CA1284959C - Dna sequence useful for the production and secretion from yeast of peptides and proteins - Google Patents

Abstract

ABSTRACT OF THE DISCLOSURE:
This invention relates to a composition of matter, namely the nucleotide sequence of the DNA gene encoding yeast premelibiase and the amino acid sequence so contained in the premelibiase protein. This invention discloses the DNA sequence of the premelibiase gene, together with the amino acid sequence of the secreted melibiase and so defines the amino acid sequence of the pre-region, and the nucleotide sequence that encodes this sequence.
The pre-region of premeliblase can be used in engineering secretion, from genetically-modified yeast, of peptides and proteins other than melibiase, since fusions made between its nucleotide sequence and that coding for foreign peptides and proteins will ensure secretion of these foreign gene products in yeast, when contained in appropriate gene expression vehicles.
Also disclosed is the nucleotide sequence of the promoter region of the premelibiase gene, this sequence being regulatable by protein products of the genes GAL4 and GAL80.
The promoter region may be integrated into a vector construct along with a structural gene and optionally including the signal sequence defined above in order to obtain controllable expression of a protein in a transformed yeast host.

Description

49~9 This invention relates to recomi~inant DNA technology In particular, it relates to sequences of DNA which in one aspect function to DrOmOte expression of a gene and, in another aspect, function to signal secretion of the pro~ein coded by the expressed gene. Such sequences are valuable in manipulating yeast cells.

Secretion, a process by which particular ~roducts of gene expression are exported from the cell to the culture medium, is a natural property of living cells. For cells that have been genetically modified to express foreign peptides and proteins, the feature of secretion o these products is desirable since the products are produced in a partially purified and readily accessible state by virtue of their extracellular location.
Protein and polypeptides produced in cells are destined either to remain within the cell or to be secreted from it. The mechanism by which the destinies of these two categorically different types of proteins is determined has been i experimentally shown to reside in a functional "signal" peptide coded for by a nucleotide sequence i.e. a signal sequence which in almost all known cases Precedes the actual sequence of the gene coding for the Protein to be secreted. According to the , ~,~

~34~
evidence, immature Proteins translated from the complementary nucleotide sequence and bound for secretion initially bear a precursorial sequence of amino acids or "siqn31" which is recognized by receptors on the membraneous secretory pathway within the cell thereby permitting the immature Protein to pass into the secretory pathway. Once so engulfed, the siqnal sequence of the Precursor protein is proteolytically cleaved to provide the active protein which may be released from the cell, after subsequent modification of its structure, e.g.
qlycosylation.
By deciphering and utilizinq such specific signal sequences it is possible to genetically engineer cells capable of producinq protein for routine secretion from the cell.
Typically, retrieval of protein from genetically enqineered cells has required lysis of the engineered cells and purification of the desired protein, since the vector does not contain the appropriate nucleotide sequence to confer secretory properties to the proteins translated from the~sequence. This process results in destruction of the cell whereas, according to one aspect of the present invention as described below, the cell may be sustained in a viable condition by supplying sufficient growth medium while continuing to secrete the desired protein.
Moreover, the protein may be extracted directly from the nutrient broth within which the enqineered cells are incubated, on a continuous basis accordinq to known chemical procedures.
As described, secretion of products expressed in yeast from qenetically-modified expression vehicles is, in principle, ~,~

4~3~9 assured ~y providing the forei~n qene inserted in the vehicle with a nucleotide sequence encoding ~ signal peptide aPprOpriate to yeast. This signal peptide should be contiquous with, and at the N-terminal end of the peptide compcisi~nq the qene pcoduct of interest.
Expression p se of foreign peptides and DrOteinS in qenetically engineered yeasts, without secretion of the molecules so expressed, has been attemPted on many occasions.
In some cases these qenes are expressed in the yeasts, but often they are not, or at least not at required levels. In order that a particular foreign qene be expressed, certain of its features must be changed. This may be done by fusinq part of a natural gene of the organism to part of the foreign gene, thus reducing the differences be~ween the unexpressed foreign gene and the expressed natural gene.
One of the most common features to be changed is the reqion upstream of the coding sequence of the gene. This region typically includes sequences necessary for the initiation of transcription, as well as sequences which enhance and/or repress i.e. requlate, the level of transcription, often in combination with particular proteins present in the cell, together with other sequences which affect the transcription and translation of the gene. This region is commonly called the 'promoter', althouqh as stated it includes more than the sequence which is strictly defined as that region which promotes tcanscription.
When it is desired that the product of a given foreign gene be secreted from yeast, another feature which is commonly ; .

added or replaced is the signal or leader sequence. This signal sequence is a short polypeptide stretch which is typically encoded in a sequence at the beginning of the translated portion of the gene.
Thus, when it is desired that the product of a given foreign gene be expressed and secreted from yeast, the promoter and/o{ signal sequence as described above may be added, or used to replace analogous foreign sequences with sequences which are functional in yeast.
An attempt to obtain secretion in yeast of foreign proteins without the use of yeast signal peptides was described by Hitzeman et al (1). The proteins of interestr human interferons, carried, in their genes, their own siqnal sequences app~opriate to secretion in human cells; when expressed in yeast, the interferons were expressed efficiently but secreted poorly. Recent reports have examined the utility of using yeast -signal peptides to obtain secretion of foreign gene products from yeast. Emr et al (2) made gene fusions between nucleotide sequences coding for the leader region of the secreted yeast peptide, alpha factor, and nucleotide sequences coding for invertase, a yeast protein normally secreted into the periplasmic space, i.e. the region between the yeast cell membrane and cell wall. While this resulted in invertase secretion to the periplasmic space, it is not clear that this was due to the alpha factor leader, since the invertase qene in the fusion included a segment of the invertase signal peptide sequence. Indeed, since alpha factor is secreted into the _ 5 _ , ~ 2~349~!~

~edium, and invertase into the periPlasm, the localisation of invertase in the experiments of Emr et al may be due to the invertase component of the qene fusion. Brake et al (3) constructed gene fusions between the alpha factor leader reqion and a synthetic DNA sequence encodinq human epidermal qrowth factor (EGF) and found that this fusion resulted in efficient secretion from yeast of mature EGF, provided a limited region of the sequence of the alpha factor leader-coding region was altered, by in vitro mutagenesis. Bitter et al (4) constructed fusions between the alpha factor leader region and each of the proteins ~-endorphin and a "consensus" human interferon; they found secretion of these foreiqn proteins but also some deyradation due to proteolysis during the secretion events.
However, in the case of interferon, at least 95~ of the secreted i protein was recovered intact from yeast culture fluids. It seems clear that, at least in the case of alpha factor, yeast secretion siqnals contain information that facilitates secretion from yeast of foreiqn peptides and proteins, albeit peptides and proteins that are secretory gene products in their natural hosts.
Melibiase, or ~-galactosidase (E.C. 3.2.1.22), a product of the growth of the yeast S. carlsberqensis (S.
uvarum), and of a few strains of the yeast S. cerevisiae, is a naturally secreted protein. A D~A fragment obtained from one of these strains by cloning into a yeast plasmid, has been shown by Post-Beittenmiller et al ~S) to confer the melibias~ positive phenotype on otherwise melibiase-neqative yeast, following introduction into the cells by transformation.

.~

~ ~ ~ 4 9~J~

It is an object of the Present invention to provide the amino-acid sequence of the precursor premelibiase and the ~re-reqion thereof, and the nucleotide sequence encoding each of these entities and to Provide a vector construct containinq the nucleotide sequence codinq for the Pre-reqiOn.
It is a further object of the present invention to provide processes wherein signal sequences capable of signalling secretion of melibiase may be combined with other genes or gene parts and introduced via cloning vectors into yeast cell hosts for secretion of proteins therefrom by means of such qenes or gene Parts.
It is a further object of the present invention to provide a regulatable promoter region which is capable of promotinq transcription of the ~NA reqion coding for the protein melibiase gene native to Saccharomyces carlsberqensis.
It is a further object of the present invention to provide processes wherein the promoter regions described above may be combined with a siqnal sequence and a polypeptide coding region via cloninq vectors and introduced into yeast cell hosts to obtain secretion of the polypeptide encoded by the codin~
reqion.
Thus, the present invention provides in a first aspect, the signal sequence of the melibiase gene native to yeast, Preferably derived from Saccharomyces carlsberqensis.

1~849~9 In a second aspect, the present invention provides the regulatable promoter reqion of the premelibiase gene native to yeast, Preferably derived from Saccharomyces carlsberqensis or a synthetic or semi-synthetic equivalent thereof.
In a third aspect, there is provided a coding region which codes for premelibiase and melibiase native to yeast, preferably derived from Saccharo~yces carlsberqensis.
In a fourth aspect, there are provided vector constructs comprisina at least one of the promoter reqion and the signal sequence for use in transforming a host yeast cell.
In its Preferred form, both the promoter region and the signal sequence are integrated on the vector construct and operatively associated with a codinq region either native or foreign to the host yeast cell to be transformed. Further, where each of the promoter region, signal sequence and coding region originate in the premelibiase region native to S. carlsberqensis the vector construct so formed is used to transform a foreign host.

BRIEF REFERENCE TO THE DRAWqNGS
FIGURE 1 represents the nucleotide sequence of a portion of Plasmid pMPS50 from Hind III to the first Bam HI
site, including the 5' flank of the premelibiase gene including the promoter, the premelibiase ~ene sequence, showing in the lower line the amino-acid sequence of pre-melibiase and in the upper line the corresponding nucleotide sequence, and extending into the 3' untranslated sequence to the first Bam HI
restriction site;

1~49~ 3 ~ IGURE 2 represents schematically a section of DNA
seqment shown in Figure l;
FIGURE 2a provides the nucleotide sequence of the natural melibiase secretion signal represented in Figure 2;
FIGURE 2b provides the nucleotide sequence of a modified melibiase secretion signal in which the natural sequence depicted in Figure 2a is coupled with a synthetic linker sequence;
FIGURE 3 illustrates, via plasmid maps, a scheme for creating plasmid p4;
FIGURE 4 illustrates, via plasmid maps, a scheme for creating plasmid p5;
FIGURE 4a provides the nucleotide sequence of a segment of plasmid p5 shown in Fiqure 4; and FIGURE 5 illustrates, via plasmid maps, a scheme for creating each of plasmids p6 and p7.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The signal sequence preferred herein acts as the signal sequence for melibiase secretion and is obtained from S.
carlsber9ensis by methods described hereinafter. The particular amino acid sequence coded by the signal sequence is reproduced below:

met-phe-ala-phe-tyr-phe-leu-thr-ala-cys-ile-ser-leu-lys-qly-val-phe-qly .!

1~849~ 19 Analoqously, an exampl~ of the nucle~tide sequence correspondi~q to the above amino acid sequence is reproduced helow:

5' ATG TTT GCT TTC TAC TTT CTC ACC GCA TGC ATC
AGT TTC AAG GGC GTT TTT GGG 3' The first six nucleotides 3' of refecence numeral 30 shown in Figure 1 represent a ~ind III site on pMP550.
Reference numeral 25 identifies the first Bam HI site downstream of Hind III site _ . Within this 5' Hind III - ~am HI 3' reqion are located the Promoter reqion and siqnal sequence of the melibiase qene as well as the melibiase coding region. The entire, separated and isolated amino acid sequence of the premelibiase coding redion is shown in the lower lines starting at reference numeral 10 and endinq at reference numeral 12. The corresponding nucleotide sequence is shown in the lines above this Particular amino acid sequence. In Fiq. 1, a represents adenine nucleotide, t represents thymine nucleotide, g rePresents ~uanine nucleotide and c represents cytosine nucleotide. The amino-acid corresponding to each codon has been entered using the normal triplet abbreviations therefor. The structural gene for premelibiase is the sequence starting at reference numeral 10 with the atg codon equivalent to the initial methionine of premelibiase and ends with the tct codon at reference numeral 12 equivalent to serine, and immediately precedinq the tqa translation-stop sequence. This sequence -;~

1~349.~9 consists of 1,413 nucleotides as shown in Fi~ure 1. Before reference numeral 10 and beyond reference numeral 12, translation of amino acids does not occur, and the sinqle row represents a nucleotide sequence. In theinaturally occurring material, atq starting codon 16 is preceded by a promoter DNA
sequence (included in the sequence between reference numerals 20 and 10) to which reference is made hereinafter. The nucleotide sequence, contained within that for premelibiase, which encodes secreted melibiase, is that sequence illustrated in Fiq. 1 commencing at reference numeral 14 with the codon gtg, equivalent to valine at the N-terminus of the secreted melibiase, and continuing to the end 12 with the tct codon, equivalent to serine. This sequence is 1,359 nucleotides in length. The entire protein illustrated in Fig. 1 has a molecular weiqht of 52,101 (between reference numerals 10 - 12).
The nucleotide sequence from reference numerals 10-14 indicated on Fiq. 1 encodes the Pre-region, or signal peptide, of premelibiase. This sequence starts with the atg codon equivalent to the initial methionine 16 of premelibiase at reference numeral 10, and ends with the g~g codon at reference numeral 14, equivalent to the qlycine residue 18 adjacent to the start of the secreted melibiase. This sequence consists of 54 nucleotides.
This signal sequence for melibiase has been found to have an unexpectedly large ability to direct the secretion from yeast cells of gene products coded by regions associated with the MEL sequence. Whilst it is not intended that ~he invention ~49 ~.'3 should in any way be li~ited or bound by any particular theocy or mode of operation, it is postulated that the MEL signal has some ability to direct gene products produced under its influence intc superior secretion pathways or via other modes of efficient operation.
Preferred promoters which are useful either in connection with the signal sequence described above or independently thereof are those which are capable of promoting transcription, in a regulatable fashion, of the premelibiase gene native to S. carlsberqensis. Preferably, the promoter region is identified in and derived from this yeast according to procedures described herein although it may be synthesized to provide a nucleotide sequence analogous to the naturally occuering one.
Selection of this particular promoter as one component in a vector construct provides distinct advantages. The premelibiase promoter region regulates transcciption in response to certain proteins, includin~ the products of the GAL4 and GAL80 genes. Specifically an increase in the level of expression of the GAL4 gene within the host containing the promoter region has been demonstrated to enhance the level of expression of a structural gene over which the promoter exerts its transcription-promoting function. Also, it has been demonstrated that where normal GAL80 product production within the host containing the promoter region is disrupted, expression of genes associated with the proMoter region is enhanced and further that expression of such genes is no longer dependent on 1~49~rj9 the presence of galactose in the medium as is the case in the presence of the GAL80 protein.
The promoter sequence is shcwn in Figure 1, between reference numerals 20 and 10.
With the knowledge of the full and complete sequences of the signal sequence and the promoter region, respectively of the melibiase gene, these sequences can either be identified and isolated from yeast cells, in whole or in part, and/or produced by synthetic methods.
Then, the promoter region, for example, may be integrated into a vector and operatively linked either with a polypeptide coding region ~er se, where only expression is desired or with a signal sequence for secretion which in turn is operatively linked to and in the same reading frame as a coding region which encodes a desired protein. In this latter construct, the signal sequence is preferably as particularly described herein.
Examples of host yeasts in which this process may be used include S. carlsber~ensis, S. cerevisiae, SaccharomycoPsis liPolYtica ~also known as Candida lipolytica or Yarrowia lipolytica) etc. It will be understood that S. carlsbergensis is also known as S. uvarum.
Examples of genes useful in the constructs according to the invention are genes fore~ign to the aforementioned yeasts, include human, animal and bacterial genes, such as those for human proteins and peptides such as interferons, insulins, hormones, growth factors, enzymes etc., bacterial and fungal . .

~ .Z~4~359 Proteins such as cellulases etc., plant proteins, etc., peptide ~lavors and enhancers, antiqens, etc.
Suitable expression vehicles or plasmids for introducinq the constructs of the invention are those which contain genes or portions thereof appropriate to their maintenance and selection in the chosen host yeast and in E.
coli, and yeast sequences appropriate to expression in the inserted foreign sequence, namely a strong yeast promoter, to ensure efficient transcription of the inserted nucleotide sequence, and a yeast sequence downstream of the insert to ensure adequate transcription termination. Specific examples of such vehicles are known and commercially available -- see for example reference (6) listed herein. In addition, yeast sequences appropriate to the exPression of the product, other than the promoter and signal sequence described here, may include a transcription terminator etc. as well as such modifications as are required to create the desired construct in a functional form.
The techniques for preparing and replicating the appropriate vector plasmids, and introducing them into the host yeast cells, are known and are within the general skill of the art in this field.
Embodiments of the invention are further described in the following specific examples.

~, 49~';9 Exal~Dle 1 - Nucleotide sequencinq of promoter reqion, signal -sequence, coding re~ion and flanking regions of melibiase and _remelibiase As shown by Post-Beittenmiller et al (5), plasmid p~550, which is plasmid Yep24 (7 and 26) containing an additional fraqment of yeast DNA, confers the melibiase-Positive phenotype on otherwise melibiase-neqative yeast when introduced into them by transformation, implying that the DNA insert contained in pMP550, an approximately 2.9 kilobase EcoRI to Bam HI fraqment from a melibiase - Positive yeast, contains the structural gene for premelibiase. Plasmid pMP550, obtained from J.E. HoPper of Pennsylvania State University, was prepared for sequencing of the DNA insert as follows: two ~ug pMP550, and 0.2 ,ug of the replicative form ~RF) of phage M13 mpl8 (Norrander et al, 8) were each digested with EcoRI and Bam HI
(New Enqland Biolabs) and electrophoresed in 1 percent w/v low meltinq-point agarose. Gel slices containing the approximately 2.9 kilobase pMP550 fraqment and the aPproximately 7.2 kilobase M13mpl8 fragment were melted at 65C to release the DNA, and a few ~1 of each mixed together and ligated at 12C for 3h in 70mM Tris. HCl buffer (pH 7.5), 7mM MqC12, 70~uM ATP, and 0.9 units T4 DNA ligase, in 20 ~ul. The ligated DNA was used to transform ~. coli strain JM109 ~9) which had been made competent by the method of Hanahan (10). Six of the plaques which appeared from the transformation were selected and the D~A

~ ,~

~2a49~

isolate~ an~ check~d for the presence of the p~550 DNA
fraqment. All were of the appcopriate structure; one was selected for sequencinq, which was done as follows: RF DNA was prepared from E. coli JM 109 transfected ~ith the selected phaqe. and 20 ~q diqested to completion with Eco RI and Pst I
tNew En~land Biolabs), ethanol precipitated, and dissolved in 66mM Tris HCl buffer tpH 8.0) containinq 0.66mM Mq C12.
Following exactly the method o~ Henikoff (11), the DNA was diqested with exonuclease III (PL-Pharmacia) and, at intervals, samples removed and treated with nuclease Sl (BRL) E. coli DNA
polymerase I (Klenow fraqment) (Boehrinqer Mannheim), and T4 DNA
liqase (Boehrin~er Mannheim), to qenerate a series of circular DI~A molecules with a decreasinq size of the pMP550 insert sequence adjoined to the M13mpl8 sequence. Following recovery of the liqated DNA's by transfection of _. coli JM 109, and an electrophoretic analysis of the size of the pMP550 DNA remaining in each, sinqle-stranded DNA was prepared from selected phage and sequenced by the dideoxy technique (12), as detailed in the BRL manual (13). ~he sequences obtained were combined using the proqram described by Larson and Messing (14), and further analysed usinq the proqrams of Devereux et al (15). Two thousand eiqht hundred and sixty-four nucleotides comprising the entire Eco RI to Bam HI fragment initially obtained from pMP550, were sequenced. Figure 1 shows this sequence, extending from the comPlete Eco RI site 28 through to the complete Bam HI site 25. Fiqure 1 also shows the predicted amino acid sequence of premelibiase, by translation of the lonq open reading frame.

4~3~'3 The calculated molecul~r weight of Premelibiase, from the nucleotide sequence, is 52,101. Based on the known N-terminal a~inn acid sequence of secreted meli~iase (see ExamPle 2), the amino acids from methionine r~presented by reference numeral 16, to glyci~e represented by the reference numeral 18 comprise the melibia~e siqnal peptide. Therefore, the calculated molecular wt. of secreted meli~iase is 50,104. This agrees well with the molecular weight of melibiase that was purified from culture supernatants of yeast transformed with plasmid pMP550 (Example 3) and deqlycosylated, i.e. approximately 50,000.
The sequence of the remainder of the S. carlsbergensis flank was determined as follows: two ~g pMP550 and 2 ~g of M13mpl8 were ~ach digested with XmaI and SphI (New En~land Biolabs) and electrophoresed in 0.8 percent w/v low meltinq-point aqarose. Gel slices containing the approximately 1.8 kilobase PMP550 fragment and the approximately 7.2 kilobase M13mD18 fragment were melted and a few ~1 of each mixed, ligated and used to transform JM109 essentially as described above. One plaque was selected for further work after verification of the presence of the required insert.
A series of deletion clones were made extending through the insert essentially according to the method of Dale et al (1985J. Briefly, 5 ~g of single-stranded DNA were hybridized with a primer (~D29), and then digested with Hind III overnight at 50C. The 3' end of the sinqle-stranded DNA was deleted to varying degrees with T4 DNA polymerase (New England Biolabs), tailed with terminal transferase (IBI) and dATP (Sigma), ~$~4~3 ,'3 annealed to RD29 primer and ligated. Follcwing transfection cf JM109, and an electrophoretic analysis of the size of the pMP550 DNA remaining in each of several phage clones, single-stranded DNA was prepared and sequenced as described above. A further nine-hundred and twenty-nine nucleotides of seguence from pMP550 were determined by this method. The two methods therefore yielded the complete sequence of the S. carlsbergensis-derived DNA in pMP550.

ExamPle 2 - Amino Acid Sequencing of Melibiase .1 Purification of Melibiase 2.1.1 Preparation cf a Yeast that Secretes Melibiase .
Plasmid pMP550 W2S introduced into the melibiase-negative yeast strain S. cerevisiae 284 (o~,leu 2-3, leu 2-112, ura 3-52, ade 1, mel), supplied by J. E. Hopper, Pennsylvania State University, by transformation, according to the method described by Ito et al (16). The transformed cells were spread onto agar plates that select for the growth of cells independent of exogenous uracil and incubated for 2-3 days at 30C. Composition per litre of this medium, designated selective medium I, was: glucose, 209; agar, 179; yeast nitrogen base without amino acids, 6.7g; succinic acid, 5.8g;

dipotassium hydrogen phosphate, 8.7g, adenine, arginine, histidine, isoleucine, leucine, methionine, tryptophan and lX~3~9~9 tyrosine, 0.029 each, lysine, 0.03g; phenylalanine, 0.059;
threonine, 0.10q and valine, 0.15~; pH was 4.6-4.8. Colonies that ap~eared on selective medium I were transferred to fresh selective medium I, allowed to grow at 30C, then transferred to aqar Plates containinq selective medium II, that i5 selective medium I with 20q/L lactic acid, 30q/L ~lycerol, and 20q/L
galactose, in the Place of 20g/L glucose. This was to allow induction by ~alactose of melibiase synthesis (5). The colonies were then used to inoculate liquid medium consisting of selective medium II without agar. Following cell growth at 30C, the cultures were assayed for secreted melibiase by the following procedure: 500 ~ul culture was centrifuged to pellet the cells, then 10 ~ul of the supernatant fluid added to 190 ~1 pH 4 buffer (30mM citric acid, 38mM dibasic sodium phosphate) containinq 12.5mM p-nitrophenyl o~-D-galactoside (p-NPG; Sigma Chemical Co.). After 10 min at 30C, 800 ~ul 0.1 M sodium carbonate was added and the yellow color measured spectrophotometrically at 407 nm. All uracil-independent transformants tested produced secreted melibiase, while S.
cerevisiae strain 284 itself produced no secreted melibiase.
One transformant, desiqnated pMP550.Sc284.1, was selected for melibiase purification.

2.1.2 - Purification of Melibiase Ten litres of selective medium II without aqar was inoculated with yeast transformant pMP550.5c284.1 and incubated 1~4'3~
at 30C with shaking until a maximum oPtical density at 660 nm had been reached. The culture was centrifuged at 3000xg, to reln~ve the cells, and the supernatant liquid concentrated to l00 ml in an Amicon ultrafiltration unit fitted with a PM-10 membrane. The concentrate was clarified by centrif~gation at 40,000xg for 30 min. then freeze-dried. The material was then dissolved in 25 ml of 50mM Tris. HCl buffer (pH 7.5) (buffer) and dialysed against buffer (3 changes at 2.5 litres per chanqe). The material was filtered throuqh a 0.45 micron membrane, to qive a solution containin~ 16.6 mg protein and 3534 units of melihiase ~17~. Melibiase activity was then separated from the bulk of other proteins on a Pharmacia FPLC system fittea with a Mono Q anion exchange column (HR5/5). The melibiase, which remained bound in the column, was eluted by application of a linear sodium chloride gradient, 125 to 245 mM
in buffer. One ml fractions were collected, assayed, and the active fractions pooled; 7.61 mg Protein was recovered, containing 3437 units of melibiase. The material was lyophilized, dissolved in 6.8 ml buffer, and chromatographed, in 2 aliquots, on a Biogel A-1.5M column (1.5 x 90.0 cm).
Fractions containinq the highest melibiase activity were pooled and contained 3.8 mg protein and 2302 units of melibiase. When electrophoresed in an SDS-polyacrylamide gel accordin~ to Laemmli (18) this material contained 2 bands, representing 98%
of the Protein. One band was diffuse, encomPassing the size ran~e 75 to 100 kdaltons, midpoint 82 kdaltons, the second sharp and with a calculated molecular weiqht of 70 kdaltons. In order 1~&49 ,9 to determine the molecl~lar weiqht of the melibiase polypeptide chain, and to determine if it was pure, covalently-linked carhohydrate, known to be Part of the melibiase secreted from S.
carlsberaensis (Lazo et al, 19; Lazo et al, 20) was enzymatically removed from the sample with endo-B-N-acetylglucosaminidase H (endo H) from Streptomyces griseus, as follows; 40 ~9 of protein was incubated with 5 milliunits of endo H (Boehringer Mannheim Canada) at 37C for 25h in a 40 ~1 reaction containinq 0.05 M citric acid and 0.1 M
disodium hydrogen phosphate. The sample was lyophilized then analysed by SDS-Polyacrylamide gel electrophoresis. A sinqle protein band, with a calculated molecular weiqht of S0 kdaltons, was observed.

2.2. Amino Acid Sequerlcinq Pure melibiase, without endo H treatment to remove carbohydrate side-chains, was subjected to an analysis of the first 10 N-terminal amino acid residues, by derivatisation with phenylthiohydantoin. The sequence, determined by the amino acid sequencing facility in the Department of Biochemistry, University of Toronto, was:
qly l or N-terminus ~ ala- X-pro-ser-tyr-asn-qly-leu-qly-leu ¦ or \ val f34~3~9 The reason ~r the ambiauity at the first 2 residues is not understood. Nevertheless, the identity of the sequence of the remaining 8 residues with those predicted by the nucleotide sequencing of the DNA insert in plasmid pMP550 (Figure 1) leads to the conclusion that the amino acid sequence of secreted melibiase, starting at the N-terminus, is as follows:

val-ser-pro-ser-tyr-asn-gly-leu-qly-leu---2.3 Structure of the Melibiase Siqnal Seauence .. . . _ .

Based on the amino acid sequence of the N-terminus of secreted melibiase, and the amino acid sequence predicted by the - nucleotide sequencinq for premelibiase, the melibiase signal sequence, starting at the N-terminus, is defined as.follows:

met-phe-ala-phe-tyr-phe-leu-thr-ala-cys-ile-ser-leu-lys-qly-val-phe-gly Example 3 - Use of an expression cassette containinq the roduction from Saccharomyces cerevisiae of a novel extracellular protein 3.1 Construction of the cassette The eXPression cassette is illustrated schematically in ~' .

1~4'3~9 Figure 2. Its essential element are (i) flanking restriction sites, in this example Bam HI, which allow for its ready insertion into appropriate E. coli/S. cerevisiae shuttle vectors; (ii) the DNA sequences for the melibiase promoter 32 (which include upstream activation sequences) and signal peptide 36 in a form such that a coding sequence other than that for melibiase (shown as 38) can be placed in operative association with them. In this example, this is accomplished by creating a Bgl II site adjacent to the sequence encoding the melibiase signal peptide. This allows a gene fusion to be made between the codons that specify the signal peptide and those that specify the novel protein. The operative association then is promoter: signal peptide codons: novel protein codons. The segment designated 34 in Figure 2 includes additional sequences such as those specifying transcription, termination, cleavage and polyadenylation. The expression cassette was constructed as described below and as shown in Figure 3 to which reference is now made, using conventional recombinant DNA techniques.
Plasmid pMP550 (Figure 3) is plasmid pBR322 (Bolivar et al; 22) containing a 4.3 kilobase DNA fragment 40 which includes the melibiase gene and its flanking DNA sequences (Post.
Beittenmiller et al; ~, and Sumner-Smith et al;23). The nucleotide sequence of fragment 40 is specified in Figure 1, as bounded by the Hind III site _ and Bam HI site 25. It should be noted that the first 346 nucleotides (reference numerals 30 to 20 in Figure 1) are derived from plasmid pB~322. This is because of the cloning strategy used, and is incidental to the _, _ 2~3495~

f~nction of the expression cassette derived from the 4.3 ~ilobase DNA fragment. Plasmid pMP550 was restricted with Hind III and Bam HI and the 4.3 kilobase fragment 40 cloned intc the plasmid pUC8 (Vieira and Messing; 24) between its Hind III and Bam HI sites. The resulting plasmid, pl, was restricted with Hind III, the DNA ends repaired by filling-in using the Klenow fragment of E. coli DNA polymerase I, and ligated, by the method of Lathe et al (25), to a synthetic oligonucleotide 42 of the sequence 5' CCGGATCCGG 3'.
3' GGCCTAGGCC 5' The product of this ligation, plasmid p2, consisted of pUC8 containing the 4.3 kilobase fragment 40 from pMP550 now bounded by Bam HI sites. Plasmid p2 was restricted with SphI which cuts uniguely within the DNA sequence that encodes the melibiase signal peptide. The linearized plasmid was then ligated to a synthetic oligonucleotide 42 of the sequence 5' CATCAGTTTGAAGGGCGTTTTTGGGAAGATCTCTGCATG 3' 3' GTACGTAGTCAAACTTCCCGCAAAAACCCTTCTAGAGAC 5' by the method of Lathe et al (25). Recombinant plasmids were sequenced across the position of the inserted oligonucleotide and plasmid p3, which contained the oligonucleotide in the orientation shown in Figure 2, was selected. Plasmid p3 was then restricted with Bam HI and the 4.3 kb fragment cloned into the Bam HI site of the shuttle plasmid Yep 24(26), generating plasmid p4. Plasmid p4 contains the 4.3 kilobase fragment originally from pMP550 but the DNA sequence encoding the melibiase signal peptide was now modified, as specified in Figure 2. The 4.3 kilobase Bam HI fragment 40 in p4 (Figure 3) constitutes the expression cassette which is an example of a preferred embodiment of the present invention.

1~49~r;9 3.2 Use of the expression cassette to enqineer production of a novel extracellular protein in yeast cultur~

A DNA sequence known to encode a celluase ( an endoqlucanase or endo-l, 4-~-D-qlucanase, EC 3.2.1.4) in the soil bacterium Cellulomonas fimi ATCC 484 was used to demonstrate the utility of the expression cassette in Saccharomyces cerevisiae. As depicted in Fi~ure 4, the endoqlucanase codinq sequence is contained,in a 2.4 kilobase Bam HI fraqment 46 from the plasmid pEC2.2 (Fiqure 4; Skipper et al;
27) provided by Dr. Robert C. Miller, University of British Columbia. The coding sequence is known to be missing the codons for the first 76 amino-terminal amino acids of the bacterial protein, including the 31 amino acid bacterial signal peptide (28). Previous experiments had shown that Saccharomyces cerevislae cells transformed with a plasmid containing the 2.4 kilobase Bam HI fraqment from pEC2.2 in an operative association with the yeast alcohol dehydroqenase 1 promoter produced a very low level of extracellular endoglucanase activity (Skipper et al; 27). The addition of an operative signal peptide provided by codons specifying the amino terminus of the yeast preprotoxin protein resulted in a greatly enhanced level of extracellular endoqlucanase activity (Skipper et al; 27).
The 2.4 kilobase Bam HI fragment 46 from pEC2.2 was inserted into Plasmid p4 (Fiqure 4) by cohesive-end ligation at the Bql II site of this plasmid. Recombinant plasmids containinq the endoqlucanase insert were restricted with Bql II, ~ ) ~849~9 to identify those containinq the insert in the appropriate orientation, and several of those sequenced across the melibiase/endoglucanase junction to identify those containing the predicted gene fusion. One of these plasmids, p5, was selected for further analysis. It contained the endoglucanase coding sequence fused to the sequence encoding the melibiase signal peptide, in the correct translational reading frame (see Figure 4a). One additional codon (AAG, lysine) was present between the terminal codon (GGG, qlycine) of the melibiase signal peptide and the 77th codon (ATC, isoleucine) of endoqlucanase, as expected from the construction (Figure 5).
The 6.7 kilobase Bam HI fragment 48 in p5, containing 4.3 kilobases of the expression cassette and the 2.4 kilobase endoglucanase coding sequence, comprised the operative melibiase:endoglucanase gene fusion, as shown in Figure 4a.
Plasmid p5 is Yep24 containing the melibiase:
endoglucanase gene fusion. Since Yep24 carries the URA3 gene, it can be used to transform ura3 yeast strains to uracil-independence. To extend the range of recipient Saccharomyces cerevisiae strains for assessment of endoglucanase expression from the melibiase elements the 6.7 kilobase Bam HI
fragment 48 from p5 was cloned into each of 2 further shuttle vectors, Yep21 and Yep 24.TRPl ARS, generating plasmids p6 and p7, respectively (Figure 5). Plasmid Yep21 ~26) carries the yeast LEU2 gene for transformation of leu2 strains to leucine-independence. Plasmid Yep24.TRPl ARS was constructed from plasmids Yep24 (26) and Yrp7 (26), as illustrated in Figure ~849~rj9 5. It is useful for transferring trpl yeast to tryptophan-independence, and ura3 yeast to uracil-independence.
To test for endoglucanase expression in yeast, Saccharo~yces cerevisiae strain 20B12 (C~, trPl, PeP4.3; Jones, 29) was transformed with plasmid p7 to tryptophan-independence and assayed for extracellular endoglucanase activity. Two assays were used: a qualitative assay based on the direct staining of agar plates (containing the substrate carboxymethylcellulose) on which the transfoemants had been grown, and a qualitative assay based on measurement of carboxymethylcellulose hydrolysis to reducing-sugar equivalents. In the plate assay, transformants were grown at 30~C on agar plates ccntaining *C tryptophan medium (30), 1.2 percent agar, 0.9 percent carboxymethylcellulose (high viscocity, Sigma Chemical Co.), 2 percent glucose, and 50 mM
sodium pbosphate buffer; final pH was 6.8 to 7Ø The yeast colonies were washed off with water, then the plates were stained with Congo Red (2 mg/ml) for a few minutes and then rinsed with lM sodium chloride. Under these conditions, endoglucanase activity is indicated by a colourless zone, since ~-1,4 glucans of seven or fewer glucose residues do not bind Congo ~ed (Wood, 31). All transformants produced extracellular endoglucanase by this assay. In the quantitative assay, transformants were grown in *tryptophan medium containing 2 percent g~ucose and 50mM sodium phosphate; (pH 6.8 to 7.0). The cultures were centrifuged to removed the cells, the supernatant fluids dialysed against water, and t~e dialysates lyophilized to ~ ~4~3~r;9 dryness. Following reconstitution in water the sa~ples wer~
assayed for prod~ction of reducing-sugar equivalent from caro~ymethylcellulose (low viscocity, Siqma Chemical Go.) by the method of Miller et al (32), as described by SkiPper et al (27) . All transformants produced extracellular endoglucanase by this assay. A typical transformant produced 6.4 units endoqlucanase ~er ml culture, or 2.32 units oer 108 cells, where 1 unit produces 1 ~mole reducinq sugar per minute at 37C.

Example 4 - Use of different confiqurations of yeast chromosomal qenes to effect altered re~ulation of the expression of a novel protein from the expression cassette In common with the galactose pathway genes GALl, GAL2, GAL7, and GAL10 expression of the MEL-l (melibiase) gene is induced by galactose and repressed by glucose. This control by the carbon source appears to be mediated by the Droducts of the GAL4 and GAL80 genes. GAL4 produces a product which is required for transcriPtion of all the genes. The action of GAL4 is inhibited by the GAL80 product, which is thought to bind to it or to its site of action on the DNA in the absence of qalactose. In the presence of galactose the binding of ~AL80 product is prevented and all the qenes are turned on. The site of bindinq of the GAL4 product is in the 5'-flanking region of each target gene, a reqion call UAS or upstream activation sequence tsee Sumner-Smith et al; 2~, for brief review).

, jr 12849~,9 Manipulations of the GAL4 and GAL80 genes are therefore expected to modify the regulation of expression of proteins dependent on the melibiase promoter, of which extracellular endoglucanase is used as an example here.
Three Saccharomyces cerevisiae strains: Sc284, Sc295 and Sc300 (Table 1) were used to examine the effects of GAL4 and GAL80 modifications on endoglucanase production from plasmids containing the operative melibiase: endoglucanase fusion described above. These strains were provided by Dr. J.E.
Hopper, Pennsylvania State University. Strain Sc284 (leu 2-3, leu 2-112, ura 3-52, ade 1, mel) is wild type with respect to GAL4 and GAL80. Strain Sc295 (ura 3-5~, ade 1, gal80-deletion) lacks the GAL80 gene, 60 that galactose is unnecessary for full expression of the melibiase promoter. Strain Sc300 (leu 2-3, leu 2-112, ade 1, qal80-deletion, ~all-gal7-gallO-deletion, ADHl:GAL4) lacks GAL80 and in addition h s 2 modifications intended to increase the availability of the GAL4 protein to the melibiase promoter. First, the GALl, GAL7 and GAL10 gene cluster is deleted. Second, an additional copy of the GAL4 gene is present, expressed from the strong promoter of the yeast alcohol dehydrogenase 1 gene; this is estimated to increase the ~ynthesis of GAL4 protein by a factor of 150 over cells containing the normal single chromosomal GAL4 gene. The phenotype of strain Sc300 with respect to melibiase promoter function is not known in any detail, but it could be reasonably predicted to be both constitutive promoter function, due to the GAL80 deletion, and an elevated maximal function, due to the 1~:849~9 increased availability of GAL4 product.
The 3 yeast strains were each transformed with an operative expression cassette/endoglucanase gene fusion, contained in an E. coli/S. cerevisiae shuttle vector appropriate to the selection of transformants (Table 1). Transformants were then grown in liquid media containing carbon sources either non-inducing, inducing or repressing for the melibase promoter in a normal GAL4, GAL80 strain, then assayed for extracellular endoglucanase activity. The results are illustrated in Table 1 and discussed below:
1. Transformant 113.1 ~strain Sc284). The absolute amount of extracellular enBoglucanase produced by this transformant was low, making it difficult to assess the regulatory effect of the various combinations of carbon sources with any accuraccy.
However the response of endoglucanase expression to the carbon sources was consistent with that expected for a strain carrying wild-type GAL4 and GAL80 genes: induction by galactose, repression by glucose.
2. Transformant 149.1 (strain Sc295). Endoglucanase expression was maximal in the absence of galactose, consistent with the expected effect of the GAL80 deletion, and greatly reduced by 2 percent glucose, consistent with normal glucose repression. The presence of galactose in fact partially repressed endoglucanase synthesis, an effect that has also been seen in GAL80 deletion strains expressing extracellular melibiase (unpublished obserations).

4~3.~'3 3. Transforma~t 142.11 (strain Sc300). Endoqlucanase ex~ression in this strain was the highest seen in any yeast recipient. Ur.expectedly, galactose was required for maximal endoqlucanase expression, and glucose was only partially effective as a repressor of its synthesis. Both these unpredicted effects are presumably due to the increased availability of the GAL4 product.
These experiments demonstrated clearly that manipulations of genes known to affect melibiase promoter function affected expression of extracellular endoglucanase, so providing additional evidence of the utility of the expression cassette in producing this and other novel protein from S.
cerevisiae.
The followinq plasmids were deposited with ATCC before the filing date hereof, i.e. on December 16, 1985 having been designated as defined below and having been allotted the following accession number. All are contained within a suitable E. coli host.
PlasmidDesignation ATCC Accession No.
p4 NAS-l 53360 p5 NAS-2 53361 p6 NAS-3 53362 p7 NAS-4 53363 Cultures containing these constructs are also currently maintained in a permanently viable state at the laboratories of Allelix Inc., 6850 Goreway Drive, ~iississauga, Ontario, Canada and are identified by the designations used herein.

lX~59 C
JJ L- .
0 o ~ o~
~ .
C
E~

0~ C
C-E ~ q:~ ~
.~ ~ c ca~ c J~ ~ ~ ~ aJ c O ~ ~
at P. ~ o o c ,- ~
~ ~ c U~ ~

~ E u~
C V 0 Cl C~
o a~ ~
~1 3 ~
C
~a o C ~ ~ 0 o c 0 0aJ C
s ~ ~ ~ a~
0 ~ L~~ ~ V
o X ~ I~ ~ JJ
E ~ ~~ 0 ,:1 0 o o ~ ~ ~ a~
a~ v ~ , _ 0 0~ O ~ rl _~
O ~ ~ ~
C ~ U~ ~ V
,' _ 4l '.~1 ~ j ~ ~
0 o ~ a E ~ o J~ ~ ~ u~
C O 0 C~ I
_I ~ ~ ~ ~
E ~ :~ ~ _I ~ ~ ~ C
~o 0 e~ ~ ..... ~ ~ 0 0 ~C ~ C~; 0 3 0 ~r ~1 _I ~ a~
--~ o 0 ~u C ~ ~ a~ 0 v 0 o ~ 0 _1 o a~ a~
Q) ~ I 10 ' ~ .C ~ O
~ ~ ~ e O ~e X ~ ~ ~ ~~ o. ~ o C~
,~ _x o x u~ 3 3 a~ w 13 ~ Q, 0 0 4J o 0 C L~
E
U C 4~
o :~~ ~ aJ
,~0-,~ ~r;
0 ~0 ~ ~ n o c Oa~ ~ a~ o~ o 0 ~~ t~
~ C ~ ~ _ J~ ~ ~; U~ _ -~rl ~.~84S~5~

o _ 0 _ C >. a!
o V o . ~ _.
U) a ._,,. ,. r ~ o ~ o~ u^~ ~ ~ ~
c ~ ~ ~ ~ ~ o ~ ~ ~ o ,~
_, 0 _,_, ~ ,.
C 0 ,, o 0 C
~, 0 0 t, o ~
,, ~
~ o , ~C
_, C ~ E

C
~, 0 ~ ~ U~ OU~ U~ ~. X U~ ~
J~ _ ~ ~ ~ ~ - ' - -t`~ C ~ 0 _ o ~r G O~
O O~ ~ 000 a~ ~ 0 ~
_l J C
0 0 . X
E~ ~ 0 ~
_ ~ C
C
-~1 a)--~ ~ C H 1~
C 01:1 0 Z Z Z
O ~ J~
~ ~1 ~
0 ~ 1 0 ~1CJ ~
C
O
P. C t~
X 0 _ ~ I _l I~C~ 9 C.) _11 ~
O
a:l 0~ ~
` 0--1- o ~''I
E-'--~: C
V ~ ~ U~ O
U~ a~ o~ o ~t ~; U~

.

. . .

4~.9 Table 1 ~2) NI (non-inducinq) in 2 PerCent lactic acid, 3 percent qlycerol, 0.05 percent qlucose; I (inducinq) is NI plus 2 percent galactose; R (repressing) is I plus 2 Percent glucose.

(3) In each case, the carbon sources were usinq in selective media, either *C uracil (33) for transformants 113.1 and 142.11, or *C leucine (34) for transformant 142.11. Final PH was 6.8 to 7Ø

(4) Cultures were centrifuqed and the supernatant fluids dialysed aqainst water, lyophilized, reconstituted in water, and assayed for Production of reducing-suqar equivalents from carboxymethylcellulose, as described (Skipper et al; 27). One unit endoqlucanase produces 1 ~umole reducinq-sugar per minute at 37C.

. .

1;~84~
.

TABLE OF REFERENCES CITED IN DISCL~)SURE

1) Hitzeman, R.A., Leunq, J.W., Perry, L.J., Kohr, W.J., Levine, H.L., Goeddel, D.V. (1983). Science 219, 2) Emr, S.A. Sche!cman, R., Flessel, M.C., Thorner, J.
(1983) Proc. Natl. Acad. Sci. USA 80, 7080-7084.

3) Brake, A.J., Merryweather, J.P., Coit, A.G., Heberlein, U.A., Masiarz, F.R., Mullenbach, G.T., Urdea, M.S., Valenzuela, P., Barr, P.J. (1984) . Proc. Natl. Acad.
Sci. USA 81, 4642-4646.

4) Bitter, G.A., Chen, K.K. Banks, A.R., Lai, P-H., (1984). Proc. Natl. Acad. Sci USA 81, 5330-5334.

5) Post-Beittenmiller, M., Hamilton, ~.W., Hopper, J.E.
(1984). Mol. Cell Biol. 4, 1238-1245.

6) Goff, C.G., Moir, D.T., Kohno, T., Gravius, T.C., Smith, R.A., Yamasaki, E., Taunton-Rigby, A. (1984).
Gene 27, 35-46.

7) Botstein, D., Falco, S.C., Stewart, S.E., Brennan, M., Scherer, S., Stinchcomb, D.T., Struhl, K., Davis, R.W.
(1979) Gene 8, 17-24.
.

,.

1~,84~ ,9 8) Norran-3er, J., KemPe, T., Messing, J. (1983). Gene 26, lnl-los.

9) Messing, J. ~unpublished).

10) Hanahan, D. (1983). J. Mol. Biol. 116, 557-580.

11) Henikoff, S. (1984) . Gene 28, 351-359.

12) Sanger, F., Nicklen, S., Coulson, A.R. (1977). Proc.
Natl. Acad. Sci USA 74, 5463-5467.

13) BRL M13mp7 cloninq/dideoxy sequencing user manual.
Bethesda Research Laboratories, Inc., Ga ithersberg, Maryland 20877.

14) Larson, R., Messinq, J. (1982). Nucl. Acids Res. 10, 39-4 9.

15) Devereux, J., Haeberli, P., Smithies, O. (1984) . Nucl.
Acids Res. 12, 387-395.

16) Ito, H., Fukada, K., Murata, K., Kimura, A. (1983). J.
Bacteriol. 153, 163-168.

17) 1 unit of melibiase hydrolyses 1 ~mole Per minute of p-nitrophenyl - oC-D-galactoside at 30C.

18) Laemmli, U.K. (1970) . Nature 227, 680-6~5.

19) Lazo, P~S., Och->a, A.G., Gascon, S. (1977). El~r. J.
Biochem. 77, 375-382.

20) Lazo, P.S. Ochoa, A.G., Garcon, S. (1978) . Arch.
Biochem. Biophys. 191, 316-325.

21) Dale, R.M.K., McClure, B.A., Houchins, J.P. Plasmid 13, 31-40. (Manuscript received before publication) .

22) Bolivar, F., Rodriquez, R.L., Grene, P.J., Betlach, M.C., Heyneker, H.L., Boyer, H.W., Crosa, J.H., Falkow, S. tl977) . Gene 2, 95-113.

23) Sumner-Smith, M., Bozzato, R.P., Skipper, N., Davies, R.W., Hopper, J.E., (1985) . Gene 36, 333-360.

24) Vieiera, J., Messinc1, J. (1982). Gene 19, 259-268.

25) Lathe, R., Keny, M.P., Skory, S., Lecocq, J.P. (1984).
DNA 3, 173-182.

26) American Type Culture Collection, Rockville, Maryland.

~ 284959 27) Skipper, N., Sutherland, M., Davies, R.W., Kilburn, D., Miller, R.C., Warren, A., I~onq, R. (1985). Science 230, 958-960.

28) Personal communication from R.C. Miller and R. Wong, University of British Columbia.

29) Jones, E. (1978) . Genetics 85, 23-33.
.

30) *C tryptophan medium contained, in grams per litre, yeast nitrogen base, 6.7; adenine, arginine, isoleucine, tyrosine, u-racil and leucine 0.02 each;
lysine, 0.03; phenylalanine, 0.05; threonine, 0.10;
valine, 0.15; Na2HP04, 3.0; KH2P04, 3.0;

! KH 2 P4, 1 - 5 -31) Wood, P.J. (1980). Carbohydrate Research 85, 271-287.

32) Miller, G.L., Blum, R., Glennon, W.E., Burton, A.L.
(1960). Anal. Biochem. 2, 127-132.

33) * uracil medium contained, in grams per litre, yeast nitroqen base, 6.7; adenine, arginine, isoleucine, tyrosine, tryptophan, and leucine, 0.02 each; lysine, 0.03; phenylalanine, 0.05; threonine, 0.10; valine, 0.15; Na2HP04, 3.0; KH2P04, 1.5.

~., 12~34~';9 34) *leucine medium contained, in grams per litre, yeast nitrogen base, 6.7; adenine, arginine, is~leucine, tyrosine, tryptophan, and uracil, 0.02 each; lysine, 0.03; phenylalanine, 0.05; threo~ine, 0.10; valine, 0.15; Na2HP04, 3.0; KH2P04~ 1

Claims (31)

1. A DNA construct for use in transforming a yeast host to obtain expression therein of a polypeptide foreign thereto, said DNA construct comprising a promoter region operatively associated with DNA coding for said foreign polypeptide, wherein said promoter region corresponds in sequence with the promoter region of the melibiase gene of Saccharomyces carlsbergensis.

2. The construct according to claim 1 wherein the DNA
coding for said foreign polypeptide is derived from the Cellulomonas fimi endoglucanase gene.

3. The construct according to claim 1 wherein the DNA
coding for said foreign polypeptide is followed by and is operatively associated with a transcription-terminating region.

4. The construct according to one of claims 1,2 or 3 wherein the DNA sequence of the promoter region is substantially as shown between reference points 20 and 10 in Figure 1 of the accompanying drawings.

5. A method for transforming a yeast host to obtain expression therein of a polypeptide foreign thereto which comprises introducing in said yeast cell a DNA construct, said construct comprising a promoter region operatively associated with DNA coding for said foreign polypeptide, wherein said promoter region corresponds in sequence with the promoter region of the melibiase gene of Saccharomyces carlsbergensis.

6. The method according to Claim 5 wherein said yeast cell is selected from S. cerevisiae and S. carlsbergensis.

7. The method according to one of claims 5 or 6 wherein the promoter region has the nucleotide sequence substantially as shown between reference points 20 and 10 in Figure 1 of the accompanying drawings.

8. The method according to claim 6 wherein the DNA coding for said foreign polypeptide is derived from the Cellulomonas fimi endoglucanase gene.

9. A yeast cell containing a promoter region of the melibiase gene which corresponds in sequence with the promoter region of the melibiase gene of Saccharomyces carlsbergensis, said promoter region being operatively associated with and exerting a transcription-controlling function over a coding region which codes for a polypeptide which is foreign to the yeast cell.

10. The yest cell according to claim 9 which is selected from the species Saccharomyces cerevisiae and Saccharomyces carlsbergensis.

11. The yeast cell according to one of claims 9 or 10 wherein the polypeptide which is foreign to the yeast cell is derived from the Cellulomonas fimi endoglucanase gene.

12. A DNA construct for use in transforming a yeast host to obtain expression and secretion of a polypeptide foreign thereto, said DNA construct comprising a promoter region operatively associated with DNA coding for said foreign polypeptide, and a signal sequence operatively associated with both the promoter region and the DNA coding for said foreign polypeptide, wherein said promoter region corresponds in sequence with the promoter region of the Saccharomyces carlsbergensis melibiase gene and wherein the signal sequence encodes a signal peptide of the amino acid sequence substantially as follows:

(N-terminus) met-phe-ala-phe-tyr-phe-leu-thr-ala-cys-ile-ser-leu-lys-gly-val-phe-gly.

13. The construct according to claim 12 wherein the signal sequence has a nucleotide sequence substantially as follows:
(5') ATG TTT GCT TTC TAC TTT CTC ACC GCA TGC ATC AGT TTG AAG GGC
GGT TTT GGG (3').

14. The construct according to claim 12 wherein the promoter region has the nucleotide sequence substantially as shown between reference points 20 and 10 in Figure 1 of the accompanying drawings.

15. The construct according to claim 12 wherein the DNA
coding for said foreign polypeptide is derived from the Cellulomonas fimi endoglucanase gene.

16. The construct according to claim 12 wherein the DNA
coding for said foreign polypeptide is followed by and is operatively associated with a transcription-terminating region.

17. A method for transforming a yeast host to obtain expression and secretion of a polypeptide foreign thereto, which comprises introducing into said yeast cell a DNA construct comprising a promoter region operatively associated with DNA
coding for said foreign polypeptide, a signal sequence operatively associated with both the promoter region and the DNA coding for said foreign polypeptide, wherein said promoter region corresponds in sequence with the promoter region of the melibiase gene of Saccharomyces carlsbergensis and wherein the signal sequence encodes a signal peptide of the amino acid sequence substantially as follows:

(N-terminus) met-phe-ala-phe-tyr-phe-leu-thr-ala-cys-ile-ser-leu-lys-gly-val-phe-gly.

18. The method according to claim 17 wherein the yeast cell is selected from Saccharomyces cerevisiae and Saccharomyces carlsbergensis.

19. A yeast cell containing a signal sequence which encodes a signal peptide of the amino acid sequence substantially as follows:

(N-terminus) met-phe-ala-phe-tyr-phe-leu-thr-ala-cys-ile-ser-leu-lys-gly-val-phe-gly said signal sequence being operatively linked with a polypeptide coding region which codes for a polypeptide which is foreign to the yeast cell.

20. The yeast cell according to claim 19 wherein the polypeptide coding region is derived from Cellulomonas fimi and encodes endoglucanase.

21. The yeast cell according to claim 19 which is selected from the species Saccharomyces carlsbergensis and Saccharomyces cerevisiae.

22. A process for obtaining expression and secretion from a yeast cell of a polypeptide which is foreign thereto, which comprises growing, in a growth-promoting medium, said yeast cell transformed by a DNA construct comprising a promoter region which corresponds in sequence with the promoter region of the melibiase gene of Saccharomyces carlsbergensis, a signal sequence which encodes a signal peptide of the amino acid sequence substantially as follows:

(N-terminus) met-phe-ala-phe-tyr-phe-leu-thr-ala-cys-ile-ser-leu-lys-gly-val-phe-gly.

said promoter and said signal sequence being linked in reading frame; and DNA coding for said polypeptide, said DNA being linked in reading frame with said signal sequence.

23. The process according to claim 22 wherein the DNA coding for said polypeptide is derived from Cellulomonas fimi and encodes endoglucanase.

24. The process according to claim 22 wherein transcription of the signal sequence and DNA coding for said polypeptide is regulated by changing conditions in the growth medium which affect the activity of the GAL4 and/or GAL80 genes and their products.

25. The signal sequence of the melibiase gene which is native to S. carlsbergensis and which encodes a signal peptide of the amino acid sequence substantially as defined below:

(N-terminus met-phe-ala-phe-try-phe-leu-thr-ala-cys-ile-ser-leu-lys-gly-val-phe-gly.

26. The signal sequence according to claim 25 having the DNA
sequence substantially as defined below:
(5') ATG TTT GCT TTC TAC TTT CTC ACC GCA TGC ATC AGT TTG AAG GGC
GTT TTT GGG (3 ')

27. A DNA construct comprising a DNA segment which encodes a peptide of the amino acid sequence subatantially as follows:

(N-terminus) met-phe-ala-phe-tyr-phe-leu-thr-ala-cys-ile-ser-leu-lys-gly-val-phe-gly and defining restriction sites flanking said DNA segment for incorporation of additional DNA components into the construct.

28. The construct according to claim 27 wherein said DNA
segment has the nucleotide sequence substantially as shown in Figure 4A.

29. The promoter region of the melibiase gene which is native to S. carlsbergensis.

30. The promoter region according to claim 29 having the DNA
sequence substantially as shown between reference points 20 and 10 in Figure 1 of the accompanying drawings.

31. A DNA construct comprising a DNA segment which corresponds in sequence to the melibiase promoter of Saccharomyces carlsbergensis and defining a restriction site downstream of said segment for incorporation of an additional DNA component into said construct.
4759f