BRPI0805601A2 - immunoglobulin g-binding peptides present in the serum of patients with neurocysticercosis - Google Patents

Abstract

The present invention relates to the use of the Phage Display technique for the selection, characterization and use of novel recombinant peptides and protein motifs which have interactions with neurocysticercosis specific serological proteins (Immunoglobulins G). IgG-binding peptides were selected from serum samples from patients with the disease. The peptides specifically bind the lgG of patients with NC resulting in a precise diagnosis, obtained in a practical way. Due to their ability to bind to disease-specific serological proteins, these peptides can potentially be used in immunodiagnostic kits.

Description

"G-IMMUNOGLOBULIN-BINDING PEPTIDES PRESENT IN NEUROCYSTICERCOSIS PATIENTS"

The present invention relates to the selection, characterization and use of recombinant peptides and Immunoglobulin G (IgG) binding protein motifs present in the serum of patients with neurocysticercosis (NC). Peptides have been specifically immunoreactive with the serum of patients with CN and may potentially be used in immunodiagnosis or vaccine compositions for disease control.

In human cysticercosis, man is the accidental intermediate host of T. solium when he eats viable eggs of the parasite. The larval form can affect a variety of tissues, including ecardiac skeletal muscles, eyes, subcutaneous tissue, oral cavity and the central nervous system (CUS) (PUSHKER N, BAJAJ MS, BALASUBRAMANYA R. Disseminatedcysticercosis involving orbit, brain and subcutaneous tissue. of Infection, 51: 245-248, 2005).

Neurocysticercosis, a pathology resulting from the presence of Taenia solium metacestoids in the central nervous system (CNS), is the most severe form of cysticercosis and is the main cause of epilepsy in developing countries (PATEL R, JHA S, YADAV RK. Pleomorphism of the clinical manifestations of neurocysticercosis). Transactions of the Royal Society of Tropical Medicine and Hygiene, 100: 134-141, 2006), and have been observed in association with other diseases as well as tumors (NIIZUMA K. et al., Malignant transformation of high-grade astrocytoma associated with neurocysticercosis in a patient with Turcot syndrome.Journal of ClinicalNeuroscience, 14: 53-55, 2007), in addition to rare cases with deparkinsonism (LÓPEZ IC. et al. Parkinsonism sensitive to Ievodopa enneurocysticercosis, Neurology, 23: 3-5, 2008).

The teniasis-cysticercosis complex is a source of concern for human and animal health professionals, however there is no effective control program by government agencies. This complex is related to extrinsic factors such as ambient temperature, humidity and egg dispersing agents. ; intrinsic factors such as potential parasite biotype and natural and acquired host immunity, as well as socioeconomic factors such as swine breeding practices, host eating behaviors, legislation, enforcement and health education (SUDEWI AAR. et al. Taenia soliumcysticercosis in Bali , Indonesia: serology and mtDNA analysis Transactions of the Royal Society of Tropical Medicine and Hygiene, 102: 96-98, 2008).

The transmission mechanisms of man-porcine-man-man cysticercosis have as their primary factor the socioeconomic and cultural conditions of the human being, since this is the only definitive host of teniasis and there are no wild reservoirs. Among these conditions stand out as sanitary as lack of personal hygiene and basic sanitation, with contamination of water and food with eggs of the parasite coming from individuals infected by the adult form of the parasite (GARCIA HH. Et al..Seroincidence of porcine T. solium infection in the Peruvian Highlands. Preventive Veterinary Medicine, 57: 227-236, 2003). Another important factor to maintain the endemic cysticercosis in a given geographic region is the positive system of swine rearing, since it allows the contact of these animals with human feces keeping the life cycle of T. solium. This factor, coupled with the ingestion of undercooked pork (ideally cooked for 30 minutes at 77 ° C), increases the prevalence of strictly cysticercosis-related teniasis (SCIUTTO E. et al. Taenia solium disease in humns and pigs : na ancientparasitosis disease rooted in developing countries and emerging as the major health problem of global dimensions (Microbes and Infection, 2: 1875-1890,2000).

According to the World Health Organization (WHO), the teniasis-cysticercosis complex affects 50,000,000 individuals worldwide, and it is estimated that 50 million people are infected annually with cysticercosis worldwide causing approximately 50,000 deaths annually. The estimated cost of treating complications of the disease in Brazil is approximately $ 85 million (PAL DK1 CARPIO A, SANDER JW. Neurocysticercosis and epilepsy in developing countries. Journal of Neurology, Neurosurgery and Psyehiatry1 68: 137-143, 2000).

In Latin America, it is estimated that the prevalence rate of NC and ocular lesions is 100 and 30 cases per 100,000 inhabitants, respectively, reaching around 350,000 people (PINTO PSA. Et al. Cysticercosisoccurrence and health risks in groups of inspected and non -expected swinein Brazil (Latin American Parasitology, 57: 129-133, 2002). The disease was found in 17 Latin American countries, with higher morbidity rates in Brazil, Chile, Peru, El Salvador, Guatemala and Mexico, with higher frequency in rural areas (PFUETZENREITER MP, ÁVILA-PIRES FD. Epidemiology of taeniasis / cysticercosis by Taenia solium and Taenia saginata. Rural Science, 30: 541-548, 2000).

Cysticercosis affects thousands of individuals in the least developed countries (MEDINA MT. Et al. Prevalence, incidence and etiology of epilepsies in Honduras Honduras: the Salama Study. Epilepsy, 46: 124-131, 2005) and in developed countries with a high rate of area immigration. (SIKASUNGE CS. et al. Risk factors associated with porcine cysticercosis inselected districts of Eastern and Southern provinces of Zambia. Veterinary Parasitolology, 143: 59-66, 2007), emerging as a serious problem in agriculture and public health in various countries (WILLINGHAM AL, ENGELSD Control of Taenia solium Cysticercosis / Teniosis, Advances in Parasitology, 61: 509-566, 2006).

In Brazil, neurocysticercosis is found with high frequency in the states of São Paulo, Minas Gerais, Paraná and Goiás, being the most affected female gender (BENEDETI MR. Et al. Clinical-epidemiological profile of patients with Neurocysticercosis seen at the regional university hospital in demaringá, Paraná, Brazil. , Archives of Neuropsychiatry, 65: 124-129, 2007). Population prevalence, however, is not known for the absence of denotification of the disease (TAKAYANAGUI OM1 MILK JP. Neurocysticercosis. Journal of the Brazilian Society of Tropical Medicine, 34: 283-290, 2001). Incidence of cysticercosis in seroepidemiological studies according to the survey, not considering indigenous communities, it ranges from 0.68 to 6.2%, being more frequent in psychiatric hospitals (38.5%) than in the general population studied (0.8% in children and 2.3% in adults). In indigenous communities, the incidence of cysticercosis is 29.4% (AGAPEJEV S. Clinical-epidemiological aspects of neurocysticercosis in Brazil. Archives of Neuropsychiatry, 61: 822-828, 2003).

Not considering regional differences, the incidence of NC in the various Neurology and Neurosurgery services in Brazil, including general hospitals, ranges from 0.03 to 13.4% in clinical studies, and from 0.12 to 9% in necropsies. Exclusively in general hospitals, the observed frequency of NC is 1.94 ± 2.03%, showing the lowest value (0.19%) in the state of São Paulo and the highest (4.8%) in the state of Paraná. In psychiatric hospitals in the state of Minas Gerais, the frequency of NC corresponds to 12.2% (AGAPEJEVS. Clinical-epidemiological aspects of neurocysticercosis in Brazil. Archives of Neuropsychiatry, 61: 822-828, 2003).

The incidence of NC has been considered low in northeastern Brazil, being frequent in the South, Southeast and Midwest states of the country, this fact may be justified by the lack of diagnosis, since under the clinical point of view the manifestations are not characteristic (PFUETZENREITER MP, ÁVILA-PIRES FD Epidemiology of taeniasis / cysticercosis by Taenia solium and Taenia saginata Rural Science, 30: 541-548, 2000).

In the Midwest region, in a sero-epidemiological study, demonstrated the endemicity (11.3%) of human cysticercosis in the city of Catalão - Goiás, located 100 km from Uberlândia (OLIVEIRA, Η. B. et al.Anti-Taenia solium IgG metacestode antibodies in serum samples frombitants of the Central-Western region of Brazil (Journal of the Tropical Medicine Institute of Sao Paulo, 48: 49-52, 2006).

In research to detect T.solium IgG anti-metacestode antibodies in blood donors from the Uberlândia Regional Hemocenter, a total of 1133 serum samples were analyzed by the indirect immunofluorescence test and the ELISA at the Uberlândia Federal University Cysticercosis Laboratory. Seropositivity was 5.6%, showing differences according to their cities of origin: Araguari (13.5%), Tupaciguara (5.0%), Monte Alegre de Minas (4.8%) and Uberlândia (4.7 %) (SILVEIRA-LACERDA EP. Et al. Anti-Taenia solium metacestodes antibodies insertum from blood donors from four cities of Triangulo Mineiro area, MinasGerais, Brazil, 1995. Journal of the Tropical Medicine Institute of São Paulo, 44: 229-231 , 2002), thus demonstrating the endemicity of cysticercosis in the sampled population and the problematic of the teniasis-cysticercosis naregion complex.

The metacestode form may persist for long periods, in many cases for years, through the actions of its excretion and secretion products, which modulate the host immune response without bidding for an inflammatory reaction, the absence or reduction of inflammation being a result of deserin proteases, which inhibit complement activation, delymphocyte activation and cytokine production, with emphasis on interleukins (IL) IL-2, IL-5 and IL10 (WANG IC. et al .. Suppression of host Th1-type granulomatousinflammation by Taenia solium metacestodes is related to down-regulation ofosteopontin gene expression (International Journal for Parasitology, 38: 239-248,2008).

In contrast, the inflammatory response around one or more degenerate metacestodes may initiate symptomatic disease through lymphocyte proliferation and further differentiation into Thh1 and Th2 effector cells, with subsequent production of various cytokines or plasma cells, with consequent production of specific antibodies. . There is a parasite - host balance that is maintained as a result of the parasite 's ability to survive in the host for long periods (SCIUTTO E. et al. Theimmune response in Taenia solium cysticercosis: protection and injury, ParasiteImmunology, 29: 621-636, 2007).

The pathology, clinic, and immune response to the parasite are related to and depend on both the location, number, size, and developmental stage of the cysticerci, as well as on the reaction of the parasitized tissues (DEL BRUTTO OH. Neurocysticercosis. Seminars inNeurology, 25 : 243-251, 2005).

The severity of the symptoms of this disease is usually associated with the chronic inflammatory response suggested by antigen persistence, which may also be influenced by glycoconjugates expressed by T. solium metacestoids (ALVAREZ Jl, RIVERA J, TEALE JM. Differentialrelease and phagocytosis of tegument glycoconjugates in neurocysticercosis: implications for immune evasion strategies (Plos Neglected Tropical Diseases, 2: 1-12,2008).

The knowledge of the immunological mechanisms involved in the parasite-host relationship has helped in understanding the pathogenesis of human parasaparosis. Consequently, this knowledge has collaborated in the development of immunological tests for the laboratory diagnosis of the disease (VAZ AJ. Immunological diagnosis of parasitic diseases. In: DE CARLI GA. (Ed). Clinical parasitology: selection of laboratory methods and techniques of human parasitic diseases. São Paulo : Atheneu, 2001, p.505-539).

The diagnosis of neurocysticercosis is based on the combination of clinical, epidemiological, radiological and serological data (HAWK MW. Et al.Neurocysticercosis: a review. Surgical Neurology, 63: 123-132, 2005). Magnetic Resonance Imaging (MRI) and / or Computed Tomography (CT) are the most sensitive and specific diagnostic tools. However, due to their high cost and restricted availability, they may be limited to use in developing countries with high infection rates.

The standard or absolute criterion for the diagnosis of CN includes (i) histological demonstration of the parasite on biopsy or operating material, (ii) evidence of cystic lesions showing the computed tomography or magnetic resonance scolex and (iii) parasitic fundus visualization in cases of Intraocular NC (DEL BRUTTO OH. Et al. Proposal for diagnostic criteria for human cysticercosis and neurocysticercosis. Journal of the Neurological Sciences, 142: 1-6, 1996) .The clinical diagnosis of cysticercosis is difficult to be performed in asymptomatic patients, and is associated with symptomatic patients. , to physiological changes caused by the location of the metacestode forms. In the case of NC, it is not always easy due to the polymorphism of neurological manifestations common to other CNS diseases (YANCEY LS1 DIAZ-MARCHAN PJ1 WHITE AC. Cysticercosis: recent advances in diagnosis and management of neurocysticercosis. Current Infectious Disease Reports, 7: 7-39 , 2005).

Clinical manifestations are not specific and there is no easy method of confirming the diagnosis of NC (YANCEY LS1 DIAZ-MARCHAN PJ, WHITEAC. Cysticercosis: recent advances in diagnosis and management of neurocysticercosis. Current Infectious Disease Reports, 7: 7-39, 2005) .

The development of immunological tests, based on the detection of specific antibodies in serum and Iiquor (CSF), results in reliable tools for the diagnosis of CN. A difficulty in diagnosing NC is the use of CSF. Although CSF samples have excellent utility in the immunodiagnosis of NC in relation to serum samples, CSF collection is an invasive procedure that requires a specialized specialist in an appropriate site (MACEDO HW. Et al. Evaluation of immunological tests for the diagnosis of neurocysticercosis. Laboratory Medicine, 38: 93-103, 2002). The use of serum samples in tests using total extracts has shown low specificity indices (MACHADO GA. Et al. Assessment of antigenic fractions of varying hydrophobicity from Taenia solium metacestodes for the diagnosis of human neurocysticercosis. Tropical Medicine and International Health, 12: 1-8, 2007 ).

Most tests using total antigens lose sensitivity and specificity, cross-reactions often occur with other parasites, especially cystic and multilocular echinococcosis, caused by the Evarian stage of Echinococcus granulosus and E.multilocularis, respectively (Kong Y. et al. Immunoelectrophoretic analysis of majorcomponent). proteins in cystic fluid of Taenia solium metacestodes (Korean Journal of Parasitology 30: 209-18, 1992).

The development of immunodiagnostic techniques has contributed with significant importance in seroepidemiological studies, together with the various complementary tests that are indispensable in the diagnosis of NC (DORNY P et al. Immunodiagnostic tools for human and porcinecysticercosis, Acta Tropica1 87: 79-86, 2003). Observation of several data, as well as clinical, epidemiological and complementary exams (neuroimaging, neurophysiological, pathological and immunological methods) have been widely used in the diagnosis of NC, since these data together can define the clinical picture of a patient. patient (DELBRUTTO OH et al. Proposed diagnostic criteria for neurocysticercosis.Neurology, 57: 177-183, 2001).

New concepts in the diagnosis of this parasitosis have been refined in recent years; These include the identification and sequencing of specific antigens and the development of new diagnostic laboratory techniques (GARCIA HH et al. New concepts in the diagnosis and management of neurocysticercosis (Taenia solium). American Journal of Tropical Medicine and Hygiene, 72: 3 -9, 2005).

Immunodiagnosis of human cysticercosis is the direct diagnosis of infection by detection of antibodies against T. solium metacestode form antigens in serum, cerebrospinal fluid (CSF), saliva or blood on filter paper, almost always reaching the central role in the diagnosis of neurocysticercosis. (COSTA JM. Enzyme Test (ELISA) in the diagnosis of neurocysticercosis. Study of different antigenic extracts for the detection of IgG antibodies in serum and cerebrospinal fluid samples. Archives of Neuro-Psychiatry, 44: 15-31, 1986). if the Complement Fixation Reaction (RFC), the Indirect Hemagglutination Reaction (HAI), the Indirect Immunofluorescence Reaction (IFI) 1 the Enzyme-Linked Immunosorbent Assay (ELISA) initially applied in the diagnosis of cysticercosis and the Immunoblotting (Enzyme-Linked Imbloelectron). - EITB).

Among all immunological methods, ELISA has been the most studied test in the diagnosis of NC because it presents significant sensitivity and specificity, easy and simple execution and low cost. Two immunological tests are recommended, one of high sensitivity and the other very specific, for greater safety in the interpretation of the results (COSTA-CRUZ JM et al. Occurrence of cysticercosis in autopsies performed in Uberlândia, Minas Gerais, Brazil. Archives of Neuro-Psychiatry, 53: 227-232, 1995).

An accurate diagnosis is the first step to proper medical treatment. In view of this objective, several patents address the use of kits with homologous (sol. Solium) MXPA02004417A or heterologous (T. crassiceps) BRPI0504527 and US005874251 antigens for the diagnosis of cysticercosis.

Total antigenic extracts are widely used in epidemiologic studies in endemic areas, but identification and purification of glycoproteins are the main objective of most nodiagnostic serological studies of NC (BUENO EC et al. Application of synthetic 8-kD andrecombinant GP50 antigens in the diagnosis of neurocysticercosis by enzyme-immunosorbent assay The American Journal of Tropical Medicine and Hygiene, 72: 278-283, 2005), since the use of different total antigen extracts of the metacestode form of T. solium (total saline extract, gallbladder fluid and total alkaline extract) result in significant differences in immunological tests (COSTA JM. enzyme immunoassay (ELISA) in the diagnosis of neurocysticercosis. Study of different antigenic extracts in the detection of IgG antibodies in serum and cerebrospinal fluid samples. Neuro-Psychiatric Files, 44: 15- 31, 1986).

Several purification techniques have already been described, in which the desensitivity and specificity rates were close to 100% (ASSANA E et al.

Isolation of a 14 kDa antigen from Taenia solium cyst fluid by HPLC and its evaluation in enzyme Iinked immunosorbent assay for diagnosis of porcinecysticercosis. Research in Veterinary Science, 82: 370-376, 2007; SATO MO. etal. Evaluation of purified Taenia solium glycoproteins and recombinant antigensin the serologic detection of human and swine cysticercosis. The Journal ofInfectious Diseases1194: 1783-1790, 2006).

The use of purified peptides has shown excellent results in several areas of immunodiagnosis, where they are considered excellent candidates for antigens due to the high sensitivity and specificity indices, as well as showing very little cross reactivity. Accordingly, synthetic peptides are promising areas of research for both immunological testing and vaccine development (FERRER E et al. Molecular cloning and characterization of the Ts8B1, Ts8B2 andTs8B3, three new members of the Taenia solium metacestode 8 kDa diagnosticantigen family. Molecular and Biochemical Parasitology, 152: 90-100, 2007; SAKO Y. et al., Recombinant antigens for serodiagnosis of cysticercosis andechinococcosis. Parasitolgy International, 55: 569-573, 2006).

In recent years several researchers have been testing new techniques to diagnose NC: a coagglutination test (CO-A) has been used to detect T. solium metacestode antigens in the urine of patients with NC1 finding moderate sensitivity and specificity (PARIJA M etal. Detection of specific cysticercus antigen in the urine for diagnosis of neurocysticercosis Acta Tropica, 92: 253-260, 2004), a 10 kDarecombinate protein of T. solium expressed in a bacterium was used to diagnose this disease by immunoblot (LEE EG et al. Feasibility of recombinant baculovirus-expressed 10-kDa antigen in the serodiagnosis of Taenia solium neurocysticercosis Transactions of the Royal Society of TropicalMedicine and Hygiene, 99: 919-926, 2005,) Epurified cloned cDNA inserts were used for detection of active NC by ELISA with serum and CSF samples, obtaining high sensitivity and specificity (FERRER E et al. Molecular cloning and c Characterization of the Ts8B1, Ts8B2 andTs8B3, three new members of the Taenia solium metacestode 8 kDa diagnosticantigen family. Molecular and Biochemical Parasitology, 152: 90-100, 2007), α antigens. saginata were tested as an alternative for the diagnosis of human CN, obtaining very satisfactory results (OLIVEIRA HB et al.Application of Taenia saginata metacestodes as an alternative antigen for theserological diagnosis of human neurocysticercosis. Parasitology Research, 101: 1007-1113, 2007), and fractions obtained by purifying the saline extract of T. trium X-114 were evaluated in the immunodiagnosis of human daneurocysticercosis, finding satisfactory results (MACHADOGA et al. Assessment of antigenic fractions of varying hydrophobicity fromTaenia solium metacestodes for the diagnosis of human neurocysticercosis.Tropical Medicine and International Health, 12: 1- 8, 2007); Other authors have tested various antigens for the diagnosis of NC by the Dot Blot test (MANDAL J et al. Evaluation of Iower molecular mass (20-24 kDa) Taeniasolium cysticercus antigen fraction by ELISA and dot blot for the serodiagnosis of neurocysticercosis in children. Parasitology Research, 102: 1097-1101,2008).

Several patents describe different techniques for diagnosing CN with various total or fractionated antigens, as well as purified proteins. US4801532 relates to a test for detection of NCative in both serum and CSF samples. US2006264614 and CA2526023, however, refer to purified T24 protein for cysticercosis and NC detection. US5354660 deals with the use of glycoproteins (GP) GP50, GP42, GP24, GP21, GP18, GP14 and GP13 in the diagnosis of NC by immunoblot technique. CA1340196 deals with the use of Cysticercuscellulosae secreted / secreted proteins in the immunodiagnosis of CN

The use of molecular markers has been extensively studied to define patterns of genetic diversity and interspecific variation for Taenia sp and to improve diagnostic epeptide markers for vaccination (HOBERG EP. Taenia tapeworms: Their biology, evolution and socioeconomic significance. Microbes and Infection, 4: 859-866,2002) .The immediate interest in the therapeutic application of NC immunity focuses on stimulating the immune system against parasite antigens, in turn of the production of a vaccine, CN1314184 reports the use of Cisticercus cellulosae extract in vaccination. of pigs, this resulted in a protection rate of 94%, besides being safe and without toxicity. Patent CN1231339 refers to a nucleic acid vaccine for the prevention and cure of human and swine cysticercosis. It consists of a three-gene expression plasmid with protective capacity (cC1, cC3 and CC4) and a gene-related expression unit. IFN gamma IL-5 porcine, the vaccine was effective in protecting against human and porcine cysticercosis.

CN1634596 relates to a vaccine consisting of a hepatitis B virus as a carrier with an insert of a cysticercus gene with protective capacity at multiple sites between the first and amino acid 183, this gene has been expressed and the protein expressed by it resulting in a vaccine. able to prevent swine cysticercosis.

US6306365-B1, US6296832-B1, US6068829-A refer to the identification of Binding Peptides to various organs of the human body isolated by injection of peptide libraries into living persons. These peptides can be used in the diagnosis of different pathologies.

W09946284-A; EP1062232-A; WO9946284-A2; AU9930783-A; EP1062232-A2; US 6174687-B1; US6232287-B1; JP2002506079-W; AU762991-B; US6610651-B1; US6784153-B1; US2005074812-A1; US6933281-B2 report the use of libraries administered in live mice to isolate ligand peptides to various organs.

US2008124277 discloses the use of library-derived peptides as drug delivery agents for inhibition of deangiogenesis and tumor growth and apoptosis induction.

US7083945, US2006068421, US2005202512, GB2408332 US2003104604, EP1452599, US2006035223 use the PhageDisplay technique to express recombinant binding polypeptides, and propose methodologies that make the technique more efficient.

Phage display is an efficient technique for identifying peptides or proteins that bind to other molecules for a variety of purposes, such as identifying peptide linkers to other molecules. The technology is based on the principle that polypeptides can be expressed on the surface of phagefiltration by inserting a coding DNA segment into the same genomes, so that the expressed peptide or protein is exposed on the surface of the fused particle to an endogenous protein.

Phage Display technology can benefit diagnostics by identifying molecules currently impossible to obtain by traditional methods. Recombinant antibodies against toxic antigens or conserved sequences and carbohydrates can be isolated (Soderlind E et al., Recombining germLinederived CDR sequences for creating diverse single-framework antibody libraries. Nature Biotechnology 18: 852-856, 2000). Crucial advantage of this technology lies in the direct link that exists between the experimental phenotype and the encapsulated genotype, showing the evolution of selected ligands to optimized molecules (Azzazy HM et al. Phagedisplay technology: clinical applications and recent innovations. Clinical Biochemistry 35: 425-45, 2002) .

This technique was developed by George Smith in 1985, who first expressed the restriction enzyme EcoRI as a fusion of phage capsid protein (pVIII). Bacteriophage M13 (Sidhu SSEngineering M13 for phage display. Biomolecular engineering 18: 57-63, 2001) is used, a filamentous bacteriophage virus that infects gram-negative bacteria which in turn has F pilus (Rodi DJ, Makowski L. Current Opinion in Biotechnology 10: 87-93, 1999). The phage particle is formed by a single strand of DNA surrounded by a protein coat consisting of five proteins (p11, pVI, pVII, pVIII and pIX). Of these five proteins there are approximately 2800 copies of pVIII and five copies of plll. In this system, the gene encoding the peptide or protein of interest is generally fused to one of the genes of these two phage protein coat proteins (Brígido MM1 Maranhão AQ. Libraries Presented in Phage Biotechnology Science and Development, 26: .44-55, 2002). Thus, the peptide is expressed at the N-terminal end of pII or pVIII.

The DNA sequences of interest are inserted into a genome localization of filamentous bacteriophages, so that the encoded protein is expressed on the surface of the filamentous phage as a fusion product to one of the phage surface proteins (Azzazy H. et al. Phage displaytechnology: clinical applications and recent innovations (Clinical Biochemistry 35: 425-45, 2002). The peptide or protein expressed on the phage surface enables binding affinity-based sequence selection for a target molecule by an in vitro selection process called biopanning (Parmely SF1 Smith GP. Antibody-selectable filamentous fd phage vectors: affinity purification of target genes. Gene 73: 305-318, 1988).

Through the Phage technique NTP terminal epitopes of Tpmy (T. solium paramiosin), which are highly immunogenic in this molecule, were mapped. Using different selection and elution methods, they identified peptides with homology to the protein in question, suggesting the identification of a linear and discontinuous epitope, with probable immunodominant determinant properties, revealed computational antigenicity analyzes (GAZARIAN KG et al. Epitope mapping onN-terminal region of Taenia solium paramyosin (Immunology Letters, 42: 191-195, 2000). This technique has been used in the understanding of diseases caused by viruses, bacteria, protozoa and parasites and the interaction between their antigens and the host immune response in the search for mapearepitopes or vaccine development.

This methodology has been shown to be useful not only for mapping protein-protein interactions but also for identifying important target molecules for the development of vaccines and drugs against parasites such as Plasmodium sp, causing malaria and Brugia malayi, causing lymphatic defilariasis (LANZILLOTTI R, COETZER TL. Phage display: a useful toolfor malaria research Trends in Parasitology1 24: 18-23, 2008; GNANASEKARM et al., Novel small heat shock protein 12.6 (HSP12.6) from Brugia malayifunctions as a human IL-10 receptor binding protein. BiochemicalParasitology, 159: 98-103, 2008), thus developing self-contained delivery vehicles (BENHAR, I. Biotechnological applications of phage and cell display. BiotechnoIogyAdvances, 19: 1-33, 2001).

The ability of recombinant phages to deliver antigens for swine cysticercosis avaccination has been tested, demonstrating a protective capacity of this vaccine against the disease (MANOUTCHARIAN, K et al.Recombinant bacteriophage-based multiepitope vaccine against Taenia soliumpig cysticercosis. Veterinary Immunology and Immunopathology, 99: 11-24,2004).

T. crassiceps antigens from a cDNA library were isolated and evaluated in the diagnosis of CN, 3 clones were found to recognize CSF antibodies and confirmed NC patient serum (ROBLES, Y. et al. Isolation of the Taenia crassiceps antigens from a phagedisplay). cDNA Iibrary and evaluation of their use for diagnosis of Neurocysticercosis (Clinical Immunology, v.116, pp. 265-270, 2005).

Affinity selection of phage library peptides using patient RLC has been suggested as an attractive tool for the development of new reagents for a simple and sensitive diagnostic test and for understanding the molecular mechanisms of NC pathogenesis (MANOUTCHARIAN, K et al., Characterization of cerebrospinal fluidantibody specificities in neurocysticercosis using phage display peptide library. Clinical Immunology, United States, v. 91, n.1, pp. 117-121,1999).

Given the difficulties of serological tests, libraries of random peptides expressed on phage surface have been developed in recent years, increasing the interest of this technique (Phage display) as a source of identification of a large number of epitopes and mimetopes.

The application of phage peptide libraries for the identification of specific amino acid antibodies brings important information about molecular mechanisms of diseases and also enables new diagnostic tools. Since this strategy does not require detailed information on the natural antigen, it is possible to identify agents responsible for diseases of obscure etiology using only patient serum and a peptide library.

Several applications of phage-exposed random peptide libraries have been successfully performed, such as epitope mapping, vaccine development and identification of non-peptide ligand mimetic peptides, and preparation of monoclonal antibodies by the use of phage libraries generated by in vitro immunization of cells. peripheral blood mononuclear cells (PBMC); study of protein-protein interactions, in addition to the use of phages as carriers in drug delivery against cancer cells (HOF D, HOEKE MO, RAATS JMH. Multiple-antigen immunization of chickens facilitates the generation of recombinant antibodies to autoantigens. Clinical and Experimental Immunology, 151: 367-377, 2007; BAIR CL Aphage display system designed to detect and study protein-protein interactions.Molecular Microbiology, Article in press, 2008; MATSUMOTO SE et al .A rapid and efficient strategy for generating antigen-specific human monoclonal antibodyby in vitro immunization and phage display method.Journal of Immunological Methods, Article in press, 2008; BAR H, YACOBY I, BENEFIT I.Killing cancer cells by targeted drug-carrying phage nanomedicines (BMCBiotechnology, 8: 37-50, 2008).

Advantages of using the technique are the ability to select high affinity ligands, the ability to produce soluble proteins, low cost, easy handling and rapidity (SMITH GP, PETRENKO VA. Phagedisplay. Chemical Reviews, 97: 391-410, 1997 ).

T. solium is not yet well characterized at the molecular level and this phage display technique can define epitopes that can be used to detect antibodies present in samples of patients with NC, to develop a simple and sensitive immunodiagnostic test, and to provide information on the molecular mechanisms of the disease (MANOUTCHARIAN K et al. Characterization of cerebrospinal fluid antibodyspecificities in neurocysticercosis using phage display peptide library. Clinical Immunology 91: 117-121, 1999).

In the pursuit of a fast, efficient methodology capable of providing a more accurate diagnosis of NC1 as well as the use of specific ligands as substance carriers, the present invention proposes the use of Phage Display for the identification and selection of IgG specific ligand peptides from patients. with NC1 determining functional protein motifs through the interaction of peptide libraries presented on filamentous phage surfaces with parasite proteins. In combination with other technologies, this invention is readily accepted because the new technology has high sensitivity and flexibility of use relative to other current technologies for identifying new markers for diagnosis, monitoring, prognosis and use with cancer drug carriers, as well as other pathologies.

Knowing that there are currently few markers with low diagnostic efficiency, it is necessary to develop new, more reliable, fast and accurate biomarkers that will aid in the diagnosis, prognosis and treatment of CN and other pathologies.

Thus, the present invention proposes the use of peptide sequences, fused or not, to carriers such as filamentous phages, drugs, or any other type of carrier and their use in the detection and identification of IgG in patients with NC for diagnostic tests.

The invention may be better understood by detailed description by way of examples for the experimental results obtained. The experimental procedures involved are detailed in sequence. The methodology employed for the selection, characterization and use of recombinant peptides and protein motifs that interact with IgG present in the serum of patients with NC was applied to different serum samples of patients with NC, other parasites and apparently healthy, proving the efficiency of their use for diagnosis of patients with CN.

Example 1:

This example relates to the selection and characterization of recombinant peptides and protein motifs that bind to NC patients immunoglobulins G. Several parameters can be used to indicate the successful selection of each peptide, as can be seen in TABLE1. These same parameters were previously used (Rodi DJ et al. Quantitative assessment of peptide sequence diversity in M13 combinatorial peptide Phage Display Libraries. Journal of Molecular Biology 322: 1039-1052,2002).

TABLE 1 presents the identity of the selected amino acid sequences, as well as their respective observed frequencies (FO), expected frequencies (EF), which correspond to the probability of the random sequence; amplification of the peptides resulting from the selection process relative to the expected frequency of the peptides in the original library; degree of information of each peptide (l (m)), which is given by -In (random probability probability); and the likely number of independent clones within the library (λ). The greater the degree of information, the more effective the dopeptide selection was, and the rarer it is in the library.

TABLE 1

<table> table see original document page 19 </column> </row> <table> continued TABLE 1

<table> table see original document page 20 </column> </row> <table>

Ten clones with different sequences were obtained (Seq. ID No. 1 to 10), all of which presented a high degree of information. Peptides that exhibit high information are less likely to occur randomly than those with low information (Rodi DJ et al.

Quantitative assessment of peptide sequence diversity in M13 combinatorial peptide Phage Display Libraries. Journal of Molecular Biology 322: 1039-1052,2002).

The high degree of information of each selected peptide obtained by bioinformatics analysis validates the bioppaning data and proves the efficiency of the Phage Display technique.

It was also observed that there was a great enrichment of all selected peptides in relation to their expected frequencies in the phage library, suggesting that they are specific for neurocysticercosis.

With the possibility of binding of the peptides to some carboxy terminal to amino terminal tumor molecule we also analyzed the reverse sequences identified as Seq. ID

11 to Seq. ID 20. For example, Seq. ID # 1 has the reverse sequence Seq. IDN2 11, Seq. ID # 2 has the reverse sequence Seq. ID No. 12, as follows, to Seq. ID No. 10 which has the reverse sequence Seq. IDN2 20 as shown in TABLE 2.

TABLE 2

<table> table see original document page 20 </column> </row> <table> continued TABLE 2

<table> table see original document page 21 </column> </row> <table>

Example 2:

This example refers to the protein sequences of the selected peptide that showed similarity with some proteins of several species of the genus Taenia, among them the most important ones: T. solium and T. saginata, which are present in the database.

TABLE 3 presents the alignment of the protein sequences of the selected peptides showing the homologies found with the main proteins related to T. solium and T. saginata species in the GeneBank data bank by BLAST, with the accession numbers that obtained similarity with the selected clones.

TABLE 3

<table> table see original document page 21 </column> </row> <table> continued TABLE 3

<table> table see original document page 22 </column> </row> <table> continued TABLE 3

<table> table see original document page 23 </column> </row> <table>

When we analyzed the clones obtained against the proteins of genus Taenia we found similarity with several proteins with various functions, several of them with potential for drug or vaccine targeting, but more emphasis was given to T. solium and T. saginata proteins.

The clones Seq. ID No. 4, Seq. ID No. 7 had similarity to c-jun deT. solium and Seq. ID No. 10 with c-fos of the same parasite. These are highly conserved with respect to other parasite genes, being identical between T.solium and T. cracisseps, being related to the proliferation and differentiation of the parasite and may influence infection.

The clone Seq. ID No. 1 showed homology to a decalreticulin precursor of a T. solium calcium-binding protein with a function of controlling intracellular calcium homeostasis. After being secreted by the acalreticulin cell it can bind to C1q, a subcomponent of the complement system, interfering with activation of the local complement complement cascade of inflammation by binding to C1q, interfering with the antibody-associated complex.

Seq. ID No. 3 and Seq. ID N 9 were similar to the annexin family proteins, associated with various phenomena related to transport, organization and ion channel formation, and their distribution coincides with the degree of granulomatous inflammation surrounding them.

Seq. ID No. 4 and Seq. ID # 7 were similar to paramiosin, also known as antigen B, which plays an important role in cysticercus survival as it inhibits the complement fraction cascade C1, which has been identified as a candidate for helminth vaccines.

Seq. ID # 26 aligned with T. solium TGTP1, a deglucose transporter that is on the outer surface of the adult and oval forms and may be candidates for parasite intervention, these could potentially be targets for vaccines.

Example 3:

This example refers to ELISA tests for studying the immunoreactivity of selected recombinant phage clones. Serum IgG levels obtained by ELISA against Seq clones. ID No. 2 1a Seq. ID No. 10, obtained by the bioppaning process, with 1: 200 dilution serone samples from group 1 subjects (neurocysticercosis n = 40); 2 (patients infected with Taenia sp. And other parasites n = 40) and 3 (healthy individuals n = 40) are shown in FIGURES 1-10, where the horizontal line indicates IR = 1 and the symbol%, positivity.

In FIGURE 1, for clone Seq. ID No. 1, 80% (32/40) of the samples were positive for group 1, 2.5% (1/40) in group 2 and 5% (2/40) in group 3.

In FIGURE 2, we observe that for clone Seq. ID No. 2 52.5% (21/40) of the samples were positive in group 1 and none (0/40) in groups 2 and 3.

FIGURE 3 shows the reactivity for clone Seq. ID No. 3, for which 95% (38/40) of the samples in group 1 were positive and respectively 5% (2/40) and 7.5% (3/40) in groups 2 and 3.

In FIGURE 4, when testing clone Seq. ID No. 4 it was observed that 97.5% (39/40) of the group 1 samples were positive, 15% (6/40) and 10% (4/40) for groups 2 and 3, respectively.

With clone Seq. ID NO: 5, FIGURE 5, a positivity of 97.5% (39/40) was observed in group 1 and groups 2 and 3 17.5% (7/40) and 10% (4/40), respectively.

FIGURE 6 shows positivity for clone Seq. ID No. 6, group 1 presented 70% (28/40) of positive samples in group 1 and groups 2 and 3, respectively, 5% (2/40) and 10% (4/40).

The positivity for clone Seq. ID No. 27, as shown in FIGURE 7, in group 1 was 65% (26/40), no sample from group 2 was positive and in group 3 the positivity was 7.5% (3/40).

When testing clone Seq. ID No. 8, 82.5% (3/40) of the samples were positive for group 1 and respectively 25% (10/40) and 2.5% (1/40) in groups 2 and 3, as shown in FIGURE 8

FIGURE 9 shows that for clone Seq. ID N-9, 100% (40/40) positivity occurred in group 1, 10% (4/40) in group 2 and 5% (2/40) in group 3.

FIGURE 10 shows positivity for clone Seq. ID N-10, where 97.5% (39/40) of group 1 samples were positive and 7.5% (3/40) in groups 2 and 3.

The results demonstrate that the peptides were specific to the target used in the selection. Most clones showed reactivity, although with differentiated phage profiles. Through the methodology it was possible to confirm the specificity of the selection because most clones presented positivity in group 1 (reactivity index-IR greater than 1).

In competition assays, proteins present in the total extract of T. solium metacestoids at different concentrations inhibited the binding of IgG to clones adsorbed on polystyrene plates in ELISA tests.

The data demonstrate that increasing amounts of serum-added parasite proteins interfere with IgG binding at the time of recognition of phage in the plate. The negative control used was a vector without insert, represented by wild phage M13KE and the positive control was demonstrated by adding the sera pool of patients with NC without antigen addition.

These data indicate that peptides expressed in phage clones may be specifically recognized by IgG present in the serum of patients with NC and these peptides are able to mimic the epitopes present in the T. solium total metacestode proteins. Thus, it was possible to demonstrate the inhibition of reactivity by competition assays for the clones obtained.

TABLE 4 shows the calculations of sensitivity, specificity, diagnostic efficiency (ED), and Youden index obtained in the ELISA tests for the detection of T. solium anti-metacestode IgG antibodies in serum samples using the selected clones. TABLE 4

<table> table see original document page 27 </column> </row> <table>

Several authors have tested different antigens, purified ourecombinant, with different indices of sensitivity and specificity. The phages tested in this work obtained sensitivity and specificities similar or superior to those demonstrated by other authors.

TABLE 5 shows the reactivity of serum samples from Group 2 patients (patients infected with Taenia sp. And other parasites) using the selected phage clones.

Some clones (NC22, NC28, NC212, NC315 and NC3IO) did not react with serum samples from patients infected with E. granulosus, which shows a great advance, since cross-reactivity with serum samples from patients infected with this parasite are frequently reported. .

The study of individuals from Group 2, ie individuals infected by Taenia sp. and for other parasites, it is important in data analysis because it represents the reality of the population, especially in our country where parasitic diseases are highly prevalent. Cross-reactivity may be related to concomitant infections or the presence of antibodies remaining from previous infections. TABLE 5

<table> table see original document page 28 </column> </row> <table>

For a better understanding of the examples used, below is a detailed description of the experimental procedures adopted.

In order to obtain IgG-binding peptides present in the serum of patients with NC, 120 serum samples were divided into 3 groups:

- Group 1: Serum samples from patients with definitive diagnosis of neurocysticercosis, where 40 serum samples from patients with definitive diagnosis of NC were used according to the previously proposed criteria (Del Brutto et al. Proposal for a diagnostic diagnosis for humancysticercosis and neurocysticercosis. Journal of the Neurological Sciences142: 1-6, 1996). Under these criteria, a definitive diagnosis of NC is made in two ways: the first is by the presence of an absolute criterion that could be the histological demonstration of the parasite by biopsy, CT or MRI visualization of the scolex or direct visualization of the parasite in the subretin through the fundus examination; and the other way is the presence of two main criteria, a secondary criterion and an epidemiological criterion. In this study, patients with definitive diagnosis were selected by an absolute criterion, which, in the present study, was the imaging visualization of the metachestodial form of T. solium.

- Group 2: Serum samples from Taenia sp. e other parasites where the objective was to verify the cross reactivity in the immunological methods. Forty serum samples from patients infected by: Hookworm (n = 5), Ascaris Iumbricoides (n = 5), Echinococcusgranulosus (n = 4), Enterobius vermicularis (n = 4), Hymenoiepis nana (n = 4), Sehistosoma mansoni (n = 4), Strongyloides stereoralis (n = 4), Taenia sp. (n = 6) eTriehuris triehiura (n = 4). Serum samples were collected from individuals with positive stool parasitological examinations following the analysis of three faecal samples by HPJ methods (Hoffmann, WA; Pons, JA; Janer, JL. Thesedimentation concentration method in schistosomiasis mansoni, Puerto Rico.Journal of Public Health Tropical Medicine 9: 283-291, 1934) and / or Baermann (Baermann, S. Eine Einfache Methode zur Auffindung von Ankylostomum (Nematoden) - Larven in Erdproden. Mededeel mit. H. Geneesk. LabWeltevredem Feestbundel, Batavia, 41-47, 1917), all being screened by the HC-UFU Clinical Analysis Laboratory.

- Group 3: Control serum samples from apparently healthy individuals, where 40 serum samples from asymptomatic voluntary subjects were used, which in three stool parasitological examinations performed by the HPJ method were negative for intestinal parasites and had no previous history of teniasis-cysticercosis.

For the purification of IgG, sera pool from patients diagnosed positively for neurocysticercosis, other parasites and apparently healthy individuals were used.

Immunoglobulin purification was performed by magnetic beads from 100 μΙ of the serum pool of patients with NC.

They were placed in an eppendorf 100 μΙ of protein G beads, which were washed 3 times with 0.1 M MES buffer, pH 5.0; Then 100 μΙ dopool of sera was added, and incubated with shaking for 30 minutes. Then the beads were washed with MES buffer and the elution was added with 30 μΙ 0.1 M citrate buffer pH 2.0, the supernatant magnetic separator was removed with the remaining immunoglobulins G (IgG). OpH was neutralized with 1: 3 Tris buffer (1 M) pH 9.1.

The amount of antibodies obtained by the protein detection and quantification method (Johnstone, AP; Thorpe, R. Immunochemistry inpractice. Blackwell Science, 318 p., 1987) where the Sample Concentration = Absorbance at 280 nm X Dilution Factor was estimated. / extinction coefficient at 280nm (1,36 for IgG).

The same procedure was performed for the purification of antibodies against patients with other intestinal parasites and apparently healthy individuals.

To elute IgG-specific phages from patients with NC, the total extract of T. solium metacestoids was used for the preparation. Fifty intact or ruptured T. solium metacestoids were used for the preparation of total saline extract (S) (Costa, JM. Test Enzyme (ELISA) in the diagnosis of neurocysticercosis.Study of different antigenic extracts in the detection of IgG antibodies in serum and cerebrospinal fluid samples. Neuro-Psychiatric Files 44: 15-31, 1986). The metacestoids were ground to grain and resuspended in 2.5 ml of distilled water and then the mixture was subjected to tissue homogenizer (Glas Col®, USA) for five 1-minute cycles in an ice bath and further ultra-treated. sound (Thornton, Impec Eletrônica, São Paulo, Brazil) at 40kHz for four cycles of 30 seconds each in an ice bath. After isolating with 2.5 ml NaCl solution (0.3 M), three more ultrasound cycles were employed. The mixture was then subjected to 4 ° C for two hours under slow agitation and then centrifuged at 12,400 g (DuPontSorvall® Products Newton, Connectcut, USA) for 30 minutes at 4 ° C. The obtained supernatant constituted the S extract.

For the selection of synthetic peptides (expressed in filamentous phage protein III protein) reactive with the antibodies described above, a random 12-amino acid (aa) peptide library (Ph.D-12 mer-New England Biolabs) was used. . The selection procedure was performed according to the manufacturer's recommendations, with some modifications.

Plaque sensitization was achieved by placing 150 μΙ / well of the previously purified IgG at 100pg / ml diluted in 0.1 M bicarbonate buffer (pH 8.6) with subsequent overnight incubation at 4 ° C under slow shaking in a humid chamber.

Then, the plate was dried by tapping the counter paper to remove residual solution to block it. Blocking is blocked by addition of blocking buffer (0.1 M NaHCO3, pH 8.6; BSA 5mg / mL) 300μΙ / well, 1 h at 4 ° C, under slow agitation. After incubation, it was washed 6 times with 200 μΙ / well TBS-T (50mM Tris HCl-pH 7.5, 150mM NaCl-0.1% Tween 20) for one minute and then dried. After receiving 10 μΙ of the phage library in 90 μΙ of TBS-T, which were placed in the IgG-sensitized well of patients with other parasitic diseases, 20 μΙ of TBS was placed in the other wells so that they were not dry.

The antibody - phage mixture was incubated for 1 hour under slow agitation at room temperature and then unbound phage were transferred to the IgG-sensitized well of apparently healthy individuals, and then to the IgG-sensitized well of NC-positive individuals. phages were finally placed in the well with the IgG of patients with NC so that those who were not disease specific would be linked in the other wells, thus making negative selections. Non-IgG-binding phages from NC patients were discarded and the plate washed an additional 10 times with 200 μΙ of 0.1% TBS-T, and then prepared for the elution of serum-bound phages from NC patients with 100 μΙ buffer. elution (total metacestode extract of T. solium 200 pg / ml in TBS-T) for 40 minutes at room temperature. The eluate was transferred to an eppendorf kept under refrigeration. A small amount of this eluate (1 μΙ_) was titrated and the remaining one was used for re-amplification, performed on 20 ml of culture containing Escherichia coli tetracycline (ER 2738) in initial phase (OD 600 ^ 0.3) and incubated for 4.5 hours on a temperature controlled shaker at 37 ° C prior to the phage precipitation procedure for further titration.

The culture was transferred to a centrifuge tube and centrifuged (10min, 10,000 rpm, 4 ° C), the residual cells discarded and the supernatant transferred to a clean and re-centrifuged tube. The supernatant was transferred to a clean tube, where 1/6 volume of PEG-NaCl (20 wt% polyethylene glycol-8000; 2.5M NaCl) was added and the mixture was left to stand overnight at 4 ° C. The next day, the precipitate (15 minutes, 10,000 rpm, 4 ° C) was centrifuged, the supernatant was discarded and the tube was centrifuged under the same conditions for 5 minutes to remove residual supernatant. The phage pellet was resuspended in 1mL of 1X TBS, transferred to a centrifuged microtube (10 minutes, 10,000 rpm, 4 ° C) for residual cell removal and the supernatant transferred to a new microtube for addition of PEG-NaCI (1/6 volume). The mixture was incubated for 1 hour on ice, further centrifuged (15 minutes, 14,000 rpm, 4 ° C), the supernatant was discarded and the tube re-centrifuged for a further 5 minutes to remove residual supernatant, and the pellet resuspended for 200 µl. of 1X TBS and centrifuged for 1 minute, the supernatant was transferred to another tube ready for titration.

The re-amplified phages from the first round of selection were used in a second round (2.0 X 1011 cfu) and thus subsequently for a total of four rounds, and from the third round the wash buffer strength of 0 0.1% to 0.5%, then using 0.5% Tween 20 in all washes.

For all titrations 1 pL of phages diluted in 9 pL LB culture medium was used. The dilutions were 101 to 106 for the eluate and eluate, the phages in the titers as described above were incubated with 200 μΙ_ E. coli (ER 2738) and plated on solid medium containing IPTG (0.5mM) and X-gal ( 40 pg / ml) along with 3 ml AgaroseTop (10 g Bacto-Tryptone, 5 g yeast extract, 5 g NaCl 1 g MgCl 2 .6 H2 O / liter).

After overnight incubation at 37 ° C, blue colonies (resulting from the vector α-complementation system) were counted to obtain the input and output titers for all selection cycles (number of blue colonies X factor of dilution),

Blue-stained colonies showing the broken X-gal substrate and the expression of the fungal β-galactosidase gene by ER 2738 bacteria were separately re-amplified in microtubes for storage of the selected clones. To this end, isolated ascolonias were added to 1mL of E. coli-containing culture medium (ER 2738) in early growth phase and tetracycline, after overnight incubation at 37 ° C under vigorous agitation, the tubes were centrifuged at 10,000 rpm for 30 seconds, for removal of the supernatant from the culture to be used for DNA extraction, and subsequent storage of the pellet together with the same 50% glycerol volume. One hundred and fourteen duly identified clones were used for the characterization processes described below.

To obtain phage DNA, isolated screened colonies were used as described above. After growth, the cultures were centrifuged (10 minutes 10,000 rpm, 4 ° C), and the supernatant used for precipitation with 1/6 volume PEG-NaCl (20% polyethylene glycol-8000, 2.5M NaCl) for 10 min. at room temperature, the material was then centrifuged at 14,000 rpm for 10 minutes at 4 ° C, the supernatant was discarded and the pellet resuspended in 100 μΙ_ Sodium Iodide buffer (10mM Tris-HCI pH 8.0, 1mM EDTA and Nal 4M), and precipitation of nucleic acid was performed with addition of 250 μι. of absolute ethanol, this material was left for 10 minutes at room temperature, centrifuged for 10 minutes at 14,000 rpm at 4 ° C, the supernatant discarded and the pellet washed with 70% ethanol, then centrifuged and the pellet resuspended in 20 μΙ_ milli water. -Q (Barbas, CF et al. Phage display. The Iaboratory Manual. New York: Cold Spring Harbor Laboratory Press, 2001).

The quality and quantity of DNA present in the samples was evaluated by 0.8% agarose gel sampling.

The sequencing reaction was performed using the Big DyeTerminator (Pharmacia) kit, 3 μΙ_ of the DNA obtained and 1 pL of Universal Primer (96M13 - 5 'HO CCCTCATTAGTTAGCGCGTAACG 3' - Amersham Biosciences), which amplifies the coding region of aa. recombinant fusion peptides in recombinant M 13 phage.

The amplification reaction took place in a thermal cycler (Eppendorff). The amplified material was precipitated by adding 4M deammonium acetate and absolute ethanol to the samples, followed by centrifugation for 40 minutes at 14,000 rpm in a refrigerated centrifuge and washing with 70% ethanol with subsequent centrifugation for 10 minutes under the above conditions. Addition was performed with 10 µl of appropriate running buffer (Loadingbuffer). Sequencing was performed using the MegaBace 1000 automated sequencer (Amersham Biosciences).

The analysis of the DNA sequences from the automatic sequencer was processed in the equipment's own software (SequenceAnalyser, Base Calier, Cimarron 3.12, Phred 15). Soon after this pre-analysis, the vector sequences were removed and only those inserts with perfect residues were translated.

For data analysis, DNA sequences generated by sequencing were analyzed using bioinformatic programs available online.

For the translation of amino acid sequences, the New EnglandBiolabs library-specific DNA sequence program DNA2PR012 (http://relic.bio.anl.gov/dna2pro12.aspx) was used. To calculate the frequency of each amino acid present in the sequenced peptides and the diversity of the same ones, the AAFREQ program (http://relic.bio.anl.gov/aaf reqs3. Aspx) was used.

To calculate the diversity and standard derivation of amino acids at each position in the peptides, the DIVAA program (http://relic.bio.anl.gov/divaa.aspx) was used. The M0TIF2 program (http://relic.bio.anl.gov/motif2.aspx) was used to identify motifs of three amino acids within the peptide population that was selected against IgGs from patients with NC.

The consensus protein motifs generated were analyzed for homologies with Taenia sp proteins deposited on the GENEBANK by the BLAST - Basic Local Alignment Search Tool (http://www.ncbi.nlm.nih.gov/BLAST).

To find a maximum similarity point between the entire selected peptide population and a protein of interest involved with NC or with a Taenia genus parasite especially T. solium and T. saginata or a protein found in BLAST by homology, the MATCH program available in http://relic.bio.anl.gov/match.aspx.

For the ELISA tests, the clones considered more relevant after bioinformatics analysis, due to the repeated presence of consensus domains in the phage population, were used.

The procedure followed in general the same parameters as in the previous tests, so the clones were re-amplified and precipitated with PEG-NaCI to clean the culture medium, using clones NC22, NC28, NC212, NC215, NC223, NC39, NC310, NC336, NC41, NC43 (previously isolated by the debioppaning procedure) having as negative control on each plate the phage helper (M13).

Polystyrene plates (Interlab, Brazil) were sensitized with clonea a concentration of 1X1010 diluted in 100 µl carbonatobicarbonate buffer (pH 9.6) and incubated overnight under shaking at 4 ° C.

After three washes with PBS plus 0.05% Tween 20 (PBS-T) 300 µl PBS-Tween 20 blocking buffer 0.05% skimmed 5% (PBST-M) 1 was added and the plate incubated for an additional 1 hour at 37 ° C, and then washed 6 times. After the washes the serum samples were added, diluted 1: 200 in PBST-M pre-adsorbed with M13 (wild) phage viral particles, and the plate incubated for 1 hour at 37 ° C.

The plate was washed an additional 6 times for the addition of conjugated anti-human IgG antibody (IgG, Fc HRP - USBiological) diluted 1: 2000 in PBST-M1 with incubation at 37 ° C for 1 hour. After washing, the reaction was revealed using OPD (O-Phenylenediamine dihydrochloroide - Sigma Chemical), a final volume of 100 μΙ_ of appropriate buffer containing H2 O and discontinued by the addition of 25 μΙ_ of H2 S04 2 Ν. Absorbance readings were taken on a Multiscan Plus Version 2.03 reader with a 492 nm filter.

Inhibition experiments were performed in the same manner as the ELISA, except for the addition of a preincubation step of the serum comproteins present in the total T. solium metacestode extract prior to incubation in the plate immediately after blocking. Varying concentrations of total proteins were added in the order of 0 to 200 Mg.

The ELISA index (IE) was calculated using the average of the three negative samples containing phage helper (phage without synthetic peptide). (IE = optical density of each sample / helper cut off = mean + 2 standard deviations). Samples with IE> 1 were considered positive.

Sensitivity, specificity, diagnostic efficiency (ED) and Youden index (IY) were determined (Mineo, JR et al. Biomedical research: from planning to publication. Uberlândia: EDUFU: Editor of the Federal University of Uberlândia, 2005. 273p. ).

The geometric mean IR values for each extract in each group were calculated using the GraphPad Prism Version 4.0 program - Windowssoftware. BIOLOGICAL SEQUENCE LIST

(1) General Patent Application Information

(1) Applicant Data:

a) Name: Federal University of Uberlândia

b) Address: Av. João Naves de Avila, 2121 - Block 5L, Santa Monica Neighborhood, Zip Code: 38400-902 - Uberlândia, MG.

(ii) Title of the invention: "PEPTIDES BINDING TO IMMUNOGLOBULIN GPRESENTS IN THE SERUM OF NEUROCYSTICERCOSIS PATIENTS"

(iii) Number of sequences in the order: twenty (20)

(iv) Computer readable format: Microsoft Word; Windows XP, PC type computer.

(2) General sequence informationFeatures of sequenced molecules:

a) Type: PROTEIN

b) Protein Name: recombinant plll fused peptide

c) Sequence Identity: Seq. ID No. 1 to Seq ID No. 20.

d) Original source of molecules: bacteriophage M13

3- Information for Seq. ID # 1 1

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linearSequence description: Seq. ID # 1:

His Wing Asp Fen Asp Asn Arg Asn Asp Ser Ser Val1 5 8 12

3- Information for Seq. ID # 2 2

Sequence Features:

a) Size: 12 amino acidsb) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID # 2:

Thr Read Tyr Be Wing Be Read Lys Pro Val Pro Wing

15 8 12

3- Information for Seq. ID # 3

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID # 3:

Read Asn Pro His Tyr Tyr Pro Met Lys Pro Thr His1 5 8 12

3- Information for Seq. ID # 4

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID # 4:

Wing Asp Asp Trn His Thr Met Le Pro Pro Glu Arg1 5 8 12

3- Information for Seq. ID # 5

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID # 5:

Ser Val Thr Wing Asp Pro Glu Asn Ile Thr Ile1 5 8 123- Information for Seq. ID # 6

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID N- 6: His Pro Read Tyr Asn Read Gly His Arg Val Asp Lys1 5 8 12

3- Information for Seq. ID # 7 7

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID # 7:

His Thr Read Lys Tyr Pro Thr Be Wing Ser Gly Ser1 5 8 12

3- Information for Seq. ID # 2 8

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linearSequence description: Seq. ID N2 8: His Glu Ile Arg Wing Pro Fen Asp Wing Wing Ans Lys1 5 8 12

3- Information for Seq. ID # 9 9

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acidc) Topology: linearSequence description: Seq. ID # 9:

Asn Met Asn Read Thr Pro Fen Asp His Trp Asn Asp1 5 8 12

3- Information for Seq. ID # 10 10

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID No. 10:

Tyr His Gln Thr Fen Ile Pro Fen Wing Leu Pro Lys1 5 8 12

3- Information for Seq. ID N2 11

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID N2 11:

Val Ser Ser Asp Asn Arg Asn Asp Fen Asp Wing His1 5 8 12

3- Information for Seq. ID N2 12String Characteristics:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID No. 12:

Pro Wing Val Pro Lys Leu SerAIa Ser Tyr Leu Thr15 8 123- Information for Seq. ID N2 13String Characteristics:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID No. 13:

His Thr Lys Met Pro Tyr Tyr His Pro Asn Leu1 5 8 12

3- Information for Seq. ID # 14 14

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linearSequence description: Seq. ID No. 14:

Glu Arg Pro Pro Met Leu Thr His Trn Asp Asp Ala1 5 8 12

3- Information for Seq. ID N2 15String Characteristics:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linearSequence description: Seq. ID N2 15Ile Thr Ile Asn Glu Pro Asp Fen Wing Thr Val Ser1 5 8 12

3- Information for Seq. ID N2 16String Characteristics:

a) Size: 12 amino acids

b) Type: amino acidc) Topology: linear

Description of sequence: Seq. ID No. 16:

Lys Asp Val Arg His Gly Leu Asn Tyr Leu Pro His1 5 8 12

3- Information for Seq. ID N217

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID N2 17:

Be Gly Be Wing Be Thr Pro Tyr Lys Read Thr His1 5 8 12

3- Information for Seq. ID No. 18

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID No. 18:

Lys Ans Wing Wing Asp Fen Pro Wing Arg Ile Glu His1 5 8 12

3- Information for Seq. ID N2 19

Sequence Features:

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID No. 19:

Asp Asn Trp His Asp Fen Pro Thr Read Asn Met Asn1 5 8 123- Information for Seq. Sequence ID: 20

a) Size: 12 amino acids

b) Type: amino acid

c) Topology: linear

Description of sequence: Seq. ID N2 20: Lys Pro Read Wing Fen Pro Ile Fen Thr Gln His Tyr1 5 8 12

Claims (9)

1.- IMMUNOGLOBULIN G-BINDING PEPTIDES PRESENT IN NOSOR OF PATIENTS WITH NEUROCYSTICERCOSIS, characterized by understanding the sequences Seq ID N2 1 to Seq ID N2 20. 2.- RECOMBINANT PEPTIDES LINKING TO COMPONENTS AND / OOMOLECULES INVOLVED DIRECTLY OR INDIRECTLY IN RESPONSE TO CYSTICERCOSIS AND THEIR REVERSE SEQUENCES SEQ ID N2 1 TO SEQ ID N2 20. 3.- MIMETIC RECOMBINANT PEPTIDES OF ANTIGENS INVOLVED IN KYSTICERCOSIS AND THEIR REVERSE SEQUENCES, characterized by comprising the sequences Seq ID N2 1 to Seq ID N2 20. 4.- PEPTIDES AND THEIR REVERSE SEQUENCES according to claims 1, 2 or 3, characterized in that they are used in in vitro or in vivo immunoassay methods as probes to detect the presence of linker molecules, such as circulating antibodies, which react against components or molecules. directly or indirectly involved in diseases such as cysticercosis, preferably neurocysticercosis. 5.- PEPTIDES AND THEIR REVERSE SEQUENCES according to claim 4, characterized in that circulating antibody-binding molecules are detected by immunoassays, such as enzyme-linked immunosorbent assays (ELISA), Western Blot, immunofluorescence, immunohistochemistry and others). immunoagglutination, electrochemical sensors, or otherwise related detection directly or indirectly in body fluid samples such as blood, saliva, urine, milk, preferably serum. Use of the peptides and their reverse sequences as defined in claims 1, 2 or 3, characterized in that they are integral in the preparation of a pharmaceutical composition as a component of treatment agents for diseases such as cysticercosis, especially aneurocysticercosis. Use of the peptides and their reverse sequences as defined in claims 1, 2 or 3, characterized in that they are used in diagnostics as carriers of molecules such as particles (radioactive, fluorescent, magnetic, biodegradable or otherwise), miscellaneous drugs or any other acting substance. direct or indirect about diseases such as cysticercosis, mainly neurocysticercosis. Use of the peptides and their reverse sequences as defined in claims 1, 2 or 3, characterized in that they are in the preparation of a vaccine composition to stimulate the human or animal immune system against cysticercosis. VACINAL COMPOSITION according to claim 8, characterized in that it comprises one or more compounds described by the sequences Seq IDN-IaSeq ID No. 20.