CA1340369C - Antisense oligonucleotides to c-myb proto-oncogene and uses thereof - Google Patents
Antisense oligonucleotides to c-myb proto-oncogene and uses thereofInfo
- Publication number
- CA1340369C CA1340369C CA 613355 CA613355A CA1340369C CA 1340369 C CA1340369 C CA 1340369C CA 613355 CA613355 CA 613355 CA 613355 A CA613355 A CA 613355A CA 1340369 C CA1340369 C CA 1340369C
- Authority
- CA
- Canada
- Prior art keywords
- cells
- tct tcg
- myb
- ggc
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
Oligonucleotides are provided having a nucleotide sequence complementary to at least a portion of the mRNA
transcript of the human c-myb gene. These "antisense"
oligonucleotides are hybridizable to the c-myb mRNA
transcript. Such oligonucleotides are useful in treating hematologic neoplasms and in inducing immunosuppression.
They are particularly useful as bone marrow purging agents.
transcript of the human c-myb gene. These "antisense"
oligonucleotides are hybridizable to the c-myb mRNA
transcript. Such oligonucleotides are useful in treating hematologic neoplasms and in inducing immunosuppression.
They are particularly useful as bone marrow purging agents.
Description
l~in~6~
ANTISENSE OLIGONUCLEOTIDES TO C-MYB
PROTO-ONCOGENE AND USES THEREOF
Field of the Invention The invention relates to antisense oligonucleotides to proto-oncogenes, and in particular to antisense oligo-nucleotides to the c-myb gene, and the use of such oligo-~0 nucleotides as antineoplastic and immunosuppressive agents.Reference to Government Grant The invention described herein was supported in part by National Institutes of Health grants CA36896, CA01324 and CA46782.
Background of the Invention Antisense Oligonucleotides The proto-oncogene c-myb is the normal cellular homologue of the avian myeloblastosis virus-transforming gene v-myb. The c-myb gene codes for a nuclear protein expressed primarily in hematopoietic cells. It is a proto-oncogene, that is, it codes for a protein which is required for the survival of normal, non-tumor cells. When the gene is altered in the appropriate manner, it has the potential to become an oncogene. Oncogenes are genes whose expres-sion within a cell provides some function in the transfor-mation from normal to tumor cell.
*
. .
The human c-myb gene has been isolated, cloned, and sequenced. Majello et al, Proc. Natl. Acad. Sci. U.S.A.
83, 9636-9640 (1986).
C-myb is preferentially expressed in primitive 5hematopoietic tissues and hematopoietic tumor cell lines of several species. Westin et al., Proc. Natl. Acad. Sci.
U.S.A. 79 2194 (1982). As cells mature, c-myb expression declines. Duprey et al., Proc. Natl. Acad. Sci. U.S.A. 82, 6937, (1985). The constitutive expression of exogenously 10introduced c-myb inhibits the erythroid differentiation of a murine erythroleukemia cell line (MEL) in response to known inducing agents. Clarke et al., Mol. Cell. Biol. 8, 884-892 (Feb. 1988). Although these data may implicate the c-myb gene product as a potentially important regulator of 15hematopoietic cell development, this evidence is largely of an indirect nature.
Some investigators report that c-myb may play an important role in regulating hematopoietic cell prolif-eration, and perhaps differentiation, Slamon et al, Science 20233, 347 (1986); Westin et al, supra; Duprey et al, supra.
The function of the c-myb proto-oncogene in normal hema-topoiesis remains speculative.
Expression of specific genes may be suppressed by oligonucleotides having a nucleotide sequence complementary 25to the mRNA transcript of the target gene. This "anti-sense" methodology finds utility as a molecular tool for genetic analysis. Antisense oligonucleotides have been extensively used to inhibit gene expression in normal and abnormal cells in studies of the function of various proto-30oncogenes.
Proliferation of the human promyelocytic leukemia cell line HL-60, which over-expresses the c-myc proto-oncogene, is inhibited in a sequence-specific, dose-depen-dent manner by an antisense oligodeoxynucleotide directed 35against a predicted hairpin loop containing the initiation codon of human c-myc. Wickstrom et al, Proc. Natl. Acad.
13~0~fi~
.
Sci. USA 85, 1028-1032 (Feb. 1988). Inhibition of c-myc expression and/or cell proliferation in HL-60 or other cells by c-myc antisense oligonucleotides is described by the following: Loke et al, Clin. Res. 36 (3), 443A
(abstract) (1988); Holt et al, Mol. Cell. Biol. 8, 963-973 (Feb. 1988); Yakoyama et al, Proc. Natl. Acad. Sci. U.S.A.
84, 7363-7367 (Nov. 1987); Harel-Bellan et al, J. Immunol.
140, 2431-2435 (Apr. 1988) and J. Cell. Biochem. Supplement 12A, 167 (Jan. 1988).
Antisense methodology has been used to study the expression of c-fos, another proto-oncogene. C-fos expres-sion and cell transition from Go to renewed growth is inhibited in 3T3 fibroblast cells transformed with an antisense oligodeoxynucleotide to the proto-oncogene.
Nishikura et al, Mol. Cell. Biol. 7, 639-649 (Feb. 1987) and J. Cell. Biochem. Supplement llA-D, 146 (1987). Also see Riabowol et al, Mol. Cell. Biol. 8, 1670-1676 (April 1988).
Mercola et al, Biochem. Biophys. Res. Comm. 147, 288-294 (Aug. 1987) disclose transfection of v-sis trans-formed cells with a plasmid directing expression of anti-sense c-fos RNA. The transfected cells exhibited a decrease in growth.
Groger et al., Proc~e~;ngs American Assn. for Cancer ~e~rch 29, 439 (March 1988) report inhibition of c-fos expression in both transformed and non-transformed human hematopoietic cells by an Epstein Barr virus episomal vector containing c-fos antisense RNA.
Transfection of transformed MethA fibroblast and non-transformed 3T3 cells by antisense RNA to the oncogene p53 has resulted in reduction of growth rate and cell proliferation. Shohat et al., Oncogene 1, 277-283 (1987).
Penno et al., American Journal of Human Genetics 39 (3), Supplement, A38 (1986) report inhibition of Yl mouse adrenal carcinoma cell growth after transfection with a plasmid directing antisense to the Ki-ras oncogene.
1340~
Reed et al., J. Cell. Biochem. Supplement 12A, 172, (Jan. 1988) report inhibition of leukemic B cells and normal peripheral blood lymphocytes with antisense oligonu-cleotides to bc1-2, a gene suggested to have oncogenic potential.
U.S. Patent 4,689,320 discloses inhibition of viruses using antisense oligodeoxynucleotides as anti-viral agents.
While the antisense methodology is a useful tool for genetic analysis, TIG, Jan. 1985, p.22-25, antisense oligonucleotides have not been used as anti-tumor agents in practical applications. Moreover, there have been no reports of antineoplastic agents utilizing antisense oligonucleotides complementary to c-myb mRNA.
Bone Marrow Purqing Bone marrow transplantation is of two types.
Allogeneic transplantation comprises the removal of healthy bone marrow cells from a donor and transplantation into a recipient having incomplete, incompetent or diseased bone-marrow. Autologous transplantation involves removal ofdiseased bone marrow, in vitro purging of the removed marrow of diseased cells, and return of the marrow to the same individual. Autologous transplant is preferable to allogeneic transplant since the need for tissue-typing and immunosuppression of the recipient, and possible tissue rejection, is obviated.
Bone marrow purging of tumor cells in autologous grafting is presently accomplished by in vitro incubation of the transplanted marrow with anti-cancer agents. Many drugs and antibodies have been evaluated as purging agents.
See Dicke et al., (eds) Autologous Bone Marrow Transplanta-tion, Proree~ings of the Third International Symposium (The University of Texas, M.D. Anderson Hospital and Tumor Institute, Houston, Texas, 1987). Such drugs are highly toxic, and must be used at relatively high doses in order to maximize tumor cell kill. High doses may lead to the 13~03fi~
. .
death of a substantial number of normal marrow cells and/or graft failure. At lower doses, some tumor cells may survive the purging procedure, accounting for the relative-ly high rate of malignancy relapse in patients undergoing autologous transplantation.
What is needed is an antineoplastic agent useful for treating hematologic neoplasia. In particular, a bone marrow purging agent is needed which effectively purges marrow of all malignant cells, while leaving normal marrow cells substantially intact.
Summary of the Invention Antisense oligonucleotides and pharmaceutical compositions thereof with pharmaceutical carriers are provided. Each oligonucleotide has a nucleotide sequence complementary to at least a portion of the mRNA transcript of the human c-myb gene. The oligonucleotide is hybrid-izable to the mRNA transcript. Preferably, the oligo-nucleotide is at least a 15-mer oligodeoxynucleotide, that is, an oligomer containing at least 15 deoxynucleotide residues. Most preferably, the oligodeoxynucleotide is a 15- to 21-mer. While in principle oligonucleotides having a sequence complementary to any region of the c-myb gene find utility in the present invention, oligodeoxynucleo-tides complementary to a portion of the c-myb mRNA trans-cript beginning with the second codon from the 5' end ofthe transcript are particularly preferred.
As used in the herein specification and appended claims, unless otherwise indicated, the term "oligonucleo-tide" includes both oligomers of ribonucleotide i.e., oligoribonucleotides, and oligomers of deoxyribonucleotide i.e., oligodeoxyribonucleotides (also referred to herein as "oligodeoxynucleotides").
As used herein, unless otherwise indicated, the term "oligonucleotide" also includes oligomers which may be large enough to be termed "polynucleotides".
The terms "oligonucleotide" and "oligodeoxynucleo-tide" include not only oligomers and polymers of the biologically significant nucleotides, i.e. nucleotides of adenine ("A"), deoxyadenine ("dA"), guanine ("G"), deoxy-5 guanine ("dG"), cytosine ("C"), deoxycytosine ("dC"),thymine ("T") and uracil ("U"), but also oligomers and polymers hybridizable to the c-myb mRNA transcript which may contain other nucleotides. Likewise, the terms "oligo-nucleotide" and "oligodeoxynucleotide" include oligomers 10 and polymers wherein one or more purine or pyrimidine moieties, sugar moieties or internucleotide linkages is chemically modified.
The invention provides a method for treating hematologic neoplasms in vivo or ex vivo comprising admin-15 istering to an individual or cells harvested from theindividual an effective amount of c-myb antisense oligonu-cleotide. The invention also provides a method for treat-ing an individual to induce immunosuppression by adminis-tering to the individual an effective amount of such 20 oligonucleotide.
In one embodiment, the method for treating hemato-logic neoplasms comprises a method for purging bone marrow of such neoplasms. Aspirated bone marrow cells are treated with an effective amount of a c-myb antisense oligonucleo-25 tide as described above.
Description of the Figures Figure 1 shows the effect of the c-myb antisense oligodeoxynucleotide in inhibiting phytohemagglutinin-stimulated lymphocyte proliferation. Normal blood lympho-30 cytes were treated at various times with phytohemagglutininand/or the c-myb antisense oligodeoxynucleotide 5'-GCC CGA
AGA CCC CGG CAC--3' .
Figure 2 is a series of microscopic (200X) photo-graphs of untreated seven-day cultures of normal human 35 myeloid cell colonies (Fig. 2A); ARH-77, an IgG-secreting 13~03~9 plasma cell leukemia (Fig. 2B); and HL-60 promyelocytic leukemia cells (Fig. 2C).
Figure 3 is a series of microscopic (40X) photo-graphs of a 1:1 mixture of ARH-77 cells and normal hemato-poietic progenitor cells exposed to 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the c-myb sense oligodeoxynucleotide 5'-GCC CGA AGA CCC CGG CAC-3' (Fig. 3A); 10 ~g/ml (t=0) plus 5 ~g/ml (t=18 hours) of the c-myb antisense oligode-oxynucleotide 5'-GTG CCG GGG TCT TCG GGC-3' (Fig. 3B); and 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the same c-myb antisense oligomer (Fig. 3C). The photographs were taken at t=day 7.
Figure 4A is a high magnification (200X) view of the persisting normal myeloid colony indicated by arrows in Figure 3C. Figure 4B is a 200X view of the plasma cell leukemia cells shown is Figure 3A.
Figure 5 is a series of microscopic (40X) photo-graphs of a 1:1 mixture of HL-60 cells and normal hemato-poietic progenitor cells exposed to 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the c-myb sense oligodeoxynucleotide 5'-GCC CGA AGA CCC CGG CAC-3'(Fig. 5A); 10 ~g/ml (t=0) plus 5 ~g/ml (t=18 hours) of the c-myb antisense oligodeoxynu-cleotide 5'-GTG CCG GGG TCT TCG GGC-3'(Fig. 5B); and 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the same c-myb antisense oligomer (Fig. 5C). The photographs were taken at t=day 7.
Figure 6A is a high magnification (200X) view of the persisting normal myeloid colony (small arrow) and degenerating HL-60 colony (large arrow) indicated by the same size arrows in the corresponding lower power view of Figure 5C; Figure 6B is a 200X view of the HL-60 cells shown in Figure 5A.
Figure 7 shows the effect of the same c-myb anti-sense oligodeoxynucleotide in inhibiting lymphocyte prolif-eration in a mixed lymphocyte reaction, as determined by -cell count (Fig. 7A) and tritiated thymidine incorporation (Fig. 7B).
Figure 8A shows the effect of maintaining a human T
cell leukemia line and normal bone marrow mononuclear cells in the absence of c-myb oligodeoxynucleotides (CONT-T LEUK
and CONT-BMC, respectively), or in the presence of 40 ~g/ml (t=0), followed by 10 ~g/ml (t=18 hours), c-myb sense oligodeoxynucleotide (T-LEUK-MYB S and BMC-MYB S, respec-tively). Figure 8B shows the effect on the same cell lines of 20 ~g/ml (t=O), followed by 5 ~g/ml (t=18 hours) of c-myb antisense oligodeoxynucleotide (LEUK-MYB AS, BMC-MYB
AS). Daily cell counts and viability determinations were performed. Results presented are the mean + standard deviation of four experiments. The sense and antisense oligodeoxynucleotides were the same as in Figure 5.
Figure 9 is a series of photomicrographs (100X) of T leukemia cells maintained in liquid suspension culture for four days and then cultured in methylcellulose for an additional ten days. Colonies formed by cells in a control culture containing no oligomers appear in Figure 9A.
Colonies formed by cells exposed to c-myb sense oligodeoxy-nucleotide (20 ~g/ml, t=0; plus 5 ~g/ml, t=18 hours) are shown in Figure 9B. Cells exposed to c-myb antisense oligodeoxynucleotide (20 ~g/ml, t=0; plus 5 ~g/ml, t=18 hours) are shown in Figure 9C. The sense and antisense oligodeoxynucleotides were the same as in Figure 5.
Figure 10 is a series of low and high magnification photomicrographs of Wright's stained cytocentrifuge prep-arations of T leukemia cells (Fig. 10A: 100X; Fig. 10B:
400X) and a mixture of bone marrow cells and T leukemia cells (Fig. 10C: 100X; Fig. 10D: 400X). T leukemia cells were cultured in the presence of c-myb sense oligodeoxynuc-leotide. The bone marrow/T-leukemia cell mixture was cultured in the presence of c-myb antisense oligodeoxynuc-leotide. The sense and antisense oligodeoxynucleotideswere the same as in Figure 5.
13~0~69 Figure 11 is a series of low and high magnification photomicrographs of myeloid leukemia cells (Fig. llA: lOOX;
Fig. llB: 400X), normal bone marrow cells (Fig. llC: lOOX;
Fig. llD: 400X), and a 1:1 mixture of leukemia cells and normal bone marrow cells (Fig. llE: lOOX; Fig. llF: 400X) cloned in plasma clot culture after exposure to c-myb antisense oligodeoxynucleotide, and then stained in situ.
Stars in Figure llF mark mature myeloid elements (polymor-phonuclear leukocytes, bands, and metamyelocytes). The~0 antisense oligodeoxynucleotide was the same as in Figure 5.
Detailed Description of the Invention We have discovered that the c-myb gene plays a critical role in regulating normal human hematopoiesis. We have further discovered a differential sensitivity of normal and malignant hematopoietic cells to c-myb antisense oligonucleotides, that is, oligonucleotides complementary to and hybridizable with the mRNA transcript of the human c-myb gene. This differential sensitivity makes possible the use of c-myb antisense oligonucleotides as effective anti-neoplastic agents, in particular, in the purging of neoplastic cells from bone marrow.
While many drugs and antibodies have been evaluated as bone marrow purging agents, the present invention is particularly advantageous for this application. The c-myb antisense oligonucleotides are much less toxic to normal cells at effective purging doses than known purging agents.
A greatly increased engraftment rate of purged marrow is thus possible. Since many more normal progenitors survive exposure to the c-myb antisense oligomers than is typically observed after optimal exposure to standard chemotherapeu-tic agents, more intensive treatment is possible. More-over, because of their high therapeutic index, the anti-sense oligonucleotides of the invention may be employed in combination regimens with more conventional agents, which could then be employed at lower doses.
1340~
.,.
The c-myb antisense oligonucleotides are also useful as immunosuppressive agents, as they inhibit prolif-eration of normal human peripheral blood lymphocytes.
The putative DNA sequence complementary to the mRNA
transcript of the human c-myb gene has been reported in Majello et al, Proc. Natl. Acad. Sci. U.S.A. 83, 9636-9640 (1986). That sequence, from initiation codon to termination codon, and the predicted 640 amino acid sequence of the putative c-myb protein, are as follows:
ATGGCCCGAAGACCCCGGCACAGCATATATAGCAGTGACGAGGATGATGAGGACTTTGAGATG
MetAlaArgArgProArgHisSerIleTyrSerSerAspGluAspAspGluAspPheGluMet TGTGACCATGACTATGATGGGCTGCTTCCCAAGTCTGGAAAGCGTCACTTGGGGAAAACAAGG
CysAspHisAspTyrAspGlyLeuLeuProLysSerGlyLysArgHisLeuGlyLysThrArg TGGACCCGGGAAGAGGATGAAAAACTGAAGAAGCTGGTGGAACAGAATGGAACAGATGACTGG
TrpThrArgGluGluAspGluLysLeuLysLysLeuValGluGlnAsnGlyThrAspAspTrp AAAGTTATTGCCAATTATCTCCCGAATCGAACAGATGTGCAGTGCCAGCACCGATGGCAGAAA
LysValIleAlaAsnTyrLeuProAsnArgThrAspValGlnCysGlnHisArgTrpGlnLys GTACTAAACCCTGAGCTCATCAAGGGTCCTTGGACCAAAGAAGAAGATCAGAGAGTGATAGAG
ValLeuAsnProGluLeuIleLysGlyProTrpThrLysGluGluAspGlnArgValIleGlu CTTGTACAGAAATACGGTCCGAAACGTTGGTCTGTTATTGCCAAGCACTTAAAGGGGAGAATT
LeuValGlnLysTyrGlyProLysArgTrpSerValIleAlaLysHisLeuLysGlyArgIle GGAAAACAATGTAGGGAGAGGTGGCATAACCACTTGAATCCAGAAGTTAAGAAAACCTCCTGG
ANTISENSE OLIGONUCLEOTIDES TO C-MYB
PROTO-ONCOGENE AND USES THEREOF
Field of the Invention The invention relates to antisense oligonucleotides to proto-oncogenes, and in particular to antisense oligo-nucleotides to the c-myb gene, and the use of such oligo-~0 nucleotides as antineoplastic and immunosuppressive agents.Reference to Government Grant The invention described herein was supported in part by National Institutes of Health grants CA36896, CA01324 and CA46782.
Background of the Invention Antisense Oligonucleotides The proto-oncogene c-myb is the normal cellular homologue of the avian myeloblastosis virus-transforming gene v-myb. The c-myb gene codes for a nuclear protein expressed primarily in hematopoietic cells. It is a proto-oncogene, that is, it codes for a protein which is required for the survival of normal, non-tumor cells. When the gene is altered in the appropriate manner, it has the potential to become an oncogene. Oncogenes are genes whose expres-sion within a cell provides some function in the transfor-mation from normal to tumor cell.
*
. .
The human c-myb gene has been isolated, cloned, and sequenced. Majello et al, Proc. Natl. Acad. Sci. U.S.A.
83, 9636-9640 (1986).
C-myb is preferentially expressed in primitive 5hematopoietic tissues and hematopoietic tumor cell lines of several species. Westin et al., Proc. Natl. Acad. Sci.
U.S.A. 79 2194 (1982). As cells mature, c-myb expression declines. Duprey et al., Proc. Natl. Acad. Sci. U.S.A. 82, 6937, (1985). The constitutive expression of exogenously 10introduced c-myb inhibits the erythroid differentiation of a murine erythroleukemia cell line (MEL) in response to known inducing agents. Clarke et al., Mol. Cell. Biol. 8, 884-892 (Feb. 1988). Although these data may implicate the c-myb gene product as a potentially important regulator of 15hematopoietic cell development, this evidence is largely of an indirect nature.
Some investigators report that c-myb may play an important role in regulating hematopoietic cell prolif-eration, and perhaps differentiation, Slamon et al, Science 20233, 347 (1986); Westin et al, supra; Duprey et al, supra.
The function of the c-myb proto-oncogene in normal hema-topoiesis remains speculative.
Expression of specific genes may be suppressed by oligonucleotides having a nucleotide sequence complementary 25to the mRNA transcript of the target gene. This "anti-sense" methodology finds utility as a molecular tool for genetic analysis. Antisense oligonucleotides have been extensively used to inhibit gene expression in normal and abnormal cells in studies of the function of various proto-30oncogenes.
Proliferation of the human promyelocytic leukemia cell line HL-60, which over-expresses the c-myc proto-oncogene, is inhibited in a sequence-specific, dose-depen-dent manner by an antisense oligodeoxynucleotide directed 35against a predicted hairpin loop containing the initiation codon of human c-myc. Wickstrom et al, Proc. Natl. Acad.
13~0~fi~
.
Sci. USA 85, 1028-1032 (Feb. 1988). Inhibition of c-myc expression and/or cell proliferation in HL-60 or other cells by c-myc antisense oligonucleotides is described by the following: Loke et al, Clin. Res. 36 (3), 443A
(abstract) (1988); Holt et al, Mol. Cell. Biol. 8, 963-973 (Feb. 1988); Yakoyama et al, Proc. Natl. Acad. Sci. U.S.A.
84, 7363-7367 (Nov. 1987); Harel-Bellan et al, J. Immunol.
140, 2431-2435 (Apr. 1988) and J. Cell. Biochem. Supplement 12A, 167 (Jan. 1988).
Antisense methodology has been used to study the expression of c-fos, another proto-oncogene. C-fos expres-sion and cell transition from Go to renewed growth is inhibited in 3T3 fibroblast cells transformed with an antisense oligodeoxynucleotide to the proto-oncogene.
Nishikura et al, Mol. Cell. Biol. 7, 639-649 (Feb. 1987) and J. Cell. Biochem. Supplement llA-D, 146 (1987). Also see Riabowol et al, Mol. Cell. Biol. 8, 1670-1676 (April 1988).
Mercola et al, Biochem. Biophys. Res. Comm. 147, 288-294 (Aug. 1987) disclose transfection of v-sis trans-formed cells with a plasmid directing expression of anti-sense c-fos RNA. The transfected cells exhibited a decrease in growth.
Groger et al., Proc~e~;ngs American Assn. for Cancer ~e~rch 29, 439 (March 1988) report inhibition of c-fos expression in both transformed and non-transformed human hematopoietic cells by an Epstein Barr virus episomal vector containing c-fos antisense RNA.
Transfection of transformed MethA fibroblast and non-transformed 3T3 cells by antisense RNA to the oncogene p53 has resulted in reduction of growth rate and cell proliferation. Shohat et al., Oncogene 1, 277-283 (1987).
Penno et al., American Journal of Human Genetics 39 (3), Supplement, A38 (1986) report inhibition of Yl mouse adrenal carcinoma cell growth after transfection with a plasmid directing antisense to the Ki-ras oncogene.
1340~
Reed et al., J. Cell. Biochem. Supplement 12A, 172, (Jan. 1988) report inhibition of leukemic B cells and normal peripheral blood lymphocytes with antisense oligonu-cleotides to bc1-2, a gene suggested to have oncogenic potential.
U.S. Patent 4,689,320 discloses inhibition of viruses using antisense oligodeoxynucleotides as anti-viral agents.
While the antisense methodology is a useful tool for genetic analysis, TIG, Jan. 1985, p.22-25, antisense oligonucleotides have not been used as anti-tumor agents in practical applications. Moreover, there have been no reports of antineoplastic agents utilizing antisense oligonucleotides complementary to c-myb mRNA.
Bone Marrow Purqing Bone marrow transplantation is of two types.
Allogeneic transplantation comprises the removal of healthy bone marrow cells from a donor and transplantation into a recipient having incomplete, incompetent or diseased bone-marrow. Autologous transplantation involves removal ofdiseased bone marrow, in vitro purging of the removed marrow of diseased cells, and return of the marrow to the same individual. Autologous transplant is preferable to allogeneic transplant since the need for tissue-typing and immunosuppression of the recipient, and possible tissue rejection, is obviated.
Bone marrow purging of tumor cells in autologous grafting is presently accomplished by in vitro incubation of the transplanted marrow with anti-cancer agents. Many drugs and antibodies have been evaluated as purging agents.
See Dicke et al., (eds) Autologous Bone Marrow Transplanta-tion, Proree~ings of the Third International Symposium (The University of Texas, M.D. Anderson Hospital and Tumor Institute, Houston, Texas, 1987). Such drugs are highly toxic, and must be used at relatively high doses in order to maximize tumor cell kill. High doses may lead to the 13~03fi~
. .
death of a substantial number of normal marrow cells and/or graft failure. At lower doses, some tumor cells may survive the purging procedure, accounting for the relative-ly high rate of malignancy relapse in patients undergoing autologous transplantation.
What is needed is an antineoplastic agent useful for treating hematologic neoplasia. In particular, a bone marrow purging agent is needed which effectively purges marrow of all malignant cells, while leaving normal marrow cells substantially intact.
Summary of the Invention Antisense oligonucleotides and pharmaceutical compositions thereof with pharmaceutical carriers are provided. Each oligonucleotide has a nucleotide sequence complementary to at least a portion of the mRNA transcript of the human c-myb gene. The oligonucleotide is hybrid-izable to the mRNA transcript. Preferably, the oligo-nucleotide is at least a 15-mer oligodeoxynucleotide, that is, an oligomer containing at least 15 deoxynucleotide residues. Most preferably, the oligodeoxynucleotide is a 15- to 21-mer. While in principle oligonucleotides having a sequence complementary to any region of the c-myb gene find utility in the present invention, oligodeoxynucleo-tides complementary to a portion of the c-myb mRNA trans-cript beginning with the second codon from the 5' end ofthe transcript are particularly preferred.
As used in the herein specification and appended claims, unless otherwise indicated, the term "oligonucleo-tide" includes both oligomers of ribonucleotide i.e., oligoribonucleotides, and oligomers of deoxyribonucleotide i.e., oligodeoxyribonucleotides (also referred to herein as "oligodeoxynucleotides").
As used herein, unless otherwise indicated, the term "oligonucleotide" also includes oligomers which may be large enough to be termed "polynucleotides".
The terms "oligonucleotide" and "oligodeoxynucleo-tide" include not only oligomers and polymers of the biologically significant nucleotides, i.e. nucleotides of adenine ("A"), deoxyadenine ("dA"), guanine ("G"), deoxy-5 guanine ("dG"), cytosine ("C"), deoxycytosine ("dC"),thymine ("T") and uracil ("U"), but also oligomers and polymers hybridizable to the c-myb mRNA transcript which may contain other nucleotides. Likewise, the terms "oligo-nucleotide" and "oligodeoxynucleotide" include oligomers 10 and polymers wherein one or more purine or pyrimidine moieties, sugar moieties or internucleotide linkages is chemically modified.
The invention provides a method for treating hematologic neoplasms in vivo or ex vivo comprising admin-15 istering to an individual or cells harvested from theindividual an effective amount of c-myb antisense oligonu-cleotide. The invention also provides a method for treat-ing an individual to induce immunosuppression by adminis-tering to the individual an effective amount of such 20 oligonucleotide.
In one embodiment, the method for treating hemato-logic neoplasms comprises a method for purging bone marrow of such neoplasms. Aspirated bone marrow cells are treated with an effective amount of a c-myb antisense oligonucleo-25 tide as described above.
Description of the Figures Figure 1 shows the effect of the c-myb antisense oligodeoxynucleotide in inhibiting phytohemagglutinin-stimulated lymphocyte proliferation. Normal blood lympho-30 cytes were treated at various times with phytohemagglutininand/or the c-myb antisense oligodeoxynucleotide 5'-GCC CGA
AGA CCC CGG CAC--3' .
Figure 2 is a series of microscopic (200X) photo-graphs of untreated seven-day cultures of normal human 35 myeloid cell colonies (Fig. 2A); ARH-77, an IgG-secreting 13~03~9 plasma cell leukemia (Fig. 2B); and HL-60 promyelocytic leukemia cells (Fig. 2C).
Figure 3 is a series of microscopic (40X) photo-graphs of a 1:1 mixture of ARH-77 cells and normal hemato-poietic progenitor cells exposed to 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the c-myb sense oligodeoxynucleotide 5'-GCC CGA AGA CCC CGG CAC-3' (Fig. 3A); 10 ~g/ml (t=0) plus 5 ~g/ml (t=18 hours) of the c-myb antisense oligode-oxynucleotide 5'-GTG CCG GGG TCT TCG GGC-3' (Fig. 3B); and 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the same c-myb antisense oligomer (Fig. 3C). The photographs were taken at t=day 7.
Figure 4A is a high magnification (200X) view of the persisting normal myeloid colony indicated by arrows in Figure 3C. Figure 4B is a 200X view of the plasma cell leukemia cells shown is Figure 3A.
Figure 5 is a series of microscopic (40X) photo-graphs of a 1:1 mixture of HL-60 cells and normal hemato-poietic progenitor cells exposed to 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the c-myb sense oligodeoxynucleotide 5'-GCC CGA AGA CCC CGG CAC-3'(Fig. 5A); 10 ~g/ml (t=0) plus 5 ~g/ml (t=18 hours) of the c-myb antisense oligodeoxynu-cleotide 5'-GTG CCG GGG TCT TCG GGC-3'(Fig. 5B); and 40 ~g/ml (t=0) plus 20 ~g/ml (t=18 hours) of the same c-myb antisense oligomer (Fig. 5C). The photographs were taken at t=day 7.
Figure 6A is a high magnification (200X) view of the persisting normal myeloid colony (small arrow) and degenerating HL-60 colony (large arrow) indicated by the same size arrows in the corresponding lower power view of Figure 5C; Figure 6B is a 200X view of the HL-60 cells shown in Figure 5A.
Figure 7 shows the effect of the same c-myb anti-sense oligodeoxynucleotide in inhibiting lymphocyte prolif-eration in a mixed lymphocyte reaction, as determined by -cell count (Fig. 7A) and tritiated thymidine incorporation (Fig. 7B).
Figure 8A shows the effect of maintaining a human T
cell leukemia line and normal bone marrow mononuclear cells in the absence of c-myb oligodeoxynucleotides (CONT-T LEUK
and CONT-BMC, respectively), or in the presence of 40 ~g/ml (t=0), followed by 10 ~g/ml (t=18 hours), c-myb sense oligodeoxynucleotide (T-LEUK-MYB S and BMC-MYB S, respec-tively). Figure 8B shows the effect on the same cell lines of 20 ~g/ml (t=O), followed by 5 ~g/ml (t=18 hours) of c-myb antisense oligodeoxynucleotide (LEUK-MYB AS, BMC-MYB
AS). Daily cell counts and viability determinations were performed. Results presented are the mean + standard deviation of four experiments. The sense and antisense oligodeoxynucleotides were the same as in Figure 5.
Figure 9 is a series of photomicrographs (100X) of T leukemia cells maintained in liquid suspension culture for four days and then cultured in methylcellulose for an additional ten days. Colonies formed by cells in a control culture containing no oligomers appear in Figure 9A.
Colonies formed by cells exposed to c-myb sense oligodeoxy-nucleotide (20 ~g/ml, t=0; plus 5 ~g/ml, t=18 hours) are shown in Figure 9B. Cells exposed to c-myb antisense oligodeoxynucleotide (20 ~g/ml, t=0; plus 5 ~g/ml, t=18 hours) are shown in Figure 9C. The sense and antisense oligodeoxynucleotides were the same as in Figure 5.
Figure 10 is a series of low and high magnification photomicrographs of Wright's stained cytocentrifuge prep-arations of T leukemia cells (Fig. 10A: 100X; Fig. 10B:
400X) and a mixture of bone marrow cells and T leukemia cells (Fig. 10C: 100X; Fig. 10D: 400X). T leukemia cells were cultured in the presence of c-myb sense oligodeoxynuc-leotide. The bone marrow/T-leukemia cell mixture was cultured in the presence of c-myb antisense oligodeoxynuc-leotide. The sense and antisense oligodeoxynucleotideswere the same as in Figure 5.
13~0~69 Figure 11 is a series of low and high magnification photomicrographs of myeloid leukemia cells (Fig. llA: lOOX;
Fig. llB: 400X), normal bone marrow cells (Fig. llC: lOOX;
Fig. llD: 400X), and a 1:1 mixture of leukemia cells and normal bone marrow cells (Fig. llE: lOOX; Fig. llF: 400X) cloned in plasma clot culture after exposure to c-myb antisense oligodeoxynucleotide, and then stained in situ.
Stars in Figure llF mark mature myeloid elements (polymor-phonuclear leukocytes, bands, and metamyelocytes). The~0 antisense oligodeoxynucleotide was the same as in Figure 5.
Detailed Description of the Invention We have discovered that the c-myb gene plays a critical role in regulating normal human hematopoiesis. We have further discovered a differential sensitivity of normal and malignant hematopoietic cells to c-myb antisense oligonucleotides, that is, oligonucleotides complementary to and hybridizable with the mRNA transcript of the human c-myb gene. This differential sensitivity makes possible the use of c-myb antisense oligonucleotides as effective anti-neoplastic agents, in particular, in the purging of neoplastic cells from bone marrow.
While many drugs and antibodies have been evaluated as bone marrow purging agents, the present invention is particularly advantageous for this application. The c-myb antisense oligonucleotides are much less toxic to normal cells at effective purging doses than known purging agents.
A greatly increased engraftment rate of purged marrow is thus possible. Since many more normal progenitors survive exposure to the c-myb antisense oligomers than is typically observed after optimal exposure to standard chemotherapeu-tic agents, more intensive treatment is possible. More-over, because of their high therapeutic index, the anti-sense oligonucleotides of the invention may be employed in combination regimens with more conventional agents, which could then be employed at lower doses.
1340~
.,.
The c-myb antisense oligonucleotides are also useful as immunosuppressive agents, as they inhibit prolif-eration of normal human peripheral blood lymphocytes.
The putative DNA sequence complementary to the mRNA
transcript of the human c-myb gene has been reported in Majello et al, Proc. Natl. Acad. Sci. U.S.A. 83, 9636-9640 (1986). That sequence, from initiation codon to termination codon, and the predicted 640 amino acid sequence of the putative c-myb protein, are as follows:
ATGGCCCGAAGACCCCGGCACAGCATATATAGCAGTGACGAGGATGATGAGGACTTTGAGATG
MetAlaArgArgProArgHisSerIleTyrSerSerAspGluAspAspGluAspPheGluMet TGTGACCATGACTATGATGGGCTGCTTCCCAAGTCTGGAAAGCGTCACTTGGGGAAAACAAGG
CysAspHisAspTyrAspGlyLeuLeuProLysSerGlyLysArgHisLeuGlyLysThrArg TGGACCCGGGAAGAGGATGAAAAACTGAAGAAGCTGGTGGAACAGAATGGAACAGATGACTGG
TrpThrArgGluGluAspGluLysLeuLysLysLeuValGluGlnAsnGlyThrAspAspTrp AAAGTTATTGCCAATTATCTCCCGAATCGAACAGATGTGCAGTGCCAGCACCGATGGCAGAAA
LysValIleAlaAsnTyrLeuProAsnArgThrAspValGlnCysGlnHisArgTrpGlnLys GTACTAAACCCTGAGCTCATCAAGGGTCCTTGGACCAAAGAAGAAGATCAGAGAGTGATAGAG
ValLeuAsnProGluLeuIleLysGlyProTrpThrLysGluGluAspGlnArgValIleGlu CTTGTACAGAAATACGGTCCGAAACGTTGGTCTGTTATTGCCAAGCACTTAAAGGGGAGAATT
LeuValGlnLysTyrGlyProLysArgTrpSerValIleAlaLysHisLeuLysGlyArgIle GGAAAACAATGTAGGGAGAGGTGGCATAACCACTTGAATCCAGAAGTTAAGAAAACCTCCTGG
2~ GlyLysGlnCysArgGluArgTrpHisAsnHisLeuAsnProGluValLysLysThrSerTrp ACAGAAGAGGAAGACAGAATTATTTACCAGGCACACAAGAGACTGGGGAACAGATGGGCAGAA
ThrGluGluGluAspArgIleIleTyrGlnAlaHisLysArgLeuGlyAsnArgTrpAlaGlu ATCGCAAAGCTACTGCCTGGACGAACTGATAATGCTATCAAGAACCACTGGAATTCTACAATG
IleAlaLysLeuLeuProGlyArgThrAspAsnAlaIleLysAsnHisTrpAsnSerThrMet CGTCGGAAGGTCGAACAGGAAGGTTATCTGCAGGAGTCTTCAAAAGCCAGCCAGCCAGCAGTG
ArgArgLysValGluGlnGluGlyTyrLeuGlnGluSerSerLysAlaSerGlnProAlaVal GCCACAAGCTTCCAGAAGAACAGTCATTTGATGGGTTTTGCTCAGGCTCCGCCTACAGCTCAA
AlaThrSerPheGlnLysAsnSerHisLeuMetGlyPheAlaGlnAlaProProThrAlaGln CTCCCTGCCACTGGCCAGCCCACTGTTAACAACGACTATTCCTATTACCACATTTCTGAAGCA
LeuProAlaThrGlyGlnProThrValAsnAsnAspTyrSerTyrTyrHisIleSerGluAla CAAAATGTCTCCAGTCATGTTCCATACCCTGTAGCGTTACATGTAAATATAGTCAATGTCCCT
GlnAsnValSerSerHisValProTyrProValAlaLeuHisValAsnIleValAsnValPro - 1340~63 CAGCCAGCTGCCGCAGCCATTCAGAGACACTATAATGATGAAGACCCTGAGAAGGAAAAGCGA
GlnProAlaAlaAlaAlaIleGlnArgHisTyrAsnAspGluAspProGluLysGluLysArg ATAAAGGAATTAGAATTGCTCCTAATGTCAACCGAGAATGAGCTAAAAGGACAGCAGGTGCTA
IleLysGluLeuGluLeuLeuLeuMetSerThrGluAsnGluLeuLysGlyGlnGlnValLeu CCAACACAGAACCACACATGCAGCTACCCCGGGTGGCACAGCACCACCATTGCCGACCACACC
ProThrGlnAsnHisThrCysSerTyrProGlyTrpHisSerThrThrIleAlaAspHisThr AGACCTCATGGAGACAGTGCACCTGTTTCCTGTTTGGGAGAACACCACTCCACTCCATCTCTG
ArgProHisGlyAspSerAlaProValSerCysLeuGlyGluHisHisSerThrProSerLeu CCAGCGGATCCTGGCTCCCTACCTGAAGAAAGCGCCTCGCCAGCAAGGTGCATGATCGTCCAC
ProAlaAspProGlySerLeuProGluGluSerAlaSerProAlaArgCysMetIleValHis CAGGGCACCATTCTGGATAATGTTAAGAACCTCTTAGAATTTGCAGAAACACTCCAATTTATA
GlnGlyThrIleLeuAspAsnValLysAsnLeuLeuGluPheAlaGluThrLeuGlnPheIle GATTCTTTCTTAAACACTTCCAGTAACCATGAAAACTCAGACTTGGAAATGCCTTCTTTAACT
AspSerPheLeuAsnThrSerSerAsnHisGluAsnSerAspLeuGluMetProSerLeuThr TCCACCCCCCTCATTGGTCACAAATTGACTGTTACAACACCATTTCATAGAGACCAGACTGTG
SerThrProLeuIleGlyHisLysLeuThrValThrThrProPheHisArgAspGlnThrVal AAAACTCAAAAGGAAAATACTGl~llllAGAACCCCAGCTATCAAAAGGTCAATCTTAGAAAGC
LysThrGlnLysGluAsnThrValPheArgThrProAlaIleLysArgSerIleLeuGluSer TCTCCAAGAACTCCTACACCATTCAAACATGCACTTGCAGCTCAAGAAATTAAATACGGTCCC
SerProArgThrProThrProPheLysHisAlaLeuAlaAlaGlnGluIleLysTyrGlyPro CTGAAGATGCTACCTCAGACACCCTCTCATCTAGTAGAAGATCTGCAGGATGTGATCAAACAG
LeuLysMetLeuProGlnThrProSerHisLeuValGluAspLeuGlnAspValIleLysGln GAATCTGATGAATCTGGATTTGTTGCTGAGTTTCAAGAAAATGGACCACCCTTACTGAAGAAA
GluSerAspGluSerGlyPheValAlaGluPheGlnGluAsnGlyProProLeuLeuLysLys ATCAAACAAGAGGTGGAATCTCCAACTGATAAATCAGGAAACTTCTTCTGCTCACACCACTGG
IleLysGlnGluValGluSerProThrAspLysSerGlyAsnPhePheCysSerHisHisTrp GAAGGGGACAGTCTGAATACCCAACTGTTCACGCAGACCTCGCCTGTGCGAGATGCACCGAAT
GluGlyAspSerLeuAsnThrGlnLeuPheThrGlnThrSerProValArgAspAlaProAsn ATTCTTACAAGCTCCGTTTTAATGGCACCAGCATCAGAAGATGAAGACAATGTTCTCAAAGCA
IleLeuThrSerSerValLeuMetAlaProAlaSerGluAspGluAspAsnValLeuLysAla TTTACAGTACCTAAAAACAGGTCCCTGGCGAGCCCCTTGCAGCCTTGTAGCAGTACCTGGGAA
PheThrValProLysAsnArgSerLeuAlaSerProLeuGlnProCysSerSerThrTrpGlu CCTGCATCCTGTGGAAAGATGGAGGAGCAGATGACATCTTCCAGTCAAGCTCGTAAATACGTG
ProAlaSerCysGlyLysMetGluGluGlnMetThrSerSerSerGlnAlaArgLysTyrVal AATGCATTCTCAGCCCGGACGCTGGTCATG
AsnAlaPheSerAlaArgThrLeuValMet 134036g The antisense oligonucleotides of the invention may be synthesized by any of the known chemical oligonucleotide synthesis methods. Such methods are generally described, for example, in Winnacker, From Genes to Clones: Introduc-tion to Gene Technology, VCH Verlagsgesellschaft mbH (H.
Ibelgaufts trans. 1987).
Any of the known methods of oligonucleotide syn-thesis may be utilized in preparing the instant antisense oligonucleotides.
The antisense oligonucleotides are most advantag-eously prepared by utilizing any of the commercially available, automated nucleic acid synthesizers. The device utilized to prepare the oligonucleotides described herein, the Applied Biosystems 380B DNA Synthesizer, utilizes ~-cyanoethyl phosphoramidite chemistry.
Since the complete nucleotide synthesis of DNA
complementary to the c-myb mRNA transcript is known, anti-sense oligonucleotides hybridizable with any portion of the mRNA transcript may be prepared by the oligonucleotide synthesis methods known to those skilled in the art.
While any length oligonucleotide may be utilized in the practice of the invention, sequences shorter than 15 bases may be less specific in hybridizing to the target c-myb mRNA, and may be more easily destroyed by enzymatic digestion. Hence, oligonucleotides having 15 or more nucleotides are preferred. Sequences longer than 18 to 21 nucleotides may be somewhat less effective in inhibiting c-myb translation because of decreased uptake by the target cell. Thus, oligomers of 15-21 nucleotides are most preferred in the practice of the present invention, par-ticularly oligomers of 15-18 nucleotides.
Oligonucleotides complementary to and hybridizable with any portion of the c-myb mRNA transcript are, in principle, effective for inhibiting translation of the transcript, and capable of inducing the effects herein described. It is believed that translation is most effec-1340~6'3 -tively inhibited by blocking the mRNA at a site at or near the initiation codon. Thus, oligonucleotides complementary to the 5'-terminal translated region of the c-~yb mRNA
transcript are preferred. The oligonucleotide is prefer-ably directed to a site at or near the initiation codon forprotein synthesis. Oligonucleotides complementary to the c-myb mRNA, beg~nn~ng with the codon adjacent to the initiation codon (the second codon from the 5/ tran~lated end of the traDslated portion of transcript), may be thus advantageously employed.
The following lS- through 21-mer oligodeoxynucleo-tides are complementary to the c-myb mRNA transcript beginning with the second codon of the translated portion of the transcript:
5'-GCT GTG CCG GGG TCT TCG GGC-3' 5'-CT GTG CCG GGG TCT TCG GGC-3' 5'-T GTG CCG GGG TCT TCG GGC-3' 5'-GTG CCG GGG TCT TCG GGC-3' 5'-TG CCG GGG TCT TCG GGC-3' 5'-G CCG GGG TCT TCG GGC-3' 5'-CCG GGG TCT TCG GGC-3' Oligonucleotides hybridizable to the c-myb mRNA
transcript finding utility according to the present inven-tion include not only native oligomers of the biologically significant nucleotides, i.e., A, dA, G, dG, C, dC, T and U, but also oligonucleotide species which have been modi-fied for improved stability and/or lipid solubility. For example, it is known that enhanced lipid solubility and/or resistance to nuclease digestion results by substituting a methyl group or sulfur atom for a phosphate oxygen in the internucleotide phosphodiester linkage. The phosphoro-thioates, in particular, are stable to nuclease cleavage and soluble in lipid. They may be synthesized by known automatic synthesis methods.
The antisense oligonucleotides of the invention inhibit normal human hematopoiesis. However, they inhibit '1 , -the growth of malignant hematopoietic cells at a significa-ntly lower concentration than normal cells. This pharmaceutically significant differential sensitivity makes the instant oligonucleotides very useful in treating hematologic neoplasms.
Hematologic neoplastic cells believed sensitive to the instant c-myb antisense oligonucleotides include, for example, myeloid and lymphatic leukemia cells, malignant plasma (myeloma) cells and lymphoma cells. The appearance of these cells in the bone marrow and elsewhere in the body is associated with various disease conditions, such as all of the various French-American-British (FAB) subtypes of acute myeloid and lymphatic leukemia; chronic lymphatic and myeloid leukemia; plasma cell myeloma and plasma cell dyscrasias; the various non-Hodgkin's lymphomas as des-cribed, for example, in the Working Formulation classifica-tion, Devita, Cancer: Principles and Practice of Oncology (2d ed. 1985), p. 1634; and possibly Hodgkin's disease.
Hematologic neoplastic cells would likely arise de novo in the marrow. In Hodgkin's disease, and in some of the various lymphomas, tumor cells may metastasize to the marrow from a primary tumor situated elsewhere in the body.
While inhibition of c-myb mRNA translation is possible utilizing either antisense oligoribonucleotides or oligodeoxyribonucleotides, oligoribonucleotides are more susceptible to enzymatic attack by ribonucleases than deoxyribonucleotides. Hence, oligodeoxyribonucleotides are preferred in the practice of the present invention.
The antisense oligonucleotides of the invention find utility as bone marrow purging agents. They may be utilized in vitro to cleanse bone marrow contaminated by hematologic neoplasms. They are useful as purging agents in either allogeneic or autologous bone marrow transplanta-tion. They are particularly effective in the treatment of hematological malignancies or other neoplasias which metastasize in the bone marrow.
13~0.363 According to a method for bone marrow purging, bone marrow is harvested from a donor by standard operating room procedures from the iliac bones of the donor. Methods of aspirating bone marrow from donors are well known in the art. Examples of apparatus and processes for aspirating bone marrow from donors are disclosed in U.S. Patents 4,481,946 and 4,486,188. Sufficient marrow is withdrawn so that the recipient, who is either the donor (autologous transplant) or another individual (allogeneic transplant), may receive from about 4 x 1o8 to about 8 x 1o8 processed marrow cells per kg of bodyweight. This generally requires aspiration of about 750 to about 1000 ml of marrow. The aspirated marrow is filtered until a single cell suspen-sion, known to those skilled in the art as a "buffy coat"
preparation, is obtained. This suspension of leukocytes is treated with c-myb antisense oligonucleotides in a suitable carrier, advantageously in a concentration of about 8 mg/ml. Alternatively, the leucocyte suspension may be stored in liquid nitrogen using standard procedures known to those skilled in the art until purging is carried out.
The purged marrow can be stored frozen in liquid nitrogen until ready for use. Methods of freezing bone-marrow and biological substances are disclosed, for example, in U.S.
Patents 4,107,937 and 4,117,881.
One or more hematopoietic growth factors may be added to the aspirated marrow or buffy coat preparation to stimulate growth of hematopoietic neoplasms, and thereby increase their sensitivity to the toxicity of the c-myb antisense oligonucleotides. Such hematopoietic growth factors include, for example, interleukin-3 and granulocyte macrophage colony stimulating factor (GM-CSF). The recombinant human versions of such growth factors are advantageously employed.
After treatment with the antisense oligonucleo-tides, the cells to be transferred are washed with auto-logous plasma to remove unincorporated oligomer. The washed cells are then infused into the recipient.
The instant c-myb antisense oligonucleotides also inhibit proliferation of human peripheral blood lympho-cytes. Accordingly, they are useful as immunosuppressiveagents, that is, they may be utilized to inhibit immune response, particularly cellular response. They are partic-ularly useful in situations where rapid, but short term, inactivation of the immune system is desirable. Such circumstances may include, but are not limited to, acute graft-versus-host disease, acute organ rejection (heart, liver, kidney, pancreas), and flares of autoimmune-type diseases such as acute systemic lupus erythematosus, rheumatoid arthritis and multiple sclerosis.
For in vivo use, the antisense oligonucleotides may be combined with a pharmaceutical carrier, such as a suit-able liquid vehicle or excipient and an optional auxiliary additive or additives. The liquid vehicles and excipients are conventional and commercially available. Illustrative thereof are distilled water, physiological saline, aqueous solution of dextrose, and the like. For in vivo antineo-plastic or immunosuppressive use, the c-myb mRNA antisense oligonucleotides are preferably administered intravenously.
It is also possible to administer such compounds ex vivo by isolating lymphocytes from peripheral blood, treating them with the antisense oligonucleotides, then returning the treated lymphocytes to the peripheral blood of the donor.
Ex vivo techniques have been utilized in treatment of cancer patients with interleukin-2 activated lymphocytes.
In addition to administration with conventional carriers, the antisense oligonucleotides may be adminis-tered by a variety of specialized oligonucleotide delivery techniques. For example, oligonucleotides have been successfully encapsulated in unilameller liposomes.
Reconstituted Sendai virus envelopes have been successfully l3~o36~
used to deliver RNA and DNA to cells. Arad et al., Biochem. Biophy. Acta. 859, 88-94 (1986).
For ex vivo antineoplastic application, such as, for example, in bone marrow purging, the c-myb antisense oligonucleotides may be administered in amounts effective to kill neoplastic cells while maintaining the viability of normal hematologic cells. Such amounts may vary depending on the nature and extent of the neoplasm, the particular oligonucleotide utilized, the relative sensitivity of the neoplasm to the oligonucleotide, and other factors. Con-centrations from about 10 to 100 ~g/ml per 105 cells may be employed, preferably from about 40 to 60 ~g/ml per 105 cells. Supplemental dosing of the same or lesser amounts of oligonucleotide are advantageous to optimize the treat-ment. Thus, for purging bone marrow containing 2 x 107 cell per ml of marrow volume, dosages of from about 2 to 20 mg antisense per ml of marrow may be effectively utilized, preferably from about 8 to 12 mg/ml. Greater or lesser amounts of oligonucleotide may be employed.
For in vivo use, the c-myb antisense oligonucleo-tides may be administered in an amount sufficient to result in extracellular concentrations approximating the above stated in vitro concentrations. The actual dosage admin-istered may take into account the size and weight of the patient, whether the nature of the treatment is prophy-lactic or therapeutic in nature, the age, weight, health and sex of the patient, the route of administration, and other factors. The daily dosage may range from about 0.1 to 1,000 mg oligonucleotide per day, preferably from about 10 to about 1,000 mg per day. Greater or lesser amounts of oligonucleotide may be administered, as required.
The present invention is described in greater detail in the following non-limiting examples.
. 13403fi.~
Example 1 Effect of c-myb Antisense Oligomer on Normal Peripheral Blood LYmphocyte Proliferation in Response to PHA Ex~osure The c-myb antisense oligonucleotides have immunosuppressant activity, as demonstrated by the following experiment wherein lymphocyte proliferation is markedly suppressed by treatment with the oligomer. Normal blood lymphocytes were treated with the c-myb antisense oligodeoxynucleotide 5 '-GTG CCG GGG TCT TCG GGC-3' at a final concentration of 40 ~g/ml. C-myb antisense and/or phytohaemagglutinin (PHA) were added to the cells as follows: (i) PHA alone, t=0 (no oligonucleotide); (ii) c-myb antisense alone, t=0 (no PHA); (iii) c-myb antisense, t=0; PHA, t=24 hours; (iv) c-myb antisense + PHA, both t=0;
(v) PHA, t=0; c-myb antisense, t=24 hours; and (vi) PHA, t=0; c-myb antisense t=24 and 48 hours. Cell counts were performed at t=day 6. The results are shown in Figure 1.
As is evident from the figure, PHA treatment alone resulted in marked cell proliferation when compared to cells exposed to 40 ~g/ml c-myb antisense oligomer. One dose of oligomer alone in the absence of PHA did not appear to be toxic to normal lymphocytes through day 6. As can be noted in Figure 1, however, once cells were exposed to PHA, either simultaneously or within 24 hours of c-myb antisense treat-ment, the 40 ~g/ml dose became very toxic to the cells, as manifested by the low cell numbers present on day 6.
Additional doses of c-myb at 24 and 48 hours did not appear to be essential in order to inhibit PHA-induced proliferation of normal cells.
~'- 13403~
Example 2 Effect of c-mYb Antisense Oliqomer on Normal Peripheral Blood Lymphocyte Proliferation in Mixed Lymphocyte Reaction The following experiment further demonstrates the immunosuppressant activity of the c-myb antisense oligonu-cleotides. Normal peripheral blood mononuclear cells (Figure 7: X cells) were either stimulated with PHA alone or mixed with mitomycin C-treated mononuclear cells from another normal donor (Figure 7: Y* cells). In two cul-tures, X cells were pre-incubated for 18 hours with 40 ~g/ml of the c-myb sense oligonucleotide 5'-GCC CGA AGA CCC
CGG CAC-3', or the c-myb antisense oligonucleotide used in Example 1. The thus treated X cells were then mixed with Y* cells. At 24 and 48 hours, an additional 10 ~g/ml of oligomers was added to the cultures. After five days, cell counts were performed (Figure 7A), and tritiated thymidine incorporation was determined (Figure 7B). Inhibition of mixed lymphocyte-induced cell proliferation and tritiated thymidine incorporation was observed only with the c-myb antisense-treated cells.
Example 3 Differential Sensitivity of Tumor (ARH-77) and Normal Proqenitor Cells Toward c-myb Oligonucleotide The following experiment was performed to establish the differential sensitivity of normal progenitor and tumor cells to c-myb antisense oligonucleotide. Accordingly, tumor cells (1 x 106 cells/ml) or normal human marrow cells (1 x 105 cells/ml) were cultured alone or mixed together in a 1:1 ratio (total cell number cultured = 1 x 105 cells/
ml) in the presence or absence of c-myb oligonucleotides.
Figures 2A, 2B and 2C respectively show a high magnification view (200X) of untreated (A) normal human myeloid cell colonies, (B) ARH-77 cells (IgG-secreting plasma cell leukemia, ATCC No. CRL 1621), and (C) HL-60 13~03~9 . .
(promyelocytic leukemia cells), all after seven days of culture. It can be observed that the normal marrow cells grow in widely separate aggregates of relatively small cell number. The tumor cells grow much more luxuriantly, and appear to overgrow each other.
Figure 3 is a series of low magnification (40X) photographs of a 1:1 mixture of ARH-77 cells and normal hematopoietic progenitor cells exposed to: (A) high dose c-myb sense 5'-GCC CGA AGA CCC CGG CAC-3' (40 ~g/ml, t=0;
20 ~g/ml supplement at t=18 hours); (B) low dose c-myb antisense 5'-GTG CCG GGG TCT TCG GGC-3'; (10 ~g/ml t=0; 5 ~g/ml supplement at t=18 hours); and (C) high dose c-myb antisense (40 ~g/ml, t=0; 20 ~g/ml supplement at t=18 hours). The Figure 3 photographs were taken at t=day 7.
While the sense-treated plate (Figure 3A) was overwhelmed with tumor cells on day 7, the low dose antisense plate (Figure 3B) displayed persistent, but dramatically reduced numbers of tumor cells. The high dose antisense plate (Figure 3C) contained a normal myeloid colony with complete disappearance of tumor cells. The arrow heads in Figure 3C
surround a normal myeloid colony which is shown at high magnification in Figure 4A. A high magnification view of the sense-treated plasma cell leukemia cells of Figure 3A
is shown in Figure 4B.
Example 4 Differential Sensitivity of Tumor (HL-60) and Normal Proqenitor Cells Toward c-myb Oligonucleotide The sense/antisense dosing procedure of Example 3 was repeated substituting HL-60 leukemia cells for ARH-77 cells, and utilizing the same dosages and dose times from Example 3. The results are shown in Figures 5 and 6.
Figure 5 is a series of low (40X) magnification views of a 1:1 mix of HL-60 cells and normal hematopoietic progenitor cells exposed to: (A) high dose c-myb sense, (B) low dose c-myb antisense, and (C) high does c-myb antisense. While a very large HL-60 tumor aggregate ~ 1340369 appeared in the sample treated with a high dose of c-myb sense oligodeoxynucleotide (Figure 5A), the colony treated with a low dose of antisense oligonucleotide is much smaller, with fewer tumor cells being apparent (Figure 5B).
A high power view of Figure 5A is shown in Figure 6B. At the high dose of antisense (Figure 5C), normal hemato-poietic progenitor cells are unaffected as evidence by the normal myeloid colony indicated by the small arrow head in Figure 5C. An HL-60 colony was observed to be degenerat-ing, as indicated by the large arrowhead.
The colonies featured in Figure 5C are shown athigher magnification in Figure 6A.
Example 5 Differential Sensitivity of Leukemic T Cells and Normal Proqenitor Cells Toward c-myb Oliqonucleotide The following experiment further demonstrates that when normal marrow hematopoietic cells are combined with leukemic blast cells in the presence of c-myb antisense oligonucleotide, leukemic cell cloning efficiency is preferentially inhibited, and is accompanied by leukemic cell death. Colony formation in semi-solid cultures was employed as an indicator system to assess survival of clonogenic progenitor cells. Of great importance, many normal hematopoietic progenitor cells were observed to survive exposure to c-myb antisense oligonucleotide, and to continue to form colonies in semi-solid culture medium.
Bone marrow cells from normal consenting donors and cells of the human T cell leukemia cell line CCRF-CEM, obtained from the American Type Culture Collection, were treated as follows. Normal hematopoietic progenitor cells were enriched from light density bone marrow mononuclear cells. The normal cells and the T leukemia cells were placed in liquid suspension cultures (RPMI 1640 with 20%
fetal bovine serum, either alone or in a 1:1 mix). Control cultures were left untreated. Treated cultures received varying amounts of the same c-myb sense and antisense .
1340~fi9 oligomers applied in the procedure of Example 3, namely 5-80 ~g/ml (~ 1 ~M to 14 ~M) at t=0, supplemented with additional oligomer (25% of the initial dose)) at about 18 hours after the start of incubation. Cultures were in-cubated (5% C02, 37~C) for four days, during which timedaily cell counts were performed and cell viability was recorded. At the end of the four days, the cells remaining in suspension (to a maximum of 2 x 105/ml) were transferred to methylcellulose cultures, Leary et al., Blood 71, 1759 (1988) containing 24 U/ml and 5 ng/ml respectively of recombinant human interleuken-3 (rH IL-3) and recombinant human granulocyte macrophage colony stimulating factor (rH
GM-CSF). After a total of ten to twelve days in culture, the culture plates were scanned in their entireties with the aid of an inverted microscope, and total colonies per cluster in the dishes were enumerated. To verify the origin of the colonies, that is, whether they were derived from the leukemic or from normal hematopoietic progenitor cells, all cells were removed from the dishes by diluting the methylcellulose in tissue culture medium, transferring the culture dish's contents to a polypropylene tube, and then preparing cytocentrifuge preparations from the con-tents of the tube for histochemical or immunochemical identification of tumor cells. Histochemical identifica-tion of tumor cells was carried out by air drying thecytocentrifugation slides, flooding the slides with Modi-fied Wright's stain (Sigma Chemical Company, #WS lb) for 5 minutes, followed by rinsing with de-ionized water for 2 minutes. The slides were then coverslipped. Clots were fixed with 4% glutaraldehyde for 8 minutes, flushed with distilled water for 12 minutes, and then dried into a film.
The plates were then flooded with Modified Wright's stain for 3 minutes, rinsed in de-ionized water for 6 minutes, and coverslipped. The immunochemical identification of tumor cells was according to the procedure of Gewirtz et al., J. Immunol. 139, 2195 (1987), utilizing the Leu-3a ~ 13~0369 monoclonal antibody (Becton-Dickenson, Mountainview, CA.).
The Leu-3a antibody is directed against the CD4 epitope.
The effect of maintaining the T cell leukemia line and the marrow cells in suspension culture according to the procedure of Example 5, in the presence or absence of the c-myb oligomers, is shown in Figure 8. In the absence of the oligomers, the T cell leukemia continued to divide in culture, whereas the numbers of bone marrow cells remained essentially unchanged. See Figure 8A. Cell viability remained high among both cell populations and always exceeded 90%, as assessed by trypan blue exclusion. Treat-ment of cells with high doses (40 ~g/ml, t=0; 10 ~g/ml, t=18 hours) of the c-myb sense oligomer did not signif-icantly effect the growth or viability of either cell type (Figure 8A). In distinct contrast (Figure 8B), when the T
leukemia cells were incubated in suspension with c-myb antisense oligomer (20 ~g/ml, t=0; 5 ~g/ml, t=18 hours) cell proliferation was not only inhibited, but there was a daily decline in cell numbers and viability as well. After four days only approximately 25-30% of the cells initially added to the culture remained; the viability of these cells was also greatly reduced (~ 70% reduction). The effect of the antisense oligomer is even more dramatic if one com-pares cell numbers (mean + standard deviation (hereinafter "SD"); n=4) in the control cultures at four days (285 + 17 x 104/ml) with the number remaining in the antisense-containing culture (4.7 + 0.8 x 104 /ml). Importantly, when suspended in the same dose of antisense oligomer, the normal marrow mononuclear cells exhibited only a slight decline in numbers and viability over the same time period (~ 90% of initial cells remaining; viability >90%). These numbers were not significantly altered if hematopoietic growth factors were added to the bone marrow cell suspen-sion during the four day incubation period.
Results from a typical experiment, repeated three times are shown in Table 1 ("BMC" = normal bone marrow cells; "MYB S" = c-myb sense oligonucleotide; "MYB AS" =
c-myb antisense oligonucleotide; "TNTC" = to numerous to count):
Cells No. Cells Oligonucleotide Colony/Cluster Plated Added Amt. Added Count (~g/ml at t=0; (Mean t Stan-t=18 hours) dard Deviation) BMC 5 x 104/ml None 24+4 MYB S (20; 5.0) 31+4 MYB S (20; 5.0) 30+6 T 5 x 104/ml None TNTC
LEUKEMIA MYB S (20; 5.0) TNTC
MYB S (20; 5.0) 1:1 BMC+ 5 x 104/ml None TNTC
LEUKEMIA of each MYB S (20; 5.0) TNTC
MYB AS (2; 0.5) TNTC
MYB AS (5; 1.0) TNTC
MYB AS (10; 2.5) 41+5 MYB AS (20; 5.0) 34+1 In dishes containing untreated bone marrow cells, colony numbers varied directly with the number of cells plated (5 x 104/ml to 2 x 105/ml), and ranged between 31+4 (mean +SD) and 274+18. In dishes containing the untreated leukemia cells, cloned at equivalent concentrations, growth was always luxuriant and the numbers of colonies were too numerous to count (TNTC) (Figure 9A). Exposure to the c-myb sense oligomer had no effect on either normal, or leukemic cell (Figure 9B) growth when compared to growth in untreated cultures. Colony formation by cells in Figure 9A
and Figure 9B were essentially identical. When leukemic blasts were cultured alone in the higher doses of antisense oligomer, the numbers of resulting colony/clusters were reduced from TNTC to a maximum of about 2 per 5 x 104 leukemia cells plated (Figure 9C). In distinct contrast, in dishes containing bone marrow cells exposed to c-myb antisense, colony formation was not significantly perturbed by the dose and exposure schedule employed (see Table 1).
Not unexpectedly then, when bone marrow cells were mixed 1:1 with T leukemia cells and then exposed to the c-myb antisense oligomer at concentrations S5 ~g/ml and 1 ~g/ml (t=0 and t=18 hours, respectively), the leukemic cells continued to grow vigorously, and the number of colonies were too numerous to count. However, when the oligomer exposure intensified, a definite dose-response relationship became apparent. At an initial dose of 10 ~g/ml, followed by 2.5 ~g/ml eighteen hours later, the leukemia cells no longer overgrew the plate, and distinct colones could be enumerated in the mixed cell cultures. Nevertheless, histochemical and immunochemical staining demonstrated that ~50% of the colonies that formed in these mixed cell dishes appeared to be of leukemic blast cell origin. When the dose of antisense oligomer employed equaled or exceeded 20 ~g/ml (t=0) followed by 5 ~g/ml (t=18 hours), leukemic colonies could no longer be identified with certainty in the cultures by simple visual analysis.
To more rigorously examine the cultures for resid-ual leukemic elements, the methylcellulose cultures were liquified with tissue culture medium, and the entire cell contents were deposited onto slides by cytocentrifugation.
Low (lOOx) and high (400x) magnification photomicrographs of Wright's stained T leukemia cells after twelve days of culture in methylcellulose are shown in Figures lOA and lOB, respectively. Most cells were small, had only a thin rim of cytoplasm, and resembled unactivated lymphocytes, though occasional large, undifferentiated blast cells with prominent nucleoli were also noted (arrows). Neither of these cell types could be identified in the culture dishes containing the leukemia plus normal cell populations which had been cultured in the high dose of c-myb antisense oligomer. As demonstrated in Figures lOC (lOOx) and lOD
(400x), respectively, only normally maturing cells could be identified in these cultures. The colonies which developed 13403~9 .
in the high dose antisense plates were also numerically equivalent to those enumerated in the bone marrow cell control plates.
Immunochemical staining with Leu 3a antibody of either T leukemia cells alone, marrow mononuclear cells alone, or mixtures of normal marrow mononuclear cells and T
leukemia célls, maintained in liquid suspension cultures for eight days, corroborated these results. After eight days in culture, only 4% of bone marrow cells stained Leu 3a positive, while ~93% of T cell leukemia cells were labeled with this antibody. When bone marrow cells and T
leukemia cells were mixed 1:1, and then stained after eight days in culture, ~98% of cells were stained with Leu 3a in the untreated culture, and in the culture containing the c-myb sense oligomer. These results indicated that the T
leukemia cells outgrew the bone marrow cells, and essen-tially replaced them in these cultures. In marked con-trast, in the mixed cell culture containing the c-myb antisense oligomer, only 3% of the cells stained with Leu 3a after eight days. This value is identical to that obtained in the bone marrow control culture, and suggests again that the leukemic cells were eliminated from the culture.
ExamPle 6 Effect of High Dose c-myb Antisense Oligomer On Leukemic Blast Cells From Acute Myeloqenous Leukemia Patients Th following experiment illustrates the effect of high dose c-myb antisense oligomer exposure on colony/clus-ter formation by leukemic blast cells isolated directly from patients with acute myelogenous leukemia.
The peripheral blood of leukemic blast cells were isolated form patients with acute myelogenous leukemia by Ficoll gradient centrifugation. The blast cells (2 x 105/ml) were washed in fresh tissue culture medium and then exposed to c-myb sense or antisense oligomers (40 ~g/ml, 13403~
t=0; 10 ~g/ml, t=18 hours) in suspension culture. Four to six hours after addition of the last dose of oligomer, the blast cells were seeded into plasma clot or methylcellulose cultures and cultured for ten to twelve days to assess the presence of residual colony/cluster forming units. Cell colonies and cell clusters were enumerated in sense (S) and antisense (AS) containing plates, and the values compared to growth in control cultures which contained no oligomers.
The results are expressed in Table 2 as % residual control culture growth (arbitrary 100% value). Significance of changes in colony/cluster growth in AS-treated plates, in comparison to that observed in controls, is given as a P
value derived by Student's t test for unpaired samples.
~ 1340~6~
Case # Cell Colonies Cell Clusters P Value S/AS1 S/AS ColonY/Cluster #1 86%/18% 60%/37% [.058]/[.080]
#4 NG2 90%/28% [----]/[.036]
#5 NG 70%/22% [----]/[.101]
#6 NG 79%/22% [----]/[.026]
#7 170%/100% 76%/128% [.423]/[.502]
#8 92%/11% 96%/46% [.008]/[.020]
#10 NG 190%/216% [----]/[.034]
#11 45%/14% 58%/21% [.021]/[.084]
#14 68%/01% 90%/53% [.152]/[.071]
#15 66%/81% 100%/100% [.736]/[.896]
#16 NG 66%/24% [----]/[.001]
#17 NG 16%/8% [----]/[.023]
#18 NG 110%/77% [----]/[.164]
#19 113%/116% 91%/91% [-717]/[-763]
#20 92%/09% 100%/50% [.051]/[.009]
#21 94%/00% 90%/06% [.006]/[.004]
#22 80%/13% 103%/11% [.001]/[.015]
#23 63%/06% 74%/27% [.001]/[.004]
#24 87%/17% 91%/26% [.002]/[.018]
#25 100%/00% 107%/38% [.019]/[.364]
#26 76%/00% 89%/00% [-009]/[.001]
#27 79%/21% 59%/18% [-014]/[.043]
#28 88%/20% 94%/152% [.009]/[.096]
1 S/AS = percentage of cell colonies or cell clusters remaining in sense (S) or antisense (AS) containing plates, compared to growth in control cultures which contained no oligomers.
2 NG = no growth.
Of the twenty-eight cases studied, we were able to gather colony, and/or cluster formation data in twenty-three cases (Table 2). Growth of cells from patients #2, #3, #9 and #12-#13 was too poor to evaluate the effect of treatment. A decline in either colony or cluster formation in comparison to growth in untreated cultures was observed in eighteen of the twenty-three evaluable cases (78%). Of those cases in which this response was observed, the decline in colony number was statistically significant (p<.05) in 11/13 cases (85%). In the two cases where the decrease was not of statistical significance, the p values were .058 (Case #1) and .051 (Case #20). Similarly, the decrement in cluster formation was statistically signifi-cant in 13/17 (76%) of the cases. The degree of inhibition was also impressive. Mean (+SD) residual leukemic colony formation in the eleven responding cases was 10.0+7.9% of control (untreated leukemia cell) colony formation. Mean (+SD) residual leukemic cluster formation in the seventeen responding cases was 25.7+15.3% of control.
Example 7 Complete Purginq of Patient-Derived Myeloid Leukemia Cells From Normal Bone Marrow Cells The following experiment demonstrates that a more intensive exposure to the antisense c-myb oligomer results in complete elimination of myeloid leukemic progenitor cells from a mixture of normal bone marrow progenitor cells, with adequate survival of the normal progenitor cells.
Normal bone marrow cells and blasts obtained from Case #26 (Example 6, Table 2) were utilized for purging using the T cell purging protocol described in Example 5.
The only modification involved was the addition of oligomer (20 ~g/ml) just prior to plating after four days in suspen-sion culture. In untreated cultures, the blasts formed 25.5+3.5 (mean +SD per 2 x 105 cells plated) colonies and 157+8.5 clusters in growth factor stimulated cultures. The 1340~6~
.
addition of c-myb sense oligomers at doses equivalent to those added to antisense containing cultures did not significantly alter these numbers (19.5+.7 colonies and 140.5+7.8 clusters). As expected (see Table 2), antisense oligomers again totally inhibited colony/cluster formation by the leukemic blasts. Colony formation as also inhibited in the plates containing normal bone marrow cells, but only by ~50% in comparison to untreated control plates. (Con-trol colony formation = 296+40 per 2 x 106 cells plated;
Treated = 149+15.5 per 2 x 106 cells). Histochemical staining of the leukemic blast cell cultures revealed only scattered residual cells in the antisense treated plates (Fig. llA: lOOx). At high magnification, these "cells"
appeared to be non-viable naked nuclei (Fig. llB: 400x).
As was stated above, at an equivalent antisense oligomer dose, bone marrow cells formed numerous, though smaller, colonies which contained cells that had matured normally (Fig. llC and llD; lOOx and 400x, respectively). In the culture dishes in which normal marrow and leukemic blast cells had been mixed in a 1:1 ratio, only normal elements could be identified with certainty (Fig. llE: lOOx; Fig.
llF: 400x). Stars in Fig. llF mark mature myeloid elements (polymorphonuclear leukocytes, bands, and metamyelocytes).
C-myb oligonucleotide, administered to cell cul-tures at concentrations utilized above, effectively kills neoplastic cells. The same concentrations, however, are non-toxic to normal progenitor cells. Thus, the oligomers are useful as anti-neoplastic agents, particularly as bone marrow purging agents.
The following non-limiting example illustrates one methodology for bone marrow purging according to the present invention.
13~ 036~9 Example 8 Bone Marrow Purging with c-myb Antisense Oligonucleotide Bone marrow is harvested from the iliac bones of a donor under general anesthesia in an operating room using standard techniques. Multiple aspirations are taken into heparinized syringes. Sufficient marrow is withdrawn so that the marrow recipient will be able to receive about 4 x 108 to about 8 x 108 processed marrow cells per kg of body weight. Thus, about 750 to 1000 ml of marrow is withdrawn.
The aspirated marrow is transferred immediately into a transport medium (TC-l99, Gibco, Grand Island, New York) containing 10,000 units of preservative-free heparin per 100 ml of medium. The aspirated marrow is filtered through three progressively finer meshes until a single cell suspension results, i.e., a suspension devoid of cellular aggregates, debris and bone particles. The filtered marrow is then processed further into an automated cell separator (e.g., Cobe 2991 Cell Processor) which prepares a "buffy coat" product, (i.e., leukocytes devoid of red cells and platelets). The buffy coat preparation is then placed in a transfer pack for further processing and storage. It may be stored until purging in liquid nitrogen using standard procedures. Alternatively, purging can be carried out immediately, then the purged marrow may be stored frozen in liquid nitrogen until it is ready for transplan-tation.
The purging procedure may be carried out as follows: Cells in the buffy coat preparation are adjusted to a cell concentration of about 2 x 107/ml in TC-l99 containing about 20% autologous plasma. C-myb antisense oligodeoxynucleotide, for example, in a concentration of about 8 mg/ml is added to the transfer packs containing the cell suspension. Recombinant human hematopoietic growth factors, e.g., rH IL-3 or rH GM-CSF, may be added to the suspension to stimulate growth of hematopoietic neoplasms , 13 !1~ 3 ~ ~
and thereby increase their sensitivity c-myb antisense oligonucleotide toxicity. The transfer packs are then placed in a 37~C waterbath and incubated for 18 - 24 hours with gentle shaking. The cells may then either be frozen in liquid nitrogen or washed once at 4~C in TC-199 containing about 20% autologous plasma to remove unincorporated oligomer. Washed cells are then infused into the recipient. Care must be taken to work under sterile conditions wherever possible and to maintain scrupulous aseptic techniques at all times.
The present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and, accordingly, reference should be made to the appended claims, rather than to the foregoing specification, as indicating the scope of the invention.
13~0369 SUPPLEMENTARY DISCLOSURE
While in principle oligonucleotides having a sequence complementary to any region of the c-myb gene find utility in the present invention, oligodeoxynucleotides complementary to the 5'-terminal portion of the c-~yb mRNA
transcript are particularly preferred.
The putative DNA sequence complementary to the mRNA
transcript of the human c-~yb gene has been reported in Majello et al, Proc. Natl. Acad. ~ci. U.S.A. 83, 9636-9640 (1986). The 5'-untranslate~ region upstream of the initia-tion oodon (i.e., upstream of the codon comprising nucleotidesll4-116Ofthecompletetranscript)is as follows:
- GGCGGCAGCGCCCTGCCGACGCCGGGGAGGGACGCAGGCAGGCGGCGGGC
AGCGGGAGGCGGCAGCCCGGTG~-~-CCCCGCGGCTCTCGGCGGAGCCCCGCCGCCCGCCGCGCC
The termination codon TGA at position 2034 is followed by a 3'-untranslated region spanning about 1200 nucleotides, which is followed by a poly(A) tail of about 140 nucleotides:
TGAGACATTTCCAGAAAAGCATTATGGTTTTCA
GAACAGTTCAAGTTGACTTGGGATATATCATTCCTCAACATGAAACTTTTCATGAATGGGAGA
AGAACCTATTTTTG~ GGTACAACAGTTGAGAGCACGACCAAGTGCATTTAGTTGAATGAA
GTCTTCTTGGATTTCACCCAACTAAAAGGATTTTTAAAAATAAATAACAGTCTTACCTAAATT
ATTAGGTAATGAATTGTAGCCA~ll~llAATATCTTAATGCAGAlllllllAAAAAAAAACAT
AAAATGATTTATCTGGTATTTTAAAGGATCCAACAGATCAGTAllllllCCTGTGATGGGTTT
TTTGAAATTTGACACATTAAAAGGTACTCCAGTATTTCA~ ~lCGATCACTAAACATATG
CATATATTTTTAAAAATCAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATT
TAATCCAGATTGTAAATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAA
CCATTTTATGAGTTTT~lGllAGCTTGCTTTAAAAATTATTACTGTAAGAAATAGTTTTATAA
AAAATTATATTTTTATTCAGTAATTTAAllll~lAAATGCCAAATGAAAAACGllllllGCTG
CTATGGTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTACAGCTTGGACAGAAAG
AAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGA~lllllAATTTTATAT
ATATATACAlrllllllCCTTCTGCAATACATTTGAAAACll~lllGGCAGACTCTGCATTTT
TTATTGTGGlllllllGllAllGllGGTTTATACAAGCATGCGTTGCACTT~llllllGGGAG
ATGTGTGll~llGATGTTCTA~l~llll~llll~lGlGTAGCCTGA~l~llllATAATTTGGGA
GTTCTCGATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACl~llGCATGG
ATCCTGl~lllGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAGTCACTGCCTTAAGAAC
ATTTGATGCAAGATGGCCAGCACTGAACTTTTGAGATATGACGGTGTACTTACTGCCTTGTAG
CAAAATAAAGATGTGCCCTTATTTT A~AAAAAAA
While antisense oligomers complementary to the 5'-terminal region of the c-myb transcript are preferred, particularly the region including the initiation codon, it should be appreciated that useful antisense oligomers are not limited to those complementary to the sequences found in the translated portion (nucleotides 114 to 2031) of the mRNA transcript, but also includes oligomers complementary to nucleotide sequences contained in, or extending into, S the 5'- and 3'-untranslated regions. We have shown that oligomers whose complementarity extends into the 5'-untranslated region of the c-myb transcript are particular-ly effective in inhibiting translation. Oligomers having a nucleotide sequence complementary to a portion of the c-myb mRNA transcript including at least a portion of the S'-untranslated region therefore comprise one group of prefer-red oligomers.
The following 15- through 21-mer oligodeoxynucleo-tides are complementary to the c-myb mRNA transcript beginning with nucleotide 111 and extending through the initiation site:
5'-CCG GGG TCT TCG GGC CAT GGC-3' 5'-CG GGG TCT TCG GGG CAT GGC-3' 5'-G GGG TCT TCG GGC CAT GGC-3~
5'-GGG TCT TCG GGC CAT GGC-3' 5'-GG TCT TCG GGC CAT GGC-3' 5'-G TCT TCG GGC CAT GGC-3' 5'-TCT TCG GGC CAT GGC-3' Example 9 Inhibition of Leukemic T Cells and Tumor (HL-60) Cells by c-myb Antisense Oliqonucleotide The following experiment is directed to the inhi-bition of growth of malignant hematopoietic cells with further c-myb antisense oligonucleotides.
Four 18-mers, designated oligomers A through D, were prepared:
(A) 5'-GCC ATG GCC CGA AGA CCC-3', the sense oligomer corresponding to c-myb nucleotides 111 through 129;
1 3 ~ 0 3 ~ 9 (B) 5'-GGG TCT TCG GGC CAT GGC-3', the anti~e~ce oligomer to c-myb nucleotides 111 through 129;
(C) 5'-CGC GTA CCG CAG GAA CCC-3', a "scram-- bled" version of 18-mer (A); and (D) 5'-ACT GCT ATA TAT GCT GTG-3', the antisense oligomer to c-myb nucleotides 129 through 147.
CCRF-CEM cells (1 x 10~ cell~) were seeded into 500 10 ~1 of tissue culture medium containing 0-80 ~g/ml of oligomer A, B, C or D (t=0). The cultures were supple-mented with additional oligomer (25% of the initial dose at t=18 hours). A control culture received no oligomer.
- Cultures were incubated for four days, after which time a cell count was taken. The results, as a function of oligonucleotide dosage, are set forth in Table 3:
CE~L COUNT
(Cells/~l; Mean + Standard Deviation) Oligomer Dosage at t=0/t=18 hrs. Oligomer Oligomer Oligomer Oligomer (ug/ml) A B C D
Control 25(no oligomer) 968+17 1636+39 1814+58 1616+38 10/2.5 1279~15 996~13 1452+18 1146+16 20/5 1297~39 646~12 1367+36 810+15 40/10 1202~29 616~17 1290+28 723+37 80/20 1136+34 504+22 1317+35 690+ 9 Neither the cense (oligomer A) or "scrambled" sense (oligomer C) molecules significantly effected leukemic cell growth. Both authentic antisense oligomers (B, D) gave inhibition. Oligomer B (70% inhibition), directed to c-myb transcript nucleotides 111-129, was more potent than oligomer D (57% inhibition), which is directed to c-myb ~ SD-35 -13 lO36~
transcript nucleotides 129-147. This result indicates that the most efficient inhibition of translation is obtained by inhibiting translation via hybridization of antisense oligomers at or near the site of translation initiation (nucleotides 114-116).
Very similar results were obtained with HL-60 cells using oligomers A, B and C. However oligomer D inhibited cell growth only ~25%, again indicating that the most efficient inhibition of translation is obtained at or near the site of translation inhibition.
ThrGluGluGluAspArgIleIleTyrGlnAlaHisLysArgLeuGlyAsnArgTrpAlaGlu ATCGCAAAGCTACTGCCTGGACGAACTGATAATGCTATCAAGAACCACTGGAATTCTACAATG
IleAlaLysLeuLeuProGlyArgThrAspAsnAlaIleLysAsnHisTrpAsnSerThrMet CGTCGGAAGGTCGAACAGGAAGGTTATCTGCAGGAGTCTTCAAAAGCCAGCCAGCCAGCAGTG
ArgArgLysValGluGlnGluGlyTyrLeuGlnGluSerSerLysAlaSerGlnProAlaVal GCCACAAGCTTCCAGAAGAACAGTCATTTGATGGGTTTTGCTCAGGCTCCGCCTACAGCTCAA
AlaThrSerPheGlnLysAsnSerHisLeuMetGlyPheAlaGlnAlaProProThrAlaGln CTCCCTGCCACTGGCCAGCCCACTGTTAACAACGACTATTCCTATTACCACATTTCTGAAGCA
LeuProAlaThrGlyGlnProThrValAsnAsnAspTyrSerTyrTyrHisIleSerGluAla CAAAATGTCTCCAGTCATGTTCCATACCCTGTAGCGTTACATGTAAATATAGTCAATGTCCCT
GlnAsnValSerSerHisValProTyrProValAlaLeuHisValAsnIleValAsnValPro - 1340~63 CAGCCAGCTGCCGCAGCCATTCAGAGACACTATAATGATGAAGACCCTGAGAAGGAAAAGCGA
GlnProAlaAlaAlaAlaIleGlnArgHisTyrAsnAspGluAspProGluLysGluLysArg ATAAAGGAATTAGAATTGCTCCTAATGTCAACCGAGAATGAGCTAAAAGGACAGCAGGTGCTA
IleLysGluLeuGluLeuLeuLeuMetSerThrGluAsnGluLeuLysGlyGlnGlnValLeu CCAACACAGAACCACACATGCAGCTACCCCGGGTGGCACAGCACCACCATTGCCGACCACACC
ProThrGlnAsnHisThrCysSerTyrProGlyTrpHisSerThrThrIleAlaAspHisThr AGACCTCATGGAGACAGTGCACCTGTTTCCTGTTTGGGAGAACACCACTCCACTCCATCTCTG
ArgProHisGlyAspSerAlaProValSerCysLeuGlyGluHisHisSerThrProSerLeu CCAGCGGATCCTGGCTCCCTACCTGAAGAAAGCGCCTCGCCAGCAAGGTGCATGATCGTCCAC
ProAlaAspProGlySerLeuProGluGluSerAlaSerProAlaArgCysMetIleValHis CAGGGCACCATTCTGGATAATGTTAAGAACCTCTTAGAATTTGCAGAAACACTCCAATTTATA
GlnGlyThrIleLeuAspAsnValLysAsnLeuLeuGluPheAlaGluThrLeuGlnPheIle GATTCTTTCTTAAACACTTCCAGTAACCATGAAAACTCAGACTTGGAAATGCCTTCTTTAACT
AspSerPheLeuAsnThrSerSerAsnHisGluAsnSerAspLeuGluMetProSerLeuThr TCCACCCCCCTCATTGGTCACAAATTGACTGTTACAACACCATTTCATAGAGACCAGACTGTG
SerThrProLeuIleGlyHisLysLeuThrValThrThrProPheHisArgAspGlnThrVal AAAACTCAAAAGGAAAATACTGl~llllAGAACCCCAGCTATCAAAAGGTCAATCTTAGAAAGC
LysThrGlnLysGluAsnThrValPheArgThrProAlaIleLysArgSerIleLeuGluSer TCTCCAAGAACTCCTACACCATTCAAACATGCACTTGCAGCTCAAGAAATTAAATACGGTCCC
SerProArgThrProThrProPheLysHisAlaLeuAlaAlaGlnGluIleLysTyrGlyPro CTGAAGATGCTACCTCAGACACCCTCTCATCTAGTAGAAGATCTGCAGGATGTGATCAAACAG
LeuLysMetLeuProGlnThrProSerHisLeuValGluAspLeuGlnAspValIleLysGln GAATCTGATGAATCTGGATTTGTTGCTGAGTTTCAAGAAAATGGACCACCCTTACTGAAGAAA
GluSerAspGluSerGlyPheValAlaGluPheGlnGluAsnGlyProProLeuLeuLysLys ATCAAACAAGAGGTGGAATCTCCAACTGATAAATCAGGAAACTTCTTCTGCTCACACCACTGG
IleLysGlnGluValGluSerProThrAspLysSerGlyAsnPhePheCysSerHisHisTrp GAAGGGGACAGTCTGAATACCCAACTGTTCACGCAGACCTCGCCTGTGCGAGATGCACCGAAT
GluGlyAspSerLeuAsnThrGlnLeuPheThrGlnThrSerProValArgAspAlaProAsn ATTCTTACAAGCTCCGTTTTAATGGCACCAGCATCAGAAGATGAAGACAATGTTCTCAAAGCA
IleLeuThrSerSerValLeuMetAlaProAlaSerGluAspGluAspAsnValLeuLysAla TTTACAGTACCTAAAAACAGGTCCCTGGCGAGCCCCTTGCAGCCTTGTAGCAGTACCTGGGAA
PheThrValProLysAsnArgSerLeuAlaSerProLeuGlnProCysSerSerThrTrpGlu CCTGCATCCTGTGGAAAGATGGAGGAGCAGATGACATCTTCCAGTCAAGCTCGTAAATACGTG
ProAlaSerCysGlyLysMetGluGluGlnMetThrSerSerSerGlnAlaArgLysTyrVal AATGCATTCTCAGCCCGGACGCTGGTCATG
AsnAlaPheSerAlaArgThrLeuValMet 134036g The antisense oligonucleotides of the invention may be synthesized by any of the known chemical oligonucleotide synthesis methods. Such methods are generally described, for example, in Winnacker, From Genes to Clones: Introduc-tion to Gene Technology, VCH Verlagsgesellschaft mbH (H.
Ibelgaufts trans. 1987).
Any of the known methods of oligonucleotide syn-thesis may be utilized in preparing the instant antisense oligonucleotides.
The antisense oligonucleotides are most advantag-eously prepared by utilizing any of the commercially available, automated nucleic acid synthesizers. The device utilized to prepare the oligonucleotides described herein, the Applied Biosystems 380B DNA Synthesizer, utilizes ~-cyanoethyl phosphoramidite chemistry.
Since the complete nucleotide synthesis of DNA
complementary to the c-myb mRNA transcript is known, anti-sense oligonucleotides hybridizable with any portion of the mRNA transcript may be prepared by the oligonucleotide synthesis methods known to those skilled in the art.
While any length oligonucleotide may be utilized in the practice of the invention, sequences shorter than 15 bases may be less specific in hybridizing to the target c-myb mRNA, and may be more easily destroyed by enzymatic digestion. Hence, oligonucleotides having 15 or more nucleotides are preferred. Sequences longer than 18 to 21 nucleotides may be somewhat less effective in inhibiting c-myb translation because of decreased uptake by the target cell. Thus, oligomers of 15-21 nucleotides are most preferred in the practice of the present invention, par-ticularly oligomers of 15-18 nucleotides.
Oligonucleotides complementary to and hybridizable with any portion of the c-myb mRNA transcript are, in principle, effective for inhibiting translation of the transcript, and capable of inducing the effects herein described. It is believed that translation is most effec-1340~6'3 -tively inhibited by blocking the mRNA at a site at or near the initiation codon. Thus, oligonucleotides complementary to the 5'-terminal translated region of the c-~yb mRNA
transcript are preferred. The oligonucleotide is prefer-ably directed to a site at or near the initiation codon forprotein synthesis. Oligonucleotides complementary to the c-myb mRNA, beg~nn~ng with the codon adjacent to the initiation codon (the second codon from the 5/ tran~lated end of the traDslated portion of transcript), may be thus advantageously employed.
The following lS- through 21-mer oligodeoxynucleo-tides are complementary to the c-myb mRNA transcript beginning with the second codon of the translated portion of the transcript:
5'-GCT GTG CCG GGG TCT TCG GGC-3' 5'-CT GTG CCG GGG TCT TCG GGC-3' 5'-T GTG CCG GGG TCT TCG GGC-3' 5'-GTG CCG GGG TCT TCG GGC-3' 5'-TG CCG GGG TCT TCG GGC-3' 5'-G CCG GGG TCT TCG GGC-3' 5'-CCG GGG TCT TCG GGC-3' Oligonucleotides hybridizable to the c-myb mRNA
transcript finding utility according to the present inven-tion include not only native oligomers of the biologically significant nucleotides, i.e., A, dA, G, dG, C, dC, T and U, but also oligonucleotide species which have been modi-fied for improved stability and/or lipid solubility. For example, it is known that enhanced lipid solubility and/or resistance to nuclease digestion results by substituting a methyl group or sulfur atom for a phosphate oxygen in the internucleotide phosphodiester linkage. The phosphoro-thioates, in particular, are stable to nuclease cleavage and soluble in lipid. They may be synthesized by known automatic synthesis methods.
The antisense oligonucleotides of the invention inhibit normal human hematopoiesis. However, they inhibit '1 , -the growth of malignant hematopoietic cells at a significa-ntly lower concentration than normal cells. This pharmaceutically significant differential sensitivity makes the instant oligonucleotides very useful in treating hematologic neoplasms.
Hematologic neoplastic cells believed sensitive to the instant c-myb antisense oligonucleotides include, for example, myeloid and lymphatic leukemia cells, malignant plasma (myeloma) cells and lymphoma cells. The appearance of these cells in the bone marrow and elsewhere in the body is associated with various disease conditions, such as all of the various French-American-British (FAB) subtypes of acute myeloid and lymphatic leukemia; chronic lymphatic and myeloid leukemia; plasma cell myeloma and plasma cell dyscrasias; the various non-Hodgkin's lymphomas as des-cribed, for example, in the Working Formulation classifica-tion, Devita, Cancer: Principles and Practice of Oncology (2d ed. 1985), p. 1634; and possibly Hodgkin's disease.
Hematologic neoplastic cells would likely arise de novo in the marrow. In Hodgkin's disease, and in some of the various lymphomas, tumor cells may metastasize to the marrow from a primary tumor situated elsewhere in the body.
While inhibition of c-myb mRNA translation is possible utilizing either antisense oligoribonucleotides or oligodeoxyribonucleotides, oligoribonucleotides are more susceptible to enzymatic attack by ribonucleases than deoxyribonucleotides. Hence, oligodeoxyribonucleotides are preferred in the practice of the present invention.
The antisense oligonucleotides of the invention find utility as bone marrow purging agents. They may be utilized in vitro to cleanse bone marrow contaminated by hematologic neoplasms. They are useful as purging agents in either allogeneic or autologous bone marrow transplanta-tion. They are particularly effective in the treatment of hematological malignancies or other neoplasias which metastasize in the bone marrow.
13~0.363 According to a method for bone marrow purging, bone marrow is harvested from a donor by standard operating room procedures from the iliac bones of the donor. Methods of aspirating bone marrow from donors are well known in the art. Examples of apparatus and processes for aspirating bone marrow from donors are disclosed in U.S. Patents 4,481,946 and 4,486,188. Sufficient marrow is withdrawn so that the recipient, who is either the donor (autologous transplant) or another individual (allogeneic transplant), may receive from about 4 x 1o8 to about 8 x 1o8 processed marrow cells per kg of bodyweight. This generally requires aspiration of about 750 to about 1000 ml of marrow. The aspirated marrow is filtered until a single cell suspen-sion, known to those skilled in the art as a "buffy coat"
preparation, is obtained. This suspension of leukocytes is treated with c-myb antisense oligonucleotides in a suitable carrier, advantageously in a concentration of about 8 mg/ml. Alternatively, the leucocyte suspension may be stored in liquid nitrogen using standard procedures known to those skilled in the art until purging is carried out.
The purged marrow can be stored frozen in liquid nitrogen until ready for use. Methods of freezing bone-marrow and biological substances are disclosed, for example, in U.S.
Patents 4,107,937 and 4,117,881.
One or more hematopoietic growth factors may be added to the aspirated marrow or buffy coat preparation to stimulate growth of hematopoietic neoplasms, and thereby increase their sensitivity to the toxicity of the c-myb antisense oligonucleotides. Such hematopoietic growth factors include, for example, interleukin-3 and granulocyte macrophage colony stimulating factor (GM-CSF). The recombinant human versions of such growth factors are advantageously employed.
After treatment with the antisense oligonucleo-tides, the cells to be transferred are washed with auto-logous plasma to remove unincorporated oligomer. The washed cells are then infused into the recipient.
The instant c-myb antisense oligonucleotides also inhibit proliferation of human peripheral blood lympho-cytes. Accordingly, they are useful as immunosuppressiveagents, that is, they may be utilized to inhibit immune response, particularly cellular response. They are partic-ularly useful in situations where rapid, but short term, inactivation of the immune system is desirable. Such circumstances may include, but are not limited to, acute graft-versus-host disease, acute organ rejection (heart, liver, kidney, pancreas), and flares of autoimmune-type diseases such as acute systemic lupus erythematosus, rheumatoid arthritis and multiple sclerosis.
For in vivo use, the antisense oligonucleotides may be combined with a pharmaceutical carrier, such as a suit-able liquid vehicle or excipient and an optional auxiliary additive or additives. The liquid vehicles and excipients are conventional and commercially available. Illustrative thereof are distilled water, physiological saline, aqueous solution of dextrose, and the like. For in vivo antineo-plastic or immunosuppressive use, the c-myb mRNA antisense oligonucleotides are preferably administered intravenously.
It is also possible to administer such compounds ex vivo by isolating lymphocytes from peripheral blood, treating them with the antisense oligonucleotides, then returning the treated lymphocytes to the peripheral blood of the donor.
Ex vivo techniques have been utilized in treatment of cancer patients with interleukin-2 activated lymphocytes.
In addition to administration with conventional carriers, the antisense oligonucleotides may be adminis-tered by a variety of specialized oligonucleotide delivery techniques. For example, oligonucleotides have been successfully encapsulated in unilameller liposomes.
Reconstituted Sendai virus envelopes have been successfully l3~o36~
used to deliver RNA and DNA to cells. Arad et al., Biochem. Biophy. Acta. 859, 88-94 (1986).
For ex vivo antineoplastic application, such as, for example, in bone marrow purging, the c-myb antisense oligonucleotides may be administered in amounts effective to kill neoplastic cells while maintaining the viability of normal hematologic cells. Such amounts may vary depending on the nature and extent of the neoplasm, the particular oligonucleotide utilized, the relative sensitivity of the neoplasm to the oligonucleotide, and other factors. Con-centrations from about 10 to 100 ~g/ml per 105 cells may be employed, preferably from about 40 to 60 ~g/ml per 105 cells. Supplemental dosing of the same or lesser amounts of oligonucleotide are advantageous to optimize the treat-ment. Thus, for purging bone marrow containing 2 x 107 cell per ml of marrow volume, dosages of from about 2 to 20 mg antisense per ml of marrow may be effectively utilized, preferably from about 8 to 12 mg/ml. Greater or lesser amounts of oligonucleotide may be employed.
For in vivo use, the c-myb antisense oligonucleo-tides may be administered in an amount sufficient to result in extracellular concentrations approximating the above stated in vitro concentrations. The actual dosage admin-istered may take into account the size and weight of the patient, whether the nature of the treatment is prophy-lactic or therapeutic in nature, the age, weight, health and sex of the patient, the route of administration, and other factors. The daily dosage may range from about 0.1 to 1,000 mg oligonucleotide per day, preferably from about 10 to about 1,000 mg per day. Greater or lesser amounts of oligonucleotide may be administered, as required.
The present invention is described in greater detail in the following non-limiting examples.
. 13403fi.~
Example 1 Effect of c-myb Antisense Oligomer on Normal Peripheral Blood LYmphocyte Proliferation in Response to PHA Ex~osure The c-myb antisense oligonucleotides have immunosuppressant activity, as demonstrated by the following experiment wherein lymphocyte proliferation is markedly suppressed by treatment with the oligomer. Normal blood lymphocytes were treated with the c-myb antisense oligodeoxynucleotide 5 '-GTG CCG GGG TCT TCG GGC-3' at a final concentration of 40 ~g/ml. C-myb antisense and/or phytohaemagglutinin (PHA) were added to the cells as follows: (i) PHA alone, t=0 (no oligonucleotide); (ii) c-myb antisense alone, t=0 (no PHA); (iii) c-myb antisense, t=0; PHA, t=24 hours; (iv) c-myb antisense + PHA, both t=0;
(v) PHA, t=0; c-myb antisense, t=24 hours; and (vi) PHA, t=0; c-myb antisense t=24 and 48 hours. Cell counts were performed at t=day 6. The results are shown in Figure 1.
As is evident from the figure, PHA treatment alone resulted in marked cell proliferation when compared to cells exposed to 40 ~g/ml c-myb antisense oligomer. One dose of oligomer alone in the absence of PHA did not appear to be toxic to normal lymphocytes through day 6. As can be noted in Figure 1, however, once cells were exposed to PHA, either simultaneously or within 24 hours of c-myb antisense treat-ment, the 40 ~g/ml dose became very toxic to the cells, as manifested by the low cell numbers present on day 6.
Additional doses of c-myb at 24 and 48 hours did not appear to be essential in order to inhibit PHA-induced proliferation of normal cells.
~'- 13403~
Example 2 Effect of c-mYb Antisense Oliqomer on Normal Peripheral Blood Lymphocyte Proliferation in Mixed Lymphocyte Reaction The following experiment further demonstrates the immunosuppressant activity of the c-myb antisense oligonu-cleotides. Normal peripheral blood mononuclear cells (Figure 7: X cells) were either stimulated with PHA alone or mixed with mitomycin C-treated mononuclear cells from another normal donor (Figure 7: Y* cells). In two cul-tures, X cells were pre-incubated for 18 hours with 40 ~g/ml of the c-myb sense oligonucleotide 5'-GCC CGA AGA CCC
CGG CAC-3', or the c-myb antisense oligonucleotide used in Example 1. The thus treated X cells were then mixed with Y* cells. At 24 and 48 hours, an additional 10 ~g/ml of oligomers was added to the cultures. After five days, cell counts were performed (Figure 7A), and tritiated thymidine incorporation was determined (Figure 7B). Inhibition of mixed lymphocyte-induced cell proliferation and tritiated thymidine incorporation was observed only with the c-myb antisense-treated cells.
Example 3 Differential Sensitivity of Tumor (ARH-77) and Normal Proqenitor Cells Toward c-myb Oligonucleotide The following experiment was performed to establish the differential sensitivity of normal progenitor and tumor cells to c-myb antisense oligonucleotide. Accordingly, tumor cells (1 x 106 cells/ml) or normal human marrow cells (1 x 105 cells/ml) were cultured alone or mixed together in a 1:1 ratio (total cell number cultured = 1 x 105 cells/
ml) in the presence or absence of c-myb oligonucleotides.
Figures 2A, 2B and 2C respectively show a high magnification view (200X) of untreated (A) normal human myeloid cell colonies, (B) ARH-77 cells (IgG-secreting plasma cell leukemia, ATCC No. CRL 1621), and (C) HL-60 13~03~9 . .
(promyelocytic leukemia cells), all after seven days of culture. It can be observed that the normal marrow cells grow in widely separate aggregates of relatively small cell number. The tumor cells grow much more luxuriantly, and appear to overgrow each other.
Figure 3 is a series of low magnification (40X) photographs of a 1:1 mixture of ARH-77 cells and normal hematopoietic progenitor cells exposed to: (A) high dose c-myb sense 5'-GCC CGA AGA CCC CGG CAC-3' (40 ~g/ml, t=0;
20 ~g/ml supplement at t=18 hours); (B) low dose c-myb antisense 5'-GTG CCG GGG TCT TCG GGC-3'; (10 ~g/ml t=0; 5 ~g/ml supplement at t=18 hours); and (C) high dose c-myb antisense (40 ~g/ml, t=0; 20 ~g/ml supplement at t=18 hours). The Figure 3 photographs were taken at t=day 7.
While the sense-treated plate (Figure 3A) was overwhelmed with tumor cells on day 7, the low dose antisense plate (Figure 3B) displayed persistent, but dramatically reduced numbers of tumor cells. The high dose antisense plate (Figure 3C) contained a normal myeloid colony with complete disappearance of tumor cells. The arrow heads in Figure 3C
surround a normal myeloid colony which is shown at high magnification in Figure 4A. A high magnification view of the sense-treated plasma cell leukemia cells of Figure 3A
is shown in Figure 4B.
Example 4 Differential Sensitivity of Tumor (HL-60) and Normal Proqenitor Cells Toward c-myb Oligonucleotide The sense/antisense dosing procedure of Example 3 was repeated substituting HL-60 leukemia cells for ARH-77 cells, and utilizing the same dosages and dose times from Example 3. The results are shown in Figures 5 and 6.
Figure 5 is a series of low (40X) magnification views of a 1:1 mix of HL-60 cells and normal hematopoietic progenitor cells exposed to: (A) high dose c-myb sense, (B) low dose c-myb antisense, and (C) high does c-myb antisense. While a very large HL-60 tumor aggregate ~ 1340369 appeared in the sample treated with a high dose of c-myb sense oligodeoxynucleotide (Figure 5A), the colony treated with a low dose of antisense oligonucleotide is much smaller, with fewer tumor cells being apparent (Figure 5B).
A high power view of Figure 5A is shown in Figure 6B. At the high dose of antisense (Figure 5C), normal hemato-poietic progenitor cells are unaffected as evidence by the normal myeloid colony indicated by the small arrow head in Figure 5C. An HL-60 colony was observed to be degenerat-ing, as indicated by the large arrowhead.
The colonies featured in Figure 5C are shown athigher magnification in Figure 6A.
Example 5 Differential Sensitivity of Leukemic T Cells and Normal Proqenitor Cells Toward c-myb Oliqonucleotide The following experiment further demonstrates that when normal marrow hematopoietic cells are combined with leukemic blast cells in the presence of c-myb antisense oligonucleotide, leukemic cell cloning efficiency is preferentially inhibited, and is accompanied by leukemic cell death. Colony formation in semi-solid cultures was employed as an indicator system to assess survival of clonogenic progenitor cells. Of great importance, many normal hematopoietic progenitor cells were observed to survive exposure to c-myb antisense oligonucleotide, and to continue to form colonies in semi-solid culture medium.
Bone marrow cells from normal consenting donors and cells of the human T cell leukemia cell line CCRF-CEM, obtained from the American Type Culture Collection, were treated as follows. Normal hematopoietic progenitor cells were enriched from light density bone marrow mononuclear cells. The normal cells and the T leukemia cells were placed in liquid suspension cultures (RPMI 1640 with 20%
fetal bovine serum, either alone or in a 1:1 mix). Control cultures were left untreated. Treated cultures received varying amounts of the same c-myb sense and antisense .
1340~fi9 oligomers applied in the procedure of Example 3, namely 5-80 ~g/ml (~ 1 ~M to 14 ~M) at t=0, supplemented with additional oligomer (25% of the initial dose)) at about 18 hours after the start of incubation. Cultures were in-cubated (5% C02, 37~C) for four days, during which timedaily cell counts were performed and cell viability was recorded. At the end of the four days, the cells remaining in suspension (to a maximum of 2 x 105/ml) were transferred to methylcellulose cultures, Leary et al., Blood 71, 1759 (1988) containing 24 U/ml and 5 ng/ml respectively of recombinant human interleuken-3 (rH IL-3) and recombinant human granulocyte macrophage colony stimulating factor (rH
GM-CSF). After a total of ten to twelve days in culture, the culture plates were scanned in their entireties with the aid of an inverted microscope, and total colonies per cluster in the dishes were enumerated. To verify the origin of the colonies, that is, whether they were derived from the leukemic or from normal hematopoietic progenitor cells, all cells were removed from the dishes by diluting the methylcellulose in tissue culture medium, transferring the culture dish's contents to a polypropylene tube, and then preparing cytocentrifuge preparations from the con-tents of the tube for histochemical or immunochemical identification of tumor cells. Histochemical identifica-tion of tumor cells was carried out by air drying thecytocentrifugation slides, flooding the slides with Modi-fied Wright's stain (Sigma Chemical Company, #WS lb) for 5 minutes, followed by rinsing with de-ionized water for 2 minutes. The slides were then coverslipped. Clots were fixed with 4% glutaraldehyde for 8 minutes, flushed with distilled water for 12 minutes, and then dried into a film.
The plates were then flooded with Modified Wright's stain for 3 minutes, rinsed in de-ionized water for 6 minutes, and coverslipped. The immunochemical identification of tumor cells was according to the procedure of Gewirtz et al., J. Immunol. 139, 2195 (1987), utilizing the Leu-3a ~ 13~0369 monoclonal antibody (Becton-Dickenson, Mountainview, CA.).
The Leu-3a antibody is directed against the CD4 epitope.
The effect of maintaining the T cell leukemia line and the marrow cells in suspension culture according to the procedure of Example 5, in the presence or absence of the c-myb oligomers, is shown in Figure 8. In the absence of the oligomers, the T cell leukemia continued to divide in culture, whereas the numbers of bone marrow cells remained essentially unchanged. See Figure 8A. Cell viability remained high among both cell populations and always exceeded 90%, as assessed by trypan blue exclusion. Treat-ment of cells with high doses (40 ~g/ml, t=0; 10 ~g/ml, t=18 hours) of the c-myb sense oligomer did not signif-icantly effect the growth or viability of either cell type (Figure 8A). In distinct contrast (Figure 8B), when the T
leukemia cells were incubated in suspension with c-myb antisense oligomer (20 ~g/ml, t=0; 5 ~g/ml, t=18 hours) cell proliferation was not only inhibited, but there was a daily decline in cell numbers and viability as well. After four days only approximately 25-30% of the cells initially added to the culture remained; the viability of these cells was also greatly reduced (~ 70% reduction). The effect of the antisense oligomer is even more dramatic if one com-pares cell numbers (mean + standard deviation (hereinafter "SD"); n=4) in the control cultures at four days (285 + 17 x 104/ml) with the number remaining in the antisense-containing culture (4.7 + 0.8 x 104 /ml). Importantly, when suspended in the same dose of antisense oligomer, the normal marrow mononuclear cells exhibited only a slight decline in numbers and viability over the same time period (~ 90% of initial cells remaining; viability >90%). These numbers were not significantly altered if hematopoietic growth factors were added to the bone marrow cell suspen-sion during the four day incubation period.
Results from a typical experiment, repeated three times are shown in Table 1 ("BMC" = normal bone marrow cells; "MYB S" = c-myb sense oligonucleotide; "MYB AS" =
c-myb antisense oligonucleotide; "TNTC" = to numerous to count):
Cells No. Cells Oligonucleotide Colony/Cluster Plated Added Amt. Added Count (~g/ml at t=0; (Mean t Stan-t=18 hours) dard Deviation) BMC 5 x 104/ml None 24+4 MYB S (20; 5.0) 31+4 MYB S (20; 5.0) 30+6 T 5 x 104/ml None TNTC
LEUKEMIA MYB S (20; 5.0) TNTC
MYB S (20; 5.0) 1:1 BMC+ 5 x 104/ml None TNTC
LEUKEMIA of each MYB S (20; 5.0) TNTC
MYB AS (2; 0.5) TNTC
MYB AS (5; 1.0) TNTC
MYB AS (10; 2.5) 41+5 MYB AS (20; 5.0) 34+1 In dishes containing untreated bone marrow cells, colony numbers varied directly with the number of cells plated (5 x 104/ml to 2 x 105/ml), and ranged between 31+4 (mean +SD) and 274+18. In dishes containing the untreated leukemia cells, cloned at equivalent concentrations, growth was always luxuriant and the numbers of colonies were too numerous to count (TNTC) (Figure 9A). Exposure to the c-myb sense oligomer had no effect on either normal, or leukemic cell (Figure 9B) growth when compared to growth in untreated cultures. Colony formation by cells in Figure 9A
and Figure 9B were essentially identical. When leukemic blasts were cultured alone in the higher doses of antisense oligomer, the numbers of resulting colony/clusters were reduced from TNTC to a maximum of about 2 per 5 x 104 leukemia cells plated (Figure 9C). In distinct contrast, in dishes containing bone marrow cells exposed to c-myb antisense, colony formation was not significantly perturbed by the dose and exposure schedule employed (see Table 1).
Not unexpectedly then, when bone marrow cells were mixed 1:1 with T leukemia cells and then exposed to the c-myb antisense oligomer at concentrations S5 ~g/ml and 1 ~g/ml (t=0 and t=18 hours, respectively), the leukemic cells continued to grow vigorously, and the number of colonies were too numerous to count. However, when the oligomer exposure intensified, a definite dose-response relationship became apparent. At an initial dose of 10 ~g/ml, followed by 2.5 ~g/ml eighteen hours later, the leukemia cells no longer overgrew the plate, and distinct colones could be enumerated in the mixed cell cultures. Nevertheless, histochemical and immunochemical staining demonstrated that ~50% of the colonies that formed in these mixed cell dishes appeared to be of leukemic blast cell origin. When the dose of antisense oligomer employed equaled or exceeded 20 ~g/ml (t=0) followed by 5 ~g/ml (t=18 hours), leukemic colonies could no longer be identified with certainty in the cultures by simple visual analysis.
To more rigorously examine the cultures for resid-ual leukemic elements, the methylcellulose cultures were liquified with tissue culture medium, and the entire cell contents were deposited onto slides by cytocentrifugation.
Low (lOOx) and high (400x) magnification photomicrographs of Wright's stained T leukemia cells after twelve days of culture in methylcellulose are shown in Figures lOA and lOB, respectively. Most cells were small, had only a thin rim of cytoplasm, and resembled unactivated lymphocytes, though occasional large, undifferentiated blast cells with prominent nucleoli were also noted (arrows). Neither of these cell types could be identified in the culture dishes containing the leukemia plus normal cell populations which had been cultured in the high dose of c-myb antisense oligomer. As demonstrated in Figures lOC (lOOx) and lOD
(400x), respectively, only normally maturing cells could be identified in these cultures. The colonies which developed 13403~9 .
in the high dose antisense plates were also numerically equivalent to those enumerated in the bone marrow cell control plates.
Immunochemical staining with Leu 3a antibody of either T leukemia cells alone, marrow mononuclear cells alone, or mixtures of normal marrow mononuclear cells and T
leukemia célls, maintained in liquid suspension cultures for eight days, corroborated these results. After eight days in culture, only 4% of bone marrow cells stained Leu 3a positive, while ~93% of T cell leukemia cells were labeled with this antibody. When bone marrow cells and T
leukemia cells were mixed 1:1, and then stained after eight days in culture, ~98% of cells were stained with Leu 3a in the untreated culture, and in the culture containing the c-myb sense oligomer. These results indicated that the T
leukemia cells outgrew the bone marrow cells, and essen-tially replaced them in these cultures. In marked con-trast, in the mixed cell culture containing the c-myb antisense oligomer, only 3% of the cells stained with Leu 3a after eight days. This value is identical to that obtained in the bone marrow control culture, and suggests again that the leukemic cells were eliminated from the culture.
ExamPle 6 Effect of High Dose c-myb Antisense Oligomer On Leukemic Blast Cells From Acute Myeloqenous Leukemia Patients Th following experiment illustrates the effect of high dose c-myb antisense oligomer exposure on colony/clus-ter formation by leukemic blast cells isolated directly from patients with acute myelogenous leukemia.
The peripheral blood of leukemic blast cells were isolated form patients with acute myelogenous leukemia by Ficoll gradient centrifugation. The blast cells (2 x 105/ml) were washed in fresh tissue culture medium and then exposed to c-myb sense or antisense oligomers (40 ~g/ml, 13403~
t=0; 10 ~g/ml, t=18 hours) in suspension culture. Four to six hours after addition of the last dose of oligomer, the blast cells were seeded into plasma clot or methylcellulose cultures and cultured for ten to twelve days to assess the presence of residual colony/cluster forming units. Cell colonies and cell clusters were enumerated in sense (S) and antisense (AS) containing plates, and the values compared to growth in control cultures which contained no oligomers.
The results are expressed in Table 2 as % residual control culture growth (arbitrary 100% value). Significance of changes in colony/cluster growth in AS-treated plates, in comparison to that observed in controls, is given as a P
value derived by Student's t test for unpaired samples.
~ 1340~6~
Case # Cell Colonies Cell Clusters P Value S/AS1 S/AS ColonY/Cluster #1 86%/18% 60%/37% [.058]/[.080]
#4 NG2 90%/28% [----]/[.036]
#5 NG 70%/22% [----]/[.101]
#6 NG 79%/22% [----]/[.026]
#7 170%/100% 76%/128% [.423]/[.502]
#8 92%/11% 96%/46% [.008]/[.020]
#10 NG 190%/216% [----]/[.034]
#11 45%/14% 58%/21% [.021]/[.084]
#14 68%/01% 90%/53% [.152]/[.071]
#15 66%/81% 100%/100% [.736]/[.896]
#16 NG 66%/24% [----]/[.001]
#17 NG 16%/8% [----]/[.023]
#18 NG 110%/77% [----]/[.164]
#19 113%/116% 91%/91% [-717]/[-763]
#20 92%/09% 100%/50% [.051]/[.009]
#21 94%/00% 90%/06% [.006]/[.004]
#22 80%/13% 103%/11% [.001]/[.015]
#23 63%/06% 74%/27% [.001]/[.004]
#24 87%/17% 91%/26% [.002]/[.018]
#25 100%/00% 107%/38% [.019]/[.364]
#26 76%/00% 89%/00% [-009]/[.001]
#27 79%/21% 59%/18% [-014]/[.043]
#28 88%/20% 94%/152% [.009]/[.096]
1 S/AS = percentage of cell colonies or cell clusters remaining in sense (S) or antisense (AS) containing plates, compared to growth in control cultures which contained no oligomers.
2 NG = no growth.
Of the twenty-eight cases studied, we were able to gather colony, and/or cluster formation data in twenty-three cases (Table 2). Growth of cells from patients #2, #3, #9 and #12-#13 was too poor to evaluate the effect of treatment. A decline in either colony or cluster formation in comparison to growth in untreated cultures was observed in eighteen of the twenty-three evaluable cases (78%). Of those cases in which this response was observed, the decline in colony number was statistically significant (p<.05) in 11/13 cases (85%). In the two cases where the decrease was not of statistical significance, the p values were .058 (Case #1) and .051 (Case #20). Similarly, the decrement in cluster formation was statistically signifi-cant in 13/17 (76%) of the cases. The degree of inhibition was also impressive. Mean (+SD) residual leukemic colony formation in the eleven responding cases was 10.0+7.9% of control (untreated leukemia cell) colony formation. Mean (+SD) residual leukemic cluster formation in the seventeen responding cases was 25.7+15.3% of control.
Example 7 Complete Purginq of Patient-Derived Myeloid Leukemia Cells From Normal Bone Marrow Cells The following experiment demonstrates that a more intensive exposure to the antisense c-myb oligomer results in complete elimination of myeloid leukemic progenitor cells from a mixture of normal bone marrow progenitor cells, with adequate survival of the normal progenitor cells.
Normal bone marrow cells and blasts obtained from Case #26 (Example 6, Table 2) were utilized for purging using the T cell purging protocol described in Example 5.
The only modification involved was the addition of oligomer (20 ~g/ml) just prior to plating after four days in suspen-sion culture. In untreated cultures, the blasts formed 25.5+3.5 (mean +SD per 2 x 105 cells plated) colonies and 157+8.5 clusters in growth factor stimulated cultures. The 1340~6~
.
addition of c-myb sense oligomers at doses equivalent to those added to antisense containing cultures did not significantly alter these numbers (19.5+.7 colonies and 140.5+7.8 clusters). As expected (see Table 2), antisense oligomers again totally inhibited colony/cluster formation by the leukemic blasts. Colony formation as also inhibited in the plates containing normal bone marrow cells, but only by ~50% in comparison to untreated control plates. (Con-trol colony formation = 296+40 per 2 x 106 cells plated;
Treated = 149+15.5 per 2 x 106 cells). Histochemical staining of the leukemic blast cell cultures revealed only scattered residual cells in the antisense treated plates (Fig. llA: lOOx). At high magnification, these "cells"
appeared to be non-viable naked nuclei (Fig. llB: 400x).
As was stated above, at an equivalent antisense oligomer dose, bone marrow cells formed numerous, though smaller, colonies which contained cells that had matured normally (Fig. llC and llD; lOOx and 400x, respectively). In the culture dishes in which normal marrow and leukemic blast cells had been mixed in a 1:1 ratio, only normal elements could be identified with certainty (Fig. llE: lOOx; Fig.
llF: 400x). Stars in Fig. llF mark mature myeloid elements (polymorphonuclear leukocytes, bands, and metamyelocytes).
C-myb oligonucleotide, administered to cell cul-tures at concentrations utilized above, effectively kills neoplastic cells. The same concentrations, however, are non-toxic to normal progenitor cells. Thus, the oligomers are useful as anti-neoplastic agents, particularly as bone marrow purging agents.
The following non-limiting example illustrates one methodology for bone marrow purging according to the present invention.
13~ 036~9 Example 8 Bone Marrow Purging with c-myb Antisense Oligonucleotide Bone marrow is harvested from the iliac bones of a donor under general anesthesia in an operating room using standard techniques. Multiple aspirations are taken into heparinized syringes. Sufficient marrow is withdrawn so that the marrow recipient will be able to receive about 4 x 108 to about 8 x 108 processed marrow cells per kg of body weight. Thus, about 750 to 1000 ml of marrow is withdrawn.
The aspirated marrow is transferred immediately into a transport medium (TC-l99, Gibco, Grand Island, New York) containing 10,000 units of preservative-free heparin per 100 ml of medium. The aspirated marrow is filtered through three progressively finer meshes until a single cell suspension results, i.e., a suspension devoid of cellular aggregates, debris and bone particles. The filtered marrow is then processed further into an automated cell separator (e.g., Cobe 2991 Cell Processor) which prepares a "buffy coat" product, (i.e., leukocytes devoid of red cells and platelets). The buffy coat preparation is then placed in a transfer pack for further processing and storage. It may be stored until purging in liquid nitrogen using standard procedures. Alternatively, purging can be carried out immediately, then the purged marrow may be stored frozen in liquid nitrogen until it is ready for transplan-tation.
The purging procedure may be carried out as follows: Cells in the buffy coat preparation are adjusted to a cell concentration of about 2 x 107/ml in TC-l99 containing about 20% autologous plasma. C-myb antisense oligodeoxynucleotide, for example, in a concentration of about 8 mg/ml is added to the transfer packs containing the cell suspension. Recombinant human hematopoietic growth factors, e.g., rH IL-3 or rH GM-CSF, may be added to the suspension to stimulate growth of hematopoietic neoplasms , 13 !1~ 3 ~ ~
and thereby increase their sensitivity c-myb antisense oligonucleotide toxicity. The transfer packs are then placed in a 37~C waterbath and incubated for 18 - 24 hours with gentle shaking. The cells may then either be frozen in liquid nitrogen or washed once at 4~C in TC-199 containing about 20% autologous plasma to remove unincorporated oligomer. Washed cells are then infused into the recipient. Care must be taken to work under sterile conditions wherever possible and to maintain scrupulous aseptic techniques at all times.
The present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof and, accordingly, reference should be made to the appended claims, rather than to the foregoing specification, as indicating the scope of the invention.
13~0369 SUPPLEMENTARY DISCLOSURE
While in principle oligonucleotides having a sequence complementary to any region of the c-myb gene find utility in the present invention, oligodeoxynucleotides complementary to the 5'-terminal portion of the c-~yb mRNA
transcript are particularly preferred.
The putative DNA sequence complementary to the mRNA
transcript of the human c-~yb gene has been reported in Majello et al, Proc. Natl. Acad. ~ci. U.S.A. 83, 9636-9640 (1986). The 5'-untranslate~ region upstream of the initia-tion oodon (i.e., upstream of the codon comprising nucleotidesll4-116Ofthecompletetranscript)is as follows:
- GGCGGCAGCGCCCTGCCGACGCCGGGGAGGGACGCAGGCAGGCGGCGGGC
AGCGGGAGGCGGCAGCCCGGTG~-~-CCCCGCGGCTCTCGGCGGAGCCCCGCCGCCCGCCGCGCC
The termination codon TGA at position 2034 is followed by a 3'-untranslated region spanning about 1200 nucleotides, which is followed by a poly(A) tail of about 140 nucleotides:
TGAGACATTTCCAGAAAAGCATTATGGTTTTCA
GAACAGTTCAAGTTGACTTGGGATATATCATTCCTCAACATGAAACTTTTCATGAATGGGAGA
AGAACCTATTTTTG~ GGTACAACAGTTGAGAGCACGACCAAGTGCATTTAGTTGAATGAA
GTCTTCTTGGATTTCACCCAACTAAAAGGATTTTTAAAAATAAATAACAGTCTTACCTAAATT
ATTAGGTAATGAATTGTAGCCA~ll~llAATATCTTAATGCAGAlllllllAAAAAAAAACAT
AAAATGATTTATCTGGTATTTTAAAGGATCCAACAGATCAGTAllllllCCTGTGATGGGTTT
TTTGAAATTTGACACATTAAAAGGTACTCCAGTATTTCA~ ~lCGATCACTAAACATATG
CATATATTTTTAAAAATCAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATT
TAATCCAGATTGTAAATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAA
CCATTTTATGAGTTTT~lGllAGCTTGCTTTAAAAATTATTACTGTAAGAAATAGTTTTATAA
AAAATTATATTTTTATTCAGTAATTTAAllll~lAAATGCCAAATGAAAAACGllllllGCTG
CTATGGTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTACAGCTTGGACAGAAAG
AAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGA~lllllAATTTTATAT
ATATATACAlrllllllCCTTCTGCAATACATTTGAAAACll~lllGGCAGACTCTGCATTTT
TTATTGTGGlllllllGllAllGllGGTTTATACAAGCATGCGTTGCACTT~llllllGGGAG
ATGTGTGll~llGATGTTCTA~l~llll~llll~lGlGTAGCCTGA~l~llllATAATTTGGGA
GTTCTCGATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACl~llGCATGG
ATCCTGl~lllGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAGTCACTGCCTTAAGAAC
ATTTGATGCAAGATGGCCAGCACTGAACTTTTGAGATATGACGGTGTACTTACTGCCTTGTAG
CAAAATAAAGATGTGCCCTTATTTT A~AAAAAAA
While antisense oligomers complementary to the 5'-terminal region of the c-myb transcript are preferred, particularly the region including the initiation codon, it should be appreciated that useful antisense oligomers are not limited to those complementary to the sequences found in the translated portion (nucleotides 114 to 2031) of the mRNA transcript, but also includes oligomers complementary to nucleotide sequences contained in, or extending into, S the 5'- and 3'-untranslated regions. We have shown that oligomers whose complementarity extends into the 5'-untranslated region of the c-myb transcript are particular-ly effective in inhibiting translation. Oligomers having a nucleotide sequence complementary to a portion of the c-myb mRNA transcript including at least a portion of the S'-untranslated region therefore comprise one group of prefer-red oligomers.
The following 15- through 21-mer oligodeoxynucleo-tides are complementary to the c-myb mRNA transcript beginning with nucleotide 111 and extending through the initiation site:
5'-CCG GGG TCT TCG GGC CAT GGC-3' 5'-CG GGG TCT TCG GGG CAT GGC-3' 5'-G GGG TCT TCG GGC CAT GGC-3~
5'-GGG TCT TCG GGC CAT GGC-3' 5'-GG TCT TCG GGC CAT GGC-3' 5'-G TCT TCG GGC CAT GGC-3' 5'-TCT TCG GGC CAT GGC-3' Example 9 Inhibition of Leukemic T Cells and Tumor (HL-60) Cells by c-myb Antisense Oliqonucleotide The following experiment is directed to the inhi-bition of growth of malignant hematopoietic cells with further c-myb antisense oligonucleotides.
Four 18-mers, designated oligomers A through D, were prepared:
(A) 5'-GCC ATG GCC CGA AGA CCC-3', the sense oligomer corresponding to c-myb nucleotides 111 through 129;
1 3 ~ 0 3 ~ 9 (B) 5'-GGG TCT TCG GGC CAT GGC-3', the anti~e~ce oligomer to c-myb nucleotides 111 through 129;
(C) 5'-CGC GTA CCG CAG GAA CCC-3', a "scram-- bled" version of 18-mer (A); and (D) 5'-ACT GCT ATA TAT GCT GTG-3', the antisense oligomer to c-myb nucleotides 129 through 147.
CCRF-CEM cells (1 x 10~ cell~) were seeded into 500 10 ~1 of tissue culture medium containing 0-80 ~g/ml of oligomer A, B, C or D (t=0). The cultures were supple-mented with additional oligomer (25% of the initial dose at t=18 hours). A control culture received no oligomer.
- Cultures were incubated for four days, after which time a cell count was taken. The results, as a function of oligonucleotide dosage, are set forth in Table 3:
CE~L COUNT
(Cells/~l; Mean + Standard Deviation) Oligomer Dosage at t=0/t=18 hrs. Oligomer Oligomer Oligomer Oligomer (ug/ml) A B C D
Control 25(no oligomer) 968+17 1636+39 1814+58 1616+38 10/2.5 1279~15 996~13 1452+18 1146+16 20/5 1297~39 646~12 1367+36 810+15 40/10 1202~29 616~17 1290+28 723+37 80/20 1136+34 504+22 1317+35 690+ 9 Neither the cense (oligomer A) or "scrambled" sense (oligomer C) molecules significantly effected leukemic cell growth. Both authentic antisense oligomers (B, D) gave inhibition. Oligomer B (70% inhibition), directed to c-myb transcript nucleotides 111-129, was more potent than oligomer D (57% inhibition), which is directed to c-myb ~ SD-35 -13 lO36~
transcript nucleotides 129-147. This result indicates that the most efficient inhibition of translation is obtained by inhibiting translation via hybridization of antisense oligomers at or near the site of translation initiation (nucleotides 114-116).
Very similar results were obtained with HL-60 cells using oligomers A, B and C. However oligomer D inhibited cell growth only ~25%, again indicating that the most efficient inhibition of translation is obtained at or near the site of translation inhibition.
Claims (30)
1. An oligonucleotide which has a nucleotide sequence complementary to at least a portion of the mRNA
transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript.
transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript.
2. An oligonucleotide according to claim 1 which is at least a 15-mer oligodeoxynucleotide.
3. An oligonucleotide according to claim 2 having a deoxynucleotide sequence complementary to a portion of the c-myb mRNA transcript including the translation initiation codon of said transcript.
4. An oligodeoxynucleotide according to claim 2 having a deoxynucleotide sequence complementary to a portion of the c-myb mRNA transcript beginning with the codon immediately downstream from the translation initiation codon of said transcript.
5. An oligodeoxynucleotide according to claim 3 or 4 which is from a 15-mer to a 21-mer.
6. An oligodeoxynucleotide according to claim 4 selected from the group consisting of 5'-GCT GTG CCG GGG TCT TCG GGC-3', 5'-CT GTG CCG GGG TCT TCG GGC-3', 5'-T GTG CCG GGG TCT TCG GGC-3', 5'-GTG CCG GGG TCT TCG GGC-3', 5'-TG CCG GGG TCT TCG GGC-3', 5'-G CCG GGG TCT TCG GGC-3' and 5'-CCG GGG TCT TCG GGC-3'.
7. 5'-GTG CCG GGG TCT TCG GGC-3', an oligodeoxynucleotide according to claim 6.
8. A pharmaceutical composition for immunosuppression or the treatment of hematological neoplasms comprising a pharmaceutical carrier and an oligonucleotide according to any one of claims 1 to 4, 6 or 7.
9. A use of an oligonucleotide which has a nucleotide sequence complementary to at least a portion of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA
transcript, for treating hematologic neoplasm ex vivo in cells harvested from an individual afflicted with a hematologic neoplasm.
transcript, for treating hematologic neoplasm ex vivo in cells harvested from an individual afflicted with a hematologic neoplasm.
10. The use according to claim 9 wherein the oligonucleotide is an at least 15-mer oligodeoxynucleotide.
11. A use according to claim 10 wherein the oligodeoxynucleotide has a deoxynucleotide sequence complementary to a portion of the c-myb mRNA transcript including the translation initiation codon of said transcript.
12. A use according to claim 10 wherein the oligodeoxynucleotide has a deoxynucleotide sequence complementary to a portion of the c-myb mRNA transcript beginning with the codon immediately downstream from the translation initiation codon of said transcript.
13. A use according to claim 11 or 12 wherein the oligodeoxynucleotide is from a 15-mer to a 21-mer.
14. A use according to claim 12 wherein the oligodeoxynucleotide is selected from the group consisting of 5'-GCT GTG CCG GGG TCT TCG GGC-3', 5'-CT GTG CCG GGG TCT TCG GGC-3', 5'-T GTG CCG GGG TCT TCG GGC-3', 5'-GTG CCG GGG TCT TCG GGC-3', 5'-TG CCG GGG TCT TCG GGC-3', 5'-G CCG GGG TCT TCG GGC-3' and 5'-CCG GGG TCT TCG GGC-3'.
15. A use according to claim 14 wherein the oligodeoxynucleotide is 5'-GTG CCG GGG TCT TCG GGC-3'.
16. A use according to any one of claims 9, 10, 11, 12, or 14 wherein the cells are bone marrow cells.
17. A use of an oligonucleotide which has a nucleotide sequence complementary to at least a portion of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA
transcript, for the production of a medicament for treating hematologic neoplasm ex vivo in cells harvested from an individual afflicted with a hematologic neoplasm.
transcript, for the production of a medicament for treating hematologic neoplasm ex vivo in cells harvested from an individual afflicted with a hematologic neoplasm.
18. An oligonucleotide which has a nucleotide sequence complementary to at least a portion of the 5'-untranslated region of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript.
19. An oligonucleotide according to claim 18 which comprises at least a 15-mer oligodeoxynucleotide.
20. An oligodeoxynucleotide according to claim 19 which comprises from a 15-mer to a 21-mer.
21. An oligodeoxynucleotide according to claim 20 selected from the group consisting of:
5'-CCG GGG TCT TCG GGC CAT GGC-3' 5'-CG GGG TCT TCG GGG CAT GGC-3' 5'-G GGG TCT TCG GGC CAT GGC-3' 5'-GGG TCT TCG GGC CAT GGC-3' 5'-GG TCT TCG GGC CAT GGC-3' 5'-G TCT TCG GGC CAT GGC-3' and 5'-TCT TCG GGC CAT GGC-3'
5'-CCG GGG TCT TCG GGC CAT GGC-3' 5'-CG GGG TCT TCG GGG CAT GGC-3' 5'-G GGG TCT TCG GGC CAT GGC-3' 5'-GGG TCT TCG GGC CAT GGC-3' 5'-GG TCT TCG GGC CAT GGC-3' 5'-G TCT TCG GGC CAT GGC-3' and 5'-TCT TCG GGC CAT GGC-3'
22. An oligodeoxynucleotide according to claim 21 wherein the oligodeoxynucleotide comprises 5'-GGG TCT TCG
GGC CAT GGC-3'.
GGC CAT GGC-3'.
23. A pharmaceutical composition for immunosuppression or the treatment of hematological neoplasms comprising a pharmaceutical carrier and an oligonucleotide according to claim 18, 19, 20 or 21.
24. A use of an effective amount of an oligonucleotide which has a nucleotide sequence complementary to at least a portion of the 5'-untranslated region of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript, for treating hematologic neoplasm ex vivo in cells harvested from an individual afflicted with a hematologic neoplasm.
25. The use according to claim 24 wherein the oligonucleotide is an at least 15-mer oligodeoxynucleotide.
26. A use according to claim 25 wherein the oligodeoxynucleotide comprises from a 15-mer to a 21-mer.
27. A use according to claim 26 wherein the oligodeoxynucleotide is selected from the group of oligodeoxynucleotides consisting of:
5'-CCG GGG TCT TCG GGC CAT GGC-3' 5'-CG GGG TCT TCG GGG CAT GGC-3' 5'-G GGG TCT TCG GGC CAT GGC-3' 5'-GGG TCT TCG GGC CAT GGC-3' 5'-GG TCT TCG GGC CAT GGC-3' 5'-G TCT TCG GGC CAT GGC-3' and 5'-TCT TCG GGC CAT GGC-3'.
5'-CCG GGG TCT TCG GGC CAT GGC-3' 5'-CG GGG TCT TCG GGG CAT GGC-3' 5'-G GGG TCT TCG GGC CAT GGC-3' 5'-GGG TCT TCG GGC CAT GGC-3' 5'-GG TCT TCG GGC CAT GGC-3' 5'-G TCT TCG GGC CAT GGC-3' and 5'-TCT TCG GGC CAT GGC-3'.
28. A use according to claim 27 wherein the oligodeoxynucleotide comprises 5'-GGG TCT TCG GGC CAT GGC-3'.
29. A use according to any one of claims 24, 25, 26 or 28 wherein the cells are bone marrow cells.
30. A use of an effective amount of an oligonucleotide which has a nucleotide sequence complementary to at least a portion of the 5'-untranslated region of the mRNA transcript of the human c-myb gene, said oligonucleotide being hybridizable to said mRNA transcript, for the production of a medicament for treating hematologic neoplasm ex vivo in cells harvested from an individual afflicted with a hematologic neoplasm.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US26790188A | 1988-11-07 | 1988-11-07 | |
US267,901 | 1988-11-07 | ||
US40802689A | 1989-09-09 | 1989-09-09 |
Publications (1)
Publication Number | Publication Date |
---|---|
CA1340369C true CA1340369C (en) | 1999-02-02 |
Family
ID=26952740
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA 613355 Expired - Fee Related CA1340369C (en) | 1988-11-07 | 1989-09-26 | Antisense oligonucleotides to c-myb proto-oncogene and uses thereof |
Country Status (1)
Country | Link |
---|---|
CA (1) | CA1340369C (en) |
-
1989
- 1989-09-26 CA CA 613355 patent/CA1340369C/en not_active Expired - Fee Related
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5098890A (en) | Antisence oligonucleotides to c-myb proto-oncogene and uses thereof | |
AU635002B2 (en) | Methods and compositions for treatment of cancer using oligonucleotides | |
US5248671A (en) | Methods and compositions for treatment of cancer using oligonucleotides | |
Tobey | Production and characterization of mammalian cells reversibly arrested in G1 by growth in isoleucine-deficient medium | |
US5744460A (en) | Combination for treatment of proliferative diseases | |
US5734033A (en) | Antisense oligonucleotides inhibiting human bcl-2 gene expression | |
EP0590090A1 (en) | SELECTIVE INHIBITION OF LEUKEMIC CELL PROLIFERATION BY $i(BCR-ABL) ANTISENSE OLIGONUCLEOTIDES | |
Bergan et al. | Electroporation of synthetic oligodeoxynucleotides: a novel technique for ex vivo bone marrow purging | |
EP0668782B1 (en) | Combination of antineoplastic agent and antisense oligonucleotides for treatment of cancer | |
EP0941317B1 (en) | Insulin-like growth factor 1 receptor (igf-1r) antisense oligonucleotide-treated breast cancer cells composition | |
WO1994023755A1 (en) | Novel methods and compositions for the treatment of ras-activated cancer with heterotypic anti-raf antisense oligonucleotides | |
JP2013541520A (en) | Method for mobilizing stem and / or progenitor cells | |
US5612212A (en) | Selective inhibition of cell proliferation by vav antisense oligonucleotides | |
KR100695677B1 (en) | Antisense compositions and cancer-treatment methods | |
CA1340369C (en) | Antisense oligonucleotides to c-myb proto-oncogene and uses thereof | |
EP0667778A1 (en) | Treatment of melanoma with antisense oligonucleotides to c-myb proto-oncogene | |
CA2004364C (en) | Antisense oligonucleotides to c-myb oncogene and uses thereof | |
US5989849A (en) | Antisense of oligonucleotides to c-kit proto-oncogene and in vitro methods | |
CA2065294A1 (en) | Antisense oligonucleotides to c-abl proto-oncogene | |
AU785056B2 (en) | C-myc antisense-treated hematopoietic stem cell composition and method | |
AU2335192A (en) | Antisense oligonucleotides to c-kit proto-oncogene and uses thereof | |
WO1994004137A1 (en) | Antisense oligonucleotides to cyclin d1 proto-oncogene | |
WO1994007538A1 (en) | ANTISENSE OLIGONUCLEOTIDES TO B-m^_y^_b^_ PROTO-ONCOGENE | |
EP1007656A1 (en) | Modified protein kinase a-specific oligonucleotides and methods of their use |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MKLA | Lapsed |