CA2066652A1 - Light-activatable plant promoter - Google Patents

Abstract

2066652 9105054 PCTABS00004 A light-activatable plant promoter is provided. This promoter was identified as a promoter sequence for the fructose-1,6-bisphosphatase gene. The promoter can be used to control the expression of genes in photosynthetic tissues.

Description

W O 91/05054 PC~r/GB90/01493 ;-; 20~66~2 LIGHT-ACTIVATAE~LE PLANT PROMOTE~

The present invention relates to a light-activatable plant promoter.
Fructose-1,6-bisphosphatase (FBPase) is a key enzyme in the reductive pentose phosphate pathway of carbon fixation of photosynthesis. The protein is nuclear encoded.
The wheat genome contains three copies, one derived from each of the progenitors of hexaploid T. aestivum. FBPase is synthesised as a precursor prote n with a transit sequence of about 50 amino acids which is cleaved from the mature protein during transport into the chloroplast.
The enzyme activity of FBPase is light-regulated via the ferredoxin/thioredoxin system. A full length cDNA for wheat FBPase has been isolated ~Raines et al, Nucl. Acids Res. 16, 7931-7942, 1988). This provided the first complete amino acid sequence for FBPase. The cDNA clone was also -used as a probe to determine steady state levels of F~Pase mRNA in wheat leaves during development and also under different light regimes (Raines et al, 1988). These results suggested that FBPase gene activity is responsive to light although other developmental factors appeared also to influence final mRNA levels.
We have now identified a promoter sequence for the FBPase gene. Accordingly, the present invention provides a light-activatable pro=ot-r hsving the seq~ence:

' ,~ , :

.. . . . .. . . . . . .. ..

,, . . . . :.. .. . .

. . ...... , , ., .. , . , . . - . . . ..
- ' . . :. , ~., , : ' , .

`2`066:6~2 ~

ATCGATAGGTTCGACAGAAGCTGCCACGTACCTATGAAACTCAATTGATTATTATATCCA
TATTATTGAAGTTTATTTTTGTAGAATGTTATTCAATTCCAGAAGTTGTAAGTTCCGTAA
GACCTGTAATATTGGCCCAATCGAAGACCAACGTTTCTTGAGCTAAATTTAGCTTTTTTT
TTAGAAAGTAATTTAGCTTGCACCCTGGTAAGTGCCACAGAGTGGCACCAATACATGGAA
CTCAAACATTTTTTGTCCCAGGTTTAGTGACGCGATGATGACAGCTTTAGTTGTCAAGCA
TGACAACCTTTTTGAATGGTAAGTTTTACTCTCTTTTTTAGATGACAACTTAGTTTTTAA
AAAGTCAGGCCAAAGTGCTTCGTGACACACGTGTGACACTTATCATTCAGTTTGTCTAAT
TCACATCTAGATATTTTTTAAGGATG~CACATCTAACCTCCCACAAGTATATAATGCATC
AATAAGAAAC~AA~A~AACTAGGACAAAAAAATAGACCACAAACAGAGTGAAAATCAGTT
TAGATATGACATAACTATGTCACATTTAGATGTGTCCTAGACAGACCCCTTATCATTTGG
GTTTACCTTTAGTAGCGGGCGTATGCCGCGGCATCAATAAATCATCATCATGTAATGTAT
ATAAGGCGTTTAGAGACTTGACGAAGGTTGTATCTACGATCCACGAAATATCTAATCTCC
AAAGGTAGGTGAATCAGACTGAAGCGAGCGACCACATCCTCACAATTCTGCCCCAATCCA
CACATTCGCCTCCAGCCCTCTCTCAAGCCACACAAACCGAGCCCGGAACCAATGGAACAA
AACAAGAAGCCGGCACCACCACCACGGTG
optionally modified by one or more base substitutions, insertions and/or deletions and/or by an extension at either or each end provided that the thus-modified sequence is capable of acting as a light-activatable promoter.
~ The invention also provides a DNA fragment comprising -- such a promoter operably linked to a heterologous gene encoding a protein. Additionally provided is a vector which comprises a heterologous gene encoding a protein under the control of a promoter as above such that the gene is capable of being expressed in a plant cell transformed with the vector. A suitable vector is one in which the promoter is fused directly to the 5'-end of the gene. The vector may :

,'.` . ::. . ' ~ ''. ' ~ ' . .
'',' . . ,: . ... ' ;, ,' .' ~,:: " ",' ,. ,:

WO91/050~ PCT/GB90/01493

2 ~ 6 6 ~ 5 2 further contain a region which enables the gene and the promoter to be transferred to and stably integrated in a plant cell genome. The vector is generally a plasmid.
Plant cells can be transformed wi~h such a vector.
The invention therefore furt~er provides plant cells which harbo~r a promoter as above operably linked to a heterologous gene encoding a protein. Transgenic plants may be regenerated from such plant cells. A transgenic plant can be obtained which harbours in its cells a promoter as above operably linked to a heterologous gene encoding a protein. Seed may be obtained from the transgenic plants.
The invention further provides a method of producing a desired protein in a plant cell, which method comprises:
(i) transforming a plant cell with a vector according to the invention, the protein encoded by the gene under the control of the said promoter being the desired . .
protein; and i? ( ii ) culturing the transformed plant cell under conditions of light which allow expression of the protein.
The invention additionally provides a method of producing a transgenic plant capable of produc.ng a desired protein, which method comprises:
~ i) transforming a plant cell with a vector according to the invention, the protein encoded by the gene under the control of the said promoter being the desired protein; and (ii) regenerating plants from the transformed cells.
~' '.

: .
; ' , .. . ~ , , ,: , .
- . ,: : , , , . : . . . .

WO91/050~S4 PCl/GB90/01493 .
. 206~6')2 :
~ ~ 4 ~

The desired proteins can be isolated from the transformed plant cells obtained by the first method and from the plants cbtained by the second method.
~ he present promoter is composed of the sequence upstream of the wheat FBPase gene from base -934 to base -54, base 1 being A of the ATG translational start codon for FBPase. The promoter may be obtained by preparing a genomic library of wheat DNA, screening the library for the FBPase gene and digesting the sequence upstream of the wheat FBPase gene with appropriate restriction enzymes. There is a ClaI
restriction site at base -934 and a HhaI restriction site at base -54.
Several plasmid vectors have been prepared which contain an upstream sequence of the wheat FBPase gene comprising the promoter sequence from base -934 to base -54.
These vectors include pl.8ES. E. coli MC 1022 harbouring pl.8ES was deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on 25 August 1989 under accession number NCIMB 401B4. The promoter may be released by ClaI/HhaI digestion of pl.8ES.
The promoter sequence may be modified by one or more base substitutions, insertions and/or deletions and/or by an extension at either or both ends. ~owever, the modified promoter sequence must still be capable of acting as a light-activatable promoter. A shortened promoter sequence from base-497 to base -54 of the upstream sequence of the wheat FBPase gene has been found not be sufficient to direct ~ .
,~,......................................................................... .
, ~: ~ 5 ~ 20`6~6~2 expression of a protein at satisfactory levels. Typically there is a degree of homology of at least 60~ between a modified sequence and the unmodified natural sequence from base -934 to base -54 upstream of the wheat FBPase gene.
The degree of homology may be at least 75~, at lea~t B5~ or at least 9S%.
A longer promoter sequence may be provided which extends upstream of base -934, for example to another restriction site. An extension upstream of base -934 typically comprises the natural FBPase sequence upstream of base -934. There is an Eco~I site at base -1726 of the _.
upstream sequence of the FBPase gene. A suitable extended promoter therefore has the sequence:

. . .. .

:

. . . ........................ : ., . . ~ -.: - . .: . .,:: . : , . . :

2~66~

GAATTCTAAGGATGGGCATGGGAGGGGGTGGGGTTTCAACCTGAGGATTTTTTCCAACCT
AAATACAGACTATGCAAACTACCTATTGTGTTTTATTCAAAAATACATCCCTTGCCCAAA
ACGAGGTAGGGCAACACCTATAGATGGCTATGGAAGAAGTTATGGAGTATCATAATATAT
GTTTCATCATATCCTTCCATATGTTATCATGATAACTTTAAAGTCCTGAAATTTGCGATA
TGCACTTGAAGCTCCGCTGTCATTCCCATGGCTTAAAAGTCACTGATTGGAGAGCATGTT
GTGTTTTTGCCCGTAGATCCATTGGCTTTAAGGTTTGATAGGTCATCGCCCTATGCTTTA
ACCTATCATGACAATAGTGGCAACAAATGCGGAAATCCAACTCGGTGCCCAGGCTCATCT
GCTCTCGGTCAGAAAAAAAATCAAAACAAATACTAGAAAAATACAAACCCCGATTTGTCT
TTTTTGCCGAGAGCTACTCAGATGTCCAAATGAGTTGAACTTTAGAACGGACCTACGTAT
CGAATTATCTACCACACATTTTTTTTTAATTTTTCTAGTATTTGTTATGATTTTTTTGTC
AGTGCACCTAAGCCCGGGAGCAGAAACGCCGCGTCCCAACAAATGCTAATGTTACGTTTG
ATTTGGTAAATGGTTCTCTTTGTGTTGTGTATCTTTTGGTTGTATTAGAAATCTTTGTGG
TCCATATGTGCATAATTTGTTCAATAAATCAATAATGTCAGATCGTCCTAAAATAAACTT
GAGAAGAAATTCATCGATAGGTTCGACAGAAGCTGCCACGTACCTATGAAACTCAATTGA
TTATTATATCCATATTATTGAAGTTTATTTTTGTAGAATGTTATTCAATTCCAGAAGTTG
TAAGTTCCGTAAGACCTGTAATATTGGCCCAATCGAAGACCCAAGTI'TCTTGAGCTAAAT
TTAGCTTTTTTTTTAGAAAGTAATTTAGCTTGCACCCTGGTAAGTGCCACACGAGTGGCA
CCAATACATGGCAACTCCAAACATTTTTTGTCCCAGGTTTAGTGACGCGATGATGACAGC
TTTAGTTGTCAAGCATGACAACCTTTTTGAATGGTAAGTTTTACTCTCTTTTTTGAGTTT
TTTAGATGACAACTTAGTTTTTAAAAAGTCAGGCCAAAGTGCTTCGTGACACACGTGTGA
CACTTATCATTCAGTTTGTCTAATTCACATCTAGATATTTTTTAAGGATGTCACATCTAA
CCTCCCACAAGTATATAATGCATCAATAAGAAACA~AAAAA~CTAGGACAAAAAAATAGA
CCACAAACAGAGTGAAAATCAGTTTAGATATGACATAACTATGTCACATTTAGATGTGTC
CTAGACAGACCCCTTATCATTTGGGTTTACCTTTAGTAGCGGGCGTATGCCGCGGCATCA
ATAAATCATCATGTAATGTATATAAGGCGTTTTAGAGACTTGACGAAGGTTGTATCTACG
ATCCACGAAATATCTAATCTCCAAAGGTAGGTGAATCAGACTGAAGCGAGCGACCACATC
CTCACAATTCTGCCCCCAATCCACACATTCGCCTCCAGCCCTCTCTCAAGCCACACAAAC
CGCAGCCCGGAACCAATGGAACAAAACAAGAAGCCGGCACCACCACCACGGTGC.

. .

, ... . . .

. .

W O 91/05054 PC~r/G B90/01493 ;;' .. ?~g6~2 - 7 ~
This longer sequence may be obtained from a genomic library of wheat DNA as above or by digesting pl.8ES with EcoRI and HhaI. The longer sequence may also be mcdified by one or more base sub ~tutions, insertions and/or deletions and/or by an extension at either or both ends. Again, such a modified se~uence must be capable of acting as a light-activatable promoter. There may be a degree of homology of at least 60~, for example at least 75%, at least 85~ or at least 95%, between the modified sequence and the unmodified natural ~equence from base -1726 to base -54 upstream of the wheat FBPase gene.
A modified promoter sequence may be obtained by introducing cha~ into the natural promoter sequence.
This may be achieved by any appropriate technique, including restriction of the natural sequence with an endonuclease, insertion of linkers, use of an exonuclease and/or a polymerase and site-directed mutagenesis. A shorter DNA
sequence therefore may be obtained by removing nucleotides from the 5'-terminus or the 3'-terminus of the natural promoter sequence, for example using an exonuclease such as BAL 31.
Whether a modified sequence is capable of acting as a light-activatable promoter may be readily ascertained. The modified sequence is placed upstream of a protein coding sequence, such as the bacterial reporter gene ~-glucuronidase as in the Example. Tobacco leaf discs can then be transformed. The protein expressed when the ..
. .

~.
:

:, .
, , . , . . . . . ~
:, ..
~ - : . ~, ., . .

WO91/05054 PCT/G~90/01493 . .
6~ 2 - 8 -transformed cells are exposed to light is then assayed, in the case of ~-glucuronidase as described in the Example.
The promoter may be operably linked to a heterologous gene encoding a protein. ~he heterologous gene may encode any protein it is desired to express. ~y "heterologous" is that the gene is not naturally operably linked to the promoter. The gene does not therefore encode wheat F~Pase.
The protein may comprise a transit peptide sequence at its N-terminus.
The promoter is typically used to control the expression of genes in photosynthetic tissues. The protein whose expression is controlled by the promoter may be a protein encoded by a herbicide-resistance gene or a protein conferring biological control of pests or pathogens. The protein ma~ therefore be an insecticidal protein, such as B.
thurinqiensis toxin, to give resistance to leaf-eating insects. Other uses to which the promoter may be put are the production of viral coat proteins to protect against viral infection, the production of high value proteins such as pharmaceuticals and the production of proteins to alter taste or nutritive value of forage grasses, etc.
~ he promoter sequence may be fused directly to a -; heterologous ~ene or via a linker. The linker sequence may comprise an intron. Excluding the length of any intron sequence, the linker may be composed of up to ~5 bases, for example up to 30 or up to 15 bases. We have found that no protein was expressed, however, when a gene en-oding .

:
:' ~

.: : ., . . . . .. .. . . . : . . . . .
.: . . . .
.

. ~ ' , . " ' . . ' :

W091/OS0~4 PCT/GB90/0l493 2~66652 ~-glucuronidase was fused to the promoter via the sequence from base -53 to base 129 of the wheat FBPase gene.
DNA fragments and vectors can be prepared ir which the promoter is operably linked to a heterologous gene. The fragm~nts and vectors may be single or double stranded.
Plant cells can be transformed by way of such fragment directly or by way of such a vector. The vector incorporates the heterologou~ gene under the control of the promoter. The vector contains regulatory elements capable of enabling the gene to be expressed in a plant cell transformed with the vector. Such regulatory elements include, besides the promoter, translational initiation and/or termination sequences. The vector typically contains too a region which enables the chimaeric gene and associated regulatory control elements to be transferred to and stably integrated in the plant cell genome.
The vector is therefore typically provided with transcriptional regulatory sequences and/or, if not present at the 3'-end of the coding sequence of the gene, a stop codon. A DNA fragment may therefore also incorporate a :
terminator sequence and other sequences which are capable of -enabling the gene to be expressed in plant cells. An enhancer or other element able to increase or decrease levels of expression obtained in particular parts of a plant or under certain conditions may be provided in the DNA
fragment and/or vector.
Transformed cells are selected by growth in an ~

` ' ~.

`.

-: : : ., .. - ~ ,. ................................................ .
- : ,. - . , : , . .

20666~2 - lO-appropriate medium. Plant tissue can therefore be obtained comprising a plant cell which harbours the heterologous gene under the control of the promoter , for example in the plant cell genome. The gene is therefore expressible in the plant cell. Plants can then be regenerated which include the heterologous gene and the promoter in their cells, for example integrated in the plant cell genome, such that the gene can be expressed. The regenerated plants can be reproduced and, for example, seed obtained.
A preferred way of transforming a plant cell is to use Aqrobacterium tumefaciens containing a vector comprising the promoter operably linked to the heterologous gene. A
hybrid plasmid vector may therefore be employed which comprises:
~ aj the heterologous gene under the control of the promoter and other regulatory elements capable of ~ enabling the gene to be expressed when integrated in the ; genome of a plant cell;
~ (b) at least one DNA sequence which delineates the ',~A, DNA to be integrated into the plant genome; and ~ c) a DNA sequence which enables this DNA to be transferred to the plant genome.
` Typically the DNA to be integrated into the plant cell genome is delineated by the T-DNA border sequences of a Ti-plasmid. If only one border sequence is present, it is `~ preferably the right border sequence The DNA sequence which enables the DNA to be transferred to the plant cell . :

.

~ : - . . ~. . , : , . . .

W O 91/05054 PC~r/G B90/01493 i `,`
20~6~`~2 genome is generally the virulence (vir) region of a Ti-plasmid.
The heterologous gene and its transcriptional and translational control elements, including the promoter, can therefore be provided between the T-DNA borders of a Ti-plasmid. The plasmid may be a disarmed Ti-plasmid f rom which the genes for tumorigenicity have been deleted. The gene and its transcriptional and control elements, including the promoter, can, however, be provided between T-DNA
borders in a binary vector in trans with a Ti~plasmid with a vir region. Such a binary vector therefore comprises:
(a) the heterologous gene under the control of the promoter and other regulatory elements capable of enabling the gene to be expressed when integrated in the genome of a plant cell; and `
~ b) at least one DNA sequence which delineates the DNA to be integrated into the plant genome.
Agrobacterium tumefaciens, therefore, containing a hybrid plasmid vector or a binary vector 1n trans with a ., Ti-plasmid possessing a v-r region can be used to transform plant cells. Tissue explants such as stems or leaf discs may be inoculated with the bacterium. Alternatively, the bacterium may be co-cultured with regenerating plant , protoplasts. Plant protoplasts may also be transformed by direct introduction of DNA fragments which encode the heterologous gene and in which the promoter and appropriate other transcriptionzl and translational control elements are ..
,:, : : . : ~ :: : , , : :, : : : . : ;

WO 91/05054 PCr/GB90/01493 2~652 present or of a vector incorporating such a fragment.
Direct introduction may be achieved using electrop~ration or polyethylene glycol.
Plant cells from monocotyledonous or dicotyledonous plants can be transformed according to the present invention. Monocotyledonous species include barley, wheat, maize and rice. Dicotyledonous species include tobacco, tomato, sunflower, petunia, cotton, sugarbeet, potato, lettuce, melon, soybean, canola trapeseed) and poplars.
Tissue cultures of transformed plant cel's are propagated to - regenerate differentiated transformed whole plants. The transformed plant cells may be cultured on a suitable medium, preferably a selectable growth medium. Plants may be regenerated from the resulting callus. Transgenic plants are thereby obtained whose cells harbour the promoter operably linked to the heterologous gene, for example integrated in their genome. The gene is consequently expressible in the cells. Seed from the reqenerated plants can be collected for future use.
Expression of the protein encoded by the gene linked . to the promoter is determined by the presence or absence of light. Expression occurs when light is present. If desired, therefore, expression of protein can be controlled ; by artificially increasing or decreasing the length of time for which plants or plant tissue cells are exposed to light, for example in a greenhouse or laboratory.
The following Examples illustrate the lnvention. In '~` ' , ~.

W09t~05054 PCT/GB90/01493 ~ 13 - 2 ~ 6 ~ 6 ~ 2 the accompanying drawings:
Figure 1 is a restriction map of F~Pase genomic . recombinant lambda 6aF1 showing the fragments subcloned for promoter construct preparation and the ~xtent of nucleotide sequencing;
Figure 2 shows the F8Pase gene structure;
Figure 3 shows the F8Pase upstream sequences with restriction enzyme sites underlined;
Figure 4 shows the construction of plasmid pBIXS, with ~ I denoting F~Pase upstr~am sequences, ~a~
denoting FBPase coding sequence, C~~~ denoting ~-glucuronidase coding sequence and I I denoting nopaline synthase terminator sequence;
Figure 5 shows the construction of plasmid pBIES;
. Figure 6 shows the construction of plasmid pBIEB;
.~ Figure 7 shows the construction of plasmid pBIHH;
Figure 8 shows the contruction of plasmids pBICH and ; pBIXH, :~ Figure 9 shows the F8Pase promoter constructs .;
pBIES:ES, pBIXS:XS, pBIHH:HH, pBICH:CH and pBIXH:XH;

Figure 10 shows the sequences at the BamHI and SmaI

; sites of pBI201.1 and pBI201.2 and the sequences of . construct junctians; and Figure 11 shows the levels of ~-glucuronidase -, activity in transformed plants, the level for untransformed . plants ~eing 0.014.
, .
:` ~

-,, :
~.

:

, . . . : . . :
.

W O 91/05054 PC~r/G B90/01493 ~0~6~2 14 -1. Isolation cf a FBPase Gene The strategy employed to isolate the wheat F~Pase promoter involved first constructing a genomic library of wheat DNA and then screening of the library using a cDNA
probe for FsPase.
High molecular weight DNA was isolated from dark grown shoots of Triticum aestivum cv Chinese Spring (Lazarus _ al, Plant Mol. ~iol 5, 8-24, 1985~. Conditions for partial digestion with Sau3A were established. DNA
fragments of 18-25 Kb were purified by size fractionation on sucrose density gradients. Lambda Charon 35 (Loenen and Blattner, Gene 26, 171-179, 1983) vector DNA was prepared by digestion with ~amHI and purification on sucrose density gradients. Vector DNA ~1.5 ~g) and wheat DNA (3.5 ~q) were ligated at high concentration ~500 ng/~l) using T4 DNA
ligase and subsequently packaged ln vitro using c~mmercially available extracts ~Stratagene).
About 2.6 x 106 recombinants were plated onto the host E. coli R803 and DNA lifts from the plaques taken onto nitrocellulose filters. The wheat FBPase cDNA (Raines et al, 1988) was random primer labelled using 3 2 PdATP and used to probe the library lifts. Positively hybridizing plaques were purified to homogeneity by several rounds of screening and then DNA from these positive pha?~ was pur~fied for further analysis.

~ .

. :, -: ' , , ' ' ' ~' . .: . . ' . :' .:

WC) 91/05054 PCr/GB9OtO1493 `` - 15 _ 2~6~32 2. Characterization of the FBPase Gene A restriction map ~as made of the 14Kb insert DNA of the positive phage 6aFl (Fig. 1) and the position and orientation of the FBPase gene determined by hybridization studies. DNA fragments covering this region were subcloned into the plasmid vector pUBS1, which is a pUCl9 derivative containing the polylinker region of the Bluescript plasmid of Stratagene (Raines et al, 198B). Overlapping sequence was obtained from these clones by exonuclease III digestion and double-stranded dideoxy nucleotide sequence analysis.
Data was assembled and analysed using the Staden packages.
The extent of the sequence determined is indicated on Fig.

.; 1.
~ DNA sequence comparisons between t~e Fspase gene and ,, the cDNA probe used to isolate it revealed no base differences which suggested that the gene copy isolated represents the active progenitor of the cloned mRNA. The FBPase gene structure revea.ed by these comparisons is shown in Fig. 2.
...

~, .

3. F~Pase Upstream Sequences The regulatory sequences upstream of the FBPase gene, .i including all of those used in the constructs described below, are given in Fig. 3. This comprises 1726 bp 5' to the translation initiation codon ATG and 194 bp of protein `~ coding sequence. Restriction enzyme sites used during . :~

.~ .
. 7 ' . ~. ,~ ' ' ' ' ' '"' ' ' ~ " " '. ''". ' . ' ' ' . ' ' " ''' ', '~ ', ': . ' ' ' " ' ' ' WOgl/05054 PCT~GB90/0l493 `'`2~6~2 l',,~, ~

subsequent cloning procedures are indicated and underlined.
It was proposed that these sequence would contain all of the promoter and other regulatory elements necessary to direct correct expression of protein coding sequences placed downs_ream under their control.
In order to test this proposal and assess the usefulness of the FBPase promoter in the context of plant transformation a series of constructs were prepared. In each case part of the FBPase upstream region was placed in front of the bacterial reporter gene ~-glucuronidase and the nopaline synthase terminator sequences. These expression cassettes were then transferred to a suitable vector for transformation into Nicotiana tabacum. ~his allowed expression, controlled by the FBPase promoter, to be detected by an enzyme assay for ~-glucuronidase activity using a fluorogenic substrate in tissue extracts from transformed plants.
~' :``
(a) Construction of the plasmid pBIXS containing 49? bp of sequence from 5' of the FBPase translation initia lon codon and 44 amino acids of FBPase coding sequence in a translational fusion to ~-glucuronidase (Fig.

4) A 0.6 Kb XbaI-SalI fragment of the FBPase gene (these sites are shown in Fig. 3) was subcloned into the plasmid vector pUBS1 to form the plasmid pO.6XS. pO.6XS was linearised using SalI and the site filled in using the ,, -.~ . . .. . . , : , . , : . : . , - :

~;~. r - 17 - 21~66 ~a 2 Klenow fragment of E. coli DNA polymerase I. The insert was then removed by digestion with X' I and the resulting fragmen_ subcloned into SmaI-Xba~ digested pBI201.1 ~Jefferson, Plant. Mol. Biol. Reporter 5, 3~7-405, 1987).
Plasmid pBI201.1 is a promoterless ~-glucuronidase cassette vector. Ligation resulted in the formation of pBIXS. The junction of FBPase sequences was checked by nucleotide sequencing (Fig. 10).

(b) Construction of the plas~id psIES containinq 1726 bp of sequence from 5' of the FBPase translational initiation codon and 44 amino acids of coding sequence in a translational fusion to ~-glucuronidase (Fig. 5) A 1.8 Rb EcoRI-SalI fragment of the FBPase gene (Fig.
3) was subcloned into the plasmid vector pUBSl to form the plasmid pl.8ES.pl.8ES was linearised using SalI and the site filled in using the ~lenow enzyme before digestion with EcoRI This FB~ase gene fragment was then reinserted into : ., SmaI-EcoRI cut pUBS1 vector. The resulting plasmid pl.BEb was digested with BamHI and SalI and the fragment ligated into ~amHI-SalI cut pBI201.2 (Jefferson, 1987) to create the construct pBIES. The sequence of t.e fusion junction is shown in Fig. 10.

.
.,.

:
',,'' ' '.

,, . - :
.
- . - .: .

WO91/0~0~4 PCT/CB90/01493 2 0 ~ ~ ~5 2 - 18 -(c) Construction of the plasmid psIEB, a transcriptional fusion to the ~-qlucuronidase codinq sequence of 1726 bp of Fapase promoter sequence (Fig. 6) This construct was designed to provide additional restriction enzyme sites to allow future modifications to be made to the promoter sequences. The plasmid pl.8ES was digested with BamHI and SalI and the FBPase fragment released purified by agarose gel electrophoresis. This fragment was then digested with HhaI and the overhang removed by digestion with T4 DNA polymerase. Following EcoRI digestion the fragment was ligated into SmaI-EcoRI cut pUBSl. The resulting plasmid pl.8EH was digested with ~pnI
and the site blunted using T4 DNA polymerase, followed by digestion with BamHI. The vector pBI201.1 was digested with SalI and the site filled in using the Rlenow enzyme before ; cutting with BamHI. Vector and FBPase promoter fragment were then ligated together to create the plasmid p~IEB. The ~ sequence of the fusion junction is shown in Fig. lO.
<
(d) Construction of the plasmid pBIHH containing 1726 bp of F3Pase promoter sequence upstream of ; ~-qlucuronidase ~Fiq. 7) pl.8Eb was digested with SalI and BamHI and the FBPase promoter fragment purified by agarose gel electrophoresis. The fragment was then digested with HhaI
and the overhang blunted using T4 DNA polymerase before ~indIII digestion. The FBPase pro=oter was then lig~ted ,. .

.. . . . . .
-- : . - . . . .. . . , . :.. :
. ~ . .. . . . . .

,: , WO91/O~OS4 PCT/GB90/01493 ~ 19 - 2 ~ ~ ~ G ~ 2 into HindIII-SmaI cut pBI201.1 to give the construct pBIHH.
The sequence of the 3' promoter junction is shown in Fig . 10 and is identical to that in pBICH and pBIXH constructs described below.

(e) Construction of the plasmids pBICH and pBIXH
!

containinq 881 bp and 444 bp respectively of FBPase promoter sequence upstream of ~-glucuronidase (Fiq. 8) These constructs are based on pBIHH (described above) but contain less promoter sequence and have additional polylinker sites 5' to the FBPase sequence. psIHH and pBIEB
were both digested with ClaI and EcoRI and the vector portion of pBIEB ligated to the FBPase-~-glucuronidase fragment derived from pBIHH. This produced the construct pBICH. Digestion of pBICH with XbaI and ClaI followed by filling in with the Rlenow enzyme and religation created the plasmid pBIXH. E. coli MC 1022 harbouring pl~8ES was deposited at the National Collection of Industrial and :
Marine Bacteria, Aberdeen, GB on 25 August 1989 under accession number NCIMB 40183.
:
4. ~ransfer of FBPase promoter fusions into binarv vectors and introduction into Nicotiana The F8Pase promoter constructs that were obtained are . shown schematically in Figure 9. The FBPase promoter ~-glucuronidase expression cassettes were subcloned from their pUC19 derived vertors as EcoRI-HindIII (pBIXS, pBICH, ., .

-~" ' '' , ' ' ' ' ' ,.~ , ' ' ' , ' ' ' ' .

W O 91/05054 PC~r/~ B90/01493 20~66~2 psIxH) or EcoRI (p3IES, pBIEB, psIHH) fragments into the binary vector p~IN 19 ~Bevan, Nucl. Acids Res. I2, 8711-8721, 1984). These constructs were then mobilised from Escherichia coli MC1022 into Aqrobacterium tumefaciens LBA4404 as described ~Be~an, 1984). Leaf discs of Nicotiana tabacum var. Samsun were transformed as described (Horsch et al, Science 223, 496-498, 19~4) and selected on shooting medium containing 100 ~g/ml kanamycin.

5. ~-qlucuronidase assav of transformed plants The activity of the FBPase promoter in individual light-grown transformants was determined by measuring ~-glucuronidase activity in leaf extracts. Tissue extracts were prepared and analysed for fluorescence of the reaction . . .
product 4-methyl umbelliferone as described (Jefferson, 1987). Reactions were usually incubated at 37C for 4 hours with aliquots sampled at 60 min intervals. The protein concentration in each extract was measured to allow direct . ~.
comparisons to be made between them (using a Bio-Rad ~it).
The two translational fusions (pBIXS and pBIES) and one transcriptional fusion (pBIEB) yielded no plants with measurable ~-glucoronidase activity above that of untransformed controls. Between 5 and 10 plants containing each construct were regenerated and assayed.
Three of the transcriptional fusions, namely pBIHH, pBICH and pBIXH did give significant levels of glucuronid lse æctivity in transiorsled plants. The results ., .

. .

... . . . . . . . . . .
, ' ' ,. ' ; , . , ', ,.. - ~ ,., :.

WO9~/0~0~4 PCT/GB90/01493 `~"` 206~2 of these assays expressed in nmol 4-methyl umbelliferone produced/min/mg protein are shown in Fig. 11. Furthermore, even given the variation commonly observed between indlvidual transformed plants, there is a significant dro~
in a~ctivity when the length of upstream sequence is reduced to the 444 bp present in the construct pBIXH. Plasmids p~I~H and pBICH are therefore vectors according to the invention. The level of activity in untransformed plants was 0.014.

EXAMPLE 2: Liqht requlation of the FBPase promoter in transformed tobacco plants Seeds from the transformed tobacco plant "HH18" were plated on tissue culture medium for germination. HH18 was one of the four pBIHH tobacco transformants from Example 1 and, in particular, was plant 1 from Figure 11. These Fl seeds were a heterogeneous population representing all possihle genetic combinations, as more than one copy of the construct may have inserted into the genome. Due to the mixed nature of the Fl generation plants 6-8 seedlings given each treatment were assayed for ~-glucuronidase activity.
The average ~-glucuronidase activity of light-grown 8 day seedlings was 2.075 pmol 4-methyl umbelliferone formed/min/5~1 extract and for etiolated ~dark-grown) plants was 0.126. In the same experiment the value for untransformed tobacco was 0.025.
, .~ .

;

. ~ .

.

,. : . .
.: l . . . .

Claims (14)

1. A light-activatable promoter having the sequence:
optionally modified by one or more base substitutions, insertions and/or deletions and/or by an extension at either or each end provided that the thus-modified sequence is capable of acting as a light-activatable promoter.

2. A promoter according to claim 1, having the sequence:

optionally modified as defined in claim 1.

3. A DNA fragment comprising a promoter as claimed in claim 1 or 2 operably linked to a heterologous gene encoding a protein.

4. A vector which comprises a heterologous gene, encoding a protein, under the control of a promoter as claimed in claim 1 or 2, such that the gene is capable of being expressed in a plant cell transformed with the vector.

5. A vector according to claim 4, wherein the promoter is fused directly to the 5'-end of the said gene.

6. A vector according to claim 4 or 5, which further contains a region which enables the gene and the promoter to be transferred to and stably integrated in a plant cell genome.

7. A vector according to any one of claims 4 to 6, which is a plasmid.

a. A plant cell which has been transformed with a vector as claimed in any one of claims 4 to 7.

9. A plant cell which harbours a promoter as claimed in claim 1 or 2 operably linked to a heterologous gene encoding a protein.

10. A transgenic plant which has been regenerated from plant cells as claimed in claim 8 or 9.

11. A transgenic plant which harbours in its cells a promoter as claimed in claim 1 or 2 operably linked to a heterologous gene encoding a protein.

12. Seed obtained from a transgenic plant as claimed in claim 10 or 11.

13. A method of producing a desired protein in a plant cell, which method comprises:
(i) transforming a plant cell with a vector as claimed in any one of claims 4 to 7, the protein encoded by the gene under the control of the said promoter being the desired protein; and (ii) culturing the transformed plant cell under conditions of light which allow expression of the protein.

14. A method of producing a transgenic plant capable of producing a desired protein, which method comprises:
(i) transforming a plant cell with a vector as claimed in any one of claims 4 to 7, the protein encoded by the gene under the control of the said promoter being the desired protein; and (ii) regenerating plants from the transformed cells.