CA1341435C - Recombinant pox virus for immunization against tumor-associated antigens - Google Patents

Abstract

Recombinant pox viruses capable of expressing cell-encoded, tumor-associated antigens are dis-closed. The recombinant viruses are useful for evoking an immune response against the antigen.

Description

RECOMBINANT POX VIRUS FOR IMMUNISATION AGAINST
TUMOR-ASSOCIATE17 AN'1'1:GENS
Background The discovery over the past decade of cellular 05 oncogenes has provided cane explanation of the molecular mechanisms that are responsible for the neoplastic conversion of many types of cells.
Nevertheless, these genes and similarly acting cellular elements can at best expla:z.n only part of the process of tumor formatz.orJ. Before growing out into a tumor, the transformed cells must confront and evade physiological mechanisms that are designed to defend the host against cancer.
Prominent in these defenses, presumably are immune mechanisms that involve specific recognition and elimination of tumor cel.ls* Th~ae mechanisms are poorly understood: the nature and importance of immunological effector mechan:~.sms are unclear, and the identity of tumor cell markers that may be recognized by these effectors remains mostly elu-sive.
A desirable mode of cancer treatment is to enlist natural immune mechanisms to establish anti-tumor immunity, Methods :for inducing effect:ive~
anti-tumor immunity, however, remain to be eluci-dated. One possible way of inducing immune response against a tumor might be to immunize with a tumor-°
associated antigen, For examples, the ectodomain of ~. ~ _.
the neu-encoded rat p185 protein constitutes a highly immunogenic determinant in tumor-bearing NFS
mice which invariably mount a strong serum response to this protein. See, Padhy, L.C. et al. (1982) 05 Cell, 28:865-871.. Tumors formed from neu-trans-fectants (cells transformed with the ne.u gene) initially grow rapidly but ultimately are seen to regress. This regression as not seen with tumors formed from other types of onc;ogene-transfected cells and can be attributed at least partially to recognition of the neu-transfectants by the host immune system. The nature of the immune mechanisms that effect this regression and establish anti-tumor immunity is unclear. It is poss:i.bl.e that the p18!~
antigen alone suffices to induce the anti.-tumor response. Alternatively, this antigen may only provoke an effective response when acting in concert with other unrelated, trans~'ormat:i.orn-specific antigens displayed by the oncogene-transformed cells.
A purified, murine melanoma tumor-specific antigen has been demonstrated to elicit tumor rejection of a melanoma.. Hearing, "~".J. et al. J.
Immunol., 137:x79 (1980. This world suggests that tumor-associated antigens can be used successfully as targets for tumor immunotherapy. Recently, Lathe:
et al. showed that immunization of mice with a recombinant vaccinia virus capable of expressing a polyoma-virus encoded antigen .i.nduced rejection o:f _~_ ~~~143~
viral-induced tumor. Lathe et al. (1987) Nature 326, 878-880. The polyoma v~.ral antigen, however, is a completely foreign and highly ammunogenic antigen.
05 Summary of the Inventiorx This inventian pertains to recombinant pox viruses capable of expressing cell-encoded tumor-associated antigens, to methods of producing the recombinant pox virus, to intermediate ~N~ vectors 1U which recombine. with pox virus _in vivo to produce the modified pox viruses a;nd to methods of im-munizing a host with the recomb.i.nant pox virus to elicit an immune response aga~.r~st a cell-encoded tumor-associated antigen. The i.rment~on is based, 15 in part, on the discovery that .immunizat.ion with the neu antigen via a recombinant pox virus serves as effective prophylaxis against tumors formed by neu oncogene-transfected cells.
Recambinant pox virus capable of expressing a 20 cell-encoded tumor-associa~k:ed anti..gen are produced by integrating into the pox virus genome sequence:?
encoding the antigen or imrnunogen.ic portions there-of. Tumor-associated antigens can be ce:~lular oncogene-encoded products gar aberrantly expressed 25 proto-oncogene-encoded products ~e.c~. pr:oducts encoded by the neu, ros, trk, and ki,t genes) and mutated forms of growth factor receptor or receptor-like cell surface molecules (e. g. surface receptor:

-4- 3~r'~435 encoded by the c-erb B gene). Other tumor-associated antigens include molecules which may o:r may not be directly involved in transformation events, but are expressed by tumor r:ells (e. g.
05 carcinoembryonic antigen, CA-x..25, melanoma as-sociated antigens, etc.) In some embodiments the sequence encoding the tumor-associa~h:ed antigen is engineered to encode a product which retains at least an immunogenic domain but is disabled with respect to its oncogenic activity. For example, truncated products may be designed which contain the immunogenic domains of the nat;.ural gene product bvt which either lack or contain :~nactivat~~d oncagenic regions.
The DNA sequence encoding the tumor-associated antigen is inserted into a region of the pox virus genome which is nonessential for replication of the pox virus, generally in assac:i.atian wa~t.h a pox virus promoter to direct its expression.
The DNA sequence encoding the tumor-associated antigen is integrated into the pox viral genome by an in vivo recombination event between an inter-mediate DNA vector carryings the DNA encoding the tumor-associated antigen and a pox virus. In essence, the intermediate DNA vector contains the antigen-encoding sequence linked to a pox viral promoter located within a DNA sequence homologous to a region of the pox viral genome which is nones-sential for replication of the pox virus. Thus, at minimum the vector comprises:
a. a prokaryotic origin of replication;

,~~41435 _~_ b. a pox viral promoter;
c. a sequence encoding a ~tumc:~r-associated antigen under the da.rectic~n of the pox viral promoter; and 05 d. DNA sequences of the pox virus into which the gene encoding the antigen sequence is to be integrated, the DNA sequences flanking the promoter and structural gene at both the 5' a.nd 3' end, the DNA sequence being homologous to the region of the pox virus genome where the sequence of the tumor associated antigen is to be inserted.
Recombination of the DNA vector and the pox virus is achieved in an appropriate host cell.
Appropriate host cells for i.n v i;vca xMecombination are:
eukaryotic cells which are 1a transfectable by the DNA vector and 2) infectable by pox vii°us. The host cell is transfected with the DNA ve~a~tor° carrying the:
antigen sequence and then infected with the pox virus. The virus is allowed to rep~.icate in the host cell during which time recombination occurs in vivo between the DNA vector and the virus resulting in insertion of the sequence encoding t:he tumor-associated antigen into the pax vix-izs genome. The recombinant viral progeny is isolated from the wild type virus.
An assayable marker can be co-int.egrated with the antigen-encoding sequence. Expression of the marker provides a basis for selectx.on c~f recombinant:
virus containing integrated DNA. other methods of selection include detection of the integrated sequences by hybridization with homologous DNA
probes. Negative selection procedures can also be used such as selection for absence of the product of the viral gene into which the DNA segment has been 05 inserted. When an assayable marker is located at the viral insertion site, xec~rmbir~ants can be identified by loss of the marker.
The recombinant virus is a virus which ex-presses in an inoculated host the cellular tumor-associated antigen. The virally-expressed product will trigger cell-mediated and./or humoral immunity against the antigen and cells bearing the antigen.
Brief Description of the Fires Figure 1 is a schematic representation of the construction of the pEVAC-rzeu pla:~mi.d.
Figure 2 shows the expression of the internally deleted p185 in vaccinia virus-infected cells.
Figure 3 shows the development of antibody response to p185 in vaccinia. virus-infected mice.
Figure 4 shows the results of tumor challenge of mice vaccinated with va~:cin.ia v.i.xws recombinants.
Detailed Description of the Invention 1. Selection of DNA ~Sequences Exicodin~ Tumor As-~
sociated Antigens...
Pox viruses serve as effective vectors for inducing immunity aga~.nst tumor-associated antigens.

1 ~~1 4~ 5 _-,_ According to this invention, the antigens can be cell-encoded molecules :i. e. , molecu~~_es which are encoded by genes intrinsic to cells as opposed to those encoded by genes introduced by are extrinsic 05 transforming agent such as a ~rirus.
Particularly preferred tumor--associated anti-gens are cell surface molecules. T~~~ese are positioned for recognition by elements of the immune systems and thus are excellent targets for immuno°
therapy.
Genes which encode cellular tumor°associated antigens include cellular oncogenes and proto-oncogenes which are aberrantly expressed. In general, cellular oncogenes encode ~:moc~.ucts which are directly relevant to the transformation of the cell and, because of this, they are particularly preferred targets for immunotxierapy. An example .i.s the tumorigenic neu gene which encodes a cell surface molecule which appears to be directly related to the transformation of a cell. Other examples include the ros, fit, and t:rk. genes. The products of prota°oncogenes (the normal. genes which are mutated to form oncagenes) can be aberrantly expressed (e. g. overexpressed) and this aberrant expression can be related to cell transformation.
Thus, the product encoded by proto-oncogenes can be targeted for immune therapy.

_$_ 1 3 ~~ 1 4 3 5 Some oncogenes have been found to encode growth factor receptor. molecules or growth factor receptor-like molecules which are expressed can the tumor cnll_ surface. An example is the cell surface receptor 05 encoded by the c-erbB gene. "1°hese are particular:Ly suitable for the purpose of this invention.
Other tumor-associated antigen:: may or may not be directly involved in transformation. These antigens, however, are expressed by certain tumor cells and provide effective targets for immuno-therapy. Some examples are carcinoembryonic antigen (CEA), CA 125 (associated with ovarian carcinoma), and melanoma specific antigens.
When a tumor-associated antigen which has oncogenic activity (such as oncogene-encoded products) it may be desirable to inactivate the oncogenic properties of the antigen while retaining its the immunogenic properties. This can be accom-plished by mutagenesis technxc~ues. ~'or example, several oncogene encoded products are known to possess tyrosine kinase activity which is related in their transforming capabilities. Frame shift mutations, point mutations or ONA deletions within the tyrosine ki.nase domain of the carzcogene can destroy tyrosine activity of the expressed product and render it devoid of turnorigenic activity. In cases where a tumorigenic region of the gene has not been identified, random rnutaticans can be made witrxin the gene and mutated genes can be selected for lack ~3~41~r35 _g_ of oncogenic activity and retention of immuno-genicity.
Cellular genes encoding tumor--associated antigens can be isolated from tumor cells employing 05 standard techniques far isolation cad:' genes. See e.g. Shih, C. and Weinberg, R.A. Ce7~.l ~9, 161-169 (1982). Many genes encoding tumor associated antigens have been cloned arid thus a.re available ~or use in constructing the recombinant pox viruses of this invention. See e.g., Bargmann et al. (1986) Nature 319, 226-238 (neu gene); Martin-2anca, ~. et al., Cold Spring Harbor Symposia on Quantative Biology, V. LI, p. 985-992 (1986) (trk gene);
Paxton, R.J. et al,., Proc. Na~k:l. A~.ad. Sci. USA 84;
920-924 (1987) (CEA).

2. Pox viruses Any member of the pox family can be used for the generation of recombinant v~.ruses~ for the purposes of vaccine development, the preferred pox virus is a virus which does not cause significant disease in normal humans or ar~:imals. for example,, for humans and other mammas, the preferred pox virus is vaccinia virus, a z°elatively benign virus, which has been used for ye<~r~~ as a vaccine against smallpox. Several strains of vaccinia, which differ in level of virulence, are available for use as vaccine strains; for the purposes r~~ vaccination, a less virulent strain such as the New York State Board of Health Strain which stzll. retains the -~.C9-ability to elicit an appropriate immune response is preferred. General techniques for integration of foreign DNA into vaccinia ~r i ~u:a to produce a modified virus capable of c~~:laression foreign protein 05 encoded by the foreign DNA a~-e described by Paole~.ti et al. U.S. Patent No. 4, G()3, 1~.2 »

3. DNA Vector for,yrecombirzation wi.t~ Fox virus According to the met~lica~l o1: ttzi~~ invention a 1U foreign gene which encodes t::he cell-encoded tumor associated antigen is inner ted .i.nt:o the genome of a pox virus so as to allow it to be expressed by the pox virus along with the e:~pressa.on of the normal complement of pox virus prc~teiz~s except for the pox 15 viral protein encoded by tl~~e gene into which the foreign DNA is inserted) » '1'h:i.:' is accomplished by first constructing a cl~imer:x~c donor vector for recombination with pox ~rirus wlnicl~z contains the DNA
encoding the tumor assoca.a~,er~ antigen together with 20 a pox viral promoter direct.:ir~g :its expansion, flanked by pox viral sequences. The flanking pox viral se-quences can be any pax DNA rec~:ion nonessential for replication: these allow tlae vector to recombine with pox virus :irz vivo at d spe~::iiio. regian in the 25 pox virus genome» This rec:ombimatx,.on results in integration of trxe DNA sequc~rxc: a erac:odirkg the tumor-associated antigen into th~.~ g~yr»ame t:o produce a recombinant virus containi~xc~ tla~~ IaNA sequence.

~3~+14~5 The DNA vectors of this invention for integra-tion of a DNA sequence of a cell-encoded tumor-associated antigen in expressible form into the pox viral genome contain the following elements:
05 a. a pox viral promoter linked t:o:
b. a DNA sequence containing a cloning site for insertion of DNA;
c. DNA sequences flanking the construct of elements a and b, the flanking sequences being homologous to a region of the pox viral genome which is nonessential to replication of the virusw d. a replicon for vector replication in a prokaryotic host; amd e. a gene encoding an assayable marker or indicator for selection of the vector in transformed prokaryotic hosts.
DNA vectors can also be constructed for in-sertion of two or more DNA. sequences encoding different tumor associated antigens into pox virus.
The antigen-encoding DNA sequences can be placed .in tandem between the homologous flanking sequences, each sequence under the control of a separate pox viral promoter.
The cloning site generally comprises recog-nition sites for several.. restx°icti~ar~ enzymes which allow different modes of insertion c~f DNA. An example sequence containing a multiple cloning site is: GGATCCCCGGGTACCGAGCTCGAA7C°'I"C, which contains the recognition sequences and cleavage sites for the ~ ~~~1 43 5 restriction endonuclease enzymes BamHI, SmaI, Kpnl, SacT and EcoRI. Sequences cantainirzg additional or different recognition s:itea can be ~.asec:~» The cloning site is located adjacent to and downstream 05 of a pox viral promoter such that an inserted gene can be placed under control of the promoter.
The pox viral promoter controls expression of the DNA sequence inserted at the cloning site and can be obtained from the spec~.es of poi virus ~wit.h.
which the vector is designed to recc>mb~.ne.
The sequences flanking the construct of ele-ments a and b (the pox viral promoter and adjacent cloning site) are homologous to a region of the pox viral genome which is not necessary far replication of the pox virus. Thus, recombi.natz.on and integra-tion of foreign DNA will occur at t~x:is site and t:he inserted DNA will not abolish viral replication. A
preferred region for insertion into pox virus is within the gene coding for thymidine kinase (TK).
Insertion into this region has several advantages:
(1) the TK gene is not requi..red for vix°al repli-cation, so insertions into this gene do not abolish viral replicat~.on~ (2) ~nsert:~ons :iruto the TK gene do, however, partially inhibit viral replication, resulting in a recombinant pox virus that is less virulent and therefore possibly more suitable as a vaccine strain; and (3) it :is possible to select recombinant viruses by selecta.ng fox° insertional inactivation of the TK gene by selecting for in-sertional inactivation of the TK gene by growth in -~~~ ~3~1~35 the presence of 5-bromodeoxyuri.dinee, In order to obtain insertion into the TK gene, ~:he recombination vector must contain flanking sequences homologous to the TK gene sequences.
05 Other nonessential regions of the pox virus genome can be used as flanking sequences to direct the stable integration of the DNA vector into the pox virus genome: these include, but are not limited to, regions of the genomic DNA contained on the lOHindIII arid HindTTIF restriction fragments.
The replicon for replication in a prokaryotic host and the gene encoding the selectahle indicator or marker allow the vector to be selected and amplified in a prokaryotic host such as E. coli to l5provide ample quantities of the vecfi:or DNA for eventual transfection of eukaryotic host cells for recombination. The replicon can be obtained from any conventional prokaryotic vector such as pBR322 or the pEMBL group of vectors. The selectable 20marker can be a gene conferring antibiotic resis-tance (e. g. ampicillin, chloramphenicol, kanamycin or tetracycline resistance).
Preferred vectors contain genetic elements which permit positive selection of recombinant 25 viruses, i.e. , those viruses which have recombined with the vector and, as a result, have acquired the sequence of interest. These elements for selection comprise a pox virus promoter, which. controls expression of the indicator gene in the recombinant 30 virus. The promoter and indicatcar gene (marker) are -14_ 13~~435 located between the flanking pox viral sequences so that the elements which allow for selection and the oncogene sequence of interest are co-integrated into the pox viral genome. Recombinant ~~iruses can then 05 be selected based upon expres~yian a~;" the marker o~
indicator.
A preferred gene for selection is the E. coli lacZ gene which encodes the selecta~rle enzyme B-galactosidase. Methods of selection based upon expression of this enzyme are discussed. below.
Other selection methods include thym:idine kinase selection as described above, and any drug resis-tance selection, for example, tree selection that .is provided by the gene encoding neomycin phospho-transferase, an enzyme which confers resistance to 6418 (Franke et al . , :1985. Nol . Cell,. Biol . !~, 1918).
Alternatively, a negative type of selection can be employed. A preferred procedure of this type involves the use of a vaccini.a virus such as vZ2 a recombinant derivative of the wr v~ccznia strain which contains a lacZ gene inserted within the HindIII F-region. Donor vectors containing homolo-gous regions of the H.indII7CF region and can recom--~5 bine with vZ2 thereby replacing the lacZ gene witYa the DNA sequence encoding the tumor-associated antigen. Recombinant virus are lacZ~ and appear as white plaques i.n the presence of ck~r~amogenic sub-strate (e.g. Bluo-GalTM). fee, Panicali, D. et al.
(1986) Gene, 47_:193-199.

1~~1~35 _~~_ As mentioned above, the preferred species of pox virus for .insertion of: DNA sequ~:nc~~s for pro-duction of vaccines is the vaccinia species.
Accordingly, preferred vectors are designed for 05 recombination with the vacci.nia vir~xs and thus, the pox viral elements of the vector are derived from vaccinia virus. A vector for recombination with vaccinia virus can contain:
a. one or more vaccinia promoter (e.g. the vaccinia 11K, 7.5K, WOK, 40K or BamT~ promoter or modified versions of these promoters)r b. a multiple cloning site adjacent to each promoter:
c. a gene encoding a selectable marker (e. g.
the E. coli lacZ gene) under control of a vaccinia promoter:
d. DNA sequences homologous ~;:o a region of vaccinia virus nonessential for replication of the virus, the DNA sequences flanking tree c°onstruct o:f elements a-d (e. g., sequences of th~~ vaccinia thymidine kinase gene);
e, a replicon for repl.~.cat~.an. in a bacterial host; and f. a gene encoding a selectable marker under control of a prokaryotic promoter fear selection of the vector in a prokaryotic host.
Vaccinia promoters are DNA sequences which direct messenger RNA synthes.~.s from vaccinia gene:
during a vaccinia virus infection. Such promoters can be isolated from the vacca.nza genome or can be -~~- 1 3 4 1 4 3 5 constructed by DNA synthesis techniques. Promoters vary in strength of activity and in time of ex-pression during the vaccinia virus ~.3.fe cycle: these parameters can be altered by mutation of the pro-05 moter sequence. The promoters can be isolated or synthesized to include or not include a trans-lational initiation colon ATE as well as a multiple cloning site for convenient insertion of foreign gene in order to express these genes in vaccinia.

4~ In vivo recombination The intermediate I~NA vectors containing the DNA
encoding the tumor-associated antigen of interest (and the marker or indicator gene) flanked by appropriate pox viral sequences will undergo recom-bination with pox virus which results in integration of the flanked genes into the prix va,ral genome.
This recombination will occur in a eukaryotic host.
cell. Appropriate host cells for recombination are cells which are 1.) infectable by pox virus and Z) transfectable by the DNA vectorA examples of such cells are chick embryo fibroblast, C.'V-1 cells (monkey kidney cells), HuT~-~1.~3 cells (human cells), and BSC40 (monkey) cells.
The cells are first infected with pox virus and then transfected with the intermediate DNA vector,.
Viral infection is accomplished by standard tech-niques for infection of eukaryotic cells with pox virus. See e.g., Paoletti et al., supra. The cells can be transfected with the intermediate DNA vector _1Z-by any of the conventional techniques of trans-fection. These include tree techniques of calcium phosphate precipitation, I3:~AE dextra~in, electro-poration and protoplast fusion. The preferred 05 technique is the calcium phosphate precipitation technique.
After infection and subsequent transfection, the cells are incubated under standard conditions and virus is allowed to replicate during which time in vivo recombination occurs between the homologous pox virus sequences in the: interzned~.ate vector and the pox virus seq~zences in the gename.
Recombinant viral progeny are then selected by any of several techniques. The presence of inte-grated foreign DNA can be detected by hybridization with a labeled DNA probe spec~.fic fRar the inserted DNA encoding the tumor anfi;igen. A1°l.:ernatively, virus harboring the tumor cell sequence can be selected on the basis of inactivation of the viral gene into which the foreign DNA was inserted. for example, if the DNA vector is designed far insertion into the thymidine kinase (TK) gene of a pox virus, viruses containing integrated DNA will be unable to express thymidine kinase (°TK-) and c:an be selected on the basis of this phenotype. ~~referred tech-niques for selecta.on are based upon ca-integration of a gene encoding a marker or ~,nd~.cator gene along with the gene of interest, as described above. A
preferred indicator gene is the E» ~:oli. lacZ gene which encodes the enzyme B-galactas.i.dase. Selection of recombinant viruses expressing F~-galactosidase 1341 43 ~
-~.~-can be done by employing a chromogenic substrate for the enzyme, Far example, recombinant viruses are detected as blue plaques in the presence of the substrate 5-bromo-4-chloro-3-indolyl-B-D-galactoside 05 or other halogenated-indolyl.-B-D-galacfi.osides (BluoGalTM).
Another preferred technique involves the use of virus vZ2 as described above.
Recombinant viruses which express the inserted DNA sequence encoding the tumor associated antigen can be determined by any of several standard pro-cedures including RNA dot blots, black plaque assays, immunoprecipitation (employa.ng antibody reactive with the antigen), etc.

5. Vaccines Live recombinant viruses expressing an an immunogenic a cell encoded tumor associated antigen can be used to induce an immune response against tumor cells which express the protein. These recombinant viruses may be administered intra-dermally, as was conventionally done far small pox vaccination, or by other routes appropriate to the recombinant virus used. These may include among others, intramuscular, subcutaneous, and oral routes. Vaccination o~ a host organism with live recombinant vacci.nia virus is ~oll.c~wed by replica-tion of the virus within the. host. During replica-tion, the oncogene sequence is expressed along with the normal complement of vaccinia genes. If the ~14~~
-~.~--ancogene product is an antigen, it will stimulate the host to mount an immunolagical response, both humoral and cell-mediated, to the tumor associated antigen (as well as to vaccinia virus a.tself).
05 6. Use of Recombinant Pox Viruses to Produce Therapeutic and D:iar~nost:ic. ~P~algents Recombinant pox virus which express tumor-associated antigens can also provide a means to produce antibody against the antigen for use thera-peutics or diagnostics. Infection of experimental animals with tree recombinant pox viruses can be u:~ed to raise both monoclonal antibodies and polyclonal antisera which recognize the: humor associated antigen. The antibodies may be useful in passive immunotherapy against tumor'. Tn d~.ac~nostics, these, monoclonal and/or polyclonal antibodies can be used as capture antibody for immunoassay in the RIA or ELISA format, t:a detect the presence or to quanti:~y the antigen in a biological fluid ~e.g., urine, blood, etc.) Alternatively, cells infected in vitro with the recombinant pox viruses can be used as a source o:~
the tumor associated antigens. Compatible host cells are infected with a recombinant pox virus capable of expressing the desired tumor associated antigen and cultured under conditions which allow the virus to replicate and express the antigen. The:
antigen is then isolated from the cells..
The invention is illust.ra.ted f°urther by the following exemplification.

- ~b ~, ~. 1 3 '~ 1 4 ~ 5 Exemplification Virus and Cells CV-1 cells were obtained from the American Type Culture Collection (ATCC#CCL"70) and were grown in 05 Minimal Essential Media (MEM) suppl~amented with 10%
fetal calf serum. Vaccinia virws strain VZ2 is a derivative of the WR strai.n which ccantains the lacZ
gene inserted at the Bam HT-site in the vaccinia virus Hind III F-region, Panical:i, D., Grzelezcki, A. & Long, C. (1986) Gene ~~', 193-199.
Construction of a chimeric donor plasmid for in vivo recombination pEVAC is a recombinant plasmid which contains a 2.5 kb Pst I fragment corresponding t.o the middle portion of the vaccinia virus HindIll P"-fragment.
Panicali, D., Davis, S.W., Mercer, ~~.R. & Paoletti, E. (1981) . J. Vi.rol. 37, 1t~00-1010; this Pstl-fragment is inserted into the Pstl site of a deriva-tive of pEMBLIB (Dente, L., Cesaren~, G. & Cortese, R. (1983) Nucleic Acids Res. 11, 1~~5-1.655), lacking a BamHI restriction site. Ad;~acent to the BamHT
site in the vaccinia virus fragment is an early vaccinia promoter which has been us~Ad previously to express a variety of antigens. PaniC.~.ali., D., Davis, S.W., Weinberg, R,A. & Paoletti, E. {1983) Proc, Natl. Acad. Sci. USA 80, 534-5368. This vector was used to insert the rat neu ~:I3NA described by 1341~r35 _~~-Bargmann et.al., (1986) Nature 319, 226-230. In order to disable the ancagenic functiarn of the neu-encoded prate.~.n, an internal. deletion was made in the neu cDNA clone by deleting the sequences 05 between the Bam HI site at. rat 2175 and the BglII
site at nt 3250 of the neu cDNA sequence. Bargmann, C.I. Hung, M.C. & Weinberg, R»A» (~.;~86) Nature 319, 226-230. This deletion removes the raglan that specifies the tyrosine kinase domain of the neu-encoded protein. In addit:i_or~ :a.t generates a frame-shift mutation downstream of the kinase domain, creating a new stop colon shortly after the 13g1I2 site at nt 3250. The resulting construct was designated pEVAC-neu. (Figure 1 shows a schematic representation of the constructa.on c~f the pEVAC-nE>_u plasmid; at the top a schematic representation of the p185 gene i.s shown; TM i.nd,icates the position of the transmembrane domain and. the b~.ack: box indicates the domain with homology to proteins with tyrosine kinase activity). The pEVAC-neu plasmid has been placed on deposit at the American Type Culture Collection, Rock.ville, Maryland and assigned the accession number X0353 .
Construction, Identification and Purification of Recombinant Vaccinia Virus Recombinant vaccini.a virus was constructed as previously described. See Panica~i, D. ~ Paolett:L, E. (1982) Proc. Natl. _Acad. S_c_i. uSA _79 4927-4931.
In short, CV-1 cells (106 cel..ls per' 6 cm plate) were:
infected with vaccinia virus V~2 at a multiplicity - L ~ °"°
of infection of 2 and incubated for ~0 minutes at 37 ° C. Cells were then transfected ~ritr~ 27 ug of calcium orthophosphate precipitated pE~AC-neu DNA.
After a further incubati.or~ for. l fa hc7ur~ at 37 ° C
05 virus was harvested and ti.tered.
The DNA used for this transfectior~ was able to recombine with homologous sequences in the HindIII
F-region of the ~IZ2 genome, thereby re~alacing the lac-Z gene. As a result, recombina~~~t virus appeared as white plaques in the presence of Bluo-Cal (Bethesda Research Laboratories), wYiile the parental virus VZ2 appeared blue. White plac~ue:> were picked and five rounds of plaque pura.ficat:~.on were per-formed. One of the recombinant v~.r~ases, designated ABT9-4, had a fin<~l concentration o~~' 1_..1x1.013 pfu/ml.
ELISA ASSAY
Serum antibody responses to var.;cinia were detected using a solid-phase ELISA. Sucrose-gradient purified vaccinia. virus (WR strain) at a protein concentration of 10 u~r/ml in 0.05M carbonate buffer pH9.~ was used to passively coat microtiter wells. After ?. hours at 37 °' c,~, the :~ol.ution was aspirated and di.lutions of test sera were added to the wells. Following a 1 hour .incur>ation at 37°C, the wells were washed three t~.mes with PBS sup-plemented with 0.05% Tween 20 and w~~~re then in-cubated with HRP-labeled goat anti-~~~ouse IgG
(Jackson Immunoresearch~ at a d~.lut~.on of 1:5000.

1 ~ 41 43 5 _~~._ Rat sera were tested using an HRP-labeled F(Ab)2 goat anti-rat IgG, also at a dilution of 1:5000.
After incubation with the second antibody, the wells were again washed three tines w~,th YBS-Tween, and 05 color was developed using 3,3,5, 5"-tetramethyl-benzidine (TMB, Sigmaj. 10 mg of TMB was dissolved in 1 ml of dimethylsulfoxide (DMSO and 100 u1 of this solution was added to 5 m1 of acetate citrate buffer pH 6.0 along with 10 u1 of :~~ H2O2. Color was allowed to develop f°or t'~.~re ma.nutes, after which the reaction was stopped by the adda.tion of 2.5M
H2S04. The absorbance was read at 450 nm an a Dynatech Mini-readerlI plate reader. Serum antibody responses to the rat p185 protein were determined similarly, using a cell lysate of DHFR G8 cells to coat the microt:iter wells. C~f~~'R G8 cells over-express the non-transforming rat p185 protein. See Hung, M.C., Schechter, A.L., Chevray, F.~i., Stern,, D.F. & Weinberg, R.A. (198 0 Proc. l~atl Acad. Sci.
USA 83, 261-254. ELISA titers against the p185 protein are reported as the last dilution which still gives as OD of at lea;~t O.OC> un.i.ts greater than the OD seen for background binding. ELISA
titers against vaccinia virus are defined as the dilution of serum which gives an O.D. which is half the maximum O.D. obtained in the assay.

2 ~ - "~ ~'~ ~4 ~ 4 3 '~
Results Construction of a NEU- Containing Recombinant vaccinia virus The neu oncogene was .initially detected by 05 transfection of DNA from chemically induced rat neuroblastomas into NIH3T3 mouse c~e~..ls * Padhy, L.C., Shih, C., Cowing, D.C., finkei.stein, R. &
Weinberg, R.A. (1982) Cell 28; 865--8'1., Shih, C. , Padhy, L.C., Murray, M. & Weinberg, R.A. (1981) Nature 290, 261-263. The resulting transfectants were found to be tumoragenac in NFS mace. These mice also were found to mount a strang humoral immune response against the extrace7..lular portion of the p185 specified by the transfeeted rat gene.
Padhy, L.C., Shih, C., Cowing, D.C.~. F~nkelstein, R.
& Weinberg, R.A. (1982) Cell 28, 8~a5°871. This p:L85 protein has many properties of a growth factor receptor. In addition to the extracel3.ular domaa:n, it has a transmembrane domain and an intracellular domain with sequences that share iior~uo:~.cagy with proteins having tyrosine kinase activity. Bargmann, C.I., Hung, M.C. & Weinberg, R.A. & Paoletti, E.
(1983) Proc. Natl. Acad. Sci. CJSA BCC, 5364-5368:
Schechter, A. L.. , Hung, M. C * , va ~idyanathan, L. , Weinberg, R.A., Yang-Feng, 'I'.L., France, U., Ullrich, A. and Coussens, L~* (1985) Science 229, 976-978. The neu-encoded ,protein found in the oncogene-transfected cells differs from its normal counterpart by a single amino acid substitution arx the transmembrane domain of the protein, Bargmann, _~5~
C.I., Hung, M.C. and Wei.nberg, R.A. (1986). Cell 45,, 649-657.
We adapted a cDNA clone of the neu oncogene for introduction into the vaccinia ~reci~..or. We first 05 removed the bulk of the sequences specifying the cytoplasmic domain of the pro~ei.n. By deleting tile kinase domain, we fully disable the oncogenic effector functions of p185 while leaving intact the immunogenic ectodomain. The truncated neu cDNA
clone, encoding the ectodoma.in, the transmembrane anchor domain, and approximately 50 amino acid residues of the intracellular domain, was then joined with the Bam-F promoter of vaccinia virus.
The resulting construct was designated pEVAC-neu.
This gene was then introduced into vac~c~.nia virus by homologous recombination (Materials and Methods).
The resulting chimeric virus was termed ABT 9-4.
Expression in Infected Cells To test whether the manipulated neu gene encoded by the recombinant vaccinia virus is ex-pressed in infE~cted cells, CV-~:1 cell.s were infected at a multiplicity of infection of 1u pfu per cell with either the ABT 9-4 recombinant virus or an equal dose of WR wild-type vaccinia virus. Directly after infection, ~5S-cysteine was added and in-fection was allowed to proceed for ~~ hours. Fol-lowing this, infected cells were lysed with RIPA
buffer and lysates were immunopreci.pitated with the ~ ~,~4~1 43 5 anti-p185 monoclonal antibody 7.16.4 (Drebin, ~J.A.
et al. (1984) Nature 812 545-548). This antibody reacts with a still undefined determinant located in the ectodomain of the protein. Figure 2 shows SDS
05 polyacrylamide ge.l electrophoresis caf the proteins immunoprecipitated with anti-p185 monoclonal anti-body (Lanes indicated "ni" represent lysates pre-cipitated with a non-immune mouse serum; lanes indicated "p185" were immunopa:ecipit:ated with the 7.16.4 monoclonal antibody; a lysate from 8101-1-1 cells (expressing the transforming p185 protein) was added as a control. The positions ~rf the molecula:~r weight markers are indicated.) As c.an be seen in Figure 2, ABT 9-4-infected cells, but not wild--type vaccinia virus-infected cells, produce a 200 kD
protein that is precipitated by t'he monoclonal antibody 7.16.4. The molecular weight of the precipitated protein is in good agreement with that calculated far the protein specified by the trun-Gated neu gene. We conclude. from these experiments that the ABT 9-4 recombinant d.irect.s the synthesis of a truncated p185 molecule.
Immune Reactivity in Virus-I,nfected;Mice The ability of inbred mice to respond to a foreign antigen is known to differ widely'between strains. Accordingly, we first tes~:ed ~rarious mouse strains far their ability to mount e.n immune re-sponse against the rat p185 protein. To da this, four-week old mice of various :trains were ~ :~ '~ 1 4 3 5 _~~_ inoculated intraperitoneally with l0~pfu of either wild-type vaccinia virus or an equal dose of ABT9-4 recombinant virus. After 4 weeks, a booster in-jection of lo8pfu of virus was given. Sera were 05 collected two weeks later. The production of antibodies directed against the ne~~ on~:ogene product was followed using an EtISA assay ~Mate~rials and Methods). The results, shown i.n Table l, demon-strate that not all mouse strains have the ability respond to the rat plF~S protein. W~: assume that these differences are due to differences in MHC
haplotypes of these mouse strains. ~'ox:° example, we note that both mouse strains of tk~e ~i-~f haplotype did not respond to the neu product In subsequent experiments we concentrated on the use of NF'S mice as a model . These mice are c;~.ose 1y re~..ated to the strain from which the NIH3T:3 cell lane arose. They thus represent a reasonable host for oncogene-transformed NIH3T~ tumor ce~.l~.

i X41 4~ 5 Table 1. Antibody titers of different mouse strains to the rat p18~ protein fa~.lowinc~ vaccination with vaccinia recombinant AB~~'~-4.
Strain Haplotype Sera ELZSA Titer d Balb/c H-2 non-immune 0 immune 0 C3H/HeN H-2k non-immune 0 i.mmr~~ae 1: 8 0 DBA/2N H-2d non-immure 0 immune 0 NFS outbred non-immune 0 immune 1 r 4 0 NzW/LacJ H-2z non~-immune 0 immune 1:80 SM/J H-2v~ non~ immune 0 immune 0 Swiss outbred non-immune 0 immune 1:80 Mice were immunized intraperitoneally~with 108pfu of ABT9-4 recombinant irus. After four weeks mice v were boosted with similar dose of rus. I"hers a vi indicated were obtained with sera coll.eo.ted twa weeks after the boost.
FLT;~A assays were performed as described in Materials and Methods.

13;1435 _~~_ We next determined the kinetics of the develop-ment of immunity against the p185 protein in NFS
mice immunized with the vaccania v:i:~~us recombinant.
To do this, NFS mice were immunized W.t.h a single 05 subcutaneous injection of lo~pfu of the ABT9-4 recombinant virus. Control mace were ~.mmunized in parallel with an equal dose of wild type vaccinia virus. To monitor the development of immunity, mice were bled at weekly intervals and tx°ue sera were tested fox an ability to prec~.pi.tat~~ p185 from lysates of 32p labeled DHFR G8 cells. Figure 3 shows SDS acrylamide gel elerarophoz~esi.s as follows:
Lane 1: non-immune mouse serum; lanes 2 and 3:
sera from mice immunized with wild type vaccinia virus collected 4 weeks post immunization; Lanes 4 and 5: sera from mice :i.mmunized with ABT9-4 recom-binant virus, 3 weeks post :~.mmut~izat.ion; Lanes 6-~:
sera from ABT9-4 immunized mice collected 4 weeks post immunization; Lanes 10 and 1.1: Sera from ABR9-4 immunized mice, 5 weeks post immunization;
Lane 12: monoclonal antibody '~.16.~.
As can be seen in figure 3, infection by the recombinant vaccinia virus led to the development of high titer antisera agaa.nst p185 within a period of three weeks. The serum titers showed a further slight increase in the next week. ~ simi:lar pattern was found for the development of imrnr:~nit;y against vaccinia virus in these mice as measured in an ELISA
assay (data not: shown'. As expected, no reactivii::y against p185 was developed when m:i.ce were exposed to ~ ~3 4' 1 4 3 5 the wild-type vaccinia virus (Figure ~, lanes 2 and 3). These data made it clear that a single in-jection of recombinant vac:c:~.n~.a 'virus ~.eads to the efficient induction of anti--p185 antibody within a 05 period of 4 weeks.
Tumor Rejection in Immune ,Mice Subsequent experiments were designed to test whether immunization of NF"S mice with the ABT9-4 recombinant virus had an effect on the tumorige-nicity of NIH3T3 cells transformed by the neu oncogene. These NTH3T0 derivatives, termed B104-101, carry the rat neu oncogene grad display substantial amounts of oncogene-encoded p185 on their surface, Padhy, L.C., Shih, C., Cowing, H.C., Finkelstein, R. & Weinberg, R.;~. (182) Cell 28, 865-871.
Young adult NFS mice were injected intra-peritoneally with 108 pfu of wild-type or recom-binant vaccinia virus and challenged with various doses of B104-1-1 tumor cells four weeks post immunization. Both viruses pro~roked similar anti-vaccinia virus immune response in these mice, as measured in a vaccinia virus ELISA assay (data not shown). The growth of tumors at the site of in-jection was followed in time a:nd is presented in Figure 4. Young adult NFS mace were immunized with a single injection of l0gpfu of wild type vaccinia virus or ABT9-4 recombinant virus. Four weeks later, these mice were challenged with either 2X106 1 ~~~ 43 5 _~ ~_ (panel A) or 1X107neu-transformed NIH3T3 cells (Panel B). As a control, a gx-oup off: i.mmunized mice was challenged with Ha-ras transformed NIH3T3 cells (panel C). Each group of consisted of 10 mice, the 05 data are represented as the average tumor area ~ ;~D.
( ) : Wild type vaccinia imm~xnizecl mice, ( ) ABT9-4 recombinant immunized mice.
The data show that in wild-type virus-infected animals, B104-1-1 cells grow progressively for the first 12 to 19 days, after which the tumors begin to regress spontaneously and ~arm.lly disappear com-pletely after about 5 weeks. A similar pattern of tumor growth and rejection was observed when non-immunized NFS mice were injected w~t.h ~n equal dose of B104-1-1 cells (data not shown). Since tumor regression is not seen when these cells are :a.njected in athymic nude mice, it is most likely tumor regression is caused by the spontaneous development of immunity against these ~.el l s .
A quite different result was obtained when B104-1-1 cells were injected into NF'S mice immunized with the ABT9-4 recombinant virus (F"figure 4A, B).
Following injection of a tumor cell dose of 2X10f cells per animal, no tumor developed at the site of injection: at a dace of 10~ G:e:lls per animal, a small nodule developed at the site of injection within five days which quickly disappeared in the next several days. These restults show that immuni-zation with the vaccinia virus recombinant 1 3 41 43'~
-~~_ drastically inhibits the outgrowth of p185-expres-sing tumor cells.
No difference in tumor outgrowth was seen when both wild-type virus immuraired mice and recombinant 05 virus-immunized mice were challenged with Ha-ras transformed NI13 3T3 cells. rfhis shy">wed that the immune protect:ian brought about by the recombinant vaccinia virus is specific for tumor cells dis-playing the neu ancogene-encoded p185 Figure 4, panel c).
Immune Reactivity in Rats The introduction of the neu-transf~'ormed NIH~T3 cells into NFS mice represents an experimental artifice in that these tamer ce:~.ls ~.>resent an immunogenic rat protein to the mouse hr~st. The immunogenicity of this protein appears to induce the eventual rejection of tumors f.'ormecl from these cells (Figure 4A, B). This situation would seem to contrast with one arising in an animal bearing an autochtonous tumor or a tumor deriving from fully syngeneic cells» In theses latter case:, na antigen of allogeneic origin is presented, and potently immunogenic proteins are usually not: dx.splayed by the tumor cells.
This reasoning caused us to question whether immunity to p185 and associated tumr"rr rejection could be developed in a fully syngeneic system.
Thus we attempted to immunize B~I~ x~at~ with the vaccinia-induced p185 antigen. The neuroblastomas ~~4~43~
in which the neu oncogene arose were induced in rats of this strain. Schubert, Lt., ~ieinemann, S., Carlisle, W., Tarikas, ~I., Kimes, t3~, F~atrick, J., Steinbach, J.H., Culp, W. & Brandt, B.L. (1974).
05 Nature 249, 224-227. Though the ectodomain encoded by the vector-borne neu gene :~.s iderutical to that of the normal p185 expressed in the BDIX rat, the possibility remained that the amino acid substitute tion present in the transmembrane domain of the oncogene-encoded protein might confer immunogenicity on this protein. This amino acid substitution is specified by the truncated neu gene borne by the vaccinia vector.
To measure the effectiveness of the vaccinia recombinant virus in rats we immunized the following rat strains with the ABT9-4 recomb~r~ant: BDIX, Fisher, Lewis, Sprague Dawley, Wistar-Kyoto.
Weanling rats were immunized by intraperitoneal injection of 108pfu of wild-type vaccinia virus or ABT9-4 recombinant virus followed by a second intraperitoneal injection of 108 pfu of virus three weeks later. Z'wo weeks after the booster injection, animals were bled and their sera were tested for reactivity with vaccinia virus a~xt:ic~ens. Both strains of virus grew well in these rats, equivalent anti-vaccinia serum response (titers 1:10.000) in an vaccinia virus FLISA were found in all rat strains). These sera were al,scx tested for an ability to precipitate either the normal or the transforming version of the p135 protein from ~ ~ '~' 1 4 3 5 lysates of neu-transfected cells. No reactivity against either pratein was found in any of the rat sera tested (data not shown .
Although na humoral immunity against p185 was 05 elicited in these rats, it remained possible that these rats would display an effective ~~nti-tumor response. Accordingly, we tested whether immuni-zation of BDIX rats by the ABT9-4 virus would result in inhibition of the growth of F31~34 neuroblastoma cells. These B104 cells derived directly from a chemically-induced tumor of a BDIX :r-at and express the transforming version of p~.85. S~:hubert, D., Heinemann, S., Carlisle, W., 'Tarikas, 1l., Kimes, B., Patrick, J., Steinbadh, ;T.~C., Culp, W. & Brandt, B.L. (1974) Nature 249, 224-227. Exposure of the BDIX rats to the A8T 9-4 viru.~ led to no significant inhibitory effect on the growth of :~.njected B104 tumor cells (data not shown). It appears that the ectodomain of the neu-p185 that is expressed in vaccinia vector-infected cells is not. immunogenic in BDIX rats, in that neither anti-p~.~3~a serum response nor anti-tumor immunity was observed.. It remains possible however that recombinants that express the neu-encoded p185 protein at a higher level, possibly used in cambinati.on with drug:: that reduce tolerance of animals against a self product, may be more effective in inducing immunity in syngeneic animals.
At present it appears however that the presence of an amino acid s ubstitution Wi.n the t:ransmembrane domain of the p185 protein :i.s not sufficient to ~3~'~~435 -3 ~--overcome a tolerance which the rat immune system shows towards this protein.
We describe the construction of a vaccinia virus recombinant expressing the extracellular 05 domain of the rat neu nncogene and its use in tumor immunotherapy. Our data indicate that the recom-binant vaccinia virus-induced immun~.ty results in the full protection of mice from subsequent tumor challenge with cells that express the rat neu-oncogene. The fact that the subtle differences between rat and mouse neu proteins were sufficient to induce a potent immune response against the rat protein in immunised mice sugcfests that. recombinant pox viruses will be powerful tools for the induction of immunity against tumor cells whose antigenicity in many cases does not differ greatly from the cells from which the tumor arose.
The immunnlogical eff'ector mechanisms that are involved in inducing anti-tumor immunity have not been studied extensively. tour data indicate that the vaccinia virus recombinant can ~.nduce signifi-cant antibody titers against the rat neu oncogene protein in vaccinated mice. Tn the present study complete protection against 'tumor c~aall.enge with neu-transformed cells was observedy suggesting that immune mechanisms other thaxa humora~. immunity were induced by the vaccinia virus recombinant. In support of this view in th.e fa_nding of others who have shown that vaccinia virus vectors can e,ffec-tively induce T-cell med.iat~:d immune responses ~143~

in immunized animals. Earl, p.L., et al. (1986) Science z34, 7~8-731.. However, inh~..bit,ion of tumorigenicity in these expera.ments was only par-tial, indicating that antibody trea~t:ment alone is 05 not sufficient to cause complete regression of the tumor induced by the neu-transformed cells. In the present study complete protect:i.on against tumor challenge with neu-transformed cells was observed, suggesting that immune mechanx.sms other than humoral.
immunity was induced by the vaccinz.a virus recom-binant. In support of this va..ew is the finding of others who have shown that vaccinia virus vectors can effectively induce T-cell mediated. immune responses in immunized animals.
Our data demonstrate that immunization with <~
single, well-defined antigen c:°.an confe~° protection against tumor cells bearing tha.s antigen. This is to be contrasted with other experimental models in which animals are immunized with tumor cells or tumor cell extracts in which a complex mixture of antigens may act to provoke :immuni~;:~~ .
Equivalents Those skilled in the art w~i.ll x-ecognize, or be able to ascertain using no more than routine ex-perimentation, many equivalents to t:he specific embodiments of the invention c~escr~.faed herein. Such equivalents are intended to b~~ encompassed by the following claims.

Claims (25)

1. Use of a recombinant pox virus capable of expressing in a host an oncogene or proto-oncogene product encoded by a gene of cellular origin to immunize an individual afflicted with a tumor which expresses the product, against the oncogene or proto-oncogene product.

2. Use as defined in claim 1, wherein the recombinant pox virus is a vaccinia virus.

3. Use as defined in claim 1, wherein the oncogene or proto-oncogene product is of human origin.

4. Use as defined in claim 1, wherein the oncogene or proto-oncogene product is of human origin and is rendered inactive with respect to its oncogenic activity, the inactivity resulting from a mutational alteration.

5. Use as defined in claim 1, wherein the oncogene product is encoded by the neu, ros, trk or kit gene or immunogenic portions thereof.

6. Use as defined in claim 1, wherein the oncogene or proto-oncogene product is a growth factor receptor molecule.

7. Use as defined in claim 1, wherein the receptor molecule is encoded by the c-erbB gene.

8. Use of a recombinant vaccinia virus capable of expressing in a host an oncogene or proto-oncogene product encoded by a gene of cellular origin to immunize an individual afflicted with a tumor which expresses the product, against the oncogene or proto-oncogene product.

9. Use of a recombinant pox virus capable of expressing in a host a cell-encoded tumor-associated antigen to immunize against the antigen an individual afflicted with a tumor which expresses the antigen.

10. Use as defined in claim 9, wherein the recombinant pox virus is a vaccinia virus.

11. Use as defined in claim 9, wherein the tumor-associated antigen is CEA, CA125 or a melanoma specific antigen.

12. A method of producing an oncogene or proto-oncogene product encoded by a gene of cellular origin, comprising the steps of:
a) infecting cells with a recombinant pox virus capable of expressing the oncogene or proto-oncogene product;
b) culturing the cells under conditions which allow the virus to replicate and to express the oncogene core proto-oncogene product; and c) isolating the oncogene or proto-oncogene product from the cells.

13 . A method of producing antibody against a cell-encoded tumor-associated antigens, comprising the steps of:

a) inoculating an animal with a recombinant pox virus capable of expressing the tumor-associated antigen; and b) isolating serum containing anitbody raised against the antigen.

14. A method of producing monoclonal antibody against a cell-encoded tumor-associated antigen, comprising the steps of:

a) immunizing an animal with a recombinant pox virus capable of expressing the tumor-associated antigen;
b) obtaining antibody-producing cells from the animal;

c) fusing the cells with an immortalizing cell to produce fused cell hybrids;

d) selecting fused cell hybrids which produce antibody against~ the antigen; and e) growing the selected fused cell hybrids and obtaining antibody secreted by the hybrids.

15. Use of a monoclonal antibody against a cell-encoded tumor-associated antigen produced by the method of claim 14 in tumor therapy, by passively immunizing an individual afflicted with a tumor by administering said antibody to said individual.

16. A vector for recombination with a pox virus and for incorporation of a DNA sequence encoding an oncogene or proto-oncogene product encoded by a gene of cellular origin, comprising:

a) a prokaryotic origin replication;
b) a pox viral promoter linked to;
c) a DNA sequence located downstream of the pox viral promoter, encoding a cellular oncogene or proto-oncogene product under the direction of the pox viral promoter;
and d) DNA sequence of pox virus flanking the promoter and the DNA sequence, the DNA
sequences being sufficiently homologous to a region of the pox viral genome so that the promoter and the DNA sequence are integrated into the viral genome at a site nonessential for replication of the virus, wherein the DNA sequence for the oncogene product is selected from the group consisting of the neu gene, the ros gene, the trk gene, the kit gene, the c-erbB gene, or immunogenic portions thereof.

17. The plasmid pEVAC-neu.

18. A vector for recombination with a pox virus and for incorporation of a DNA sequence encoding a cell-encoded tumor-associated antigen, comprising:
a) a prokaryotic origin replication;
b) a pox viral promoter linked to;
c) a DNA sequence located downstream of the pox viral promoter, encoding a cell-encoded tumor-associated antigen under the direction of the pox viral promoter;
and d) DNA sequences of pox virus flanking the promoter and the DNA sequence, the DNA
sequences being sufficiently homologous to a region of the pox viral genome so that the promoter and the DNA sequence are a integrated into the viral genome at a site nonessential for replication of the virus, wherein the DNA sequence encoding the cell-encoded tumor-associated antigen is selected from CEA, CA125 or a melanoma specific antigen.

19. A recombinant pox virus capable of expressing in a host an oncogene or proto-oncogene product encoded by a gene of cellular origin, wherein the oncogene or proto-oncogene product is a protein kinase.

20. A recombinant vaccina virus containing, in a region of the viral genome nonessential for replication of the virus, one or more foreign oncogene or proto-oncogene encoding DNA sequences of cellular origin which encode an oncogene or proto-oncogene product, the sequence or sequences being under control of a vaccinia promoter, wherein the oncogene or proto-oncogene product is a protein kinase.

21. Use according to claim 1, wherein the oncogene or proto-oncogene product is a protein kinase.

22. A vector for recombination with a pox virus and for incorporation of a DNA sequence encoding an oncogene or proto-oncogene product encoded by a gene of cellular origin, comprising:

a) a prokaryotic origin replication;

b) a pox viral promoter linked to;

c) a DNA sequence located downstream of the pox viral promoter, encoding a cellular oncogene or proto-oncogene product under the direction of the pox viral promoter;
and d) DNA sequences of pox virus flanking the promoter and the DNA sequence, the DNA
sequences being sufficiently homologous to a region of the pox viral genome so that the promoter and the DNA sequence are integrated into the viral genome at a site nonessential for replication of the virus, wherein the oncogene or proto-oncogene product is a protein kinase.

23. A nectar of claim 22, wherein the vector is a plasmid vector.

24. A vector of claim 23, wherein the pox viral promoter is a vaccinia promoter.

25. Use as defined in claim 1, wherein the oncogene or proto-oncogene product is an altered growth factor receptor molecule.