CA2054709A1

CA2054709A1 - Non-melanocytic, eucaryotic cell constitutively expressing biologically active human tyrosinase and use thereof

Info

Publication number: CA2054709A1
Application number: CA002054709A
Authority: CA
Inventors: Brigitte Bouchard; Alan N. Houghton
Original assignee: Individual
Current assignee: Memorial Sloan Kettering Cancer Center
Priority date: 1989-04-26
Filing date: 1990-04-26
Publication date: 1990-10-27
Also published as: EP0507772A1; EP0507772A4; WO1990012869A1; JPH04505249A

Abstract

This invention provides a non-melanocytic eucaryotic cell constitutively expressing biologically active human tyrosinase. The present invention also provides methods of producing biologically active human tyrosinase. Additionally, the invention provides a non-melanocytic eucaryotic cell which constitutively expresses biologically active human tyrosinase which in turn catalyzes the production of melanin. The melanin so produced may then be recovered.

Description

WO 90/12869 PCI`/US90/02288 2 0 ~
NON-ME~ANOCYTIC, 2'aCARYOTIC CE~;~ C!ON8'1!~ 1!2JTI'VE~Y E~ E88ING
EIO~OGIC~Y_ACTIVB ~UMAN TYR08IN~8~ AND U8E ~EREOF
Backq~ound of the Invention .
Throughout this application, various publications are referenced by Arabic Numerals within parentheses. Full citations for these publications may be found at the end of the specifir-ation immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date o~ the invention described ancl claimed herein. -Melanocytes and cells of melanocyte lineage are ~-distinguished by their capacity to synthesize the pigment melanin. Melanin production is primarily regulated by the enzyme tyrosinase tmonophenol, 3, 4-dihydroxyphenylalanine:
oxygen oxidoreductase, EC 1.14.18.1).
:
Nelanin synthesis occurs principally in melanosomes which `;
are specialized organelles. Thus, melanin synthesis is generally restricted to melanosome-containing melanocytic cells.
.
` Thi~ application describes ~he isolation of a full leng~h of cDNA clone encoding human tyrosinase. Isolation is achiev2d by using a probe whose sequence is homologous to the Pmel 34 cD~A ~equence described by Kwon et al. (1, 35, 37).
~oreover, transfection and expression of this new human tyrosinase cDNA clone in mouse fibroblasts induced pigmentation in a cell type which normally does not synthesize melanin.

,, ..

:.. : .: ,, . . - . . : .
: ~ : : : : . ~:: . - , . , .. . - . . . . . . . .. .. ..

.. . . .,.: .
~; '''' . ' : ' WO90~12869 PCT/US90/02288 Levels ~yroslnase activity in transfected fibroblasts were equivalent to tyrosina~e levels in highly pigmented human melanoma cell lines. These tyrosinase-positive fibroblast c~ll lines demonstrate that melanin synthesis can take place in cells that are not melansome-containing. As a result, we have a tool in which to study the regulation, transport and proce~sing of tyrosinase synthesis.

"~

:
i '~

~3~ 2~7U~ ~ `

SUMMARYQ F THE INVENTI~2~

This invention provides a non-melanocytic eucaryotic cell constitutively expressing biologically active human tyrosinase. This invention also provides such a cell which expresses biologically active human tyrosinase under ~: :
conditions such that the cell produces melanin.
': .
Still further, this invention provides a ~ethod of producing biologically active human tyrosinase and melanin.

~, ~'-..'.

~ .

' :

~-'.

'' ~;:~' ' '': ,. :: - ~ , ., ,, :- :

'', ' ' : , .. ..

~ 4-BRIEE DESCRIPTION OF THE FIG'~RES

Eioure 1. Nucleotide and predicated amino acid sequence of BBTY-l cDNA. The nucleotide sequence is numbered in the 5' 5 to 3' direction. ResiAues of a predicted signal peptide are indicated by negative numbers, and a cleavage site by a vertical arrow. Termination site (TAA) and polyadenylation ; signal (869 to 875) are underlined. Potential glycosylation sites are designated by dashed lines.
Fiqure 2. Northern blot analysis of poly (A')-selected RNA
(4 ~g/lane) from two pigmented melanoma cell lines that express tyrosinase and the B cell lymphoma cell line Daudi.
The blot was hybridized with the 32P-labeled insert of pBBTY-15 1. L~nes: l) SX-MEL-23 melanoma; 2) SX-M~L-l9 melanoma;
and 3) Daudi.

Fioure 3. Cell pellets o~ h929 cells transfected with sense BBTY-l (LpcTYR cell line), anti-sense BBTY-l (LpcTYW cell line), or pUC 18 plasmid (LpC cell line). LpcTYR and LpcTYW
cell lines were transfected with BBTY-l inserted sense or antisense into the expression vector pcEXV3. LpcTYR-l and ~;~
LpcTYR-2 are subclones of LpcTYR. l) LpC cnll pellet (non-pigmented); 2) LpcTYW (non-pigmented); 3) LpcTYR-l (pigmented~; and 4) LpcTYR-2 (pigmented).

Fi~ure 4. LpcTYR cells in culture. A nest of cells in the middle of the field contains large, pigmented cytoplas~ic granules. Mag~ification x320.
~gure S. Transmission election micrographs of segments of LpcTYR cells. A) Cytoplasmic membrane-bound vesicles contain}ng lectron denae meterial are lndioated by arrows.

: ~ , . . . .
, , .. . .. . . .
: .. . ., ..

~-W~90/12869 PCr/US90/02~88 -~- 2 ~ 'J

One scale bar represent~ 1 ~m. Magnification x 8,400. B) Higher magnification field of a cytoplas~ic membrane-bound vesicle containing pigment. One scale bar r~presents 1 ~m.
Magnification x 16,800.
Fiqure 6. Expression of tyrosina~e actiYity in cell extracts from: 1) SK-MEL 19 melanoma; 2~ Lpc cells : (transfected with pUC 18 plasmid); 3) LpcTYR-1 cells (transf~cted with BBTY-1 sense construct~ 4~ LpcTYR-2 cells (transfected with ~BTY-l sense construct~; and 5) LpcTYW
cells (transfected with a BBTY 1 antisense const~uct)~
Tyrosine hydroxylase activity is expressed as (cpm 3H20/min/mg protein) [! -~~ lbar~] or (cpm 3H2D/min/5xlO6 cells) t~ \\lbars].
Fioure 7. Immunoprecipitation of lysates from 35S-methionine meta~olically labeled SR-MEL l9 melanoma cells, LpcTYR-2 cells expressing BBTY-1, and L929 cells. ~anes: l) mAb TA99; 2) mAb 2G10; 3) control rabb$t sera; and 4) rabbit anti-tyrosinase antisera. A 75 kD band i5 detected in SK-~EL-19 (with TA99, 2G10 and anti-tyrosinase) and LpcTYR-2 cells (with anti-tyrosinase). Molecular weight standards:
Myosin M chain (200 kD); phosphorylase (96 kD); bovine serum albumin (68 kD); and ovalbumin (43 kD).
Fi~wrç~. Indirect immunofluor~scenc~ assays for antigen ~xpr~sion by~ A) LpcTYR-2 cells expressing BBTY-1, and B) SK-NE~ 19 ~elanoma cells. mAb TA99 (anti-gp75) ~; mAb CF21 (anti-melano~omal antigen) ~; mAb H100~5R28 (anti H-2k) o;
~nd r~b AJ~ (anti=integrin; positive control) ~.

, ..

; ,: - , .

. -. :' ' ' , ' . ' ' ` -wo~oJ12869 PCT/US90/0228 ~ETAILEP ~ESÇ~IPTION OF THE INVENTION

The present invention provides a non-melanocytic eucaryotic cel,1 constitutively expressing biologically active human 5 tyrosinase.

As used herein "biologically active human tyrosinase~ means a polypeptide having (1) an amino acid sequence identical :
to, or substantially identical to, the amino acid sequence 10 o~ and (2) the biological activity of naturally occurring human tyrosin se.

Further, as used herein "non-melanocytic eucaryotic cell"
means eucaryotic cell characterized by the absence of lS melanoso~es, that is, the organelles associated with the ~ -production of the polymeric pigment melanin. On example of such a cell is a fibroblast.
. ' '.
In principle, any eucaryotic cell is useful in the practice 20 o~ the subject invention including without limitation, ma~malian cells such as human cells for example fibroblast cells, the cells or other animals such as ovine, porcine, , murine, bovine or avian cells, insect:cells, or yeast cells.
:
25 Useful non-melanocytic eucaryotic cells include eucaryotic cells in which DNA encoding biologically acti~e human tyrosina^~e i~ not naturally present and into which such DNA
has been int~oduced. ~ethods ~or introducing such DNA are :
well known to those s~illed in the art as are methods for 30 doing so under conditions such that the DNA will be expressed and biologically active human tyrosinase produced (43~.

',, ~

" :

, ~ ~

`; ' ` . . : :
: ~ , :~ ., w09~/12869 P~T/~S90/022~8 In one embodiment of the invention, the DNA encoding human tyrosinase is carried on an expression vector suitable for expression in the eucaryotic cell type involved. For example, for a mammalian cell, the expression vector may be a retrovirus; for an insect cell, the expression vector may be a baculovirus. Any nucleic acid encoding ~iolsgically active human tyrosinase may be used in this invention. One such DNA is DNA having the sequence shown in Figure 1 extending from nurleotide 58 to nucleotide 1593 (BBTY-1).

Methods for constructing expression vectors are well known in the art (43). Using such methods DNA encoding a biologically active human tyrosinase is inserted into a suitable expression vector under the control of appropriate regulator sequences. The resulting vectors ar then introduced into an appropriate eucaryotic cell, again using methods well known in the art (43) under suitable conditions as to obtain a non-melanocytic eucaryotic cell constitutively expressing biologieally active human tyrosinase. .

` For example, the non-melanocytic eucaryotic cell may be a mammalian cell such as a mouse or human fibroblast cell and may comprise a retroviral expression vector, for example, an - 25 expression vector which comprises an SV40 early region promoter and enhancer sequ~nces, an initiation codon immediately upstream o~ the DNA encoding human tyrosinase, and a termination signal immediately downstream of the DNA
; encoding human tyrosinase.
~ . Alternatively, ~he non-melanocytic eucaryotic cell may be an insect cell and ~ay co~prise a baculovirus expression veotor, for exa=ple, an xpres~ion ~ector whlch comprise~

, , .
.
.
:

w~so/l28~9 PCT~S90/02288 ~ ~3 8-DNA e~coding biologically active human tyrosinase under the expressional control of a polyhydrin promoter (44).

As yet another alternative, the non-melanocytic eucaryotic cell may be a yeast cell and may comprise an expression plasmid, for ~xample, an expression plasmid which comprises ..
DNA encoding biologically active human tyrosinase under the expressional control o~ a suitable promoter such as the alcohol dehydrogenase isoenzyme I (ADH I), the phosphoglycerol kinase (PGK) promoter, the repressible acid : phosphatase (PHU5) promoter and the ~ factor promoter (plus the signal sequence).

In a preferred embodiment of this invention the non-melanocytic eucaryotic cells which constitutively producesbiologically active human tyrosinase produces melanin.

This invention also provides a method for producing a biologically active human tyros:inase which comprises culturing the cells described hereinabove under conditions such that.the cells express the biologically active human tyrosinase and recovering the human t:yrosinase so expressed.
: , :
Conditions for culturing the cells and for recovering the ; 25 biologically active human tyrosinase are known in the art~:
and vary depending upon the nature of the eucaryotic cell, expression vector (if any) and the like.
~ ' : This invention also provides a method for producing a biologically active human tyrosinase which comprises culturing the cells described hereinabove under conditions such that the cells express the biologically active human tyrosinase and re=overing the human tyrosinase so expressed.

;~
. .

.. . .
~, . . , . : .
, . .,~ ~ :
:, :

WO90/12~69 PCT/US90/02288 ~0~7~9 : Additionally, the method of producing melanin which : comprises culturing eucaryotic cells under conditions such that the cells express biologically active human tyrosinase and the tyrosinase so expressed catalyzes the production of melanin, and then recovering the melanin so produced.

This invention is illustrated in the Experimental Details section which follows. This section is set forth to aid in an understanding of the invention but is not intended to, and should not be constxued to, limit in any way the invention as set forth in the claims which follow.

.' . ~ ' ~ ., ~.
~` ' ' ;-.

'J~
.~ .
., .

~:

.' .

', ' :. , ,, ~ ' .

' , : ' ' "

W090/12869 PCT/US90/0228~
~,~5~ o EXPE~IMENTAh~ aI~S

MATE~IALS AN~ METHODS

~ell Culture ~nd Cell ~ines.
Melanoma cell lines were established as previously described (2). TK L929 cells (mouse fibroblast) (3) were used for transfection experiments. Cell lines were maintained in Eagle's Minimum E~sential Medium supplemented with 2 mM
glutamine, O.lmM non-essential amino acids, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 10% fetal bovine serum (complete medium). Cells were passaged with trypsin (1 mg/ml and EDTA (0.2 mg/ml). All cultures were ohecked regularly for the presence o~ mycoplasma and contaminated cultures were discarded.

Ele~i;ro~LMi ~ell pellets were fixed in Karnofsky's fixative overnight, rinsed in PBS for 1 hour, then post--fixed for 1 hour in 1%
osmium tetroxide-PBS solution. Cell pellets were dehydrated in graded ethyl alcohol followed b~y propylene oxide, and embedded in Mar~glas-D.E.R. 732 epoxy resin (Dow Chemical Co., Midland, Michigan). For or:ientation, 1 ~m thic~
sections were s~ained with borate--buffered 1% toluidine blue. Thin sections were stained with uranyl acetate followed by lead ci~rate and examined with a Philips 410 ~S
electron microscope.

c~N~_~ibrary and 5creeninq.
A c~N~ library was constructed from 3 ~g of poly(A+) selected mRNA (4) prepared from the human melanotic melanoma cell line SK-MEL-l9 (2). Full length cDNA was synthesized, rendered blunt-ended using Rlenow enzyme, and tailed with :. ... ~ . , ~.,, - ~ ; .. . , . , .,: , .. .
. . ~ - . , , ... .

': '' : :
,~ .: . . . . . . .

WO90/12~69 PCT/US9OtO2288 EcoRI linXers (New England Biolabs, Inc., Beverly, MA) ~5).
The c~NA was then size-fractionated on Ultrogel Aca 34 (Pharmacia Fine Chemicals, Piscataway, NJ) (6). cDNA
molecules > aoo bp were used to ronstruct a library of 3 x 105 reco~binants in the lambda phage vector gtlO(7)~ For screening, a 50 base oligonucleotide probe (50-mer, shown - below) based on the 5' terminal coding region o~ the human tyrosinase Pmel 34 cDNA clone (1) was used.

lO ........... 10........ 20...... ~.30....... 40........ 50.
5'GTTCTTAGAGGAGACACAGGCTCTAGGGAAAATGGCCAGCGGAGGTCTGGA3' The oligonucleotide was synthesized on an Applied Biosystem DNA synthesizer, model 310 A (Applied Biosystems, Foster City, ~A). The probe was end-labeled with gamma 32P-AT~ and T4 polynucleotide kinase (4). Prehybridization and hybxidization were carried out at 48C for 4 hours and 18 hours, respectively, in 6x NET (1~: NET is 0.15M NaCl, 1 mM
` EDTA, and 15~M Tris-~Cl, pH 8), 0.1% SDS and 5x Denhardt's 1 20 solution (0.1% BSA, O.1% Ficol:L 400, 0.1~ polyvinyl-pyrolidone), and 100 ~g/ml of denatured sal~on sperm DNA.
Duplicate filter~ were washed in l5x NET, 0.1% SDS at room temperature, followed by stringent washes at 55 and 60C.
`~ The filters were then autoradiogra]phed for 4 hours at -70~.
DNA Sequen~in~-Plaque purified phage DNA was restricted with EcoRI and cDNA
A insert~ were subcloned into the plasmid vector pUC 18(~
Recombinant plasmids and deletion subclones subsequently obtained by digestion with exonuclease III/Mung Bean nuclease (3) were sequenced by the dideoxynurleotide chain termination method (10).

~ ~ .

. ~
' . .

.

. ~ . , - , ' Wo~0/12869 PCT/US90/~2288 ~?~ 12-Northern Blo~ AnalYsis.
Poly (A+)-mRNA (4 ~g) was fractioned on 1~ ~ormaldehyde denaturing agarose gels (4), trans~erred of Gene Screen Plu~
membranes (Dupont, New England Nuclear, ~oston, MA), and hybridized to a 32P-labeled cDNA probe. The filters were washed twice at room temperature in 2x SSC (lX SSC is 0.15M
NaCl, 0.015 M sodium citrate pH 7) and 1% SDS, then stringent washes were carried out at 55C in lX SSC, 1~ SDS, and at 65C in O.lX SSC, 1% SDS, for 15 minutes each.

Transfection ~neIiments.
The cDNA inserts were subcloned into the Eco~I site of the expression vector pcEXV-3, which allows expression of cDNA
under the control of SV40 early region promotor and enhancer sequences 511). E~pression plasmids containing cDNA inserts in opposite orientations (5'--~ 3' or 3'--> 5') were constructed. Sense and antisense oriented plasmids were designated pcTYR and pcTYW, respectively. L929 cells were cotransfected by the calcium phosphate precipitation technique (12) with the following combinations~
transfection with pUC 18, pSV2 ~.o plasmid, and high `:.
molecular weight carrier DN~ ~rom L929 cells; (2) trans~ection with pcTYR, pS~2 neo plasmid, and high :-:
molecular weight carrier DN~ from L929 cells; or (3) 2S transfection with pcTYR, pSV2 neo plasmid, and high molecular weight carrier DNA from L929 cells.
'.
Selection o~ transf~ctant-~ wa~ ~tarted on day 3 following transfection with 1 mg/ml of the antibiotic G418 (Sigma Chemical Co., St. Louis, ~0). Complet~ mediu~ with G418 was replaced every 3 days and colonies appaaring on days 10-14 ware isolated usin~ cloning rings and expanded. The mouse origin of transfected cell lines was confirmed by positive . ~
?

~ . . .. . , :
: :: -. .. - , - . - -. : :
; ~ :
,..
:, . - , . :; -, .:.

Woso/12869 PCT/US9~tO2288 ~ Q t, ~

anti-mouse Ig mixed hemadsorption assays using H-100-5R28, a monoclonal antibody directed against H-2Kk (mouse MHC
class I antigens) (13~, and lack of reactivity with mAb M3-68 (14) or AJ2 (15) which recognize virtually all human melanoma cells but no_ L929 cells.

Serolo~ical Reage~ts and Assays.
CF21 (IgG1) and TA99 (IgG2a) are mAb which have been previously described that recognize distinct antigens in human melanosomes (16). The monoclonal antibody 2G10 (IgG2a) recognizes a 75 kD intracellular glycoprotein of pigmented melanotic cells (17). mAb AJ2 (IgGl) recognizes the beta subunit of human VLA/integrin molecules (15, 18).
Rabbit anti-tyrosinase antiserum was raised by immunization with purified mouse tyrosinase (19). Tyrosinase was purified by DEAE ion exchange chromatography followed by sequential discontinuouspolyacrylamide gel electrophoresis.
Anti-mouse immunoglobulin hemadsorp~ion assays and indirect immunofluorescence studies were performed as described (2, 20).

Immunop~ecipitations.
Cells were labeled with 35S-methionine (ICN Radiochemicals, Irvine, CA) for 16 hours in methionine-free complete medium containing 2~ dialyzed FBS, and lysed in 50mM Tris, 5mM
EDTA, 0.5% NP40, lmM PNSF. The lysates were precleared twice by incubation with 5 ~g/ml of protein A Sepharose ' (Pharmacia Fine Chemicals) for 30 minutes at 4C.
Immunoprecipitations were performed by incubating the lysates w~th antibodies, followed by addition of protein A
sepharose. ~he immunoprecipitates were extensively washed and analyzed for molecular size by SDS/polyacrylamide gel electrophoresis (21) under reducing conditions.

'~' :' :
.

TYrosinase Ac~ivit~3~ss~X.s-Cells were solubilized in PBS, 1~ NP40, pH 6.8, and centri~uged to obtain clear supernatants. Tyrosine hydroxylase activity was assayed using a modification o~ the method described by Pomerantz (22). The reaction mixture contained 1 ~Ci/ml 3H-tyrosine (54.2 Ci~mMol) in PBS, 1~
NP40, 0.1 mM L-tyrosine, and 0.1 mM L-DOPA. The reaction was carried out at 37C for 1 hour, and terminated by addition of 0.2 ml of a charcoal suspension (100 mg/ml in 0.1 ~ citric acid). After 30 min on ice, the samples were centrifuged and an aliquot was counted in a Beck~an LS 9000 scintillation counter. All assays were performed in duplicate. Controls included 3H20 release measured in lysates from the human renal carcinoma cell line SK-RC-7 and reaction mixture in PBS, 1% NP40 alone. Specific tyrosinase activity was calculated as follows: [(3X20 release by test cell lysate)- ( ~H20 release by control reaction ~ixture in PBS)]. ~rotein concentrations were determined by the Bradford's dye binding method using the Protein Assay Kit (Bio-Rad Laboratories, Richmond, CA). For melanin assays, 3X106 cells were solubilized in n . 5 ml Protosol (NEN, DuPont, Boston, MA) and kept on :ice for 2 hours. An absorption baseline was established using Protosol, and absorption spectra for cell extract~ were determined between 320-450 n~ and compared against 2 melanin ~ontrol 100 ~g/ml, in Protosol.

~: .
.

. . -.

.. , ~ . .
., . ; . .:

,' ~ ' ' : ' ' : ~ :

.

W090/12~69 PCT/VS90/02288 -15- 2~5 a 7 ~E8~

Isolation and Sequencinq of the cDNA Clone BBTY-1.
cDNA slones were isolated from a lambda gtlO library derived from the plgmented human melanoma cell line SK-MEL-19 (see Materials and Methods). 105 recombinant cDNA clones were screened and four reactive clones were plaque purified. The four cDNA inserts were subcloned into the plasmid vector pUC
18 and clones were designated pBBTY-1, -2, -3, and -4. Two clones, pBBTY-1 and pBBTY-2, each containing cDNA inserts of 2 kb, ha~ restriction maps identical to each other and to that of Pmel 34 reported by Kwon et al. (1) (digested with Bgl II, Hpa II, Msp I, Nco I, Pvu II, and Taq I). The cDNA
inserts in clones pBBTY-3 and pBBTY-4 were 1.7 and 1.8 kb, respectively. The restriction map of pBBTY-3 was di~ferent from those of pBBTY-l and pBBTY-2 downstream of position 960 (a PvuII restriction site). pB~TY-l was subsequently saquenced and used for further experiments.

The nucleotide sequence of BBTY-1 (Fi~. 1) contained a single o~en reading frame of 1593 residues capable of encoding a 531 amino acid (aa) polypeptide with a derived molecular weight of 60.37 kD. A leader peptide of 19 aa was assigned to positions -19 through -1 (23). The processed core protei~ w~s predicted to have a molecular weight of 58.118 kD. Sev~n potential N-glycosylation signals (Asn-X-Ser/Thr) were predicted at position~ 69, 94, 144, 213, 273, 320, and 354. Based on a hydrophobicity plot according to ~he method o~ Kyte-Doolittle (24), a transmembrane region was predicted within a highly hydrophobic domain betw~en aa positions 460 and 480. There was a 318 base 3' non-coding region that contained an atypical polyadenylation signal AATTAAA (25)o The nucleotide and aa sequence o~ BBTY-1 were ,, - . , .

.. . . . ..
.
., ~: .

wo9o/l2869 PCT/US90/02288 ~ 16-nearly identical to the sequence of the Pmel 34 cDNA (1).
However, BBTY-l contained an additional upstream 5' sequence, including a potential initiation codon not present : in ~mel 34 (bases 1 to 7). There were also differences in the predicted amino acid sequence of BBTY-l at posi ions 25-28, 162, 291, 356-361, 38s, 478 and 503-512. The predicted molecular size o~ khe pro~essed protein coded by BBTY-1 was smaller than the processed protein predicted from Pmel 34 (62.16 kD). Based on this sequence analysis, BBTY-l was a candidate for a full length cDNA clone encompassing a complete coding region.

Transcri~tion of BBTY-1 in Human Melanoma Cells.

BBTY-1 cDNA was used to det~ct ~RN~ transcripts in Northern blot analysi~ of a panel of melanoma cell lines, including . those known to expres~ tyrosinas~ activity as well as tyrosinase-negative melanomas. The major transcript detected was 2.4 kb, but a weaker signal was seen at 4.7 kb (Figure 2). Three groups of melanomas were observed based on Northe~n blot analysis using poly (A~)-selected RNA: (a) mRNA was detected in 9 pigmented melanomas that express tyrosinase activity; (b) no mRNA was detected in 5 non-pigmented, tyrosinase-negative melanomas; (c) mRNA was detected in 3 non-pigmented tyro~inase-negative melanomas.
There was little or no d$f~erence in the intensity of mRNA
signal detected group; (c) versus (a). No transcript was detected in ~RNA ~rom the B cell ly~phoma cell line Daudi or from tha T cell leukemia cell line HUT-78.

..

., - . . ................................ .
: ' ., : ,- , . :' : , . .

woso~l2~69 PCT/US~/0~288 7 f~ ~
Melanin Synth~sis inL~929 ells Transfected with ~BT~

BBTY-1 was transfected into L929 mouse fibroblasts using the expression vector pcEXV-3 (11~. L929 cells transfected with pcTYR (sense orientation) were designated LpcTYR. Control cells transfected with pcTYW (antisense orientation) were designated LpcTYW, and with the plasmid pUC 18 were designated LpC. LpcTYR cells contained pigment, while no .-pigmentation was detected in LpcTYW, LpC or untransfected L929 cells. As shown in Fig. 3, the cell pellets of LpcTYR
- clones were dark brown in contrast to the non-pigmented pellets of LpcTYW and LpC cultures.

Cell pellets o~ LpcTYR were more deeply pigmented when cultures were harvested at confluency. LpcTYR clones have continued to produce pigment for more than 5 months in continuous culture. In order to confirm that the pigment in LpcTYR has the characteristics of melanin, absorption spectra of cell extracts from LpcTYR and control L929 cells were compared to those of extracts of the pigmented melanoma cell line 5X-MEL-l9 and purified m~lanin. LpcTYR and SK-MEL-19 extract~ and melanin had identical patterns of absorption, with broad absorption from 360 nm to >450 nm; ;~
this absorption pattern was not observed with ~929 cell extracts. The absorption patterns by extracts of LpcTYR and SK-N~L-l9 and melanin standard were identical to the previously described absorption spectra for melanin (26).

Small clusters of cells conta~ning dark cytoplasmic inclusions were observed throughout the LpcTYR culture by light ~icroscopy (Fig. 4) - these clusters of cells always comprised a ~inority of the culture population.

Occasional ~lack, round cells were detected ~loating in the tissue culture medium, perhaps related to cytostatic or .
: .. ~ -:

woso/l2~69 PCT/US90/0228 cytotoxic effects of melanin by-products, and the prevalence o~ these cells increased as the culture reached confluency.

Transmission electron microscopy revealed that LpcTYR cells, but not control LpC cells, had cytoplasmic membrane-bound vesicles (Fig. 5) containing electron dense material consistent with melanin. There was no evidence of melanosomal structural elements within LpcTYR cells or Lpc cells.
Tyrosinase Activity In L929 Cells ExPressina BBTY-1.

To confirm that the BBTY-1 product was human tyrosinase, tyrosine hyclroxylase activity was me~sured in protein extracts of subclones of LpcTYR, LpcTYW and LpC. Cell extracts from two subclones of LpcTYR, designated LpcTYR~1 and LpcTYR-2, expressed levels of tyrosinase activity that were comparable to levels in the p.igmented hu~an melanoma cell line SK MEL-l9 (Fig. 6). In contrast, extracts of LpcTYW and LpC contained no detectable tyrosinase activity.
, .
An~lysis of Ex~ression of ~elanosomal Antiaens in ~ ~pÇTYR i :~
Cell~

25 LpcTYX-2 9 SK-~EL-~9 melanoma cells and control L9~9 cells were ~etabolically labeled with 33S-methionine and cell extract~ wer~ immunoprecip~tated with rabbit anti-tyrosinase antiserum or ~Ab ~Ag9 (which detects the melanoso~al antigen gp75). In addition, mAb 2GlO wh~ch is also directed ayainst an intracellular 75 kD antigen expressed by pigmented melanoma cells (17) was tested. Anti-tyrosinase antiserum , detected a 75 kD protein in LpcTYR-2 cells and a protein of ;
the sam- size in SK-NEL-l9 =elano=a cells (Fig. 7). ~he . :
.
- . . ., . .;
: .. , . . .~ .. . .. . ,,: . , :. -, ., - . : ;. ... .

, . , . . , , . , . :. ~ -.. . . .
. . .: . .-....... ~ .

woso/l2x6s PCT/VS90/02288 -19- 20~7~

molecular size of tyrosinase in LpcTYR-2 and S~-MEL-19 cells corresponded to the size of glycosylated tyrosinase. ~ very faint band at approximately 75 XD was inconsistently detectad in L929 cells with anti-tyrosinase antiserum - this likely represents a cross-reaction of polyclonal sera to a non-tyro~inase molecule in L929 cells since no tyrosinase activity or tyrosinase transcript was detected in these cells and cold lysates from L929 cells did not block immunoprecipitation of tyrosinase from LpcTYR-2.
No specific bands were detected by either mAb TA99 or mAb 2G10 in LpcTYR-2 extracts, although both antibodies precipitated a broad 75 kD band from melanoma SK-~EL-19 lysates. These results were confirmed using immunofluorescence assays. Neither mAb TA99 nor 2G10 stained LpcTYR cells but both reacted with SX-ME~-l9 cells (Fig. 8). In addition, mAb CF21, dir~cted against a melanosomal antigen o~ unknown molecular ~ize, did not react with LpcTYR but stainad SK-MEL-l9 (Fig. 8). Accordingly, mAb TA99, CF21 and 2G10 appear to identify antigens distinct from tyrosinase encoded by BBTY-l cDNA clone.

` ~ISCUSSION
:`
Tyrosinase catalyzes the Q-hydroylyation of monophenols and oxidation of Q-diphenols to Q-quinones. In mela~ocytic c~lls, tyrosinase enzy~atically converts tyrosine to dihydroxyphenylalanine (DOPA) and DOPA to dopaquinone, leading to th~ spontanesus formation of the complex mixture 30 ~ o~ pig~ent~ known as melanin (27). The later steps in this pathway are not well characterized, and it has ~een suggested that a number of other factors, both catalytic and inhibitory, =ay regulate melanin ~ynthesi6 ~nd iniluence the : ~ :
. , .

WO90/12869 PCTtUS90/02288 ~ -20-c ~ v species of melanin formed (28, 29). ~he complexity of pigment expression has been further highlighted by genetic studies in the mouse where more than 50 loci have be~n found to influence c~at color (30). Thus, it is possible that a number of gene products, most not yet identified, can play a role in melanogenesis.

It is remarkable that trans~ected L929 fibroblasts not only stably expressed tyrosinase activity but were able to produce and package melanin. Melanin precursors ar~
cytotoxic, and it has been presumed that melanocytic cells contain mechanisms, perhaps located within melanosome~, that protect from the effects of toxic intermediates. Melanin precursors were cytotoxic in transfected L929 cells, and that cells producing substantial amounts of piyment were destined to die, based on the following observations: (1) only a subpopulation of transfected cells contained pigmented vesicles; (2~ deeply pigm~nted, non-viable cells were observed floating in the supernatant of transfectant cultures; and (3) when transfected cl~lls were cryopreserved and then ~hawed, pigmented cells were~not initially detected but eventually repopulated the culture.

The details involving the synthesis or processing of human tyrosinace in transfected L929 cells has not been analyzed.
It appears that human ty~osinase is glycosylated to a form identical in ~ize to fully processed tyrosinase expressed in human melanocytic cells. It is likely that hu~an tyrosinase was processed through ~he Golgi apparatus in L929 cells and transported to or remaining in Yesicles arising ~rom the trans Golgi. The nature and destination of these ~esicles is not kno~n. It is interesting to speculate that these vesicles sisht be precur*ors of melanososes but that ' . ., ,. ., , , . . : ~ ~ . . . : -,, ~
. ~: ,, ' :: : , .

WO90/12869 PCT/US90/022~8 -21- 2~

formatio~ of melanosomes would d~pend on the products of other speci~lized genes.

The expression and regulation of tyrosinase has been the subject of extensive studies, but the formal identification of the gene that code for tyrosinase has not been straightforward (reviewed in 31). Two distinct, and distantly related, gPne~ have been proposed as candidat~s for mouse tyrosinase, based on detection of mRNA of these genes in melanscytic cells and reactivity of the protein product with antibodies against tyrosinase (32, 33).
Neither gene, however, was demonstrated to directly code for a product wi~h tyrosinase acti~ity. It is likely that antibodies used to detect the products of putative lS tyrosinase cDNA clones reacted with other molecules that co-purified with tyrosinase. This situation was recently clarified by the identification of the mouse tyrosinase gene by ~uller et al. who isolated a cD~ clone, pmctyrl, that coded for transient expression of tyrosinase activity in transfection assays (34). No pigment synthesis was reported in transfected cells, possibly because assays were performed only shortly after transfection, because the recipient cells were different (an amelanotic melanoma and a breast carcinoma cell line), or because levels o~ tyrosinase activity appeared to be much lower than in mouse fibroblasts trans~ect~d w~th BBTY-l.
:;~
The candidates for ~he human tyrosinase gene, designated Pmel 34, has been reported by Kwon et al. (1). Kwon and co-workers also recently described a mouse cDNA, MTY811C;isolated using Pmel 34 t35). The gene product encoded by MTY811C was predicted to be 81% homologous to the protein encod d by Pmel 34. Both the human Pmel 34 and the mouse ~' :

, . ~ .

:.

W090/12869 ~ PCT/~S90/02288 ~ 22-MTY811C correspond to the human counterpart of the mouse pmctyrl gene, and in fact the pmctyrl clone was also isolated by screening a cDN~ library from mouse melanoma cells with the Pmel 34 cDNA. The Pmel 34 cDNA clone was detected by screening a cDNA library with polyclonal antisera rai~ed against hamster tyrosinase. Pmel 34 has been mapped to the c-albino locus in the mouse, the presumed site of the tyrosinase structuxal gene or a gene that regulates tyrosinase expression. The nucleotide and predicted aa sequences of BBTY-l and Pmel 34 are closely similar, except BBTY-l contains an initiation codon that is not present in Pmel 34. Additionally, there are minor differences in nucleotide and predicted aa sequences. It is possible that some of these differences represent genetic polymorphism or somatic mutations (related to the source of cell types used to isolate cDN~ - melanoma cells for BBTY-l versus melanocytes for Pmel 34). It is interesting to note that, where ~here are distinct differences in sequences between BBTY-1 and Pmel 34, the sequence of 8BTY-l is very close or identical to the mouse pmctyrl tyrosinase sequence (e.g., amino acids, 356-361, and 385).

Multiple transcripts of the tyrosin2Lse gene have been found in mouse melanoma cell~ (36). Th~ re!maining transcripts are generated by alternative splicing leading to deletion of internal ~equences, presumably by exon skipping or by selection o~ internal splice sites. ~hen these alternative transcripts have been expressed, they have not been found to encode active tyrosinase (34, 36) . The BBTYol cDNA
represents the human counterpart of the mouse pmcTyrl transcript. Another cDN~ clone which was isolated, BBTY-3, :
differs from BBTY-l in its 3' restriction ~ap, possibly corresponding to an alternative transcript of the human .
, ~ .
.

~ ':

~ , . . : ~
.,:. . . : ~ , , . : . :
'. . .. : ~.... ' . : ' ~ :

w~90/12869 PCT/US90/0228 2~7~9 tyrosinase gene.

As to the relationship o:E tyrosinase to the melanosomal/cytoplasmic antigens recognized by mAb 2G10, TA99, and CF21, researchers have shown that mAb 2G10 immunodeple es tyrosinase activity (37) and therefore possibly r~cognizes a molecule with tyrosinase activity.
However, mAb 2G10 did not react wi~h human tyrosinase encoded by BBTY-1, suggesting that mAb 2GlO recognizes a distinct molecule from the gene product of BBTY-1. TA99 mAb recognizes an acidic 75 kD glycoprotein (38), and the anti~en recognized by TA99 is a candidate for tyrosinase, based on its expression in melanosomes, its molecular size and charge. The findins that mAb TA99 and CF21 did not react with L929 transfectants provides evidence that they do not recognize determinants coded for by the BBTY-1 human tyrosi~ase ~olecule. Further data suggest that mAb TA99 does not recognize tyrosinase: 1) ~Ab TA99 does not `. precipitate tyrosinase activity fro~ melanoma cell extracts `. 20 (39, 40); 2) the TA99 antigen, gp75, is generally co-`~ expressed with tyrosinase activity, but there are examples o~ gp75~ melanoma cell lines that do note express tyrosinase activity; and 3) the expression of tyrosinase and gp75 in . melanoma cell lines has been independently regulated (20).
; Understanding ~he speci~icity of monoclonal antibodies that react with melanoso~al antigens will be i~portant for sorting out the identity of these molecules. It has been proposed in a recent report by ~imenez et al. that a second gene only distantly related to BBTY-l and Pmel 34 (33), mapping to the ~ (bro~n) locus in the mouse (41), codes for - a gene product with tyrosinase activity (42)o Thus, it is , becoming increasingly evident that t~rosinase is a memb~r of . ' .

'~'.

, ' ` ~ . . ,~ -~, , ' . :~' . ` . ' ~: .
:
.: . . -WOso~l2869 PCT/US90/02288 ~ 7~ -24-a family of related molecules that include distinct genes and alternative transcripts of these genes (32-34, 36, 41, - 42).

Sum~ary , A distinguishing characteristic of cells of the melanocyte lineage is the expression of the melanosomal enzyme ; tyrosinase which catalyzes the synthesis o~ the pigment melanin. A tyrosinas~ cDNA clone, designated BBTY-l, was isolated from a library constructed from the pigmented TA99~/CF21~ melanoma cell line SK-MEL-19, Expression o~
BBTY-1 in mouse L929 fibroblasts led to synthesis and expression of active tyrosinase, and, unexpectedly, to stable production o~ melaninO ~elanin was synthésized and stored within membrane-bound vesicles in the cytoplasm of transfected fibroblasts. BBTY-1 detected a 2.4 kb mRNA
~ transcript in 9 of 9 pigmented, tyro~inase-positive melanoma : cell lin~s. Tyrosinase transcripts of th~ same size were d~tected in a subset (3 o~ 8) o~ non-pigmented, tyrosinase-negative .melanoma cell lines, suggesting that post-transcriptional events are important in regulating tyrosinass activiky. Two melanocyte antige~s~ recognized by . monoclonal antibodies TA99 and CF21, that are specifically " ~5 locatPd within melanosomes and are co-expre sed with .`' tyrosinase activity did not react with transfected ~ouse ~ibroblasts Qxpr~ssing human tyrosinase, supporting the - conclusion that these antigenic determinants are distinct xom the tyrosinase molecule cod~d for by BBTY~
;

~ , , ~ ;
., .

: . .. . : :. , : ~
,.,: " .: :. : ~ . .

WO90/12869 PCT/US90~02288 2~7~,~
~EPE~E~C~8 1. ~won, B.S., et al., (198~) Xsolation and sequence of cDNA clone for human tyrosinase that maps at the mouse c-albino locus, Proc~ Natl. Aoad. Sci. USA 84: 7473.

2. Houghton, A.N., et al. (19821 Surface antigens of melanocytes and melanoma: markers of melanocyte differentiation and melanoma subsets, J. Exp. Med. 156:
1755.

3. Kit, S., et al. (1963) Deletion of thymidine kinase activity from L cells resistant to bromodeoxyuridine.
Exp. Cell. Res. ~1: 297.

4. Maniatis, T., et al., Molecul~r Cl~nina~ oratory ~nual. Cold Spring Harbor Laboratory Press, Cold Spring ~arbor, New York (1982~. ;-5. Gubler, U., Hoffman, B~Jo (1!363) A simple and very efficient met~od of generating cDNA libraries, Gene ~`
~5: 263.

; 6. Watson, C~J., and Jackson, J.F. (1985) Constructing and ~ ~
Screening cD~A Libraries in k gt ll in DNA Cloning: A `
Practical Approach, D.M. Glover (ed), IR~ Press, Oxford ~: 79.

7. Huynh, T.V., et al., An Alternative Procedure for the Syn~hesis of Double Stra~ded cDNA for Cloning in Phage and Plasmid Vectors in DN~ Cloning: A Practical Approachl D.M. Glover (ed), IRL Press, Oxford 1: 49 ~1985).

, ~:
~ ~ .

: ' ' . ~ .
, ,, , , , ,. . ..

~, -: . . . .

. , ~ - ~ - , , . :
, , ;- . , - ~:, . ..

Woso/12869 PCT/US90/02288 ~ 26-8. Vieira, J. and M~ssing, J. (1982) The pUC plasmids and ~13Mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers, Gene 1~:
259.
9. ~eni~off, S~ (1984) Unidirectional digestion with Exonuclease III creates targeted breakpoints for DNA
sequencing, Gene 28: 351.
. :
10 10. Sanger, F., et al. (1977) DNA sequencing with chain termination inhibitors, Proc. Natl. Acad. Sci. USA 74:
5463.
.
- 11. ~iller, J. and Germain, R.N. (1986) E~ficient cell surface expression of class II M~C molecules in the absence of associated invariant chain, J. Exp. ~ed. ~:
`~ 164: 1~78.
:. . ,'~
12. Wigler, M., et al., (1979) Transformation of mammalian cells with genes from procaryotes and ~ucaryotes, Cell `~! ~ ?77. ` : .

13. Lemke, H., et al., (1979) Fine specificity analysis :~
with monoclonal antibodies oi ~ntigens controlled by ~ :
;~ 25 the MHC Qa/Tl region in mice, Immunol. Rev. 47: 175. ~;
~, .~ 14. Real, F.X., et al., tl985) Surface antigens of ~ .
melanomas and melanocytes defined by mouse ~onoclonal ~ :
antibodies: specificity analysis and comparison of antigen eXpression in cultured cells an tissues, Cancer :~ Res. 4S: 4401.

15. Cairncross, J.G., ~t al., (1982) Cell Surface antigens ,' .`~ '.
:~
" ':
., ~

: :::: : : .. .. : . .. . . . .
,: , . . ,. : .
.: .: : - - - . . :
. . , . :. ., : . , - : : . :' ' :
, ~ . .,, :'. - .' ' , . ~: :

WO90/12~69 PCT/US90/02288 2a~7~.9 of human astrocytoma de~ined by mouse monoclonal antibodies: identification of astrocytoma subsets, Proc. Natl. Acad. Sci. USA ?9: 5641.

16. Thomson, T.M., et al., (1988) Differentiation antigens of melanocytes and melanoma: analysis of melanosome and cell ~urface markers of human pigmented cells with monoclonal antibodies, J. Inv. Dermatol. 20: 459.

17. Natali, P.G., et al., (1986) A melanocyte differentiation antigen recognized ~y a new murine monoclonal anti~ody mAB, J. Invest. Dermatol. 87: 392.

18. Kantor, R.R.S., et al., ~1987) Biochemical analysis of two cell surface glycoprotein complexes, very common antigen 1 and very common antigen 2, J. Biol. Chem.
~62: 31.
`:
19. Fuller, B.B., et al., (1987) Melanocyte-stimulating hormone regulation of tyrosine in Cloudman S-91 mouse melanoma cell cultures, J. Biol. Chem. 262: 4024.

20. ~oughton, A.N., et al., (1987)]Phenotypic heterogeneity of melano~a: relation to ~he differentiation program of melanoma oells, J. E~p. Medl. 164: 812.

21. Laemmli, U.K., ~1970) Cleavage of structural proteins ;~
during assEmbly of the head of bacteriophage ~4, Nature ~: 6~0.
22. Pomerantz, S.H., (1969) L-Tyrosine-3, 5'-3~ assay for tyrosinase development in skin of new born hamsters, Scienoe 164: 838.

"~
.. .

. . .

: . . , ` -- - - :' - , ' -: ~ ' ':, ' -.. ... ,:. .. . .
-~ :

WOgO/12869 PCT/US90/02288 . von Heigne, G., (1983~ Patterns of amino acids near signal sequencing cleavage sites, Eur. J. Bio~.aem. 133:
17.

24. Kyter, J. and Doolittle, R., (1982) A simpl~ method for displaying the hydropathic character of a protein, J. ~:
Mol. Biol. 157: 105.

25. WilXins, M. and Stephenson, P., tl984) Role of the conserved AAU-AAA sequence from AAUAAA point mutants prevent mRNA 3' end formation, Science 2260 1045.

26. Oikawa, A. and Nakayasu, M., (1973) Quantitative measurement of melanin as tyrosine equivalents and as ~;
weight of purified melanin, Yale J. Biol. Med. 46: 500. :~
. ~, .
27. ~ason, ~.S., (1948) The chemistry of melanin III.
~echanism of the oxidation of dihydroxyphenylalanine and tyrosinase, J. Biol. Chem. 172: 83. : ~ .
. . ~:
28. Pawelek, J. and Lerner, A.B., (1978) 5-6 : dihydroxyindol~ is a melanin precursor showing potent ~. cytotoxicity, Nature ~76: 627, -:
`. 25 29. Pawelek, J., (1980) N~w regulators of melanin biosynthesi~ and the autodestruction of melano~a cells, Nature 1~: 617. -~
~.
30. Silvers, W7K., (1979) The ~oat Colors of Mice: A Mod~l ~or Ma~alian Gene Action and Interaction, Springer, ~;~
Berlin. -~

31. Uearing, V.~. end Jimenez, ~., (l9a9) ~na1ysis of ' ~.
.' :

,... .. ... ... . . . ..

: .. . . .. . . : .; . , ,, -: , :: : . . : . . . -. . .

WO90/12869 P~T/US90/02288 -29~ 2~d7~3~

mammalian pi~mentation at the molecular level, Pigment Cell Res. ~: 75-85.

32. Yamamoto, H., et al., (1987) Cloning and sequencing of mouse tyrosinase cDNA, Jpn. J. Genet. 6~: ~71.
, 33. Shiblhara, S., et al., (1986~ Cloning and expression of cDNA encoding mouse tyrosinase, Nucl. Acid. Res. 14 2413.
"
34. Muller, G.S., et al., (1988) Functional analysis of ::
. alternatively spliced tyrosinase gene transcripts, EMBO
J. 7: 2723.
. ' :' : 15 35. Kwon, B.S., et al., (1988) Sequence analysis of mouse tyrosinase cDNA and the e~fect o~ melanotropin on its gene expression, Biochem. Biophys. ~es. Commun. 153:
1301.
. , .
: 20 36. Ruppert, S., et al., (1988) Multiple transcripts of the ; mouse tyrosinase gene are ~enerated by alternative splicing, EMBO J. 7: 2715.

37. Xwon, B.S., et al., (1987) A melanocyte-speci~ic ~ :
complementary cDNA clone whose expression is inducible by melanotropin and isobutylmethyl zanthine, ~ol. Biol.
Ned. 4: 339.

38. Tai, To~ et al., (1983) Glycoproteins as ~ ~:
di~ferentiation markers in human ~alignant melanoma and melanocytes, Cancer Res. 43- 2773.
. ~ ~
~ 39. ~attes~ J., et al., (1983~ A pismentation-associated, .. . .

~, .

~, .
. ,- :. : ,. . :

... .-,. - , , - : :, ;, .

, ~,. . . .

WO90~12869 ` PCT/US90/02288 ~ 'J -30~

differentiation antigen of human melanoma defined by precipitating antibody in human serum, Int. J. Cancer 3~: 717.

40. Thomson, T.M., et al., (l985) Pigmentation-associated glycoprotein of human melanomas and melanocytes: ~
de~inition with a mouse monoclonal antihody, J. Inv. ~- .
Derm. 85: 169.

41. Jackson, I.T., (l988) A cDNA encoding tyrosinase related protein maps to the brown locus in mouse, Proc.
Natl. Acad. Sci. USA 85: 4392. ~;
:: :
42. Jimenez, ~., et al., (1989) Specific identification o~
an authentic clone for mammalian tyrosinase, J. Biol. ~-Chem. ~~: 3397~3403-43. Winnacker, E-L., (1988) From Genes to Clones, Introduction to Gene Technology.
44. Smith, et al., U.S. Patent Nu~ber 4,745,051, issued ~`
May 17, l988.
; '.
~ ,;, .

.. , . -- . . . - .,, . ~ -,.: : .
- - .. ~ . : . . ~ -. :.

:

Claims

What is claimed is:

1. A non-melanocytic eucaryotic cell constitutively expressing a biologically active human tyrosinase.

2. The non-melanocytic eucaryotic cell of claim 1, wherein the biologically active human tyrosinase is expressed from an expression vector which comprises DNA encoding the human tyrosinase.

3. The non-melanocytic eucaryotic cell of claim 1, wherein the eucaryotic cell is a yeast cell.

4. The non-melanocytic eucaryotic cell of claim 1, wherein the eucaryotic cell is a mammalian cell.

5. The non-melanocytic eucaryotic cell of claim 1, wherein the eucaryotic call is an insect cell.

6. The non-melanocytic eucaryotic cell of claim 2, wherein the DNA encoding human tyrosinase is cDNA having the sequence shown in Figure 1 extending from nucleotide 58 to nucleotide 1593.

7. The non-melanocytic eucaryotic cell of claim 2, wherein the eucaryotic cell comprises mammalian cell and the expression vector additionally comprises SV40 early region promoter and enhancer sequences, an initiation codon immediately upstream of the DNA encoding human tyrosinase, and a termination signal immediately downstream of the DNA encoding human tyrosinase.

8. The non-melanocytic eucaryotic cell of claim 2, wherein the eucaryotic cell comprises an insect cell and the expression vector comprises a baculovirus.

9. A non-melanocytic eucaryotic cell of claim 1 which produces melanin.

10. A method of producing biologically active human tyrosinase which comprises culturing cells of claim 1 under conditions such that the cells express biologically active human tyrosinase and recovering the human tyrosinase so expressed.

11. A method of producing melanin which comprises culturing cells of claim 1 under conditions such that the cells express biologically active human tyrosinase and the tyrosinase so expressed catalyzes the production of melanin and then recovering the melanin so produced.