CA2050850A1

CA2050850A1 - Recombinant herpes viruses, a vaccine based on these recombinants, their preparation process, genes, vectors and plasmids used in this process

Info

Publication number: CA2050850A1
Application number: CA002050850A
Authority: CA
Inventors: Louis J. N. Ross; Matthew M. Binns; Arielle Rey-Senelonge; Michel E. A. Riviere
Original assignee: Individual
Current assignee: Boehringer Ingelheim Animal Health France SAS
Priority date: 1990-09-07
Filing date: 1991-09-06
Publication date: 1992-03-08
Also published as: FR2666589A1; FR2666589B1; AU8370891A; JPH05168473A; EP0477056A1; AU657488B2

Abstract

New recombinant herpes viruses, a vaccine based on these recombinants, their preparation process, genes, vectors and plasmids used in this process.

Abstract The invention concerns the sequence of the unique short region Us of Marek's disease virus coding for the kinase protein.
It also concerns the recombinant herpes viruses in which a hetero-logous gene has been inserted in the homologous region of the gene coding for the kinase protein and, in particular, the Marek recom-binant viruses expressing a gene of an avian pathogenic agent which could possibly be a gene of another serotype of the Marek viruses. It also concerns a process for the preparation of these recombinants as well as the vaccines obtained.

Description

New recombinant herpes viruses, a vaccine based on these recombinants, their preparation ~rocess, ~enes, vectors and plasmlds used in this process.

The present invention concerns recombinant herpes viruses, in particular, for producing vaccines, their process of preparation and the plasmids produced during this process. More-over, it concerns a part of the chromosome of Marek's disease virus (MDV) which can be used for preparing such vaccines.
Different types of viruses have been used as expression vectors of foreign genes, in particular of genes coding for anti-genic proteins, and have proven their potential for immunizing animals. The vaccinia virus has, to a great extent, been used for constructing recombinant viruses. The herpes viruses have also been used: the herpes simplex virus (HSV) (M. Shih et al., Proc.
Natl. Acad. Sci., USA. 1984, 81, 5867-5870), the varicella virus (VZV) (R. Lowe et al., Proc. Natl. Acad. Sci., USA. 1987, 84, 3896-3900). The foreign gene is inserted into a fragment of the genomic DNA of the herpes virus, corresponding to a non-essential region for the viral replication, cloned in a plasmid. This gene is transferred into the viral genome by homologous recombination.
This latter step is carried out by cotransfection of the herpes genomic DNA and plasmid since this genomic DNA is by nature infec-tious.
Different genes of herpes viruses have been identified as non-essential to viral growth, certain of these genes being associated with virulence.

- 2 - 26~1~7~

The gene of the thymidine kinase of the herpes simplex virus (D. Dubbs et al., Virology, 1465, 22, 493-502), of the Aujeszky virus ~G. Tatarov, Zentralbl. Vet. Med., 1968, 15 B! 848853), of the rhinotracheal infectious bovine virus (S. Kit et al., Virology, 1983, 130, 381-389).
- The gene gIII of the Aujeszky virus (A. Robins e-t al., J.
Virol., 1986, 59, 635-645).
- The gene gX of the Aujeszky virus (D. Thomsen et al., J.
Virol., 1987, 61, 229-232).
- The gene gI of the Aujeszky virus (C. Mettenleiter et al., J. Virol., 1987, 61, 4030-4032).
Viruses in which one or other of these genes has been deleted nonetheless retain the capacity to produce a latent infec-tion in mice.
Studies pertaining to the unique short region of the genome of the herpes simplex virus HSV-l have been conducted (B.
Megnier et al., Virology, 1988, 162, 251-254) and have shown that the viruses HSV-l in the short region of which a gene has been deleted, have undergone an attenuation.
For their part, F'.C. Purves et al. (Journal oE Virology, 1987, vol. 61, No. 9, 2896-2901) have demonstrated that the open reading frame US3 of the short fragment of the HSV-l virus genome codes for a virus enzyme, the kinase protein, and is not essential to the replication of said virus.
Studies have been undertaken on Marek's disease virus which belongs to the subfamily of gamma herpes viruses. This is an enveloped virus having a double stranded linear genomic DNA of - 3 - 263~

about 175 kilobases. Its genome is composed of a long segment (UL) and of a short segment (Us) framed by repeated inversed ter-minal sequences.
Marek's disease virus causes paralysis and a lympho-proliferative disease in chickens, usually, at the age of 2 to 5 months. This disease results in very significant economic losses (L. Payne, Biology of Marek's Disease Virus and the Herpes Virus of Turkeys, in The Herpes Virus, vol. 1, pp. 347-431, edited by B.
Roizman, Plenum Press).
The strains of Marek's disease virus have been classified into three serotypes:
- serotype 1 comprises the pathogenic strains and attenuated strains derived therefrom.
- serotype 2 comprises the naturally attenuated strains.
- serotype 3 comprises the herpes virus of turkeys (HVT) and its variants.
Consequently, the term Marek's attenuated disease virus will designate serotypes 1, 2 and 3 at the same time.
Marek's disease virus (MDV) and herpes virus of turkeys 2~ (HVT) have similar genomic arrangements (A. Buckmaster et al., J.
Gen. Virol., 1988, 69, 2033-2042) and numerous homologies of sequence all along their genome (C. Gibbs et al., Proc. Acad.
Natl. Sci. USA, 1984, 81, 3365-3369).
The chicks are vaccinated at the age of one day and are then protected against Marek's disease for their entire life. For numerous years, vaccination with the herpes virus of live turkeys (HVT) has been very effective for controlling the disease.

4 ~ 2 6 ~j~6~ ,7,~ r Nevertheless. -the emergence of new viral strains which are highly virulent has led to the use of strains of attenuated Marek's disease viruses of another serotype, to vaccinate and thus increase the level of protection, either, for example, the strain CVI 988, MDV serotype 1 attenuated by passing over cells (B.
Rispens et al., Avian Dis., 1972, 16, 1108-125), or, for example, the association of the HVT MDV serotype 3 and SBl strains, MDV
serotype 2 (K. Schat et al., J. Natl. Cancer Inst., 1987, 60, 1075-1082).
The genome of Marek's virus has certain similarities with the genome of alpha viruses, herpes simplex (~SV) and chickenpox (VZV). Most of the genes localized in the long region UL of the genome are approximately colinear between the herpes simplex virus, chickenpox (D. McGeogh, J. Gen. Virol., 1988, 69, 1531-1574) and Marek's disease virus (A. Buckmaster, 1988). Thus.
in the international patent application WO 90/02802, it was pro-posed that the genes be inserted into this UL region of HVT and MDV.
On the other hand, the loca]ization of genes in the Us segment shows a laryer divergence between herpes viruses. Also among the dozen open reading frames identified for the herpes simplex virus, only four have a homology with the chickenpox virus (McGeogh, 1988, cited above).
In fact, the prior art does not suggest that there is an interest in proceeding with a homology study of open reading frames of the unique short region of the genome of Marek's disease virus with the HSV-l genes.

- 5 -- 263~6~7~
( J
The present invention divulges, for the first time, the sequence coding for the kinase protein of the genome of Marek's disease virus (MDV) and allows one to establish, in a surprising manner, that this gene can be deleted without blocking the viral replication and allowing the insertion of heterologous sequences opening the way for development of a series of viral expression vectors.
This type of a recombinant and at-tenuated virus of Marek's disease constitutes a choice candidate for developing a viral vector expressing foreign genes to be used for polyvalent vaccination of poultry since it has the advantage of being able to be used for its own vaccinal properties and as a vaccine against other viral, bacterial and parasitic diseases as, for example, infectious avian bronchitis, Newcastle's disease, fowl plague, egg-drop syndrome, Gumboro's disease, chicken anaemia, coccidio-sis, fowl pox, infectious laryngotracheitis, avian colibacillos, is pasteurellosis, haemophilosis.

SUMMARY OF THE INVENTION

The object of the invention is to provide recombinant herpes viruses, including a recombinant attenuated Marek's disease virus (serotypes 1, 2 or 3), recombinant which can be used as a vaccine, the method for constructing such a recombinant virus as well as a vector virus allowing the multivalent vaccination against viral, bacterial or parasitic aviall diseases.
One object of the invention is the nucleotide sequence - 6 - 263~

and its variants corresponding to the US3 gene which is homologous to the kinase protein gene of the herpes simplex virus and the surrounding regions. The term variants of the nucleotide se-quence, as commonly used, means any equivalent sequence such as obtained, for example, by degeneration of the code, minor modifi-cations, mutations or corresponding to viral variants.
Another object of the invention is a recombinant virus selected from the herpes viruses, including the viruses of pseudorabies disease, infectious bovine rhinotracheitis, equine rhinopneumonitis, feline rhinotracheitis, canine herpes.
Another object of the invention is also a Marek's disease recombinant virus comprising one or more heterologous genes inserted in the region of its genome corresponding to US3 gene in such a way so as to be expressed.
By "heterologous gene", one means, in particular, a gene coding for a protein or an immunogenic glycoprotein of a viral, bacterial or parasitic pathogenic agent, in particular, an agent associated with an avian pathology. This also relates to the construction of hybrid viruses, for example, by introducing, into the genome of a turkey herpes virus, genes coding for immunogenes of a Marek's disease virus of serotype 1 and/or serotype 2.
"Heterologous gene" is also intended to mean a gene coding for a peptide or a protein, for example, hormone, growth factor, immunomodulator.
The heterologous gene is preferably expressed under the control of regulating sequences of US3 gene transcription. One can, however, see to it that this expression is either controlled by a promoting sequence coming from another gene of the virus in question, for example, the promoter of TK gene, of gA gene, of gB gene or from another herpes virus, for example, the promoter of gI gene of the infectious bovine rhinotracheitis virus or from gene II or gene III of pseudorabies virus.
Preferably, the start and stop codons of US3 gene are substituted by those of the gene to be expressed.

DESCRIPTION OF THE FIGURES

Figure 1 shows the construction of the plasmid pMDV 53L
which contains the lacZ gene inserted instead of US3 gene.
Figure 2 shows the construction of the plasmid pMDV 53 CL
whlch contains the lacZ gene under the control of the promoter iE of the human cytomegalovirus instead of US3 gene.
Figure 3 shows the plasmid pMDV 53F which contains the gene of the fusion protein of Newcastle's disease virus instead of US3 gene.

DESCRIPTION OF THE INVENTION: MATERIALS AND METHODS

Viral Strain The serotype 1 strain RBlB of Marek's disease virus (MDV) was used (Schat K.A. et al., 1982, Avian Pathol. 11, 593-605).
The virus culture methods and methods for extraction of viral DNA having a high molecular weight have been described (C. Lee et aL., 1980, J. Gen. Virol., 51, 235-253; N. Ross et al., 1989, 70, 1789-1804).

'~ , . , ~ . ', .

- 8 ~ ? ~!J 2~361-74 Cell Culture The fibroblasts of chicken embryo (CEP) were cultivated in 199 F10, medium supplemented by penicillin, streptomycin, fungizone and fetal calf serum, as described (N. Ross, 1975, J.
Gen. Virol., 28, 37-47).
Cloning of Viral DNA
Generally, the techniques used for the construction of recombinant plasmids are those described by T. Maniatis et al.
(T. Maniatis et al., 1982, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor. NY).
For all clonlng and subcloning steps, the vector linearized by the appropriate restriction enzymes is dephosphorized before ligation. The purification of the DNA
fragments starting from an agarose gel is done according to the technique described by the manufacturer: "Geneclean" (Bio 101, San Diego, California, USA).
Sequencing The cloned fragments are sequenced according to the classic technique described by Sanger (G. Sanyer, S. Nicklen. A.
Coulson, 1977, Proc. Natl. Acad., USA 74, 5463-5467). The sequences aEter translation have been compared to -the published sequences of herpes simplex virus and chickenpox (McGeogh, 1985, J. Mol. Biol. 181, 1, 13; K. Davison et al., 1986, J. Gen. Virol.
67, 1759-1816).
Contro]led Mutagenesis The DNA fragments, subcloned in the Blue Script vector (Stratagene, La Jolla, California, USA) are mutagenesized after - 9 - 2 ~ ~ fJ ~ 26361-74 separation of the DNAs simple fragment with the help of the R408 helper phage (Stratagene, La Jolla, California, USA) (M. Russel, S. Kidd. M. Kelley, 1986, Gene 45, 333-338~.
The mutagenesis procedure and selection of the mutants by using the strain CJ 236 dut-, ung- of E. coli (In Vitrogen, San Diego, California, USA) is described by T. Kunkel, (T. Kunkel 1985, Proc. Natl. Acad. Sci., 82, 488-492 and T. Kunkel et al., 1987, Methods of Enzymology 154, 367-382, Acad. Press).
In vivo Recombination The recombinant viruses are obtained according to the conventional techniques of transfection of the sensitive cells, such as the calcium phosphate method or the one using the Lipo-fectine reactive described by the manufacturer BRL (P.L. Felgner et al., 1987. Proc. Natl. Acad. Sci., USA, 84, 7413). For this, the chicken embryo fibroblasts, cultivated to confluence, are cotransfected with the genomic DNA and the plasmid carrier of the DNA fragment to be inserted, flanked in 5' and 3' by the genome sequences which allows the recombination.
The recombinant viruses can then be screened by hybridi-zation with an appropriate probe or by plaque colouring. When agene marker, the lacZ gene of ~-galactosidase, is inserted into the gene of Marek's disease virus, the expression of this gene can be followed by adding, to the cell covering, an agarose overcoat enclosing the chromogenic subætrate for the ~-galactosidase, e.g.
Xgal (5-bromo-4-chloro-3-indolyl, B.D. galactopyranoside).

: :' ~ . .

3 ~ ~

Example 1: Isolating an EcoRI fragment of 5.25 kilobases.

The viral genomic DNA was digested by the restriction enzyme EcoRI
and the fragments cloned in the vector pUC 13 (Pharmacia) (Yannisch, Perron et al., 1985, Gene 33, 103-119).
Among the cloned fragments, a fragment of 5.25 kilo-bases, localized at the level of the small fragment Us, has been, more particularly, analyzed by sequencing (pMDV 05; sequence ID
no. 1).
The sequence comprises six open reading frames (ORF).
The translated sequences of 4 of these ORF have a homology with the type I HSV virus proteins, localized in the Us fragment. In particular, the US3 gene of Marek's disease virus has a homology with the gene of the kinase protein of the herpes simplex virus.
Surprisingly, the study of this region has shown that the US3 gene can be deleted without blocking the viral replica-tion.

Example 2: Construction of a plasmid pMDV 53L for which the US3 ene has been replaced by the lacZ gene (Figure 1).

The EcoRI fragment of 5.25 kilobases stemming from the clone pMDV 05 was digested by the NcoI enzyme and the extremities thus generated restored by the DNA polymerase Klenow fragment. It was then digested by the KpnI enzyme and the fragment of 1989 pairs of bases thus liberated was cloned in the Blue Script vector linearized by the enzymes EcoRV and KpnI to give the plasmid pMDV

~" :''"' .

r; ~ j~
~ 26361 - 74 52 having 4947 pairs of bases.
The NcoI and Sa]I sites were respectively introduced to the extremities 5' and 3' of -the cloned fragment by controlled mutagenesis using the oligonucleotides designated by Seq ID no. 2 and 3, in the list of attached sequences, which generates the pMDV
53 plasmid. The lacZ gene was purified from the pMC 1871 plasmid (Pharmacia LKB, Uppsala, Sweden) (S.K. Shamira et al. 1983, Gene 25, 71-82) by digestion by the enzymes SmaI and SalI.
It was then inserted into the pMDV 53 plasmid, partially digested by the NcoI enzyme, treated by the DNA polymerase Klenow fragment and then controlled by the enzyme SalI, which generates the plasmide pMDV 53L of about 6687 pairs of bases~

Example 3: Preparation of a Marek's disease virus comprising the lacZ ~ene.

The chicken embryo fibroblasts were cotransfected with the total chromosomal DNA of the virus and the DNA of the linearized plasmid pMDV 53L (10 to 50 ~(~). I'he cultures were observed for 4 to 6 days until infectious centres appeared.
Alternatively, the cells were trypsinated after 72 hours, then 20 reinoculated (1:1 or 1:2) in a secondary passage, until lysis segments were ob-tained.
The medium was then replaced by the new medium comprising 1% agarose and 0.5~ Xgal.

The plaques which are due to the recombination viruses are distinguished by their blue colour.

- 12 ~ 26361-74 The viruses can thus be purified by plaque purification and, after inoculation with healthy cells, give cytopathogenic effect shapes coloured in blue in the presence of Xgal.

Example 4: Construction of the plasmid pMDV 53 CL which comprises the lacZ gene under the control of the immediate early promoter of the human cytomegalovirus (CMV) (Figure 2).

The lacZ gene of ~-galactosidase was placed under the control of the immediate early promoter of the human cytomegalovirus (IECMV) in the vector pCMV-lacZ.
The fragment of about 4500 pairs of bases comprising the whole, the promoter IE of the cytomegalovirus and the lacZ gene, were digested by the EcoRI enzyme and the extremities filled by the DNA polymerase Klenow fragment. It was then digested by the SalI enzyme.
The fragment thus liberated was cloned in the partially digested pMDV 53 vector, by the NcoI enzyme, treated by the DNA
polymerase Klenow fragment and then digested by the SalI enzyme.
This plasmid composed of about 8200 pairs of bases is called pMDV
53 CL.

Example 5: Construction of a Marek recombinant virus for which the lacZ gene was introduced under control of the immediate early promoter of the cytomegalovirus, inst ad of the US3 gene.
The CEP were cotransfected with the genomic D~A of the virus and from 10 to 50 ~g of DNA of the linearized plasmid pMDV
53 CL.

~, r - - ~J ~
- 13 - ~ - i 26361-74 One can thus obtain the recombinant viruses which are distinguished by the appearance of blue-coloured infectious plaques in the presence of the chromogen substrate Xgal. These viruses were purified according to the plaque purification technique and allowed to infect the secondary chicken embryo fibroblasts.
The blue-coloured infectious pLaques can be obtained in the presence of Xgal which shows that the lacZ gene is inserted at the locus of the US3 gene.

Ex~le ~. Construction of the pMDV 53F plasmid which comprises the ~ene of the fusion protein of Newcastle's disease virus instead of the US3 gene (Figure 3) .

The fusion gene (J. Taylor et al., 1990, J. Virol., 64, 1441-1450) was introduced in the form of a fragment at the blunt ends in the Blue Script vector at the SmaI site to give the pNFl plasmid having 5300 pairs of bases.
NcoI and SalI sites were introduced by controlled mutagenesis at the level of the ~TG and stop codons of the fusion gene, due to the oligonucleotides indexed SEQ ID no. 4 and SEQ ID
no. 5 respectively in the list of the attached sequences.
The fragment of 1682 pairs of bases NcoI/SalI coming from the pNF2 plasmid was inserted into the pMDV 53 vector partially digested by the NcoI enzyme and digested by the SalI

enzyme to give the pMDV 53F plasmid having 5369 bases pairs.

- 14 ~ ! 26361-74 Example 7: Construction of a Marek's disease virus comprising the fusion protein gene of Newcastle's disease virus.

_ _ _ The chicken embryo fibroblasts were cotransfected with the total genomic DNA of the virus and 10 to 50~ g of linearized DNA of the pMDV 53F plasmid. The cultures were observed for the appearance of infectious plaques.
The recombinant viruses were then screened by hybridization with a probe including the fusion gene.
Similar procedures were used for the construction of the non-avian recombinant herpes viruses, by inserting a heterologous gene in the Us region and, in particular, in the homologous gene at US3 gene of Marek's virus.
The invention also concerns vaccines, live or not, made up of or containing recombinant viruses constructed according to the invention, or containing immunogenes expressed by these viruses.

- 15 - ~ 26361-74 APPE~DIX I

LIST OF SEQUE~CES

SEQ ID no. 1 Length of sequence: 5.255 pairs of bases Type of molecule sequenced: genomic DNA
origin of the molecule: Marek's disease virus, strain RBl B
Experimental source: pMDV 05 plasmid Characteristics:

from 1 to 324 pairs of bases: non-coding region from 325 to 1,135 pairs of bases: USl gene. The gene is coded by the complementary DNA segment at the indicated sequence and is transcribed from right to left (SEQ ID no. l.B) from623 to 1,214 pairs of bases: US2 gene from1,215 to 1,245 pairs of bases: non-coding region from1,246 to 2,451 pairs of bases: US3 gene from2,452 to 2,563 pairs of bases: non-coding region from2,564 to 3,004 pairs of bases: US4 gene from3,005 to 3,190 pairs of bases: non-coding region from3,191 to 4,384 pairs of baRes: US5 gene from4,385 to 4,494 pairs of bases: non-coding region from4,495 to 5,253 pairs of bases: US6 gene .

CAAAAATTTACATTAGTAATCTTTCTCGGTGGCTTACCAAATCGTCCTCTTGGTATATCCATArCATCGAAC 72 ATTGTAGcATTGAcTcTGcTcATcGTTGTcTTTcAAATGcGcTcGATTGTTGAATcTcTccTGATGTTAGAA 14 ~et Ala His GIY lle Pro 6 Asp Gln Val Pra AsP Thr Leu lle Ala Ser Asn Leu Phe GIY LY5 GIY Ile His 24 Ser Ser Ala ~et Arg His Ile Ser Ala Ala Pro Thr Ilo His LY5 LeU CYS Gly 42 GCA TTA CCA GAA ACT TCA GAT TCC AAC ATC AAA TAT CCA GAT AGA ACA TCC TGC P0~
Ala Leu Pro Glu Thr Sar AsP Ser Asn lle LYS Tyr Pro AsP Arg Thr Ser CYS 60 His Ser Val Glu His Pro Ala Thr Ser Ser Asn Ser Arg Thr lle Asn Glu Ser 78 Leu Val Pro Ala Asn Pro Val Pro Arg Thr Pro Val Pro Sqr Gly GIY Phe Val 96 Leu Thr Ile GlY Arg Cys CY5 Arg Gly Arg Ile Asn ~et GlY Leu Ala Lys Arg 114 Asn Arg Ser Ala Al4 L-u Thr lle ~et GIY Thr Pro Thr Ser Ser CYS Il~ CY5 132 Ser lle His CYS Phe lle Arg Asn Ile His LYS Val AsP Ala Ala Ser LeU Asp 150 LeU Pro GlY Asn Arg S-r His Ser S-r Arg Ser Val Thr lle Val lle ~et Asp 168 Thr Pro ll~ Ph~ Thr Pro Pro lle 11- Phe Ph- lle Val Asn Asn Trp Al4 GIY 186 Leu lle Ser LYS Ser Tyr Thr S~r Gly Arg Il- 197 ~et Ser Ser S~r Pro Glu Ala Glu Thr ~et Glu CYS Gly lle Ser S~r Ser 214 AAA GTA CAC GAC TCT AAA ACT AAT ACT ACC TAC GGA ATT ATA CAT AAC AGC ATC 135~0 Lys Val His Asp Ser LYS Thr Asn Thr Thr Tyr Gly lle Ila His Asn Ser 11- 23~

Asn Gly Thr AsP Thr Thr Leu Phe Asp Thr Phe Pro Asp Ser Thr AsP Asn Ala 250 Glu Val Thr Gly AsP Val Asp Asp Val Lys Thr Glu Ser Ser Pro Glu Ser Gln 268 Ser Glu Asp Leu Ser Pro Phe Gly Asr\ Asp GIY Asn Glu Ser Pro Glu Thr Val 286 ACG GAC ATT GAT GCA GTT TCA GCT GTG CGA ATG CAG TAT AAC AAT GTT TCA TCG 156~
Thr AsP Ile Asp Ala ~al Ser Ala Val Arg ~et Gln Tyr Asn Asn Val Ser Ser 304 Leu Ser Pro G1Y Ser Glu Gly Tyr Ile Tyr Val Cys Thr LYS Arg GIY Asp Asn 322 Thr LYS Arg LY5 Val Ile Val Lys Ala Val Thr G1Y Asp LYS Thr Leu GIY Ser 340 Glu Il- Asp Ile Leu LYS LYS ~et Ser His Arg Ser Ile Ile Arg Leu Val His 358 Ala Tyr Arg Trp LYS Ser Thr Val Cys ~et Val ~et Pro LY5 Tyr Lys Cys Asp 376 Leu Ph- Thr Tyr Ile Asp Ile ~et Gly Pro Leu Pro Leu Asn Gln ~le Il- Thr 394 ATA GAA CGG GGT TTG CTT GGA GCA TTG GCA TAT ATC CAC GAA AAG GGT ATA ATA t890 Ile Glu Arg Gly Leu Leu Gly Ala Leu Ala Tyr Ile His Glu Lys Gly Ile Ile 412 CAT CGT GAT GTA AAA ACT GAA AAT ATA TTT TTG GAC AAA CCT GAA AAT GTA GTA 194q His Arg Asp Val Lys Thr Glu Asn Ile Phe Leu Asp Lys Pro Glu Asn Val Val 430 Leu GlY Asp Phe GIY Ala Ala Cy5 Lys Leu Asp Glu His Thr Asp LYS Pro LYS 44e Cys Tyr Gly Trp Ser GlY Thr Leu Glu Thr Asn Ser Pro 61u Leu L-U Ala LeU 466 Asp Pro Tyr Cys Thr LYS Thr Asp Ile Trp Ser Ala Gly Leu Val Leu Phe Glu 484 ~et Ser Val LYS Asn Ile Thr Phe Phe Gly LYS Gln Val Asn GIY Ser Gly Ser 502 Gln Leu Arg Ser lle Ilo Arg CYS Leu Gln Val His Pro Leu Glu Phe Pro Gln 520 Asn Asn Ser Thr Asn Leu Cys Lys His Phe LYS Gln Tyr Ala lle Gln Leu Arg 538 His Pro Tyr Ala Ile Pro Gln Ile Ile Arg Lys Ser Gly ~et Thr ~et Asp Leu 556 Glu Tyr Ala lle Ala LYS ~st Leu Thr Phe Asp Gln Glu Phe Arg Pro Ser Ala 574 Gln Asp Ilo Leu ~st L-u Pro Leu Phe Thr Lys Glu Pro Ala Asp Al~ L-u Tyr S92 Thr Ile Thr Ala Ala His ~et 599 TATAcTAcGcGTTAccTGcAATAATGAcAAcATTcGAAGTcTTTGAAGATTcGcAGAccTTTTTTGcGAATG 2566 ~-t 600 Ala Pro Ser GlY Pro Thr Pro Tyr Ser His Arg Pro Gln Ile LYS His Tyr Gl~ 618 Thr Phe Leu Asp Cys ~et Arg Tyr Thr LeU Asn A5P Glu Ser LYS Val Asp Asp 636 AGA TGT TCA GAC ATA CAT AAC rcc TTA GCA CAA TCC AAT GTT ACT TCA AGC ATG 2728 Arg CYS Ser Asp Ile His Asn Ser Leu Ala Gln Ser Asn Val Thr Ser Ser ~et 6S4 Ser Val ~et Asn Asp Ser Glu Glu TYr Pro Leu Ile Asn GIY Pro Ser ~et Gln 672 Ala Glu AsP Prr Lys Ser Val Phe Tyr Ly5 Val Arg Lys Prr. Asp Arg Ser Ar~ 69C

Asp Phe Ser Trp Gln Asn Leu Asn Ser His G1Y Asn Ser Gly Leu Arg Arg Glu 708 Lys Tyr Ile Arg Ser Ser Lys Arg Arg Trp Lys Asn Pro Glu Ile Phe Lys Val 726 Ssr Leu Lys Cys GIU Ser Ile GIY Ala Gly Asn Gly Ile Lys Ila Ser Phe Ser 744 Phe Phe 746 ~et Lys Val Phe Phe 7S1 Phe Arg Tyr Ile Ser Ser Thr Arg ~et Ile Leu Ile Ile Cys Leu Leu Leu Gly 769 Ile Gly Asp ~et Ser Ala ~et Gly Leu LY5 LY5 AsP Asn Ser Pro Ile Ile Pro 787 Thr Leu His Pro LY5 GlY Asn Glu Asn Leu Arg Ala Thr Leu Asn Glu TYr LYS 805 Ile Pro Ser Pro Leu Phe AsP Thr Leu Asp Asn Ser Tyr Glu Thr LYs His Val 823 I1R Tyr Thr Asp Asn Cys Ser Phe Ala ~al Leu Asn Pro Phe G1Y Asp Prr. LY5 841 Tyr Thr Leu L~u Ser Leu Leu Leu ~et G1Y Ar3 Arg Lys Tyr AsP Ala Leu Val 8~9 Ala TrP Phe Val Leu GIY Arg Ala CY5 GlY Arg Pro Ile Tyr Leu Arg Glu Tyr 877 GCC AAC TGC TCT ACT AAT GAA CCA TTT GGA ACT TGT AAA lTA AAG TCC CTA GGA 3637 Ala Asn Cys Ser Thr Asn Glu Pro Phe GlY Thr Cys LY5 Leu Lys Ser Leu Gly 895 Trp Trp Asp Arg Arg Tyr Ala ~et Thr Ser Tyr 119 Asp Arg AsP Glu Leu Lys 913 Leu Ile Ile Ala Ala Pra Ser Arg Glu Leu Ser GIY Leu Tyr Thr Arg Leu 11e 931 Ile Ile Asn GlY Glu Pro Ile Ser Ssr Asp Ile Leu Leu Thr Val Lys Glu Thr 949 Cys Ser Phe Ser Arg Arg G1Y Ile Lys Asp Asn LYS Leu CYS LYS Pro Phe Ser 967 Phe Phe Val Asn Gly Thr Thr Arg Leu Leu Asp ~et Val GIY Thr GIY Thr Pro 985 Arg Ala His Glu Glu Asn Val LYS Gln Trp Leu Glu Arg lle Gly Gly LYS His 1003 Leu Pro lle Val Val Glu Thr Ser ~et Gln Gln Val Ser Asn Leu Pra Ars Ser 1021 Phe Arg Asp Ser Tyr Phe LYS Ser Pro Asp Asp Asp Lys Tyr Asp Asp Val LYS 1039 ~st Thr Ser Ala Thr Thr Asn Asn Ile Thr Thr S-r Val Asp Gly Tyr Thr GIY 1057 Leu Thr Asn Arg Pro Glu Asp Phe Glu LYS Ala Pro Tyr Ile Thr Lys Arg Pro 1075 Ile Ile Ser Val Glu Glu Ala Ser Ser Gln Ser Pro LYS lle Ser Thr Glu Lys 1093 Lys Ser Arg Thr Gln Ile Ile Ile Ser Leu Val Ual Leu Cys Val ~et Phe CYS 1111 Phe Ile Val Ile G1Y Ser Gly Ile Trp Ile Leu Arg Lys His Arg Lys Thr Val 1129 ~et Tyr Asp Arg Arg Ars Pro S-r Arq Arg Ala Tyr Ssr Ars L-u 1144 ~e~ Tyr Leu Leu Gln Leu L~u Phe Trp Il~ Arg 1155 Leu Phe Arg Gly lle Trp Ser Ile Val Tyr Thr G1Y Thr Ser Val Thr Leu Ser 1173 AcG GAC CAA TCT GCT CTT GTT GCG TTC TGC GGA TTA GAT AAA ATG GTG AAT GTA 4635 Thr Asp Gln Ser Ala Leu Val Ala Phe CYS GIY L-u Asp LYs ~et Val Asn Val 1191 CGC GGC CAA CT r TTA TTC CTG GGC GAC CAG ACT CGG ACC AGT TCT TAT ACA GGA 4689 Arg Gly Gln Leu Leu Phe Leu Gly Asp Gln Thr Arg Thr Ser Sdr Tyr Thr GIY 1209 Thr Thr Glu Ile Leu Lys Trp Asp Glu Glu Tyr LYS Cys Tyr Ser Val Leu His 1227 Ala Thr Ser Tyr ~et Asp CYS Pro Ala Ile Asp Ala Thr Val Phe Arg Gly Cys 1245 Arg Asp Ala Val Val Tyr Ala Gln Pro His Asp Arg Val Gln Pro Phe Pro Glu 1263 Lys Glr Thr Leu Leu Arg Ile Val Glu Pro Arg Val Ser Asp Thr G1Y S~r Tyr 1281 Tyr Ile Arg Val Ala Leu Ala GIY Arg Asn ~et Ser Asp lle Phe Arg n.t Ala 1299 Val Ile Ile Arg Ser Ser LYS Ssr Trp aa cys Asn His Ser Ala Ser Ser Phe 1317 Gln Ala Hls LY5 Cys Ile Arg Tyr Val Asp Arg ~et Ala Phe Glu Asn Tyr Leu 1335 Ile Gly His Val G1Y Asn Leu Leu Asp Ser Asp Sar Glu Leu His Ala Ile Tyr 1353 Asn lle Thr Pro Gln Ser Ile Ser Thr Asp Ild Asn Ile lle Thr Thr Pro Phe 1371 Tyr ~sP Asn Ser GIY Thr lle Tyr Ser Prtl Thr Val Phe Asn Le~J Phe Asn Asn 1389 . AAT TCC CAT GTC GAT GCA ATG AAT TC 5255 Asr~ Ser His Val AsP Ala ~et Asn 1397 ~ 7 SEQ ID no. 1 B
. . _ Length of sequence: 1,188 pairs of bases Type of molecule sequenced: genomic DNA
Origin of the molecule: Marek's disease virus, strain RBl B
Experimental source: pMDV 05 plasmid Characteristics:

from 1 to 324 pairs of bases: non-coding region from 325 to 1,135 pairs of bases: USl gene: the gene is transcribed from right to left; the indicated sequence is complementary to the sequence SEQ ID no. 1 22 ~ r~

~let 51/ Val S-r GAG~TC~6ACC6GCCCAGTTATTAA~AATAA~A~A6ATTATTG6T5~A,15AA6 A15 G~JT 5T6 TCC 1189 !1st Ile T~,r lle V~l Thr 'eu Lau ~;F 61U C;~ A~P Ar~ ?U Pro 61/ Ar~ ~er AT6 ATA ACT ATA bTC ACA CTT CTA 5AT 6AA T5C 6AT GJA TT5 CCA 6GA AGA TCT 111 Ar~ A5F Al~ Ala Ser Thr Leu Tr~ il9 Phe Leu Ile LY, Glr, C~s Met 61U Glr, hGA GAT 6CT GCA TCT ACT TTA TGG ATA TTC CTT ATA AAG CAA TGT ATG GAA CAA 1069 Ile Gln Asp AsF Val 61Y Val Pro Ile Ile ~ai ArQ Ala Ala Asp Leu Phe Ar~
: ATA CAG 6AT GAT GTG GGT GTG CCC ATA ATC GTC AGA GCT 6CA GAC CTA TTC CGT 1015 Phe Ala Ly; Pro Met Leu Ile Leo Pro ArQ 51r His Ar~ Pro Ile Val Ar~ Thr LYS Pro Pro A;p G1Y Thr Gly Val ArQ 61y Thr Gly Leu Ala Gly Thr Ar~ Asp Ser Phe 11e Val Ar~ Leu Phe GIU Asp ~al Ala 61Y CYS Ser Thr Glu TrF Gln TCG TTT.ATA GT6 CG6 CTA TTT GAA GAT 5TT 6CA ÇGA TGT TCC ACA GAA T56 CAG 8S3 Asp Val L9U Ser 61y Tyr Leu Met L91J 51U ~er Glu Val Ser 51y Asr, Ala Pro GAT 5TT CTA TCT GGA -TAT TT6 At6 TTG GAA TCT GAA 6TT TCT G5T AAT GC CCA '99 His Ser l.el~ Trp Ile Val Gly Ala Ala AsF Ile Cys ArQ lle Ala Leu Glu C~s : Ile Pro Le~J Pro Lys ArQ Le~J Leu Ala Ile Lys ~al Ser Gly Thr 1`rF Ser 51y ATT ÇCT TTG CCA AAA AGG TTA CTT GCA ATC AAA GT6 TCT b6G ACC -5G TCC 6GT 691 ~et ~ro Trp Ala lle Pro A;p A~r, Il9 Gln Thr Leu Leu Thr Ser Thr Trp 61u ATG CCG TGG 5CC ATT CCC GAC AAT ATr CAA ACT CTC TlG ACA TCT ACA TG6 6~A 637 Pro ~Y5 Phe As~ T~lr Pro Glu A;P ArQ Ala His Phe Cy5 AsP Ser Asp ~et Val CCG AA6 TTC 6AC ACC CCA 6AA 6AT A6A GCG CnT TTT TGC GAC AGT 5AT ATG 6TA 583 Çys Val Tfr L~fs Ile Leu G1Y ~er Pro Pro Asr, Pro Leu Lfs Pro Pro 61u Ile .~ Glu Pro Pro Glr ~et 5~r Ser Thr Pro G1Y Ar~ Lau Phe CYS C~s G1Y LY5 Cys 1~ 5AA CCA CÇT CAA AT6 A6T AGT ACA CCC 56C A6A TTA TTC T6T TGT 6GA AAA TGT 475 ÇY; LY; LYS Glu Asp Ar~ Asp Ala Ile Ala 11e Pro ~al Ar~ TYr Thr Ala Th~
T6C AAG AAA GAA 6AT A6A GAT GCG ATT GCA ATT CCG 6TT CGT TAC ACT GCG ACA ~67 Gly Ly~ S~n Ang IIQ 61n LY5 LY5 Cyi Ar~ Ala GIY Ser His 6GA~ AAG TCA CGA ATA CA6 AAA AAA TGT AGA GCC GGT AGT CAT TA6CT6TTATTCGAC 310 CAAcc6rcGcTATAGTGTcAcGTATAATTTGTATATTAcTGcAATAAcAAAcccTTcTAGATcAcTTATGTA 166 TCCA6GCTATCTTCCATATACTTCTAACATCAGGA6AGATTCAACAATCGAGC6CATTTGAAAGACAAC6Ar 94 GATTAcTAATGTAAATTTTTG

:
.

, - ~ :. . , . - :
,:~ ' "

~ ,~s _, d?, f' ~ ' i ~ 23 - 26361-74 SEQ I D no. 2 Type of sequence: oligonucleotide Length of sequence:
Type of molecule: DNA
5 ' GGA CTC GAA ~CCA TGIG AGT CTA TTA CC 3 ' SEQ ID no. 3 Type of sequence: oligonucleotide Length of sequence:
Type of molecule: DNA
5 ' GAC GGG TGT CGA CAT ATG AG 3 ' Sal I
SEQ I D no. 4 _ Type of sequence: oligonucleotide Length of sequence:
Type of molecule: DNA
5 ' CTG GAG CCC ATG GFG CAC CTT TG 3' NCOl -SEQ ID no. 5 Type of sequence: oligonucleotide Length of sequence:
Type of molecule: DNA
5 ' CAA ATT GCT ATT GTC GA IC ACC TCC GCC TCT C 3 ' Sal I

Claims

1. Nucleotide sequence, and its variants, from the unique short domain (Us) of the virus of Marek's disease, characterized in that it corresponds to the US3 gene, is non-essential to replication, and is homologous with the kinase protein gene of the herpes simplex virus.

2. Nucleotide sequence US3 of the MDV virus, and his variants, according to claim 1 appearing on the sequence ID
no. 1.

3. Nucleotide sequence ID no. 1 and genes and their variants including this sequence.

4. Recombinant virus selected from the herpes virus, comprising at least one heterologous gene inserted into the Us region of the genome of said virus corresponding to the yene of the kinase protein.

5. Recombinant virus according to claim 4, characterized in that the gene is a coding gene for a viral, bacterial or parasitic immunogene.

6. Recombinant virus of Marek's disease according to claim 5, comprising at least one heterologous gene, characterized in that this gene is inserted into the region of its genome corresponding to the US3 gene, in such a way so as to be able to be expressed.

7. Recombinant virus according to claim 6, characterized in that the inserted heterologous gene codes for a pathogen selected from the group consisting of infectious avian bronchitis, Newcastle's disease, Gumboro's disease, fowl plague, chicken anaemia, egg-drop syndrome, fowl pox, infectious laryngo-tracheitis, avian coli bacillosis, pasteurelosis, coccidiosis, haemophilosis.

8. Recombinant virus according to one of claims 6 and 7, characterized in that this is the MDV virus.

9. Recombinant virus according to one of claims 6 and 7, characterized in that this is the HVT virus.

10. Recombinant virus according to claim 9, characterized in that the inserted gene codes for an immunogene of a Marek's disease virus of serotype 1 or 2.

11. Recombinant virus according to any one of claims 4 to 10, characterized in that the gene is inserted in order to be expressed under the control of the transcription regulating sequences of the gene of the kinase protein.

12. Recombinant virus according to one of claims 4 to 11, characterized in that the heterologous gene inserted is likely to be expressed under the control of promoting sequences of the virus in question, or other herpes viruses.

13. Recombinant virus according to any one of claims 4 to 12, characterized in that the start and stop codons of the gene inserted are substituted for those of the US3 gene.

14. Vaccine characterized in that it comprises a recombinant virus according to any one of claims 3 to 9.

15. Process for preparation of a recombinant virus of Marek's disease, characterized in that at least one heterologous gene is inserted into the region of its genome corresponding to the US3 gene, in such a way so as to be able to be expressed.