CA2004364C - Antisense oligonucleotides to c-myb oncogene and uses thereof - Google Patents

Abstract

ANTISENSE OLIGONUCLEOTIDES TO C-MYB
PROTO-ONCOGENE AND USES THEREOF
Abstract of the Disclosure Oligonucleotides are provided having a nucleotide sequence complementary to at least a portion of the mRNA
transcript of the human c-myb gene. These "antisense"
oligonucleotides are hybridizable to the c-myb mRNA
transcript. Such oligonucleotides are useful in treating hematologic neoplasms and in inducing immunosuppression.
They are particularly useful as bone marrow purging agents.

6056-72 (CIP)2 CN
/tep

Description

ssw~~~~~i~

ANTISENSE OhIGONI1C7LEOTIDES TO C-i~IB
PROTO-ONCOGENE AND USES THEREOF
Field of the Invention The invention relates to antisense oligonucleotides to proto-oncogenes, and in particular to antisense oligo nucleotides to the c-myb gene, and the use of such oligo nucleotides as antineoplastic and immunosuppressive agents.
Background of the Invention Antisense Oliganucleatides The proto-oncogene c-myb is the normal cellular homologue of the avian myeloblastosis virus-transforming gene v-~nyb. The c-xnyb gene nodes for a nuclear protein expressed primarily in hematopoietic cells. It is a proto-oncogene, that is, it codes for a protein which is required for the survival of normal, non-tumor cells.
When the gene is altered in the appropriate manner, it has the potential to become an oncogene. Oncogenes are genes whose expression within a cell provides some function in the transformation from normal to tumor cell.
6056-72 (CIP)2 CN
/tep The human c-myb gene has been isolated, cloned, and sequenced. Majello et al, Proc. Natl. Acad. Sci. U.S.A.
83, 9636-9640 (1986).
C-myb is preferentially expressed in primitive hematopoietic tissues and hematopoietic tumor cell lines of several species. Westin et al., Proc. Natl. Acad.

Sci. U.S.A. 79 2194 (1982). As cells mature, c-myb expression declines. Duprey et al., Proc. Natl. Acad.

Sci. U.S.A. 82, 6937, (1985). The constitutive expres-sion of exogenously introduced c-myb inhibits the eryth-roid differentiation of a marine erythroleukemia cell line (MEL) in response to known inducing agents. Clarke et al., Mol. Cell. Biol. 8, 884-892 (Feb. 1988).

Although these data may implicate the c-myb gene product as a potentially important regulator of hematopoietic cell development, this evidence is largely of an indirect nature.

Some investigators report that c-myb may play an important role in regulating hematopoietic cell proiif-eration, and perhaps differentiation, Slamon et al, Science 233r 347 (1986) ~ Westin et al, supra; Duprey et al, supra. The function of the c-myb proto-oncogene in normal hematopoiesis remains speculative.

Expression of specific genes may be suppressed by oligonucleotides having a nucleotide sequence complemen-tary to the mRNA transcript of the target gene. This 'antisense" methodology finds utility as a molecular tool for genetic analysis. Antisense oligonucleotides have been extensively used to inhibit gene expression in normal and abnormal cells in studies of the function of various proto-oncogenes.

Proliferation of the human promyelocytic leukemia cell line HL-60, which over-expresses the c-myc proto-oncogene, is inhibited in a sequence-specific, dose-dependent manner by an antisense oligodeoxynucleotide 6056-72 (CIP)2 CN
/tep ~a directed against a predicted hairpin loop containing the initiation codon of human c-myc. Wickstrom et al, Proc.

Natl. Acad. Sci. USA 85, 1028-1032 (Feb. 1988). Inhibi-tion of c-myc expression and/or cell proliferation in HL-60 or other cells by c-myc antisense oligonucleotides is described by the following: Loke et al, Clin. Res. 36 (3), 443A (abstract) (1988); Holt et al, Mol. Cell.

Biol. 8, 963-973 (Feb. 1988); Yakoyama et al, Proc.

Natl. Acad. Sci. U.S.A. 84, 7363-7367 (Nov. 1987); Fiarel-Bellan et al, J. Immunol. 140, 2431-2435 (Apr. 1988) and J. Cell. Biochem. Supplement 12A, 167 (Jan. 1988).

Antisense methodology has been used to study the expression of c-fos, another proto-oncogene. C-fos expression and cell transition from Go to renewed growth is inhibited in 3T3 fibroblast cells transformed with an antisense oligodeoxynucleotide to the proto-oncogene.

Nishikura et al, Mol. Cell. Biol. 7, 639-649 (Feb. 1987) and J. Cell. Biochem. Supplement 11A-D, 146 (1987).
Also see Riabowol et al, Vital. Cell. Biol. 8, 1.670-1676 (April 1988).

Mercola et al, Biochem. Biophys. Res. Comm. 147, 288-294 (Aug. 1987) disclose transfection of v-sis trans-formed cells with a plasmid directing expression of anti-sense c-fos RNA. The transfected cells exhibited a decrease in growth.

Groger et al., Proceedings American Assn. for Cancer Research 29, 439 (March 1988) report inhibition of c-fos expression in both transformed and non-transformed human hematopoietic cells by an Epstein Barr virus episomal vector containing c-fos antisense RNA.

Transfection of transformed MethA fibroblast and non-transformed 3T3 cells by antisense RNA to the onco-gene p53 has resulted in reduction of growth rate and cell proliferation. Shohat et al., Oncogene 1, 277-283 (1987).

6056-72 (CIP) 2 CN
/tep _q_ Penno et al., American Journal of Human Genetics 39 (3), Supplement, A38 (1986) report inhibition of Y1 mouse adrenal carcinoma cell growth after transfection with a plasmid directing antisense to the Ki-ras oncogene.

Reed et al., J. Cell. Biochem. Supplement 12A, 172, (Jan. 1988) report inhibition of leukemic B cells and normal peripheral blood lymphocytes with antisense aliganucleotides 'to bcl-2, a gene suggested to have oncogenic potential.

U.S. Patent 4,689,320 discloses inhibition of viruses using antisense oligodeoxynucleotides as anti-viral agents.

While the antisense methodology is a useful tool far genetic analysis, TIG, Jan. 1985, p.22-25, antisense oligonucleotides have not been used as anti-tumor agents in practical applications. Moreover, there have been no reports of antineoplastic agents utilizing antisense oligonucleotides complementary to c-myb mRNA.

Bone Marrow Puroing Bone marrow transplantation is of two types.

Allogeneic transplantation comprises the removal of healthy bone marrow cells from a donor and transplanta-tion into a recipient having incomplete, incompetent or diseased bone-marrow. Autolagaus transplantation invol-ves removal of diseased bone marrow, in vitro purging of the removed marrow of diseased cells, and return of the marrow to the same individual. Autologous transplant is preferable to allogeneic transplant since the need for tissue-typing and immunosuppression of the recipient, and possible tissue rejection, is obviated.

Bone marrow purging of tumor cells in autologous grafting is presently accomplished by in vitro incubation of the transplanted marrow with anti-cancer agents.
Many drugs and antibodies have been evaluated as purging agents. See Dicke et al., (eds) Autologous Bone Marrow 6056-72 (CIP)2 CN
/tep ~~~~~~~)~
_5_ Transplantation, Proceedings of the Third Tnternational Symposium (The University of Texas, M.D. Anderson Hospital and Tumor Institute, Houston, Texas, 1987).

Such drugs are highly toxic, and must be used at rela-y tively high doses in order to maximize tumor cell kill.

High doses may lead to the death of a substantial number of normal marrow cells and/or graft failure. At lower doses, some tumor cells may survive the purging proced-ure, accounting for the relatively high rate of malig-nancy relapse in patients undergoing autologous trans-plantation.

What is needed is an antineoplastic agent useful for treating hematologic neoplasia. In particular, a bone marrow purging agent is needed which effectively purges marrow of all malignant cells, while leaving normal marxow cells substantially intact.

Summary of the Invention Antisense oligonucleotides and pharmaceutical compositions thereof with pharmaceutical carriers are provided. Each oligonucleotide has a nucleotide sequence complementary to at least a portion of the mRNA trans-cript of the human c-myb gene. The oligonucl2otide is hybridizable to the mRNA transcript. Preferably, the oligonucleotide is at least a 15-mer oligodeoxynucleo-tide, that is, an oligomer containing at least 15 deoxy-nucleotide residues. Most preferably, the oligodeoxynuc-leotide is a 15- to 21-mer. While in principle oligonuc-leotides having a sequence complementary to any region of the c-myb gene find utility in the present invention, oligodeoxynucleotides complementary to a portion of the c-myb mRNA transcript (i) including the translation initiation codon, and/or (ii) beginning with the second codon from the 5' end of the transcript, are particularly preferred.
6056-72 (CIP)2 CN
/tep ~~~~~?~
-s-As used in the herein specification and appended claims, unless otherwise indicated, the term 'oligonuc-leotide" includes both oligomers of ribonucleotide i.e., oligoribonucleotides, and oligomers of deoxyribonucleo-tide i.e., oligodeoxyribonucleoti.des (also referred to herein as "oligodeoxynucleotides").

As used herein, unless otherwise indicated, the term "oligonucleotide' also includes oligomers which may be large enough to be termed polynucleotides".

The terms "oligonucleotide' and "oligodeoxynucleo-tide" include not only oiigomers and polymers of the biologically significant nucleotides, i.e. nucleotides of adenine ('A"), deoxyadenine ("dA"), guanine ("G"), deoxy-guanine (''dG"), cytosine ("C"), deoxycytosine ("dC'), thymine ( "T' ) and uracil ('U' ) , but also oligomers and polymers hybridizable to the c-myb mRNA transcript which may contain other nucleatides. Likewise, the terms "oligonucleotide" and 'oligodeoxynucleotide' include oligomers and polymers wherein one ar more purine or pyrimidine moieties, sugar moieties or internucleotide linkages is chemically modified.

The term "downstream when used in reference to a direction along a nucleotide sequence means the 5-3' direction. Similarly, the term "upstream' means the 3'-5' direction.

The invention provides a method for treating hematologic neoplasms ~.n vivo or ex vivo comprising administering to an individual or cells harvested from the individual an effective amount of c-~nyb antisense oligonucleotide. The invention also provides a method for treating an individual to induce immunosuppression by administering to the individual an effective amount of such oligonucleotide.

In one embodiment, the method for treating hemato-logic neoplasms comprises a method for purging bone 6056-72 (CIP)2 CP1 /tep ~~~~~~,b~
_7-marraw of such neoplasms. Aspirated bone marrow cells are treated with an effective amount of a c-myb antisense oligonucleotide as described above.

Description of the Figures Figure 1 shows the effect of the c-myb antisense oligodeoxynucleotide in inhibiting phytohemagglutinin-stimulated lymphocyte proliferation. Normal blood lymphocytes were treated at various times with phytohema-gglutinin and/or the c-myb antisense oligodeoxynucleotide 5'-GCC CGA AGA CCC CGG CAC-3'.

Figure 2 is a series of microscopic: (200X) photo-graphs o.f untreated seven-day cultures of normal human myeloid cell colonies (Fig. 2A); ARH-77, an TgG-secreting plasma cell leukemia (Fig. 2B); and HL-60 promyelocytic leukemia cells (Fig. 2C).

Figure 3 is a series of microscopic (40X) photo-graphs of a 1:1 mixture of ARH-77 cells and normal hematopoietic progenitor cells exposed to 40 ~cg/ml (t=0) plus 20 ~sg/ml (t=18 haurs) of the c-myb sense oligo-deoxynucleotide 5'-GCC CGA AGA CCC CGG CAC-3' (Fig.
3A);

10 ~g/ml (t=0) plus 5 ~g/ml (t=18 hours) of the c-myb antisense oligodeoxynucleotide 5-GTG CCG GGG TCrr TCG

GGC-3' (Fig. 3B); and 40 ug/ml (t=0) plus 20 ~.g/ml (t=28 hours) of the same c-myb antisense oligomer (Fig. 3C).

The photographs were taken at t=day 7.

Figure 4A is a high magnification (200X) view of the persisting narmal myeloid calany indicated by arrows in Figure 3C. Figure 4B is a 200X view of the plasma cell leukemia cells shown is Figure 3A.

Figure 5 is a series of microscopic (40X) photo-graphs of a 1:1 mixture of HL-60 cells and normal hemato-poietic progenitor cells exposed to 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the c-myb sense oligadeoxynuc-leatide 5'-GCC CGA AGA CCC CGG CAC-3'(Fig. 5A); 10 ,ug/ml (t=0) plus 5 ~g/ml (t=18 hours) of the c-myb antisense 6056-72 (CIP)2 CN
/tep e~~~~~~'~~
-g-oligodeoxynucleotide 5'-GTG CCG GGG TCT TCG GGC-3'(Fig.
5B); and 40 ug/ml (t=0) plus 20 ug/ml (t=18 hours) of the same c-myb antisense oligomer (Fig. 5C). The photographs were taken at t=day 7.

Figure fiA is a high magnification (200X) view of 'the persisting normal myeloid colony (small arrow) and degenerating HL-60 colony (large arrow) indicated by the same size arrows in the corresponding lower power view of Figure 5C; Figure 6B is a 200X view of the AIL-60 cells shown in Figure 5A.

Figure 7 shows the effect of the same c-myb anti-sense oligodeoxynucleotide in inhibiting lymphocyte proliferation in a mixed lymphocyte reaction, as deter-mined by cell count (Fig. 7A) and tritiated thymidine incorporation (Fig. 7B).

Figure 8A shows the effect of maintaining a human T

cell leukemia line and normal bone marrow mononuclear cells in the absence of c-~nyb oligodeoxynucleotides (CONT-T LEUK and CONT-BMC, respectively), or in the presence of 40 ~,g/m1 (t=0), followed by 10 ~g/m1 (t=18 hours), a-myb sense oligodeoxynucleotide (T-LEUK-MYB
S

and BMC-MYB S, respectively). Figure 8B shows the effect on the same cell lines of 20 ~g/ml (t=0), followed by ~g/ml (t=18 hours) of c-myb antisense oligodeoxynucleo-tide (LEUK-MYB AS, BMC-MYB AS). Daily cell counts and viability determinations were performed. Results presen-ted are the mean standard deviation of four experi-ments. The sense and antisense oligodeoxynucleotides were the same as in Figure 5.

Figure 9 is a series of photomicrographs (100X) of T leukemia cells maintained in liquid suspension culture for four days and then cultured in methylcellulose for an additional ten days. Colonies formed by cells in a control culture containing no oligomers appear in Figure 9A. Colonies formed by cells exposed to c-x~nyb sense 6056-72 (CTP)2 CN
/tep D
-oligodeoxynucleotide (20 ~g/ml, t=0; plus 5 ~g/ml, t=18 hours) are shown in Figure 9B. Cells exposed to c-myb antisense oligodeoxynucleotide (20 ~cg/ml, t=0; plus ug/ml, t=18 hours) are shown in FicJure 9C. The sense and 5 antisense oligadeaxynucleotides were the same as in Figure 5.

Figure 10 is a series of low and high magnification photomicrographs of Wright~s stained cytocentrifuge prep-arations of T leukemia cells (Fig. 10A: 100X; Fig. 10B:

400X) and a mixture of bane marrow cells and T leukemia cells (Fig. 10C: 100X; Fig. 10D: 400X). T leukemia cells were cultured in the presence of c-myb sense oligodeoxy-nucleotide. The bone marrow/T-leukemia cell mixture was cultured in the presence of c-myb antisense oligodeoxy-nucleotide. The sense and antisense oligodeoxynucleo-tides were the same as in Figure 5.

Figure 11 is a series of low and high magnification photomicrographs of myeloid leukemia cells (Fig. 11A:

100X; Fig. 11B: 400X), normal bone marrow cells (Fig.

11C: 100X; Fig. 11D: 400X), and a 1:1 mixture of leukemia cells and normal bone marrow cells (Fig. 11E: 100X;
Fig.

11F: 400X) cloned in plasma clot culture after exposure to c-myb antisense oligadeoxynucleotide, and then stained in situ. Stars in Figure 11F mark mature myeloid ele-ments (polymorphonuclear leukocytes, bands, and meta-myelocytes). The antisense oligodeoxynucleotide was the same as in Figure 5.

Detailed Description of the Inventioxa We have discovered that the c-myb gene plays a critical role in regulating normal human hematopoiesis.

We have further discovered a differential sensitivity of normal and malignant hematopoietic cells to c-myb anti-sense oligonucleotides, that is, aligonucleotides comple-mentary to and hybridizable with the mRNA transcript of the human c-myb gene. This differential sensitivity 6056-72 (CIP)2 CN
/tep makes possible the use of c-myb antisense oligonucleo-tides as effective anti-neoplastic agents, in particular, in the purging of neoplastic cells from bone marrow.
While many drugs and antibodies have been evaluated as bone marrow purging agents, the present invention is particularly advantageous for this application. The c myb antisense oligonucleotides are much less toxic to normal cells at effective purging doses than known purging agents. A greatly increased engraftment rate of purged marrow is thus possible. Moreover, because of their high therapeutic index, the antisense oligonucleo-tides of the invention may be employed in combination regimens with more conventional agents, which could then be employed at lower doses.
Since many more normal progenitors survive exposure to the c-myb antisense oligomers than is typically observed after optimal exposure to standard chemothera-peutic agents, higher doses of c-myb antisense may be utilized in comparison to such standard agents.
The c-myb antisense oligonucleotides are also useful as immunosuppressive agents, as they inhibit proliferation of normal human peripheral blood lympho-cytes.
The putative DNA sequence complementary to the mRNA
transcript of the human c-myb gene has been reported in Majello et al, Proc. Natl. Acad. Sci. U.S.A. 83, 9636 9640 (1986). That sequence, and the predicted 640 amino acid sequence of the putative c-myb protein, are as follows:
GGCGGCAGCGCCCTGCCGACGCCGGGGAGGGACGCAGGCAGGCGGCGGGC
AGCGGGAGGCGGCAGCCCGGTGCTCCCCGCGGCTCTCGGCGGAGCCCCGCCGCCCGCCGCGCC
ATGGCCCGAAGACCCCGGCACAGCATATATAGCAGTGACGAGGATGATGAGGACTTTGAGATG
MetAlaArgArgProArgHisSerIleTyrSerSerAspGluAspAspGluAspPheGluMet 5056-72 (CIP) 2 CN
/tep _11_ TGTGACCATGACTATGATGGGCTGCTTCCCAAGTCTGGAAAGCGTCACTTGGGGAAAACAAGG
CysAspHisAspTyrAspGlyLeuLeuProLysSerGlyLysArgHisLeuGlyLysThrArg TGGACCCGGGAAGAGGATGAAAAACTGAAGAAGCTGGTGGAACAGAATGGAACAGATGACTGG
TrpThrArgGluGluAspGluLysLeuLysLysLeuVal.GluGlnAsnGlyThrAspAspTrp AAAGTTATTGCCAATTATCTCCCGAATCGAACAGATGTGCAGTGCCAGCACCGATGGCAGAAA
LysValIlPAlaAsnTyrLeuProAsnArgThrAspValGlnCysGlnHisArgTrpGlnLys GTACTAAACCCTGAGCTCATCAAGGGTCC'rTGGACCAAAGAAGAAGATCAGAGAGTGATAGAG
ValLeuAsnProGluLeuIleLysGlyProTrpThrLysGluGluAspGlnArgValIleGlu CTTGTACAGAAA'rACGGTCCGAAACGTTGGTCTGTTATTGCCAAGCACTTAAAGGGGAGAATT
LeuValGlnLysTyrGlyProLysArgTrpSerValIleAlaLysHisLeuLysGlyArgIle GGAAAAC.AATGTAGGGAGAGGTGGCATAACCACTTGAATCCAGAAGTTAAGAAAACCTCCTGG
GlyLysGlnCysArgGluArgTrpHisAsnHisLeuAsnProGluValLysLysThrSerTrp ACAGAAGAGGAAGACAGAATTATTTACCAGGCACACAAGAGACTGGGGAACAGATGGGCAGAA
ThrGluGluGluAspArgIleIleTyrGlnAlaHisLysArgLeuGlyAsnArgTrpAlaGlu ATCGCAAAGCTACTGCCTGGACGAACTGATAATGCTATCAAGAACCACTGGAATTCTACAATG
IleAlaLysLeuLeuProGlyArgThrAspAsnAlaIleLysAsnHisTrpAsnSerThrMet 6056-72 (CIP)2 CN
/tep CGTCGGAAGGTCGAACAGGAAGGTTATCTGCAGGAGTCTTCAAAAGCCAGCCAGCCAGCAGTG
ArgArgLysValGluGlnGluGlyTyrLeuGlnGluSerSerLysAlaSerGlnProAlaVa1 GCCACAAGCTTCCAGAAGAACAGTGATTTGATGGGTTTTGC'i'CAGGCTCCGCCTACAGCTCAA
AlaThrSerPheGlnLysAsnSerHisLeuMetGlyPheAlaGlnAlaProProThrAlaGln CTCCCTGCCACTGGCCAGCCCACTGTTAACAACGACTATTCCTATTACCACATTTCTGAAGCA
LeuProAlaThrGlyGlnProThrValAsnAsnAspTyrSerTyrTyrHisIleSerGluAla CAAAATGTCTCCAGTCATGTTCCATACCCTGTAGCGTTACATGTAAATATAGTCAATGTCCCT
GlnAsnValSerSerHisValProTyrProValAlaLeuHisValAsnIleValAsnValPro CAGCCAGCTGCCGCAGCCATTCAGAGACACTATAATGATGAAGACCCTGAGAAGGAAAAGCGA
GlnProAlaAlaAlaAlaIleGlnArgHisTyrAsnAspGluAspProGluLysGluLysArg ATAAAGGAATTAGAATTGCTCCTAATGTCAACCGAGAATGAGCTAAAAGGACAGCAGGTGCTA
IleLysGl.uLeuGluLeuLeuLeuMetSerThrGluAsnGluLeuLysGlyGlnGlnValLeu CCAACACAGAACCACACATGCAGCTACCCCGGGTGGCACAGCACCACCATTGCCGACCACACC
ProThrGlnAsnHisThrCysSerTyrProGlyTrpHisSerThrThrIleAlaAspHisThr AGACCTCATGGAGACAGTGCACCTGTTTCCTGTTTGGGAGAACACCACTCCACTCCATCTCTG
ArgProHisGlyAspSerAlaProValSerCysLeuGlyGluHisHisSerThrProSerLeu CCAGCGGATCCTGGCTCCCTACCTGAAGAAAGCGCCTCGCCAGCAAGGTGCATGATCGTCCAC
ProAlaAspProGlySerLeuProGluGluSerAlaSerProAlaArgCysMetIleValHis CAGGGCACCATTCTGGATAATGTTAAGAACCTCTTAGAATTTGCAGAAACACTCCAA.TTTATA
GlnGlyThrIleLeuAspAsnValLysAsnLeuLeuGluPheAlaGluThrLeuGlnPheIle GATTCTTTCTTAAACACT'.CCCAGTAACCATGAAAACTCAGACTTGGAAATGCCTTCTTTAACT
AspSerPheLeuAsnThrSerSerAsnHisGluAsnSerAspLeuGluMetProSerLeuThr TCCACCCCCCTCATTGGTCACAAATTGACTGTTACAACACCATTTCATAGAGACCAGACTGTG
SerThrProLeuIleGlyHisLysLeuThrValThrThrProPheHisArgAspGlnThrVa1 AAAACTCAAAAGGAAAATACTGTTTTTAGAACCCCAGCTATCAAAAGGTCAATCTTAGAAAGC
LysThrGlnLysGluAsnThrValPheArgThrProAlaIleLysArgSerIleLeuGluSer TCTCCAAGAACTCCTACACCATTCAAACATGCACTTGCAGCTCAAGAAATTAAATACGGTCCC
SerProArgThrProThrProPheLysHisAlaLeuAlaAlaGlnGluIleLysTyrGlyPro CTGAAGATGCTACCTCAGACACCCTCTCATCTAGTAGAAGATCTGCAGGATGTGATCAAACAG
LeuLysMetLeuProGlnThrProSerHisLeuValGluAspLeuGlnAspValIleLysGln GAATCTGATGAATCTGGATTTGTTGCTGAGTTTCAAGAAAATGGACCACCCTTACTGAAGAAA
GluSerAspGluSerGIyPheValAlaGluPheGlnGluAsnGlyProProLeuLeuLysLys ATCAAACAAGAGGTGGAATCTCCAACTGATAAATCAGGAAACTTCTTCTGCTCACACCACTGG
IleLysGlnGluValGluSerProThrAspLysSerGlyAsnPhePheCysSerHisHisTrp 6056-72 (CIP)2 CN
/tep ~~~~~~3~

GAAGGGGACAGTCTGAATACCCAACTGTTCACGCAGACCTCGCCTGTGCGAGATGCACCGAAT
GluGlyAspSerLeuAsnThrGlnLeuPheThrGlnThrSerProValArgAspAlaProAsn ATTCTTACAAGCTCCGTTTTAATGGCACCAGCATCAGAAGATGAAGACAATGTTCTCAAAGCA
IleLeuThrSerSerValLeuMetAlaProAlaSerGluAspGluAspAsnValLeuLysAla TTTACAGTACCTAAAAACAGGTCCCTGGCGAGCCCCTTGCAGCC'i'TGTAGCAGTACCTGGGAA
PheThrValProLysAsnArgSerLeuAlaSerProLeuGlnP.roCysSerSerThrTrpGlu CCTGCATCCTGTGGAAAGATGGAGGAGCAGATGACATCTTCCAGTCAAGCTCGTAAATACGTG
ProAlaSerCysGlyLysMetG.luGluGlnMetThrSerSerSerGlnAlaArgLysTyrVa1 AATGCATTCTCAGCCCGGACGCTGGTCATGTGAGACATTTCCAGAAAAGCATTATGGTTTTCA
AsnAlaPheSerAlaArgThrLeuValMet GAACAGTTCAAGTTGACTTGGGATATATCATTCCTCAACATGAAACTTTTCATGAATGGGAGA
AGAACCTATTTTTGTTGTGGTACAACAGTTGAGAGCACGACCAAGTGCATTTAGTTGAATGAA
GTCTTCTTGGATTTCACCCAACTAAAAGGATTTTTAAAAATAAATAACAGTCTTACCTAAATT
ATTAGGTAATGAAfiTGTAGCCAGTTGTTAATATCTTAATGCAGATTTTTTTAAAAAAAAACAT
AAAATGATTTATCTGGTATTTTAAAGGATCCAACAGATCAGTATTTTTTCCTGTGATGGGTTT
TTTGAAATTTGACACATTAAAAGGTACTCCAGTATTTCACTTTTCTCGATCACTAAACATATG
CATATATTTTTAAAAATCAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATT
TAATCCAGATTGTAAATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAA
CCATTTTATGAGTTTTCTGTTAGCTTGCTTTAAAAATTATTACTGTAAGAAATAGTTTTATAA
AAAATTATATTTTTATTCAGTAATTTAATTTTGTAAATGCCAAATGAAAAACGTTTTTTGCTG
CTATGGTCTTAGCCTGTAGACA'I'GCTGCTAGTATCAGAGGGGCAGTACAGCTTGGACAGAAAG
AAAAGAAACTTGGTGTTAGGTAATTGACTA~i'GCACTAGTATTTCAGACTTTTTAATTTTATAT
ATATATACATTTTTTTTCCTTCTGCAATACATTTGAAAACTTGTTTGGCAGACTCTGCATTTT
TTATTGTGGTTTTTTTGTTATTGTTGGTTTATACAAGCATGCGTTGCACTTCTTTTTTGGGAG
ATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGTGTGTAGCCTGACTGTTTTATAATTTGGGA
GTTCTCGATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGG
ATCCTGTGTTTGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAGTCACTGCCTTAAGAAC
ATTTGATGCAAGATGGCCAGCACTGAACTTTTGAGATATGACGGTGTACTTACTGCCTTGTAG
CAAAATAAAGATGTGCCCTTATTTTAAAAAA.AAAAAAAA
6056-72 (CIP)2 CN
/tep ~.) _14-~
The initiation codon ATG appears at position 114, preceded by a 5~-untranslated region. The termination codon TGA at position 2034 is followed by a 3'-untrans-lated region spanning about 1200 nucleotides, which is followed by a poly(A) tail of abowt 140 nucleotides.
The antisense oligonucleotides of the invention may be synthes9.zed by any of the known chemical oligonucleo-tide synthesis methods. Such methods are generally described, for example, in Winnacker, From Genes to Clones: Introduction to Gene Technology, VCH Verlagsge-sellschaft mbH {H. Ibelgaufts trans. 1987).
Any of the known methods of oligonucleotide syn-thesis may be utilized in preparing the instant antisense oligonucleotides.
The antisense olictonucleotides are most advantaa-eously prepared by utilizing any of the commercially available, automated nucleic acid synthesizers. The device utilized to prepare the oligonucleotides described herein, 'the Applied Biosystems 380B DNA Synthesizer, utilizes ,e-cyanoethyl phosphoramidite chemistry.
Since the complete nucleotide synthesis of DNA
complementary to the c-~yb mRNA transcript is known, antisense oligonucleotides hybridizable with any portion of the mRNA transcript may be prepared by the oligonuc-leotide synthesis methods known to those skilled in the art.
While any length oligonucleotide may be utilized in the practice of the invention, sequences shorter than 15 bases may be less specific in hybridizing to the target c-myb mRNA, and may be more easily destroyed by enzymatic digestion. Hence, oligonucleotides having 15 or more nucleotides are preferred. Sequences longer than 18 to 21 nucleotides may be somewhat less effective in inhibi-ting c-myb translation because of decreased uptake by the target cell. Thus, oligomers of 15-21 nucleotides are 6056-72 (CIP)2 CN
/tep i~~'~~~i~

most preferred in the practice of the present invention, particularly oligomers of 15-18 nucleotides.

Ol.igonucleotides complementary to and hybridizable with any portion of the c-myb mRNA transcript are, in principle, effective far inhibiting translation of the transcript, and capable of inducing the effects herein described. It is believed that translation is most effectively inhibited by blocking the mRNA at a site at or near the initiation colon. Thus, oligonucleotides complementary to the 5'-terminal region of the c-myb mRNA

transcript are preferred. It is believed that secondary or tertiary structure which might interfere with hybridi-zation is minimal in this region. Moreover, it has been suggested that sequences that are too distant in the 3' direction from the initiation site may be less effective in hybridizing the mRNA transcripts because of a "read-through phenomenon whereby the ribosome is postulated to unravel the antisense/sense duplex 'to permit translation of the message. See, e.g. Shakin, J. Biochemistry 261, 16018 (1086).

The antisense oligonucleotide is preferably direc-ted to a site at or near the initiation colon for protein synthesis. Oligonucleotides complementary to a portion of the c-myb mRNA including the initiation colon (the first colon from the 5' end of the translated portion of the c-myb transcript, comprising nucleotides 114-116 of the complete transcript) are preferred, as are oligonuc-leotides complementary to the portion of the c-~yb mRNA

beginning with the colon adjacent to the initiation colon (the second colon from the 5' end of the translated portion, comprising nucleotides 117-119 of the complete transcript.

While antisense oligomers complementary to the 5'-terminal region of the c-myb transcript are preferred, particularly the region including the initiation colon, 6056-72 (CIp) 2 CN
/tep ( '/

it should be appreciated that useful antisense oligomers are not limited to those complementary to the sequences found in the translated portion (nucleotides 114 to 2031) of ttie mRNA transcript, but also includes oligomers complementary to nucleotide sequences contained in, or extending into, the 5'- and 3'-untranslated regions. We have shown that oligomers whose complementarity extends into the 5'-untranslated region of 'the c-myb transcript are particularly effective in inhibiting translation.
Oligomers having a nucleotide sequence complementary to a portion of the c-myb mRNA transcript including at least a portion of the 5'-untranslated region therefore comprise one group of preferred oligomers.
The following 15- through 21-mer oligodeoxynucleo tides are complementary to the c-myb mRNA transcript beginning with the second codon of the 'translated portion of transcript (nucleotides 117-1.19 of the complete tran script):
5'-GCT GTG CCG GGG TCT TCG GGC-3' 5'-CT GTG CCG GGG TCT TCG GGC-3' 5'-'I' C't'G CC(; CCG TCT TCG CrC-3' 5'-GTG CCG GGG ~'CT TCG GGC-3' 5'-TG CCG GGG TCT TCG GGC-3' 5'-G CCG GGG TCT TCG GGC-3' 5'-CCG GGG TCT TCG GGC-3' Similarly, the following 15- through 21-mer oligo-deoxynucleotides are complementary to the c-myb mRNA
transcript beginning with nucleotide 111 and extending ' through the initiation site:
5'-CCG GGG TCT TCG GGC CAT GGC-3' 5'-CG GGG TC'f TCG GGG CAT GGC-3' 5'-G GGG TCT TCG GGC CAT GG C-3' 5'-GGG TCT TCG GGC CAT GGC-3' 6056-72 (CTf)?. CN
/tep 5'-GG TCT TCG GGC CAT GGC-3' 5' -G 'I'CT TCG GGC CAT GGC -3 ' 5'-TGT TCG GGC CAT GGC-3' Uligonucleotides hybridizable to the c-myb mRNA

transcript finding utility according to the present invention include not only native oligomers of the biologically significant nucleotides, i.e., A, dA, G, dG, C, dC, T and U, but also oligonucleotide species which have been modified for improved stability and/or lipid solubility. For example, it is known that enhanced lipid solubility and/or resistance to nuclease digestion results by substituting a methyl group or sulfur atam for a phosphate oxygen in the internucleotide phosphodiester linkage. The phosphorothioates, in particular, are stable to nuclease cleavage and soluble in lipid. They may be synthesized by known automatic synthesis methods.

The antisense oligonucleotides of the invention inhibit normal human hematopoiesis. I-Iowever, they inhibit the grawth of malignant hematopoietic cells at a significantly lower concentration than normal cells.

This pharmaceutically significant differential sensitiv-ity makes the instant oligonucleotides very useful in treating hematologic neoplasms.

Hematologic neoplastic cells believed sensitive to the instant cmyb antisense oligonucleotides include, for example, myeloid and lymphatic leukemia cells, malignant plasma (myelomaj cells and lymphoma cells. The appear-ance of these cells in the bone marrow and elsewhere in the body is associated with various disease conditions, such as a11 of the various French-American-British (FABj subtypes of acute myeloid and lymphatic leukemia; chronic lymphatic and myeloid leukemia; plasma cell myeloma and plasma cell dyscrasias; the various~non-~Iodgkin's lymph-omas as described, for example, in the Working Formula-tion classification, Devita, Cancer: Principles and 6056-72 {CIP)2 CIA
f tep -1g-Practice of Oncoloc~y (2d ed. 1985), p. 1634; and possibly Hodgkin's disease.
Hematologic neoplastic cells would likely arise de novo in the marrow. In Hodgkin's disease, and in some of the various lymphomas, tumor cells may metastasize to the marrow from a primary tumor situated elsewhere in the body.
While inhibition of c-myb mRNA translation is possible utilizing either antisense oligoribonucleotides or oligodeoxyribonucleatides, oligoribonucleotides are more susceptible to enzymatic attack by ribonucleases than deoxyribonucleotides. Hence, oligodeoxyribonucleo-tides are preferred in the practice of the present invention.
The antisense oligonucleotides of the invention find utility as bone marrow purging agents. They may be utilized in vitro to cleanse bone marrow contaminated by hematologic neoplasms. They are useful as purging agents in either allogeneic or autologous bone marrow transplan-tation. They are particularly effective in the treatment of hematological malignancies or other neoplasias which metastasize in the bone marrow.
According to a method for bone marrow purging, bone marrow is harvested from a donor by standard operating room procedures from the iliac bones of the donor.
Methods of aspirating bone marrow from donors are well known in the art. Examples of apparatus and processes for aspirating bone marrow from donors are disclosed in U.S. Patents 4,481,946 and 4,486,188. Sufficient marrow is withdrawn so that the recipient, who is either the donor (autologous transplant) or another individual (allogeneic transplant), may receive from about 4 x 10~
to about 8 x 108 processed marrow cells per kg of body-weight. This generally requires aspiration of about 750 to about 1000 ml of marrow. The aspirated marrow is 6056-72 (CIP)2 CN
/tep ~~~~~D~

filtered until a single cell suspension, known to those skilled in the art as a "huffy coat' preparation, is obtained. This suspension of leukocytes is treated with c-myb antisense oligonucleotides :in a suitable carrier, advantageausly in a concentration of about 8 mg/ml.

Alternatively, the leucocyte suspea~sion may be stored in liquid nitrogen using standard procedures known to those skilled in the art until purging is carried owt. The purged marrow can be stored frozen in liquid nitrogen until ready for use. Methods of freezing bone marrow and biological substances are disclosed, for example, in U.S.

Patents 4,107,937 and 4,117,881.

Other methods of preparing bone marrow for treat-ment with c-myb antisense may be utilized, which methods may result in even more purified preparations of hemato-poietic cells than the aforesaid huffy coat preparation.

One or more hematopoietic growth factors may be added to the aspirated marrow or huffy coat preparation to stimulate growth of hematopoietic neoplasms, and thereby increase their sensitivity to the toxicity of the c-myb antisense oligonucleotides. Such hematopoietic growth factors include, for example, interleukin-3 and granulocyte macrophage colony stimulating factor (GM-CSF). The recombinant human versions of such growth factors are advantageously employed.

After treatment with the antisense oligonucleo-tides, the cells to be transferred are washed with auto-logo~as plasma or buffer to remove unincorporated oligo-mer. The washed cells are then infused into the recip-Tent, The instant c-myb antisense oligonucleotides also inhibit proliferation of human peripheral blood lympho-cytes. Accordingly, they are useful as immunosuppressive agents, that is, they may be utilized to inhibit immune response, particularly cellular response, They are 6056-72 (CTP)2 CN
/tep -20~
particularly useful in situations where rapid, but short term, inactivation of the immune system is desirable.

Such circumstances may include, but are not limited to, acute graft-versus-host disease, acute organ rejection (heart, liver, kidney, pancreas), and flares of auto-immune-type diseases such as acute systemic lupus erythe-matosus, rheumatoid arthritis and multiple sclerosis.

For in vivo use, the antisense oligonucleotides may be combined with a pharmaceutical carrier, such as a 20 suitable liquid vehicle or excipient and an optional auxiliary additive or additives. The liquid vehicles and excipients are conventional and commercially available.

Illustrative thereof are distilled water, physiological saline, aqueous solution of dextrose, and the like. For in vivo antineoplastic or immunosuppressive use, the c-myb mRNA antisense oligonucleotides are preferably administered intravenously. It is also possible to administer such compounds ex vivo by isolating lympho-cytes from peripheral blood, treating them with the antisense oligonucleotides, then returning the treated lymphocytes 'to the peripheral blood of the donor. Ex vivo techniques have been utilized in treatment of cancer patients with interleukin-2 activated lymphocytes.

In addition to administration with conventional carriers, the antisense oligonucleotides may be adminis-tered by a variety of specialized oligonucleotide deliv-ery techniques. For example, oligonucleotides have been successfully encapsulated in unilameller liposomes.

Reconstituted Sendai virus envelopes have been success-fully used to deliver RNA and DNA to cells. Arid et al., Biochem. Biophy. Acta. 859, 88-9~ (l986).

For ex vivo antineoplastic application, such as, for example, in bone marrow purging, the c-myb antisense oligonucleotides may be administered in amounts effective to kill neoplastic cells while maintaining the viability 6056-72 (CIP)2 CN
/tep f~~r~~3~m~

of normal hematologic cells. Such amounts may vary depending on the nature and extent of the neoplasm, the particular oligonucleotide utilized, the relative sensi-tivity of 'the neoplasm to the oligonucleotide, and other factors. Concentrations from about 10 to 100 ~g/ml per 106 cells may be employed, preferably from about 40 to 60 ~g/ml. per l06 cells. Supplemental dosing of the same or lesser amounts of oligonucleotide are advantageous to optimize the treatment. Thus, for purging bone marrow containing 2 x 10' cell per ml of marrow volume, dosages of from about 2 to 20 mg antisense per ml of marrow may be effectively utilized, preferably from about 8 to mg/ml. Greater or lesser amounts of oligonucleotide may be employed.

For in vi.vo use, the c-myb antisense oligonucleo-tides may be administered in an amount sufficient to result in extracellular concentrations approximating the above stated in vitro concentrations. The actual dosage administered may take into account the size and weight of the patient, whether the nature of the treatment is prophylactic or therapeutic in nature, the age, weight, health and sex of the patient, the route of administra-tion, and other factors. The daily dasage may range from about 0.1 to 1,000 mg oligonucleotide per day, preferably from about 10 to about 1,000 mg par day. Greater or lesser amounts of oligonucleotide may be administered, as required.

The present inventian is described in greater detail in the following non-limiting examples.
6056-72 (CIP)2 CN
/tep ~~~~~~3~
-22~
Example 1 Effect of c-myb Antisense Oliqomer on Normal Peripheral Blood Lymphocyte Proliferation in Response to PHA Exposure The c-myb antisense oligonucleotides have immunosuppressant activity, as demonstrated by the following experiment wherein lymphocyte proliferation is markedly suppressed by treatment with the oligomer.

Normal blood lymphocytes were treated with the c-myb antisense oligodeoxynucleotide 5'-GTG CCG GGG TCT TCG

GGC-3' at a final concentration of 40 ~g/ml. C-myb antisense and/or phytohaemagglutinin (PHA) were added to the cells as follows: (i) PHA alone, t=0 (no oligonucleo-tide); (ii) c-myb antisense alone, t=0 (no PHA)t (iii) c-myb antisense, t=0; PHA, t=24 hours; (iv) c-~yb anti-sense + PHA, both t=0; (v) PF-IA, t=0; c-myb antisense, t=24 hours; and (vi) PHA, t=0; c-myb antisense t=24 and 48 hours. Cell counts were performed at t=day 6. The results are shown in Figure 1. As is evident from the figure, PHA treatment alone resulted in marked cell proliferation when compared to cells exposed to 40 ~g/ml c-myb antisense oligomer. One dose of oligomer alone in the absence of PHA did not appear to be toxic to normal lymphocytes thraugh day 6. As can be noted in Figure 1, however, once cells were exposed to PHA, either simultaneously or within 24 hours of c-myb antisense treatment, the 40 ~cg/m1 dose became very toxic to the cells, as manifested by the law cell numbers present on day 6. Additional doses of c-myb at 24 and 48 hours did not appear to be essential in order to inhibit PHA-induced proliferation of normal Cells.

6056-72 (CIP)2 CN
/tep ~~:3~~~.

Example 2 Effect of c-myb Antisense Oligomer on Norman Peripheral Blood ~mphoc~te Proliferation in Mixed Lymphocyte Reaction The following experiment further demonstrates the immunosuppressamt activity of the c-myb antisense oligo-nucleotides. Normal peripheral blood mononuclear cells (Figure 7: X cells) were either stimulated with PHA
alone or mixed with mitomycin C-treated mononuclear cells from another normal donor (Figure 7: Y~' cells). Tn two cultures, X cells were pre-incubated for 18 hours with 40 ~ag/ml of the a-myb sense oligonucleotide 5'-GCC CGA AGA
CCC CGG CAC-3', or the c-myb antisense oligonucleotide used in Example 1. The 'thus treated X cells were then mixed with Y~' cells. At 24 and 48 hours, an additional 10 ~g/ml of oligomers was added to the cultures. After five days, cell counts were performed (Figure 7A), and tritiated thymidine incorporation was determined (Figure 7B). Tnhibition of mixed lymphocyte-induced cell prolif-eration and tritiated thymidine incorporation was ob-served only with the c-myb antisense-treated cells.
Example 3 Differential Sensitivity of Tumor (ARH-77 and Normal Progenitor Cells Toward a-myb Oligonucl.eotide The following experiment was performed to establish the differential sensitivity of normal progenitor and tumor cells to c-myb antisense oligonucleotide. Accord-ingly, tumor cells (1 x 106 cells/ml) or normal human marrow cells (1 x 10s cells/ml) were cultured alone or mixed together in a 1:1. ratio (total cell number cultured - 1 x 106 cells/ ml) in the presence or absence of c-myb oligonucleotides.
6056-72 (CTP)2 CN
/tep ~~~~~~~3~

Figures 2A, 2B and 2C respectively show a high magnification view (200X) of untreated (A) normal human myeloid cell colonies, (B) ARH-77 cells (IgG-secreting plasma cell leukemia, ATCC No. CRL 1621), and (C) HL-60 (promyelocytic leukemia cells), a11 after seven days of culture. It can be observed that the normal marrow cells grow in widely separate aggregates of relatively small cell number. The tumor cells grave much more luxuriantly, and appear to overgrow each other.

Figure 3 is a series of low magnification (40X) photographs of a 1:1 mixture of ARH-77 cells and normal hematopoietic progenitor cells exposed to: (A) high dose c-myb sense 5'-GCC CGA AGA CCC CGG CAC-3' (40 ug/m1, t=0;

~sg/ml supplement at t=18 hours); (B) low dose c-myb 15 antisense 5'-GTG CCG GGG TCT TCG GGC-3'; (10 ~sg/ml t=0; 5 ~g/m1 supplement at t=18 hours); and (C) high dose c-myb antisense (40 ~g/ml, t=0; 20 ~g/ml supplement at t=18 hours). The Figu~:e 3 photographs were taken at t=day 7.

While the sense-treated plate (Figure 3A) was overwhelmed 20 with tumor cells on day 7, the low dose antisense plate (Figure 3B) displayed persistent, but dramatically reduced numbers of tumor cells. The high dose antisense plate (Figure 3C) contained a normal myeloid colony with complete disappearance of tumor cells. The arrow heads in Figure 3C surround a normal myeloid colony which is shown at high magnification in Figure 4A. A high magni-fication view of the sense-treated plasma cell leukemia cells of Figure 3A is shown in Figure 4B.

Example 4 Differential Sensitivity of Tumor NHL-60 and Normal Proctenitor Cells Toward c-mvb Oliaonucleotide The sense/antisense dosing procedure of Example 3 was repeated substituting HL-60 leukemia cells for ARH-77 6056-72 (CTP)2 CN
/tep s~~~~~i~

cells, and utilizing the same dosages and dose times from Example 3. The results are shown in Figures 5 and 6.
Figure 5 is a series of low (40X) magnification views of a 1:1 mix of FIL-60 cells arid normal hemato poietic progenitor cells exposed to: (A) high dose c-myb sense, (B) low dose c-myb antisense, and (C) high does c-myb antisense. While a very large HL-60 tumor aggregate appeared in the sample treated with a high dose of c-myb sense oligodeoxynucleotide (Figure 5A), the colony treated with a low dose of antisense oligonucleotide is much smaller, with fewer tumor cells being apparent (Figure 5B). A high power view of Figure 5A is shown in Figure 6B. At the high dose of antisense (Figure 5C), normal hematapoietic progenitor cells axe unaffected as evidence by the normal myeloid colony indicated by the small arrow head in Figure 5C. An HL-60 colony was observed to be degenerating, as indicated by the large arrowhead.
The colonies featured in Figure 5C are shown at higher magnification in Figure 6A.
Example 5 Differential Sensitivity of Leukemic T Cells and Normal Progenitor Cells Toward c-myb Oligonucleatide The following experiment further demonstrates that when normal marrow hematopoietic cells are combined with leukemic blast cells in the presence of c-myb antisense oligonucleotide, leukemic cell cloning efficiency is preferentially inhibited, and is accompanied by leukemic cell death. Colony formation in semi-solid cultures was employed as an indicator system to assess survival of clonogenic progenitor cells. Of great importance, many normal hematopoietic progenitor cells were observed to survive exposure to c-myb antisense oligonucleotide, and 6056-72 (CIP)2 CN
/tep s~~~'~~~~
_26_ to continue to form colonies in semi-solid culture medium.

Bone marrow cells from normal consenting donors and cells of 'the human T cell leukemia cell line CCRF-CEM, obtained from the American Type Culture Collection, were treated as follows. Normal hematopoietic progenitor cells were enriched fram light density bone marrow mononuclear cells. The normal cells and the T leukemia cells were placed in liquid suspension cultures (RPMI

1640 with 20% fetal bovine serum, either alone or in a 1:1 mix). Control cultures were left untreated. Treated cultures received varying amounts of the same c-myb sense and antisense oligomers applied in the procedure of Example 3, namely 5-80 ~ag/ml (~ 1 ~cM to 14 ~.M) at t=0, supplemented with additional oligomer (250 of the initial dose)) at about 18 hours after the start of incubation.

Cultures were incubated (5~ C02, 37C) for four days, during which time daily cell counts were performed and cell viability was recorded. At the end of 'the four days, the cells remaining in suspension (to a maximum of 2 x 106/m1) were transferred to methylcellulose cultures, Leery et al., Blood 71, 1759 (1988) containing 24 U/ml and 5 ng/ml respectively of recombinant human inter-leuken-3 (rH IL-3) and recombinant human granulocyte macrophage colony stimulating factor (rH GM-CSF). After a total of ten to twelve days in culture, the culture plates were scanned in their entireties with the aid of an inverted microscope, and total colonies per cluster in the dishes were enumerated. To verify the origin of the colonies, that is, whether they were derived from the leukemic or from normal hematopoietic progenitor calls, a11 cells were removed from the dishes by diluting the methylcellulose in tissue culture medium, transferring the culture dish's contemts to a polypropylene tube, and then preparing cytocentrifuge preparations from the con-tents of the tube for histochemical or immunochemical 6056-72 (CIP)2 CN
/tep ~~~~~~n~

identification of tumor cells. Histochemical identifica-tion of tumor cells was carried out by air drying the cytocentrifugation slides, flooding the slides with Modi-fied Wrights stain (Sigma Chemical Company, #WS 1b) for 5 minutes, followed by rinsing with de-ionized water for 2 minutes. '.Che slides were then coverslipped. Clots were fixed with 4~ glutaraldehyde for 8 minutes, flushed with distilled water for 12 minutes, and then dried into a film. The plates were then flooded with Modified Wrights stain for 3 minutes, rinsed in de-ionized water for 6 minutes, and coverslipped. The immunochemical identification of tumor cells was according to the procedure of Gewirtz et al., J. Tm~nunol. 139, 2195 (1987), utilizing the Leu-3a monoclonal antibody (Becton-Dickenson, Mountainview, CA.). The Leu-3a antibody is directed against the CD4 epitope.

The effect of maintaining the T cell leukemia line and the marrow cells in suspension culture according to the procedure of Example 5, in the presence or absence of the c-myb oligomers, is shown in Figure 8. In the absence of the oligomers, the T cell leukemia continued to divide in culture, whereas the numbers of bone marrow cells remained essentially unchanged. See Figure 8A.

Cell viability remained high among both cell populations and always exceeded 90%, as assessed by trypan blue exclusion. Treatment of cells with high doses (40 ~eg/ml, t=0: 10 ~g/ml, t=18 hours) of the c-myb sense oligomer did not significantly effect the growth or viability of either cell type (Figure 8A). In distinct contrast (Figure 8B), when the T leukemia cells were incubated in suspension with c-~yb antisense oligomer (20 ~g/ml, t=0;

5 ~g/ml, t=18 hours) cell proliferation was not only inhibited, but there was a daily decline in cell numbers and viability as well. After four days only approximate-ly 25-30% of the cells initially added to the culture 6056-72 (CIP)2 CId /tep ~~~~~ ~~D~
_28-remained; the viability of these cells was also greatly reduced (~ 70$ reduction). The effect of the antisense oligorner is even more dramatic if one compares cell numbers (mean ~ standard deviation (hereinafter "SD'~);
n=4) in the control cultures at four days (285 ~~ 17 x 10''/m1) with the number remaining in the antisense_ containing culture (4.7 ~ 0.8 x 10''/m1). Importantly, when suspended in the same dose of antisense oligomer, the normal marrow mononuclear cells exhibited only a slight decline in numbers and viability over the same time period (~ 90~ of initial cells remaining; viability >90~). These numbers were not significantly altered if hematopoietic growth factors were added to the bone marrow cell suspension during the four day incubation period.
Results from a typical experiment, repeated three times are shown in Table 1 ("BMC~' = normal bone marrow cells; "MYB S" = c-anyb sense oligonucleotide; "MYB AS" _ c-myb antisense oligonucleotide; '~TNTC" = to numerous to count) 6056-72 (CIP)2 CN
/tep o~s~~~~~i~

Cells No. Cells Oligonucleotide Colony/Cluster P1 te' Added Amt. Added Count (E~g/mlat t=0; (Mean Stan-t=18 hours) dard Deviation) BMC 5 x 104/m1 None 244 MYB (20; 5.0) 314 S

MYB (20; 5.0) 306 S

T 5 x 10'~/ml None TNTC

LEUKEMIA MYB (20; 5.0) TNTC
S

MYB (20; 5.0) 1:1 S

BMC+ 5 x 104/m1 None TNTC

LEUKEMIA of each MYB (20; 5.0) TNTC
S

MYB (2; 0.5) TNTC
AS

MYB (5; 1.0) TNTC
AS

MYB (10; 2.5) 41-5 AS

MYB (20; 5.0) 34v1 AS

In dishes containing untreated bone marrow cells, colony numbers varied directly with the number of cells plated (5 x 104/m1 to 2 x 10s/ml), and ranged between 31~4 (mean ~SD) and 274~18. In dishes containing the untreated leukemia cells, cloned at equivalent concen-trations, growth was always luxuriant and the numbers of colonies were too numerous to count (TN~~C) (Figure 9A) .
Exposure to the c-myb sense oligomer had no effect on either normal, or leukemic cell (Figure 9B) growth when compared to growth in untreated cultures. Col~ny forma-tion by cells in Figure 9A and Figure 9B were essentially identical. When leukemic blasts were cultured alone in the higher doses of antisense oligomer, the numbers of resulting colony/clusters were reduced from TNTC to a maximum of about 2 per 5 x ~.0~ leukemia cells plated (Figure 9C). In distinct contrast, in dishes containing bone marrow cells exposed to c-myb antisense, colony formation was not significantly perturbed by the dose and 6056-72 (CIP)2 CN
/tep exposure schedule employed (see Table 1). Not unexpec-tedly then, when bone marrow cells were mixed 1:1 with T

leukemia cells and then exposed to the c-myb antisense oligomer at concentrations <_5 ug/ml and 1 ~eg/ml (t=0 and t=18 hours, respectively), the leukemic cells continued to grow vigorously, and the number of colonies were too numerous to count. However, when the oligomer exposure intensified, a definite dose-response relationship became apparent. At an initial dose of 10 ~g/ml, followed by 2.5 ~g/ml eighteen hours later, the leukemia cells no longer overgrew the plate, and distinct colones could be enumerated in tYie mixed cell cultures. Nevertheless, histochemical and ~.mmunochemical staining demonstrated that ~50% of the colonies that formed in these mixed cell dishes appeared to be of leukemic blast cell origin.

When the dose of antisense oligomer employed equaled or exceeded 20 ,ug/ml (t=0) followed by 5 ~g/ml (t=18 hours), leukemic calonies could no longer be identified with certainty in the cultures by simple visual analysis.

2o To more rigorously examine the cultures for resid-~

ual leukemic elements, the methylcellulose cultures were liquified with tissue culture medium, and the entire cell contents were deposited onto slides by cytocentrifuga-Lion. Low (100x) and high (400x) magnification photo-micrographs of Wright's stained 'f leukemia cells after twelve days of culture in methylcellulose are shown in Figures 10A and 10B, respectively. Most cells were small, had only a thin rim of cytoplasm, and resembled unactivated lymphocytes, though occasional large, undifferentiated blast cells with prominent nucleali were also noted (arrows). Neither of these cell types could be identified in the culture dishes containing the leukemia plus normal cell populations which had been cultured in the high dose of c-myb antisense oligamer.

As demonstrated in Figures 10C (100x) and 10n (400x), 6056~72 (C2P)2 CN
/tep ~l respectively, only normally maturing cells could be identified in these cultures. The colonies which devel-oped in the high dose antisense plates were also numer-ically equivalent to those enumerated in the bone marrow cell control plates.

Immunochemical staining with Leu 3a antibody of either T leukemia cells alone, marrow mononuclear cells alone, or mixtures of normal marrow mononuclear cells and T leukemia cells, maintained in liquid suspension cul-tares for eight days, corroborated these results. After eight days in culture, only 4% of bone marrow cells stained Leu 3a positive, while ~93% of T cell leukemia cells were labeled with this antibody. When bone marrow cells and T leukemia cells were mixed 1:1, and then stained after eight days in culture, -98~ of cells were stained with Leu 3a in the untreated culture, and in the culture containing the c-myb sense oligomer. These results indicated that the T leukemia cells outgrew the bone marrow cells, and essentially replaced them in these cultures. In marked contrast, in the mixed cell culture containing the c-myb antisense oligomer, only 3% of the cells stained with Leu 3a after eight days) This value is identical to that obtained in the bone marrow control culture, and suggests again that the leukemic cells were eliminated from the culture.

Example 6 Effect of High Dose c-mgb Antisense Oliqomer On Leukemic Blast Cells From Acute M~eloqanous Leukemia Patients Th following experiment illustrates the effect of high dose c-myb antisense oligomer exposure on colony/
cluster formation by leukemic blast cells isolated directly from patients with acute myelogenous leukemia.
6056-72 (CIPj2 CN
/tep ~(~~)''~~~~~

The peripheral blood of leukemic blast cells were isolated form patients with acute myelogenous leukemia by Ficoll gradient centrifugation. The blast cells (2 x 106/m1) were washed in fresh tissue culture medium and then exposed to c-myb sense or antisense oligomers (40 ~,g/ml, t=0; 10 ~g/ml, t=18 hours) in suspension culture.
Pour to six hours after addition of the last dose of oligorner, the blast cells were seeded into plasma clot or methylcellulose cultures and cultured for ten to twelve days to assess the presence of residual colony/cluster forming units. Cell colonies and cell clusters were enumerated in sense (S) and antisense (AS) containing plates, and the values compared to growth in control cultures which contained no oligomers. The results are expressed in Table 2 as 'k residual control culture growth (arbitrary 100o value). Significance of changes in colony/cluster growth in AS-treated plates, in comparison to that observed in controls, is given as a P value derived by Student s t test for unpaired samples.
6056-72 (CIP)2 CN
/tep dad/
t~I~ Z (dI~) ZG-9509 y~MOxb ou - ~H Z
~ sxauzobtto O E
ou pauz~~uoo uozuM saxn~.Ina to.z~.uoa u-r ~~.MOxb o~ pax~duzoa 'sa~.a-~d buzuzs~.uoa (S~) asuasr~.u~ xo (S) asuas uz butu~r~tua.z sxa~.snto ZZaa xo sazuoZoo -~Ta~ ~o ab~~.uao.zad ~ S~/S T
L9~o]If6oo'] %z5T/%~6 %oz/%88 8z#

[~0]/[i~TO'] %8T/%65 %TZ/%6L LZ# SZ

CT00']/C600] %00/%68 %00/%9G 9Z#

Ci~9~/C6t0] %8E/%LOT %00/%00t SZ#

CBTO]/[Z00'] %9Z/%T6 %GT/%G8 i~Z#

Li~00 ] /[C00%LZ/%~G %90/%9 Z#
]

CSTO']/CT00'] %TT/%EOT %T/%08 ZZ# oZ

[i00' ]/C900' %90/%06 %00/%b6 TZ#
]

C600']/[TSO] %OS/%00t %60/%Z6 OZ#

C9L']/CLTG] %T6/%T6 %9TT/%TT 6T#

C~9'L]/C--__] %LL/%OTT Jtd 8T#

CZO']/C-__-] %8/%9T Jts LT# ST

CT007/L-__-] %~z/%99 ~~ 9T#

C968']/C9L'] %00T/%00'L %T8/%99 ST#

[TL0']/LIST'] %5/%06 %TO/%89 'bT#

C80']/[TZO'] %TZ/%85 %bT/%5~ TT#

Ci~0']/C--_-_]%9TZ/%06T Jts OT# OT

COZO']/C800'] %9'~/%96 %TT/%Z6 8#

[ZOS']/[Z'V'] %8ZT/%9L %00T/%OLT G#

09Z0']/C--__] %ZZ/%6G JbI 9#

LTOT ] /C--___)%ZZ/%OG ~i~ 5#

090']/C-___] %$Z/%06 Zits ~# c, C080']/C850'] %L/%09 %8T/%98 T#

xa~snT~77Cuoto~SKI T Sti S

anT~n d s.za~.snt~ SaTLIO'[O~ ase~
tta~ j~a~

Z ~H'~S
_E~:_ e~~~~~~~i~

Of the twenty-eight cases studied, we were able to gather colony, and/or cluster formation data in twenty-three cases (Table 2). Growth of cells from patients #2, #3, #9 and #12-#13 was 'too poor to evaluate the effect of treatment. A decline in either colony or cluster forma-tion in comparison to growth in untreated cultures was observed in eighteen of the twenty-three evaluable cases (78~). Of those cases in which this response was obser-ved, the decline in colony number was statistically significant (p<_.05) in 11/13 cases (85~). Tn the two cases where the decrease was not of statistical signif-icance, the p values were .058 (Case #1) and .051 (Case #20). Similarly, the decrement in cluster formation was statistically significant in 13/17 (76Q) of the cases.
The degree of inhibition was also impressive. Mean (tSD) residual leukemic colony formation in the eleven respond ing cases was 10.0-~7.g~ of control (untreated leukemia cell) colony formation. Mean (LSD) residual leukemic cluster formation in the seventeen responding cases was 25.7~15.3 of control.
Example 7 Complete Purqinq of Patient-Derived Myeloid Leukemia Cells From Normal Bone Marrow Cells The following experiment demonstrates that a more intensive exposure to the antisense c-myb oligomer results in complete elimination of myeloid leukemic progenitor cells from a mixture of normal bone marrow progenitor cells, with adequate survival of the normal progenitor cells.
Normal bone marrow cells and blasts obtained from Case #26 (Example 6, Table 2) were utilized for purging using the T cell purging protocol described in Example 5.
The only modification involved was the addition of oligomer (20 ~g/ml) just prior to plating after four days 6056-72 (CIP)2 CN
/tep ~~~~~~~D~

in suspension culture. In untreated cultures, the blasts formed 25.5-Q3.5 (mean SD per 2 x 106 cells plated) colonies and 157v8.5 clusters in growth factor stimulated cultures. The addition of c-myb sense oligomers at doses equivalent to those added to antisense containing cul-tures did not significantly alter these numbers (1g.5.7 colonies and 140.5v7.8 clusters). As expected (see Table 2), antisense oligomers again totally inhibited colony/

cluster formation by the leukemic blasts. Colony forma-l0 tion as also inhibited in the plates containing normal bone marrow cells, but only by ~50% in comparison to untreated control plates. (Control colony formation -29640 per 2 x 10s cells plated; Treated = 14915.5 per x 10~ cells). Histochemical staining of the leukemic blast cell cultures revealed only scattered residual cells in the antisense treated plates (Fig. 11A: 100x).

At high magnification, these "cells" appeared to be non-viable naked nuclei (Fig. 11B: 400x). As was stated above, at an equivalent antisense oligomer dose, bone marrow cells formed numerous, though smaller, colonies which contained cells that had matured normally (Fig.

and 11D; 100x and 400x, respectively). Tn the culture dishes in which normal marrow and leukemic blast cells had been mixed in a 1:1 ratio, only normal elements could be identified with certainty (Fig. 11E: 100x;
Fig.

11F: 400x). Stars in Fig. 11F mark mature myeloid elements (polymorphonuclear leukocytes, bands, and metamyelocytes).

C-myb oligonucleotide, administered to cell cul-tunes at concentrations utilized above, effectively kills neoplastic cells. The same concentrations, however, are non-toxic to normal progenitor cells. Thus, the oligo-mers are useful as anti-neoplastic agents, particularly as bone marrow purging agents.
6056-72 (CTP)2 CN
/tep ~m The following non-limiting example illustrates one methodology for bone marrow purging according to the present invention.
Example i3 Bone Marrow FurainwcLwith c-~m~b Antisense Ol.iqonucleotide Bone marrow is harvested from the iliac bones of a donor under general anesthesia in an operating room using standard techniques. Multiple aspirations are taken into heparinized syringes, Sufficient marrow is withdrawn so that the marrow recipient will be able to receive about x 10A to about 8 x 10$ processed marrow cells per kg of body weight. Thus, about 750 to 1000 ml of marrow is withdrawn. The aspirated marrow is transferred immediate-ly into a transport medium (TC-199, Gibco, Grand Island, New York) containing 10,000 units of preservative-free heparin per 100 ml of medium. The aspirated marrow is filtered through three progressively finer meshes until a single cell suspension results, i.e., a suspension devoid of cellular aggregates, debris and bane particles. The filtered marrow is then processed further into an auto-mated cell separator (e. g., Cobe 2991 Cell Processor) which prepares a 'buffy coat" product, (i.e., leukocytes devoid of red cells and platelets). The huffy coat preparation is then placed in a transfer pack for further processing and storage. It may be stored until purging in liquid nitrogen using standard procedures. Alter-natively, purging can be carried out immediately, then the purged marrow may be stored frozen in liquid nitrogen until it is ready for transplantation.

The purging procedure may be carried out as follows: Cells in the huffy coat preparation are ad-justed to a cell concentration of about 2 x 10'/m1 in TC-199 containing about 20o autologous plasma. C--myb 6056-72 (CIPj2 CN
/tep antisense oligodeoxynucleotide, for example, in a concen-tration of about 8 mg/ml is added to the transfer packs containing the cell suspension. Recombinant human hematopoietic growth .factors, e.g., rH IL-3 or rH GM-CSF, may be added to the suspension to stimulate growth of hematopoietic neoplasms and thereby increase ~their sensitivity c-myb antisense oligonucleotide toxicity.
The transfer packs are then placed in a 37~C waterbath and incubated for 18 -- 24 hours with gentle shaking. The cells may then either be frozen in liquid nitrogen or washed once at 4~ C in TC-139 containing about 20% auto-logous plasma to remove unincorporated oligomer. Washed cells axe then infused into the recipient. Care must be taken to work under sterile conditions wherever possible and to maintain scrupulous aseptic techniques at a11 times.
Example 9 Inhibition of Leukemic T Cells and Tumor NHL-60) Cells by c-myb Antisense Oli~onucleo~tide The following experiment is directed to the inhi-bition of growth of malignant hematopoietic cells with further c-myb antisense oligonucleotides.
Four 18-mars, designated oligomers A through D, were prepared:
(A) 5'-GCC ATG GCC CGA AGA CCC-3~, the sense oligomer corresponding to c-myb nucleotides 111 through 1290 ( B) 5' -GGG TCT TCG GGC CAT GGC-3 ' , tile antisense oligomer to c-myb nucleotides 111 through 129;
(C) 5~-CGC GTA CCG CAG GAA CCC-3', a "scram-bled" version of 18-mar (A); and 6056-72 (CIP)2 CN
/tap ~~~~~~~i~

(D) 5'-ACT GCT ATA TAT GCT GTG-3', the antisense oligomer to c-~myb nucleotides 129 through 147.
CCRF-CEM cells (1 ac 10F cells) were seeded into 500 ~1 of tissue culture medium containing 0-80 ~g/ml of oligomer A) B, C or D (t=0). The cultures were supple mented with additional oligomer (25~ of the initial dose at t=18 hours). A control culture received no oligomer.
Cultures were incubated for four days, after which time a cell count was taken. The results, as a. function of oligonucleotide dosage, are set forth in Table 3;

CELL COUNT
(Cells/~cl~ Mean ~ Standard Deviation) Oligomer Dosage at t=O/t=18 hrs. Oligomer Oligomer 0ligomer 0ligomer (ug/ml) A B C D
Control (no oligomer) 96817 163639 181458 161638 10/2.5 1279A5 996t13 1452A8 17.46t16 20f 5 1297 39 646 12 136p 36 810*

40/10 120229 61617 129028 723t37 80/20 1136+_34 50422 131735 690 9 Neither the sense (oligomer A) or "scrambled'~ sense (oligomer C) molecules significantly effected leukemic cell growth. Both authentic antisense oligomers (B, D) gave inhibition. Oligomer B (70% inhibition), directed to c-myb transcript nucleotides 111-129, was more potent than oligomer D (57o inhibition), which is directed to c-myb transcript nucleotides 129-147. This result indi-cates that the most efficient inhibition of translation is obtained by inhibiting translation via hybridization 6056-72 (CIP)2 CN
/tep of antisense aligomers at or near the site of translation initiation (nucleotides 114-115).
Very similar results were obtained with HL-60 cells using oligome.rs A, B and C. However oligomer D inhibited cell growth only ~25~, again indicating that the most efficient inhibition of translation is obtained at or near the site of translation inhibition, The present invention may be embodied in other specific forms without departing from 'the spirit or essential attributes thereof and, accordingly, reference should be made to the appended claims, rather than to the foregoing specification, as indicating the scope of the invention.
605&-72 (CIP)2 CN
/tep

Claims (21)

1. A use of an effective amount of an oligonucleotide which has a nucleotide sequence complementary to at least a portion of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript, for treating hematologic neoplasm in vivo in cells harvested from an individual afflicted with a hematologic neoplasm.

2. The use according to claim 1 wherein the oligonucleotide is an at least 15-mer oligodeoxynucleotide.

3. A use according to claim 2 wherein the oligodeoxynucleotide has a deoxynucleotide sequence complementary to a portion of the c-myb mRNA transcript including the translation initiation codon of said transcript.

4. A use according to claim 2 wherein the oligodeoxynucleotide has a deoxynucltodie sequence complementary to a portion of the c-myb mRNA transcript beginning with the codon immediately downstream from the translation initiation codon of said transcript.

5. A use according to claim 2 wherein the oligodeoxynucleotide has a deoxynucleotide sequence complementary to a portion of the c-myb mRNA transcript which includes at least a portion of the 5'-untranslated region of said transcript.

6. A use according to claim 2 wherein the oligodeoxynucleotide comprises from a 15-mer to a 21-mer.

7. A use according to claim 4 wherein the oligodeoxynucleotide is selected from the group consisting of:
5'-GCT GTG CCG GGG TCT TCG GGC-3', 5'-CT GTG CCG GGG TCT TCG GGC-3', 5'-T GTG CCG GGG TCT TCG GGC-3', 5'-GTG CCG GGG TCT TCG GGC-3', 5'-TG CCG GGG TCT TCG GGC-3', 5'-G CCG GGG TCT TCG GGC-3' and 5'-CCG GGG TCT TCG GGC-3'.

8. A use according to claim 7 wherein the oligodeoxynucleotide comprises 5'-GTG CCG GGG TCT TCG
GGC-3'.

9. A use according to claim 5 wherein the oligodeoxynucleotide is selected from the group of oligo-deoxynucleotides consisting of:
5'-CCG GGG TCT TCG GGC CAT GGC-3', 5'-CG GGG TCT TCG GGG CAT GGC-3', 5'-G GGG TCT TCG GGC CAT GGC-3', 5'-GGG TCT TCG GGC CAT GGC-3', 5'-GG TCT TCG GGC CAT GGC-3', 5'-G TCT TCG GGC CAT GGC-3' and 5'-TCT TCG GGC CAT GGC-3'.

10. A use according to claim 9 wherein the oligodeoxynucleotide comprises 5'-GGG TCT TCG GGC CAT
GGC-3'.

11. A use according to any of claims 1 to 10 for treating aspirated bone marrow cells.

12. A use of an effective amount of an oligonucleotide which has a nucleotide sequence complementary to at least a portion of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript, for inducing immunosuppression in an individual in need thereof.

13. A use according to claim 12 wherein the oligonucleotide is an at least 15-mer oligodeoxynucleotide.

14. A use according to claim 13 wherein the oligodeoxynucleotide has a deoxynucleotide sequence complementary to a portion of the c-myb mRNA transcript including the translation initiation codon of said transcript.

15. A use according to claim 13 wherein the complementary to a portion of the c-myb mRNA transcript beginning with the codon immediately downstream from the translation initiation codon of said transcript.

16. A use according to claim 13 wherein the oligodeoxynucleotide has a deoxynucleotide sequence complementary to a portion of the c-myb mRNA transcript which includes at least a portion of the 5'-untranslated region of said transcript.

17. A use according to claim 13 wherein the oligodeoxynucleotide comprises from a 15-mer to a 21-mer.

18. A use according to claim 15 wherein the oligodeoxynucleotide is selected from the group consisting of:
5'-GCT GTG CCG GGG TCT TCG GGC-3', 5' -CT GTG CCG GGG TCT TCG GGC-3 ', 5'-T GTG CCG GGG TCT TCG GGC-3', 5'-GTG CCG GGG TCT TCG GGC-3', 5'-TG CCG GGG TCT TCG GGC-3', 5'-G CCG GGG TCT TCG GGC-3' and 5'-CCG GGG TCT TCG GGC-3'.

19. A use according to claim 18 wherein the oligodeoxynucleotide comprises 5'-GTG CCG GGG TCT TCG
GGC-3'.

20. A use of an effective amount of an oligonucleotide which has a nucleotide sequence complementary to at least a portion of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript, for the production of a medicament for treating hematologic neoplasm in vivo in cells harvested from an individual afflicted with a hematologic neoplasm.

21. A use of an effective amount of an oligonucleotide which has a nucleotide sequence complementary to at least a portion of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript, for the production of a medicament for inducing immunosuppression in an individual in need thereof.