CA1280079C - Methods for in vitro diagnosis of malignant cells originating from the alimentary tract - Google Patents

Abstract

The invention relates to the in vitro diagnosis of malignant cells originating from the digestive tract by bringing a biological sample into contact with a reagent exhibiting a specific affinity for villin.

Description

~ r ~ 85 ~

Means for the in vitro diagnosis of malignant cells digestive tract The invention relates to means of dia-1n vitro diagnosis of the existence or not in humans of proliferation of malignant cells from digestive tract tumors, more particularly of the adenocarcinoma type. These means concern both ln vitro diagnostic procedures, only material elements which can be implemented in these procedures.
dice, more particularly fragments of ~ DN used sands as probes or antibodies, preferably monoclonal rence, directed against human villin.
The invention further extends its effects to the various different applications of these monoclonal antibodies, for example example to the purification of human villin from shot of cell extracts containing it. As such, the invention also relates to purified human villin herself.
It has already been proposed to use the detection of structural proteins as a specific queurs, for the identification of certain types of higher eukaryotic cells and for studying the follow-up of the different stages of their development development, especially during their differentiation.
As examples of known markers, mention will be made filament proteins, for example vimentin, keratins or neurofilament proteins, which allowed the identification of certain types of lules, the study of their development, from the stage from embryogenesis to the final stage of diffe-cell renciation, as well as their behavior vis-à-vis the surrounding environment (E. LAZARIDES, Nature, 283, 249 (1980) and R. MOLL et al., Cell 31, 11 (1982).

~. '' ~ z ~

Keratins are often considered to be particularly effective markers, allowing distinguish epithelial cells and cells not epithellal. This being so, it has been established that type of distinction did not always allow for unambiguously blur the origin of cells epithelial in issue.
However, the need to establish in a certain way the origin of certain types of cells has a particularly important importance in a large number of cases, for example when it comes, examination of a biological sample testifying of a proliferation of tumor cells to identify primary tumor cells, found at the gine of this proliferation, or to detect the existence of metastases whose origin would be a cancer of the digestive tract or to check the effectiveness of a chemotherapy treatment or others against cancer metastases. We know well that the effectiveness of cancer treatment can be linked to the precise identification of tumor cells which are the root cause of the disease.
These observations apply with force particular to the detection, preferably early, of proliferation of tumor cells of digested origin tive (responsible for a large proportion of cancers observed in the clinic) or renal, or of derivatives of the preceding cells, more particularly specifically with the identification of character markers ticks from these cells.
The invention is therefore more particularly interested in the detection of tumor cells that have retained some of the essential phenotypes of cells-the epithelials normally present in the mucous membranes its of the digestive system, more particularly the intestinal mucous membranes, and of which the differentiated types ~ 2 ~

major are constituted by absorbent cells or enterocytes.
More particularly still the invention is relates to specific markers likely to be detected, whether or not they are worn by these tumor cells.
In particular, the invention aims to allow the detection of these markers, even when they are stained with said tumor cells, especially on the occasion necrosis of these cells, and released, by example in the bloodstream.
The marker put into play as part of the present invention consists of all or part of villin. It is a protein with a weight 15 molecular of the order of 95,000 daltons which is normally present in the villi of the mucous membranes digestive, more particularly intestinal. The villin is able to bind to actin in the presence calcium ions.
From one species to another, the acid sequence amino acids may differ slightly, but the characteristics ques functional are maintained. The techniques of purification known to date allow to obtain the almost pure state of chicken villine and that pork. However, these techniques do not lead obtaining purified human villin.
One of the best known villines is that of chicken. It is made up of a sequence of 854 amino acids. It can be cut by proteolysis formed with trypsin and protease V-8 in determined points, to produce 44 Kd fragments, 51 Rd and 10 Kd whose relative positions appear are in the card, villin, after Paul MADSUDAIRA, MRC, Laboratory of Molecular Biology, Cambridge, UK and John GLENNEY et al, JBC, 1981, 256, 8156-8161, which is as follows:

~ x ~ o ~

Protected proteolysis fragments Binding site to actin, independent dante of the presence calcium 44 Kd 51 Kd V8 10 Kd (HP) Ti NH2 ~ COOH

1 ~ --t 69 779 ~ ---------- ~ 854 binding site to region known as 10 actin, sequence dependent the presence of calcium amino acids Ti: tryptic rupture V8: rupture with protease V8.
The amino acid sequence of the part COOH-terminale (779-854) or "part de tête" (head piece or "HP peptide") for chicken villin is the next:

Val-Phe-Thr-Ala-Thr-Thr-Thr-Leu-Val-Pro-Thr-Lys-Leu-Glu-Thr-Phe-Pro-Leu-Asp-Val-Leu-Val-Asn-Thr-Ala-Ala-Glu-Asp-Leu-Pro-Arg-Gly-Val-Asp-Pro-Ser-Arg-Lys-Glu-Asn-His-Leu-Ser-Asp-Glu-Asp-Phe-Lys-Ala-Val-Phe-Gly-Met-Thr-Arg-Ser-61 7 ~ 71 Ala-Asn-Leu-Pro-Leu-Trp-Lys-Gln-Gln-Asn-Leu-Lys-Lys-Glu-Glu-Lys-Gly-Leu-Phe In general, villin is pre-especially feels in the edges in brush-ses which are observed on the surface of enterocytes, especially when these have reached their ultimate stage of differentiation, at the level of the walls of light intestinal. Microvilli are organelles 3Q assemblies in the final stage of differentiation enterocytes. Villin is more particularly ~ z ~

localized in axial microfilament bundles of these microvilli. It contributes to the constitution tion of their cytoskeleton. By examining sections con-immunofluorescence jellies, it has been found that villin was present at the apical pole of the cells elongated forming columns flush with the wall internal of the intestine, and also near proximal tubular cells of the kidney. In both case these are regions coinciding with the border in brush the affected cells. But the villin did not not detected at various other types of villi of various other epithelia, when these were devoid of a brush border very organized (A. BRETSCHER et al, Exp. Cell. res., 135, 213 (1981) or also article by H. REGGIO et al, published in the book "Membranes in Growth and Development "(Membranes being grown and development) by A. LISS, New York ((198 ~) pp.
89-105).
It has also been found that villin was present in enterocytes in a pre-because of their development, well before the implementation of the brush border.
The invention results from a double discovery Villin remains practically systematically detectable.
during the tumorigenesis of the tissues of the digestive tract, and more particularly in can-colon colon, one of the forms of cancer among more widespread and also in certain types of cancer kidney disease, while villin has never been detected in primary tumor cells resulting from the initial cancerization of tissue located in other very organs (liver, ovaries, lungs, etc.).
In addition, villin is detectable in vivo at all levels of tumor cell development those of the digestive tract, both at the early stage of the ~; r lZ8 ~

tumorigenesis only at the later stages, whatever or the state of differentiation of the cells in question.
The diagnostic method according to the invention, which essentially aims at the in vitro detection of tumor cells originally formed in the region digestive and / or derived therefrom in a sample biological character is characterized by the contacting of this biological sample with reagents present both a specific affinity for villin or recon-lQ being born the gene coding for this protein.
The diagnostic method according to the invention is applicable to any biological sample susceptible to ble to contain tumor cells of digested origin tive or possibly formed tumor cells in other regions of the body, under the influence primary cells of digestive or renal origin, or still to any biological sample likely to contain degradation products of these various tumor cells, including the villin marker, a on the occasion of the necrosis of said cells. This exchange organic tillon can consist of all forms of specimens: fragments of tissue or solid tumors of, for example obtained by biopsy, or alternatively body fluids, especially whole blood or blood serum, susceptible to abut malignant cells or original fragments res of these.
According to one embodiment of the invention, the reagent used in the diagnostic process of the invention consists of DNA, the se-quence has a region coding for a sequence amino acids from human villin, more special-the COOH-termi.nale part.
According to another embodiment of the in-vention, the techniques used in the diagnostic process call for immunological techniques.

that the reagent has a specific affinity for villin then being made up of antibodies likely to recognize villin.
These antibodies are themselves labeled with any known per se, or are recognizable by their turn, when they are in the fixed state on the villin or the tissues carrying it, by immunoglobulins mar-quées or other labeled proteins (e.g.
Staphylococcus aureus protein A).
Particularly suitable techniques are those that were used in the tests which will be described later, and which have led to findings set out above.
The invention also aims to provide specific new means for detecting villin at the level of the microvilli of the entero-cytes or similar cells (it being understood that the use of sation of these new means is not necessarily limited to the implementation of the diagnostic process 2Q according to the invention).
According to one aspect of the invention, these means are made up of DNA corresponding to the mRNA
plet of human villin or by a DNA fragment whose nucleotide sequence contains a region encoding an amino acid sequence of villin human, capable of specifically hybridizing with a nucleotide sequence encoding villin.
-/
/ -c ~ 7 , ~ !, ~ .J

The invention more specifically relates to the use of tion in the above method of a DNA corresponding to complete human villin mRNA or fragment cDNA characterized by the fact that it contains at least part of the nucleotide sequence coding for amino acids of the COOH end of human villin.
This nucleotide sequence and the corresponding sequence a number of the coded amino acids are indicated below:

LYS TRP SER ASN THR LYS SER TYR GLU ASP LEU LYS ALA GLU
AAG TGG AGT AAC ACC AAA TCC TAT GAG GAC CTG AAG GCG GAG
SER GLY ASN SER ARG ASP TRP SER GLN ILE THR ALA GLU VAL
TCT GGC AAC TCT AGG GAC TGG AGC CAG ATC ACT GCT GAG GTC
THR SER PRO LYS VAL ASP VAL PHE ASN ALA ASN SER ASN LEU
ACA AGC CCC AAA GTG GAC GTG TTC AAT GCT AAC AGC AAC CTC
SER SER GLY PRO LEU PRO ILE PHE PRO LEU GLU GLN LEU VAL
AGT TCT GGG CCT CTG CCC ATC TTC CCC CTG GAG CAG CTA GTG
ASN LYS PRO VAL GLU GLU LEU PRO GLU GLY VAL ASP PRO SER
AAC AAG CCT GTA GAG GAG CTC CCC GAG GGT GTG GAC CCC AGC
ARG LYS GLU GLU HIS LEU SER ILE GLU ASP PHE THR GLN ALA
AGG AAG GAG GAA CAC CTG TCC ATT GAA GAT TTC ACT CAG GCC
PHE GLY MET THR PRO ALA ALA PHE SER ALA LEU PRO ARG TRP
TTT GGG ATG ACT CCA GCT GCC TTC TCT GCT CTG CCT CGA TGG
LYS GLN GLN ASN LEU LYS LYS GLU LYS GLY LEU PHE *
AAG CAA CAA AAC CTC AAG AAA GAA AAA GGA CTA TTT TGA GAAG
AGTAGCTGTGGTTGTAAAGCAGTACCCTACCCTGATTGTAGGGTCTCATTTTCTCA
CCGATATTAGTCCTACACCAATTGAAGTGAAATTTTGCAGATGTGCCTATGAGCAC
AAACTTCTGTGGCAAATGCCAGTTTTGTTTAATAAATGTACCTATTCCTTCAGAAA
GATGATACCCCAAAA ~ AAaA ~ A

7 ~ `
- 8a -The nucleotide sequence used is used as a probe for the detection of mRNAs or DNA encoding human villin.
A suitable probe for this type of detection is advantageously marked by a radioactive element or any other group allowing its recognition to the state hybrid with the preparation containing mRNA or DNA a to study.
According to conventional techniques, these probes are brought into contact with a biological sample containing the cells to be studied, or directly with their nucleic acids, under conditions permitting the possible hybridization of the nucleotide sequence of //// ' ~ L28 ~ 9 the probe with a possible additional sequence-contained in the test sample.
The reproducibility of the detection was tested using a probe containing an insert of 200 base pairs.
These nucleotide probes, which constitute new products falling within the scope of the invention tion, are also used, in another aspect, for studying the expression of villin mRNAs in each of the differentiation states of entero-villin-expressing cytes and / or cells, and in the different stages of maturation of ori cells renal or intestinal gine.
The probes obtained thus make it possible to-complete the number, organization and structure of or villin genes such as isolates from from a human genomic bank.
In accordance with the invention, the se-nucleotide sequence encoding the end of the human villin using the following steps your:
- according to known techniques, the MRNA (messenger RNA) total from a cell line lular expressing villin;
- we build a cDNA bank (complete DNA -men);
- the cDNAs are inserted into a vector suscep-tible of expressing the protein coded by the insert;
- we transform using the recom- mended vectors binants obtained a bacterial strain, then we establish conditions allowing expression of the protein researched in bacteria;
- we select the recombinant clones containing the specific villin clone using of antibodies recognizing villin.
The cDNA bank construction step ~ i ~ LZ8 ~

is carried out using a vector capable of expressing the protein encoded by the inserted cDNA.
Particularly cloning vectors advantageous, in particular because of their ex-high pressure, consist of pEX-type plasmids. Such plasmids are described by Stanley and Luzio in EMBO Journal, 1984, 3, 1429-1434. They derived from plasmids containing the cro- fusion gene lacZ whose expression is under the control of the promo-PR of lambda bacteriophage. This expression cannot be induced by temperature.
A polynucleotide containing several sites unique restriction is inserted in each of read phases, as well as termination signals transcription and translation. CDNAs inserted at the unique restriction sites are expressed with great effectiveness in the form of -tin hybrid cro- ~ gal-peptide corresponding. This hybrid protein is sparingly soluble, which reduces advantageously the risks of proteolysis in the bacteria and facilitates its immunological detection by specific antibodies.
To insert cDNA into the good orientation with respect to the cro-lacZ gene, so to obtain expression in the bacterium of the polypeptide corresponding, we use an addition protocol sequential of different linkers at both ends cDNA according to the technique of Helfmann et al. in PNAS USA, 1983, 80, 31-35. The linkers used correspond to the BarnHI and SalI cleavage sites.
These recombinant plasrnides are used to transform, according to conventional techniques, the strain bacterial used for the expression of the pro-tine by the sequence sought.
The bacterial strains of E. coli are par-particularly preferred, especially the strain ~ L280 ~ 7 ~

E. coli pop 2135 which contains the cIts857 allele of the re-presser cro.
We thus obtain in the bacterial strain a cDNA library corresponding to the mRNA of the cells expressing a high level of villin, containing approximately 30,000 recombinant clones.
The expression of the hybrid protein is inducible by temperature. We therefore operate at a temperature where the repressor of the cro gene is no longer active. To this end, it is satisfactory to incubate the strains about 2 hours at a temperature above ambient, in particular of the order of 40-42C.
Clones recovered after lysis of bacteria and protein renaturation according to techniques classics are selected by immunological screening than.
In a preferred manner, we first perform screening of the cDNA library with at least one type polyclonal anti-villin antibody. The clones rea specific to the poly- antibody (ies) clonal are re-screened using at least one type of monoclonal antibodies directed against COOH- epitopes terminals.
Satisfactory screening is carried out using a polyclonal anti-villin antibody such as an anti polyclonal body directed against pork villin intact then one or more monoclonal antibodies recognizing epitopes located in the COOH- region terminal of the molecule.
3Q Screening using polyclo- antibody nal is advantageously followed by a secondary screening using another polyclonal antibody, in particular bind a polyclonal antibody against the fragment COOH-terminal of chicken villin.
The invention relates more particularly to a clone carrying a cDNA corresponding to villin 07 ~

human characterized in that it reacts specifically with the polyclonal antibody against villin intact, with the polyclonal antibody directed against COOH-terminal peptide of chicken villin and with the two monoclonal antibodies directed against epi-COOH-terminals.
The invention also relates to a carrier clone a cDNA corresponding to villin comprising a insert with a polyA sequence and a poly- site adenylation.
According to another aspect of the invention, the means used for the detection of villin are made up of monoclonal antibodies.
This aspect of the invention is based on the the fact that villins, originating from different species these have common epitopes, accessible to monoclonal antibodies recognizing a specific way not only the particular villin used to immunization of the animal, whose splenic cells that had been fused with mye cells lome suitable for the production of secreted hybridomas of said monoclonal antibodies, but recognizing also specifically from the original villins other species, including the human species.
A preferred monoclonal antibody according to the vention is therefore characterized by the following properties-your:
- It recognizes purified pork villin (Western Blotting).
- It recognizes chicken villin (Western Blotting).
- It recognizes the villin cell extract from the line derived from a human colon adenocarcinoma:
HT29 (Western Blotting).
- It recognizes rat villin in immunocytochemistry (frozen sections (cryostat) of intestinal mucosa of rat attached to formaldehyde).

,, ~.

~ 2lS ~

A preferred monoclonal antibody among those that meet the previous definition also recognizes lemen t an epitope contained in the "HP peptide" of the chicken villine, recognition being possible both with respect to the previously isolated HP peptide and with regard to peptide 51 Kd still containing the peptide HP; this antibody does not recognize the 44 Kd peptide nor the pep-tide 44 Kd from chicken villin.
The preferred antibody of the invention recognizes moreover the protein HP, both in the denna state ture, especially after treatment with dodecylsulfate sodium (SDS) than on the epithelial cells villine tutors. This result demonstrates that the epi-tope carried by the HP peptide is not masked by other very proteins in the cell environment.
The invention naturally also relates to the secretory hybridomas of these monoclonal antibodies.
An advantageous technique for producing these hybridomas, especially by fusion of mouse spleen cells immunized against purified pork villin, hand, and cells from an appropriate myeloma, will described later. The preferred hybridoma thus obtained (strain BD-D 2C3) has been deposited in the Natio- Collection nale of Microorganism Cultures (CNCM) of the Ins-titut Pasteur de Paris, April 29, 19 ~ 5, under the n I-440.
According to an advantageous aspect of the invention, the immunogen used to form antibodies can be expressed in large amounts in the bacteria laughs. This immunogenic agent corresponds to the coded peptide by the nucleotide sequence defined above corresponds to based on human villin DNA or a fragment.
According to conventional techniques, we inject the peptide to animals, we collect the antisera, then, if necessary, the antibodies from the anti-sera, for example by affinity chromatography. The ~.

~ 2 ~ 30 () 79 antibody production according to this variant takes on a interest all the greater as the HP region coded by the cDNA fragment defined above is both the most immunogenic and specific region of the villin.
Note that the protein encoded by the nucleotide sequence of the DNA complementary to the villin or a fragment of this DNA also constitutes a source of antigens for carrying out ra-competitive dioimmunoassays (either by the ELISAdirect method, or by the ELISA method by competition).
It goes without saying, however, that any other agent immunogen containing the same immunogenic sequence can be used; for example, the HP peptide itself, the if necessary grafted beforehand on a molecule teuse, such as bovine serum albumin, for the purpose of grow its immunogenic properties.
It will be clear to those skilled in the art that having in hand the preferred monoclonal antibody according to the invention, it is able to define the epito-characteristic spike to the HP peptide. To identify it more specifically, it could in particular have use of a process comprising the following steps:
- synthesis of a polynucleotide sequence coding for the HP peptide (or for the HP peptide part of which it is reasonable to assume that it contains the epitope research), linearization of said plasmid defined above, the nucleotide sequence coding for the end COOH-terminal of the villin, and this at the level of a site restriction outside of said sequence, - pruning in a controlled manner of the linearized plasmid with an exonucleolytic enzyme, such as the enzyme Bal 31, - recircularization of the plasmid by means of DNA-ligase, ;

- transformation of an appropriate microorganism, even transformable by the corresponding plasmid and able to express the insert contained in it, - contacting expression products of this microorganism with the antibody in question, the cycle of operations which has just been defined being repeated until the detection of said detection disappears immunogenic peptide among expression products of said microorganism transformed by the last plasmid recircularized.
It is possible, at the end of each of the cy-keys to the above-defined process, in particular sequencing of end parts of the plasmid before and after the last last pruning operation, which led to the loss of ability to recognize the recircularized plasmid intermediate, to locate the epitope at the level of the peptide encoded by the nucleotide sequence eliminated during this last pruning operation. This means that the made for those skilled in the art to dispose of the antibody monoclonal above is equivalent to setting arrangement of the chemical defined peptide sequence-and containing this epitope.
The invention also relates to villin practically pure biologically reactive human with the preferred monoclonal antibody defined above and essentially giving only one band in poly- gel electrophoresis migration tests acrylamide, in particular SDS-PAGE.
Indeed, human villin can be ex-treats a lysate of human enterocytes, in particular ob-held by treating these with a solution aqueous containing an appropriate detergent, and purified to using the above monoclonal antibody. A process of purification of this type involves the monoclonal antibody nal advantageously immobilized on a solid support, preferably suitable for chromatographic operations.

~, ~

~ ~ rc ~

Affinity letter. For example, the monoclonal antibody is attached to a tri-crosslinked agarose network dimensional, marketed under the brand SEPHAROSE
by the Swedish company PHARMACIA AG, for example by the cyanogen bromide method.
The invention therefore relates more particularly-a process for the separation of human villin characterized by the operations of doing not-ser a solution containing it in contact with a column affinity carrying the above-mentioned monoclonal antibody, for selectively fix human villin, then recover manage this by dissociation of the antigen- complex antibody either by acid buffer at pH 2-4 based on glycine, either by a basic methyl-based buffer amine, pH 11, then dialyzed against an acetate buffer ammonium tate.
It goes without saying that the invention also relates to lower molecular weight polypeptides wheat consisting of human villin fragments.
It will be clear to the specialist that the frag-elements can be obtained by cutting the villin human by cleavage enzymes of polypeptides into specific sites. As an example of such proteins, we will first mention trypsin or the protease of Staphylococcus aureus V8, alpha-chymotrypsin, the "submandibular gland protease mouse "(submaxillary gland protease) commercial Specialized by BOEHRINGER, the collagenase of Vibrio alginolyticus chemovar iophagus, which recognizes specifically said Gly-Pro and Gly-Ala peptides, etc.
It goes without saying that then also do part of the invention hybridomas and mono- antibodies species-specific or non-clonal which may be made from human villin or its fragments.

l 7 Other features and benefits of the invention will appear; will still be in the description which follows specific conditions, indicated as example, detection of human vilin, production tion and implementation in hybridoma tests of monoclonal antibodies.
We also report a process for obtaining a clone carrying a portion of villin cDNA
human.
EXAMPLE 1: DETECTION OF HUMAN VILLINE.
The expression of villin can be studied at different stages of cell proliferation tumors or not originating from the digestive regions or kidneys on the one hand, and other areas of the body on the other hand. Starting from the tissues concerned, these have been frozen, fixed and prepared under conditions to allow the realization of cuts (cryocuts) according to the technique described by BROWN and FARQUHAR, Cell, 36, 295 (1984).
2Q Sections having thicknesses of 5 ~ m have were obtained at -25C and deposited on glass slides covered with polylysine. After soaking in a solution of a buffer consisting of a saline solution of phosphate and containing 0.2% gelatin (PBS-gelatin), the sections were treated to detect villin at using a solution containing 50 ~ l of antiserum anti-villin rabbit diluted 1/800 in PBS ~ -gela-tine, then incubated for 25 minutes at temperature room in a humid room.
: 30 The cups were then washed three times for 10 minutes in PBS ~-gelatin.
Rabbit anti-IgG labeled with rhoda-mine (produced by the Dutch company Nordic Immu-nological Laboratories) were then added and the sections incubated in the presence of these anti-IgGs at room temperature rature for 25 minutes. The cuts have .

~ Z ~ 00'- ~ 9 then was washed thoroughly in PBS-gela-tine, then mounted for examination under a fluorescent microscope rescence (ZEISS photomicroscope) lens team immersion in Plan Neofluar oil and a set of appropriate filters.
Control tissues or tumor tissues other origins have been treated in the same way.
The following observations could be made your:
When the tissue came from adenocarci-nomes du colon, ll observations on 12 were revealed positive in terms of the expression of the city born. Human tumors from other origins such as lymphomas, in particular lymph nodes of nodule mesente-and various types of carcinomas of other origins gines resulting from metastases or not at the pan level creas, from the esophagus, did not express the protein.
Generally, the observations have shows a close correlation between the intesti-primary outcome of treated tumors and expression of villin. The numerous tests carried out on tumors clearly of distinct origin have practically in all cases revealed negative at the level of the ex-protein pressure.
It should be noted that in the original tissues intestinal gine, villin has always been observed, whatever the degree of proliferation of said cells the.
The above tests have been carried out with polyclonal antibodies. Much results sharper can be obtained with the mono- antibody clonal preferred which was the subject of a deposit at the CNCM.
The conditions under which hybridomas secretors of these monoclonal antibodies have been isolated will be described below by way of examples. He will be also indicates a preferred mode of implementation of ~ 8 ~

conditions under which the diagnosis of the presence whether or not villin can be detected in tests ELISA immunoassays.

AGAINST THE VILLINE.
A) IMMUNIZATION PROGRAM
- Balb / C o mouse 6 to 8 weeks.
- Antigen: purified pig villine (10 mg / ml) (strip homogeneous after electrophoresis of the protein on gel polyacrylamide (10%) in the presence of SDS ~ of molecular weight 95 Kd):
. 10 mM Imidazole . 75 mM HCl . 1 mM EGTA
. 0.1M DTT
. 50% Glycerol.
- Program:
. Day 0: IP injection of 50 ~ g of city pure line in a 50/50 emulsion (PBS-Adjuvant Freund Complete).
. Day 14: Recall in IP 50 ~ g of villin (PBS-Freund Incomplete adjuvant emulsion).
-. Day 21: Recall in IP 50 ~ g of villin (PBS-Freund Incomplete adjuvant emulsion).
. Day 28: IM injection of 20 ~ g of city pure line in solution in PBS.
. Day 29: IV injection of 10 ~ g of villin pure in solution in PBS.
. Day 32: Fusion.
B) MERGER
I) Parental cells ; a) Myeloma cells:
. .
. Sp2 / 0-Agl4 line (8 resistant Azaguanine).
. Sterile culture in DMEM medium 10% FCS.

2 ~

b) Spleen cells:
Origin: mouse spleen o Balb / C hyperimmu-niche against pork villin.
II) Cell fusion process according to Kuhler G. and Milstein C. (Continuous culture of fused-cells secret-ing antibody of predefined specificity, Nature 1975, 256, 495).
- Fusion in DMEM medium without serum under conditions sterile, in the presence of a polyethylene solution glycol (PEG 1000-Merck 9729) at 50% in a DMEM medium without serum. After counting the two types of parental cells, myeloma cell suspension in culture is mixed with the cell suspension 1: 5 splenic.
- Contact 2'30 ".
- PEG action stopped by dilution in DMEM medium full.
- Final dilution of the cell suspension (2x105 cells / ml) in DMEM-HAT selective medium.
- Distribution in wells COSTAR-24 holes 1 ml / -well (COSTAR Tissue Culture Cluster 24, Cat. N 3524, COSTAR 205 Groadway, Cambridge, Ma. USA).
III) Selection of clones ; The clones are identified for their capacity -25 cited to secrete antibodies to villin purified pork.
C) SELECTION METHOD
I) ELISA test: This test allows highlighting of anti-villin monoclonal antibodies in supernatants culture giants after fusion.
- Antigen fixation on support (ELISA plate) Concentration: 5 ~ g / ml in phosphate buffer potassium 50 mM pH 8, 1 night at 4C.
- Saturation with PBS-Tween 20-BSA.
- Incubation I with undiluted hybridoma supernatant, 3 hours at 4C.

'' ~ 28 ~

- Incubation II with anti-mouse IgG labeled with beta-galactosidase, 2 hours at 4C.
All washes between each step are carried out with PBS-Tween ~ 20 0.1%.
- Substrate O-nitrophenyl-beta-D-galactopyranoside (Sigma N11-27) in 0.1 M phosphate buffer pH 7.0.
10 3 M MgSO4. 2xlO 3 M MnSO4. 2xlO 3M magnesium Tritriplex ~ dehydrated (Merck 8409).
Reading: DO 414 nm.
10The clones selected are those for the-which hybridoma supernatants give a higher OD
less than 10 times the OD of the background noise.
II) Western Blotting according to Burnett. Anal. Biochem.
1981, 112, 195-203.
15This test allows you to select the clones `~ secreting anti-villin monoclonal antibodies from pork, also recognizing human villin and chicken villin, among the positive clones for ELISA test.
Different stages of the test:
~ `a) Electrophoresis on polyacrylamide gel a cellular extract from the intestinal mucosa of - ~ chicken and a cell extract from the HT29 line ; (human colon adenocarcinoma) expressing villin.
25b) Electrotransfer of separated proteins on polyacrylamide gel on nitrocellulose paper.
c) Incubation of nitrocellulose paper on ., where the cellular proteins were transferred with previously selected hybridoma supernatants ELISA 1 night at 4 C.
d) 1 hour incubation at room temperature with anti-mouse IgG labeled with peroxidase.
- ~ e) substrate:
- 10 mg diamino tetrahydrochloride-well ~ idine.

'~

~ X8 ~ 9 - 20 ml 0.1 M Tris HCl pH 7.6.
- 0.2 ml H2O2 at 1%.
All washes between each step are performed with newborn calf serum-PBS-Triton X100.
f) positive reaction: rapid onset a brown band (molecular weight 95 Kd) if the ; monoclonal antibody antigen reaction has taken place.
'~ D) CLONING OF THE SELECTED HYBRIDS
- Method of limited dilutions:
Dilution in selective medium of positive clones so as to distribute only one cell per well ~ - (96-hole plates) on macrophages (mouse origin Balb / C, 4 weeks) attached to the bottom of the wells.
Addition of conditioned selective medium.
- Selection of positive clones according to the methods `previously stated.
- Recloning if necessary.
E) PREPARATION OF ASCITES
- Selected clones are injected into mice (who have been injected with "PRISTANE ~" (Aldrich, 2,6,10,14-tetramethylpentadecane) 4 to 5 days before).
- 1 to 2X106 injected cells / mouse.
- Recovery after 10 to 15 days of the liquid of ascites containing the clone cells which have proliferated . .
~ fairy. Ascites fluid has a mono- antibody level ,;.
! `clonal anti-villin greater than 1 mg / ml.
; = Freezing of selected clones in DMEM medium ~ - 10% FCS-5% DMSO.
- ~ 30 Storage in liquid nitrogen at -176C.
DIRECT ELISA PROCEDURE FOR DOSING THE VILLINE.
= Adsorption of purified IgG from ascites BD-D2C3 in constant concentration on plates ELISA.
The antibody was purified by chromatography '~
''''.'''' ion exchange (DEAE-Tris acryl) and on column hydroxyapatite.
. Concentration to be established.
. Incubation 2 hours at 37 ° C, then 1 night at 4-C.
. Wash in PBS / Tween 20 0.1 '~ ..
= Plate Saturation ~ 30 minute incubation in the presence of P ~ S / Tween 20 - 0.1 ~. / BSA 0.4 ~ 0.
= Addition of anti-ene . Decreasing concentration range of villin purified from 5 ~ g / ml to 1 or 0.1 ng / ml in the presence of asA
0.4 ~.
. Incubation 3 hours at 4 C.
. Washes in PBS / Tween 20 0.1 ~ 0.
; 15 = Addition of Purified IqG from a poly- serum clonal rabbit directed against villin and coupled to beta-galactosidase.
~. Incubation 2 hours at 4 C.
-. Washes in 0.1% PBS / Tween 20.
= Detection of beta-aalactosidase . Addition of 20 mg of p-nitrophenyl-beta-D-g_lacto-pyrannoside from a 4 mlgl solution in 20 ml of 0.1 M phosphate buffer pH 7, MgS04 10 3 M, MnS04 2x10 M, EDTA ~ Merck 8409) 2x10 3 M.
; 25. Incubation x hours at 37 C.
. Optical density reading at 414 nm.
EXAMPLE 3 __PRrPAP ~ AT. ~ N 3'cDNA CORRESPON ~ ANT A LA
HUMAN VILLINE.
Pre ~ 2ration of A ~ Nm.
The mRNAs are prepared from the line HT29 cell derived from a collared adenocarcinoma human. RNAs are extracted by the chloru-e method guanidium described by Ullrich et al. in Science, 1977, 196, 1313-1319. Purification of polyA mRNAs is carried out by chromatography on an oligo column dT-cellulose according to the method described by Aviv and Leder in Proc. Na-tl. Acad. Sci. USA, 1972, 69, 1408-1412.
Preparation of cDNAs.
The first and second strand of cDNAs are pre-trimmed according to the method of Fiddes and Goodman described in Nature, 1979, 281, 351-356. The sequential addition tial of SalI linkers at the 3 'end and Bam HI at the 5 'end is carried out by the Helfmann method et al. reported in Proc. Natl. Acad. Sci. USA, 1983, 80, 31-35.
A cDNA library containing approxi-ron 30,000 recombinant clones.
Vector.
Plasmids pEXl-3 are used (see Stanley :
and Luzio, EMBO Journal, 1984, 3, 1429-1430, 1984). These vectors are derived from plasmids containing the gene for cro-LacZ fusion, the expression of which is under the control of PR promoter of bacteriophage lambda. A polyunucleo-tide containing several unique restriction sites a was inserted at the 3 'end of the LacZ gene. The signals transcription termination and translation are also included in the three reading phases.
The cDNAs were inserted into each of the restriction enzyme digested pEX plasmids Bam HI SalI. They are therefore all in the same orientation relative to the Cro-LacZ gene.
Transformation.
The strain is used as the bacterial strain E. coli pop 2135, built by O. Raibaud as a design

3 ~ crit in Nucleic Acid Research as follows:
We clone into the Bam HI site of a polylinker, the 2.3 kb BglII fragment of phage lambda, carrying the C1857 allele and the PR promoter by operating according to the diagram below:

. ~

~ Z8 ~

II CI857, PR ~

\
GA ~ G ~ e ~ COO ~ u ~ c ~ r ~ AGO ~ CDO ~ LK ~ IA ~ TCGA ~ TTC
EcoRI Ba ~ HI EcoRI
The EcoRI fragment thus obtained is then cloned into the EcoRI site of pOM41 and transferred to the ; chromosome of strain C600 (see Gene, 29, 231-241).
- By cotransduction Pl 'with a proxy marker-imal aroB, we introduce this structure into the chromo-some of MM294 (F endA thi hsdR). We get E. coli .:
10 pop 2135: orientation maIT, CI857, PR, maIPO.
The transformation of the bacterial strain E. coli pop 2135 by recombinant plasmids is performed using the rubidium technique described by Hanahan et al., J. Mol. Biol., 1983, 166, 15 557-580. This strain contains the cIts857 allele of cro repressor.
The number of recombinants obtained is in the order of 103 to 104 ng of cDNA.
Selection of clones by immunological detection.
_ The recombinant clones obtained are spread out on nitrocellulose filters. The synthesis of the pro-hybrid tein is induced after 2 hours of incubation at 42C. After lysis of bacteria by the SDS and renatura-tion of proteins in the absence of methanol, the clones are analyzed by immunological screening. The renatu-protein ration is carried out according to the technique de Burnett reported in Anal. Biochem. 1981, 112, 195-203.
At first, the bank is screened by a polyclonal antibody directed against the villin of intact pork. Then a secondary screening is carried out.
re using a directed polyclonal antibody ~ ' ~ 8 ~ B ~

COOH-terminal fragment of chicken villin and two monoclonal antibodies (BDD2C3 and IID3H9) recognizing epitopes located in the COOH-terminal region of the molecule.
The pEXZ-V19 clone contains an insert of 510 base pairs. The coding part represents 330 pairs of basics. It is followed by a non-coding region of 200 base pairs.
Cloned cDNA codes for 95 amino acids COO ~ -terminals of human villin and represents about 1/10 'of the whole protein (molecular weight area: 95 Kd).
': ~

'15 `~ 20 ';' :

, REFERENCES
(1) Ullrich, A., Shine, J., Chirgwin, J., Pictet, R., Tischer, E., Rutter, WJ & Goodman, HM
Rat insulin genes: construc-tion of plasmids containing - 5 the coding sequences.
Science, 1977, 196, 1313-1319.
(2) Aviv, H. & Leder, P.
Purification of biologically active globin mRNA by chromatography on oligothymidylic acid cellulose.
Proc. Natl. Acad. Sci. USA, 1972, 69, 1408-1412.
(3) Fiddes, JC ~ & Goodman, HM
Isola-tion, cloning and sequence analysis of the cDNA
for the alpha-subunit of human chorionic gonadotropin.
Nature, 1979, 281, 351-355.

(4) Helfman, DM, Feramisco, JR, Fiddes, JC, Thomas, GP & Hughes, SH
Identification of clones that encode chicken tropo-myosin by direct immunological screening of a cDNA
expression library.
Proc. Natl. Acad. Sci. USA, 1983, 80, 31-35.

(5) Stanley, KK & Luzio, JP
Construction of a new family of high efficiency bac-terial expression vectors: identification of cDNA
clones coding ~ or human liver.
EMBO Journal, 1984, 3, 1429-1434.

(6) Stanley, KK
Solubilization and immune-detection of beta-galactosid-ase hybrid proteins carrying foreign antigenic deter-minants.
Nucleic Acids Res., 1983, 11, 4077-4092.

(7) Hanahan, D.
Studies on transformation of E. coli with plasmids.
J. Mol. Biol., 1983, 166, 557-580.

(8) Burnett, WN
"Western Blotting": Electrophoretic transfer of r ~
1 ~ -proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection . with antibody and radioiodinated protein A.
Anal. Biochem., 1981, 112, 195-203.

'1 0 .
~ 15 ~ ~ 0 ': -: 25 : ~. 30

Claims (16)

The realizations of the invention concerning the-which an exclusive property right or privilege is claimed, are defined as follows: 1. Diagnostic method for detection in vitro tumor cells initially formed in the digestive tract and / or derived therefrom in a biological sample suspected of having a tumor character, characterized by contacting of this biological sample with a reagent presenting a specific affinity for villin. 2. Method according to claim 1, charac-terized in that the reagent having an affinity specific for villin is constituted by anti antivillin body, these antibodies recognize the human villin. 3. Monoclonal antibodies against villin which can be used in the process according to the claim cation 2, characterized by the following properties:
- it recognizes purified pork villin (Western Blotting);
- it recognizes chicken villin (Western Blotting);

- it recognizes the villin of cell extract blood of the line derived from a colon adenocarcinoma human (Western Blotting);
- it recognizes rat villin in immuno-cytochemistry (frozen sections (cryostat) of mucosa intestinal rat attached to formaldehyde). 4. Monoclonal antibodies as claimed cation 3, characterized in that they recognize a antigenic site contained in the C-terminal sequence (779-854) or "head part" of chicken villine of formula:

said monoclonal antibodies being capable of recognizing be born said "head part", whether it is isolated or within the 51Kd peptide contained in the chicken villine. 5. Hybridoma producing mono- antibodies clonal according to claim 3 filed with the CNCM under No. I-440 on April 29, 1985. 6. Method according to claim 1, charac-terized in that the reagent used is a reagent recognizing the gene encoding villin human. 7. The method of claim 6, charac-terized in that the gene recognizing reagent coding for human villin is made up of DNA
whose sequence includes a region coding for a amino villin sequence of human villin plus especially the COOH-terminal part. 8. DNA usable in the process according to the claim 7, characterized in that it corresponds to complete human villin mRNA or a fragment DNA whose nucleotide sequence contains a region encoding an amino acid sequence of the human villin, capable of hybridizing specifically with a nucleotide sequence encoding villin. 9. Fragment of cDNA usable in the pro-assigned according to claim 7, characterized by the fact that it contains at least part of the sequence nucleotide encoding the amino acids of the COOH mite of human villin, nucleic acid and that of the corresponding amino acids having respectively the following sequences:

10. Application of the reagents used in the method of claim 1 in isolation biologically pure human villin giving no basically only one molecular weight band in gel electrophoresis migration tests polyacrylamide. 11 .. Application as a probe for the detection of mRNA or DNA encoding villin at least part of the nucleotide sequence according to claim 4, this sequence being where appropriate marked by a radioactive element or any other group allowing its recognition to the state hybridized with the preparation containing mRNA or DNA
to study. 12. Method for obtaining the sequence nucleotide encoding the end of villin human according to claim 9, characterized in than:
- according to known techniques, the Total mRNA (messenger RNA) from a line cell expressing villin;
- we build a cDNA bank (complete DNA
mental);
- the cDNAs are inserted into a vector suscep-tible of expressing the protein encoded by the insert;

- we transform using the recom- mended vectors binants obtained a bacterial strain, then we establish conditions allowing expression of the protein sought in the bacteria;
- the recombinant clones are selected containing the specific villin clone using of antibodies recognizing villin. 13. The method of claim 12, charac-terrified in that building the cDNA bank is carried out using a cloning vector capable to express the protein encoded by the inserted cDNA, plus especially by pEX-type plasmids. 14. Method according to claim 12 or 13, characterized in that a bacterial strain is transformed type E. coli, especially E. coli pop 2135, using the recombinant vectors containing a nucleotide sequence encoding the end of the human villin. 15. The method of claim 12, charac-terrified in that we screen the bank of cDNA using a polyclonal antivillin antibody such as a polyclonal antibody to villin intact pork then one or more mono- antibodies clonal recognizing epitopes located in the COOH-terminal region of the molecule, screening using the polyclonal antibody being advantageously followed by secondary screening using another polyclonal antibody, in particular a poly-clonal to the COOH-terminal fragment of the chicken villine. 16. Clone carrying a cDNA corresponding to human villin according to claim 9, character-laughed at in that it reacts specifically with the antibody polyclonal directed against intact villin, with the polyclonal antibody directed against the peptide COOH-chicken villine terminal and with the two anti monoclonal bodies directed against COOH- epitopes terminals.