCCAAAGGAA 18.l ~9 CAA~GCCCCAAGAAC6CACCGC l9-1 ~2Q ~CC~C5GAGGTGCCCCAGA~CTC Z0.
~C~ 5~CTCATGCCTC~AA~A~
~C~ GA~CCC~CACCCTGCCGTGT~CC
~C~ A~CA~AAATTCGGCTAGGA~CC
~_l . ~ . ' ' - ~

,: . . , ;
, . : ' : ' , ~ , . . . , . . : ~ . , .
': ' , ` ' ~ ' , - : ~ . -o~ ~
W09t/07508 PCT/US90/0661 Notes To Table 2 The size of amplified products (V~ bands! b~ V~
and 3'C~ primers ranged from about 170 to 220 bp. The size of the amplified cDNA IC~ band) by 5'C~ and 3'C~
primers was about 600 bp. The 3'C~ primer used in this study matches exactly both C~ 1 and C~ 2 DNA. The sequences of V~ , C~ , and C~ are from previously published reports.
aMembers of each V~ family which have identical seque~ces as the correspondin~ primer are listed.
V~ 13.1, CV~ 13.2, and V~ 14.1 have also been called V~ 12.3, 12.4, and 3.3, by Toyonaga, et al., Ann.
Rev. Immunol. 5: 585-620 (1987), Kimura, et al., Eur. J.
Immunol. _ : 375-383 (1987).

Among the at least 20 different families of human V~
genes, at least 46 different members of these families have been cloned and sequenced, as reported by Toyonaga, et al., supra; Concannon, et al., Proc. Natl. Acad. Sci.
USA 83: 6598-6602 (1986); Lai, et al., Nature 331:
543-546 (1988). To analyze human T cell V~ usage, 22 different V~ -specific oligonucleotides for use as 5' sense primers for PCR were synthesized. Their sequences, and the V~ 's which they would be expected to amplify, are shown in Table 2. All the V~ 's indicated as amplified have sequences matching their corresponding primers exactly. There may have been other V~ genes amplified with these primers. For example, the V~ 6 primer matches V~ 6.4 except for one nucleotide, and further experiments will be needed to find out if V~ 6.4 is amplified using this primer. Altogether, all these primers would be expected to cover at least 39 of the 46 ~-sequenced human genes. Each V~ specific oligomer was picked to have roughly the same G+C content and to be located at relatively the same position in V~ .

:. . . - -: .... - , ~ - , . . . . ..
~ -. . , . .. . ~ ~, , .. . . . - . . - -.. , :. :~ . - - - :: . :. : : .:

- . . . - , : :... . ,- , -, . - - . . .
.. .. ~. , . , : . , ..... .- :: . :: : .
. - .. , ... .. : : ,: . ...
., ... ., . . . '. - : ~

- ' ' ~ - ': . : . . -- WO9l/07508 ~ PCT~US90/06613 Exa~le 4 .
Total RNA was prepared from human peripheral T cells stimulated by anti-CD3 antibody or one of 5 different S. aureus toxins (SEB, SEC2, SEE, exfoliatins toxin (ExT), and toxic shock syndrome toxin 1 (TSST), as described in the previous e~amples. At the time of analysis these populations contained 50-90% T cell blasts as judged by flow cytometric analysis. A single strand -~
complementary DNA was prepared for mRNA phenotyping, following Buus, et al., Science 35: 1353-1358 (1987);
Townsend, et al., Cell 44: 959-968 (1986), and aliquots of cDNA from each sample were amplified with each of the 22 5' V~ specific sense primers and the 3' C~ specific antisense primer. As an internal control, TCR~ chain mRNA was co-amplified in the same tube. Amplification was performed with 25 cycles, a limited number use~ to ensure that the amount of product synthesized was -proportional to the amount of ~ mRNA in the original preparation. The specificity Or each V~ specific primer ~0 was determined by the size of its amplified product and hybridization to the amplified products of specific probes (not shown). The amplification efficiencies of four of the primer sets (5'C~ -3'~, V/~s , 3, and 8-3'C~) -were determined as described by Chelly, et al., ~E~.
The average -_ficiency ranged about 46-48%. For each sample the number of counts in the V~ band were normalized to those found in the C~ band.
It was necessary to ~ind out whether or not the relative incorporation in this PCR reaction was proportional to the number of cells in the responding population expressing a particular V~ element. However, two possible sources of error had to be considered. The -first of these was contribution from unstimulated T
cells. It was reasoned that, since mRNA levels are extremely low in unstimulated T cells compared to T cell blasts, the contribution from unstimulated cells would only become a problem when the proportion of blasts .

,,. ~ . - - - - . - . . . . . . . . . . .

, . .: - ' ' " ': ' .
'. .: ': ' ' ' ' : ' ~ ' ... . . ... .

W O 91t07508 2 ~ 8 P ~ /US90/066 expressing a particular Vp was very low compared to the unstimulated cells. Secondly, since all T cells have the potential to rearrange the ~-locus on both chromosomes, transcription of V~ mRNA from a non-productively rearranged chromosome in at least some T cells might confuse the analysis. Since non-functional mRNA could be expected to be at a low level due to its instability, it was reasoned that this mRNA may only present a problem in cases where a particular V~ element was poorly expressed in the blast population.
In order to test these assumptions, the actual percentage of T cell blasts expressing V~ 5.2/3, V~ 8 and V ~12 in the various samples using flow cytometry and anti- V~ monoclonal antibodies was determined prior to preparing mRNA. When the normalized PCR incorporations for V ~ 's 5.2/3, 8 and 12 for these samples were plotted in a log/log plot against the percentage of T cell blasts staining with these anti-V~ s monoclonal antibodies, a ~-linear relationship was obtained (Figure 3) with the data from three different experiments indistinguishable. This relationship was most evident for values above 1%. Below about 1~ V~, expression or a normalized PCR incorporation - of about 30 the correlation was lost. It was concluded, therefore that contributions from unstimulated T cells and non-productively rearranged ~-genes were ir.significant when Vfi expression in the blasts was greater than 1~. Therefore, the data plotted in Figure 4 was used as a standard curve to analyze expression of -V ~'s for which antibody was not used, estimating the percent V~ expression from the normalized PCR
incorporation.

Example 5 The PCR methodology was used to analyze the expression of V~ 5.2/3, V~ 8, V ~12 and 19 other V ~s or V~ families in normal peripheral T cells stimulated with the various toxins. T cells stimulated with anti-CD3 .

, . , - ~- -, -: - :,-: : : . .. . . . .

~-i` wo 9l/07s08 2 ~ PCT/US90/06613 were used as a control, because Examples 1 and 2 show that stimulation with anti-CD3 did not significantly change the percentages of T cells bearing particular V ~ 's from that seen in the starting population. Results are shown in Figure 4. The results of a complete analysis of the response of T cells from a single individual to five different S. aureus toxins are summarized in Table 3.
': -,~ .. .. ~ . : . . . . . : .

WO 91/07508 ~ 0 ~ 8 ~ ~ 1 8 - PCl/US90/06~

_ ., ~_ ~ ~ _ ~ .
>~ ~ ~''S~ " `S ~ "' .. ~ n~ &~
@ ~E ~ a~o;~ lag;8"P~S
__ ~ ~ . _ .' .~ ~ ~ ~ ~ r ooo~ _ 3 ~ ~ , rJ~n j~ ~
Y~ C~5~ 2' ~ _ 1 ~ ` ~ o s~ # ¦ ~ ~ 33~~ 3~ ~ ~ -~r; ~ ~ n~
0 1~ 3 : 3 _ ~
~ I i 1~) 3 ~ ~ n n ~ _ _ 'Ç~ ~ Xn~ ~ ~ X~
o 1 ~ ~ ~ _ L~ ~ ~ ~ d ~ 33 ~ o x _ ~ ~n~ ~
n I q 3~ ~ ~ ~
8 )~ ~ ~ O ~ ~ N ~ O~ ~ O O ~ ~ N ~ ~ ~ q ~ ~
3~ ~ Y ~o ~ n ' V ~ ~ ~ ~ ;i;
,, ~ ~ ~3~ 8 _ E~ ~ ~--~ '~ ~
_ _ ~ _ !` ~e~ 2 . . : . ` .

~ WQ 91/07508 2 ~ ? ~ PCT/US90/06613 Some V~ families were used more abundantly than others by normal peripheral T cells. Members of the V~
2, 3, 6, 7 and 8 farnilies and V~ 13.1 were expressed by more than 50~ o. total T cells. Such a finding was perhaps not unexpected for V ~6 and V~ 8 which are part of large families of V ~'s (although the V~ 6 oligonucleotide probably primes for only 3 of the 9 members of the Vl36 family), but is more surprising for V ~13.1, which appears to be the product O r a single gene. The uneven expression of V~'s by human peri-pheral cells did not appear to be idiosyncratic for this individual or determined by MHC, since similar frequencies were seen for 2 other unrelated human donors tested (see discussion, infra, and Figure 5).
Complete analysis of the expression of mRNA for all 20 families of human T cell receptor V~ genes showed clearly that all the toxins preferentially stimulated T
cells expressing particular V~ 's, moreover the pattern of stimulation was different for each toxin. A number of 20 striking new associations were found. Most dramatically -V~ 2-bearing cells were highly-enriched by stimulation with TSST. About 50~ of the T cells in TSST stimulated T
cell blasts had V~ 2. As was shown, supra SEB stimulated T cells bearing V~ 12, but this analysis also revealed stimulation of T cells bearing V~ 3, V ~14, V ~15, V ~17 and perhaps V~ 20 by SEB. The related toxin, SEC2, also stimulated T cells expressing V ~ 12, V~ 14, V ~15, V~ 17 and V ~20, but not those expressing V~ 3. SEE stimulated T cells bearing members of the V~ 8 family, as we have previously shown, but also increased the proportion of V~ 5.1 , V~ 6.1-3 , and V~ 18 cells.
Using this method, it was possible to estimate roughly the percentage of all the T cells in a given human cell population that could be accounted or by summing those bearing the different V ~ s measured. As shown in Table 3, this percentage was about 90~ for T
cells stimulated with anti-CD3, suggesting that the .: . . . . ~
.: . . . .

, . ' .~ ' . .

W O 91/07508 ~ ~ P ~ /US90/066 estimate that the V~ oligonucleotides would prime for expansion of mRNA's encoded by 39 of the 46 human V~.
genes is not exaggerated, certainly not by an order of magnitude. This suggests that the 46 known V~ sequences probably cover most of the human genes. The quantitative PCR's accounted for a lower percentage Oc blasts stimulated by some of the toxins, in particular, ExF. It is possible that this toxin predominantly stimulates T
cells bearing V ~'s not covered by the listed primers.
Some of the most dramatic associations in Table 3 were tested in two additional human individuals to see how general the phenomena were (Figure 5). The stimulation experiments, and calculations, were identical to those used suPra. In their responses to these toxins the 3 individuals behaved almost identically. For example, V~ 2 T cells were enriched by TSST to almost the same level of 45% in every case. Similarly, in all three individuals, SEB stimulated T cells bearing V~ 3 and SEE stimulated T cells bearing V ~ 8.

Example 6 The similarities between mice and humans in the T
cell response to these toxins in striking. In both cases T cells bearing particular V~ 's dominate the response to each toxin. In both cases the discriminatory powers of the toxins can be particularly dramatic. For example, in humans V~ 5.1 T cells responded to SEE, whereas cells bearing V ~5.2/3 did not. Similarly, it has been observed by the inventors that, in the mouse, several toxins can distinguish among the members of the V~ 8 family. This member-specific response to superantigens has also been seen in mice for the endogeneous superantigen, Mls-l , which stimulates T cells bearing V ~8.1 but not those expressing V p8.2 or V~ 8.3. See - Kappler, et al., Nature 332: 35-40 (1988).
Extensive sequence analysis of vr~ genes rom mouse and man shows that there are some homologues, both by . -. - ~ ~ . - , . . , . ~ :
- ~ . .: .. . : . .~. - . . .. , . .; .. : ~ :
., . .. : ~ . -:
: : . . :- . : . . ,: .. -: - : .. , .: . . . . : : .
,, . .. , ,.. - . . . . : :

WO91/07508 ~ J ~ PCT/VS90/06613 primary sequence, and bv their relative location in the V~
gene complex. See Toyonaga, et al., Ann. Rev. Immunol.
5: 585-620 (1987); Concannon, et al., Proc. Natl. Acad.
Sci. USA 83: 6598-6602 (1986); Lal, et al., Nature 331:
543-546 (1988). The stimulation patterns by the different toxins O r these homologues by using data for mice V~ stimulation by toxins was compared, followins White, et al., Cell 56: 2/-35 (1989). As indicated in Table 4, in some cases T cells bearing homologous V~ 's show a similar pattern of response to the toxins. ExT
and especially TSST, for example, stimulated T cells bearing human V ~ 2 and mouse T cells bearing the most -~
analogous V ~15. Human T cells expressing members of the V ~ 12, 14, 15 and 17 families all showed a tendency to respond to SEB and SEC2, but not ExT or TSST. This ~
property was shared by their closest murine relatives, -mouse V ~ 's 8.1, 8.2 and 8.3. However, similar response patterns by T cells bearing homologous V ~'s was not always seen. For example, T cells bearing murine V ~3 responded to most of these toxins, however, those bearing the closest human analog, V ~10, did not. Even with all this information in hand, a close examination of the primary amino acid sequences of the human and mouse V~
elements has not yet revealed the essential residues responsible for toxin specificity. Thus, while tempting, complete generalization from mouse to human systems (MHC
to HLA) is not indicated.

- - : ; . . .. .
-. ,. . .-~ :
- : . . .
- ~ . , - ., . - :. . . ..
-, - , ..... ... , , . 1 .

'- : . , .:

2 ~
WO91~07508 - 22 - PCT/US90/066 Table 4. Correlations Between Mouse and Human V
Usage in Response to S. Aureus Toxlns.

.. _ . _~
Enriohe~ ~n ~es~onsQ to .. _ . _ S~B ~E~2 SEE Ex~ ~sS~
. , . . _ .
~OUS~ ~ IJ 8.
8.2 ~-~
.
Ru~ 1~ ~ 6'7) t t -- -i~o~olcgg ~2 (62) ~% Eos~o) 1~ (60) -_ * _ _ 1~ ~s8a ~ , .
1 ( ~5 ) _ _ _ _ _ 7 t~2) ~
- .
~OUs~ ~ t~ ~
~U~ 8 t71~ _ _ ~ _ _ ~o~olo~ 3 ~ 6 0 ) _ _ * ~ ~:
t~ ~os:~o) ~t ~5~ _ _ + ~;
__ .
~Sou ~ ~ t ~n 2 ~6S~ ~
~o~olog .
~% ~o~) .
. . ,. - . .
~OU~ ~ 3 ~ +
~u~sa~ 67) _ _ _ _ _ Xorso~og~ 50 tS6) ~ .

- . .
.:: - , , ., ., ''~

WO91/07508 - 23 ~ $~ ~ PCT/US90/06613 In comparing mouse and man, the most striking difference to emerge thus far in our studies is the apparent lack of mechanisms limiting V~ expression in humans. In the mouse, despite the potential for expression of over 20 vfi elements in the species as a whole, various mechanisms limit V~ expression in individual mice. In some strains large genetic deletions have eliminated about half of the V~ gene elements.
See, e.g., Behlke, et al., Proc. Natl. Acad. Sci. USA 83:
10 767-771 (1986). Other V~ gene elements are often inactivated by point mutations. See Wade, et al., J.
Immunol. 141: 2165-2167 (1988). Most ingeniously, in many strains of mice, self-superantigens, expressed during T cell development lead to the deletion of T cells bearing particular V~ elements during the establishment of self tolerance. See in this regard Kappler, et al., Cell 49: 273-280 (1987); Kappler, et all, Cell 49:
263-271 (1987); macDonald, et al., Nature 332: 40-45 (1988); Pullen, et al., Nature 335: 79~-801 (1988);
20 Kappler, et al., Nature 332: 35-40 (1988); Abe, et al., -J. Immunol 140: 4132-4138 (1988). It i~ proposed that these mechanisms which lead to limited V~ expression in individual m ce may be a protective evolutionary response to the pressure exerted by bacter al toxins, so that in a population of mice some individuals will be relatively resistant to the effects of any particular toxin superantigen. No evidence for widespread similar mechanisms in humans has emerged thus far from the limited number of individuals examined. Thus large genetic deletions have not been found nor have self-superantigens which cause elimination of T cells bearing particular V~ been observed. A closer examination both of individual members of the V~
families and of larger human populations, especially those with a much more widespread exposure at an early age to these types of toxins, may be required to observe some of these mechanisms at work in humans.
, - . . . :, ~ - - : . . - - - :.. .

. .' ' ' : ' . . '.' '~ ' . :

'''' ` ' ' ' ~' ~ ' ' " . ~ ' ' , ' wo 9l,07508 2 ~ 24 - PCT/US90/066~

Example 7 Patients (9 in total) were all diagnosed as having toxic shock syndrome by their private physicians. They were then screened to determine if they met the definition for severe toxic syndrome as jointly created by the Centers for Disease Control and several investigators. See Todd, Clin. Microbiol. Rev. 1:
432-466 (1988); Reingold, et al., Ann. Intern. Med. 96:
875-80 (1982); Wisenthal, et al., Ann. J. Epidemol. 122:
10 847-56 (1985). Major criterial (all required) for the diagnosis include fever (>39.8C), rash (diffuse erythematous rash evolving to desquamation), and hypotension (systolic blood pressure C90 mmHg for adults --and/or orthostatic syncope or dizziness). Minor criteria (3 required) for the definition include diarrhea and/or vomiting, muscular involvement, mucous membrane hyperemia, decreased renal function or pyuria, elevated liver enzymes, platelet count ~100,000/mm3, and disorientation or altered state of consciousness. All ~
20 patients studied also had at least one probable focus of ~ -S. aureus infection. As a control, in addition to normal .
individuals, one patient with severe toxic shock syndrome associated w_th group A Streptoccocus pyogenes (Stevens, et al., New Eng. J. Med. 321: 1-7 (1989) was also studied.
Disease in four patients appeared to be related to menstruation and tampon use. S. aureus was cultured from 2 of these patients, and the vagina was presumed to be the site of S. aureus infection in the remainder. The development of toxic shock syndrome in Patient 6 appeared to be related to an S. aureus vaginal infection four weeks after cesarian section. Disease in Patient 4 was associated with sinusitis from which S. aureus was cultured. Eposides in two children (Patients 7 and 8) were associated with subcutaneous abcess of the buttocks and peritonsillar cellulitis, respectively. S. aureus was cultured from both foci, and these isolates produced ~ -WO91/07508 2 ~ ~ g ~ PCT/US90/06613 TSST-l as well as entertoxins A and C in vitro. Patient 3 had previously experienced more than 10 episodes of toxic shock syndrome thought to be related to upper respiratory and sinus infection with S aureus. Despite being prophylactically treated with dicloxacillin, she required hospitalization for the clinical episode of toxic shock syndrome studied here. At the time of hospitalization, a culture of the nasopharynx was negative for S. aureus. Thus, with the possible exception of this latter patient, toxic shock syndrome in the nine patients studied appeared to be related to focus of S. aureus infection. The time from acute onset of symptoms and from initiatlon of treatment (including antibiotics) to the tlme samples were obtained for analysis of T cell subset changes is also listed in Table S. At the beginning of the study, it was unclear as to how long abnormalities in T cell subsets would persist after the toxic shock syndrome, and no restriction was placed on this variable.

.
.. ~ . . . ;-., .

- , . . . : , ' . . . : , ' ' . : , . ' . . . :

WO 91/07508 2 ~ 2 6 - P~/US90/066 T~blc 5 Clinic~l Cll~r~ctcristics ot B:llicll(s S~u(li~

Sourcc of S,~urcu~ Major Minor Cullurc of Days ~ronl o nscl of nl ~ 5c~ infection Critcri~t*~s~2+' Sourc~/Enlcroto.<in syml)toll~s/trc;llmcllt - production++ lo ririt blo- d s;~ plc 32/E va~ina, allA,B,C,D, ND 14/10 mcnstluation~ ed E,F,C
218/F va~in~, allA,B,C.D, ND,~ gn menstn~ion-relatcd E

321/I: none~ 311A,B,C Nc~ 6/5 426/F sinus allA.B,C,D, S. ~urclls, 152/150 E,G not tesled 513/F va~im, allB,C,E S. ~urc~, 13/11 menstruation-relatcd not tested 623/F va~in~, allC,D,G S. ~ureu~. 8n post-surgical not tcstcd 716/M buttocks allA,B,C,D, S. itureus, 4/3 abscess E TSST-I, A,C

S- 8/1: pcritonsil~r ~11A,B,C,D S. aurct~ /3 ccllulitis TSST-I, A,C

9I~/F v~gina, ~11A,C,D ~ ;turcll!;, 1/3 mctlstru~tion-rcl:Ltcd TSST-I, C
~ .

. . , - - . - - . - . - -: - .: . - . - -- -WO91/07508 ~ PCT/US90/06613 . .

Major criteria include fever C>102F), a characteristic erythematous rash that subsequently i5 followed by desquamation, and hypotension.

Minor criteria include A, gastrointestinal symptoms tvomiting or diarrhea); B, muscle involvement (cleaved CPK or sever myalgias); C, hyperenia of the mucous membranes; D, renal functional impairment or pyuria; E, laboratory evidence of hepatic dysfunction; F, thrombocytopenia (platelet count ~100,00/mm ); and G, lQ disorientation or altered state of consciousness.

Patient 3 had at least 10 prior episodes of toxic shock syndrome. Several of these had been associated with sinusitis, and previous evaluations had included positive cultures of S. aureus from the nasopharynx and sinus. The patient was being treated prophylactically with antibiotics, and at the time of this hospitallzation, all cultures were negative for S. aureus.

In some of the later cases studied, the source of infection was cultured and S. aureus isolates were tested for in vitro production of enterotoxins, A,B,C1,C2,C3,D
and E, and TSST-l. . . -Not done.

. - i .- , ... . - . ~ : ~ : - : :

: , .
. . . ..

WO91/07508 ~ PCT/US90/06613 Peripheral blood mononuclear cells taken from the patients were isolated from heparinized blood following Ficoll hypaque gradient centrifugation. Stimulation of T
cells were accomplished as described supra in plastic flasks coated with purified anti-CD3 antibody. Cells were cultured at lxlO~ cells per ml in media containing P~P~II 1640 supplemented with 2 mM glutamine, lO mM hepes buffer, lO0 u/ml penicillin, lO0 ug/ml streptomycin, and lO~ fetal calf serum. After three days of culture, live cells were harvested and cultured for an additional 24 hours in 25 u/ml recombinant human IL- to expand cells expressing the receptor for IL-2 while allowing regeneration of potentially modulated T cell receptors.
The cells were then harvested, washed and used for either indirect immuno~luorescence staining or quickly frozen in liquid nitrogen for subsequent RNA extraction.
Indirect immunofluorescence was performed bv ~ -incubating cells with saturating amounts of monoclonal antibody, and then staining with a fluorescein-conjugated goat anti-mouse Ig(Tago, Inc., Burlingame, CA) was described supra. Control samples included cells stained ~-with the second-step reagent alone, and background values were subtracted. Forward angle and 90C light scatter -patterns were used to gate on the large lymphoblasts, which were easily distinguished _rom small lymphocytes and which comprised the great majority of all viable cells. Fluorescence intensity was determined using an Epics C cell sorter. Monoclonal antibodies used as staining reagents were directed to CD4 and CD8, and to epitopes on T cell receptors bearing V~ 5, V ~6, V ~8, and V ~12, again as described supra.
Total RNA was prepared from anti-CD3 stimulated cells as described and total RNA was used for the synthesis of first strand cDNA using reverse transcriptase, also as indicated suPra. Similarly, cDNA
was amplified using the polymerase chaln reaction as described in Example 3.
,~

'; ' , : , :,, . ::, , , . - . - . , , .. ~ . , , . - : .. - ~
, . , . ., . , , ., . ~ ~-.

WO9l/07508 2 a ~ PCT/US90/06613 In a fashion similar to Examples 1-6, peripheral blood mononuclear cells were isolated from patients and controls, and T celis were stimulated in culture with anti-CD3 antibody and IL-2. Using cDNA made from total RNA isolated from the T cell blasts and a quantitative polymerase chain reaction, T cell receptor gene segments encoding V ~2, V~5 (5.2 and 5.3), V~ 8 (8.1 and 8.2), -and V ~12 were amplified and quantitated. To control for the amount of T cell receptor ~RNA and variation in reaction rate, a C~ gene segment was also amplified in each reaction. Figure 6 shows results with T cells from Patien, 1 and a concomitantly-studied normal individual.
A striking increase in amplified V~ 2 DNA is apparent in the patient compared with control, whereas little difference is observed in the C ~ products. There is also little difference between patient and control in the amount of V~ 5, V~ 8, or V ~12 product especially when normalized to the relative amount of C ~ amplified in each reaction.
The data in Table 6 are expressed as a ratio of Vp DNA to C~ DNA amplified in the same reaction. Although all Oc the controls (studied concomitantly with patients) had V ~ 2/C~ ratios less than or equal to 0.10, initial samples from 5 of the 9 patients had ratios greater than 0.17 (p=0.03 by Fisher's exact test) with one, for Patient 1, as high as 0.78. Abnormal V~ 2~C~ ratios were demonstrated in 3 of the 4 patients with menstruation-related disease and in 2 of the 5 nonmenstrual cases. In contrast to V~ 2, none of the other V~ /C ~ ratios were increased more than 2 SD above control values, indicating the selective nature of V~ 2 expansion in toxic shock syndrome. Tt shoul~ be noted that among the patients not demonstrating increased V ~2/C ~ ratios (Patie`nts 4,6,8,9), one (Patient 4~ was studied a relatively long period after the acute disease such that an increased level could have been missed.

.

.

. .

. - . . :. . . ... : . , . . . . , ~
.: . . :........ :. . . . . : . . , . . :
. ~ ... . . : : .
. :: . . - , -2 ~ 5 ~ 3 () -T;lblc 6 Vp Expression in l'eripller~l 131Oo(l T Cells l;r(lm l'~tiellls ~villl l`oxie Sllock Syn~lrome V13/C Ratio~

P;ltien~ #V~2 VB5t V~8# V,B 12 Q78 0.07 0.03 0.0~
2 0.25 0.02 0.01 0-03 3 0.18 0.~3 0.03 0.03 4 0.07 0.02 0.03 0 03 0.18 0.04 0.03 0.01 6 0.11 0.04 0.04 0.01 7 0.46 0.04 0.03 0.01 8 0.08 0.04 0.04 0.0 1 9 0.05 0.04 0.04 ().01 Cont~ols (N=7) (me~n + S.E) 0.0~+0.01 0.05+0.01 0.025+0.01 0.03+0.5)1 ~ D~t~ ~re presenled for the initi31 s~nple obt~ined frorn e~ch p~tient (see T~l~le I ).

+ A prin~er specific for ~ sequencc eornmon to V,BS.2 ~nd V~B5.3 f~mily memocrs w;ls us~

~Apr.itnerspecificfor~sequencecommontoV~8.1~ndV~8.2f;mlilymemb~rsu~;lsuse~1. -. . - ,, ; - .: :

. ..

WO91/07508 2 ~ PCT/US90/06613 T cells isolated from patients and controls were also analyzed for subset alterations by indirect immunofluoresce and cytofluorographic analysis. No consistent alteration in the percentage of CD4 and CD8 T cells were noted even in patients with markedly elevated V~ 2 levels. The ranges of CD4 and CD8 T cel' percentages were 30-84~ and 14-60%, respectively, in patients compared with means (+ SE) values of 64 + 5.1%
and 29 + 4.6~ for control ndividuals. Cells from 7 of the patients were also stained for the expression of V~

5, V ~6, V ~8, and V ~,12. Consistent with the above analysis by the quantitative polymerase chain reaction technique, values outside the normal range were not observed for these non-Vf~12 T cell subsets. Mean + SE
values or patients vs. controls ~N=12) were: V~ 5, ~.4+0.25 vs. 3.1+0.30; V p8, 4.3+0.63 vs. 3.7+0.50; V~ 6, 3.0+0.46 vs. 3.4+0.41; and V ~,12, 1.6+0.14 vs. 1.5+0.09.
Examples 1-6 show that the efficiency of V~ 2 ampli,ication is similar to that .or V f, 5 and V ~8, supporting the validity of estimating the percentage of circulating T cells expressing V f~ 2 by the polymerase chain reaction method. The results suggest that V~,2 T
cells in normal individuals are approximately 10% of the peripheral blood T cell population. In contrast, peak values for patients l and 2 may be as great as 70% and 30~, respectively, emphasizing the striking stimulation of V~, 2 T cells occurring in some patients.
One patient with severe toxic shock syndrome associated with group A streptococcus was also studied.
All ma]or and minor criteria for the definition of toxic shock syndrome were present, and the patient died approxlmately too weeks after hospitalization. The patient was studied within one week of the onset of symptoms, and the V~j2/C d~ ratio was 0.08, clearly within the normal range.

- .- : . , - . . . ~ ::
.- . . : . - . ..
- - ~ - :, . . :
- - : - . .
: . . . . . .
- . , - . ' : . ~ : , , :: ' WO91/07508 2 3 ~ PCT/US90/066 Example 8 Serial samples were obtained from two patients to examine longitudinal changes in T cells expressing V~ ?
after the acute disease. V~ 2 T cell percentages in Patient 1 decreased by half within 2 weeks after the initial determination and were almost normal by 60 days after the onset of the acute disease (Figure 7 - top panel). Patient 2 demonstrated near-normalization of V~2 levels within ~5 days of the acute episode (Figure 7 -bottom panel). These serial studies also emphasize the relative lack of fluctuation over time in T cell subsets -expressing other V~ segments, an observation also made in studies of normal individuals some of which are discussed su~ra.
The foregoing examples show that a pathological condition, such as an infection, can be diagnosed by assaying a sample from a patient to determine levels of ~-particular V~. molecules in the sample. Increased levels of specific subtypes have been found to be linked to particular antigens, as the results show.
The term "pathological condition" as used herein is not limited to an infection; rather, it refers to any condition where an abnormal immune response has occurred.
This includes, e.g., autoimmune diseases where, as has been shown supra, specific V~ type molecules are present where they should not be, or are present in quantities above those found in normal individuals.
Increases in V~, quantities are not the only way to diagnose pathological conditions in accordance with this invention. The art is familiar with various diseases and pathological states, such as HIV infection, where T cell levels are below those normally encountered. Correlation of particular V~ types to conditions characterized by T
cell depletion are also embraced herein.
Examples 7 and 8 shows that a selective increase in circulating T cells expressing V ~2 is frequently assoc~ated with toxic shock syndrome. Other T cell -; . : . . . , . : . .: . :
~ ~ ., . - .................. ,. . . : . .

- - ~: -, . , WO91/07508 ~ ~Vu~ PCT/US90/06613 subsets studied including those expressing Vf35, Vl,8, and V ~12 were not increased above normal levels and did not ~luctuate over time. Thus, measurement of the proportion of T cells expressing V~ 2 in peripheral blood could be used as a diagnostic test for this disease.
Diseases that result in nonspecific T cell activation should not lead to a selective increase in Vf~2 T cells.
It should also be emphasized in TSST-l and other S.
aureus enterotoxins stimulate cells bearing particular V~ segments almost regardless of the composition of the rest of the T cell receptor on these cells. Other variable elements (D~ ,, V ~ , J ~) do not appear to contribute much to the recognition of these V~ - specific superantigens as they do for conventional antigens.
Thus, although it is possible that some conventional antigens may also stimulate a subset of T cells expressing V~ 2, the magnitude of this response with the frequency of responding T cells being much less than l in l00 would be only a small frac.ion of that resulting from stimulation of TSST-l. It seems unlikely that such a response could change circulating levels o r V~ 2 T
cells.
It is apparent that not all of the patients with toxic shock syndrome in this study demonstrated elevated V~ levels. One patient was studied nearly five months after the acute illness, and elevated levels could have been missed. This possibility is corroborated by the serial changes in two patients, in which a return to near-normal levels occurred within one to two months ~ -after presentation. Examples 1-6 indicated that S.
aureus toxins other than TSST-l do not stimulate V~ 2 T
cells but do stimulate other sets of T cells in a V~-specific fashion. Thus the experiments set forth in Examples 7 and 8, which focused on T cells expressing V~2, are likely to detect abnormalities only in TSST-l mediated disease. Future studies that include the measurement of T cell subsets likely to be expanded by ~. ; . -WO91/07508 ~ 34 PCT/US9~/06 these other toxins may increase the frequency of positive tests. As predicted, the patient with fatal shock syndrome associated with group A streptococcus did not have elevated levels of circulating V~ 2 T cells.
The data presented here indicate that during to~ic shock syndrome T cell stimulation occurs on a scale not observed in response to conventional antigens, and it is proposed that this massive T cell activation is a critical event in the development of disease. These activated T
cells are likely to be releasing IL-2, interferon-gamma, lymphotoxin (TNF-~), and a variety of other less well~characterized lymphokines. See ~.icusan, et al., Immunology 58: 203-8 (1986). IL-2 infusions have been associated with a high frequency of induced hypotension as taught by Belldegrun, et al., Ann. Int. Med. 106:
817-22 (1987); Ann. Int. Med. 109: 953-8 (1988). The T
cell activation process and/or release of IL-2 could also greatly enhance or be required for the release of IL-l and TNF by macrophases. Nedwin, et al., J. Immunol. 135:
2492-7 (1985). If T cell activation is required for expression of toxic shock syndrome, T cell depletion or functional inactivation should interrupt the cascade of -events in S. aureus toxin mediated disease. This may be , partially supported by studies suggesting that administration of corticosteroids early in the disease course mav produce beneficial effects in some patients.
See Todd, et al., JAMA 252: 3399-3402 (1984).
In this initial study, patients were not studied at the time of initial presentation. Kinetic studies where therefore limited to following changes in T cell repertoire after the initial increase in percentage of V~2 T cells. The return of this subset to relatively normal levels was surprisingly rapid in the-two patients that were serially followed. The fact that levels do return to normal indicates that the increase in V~ T
cells occurs after the onset of toxic shock syndrome and is not a factor influencing susceptibility. The - ~ ., ' .' ' ' . : ,. ' ~: . ,' ' ~ . , ' ~L.

mechanisms responsible for the decrease in circulaLing V~2 T cells with time are unclear. Studies in rodents after immunization have indicated that after activation and expansion in numbers, antigen-specific T cells emigrate from lymphoia tissues (the site of antigen activation) into the recirculating pool (i.e. thoracic duct lymph). See Sprent, et al., Cell Immunol. 2: 171-81 (1971); Wilson, et al., J. Immunol. 116: 1030-40 (1976).
These cells gradually decrease over time, perhaps reflecting their return to lymphoid tissues and/or the continuous entry of other antigen-activated cells into the recirculating pool.
The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, it being recognized that various modifications are possible within the scope of the invention.

.

- . . - ,. - ~ , : . - .

; - ' ~' ~ . :. . ' `

Claims (10)

WE CLAIM:

1. Method for diagnosing a pathological condition in a human comprising assaying a body fluid sample of a patient to determine level of a T-cell subtype characteristic of said pathological condition and comparing the level determined to normal levels in a comparable body fluid sample, wherein a variance in the level of said T-cell subtype is indicative of said pathological condition.

2. Method of claim 1, wherein said pathological condition is a staphylococcus infection.

3. Method of claim 1, wherein said pathological condition is an autoimmune disease.

4. Method of claim 1, comprising assaying said body fluid sample by contacting it with an antibody which specifically binds to a cell surface antigen characteristic of said T-cell subtype.

5. Method of claim 4, wherein said antibody is a monoclonal antibody.

6. Method of claim 5, wherein said monoclonal antibody is a monoclonal antibody specific for a T-cell surface antigen selected from the group consisting of V.beta.
5, V.beta.6, V.beta.8 and V.beta.12.

7. Method of claim 1, comprising assaying said body fluid sample by determining the amount of DNA present which codes for a cell surface antigen which characterizes said T-cell subtype.

8. Method of claim 7, comprising determining said DNA by polymerase chain reaction.

9. Method of claim 7, wherein said cell surface antigen is selected from the group consisting of V.beta.1, V.beta.2, V.beta.3, V.beta.4, V.beta.5.1, V.beta.5.2, V.beta.5.3, V.beta.6.1, V.beta.6.2, V.beta.6.3, V.beta.7, V.beta.8, V.beta.9, V.beta.10, V.beta.11, V.beta.12, V.beta.13.1, V.beta.13.2, V.beta.14, V.beta.15, V.beta.16, V.beta.17, V.beta.18, V.beta.19 and V.beta.20.

10. Method for diagnosing toxic shock syndrome comprising assaying a body fluid sample of a patient to determine level of V.beta.2 subtype T-cells in said body fluid sample and comparing said level to normal levels in a comparable body fluid sample, wherein an increase in said V.beta.2 subtype level is indicative of toxic shock syndrome.