BRPI0707755A2 - nucleic acid constructs and methods for producing altered seed oil compositions - Google Patents

Abstract

NUCLEIC ACID CONSTRUCTIONS AND METHODS FOR THE PRODUCTION OF ALTERED OIL COMPOSITIONS DESEMENTS The present invention belongs to the field of plant genetics and provides molecules, recombinant nucleic acid constructions and other agents, associated with the coordinated manipulation of multiple navy genes of acid synthesis fatty. In particular, the agents of the present invention are associated with the simultaneous improved expression of certain genes in the fatty acid synthesis pathway, and suppressed expression of certain other genes in the same pathway. Plants incorporating these agents and, in particular, plants incorporating these constructions are also provided, where the plants exhibit altered seed oil compositions.

Description

Report of the Invention Patent for "NUCLEIC ACID CONSTRUCTIONS AND METHODS FOR PRODUCTION OF SEED OIL CHANGED COMPOSITIONS".

Cross-reference to related patent applications

This patent application claims the benefit, according to 35USC-§ 119 (e), of US Provisional Application No. 60/772 614, entitled "Modified Gene Silencing" and filed on February 13, 2006, of US application. Provisional Application No. 60/781 519, entitled "Soybean Oil and Seed Oil Compositions and Same Production Method" and filed March 10, 2006, and US ApplicationNo. 11/376 328, entitled "Nucleic Acid Constructions and Methods of Production of Altered Seed Oil Compositions" and filed March 16, 2006.

String Listing Embedding

A paper copy of the Sequence Listing and computer readable diskette containing the file named "Omni2 AS Fl-LED.txt" of the 60,690-byte (measured in MS-DOS) sequence listing, recorded December 25 2003 and filed with US Application No. 10/669 888, are hereby incorporated by reference in this application. A paper copy of the Sequence Listing and Computer Dial-Up containing the file named "Omni-Child.txt" of the 61,434 byte (measured in MS-DOS) sequence listing, recorded March 15, 2003 , are incorporated herein by reference in this application.

Field of the invention

The present invention is directed to nucleic acid molecules, constructs and other agents associated with the coordinated manipulation of multiple genes in the fatty acid synthesis pathway. In particular, the agents of the present invention are associated with the simultaneous intensified expression of certain genes in the fatty acid synthesis pathway and the suppression of expression of certain other genes in the same pathway. The present invention is also directed to plants incorporating these agents and especially plants incorporating these constructs, wherein the plants exhibit altered seed oil compositions.

Plant oils are used in a variety of applications.

There is a need for new vegetable oil compositions and improved embroideries to obtain oil compositions derived from biosynthetic or natural vegetable sources. Depending on the intended use of the oil, several different fatty acid compositions are desired. Plants, especially species that synthesize large amounts of seed oils, are an important source of edible and industrial use oil. Seed oils are composed almost entirely of triacylglycerols, in which fatty acids are esterified to the three hydroxyl groups doglycerol. .

Soybean oil contains approximately 16-20% saturated fatty acids: 13-16% palmitate and 3-4% stearate. See, Gunstone et al., The Lipid Handbook, Chapman & Hall, London (1994). Soybean oils have been modified by various breeding methods to benefit specific markets. However, no clogging oil is available, the benefits of which cover major users of this type of oil, such as consumers of salad oil, cooking oil and frying oil, and industrial markets such as biodiesel and biolubricant markets. Previous soybean oils were very costly or lacking in important food quality, such as oxidative stability, to give the cold food a good taste and saturated fat content, or of significant biodiesel property, such as appropriate emissions of nitric oxide or cold tolerance, or Cold flow.

Taller plants synthesize fatty acids through a common metabolic pathway - the fatty acid synthetase (FAS) pathway located in plastids. β-Ketoacyl-ACP synthases are important enzymes that limit the FAS opacity of plant cells, existing in several versions. Β-Ketoacyl-ACP Synthase I catalyzes chain elongation to palmitoyl-ACP (C16: 0), while β-Ketoacyl-ACP Synthase II catalyzes chain elongation to stearoyl-ACP (C18: 0). Β-Ketoacyl-ACP Synthase IV is a variant of β-Ketoacyl-ACP Synthase II and can also catalyze chain elongation up to 18: 0-ACP. In soybeans, the main products of FAS are 16: 0-ACP and 18: 0-ACP. The desaturation of 18: 0-ACP to form 18: 1-ACP is catalyzed by a soluble plastid delta-9 desaturase (also referred to as "stearoyl ACP desaturase"). ConsulNoelker et al., 52 Annu. Rev. Plant Physiol. Plant Moi Biol. 335-61 (2001).

FAS and delta-9 desaturase products in plastids, 16: 0-ACP, 18: 0-ACP and 18: 1-ACP, are specific thioesterase (FAT) hydrolyzed (FAT). Plant thioesterases can be classified into two gene families based on sequence homology and substrate preference. The first family, FATA, includes long-chain acyl-ACP thioesterases with activity primarily over 18: 1-ACP. Second-family enzymes, FATB, commonly use 16: 0-ACP (palmitoyl-ACP), 18: 0-ACP (es-thearoyl-ACP) and 18: 1-ACP (oleoil-ACP). These thioesterases play an important role in determining chain length during de novo biosynthesis of fatty acids in plants, and therefore these enzymes can be used for various modifications to fatty acid compositions, especially in relation to the relative proportions of various acyl groups. fatty acids, present in oils stored in seeds.

The products of the reactions of FATA and FATB, the free fatty acids, leave the plastids and are converted to their respective acyl CoAesters. AciI-CoAs are substrates for the lipid biosynthesis pathway (Viade Kennedy), located in the endoplasmic reticulum (ER). This pathway is responsible for the formation of the lipid membrane as well as for the detriacylglycerol biosynthesis that constitute the seed oil. In ER there are other membrane-bound desaturases that may further desaturate 18: 1 for polyunsaturated fatty acids. A delta-12 desaturase enzyme (FAD2) catalyzes the insertion of a 18: 1 double bond, forming linoleic acid (18: 2). An enzyme delta-15 desaturase (FAD3) catalyzes the insertion of an 18: 2 double bond to form linolenic acid (18: 3). Many complex biochemical pathways have been genetically engineered at present, usually by suppression or overexpression of degeneration. isolated. Further investigation of the potential for genetic manipulation of plants will require coordinated manipulation of multiple genes in one path. Several approaches have been used to combine transgenes in a plant - including sexual cross-breeding, re-transformation, co-transformation and the use of linked transgenes. A chimeric transgene with sequences from partially linked genes can be used to coordinately suppress numerous endogenous plant genes. Constructs whose model is based on viral polyproteins can be used simultaneously to introduce multiple coding genes into plant cells. For review, see Halpin et al, Plant Moi Biol. 47: 295-310 (2001).

Therefore, a desired plant phenotype may require the expression of one or more genes and the concomitant reduction of expression of another gene or genes. There is therefore a need to simultaneously overexpress one or more genes and suppress, or negatively regulate, the expression of another gene or genes in plants by employing a single transgenic construct.

Summary of the Invention

The present invention provides a recombinant nucleic acid molecule or molecules which when introduced into a cell or organism are capable of suppressing, at least partially reducing, reducing, substantially reducing or effectively eliminating the expression of at least one. or more endogenous FAD2, FAD3 or FATB RNAs, at the same time as co-expressing, co-expressing or co-expressively producing one or more transcribed RNAs or proteins from a gene encoding beta-ketoacyl-ACP synthase I, beta-ketoacyl-ACP synthase IV, delta-9 desaturase or GP4 EPSPS. The present invention also provides plant cells and plants transformed with the same molecule or nucleic acid molecules and seeds, oil and other products derived from plant-transformed plants.

The present invention also provides a recombinant nucleic acid molecule comprising a first set of DNA sequences capable of, when expressed in a host cell, suppressing endogenous expression of at least one, preferably two, genes selected from the host. FAD2, FAD3 and FATB] and a second set of DNA sequences capable of, when expressed in host cell, increase the endogenous expression of at least one gene selected from the group consisting of a beta-ketoacyl-gene. ACP synthase I, a Beta-acyl-ACP synthase IV gene, a delta-9 desaturase eCP4 EPSPS gene.

Further provided by the present invention is a recombinant nucleic acid molecule comprising a first set of DNA sequences capable of, when expressed in a host cell, forming a dsRNA construct and suppressing endogenous expression of at least one, preferably two, selected genes. of the group consisting of genes FAD2, FAD3 and FATB, in which the first set of DNA sequences comprises a first non-coding sequence expressing a first RNA sequence that exhibits at least 90% identity to a non-coding region of a FAD2 gene. , a first antisense sequence expressing a first antisense RNA sequence capable of forming a double-stranded RNA molecule with the first RNA sequence, a second non-coding sequence expressing a second RNA sequence that exhibits at least at least 90% identity to a non-coding region of a FATB gene, and a following antisense sequence expressing a second antisense sequence of RNA capable of forming a double-stranded RNA molecule with the second RNA sequence; and a second set of DNA sequences capable of, when expressed in a host cell, enhancing endogenous expression of at least one gene selected from the group consisting of a beta-ketoacyl-ACP synthase I gene, a gene of the beta-acyl-ACP synthase IV, delta-9 desaturase umgene and CP4 EPSPS.

The present invention provides methods of transforming plants with these recombinant nucleic acid molecules. The methods include a method of producing a seed-transformed plant showing increased oleic acid content, reduced saturated fatty acid content, and reduced polyunsaturated fatty acid content, comprising (A) transformation of a plant cell to a recombinant nucleic acid molecule comprising a first set of DNA sequences capable of, when expressed in a host cell, suppressing endogenous expression of at least one, preferably two, genes selected from the group consisting of the FAD2, FAD3 and FATB genes , and a second set of DNA sequences capable of, when expressed in a host cell, enhancing endogenous expression of at least one gene selected from the group consisting of a beta-ketoacyl-ACP synthase I gene, a dabeta-ketoacyl-ACP gene synthase IV, a delta-9 desaturase gene and CP4EPSPS; and (B) cultivation of the transformed plant, in which the transformed plant produces seed with increased oleic acid content, reduced saturated acid dioxide content and reduced polyunsaturated fatty acid content relative to a similarly but non-plant genetic background. recombinant nucleic acid molecule.

Also provided are methods of transforming plant cells with recombinant nucleic acid molecules. The methods include a method for altering the oil composition of a plant cell, comprising (A) transforming a plant cell with a recombinant nucleic acid molecule comprising a first set of DNA sequences capable of, when expressed in a host cell, suppressing endogenous expression of at least one, preferably two genes selected from the group consisting of the FAD2, FAD3 and FATB genes, and a second set of DNA sequences capable of, when expressed in a host cell, increase endogenous expression of at least a gene selected from the group consisting of a beta-ketoacyl ACP synthase I gene, a beta-ketoacyl ACP synthase IV gene, a delta-9 desaturase gene and CP4 EPSPS; and (B) culturing the plant cell under conditions in which transcription of the first set of DNA sequences and the second set of DNA sequences is initiated, wherein the oil composition is altered relative to cells of a plant with similar genetic background. but devoid of the recombinant nucleic acid molecule.

The present invention also provides a transformed plant comprising a recombinant nucleic acid molecule, comprising a first set of DNA sequences capable of, when expressed in a host cell, suppressing the endogenous expression of at least one, preferably, one. two genes selected from the group consisting of the genes FAD2, FAD3 and FATB; and a second set of DNA sequences capable of, when expressed in a host cell, enhancing endogenous expression of at least one gene selected from the group consisting of a beta-ketoacyl ACP synthase I gene, a beta-acyl acp synthase IV gene , a delta-9 desaturase gene and CP4 EPSPS. Also provided by the present invention is a seed-transformed soybean plant, which roughly exhibits an oil composition containing from 55 to 80% by weight of oleic acid, from 10 to 40% by weight of linoleic acid, 6% or less. weight of linolenic acid and 2 to 8% by weight of saturated fatty acids, raw material, plant parts and seeds derived from the plant. In another embodiment, the present invention provides a transformed seed plant in which the seed exhibits an oil composition comprising approximately 65-80% oleic acid, approximately 3-8% saturated and approximately 12-32% polyunsaturated. . Raw material, plant parts and seed derived from this plant are included as well. In another embodiment, the present invention provides a soybean seed transform plant, wherein the seed exhibits an oil composition comprising approximately 65-80% oleic acid, approximately -to 2-3.5% of saturated and approximately 16.5-33% of polyunsaturated. Raw material, plant parts and seed derived from this plant are included as well.

The present invention provides a soybean seed exhibiting oil composition comprising from 55 to 80% by weight of oleic acid, from 10 to 40% by weight of linoleic acid, 6% or less of linolenic acid and 2 8% by weight of saturated fatty acids, and also provides a soybean seed exhibiting oil composition comprising 65 to 80% by weight of oleic acid, from 10 to 30% by weight of linoleic acid, 6% or less by weight of acid. linolenic acid and 2 to 8% by weight of saturated fatty acids. In another embodiment, the present invention provides a soybean exhibiting oil composition comprising approximately 65-80% oleic acid, approximately 3-8% saturated and approximately 12-32% polyunsaturated. In another embodiment, the present invention provides a soybean seed having an oil composition comprising approximately 65-80% oleic acid, approximately 2-3.5% saturated, and approximately 16.5-33% polyunsaturated.

Also provided by the invention are oil composition soybean foods comprising 69 to 73 wt.% Oleic acid, 21 to 24 wt.% Linoleic acid, 0.5 to 3 wt.% Linolenic acid and 2 -3% by weight of saturated fatty acids.

The crude soybean oil provided by the invention exhibits an oil composition comprising 55 to 80 wt% oleic acid, 10 to 40 wt% linoleic acid, 6 wt% or less linolenic acid and 2 to 8 wt% by weight of saturated fatty acids. Another crude soybean oil provided by the invention exhibits oil composition comprising from 65 to 80% by weight of oleic acid, from 10 to 30% by weight of linoleic acid, 6% or less by weight of linolenic acid and from 2 to 8% by weight. weight of saturated fatty acids. In another embodiment, the crude soybean oil provided by the present invention exhibits an oil composition comprising approximately 65-80% oleic acid, approximately 3-8% saturated and approximately 12-32% polyunsaturated. In another embodiment, the crude spawn oil provided by the present invention exhibits oil composition comprising approximately 65-80% oleic acid, approximately 2-3.5% saturated and approximately 16.5-33% polyunsaturated. .

The present invention also provides a soybean seed having an oil composition containing from about 42% to about 85% by weight of oleic oil and from about 8% to about 1.5% by weight of fatty acids. saturated. In another embodiment, a soybean seed of the present invention exhibits an oil composition containing from approximately 42% to approximately 85% by weight of oleic acid, from approximately 8% to approximately 1.5% by weight of saturated fatty acids, less than 35%. % by weight of linolenic acid, where a combined amount of oleic acid and linolenic acid is approximately 65% to approximately 90% by weight of the total oil composition; and the seed has a recombinant nucleic acid molecule with a DNA sequence that includes a deFAD2-1 intron fragment, the length of which is approximately 50 to about 400 contiguous nucleotides, a 3 'FATB RTU, and a 5'. FATB RTU, a heterologous beta-ketoacyl-ACP synthase IV, and a heterologous delta-9 desatrazase in host cell.

A soybean seed of the present invention may exhibit an oil composition comprising from approximately 50% to approximately 80% by weight of oleic acid, from approximately 8% to approximately 1.5% by weight of saturated fatty acids of approximately 50%. -to 2% to approximately 45% by weight of linoleic acid, from approximately 4% to approximately 14% by weight of linolenic acid, where the combined amount of oleic acid and linolenic acid is approximately 65% to approximately 90% by weight of the total oil composition, and the seed comprises a recombinant nucleic acid molecule, comprising a DNA sequence that includes a FAD2-1 intron fragment, which is approximately 50 to approximately 50 µm long. 400 contiguous nucleotides, a FATB CTP coding region, and 42 contiguous nucleotides from a 5 * FATB RTU. In another embodiment, a soybean seed may comprise a recombinant nucleic acid molecule, including a DNA sequence that suppresses endogenous expression of FAD2 and FATB, wherein the seed exhibits approximately 46 to 75% oil composition. by weight of oleic acid, 1.5 to 8.5% by weight of saturated fatty acids, 2.5 to 38% by weight of linoleic acid and 4.5 to 17.5% by weight of linolenic acid.

The present invention also includes a method for reducing the FAD2 gene suppression relative to the level of FAD2 gene suppression, obtained by expressing a recombinant FAD2 dsRNA1 construct consisting of a full FAD2 intron or a FAD2 complete UTR by: i) expressing a recombinant FAD2 sequence in a plant cell, wherein the recombinant FAD2 sequence is derived from an endogenous FAD2 gene in a cell, and the recombinant FAD2 sequence consists of a deFon2 deintron fragment or a fragment of the FAD2 RTU, and ii) suppression of an endogenous FAD2 gene with the recombinant FAD2 sequence, wherein the level of FAD2 gene suppression is lower than the level of gene expression obtained by expression of a dsRNAi construct, including a consequence of recombinant FAD2 with full length of a deFAD2 intron or full length of FAD2 RTU.

The present invention also provides methods for altering the composition of oil from a plant cell by: transforming a plant cell with a recombinant FAD2 sequence derived from part of an endogenous FAD2 gene. The recombinant FAD2 sequence consists of a FAD2 intron fragment or FAD2- UTR fragment, and plant cell development under conditions where transcription of the recombinant FAD2 sequence is initiated and by which the oil composition is altered. , in relation to a plant cell with similar genetic background, but lacking the recombinant FAD2 sequence. In another embodiment, a method of increasing oleic acid content and reducing saturated fatty acid content in a plant seed by: i) shortening the length of a first recombinant FAD2 sequence until the level of FAD2 gene suppression of a plant transformed with the first recombinant FAD2 sequence to be at least partially reduced relative to the level of FAD2 gene suppression in a cell with similar genetic background, and a second recombinant FAD2 sequence, wherein the second recombinant FAD2 sequence te consists of more of the endogenous FAD2 sequence than the first recombinant FAD2 sequence; ii) expression of a recombinant FATB sequence capable of at least reducing the FATB gene expression in a plant relative to FATB suppression in a cell cell with similar genetic background but without the recombinant FATB sequence; iii) developing a plant with a recombinant nucleic acid molecule comprising the first recombinant FAD2 sequence and the recombinant FATB sequence; and iv) cultivating a plant producing seed with a reduced saturate content of fatty acids relative to the seed of a plant with a similar genetic background, but devoid of the first recombinant FAD2 sequence and the recombinant FATB sequence.

In yet another embodiment, the present invention includes a method of producing a seed-transformed plant exhibiting reduced saturated fatty acid protein by: transforming a cell cell with a recombinant nucleic acid molecule comprising a recombinant DNA sequence suppressing FAD2 expression endogenous eFATB, wherein the recombinant DNA sequence has a recombinant FAD2 and recombinant FATB nucleic acid sequence, wherein the FAD2 sequence is comprised of less than the complete sequence of an FAD2 intron, and transformed plant development, wherein the transformed plant produces seed with reduced saturated fatty acid content compared to seed from a plant with a similar genetic background but lacking the recombinant DNA sequence.

In another embodiment, the present invention is directed to a method of modulating the oil fatty acid composition of a seed of a temperate climate oilseed crop by isolating at least one genetic material having at least one genetic material. 40 extending nucleotides capable of suppressing the expression of an endogenous naval gene from fatty acid synthesis; generation of more than one shortened fragment of genetic material; introducing each of the shortened fragments into a plant cell of temperate climate oilseed crop for transgenic plant production; and selecting a transgenic plant comprising a shortened fragment of certain length and sequence that desirably alters the fatty acid composition of the seed oil.

The present invention also includes a soybean seed exhibiting oil composition with greatly reduced fatty acid content and moderately increased oleic acid content and DNA sequence suppressing FAD2 expression in plant cell, wherein the DNA sequence has a recombinant FAD2 sequence consisting of an intron fragment of FAD2. Another embodiment of the present invention is a nucleic acid molecule comprising a FAD2-1A intron sequence, wherein the FAD2-1A intron fragment has from about 60 to about 320 contiguous nucleotides. In an alternative embodiment, the present invention also includes a seed of soybean with a first recombinant DNA sequence suppressing endogenous soybean FAD2-1 expression, comprising a despondent FAD2-1 intron, and a second sequence of Recombinant DNA expressing increased levels of a gene selected from the group consisting of KASI, delta-9 desaturase, KASIV and combinations thereof.

The present invention also includes a soybean soybean plant cell whose oil exhibits a fatty acid composition comprising approximately 42% to approximately 85% oleic acid by weight of total fatty acids, and lower fatty acid content. to 8% by weight of total fatty acids. The present invention also includes a soybean plant cell from a soybean seed, the oil of which exhibits a fatty acid composition comprising approximately 42% to approximately 85% by weight of the total fatty acid weight and acid content. saturated fatty acids less than 3% by total fatty acid

The present invention also includes a nucleic acid molecule comprising a FAD2-1A intron sequence, wherein the FAD2-1A intron fragment has from about 60 to about 320 contiguous nucleotides. Also included is a recombinant DNA construct comprising a soybean FAD2-1 intron fragment, which is approximately 20 to about 420 contiguous nucleotides, and a soybean FATB gene fragment, which is approximately 40 and approximately 450 contiguous nucleotides. Another embodiment includes a recombinant nucleic acid molecule with a first DNA sequence that suppresses endogenous soybean FAD2-1 and FATB expression, wherein the first recombinant DNA sequence includes a FAD2-1 intron fragment. whose length is between about 20 and about 420 contiguous nucleotides, a soybean FATB 3 'UTR and a FATB 5' UTR displace or CTP coding area, and a second recombinant DNA sequence that increases expression of at least one of the selected genes of the group consisting of beta-ketoacyl ACP synthase IV and delta-9 desaturase.

The present invention also includes an unmixed soybean oil whose fatty acid composition comprises an oleic acid content of from approximately 42% to approximately 85% by weight of the fatty acid and saturated fatty acid content of from approximately 1.5% to approximately 8%. % by weight of total fatty acids; a semi-mixed soybean oil, the fatty acid composition of which contains an oilic acid content of approximately 42% to approximately 85% by weight of the total fatty acids and a saturated fatty acid content of approximately 8% or less by the weight of the total fatty acids; an unmixed soybean oil the fatty acid composition of which contains an oleic acid content of approximately 42% to approximately 85% by weight of the total fatty acids and a linolenic acid content of less than 3% by weight of the total fatty acids; an unmixed soybean oil whose fatty acid composition comprises an oleic acid content of approximately 42% to approximately 85% by weight of the total fatty acids, fatty acid content of approximately 8% or less by weight of the acids fatty acids and linolenic acid content of approximately 1.5% or less by weight of total fatty acids. The present invention also includes a soybean feed derived from a soybean seed, the oil of which exhibits a fatty acid composition comprising approximately oleic acid content. 42% to approximately 85% by weight of total fatty acids, and less than 8% by weight of total fatty acids by weight. The present invention also includes a soybean feed of soybean seed, the oil of which exhibits a fatty acid composition comprising oleic acid content of from about 42% to approximately 85% by weight of fatty acid, and linolenic acid content of less than approximately 3%. % by weight of total fatty acids.

The present invention also includes a method for reducing the suppression of the FAD2 gene in relation to the level of suppression of the FAD2 gene, obtained by expressing a dsRNAi construct with a heterologous FAD2 sequence, consisting of a complete intron of FAD2or FAD2 full RTU, the method by: i) expressing a heterologous FAD2 sequence in a plant cell, wherein the heterologous FAD2 sequence is derived from an endogenous FAD2 gene in a plant cell and is either an FAD2 intron fragment or a deFAD2 RTU fragment, and ii) deletion of an endogenous FAD2 gene with the heterologous deFAD2 sequence, where the level of suppression of the FAD2 gene is lower than the level of gene expression, obtained by expression of a heterologous FAD2 sequence, consisting of the extension of a FAD2 intron or the full extension of a FAD2 RTU.

The present invention also includes a method for altering the composition of oil from a plant cell by transforming a plant cell with a heterologous FAD2 sequence derived from part of an endogenous FAD2 gene, wherein the heterologous FAD2 sequence consists of an intron fragment of FAD2 or FAD2 RTU fragment; and development of the plant cell under conditions in which heterologous FAD2 sequence transcription is initiated, whereby the composition of the oil is altered relative to a plant cell with a similar genetic background but devoid of the FAD2 sequence. The present invention also includes a method for increasing oleic acid content and reducing saturated fatty acid content in a plant seed, comprising i) shortening the length of a first heterologous FAD2 sequence until the level of suppression of geneFAD2 from a plant transformed with the first heterologous FAD2 sequence is at least partially reduced relative to the level of FAD2 gene suppression in a plant cell comprising similar antecedent genetics, and a second heterologous FAD2 sequence, wherein the second heterologous FAD2 sequence consists of more of the endogenous FAD2 sequence than the first sequence heterologous FAD2; ii) expression of a heterologous FATB sequence capable of at least partially reducing FATB gene expression in a plant cell, relative to FATB suppression in a plant with a similar antecedent genetic background, but without the heterologous FATB sequence; iii) developing a plant comprising a genome with the first sequence of heterologous FAD2 and the sequence of heterologous FATB; and iv) growing a plant that produces seed with reduced fatty acid content in relation to the seed of a plant with similar genetic background, but without the first heterologous FAD2 sequence and the heterologous AF TB sequence.

The present invention also includes a method of modulating seed-derived oil fatty acid composition from a temperate de-oilseed culture comprising isolating a fragment of genetic material the extent of which comprises at least 40 nu-cleotides and is capable of to suppress the expression of an endogenous gene via fatty acid synthesis; introduction of genetic material in a plant cell of temperate oilseed culture; production of a transgenic plant; and selecting a transgenic plant seed that includes genetic material that modulates the fatty acid composition of the seed oil.

In another embodiment, the present invention also includes a soybean seed cell, the oil of which exhibits a fatty acid composition comprising oleic acid content of approximately 42% to approximately 85% by weight of total fatty acids, and saturated fatty acid content of less than 8 % by weight of total fatty acids.

The present invention also includes a heterologous nu-clicic acid molecule comprising a despondent FAD2-1 intron fragment of about 20 to about 420 contiguous nucleotides, and a soybean FATB gene fragment of which extension is. between about 40 and about 450 contiguous nucleotides. In another embodiment, the present invention is directed to a heterologous nucleic acid molecule comprising a nucleic acid sequence with a soybean FADE-1 intron fragment, the length of which is from about 20 to about 420 nucleotides, a fragment. of the soybean FATB gene, which is approximately 40 to about 450 nucleotides in length, and a nucleic acid sequence that enhances the expression of beta-ketoacyl ACP synthase IV or delta-9 desaturates or both.

The present invention is also directed to a method of decreasing linolenic acid content of a soybean seed by i) introducing into a soybean cell a heterologous nucleic acid molecule comprising a nucleic acid sequence from at least two members of the FAD3 gene family (ii) expression of a nucleic acid sequence from a FAD3 gene capable of at least partially reducing endogenous FAD3 gene expression in a plant cell iii) development of a cell a plant comprising a genome with a nucleic acid sequence from at least two members of the FAD3 gene family; and iv) cultivation of the reduced linolenic acid plant cell in relation to a plant cell with a similar genetic background, but devoid of at least two members of the degenerate family FAD3. The present invention also includes a recombinant DNA construct with DNA fragments of at least two members of the FAD3 gene family.

The present invention also includes an unmixed soybean oil whose fatty acid composition comprises approximately 42% to approximately 85% oleic acid content, by weight of the fatty acid acids, approximately 8% or less saturated fatty acid content , by weight of total fatty acids and linolenic acid content of approximately 1,5% or less by weight of total fatty acids.

Brief Description of Drawings

Figures 1-4 each describe examples of nucleic acid molecule configurations.

Figures 5 (a) - (d) and 6 (a) - (c) each depict illustrative configurations of a first set of DNA sequences.

Figures 7- 20 each describe nu-cyclic acid molecules of the present invention.

Figure 21 depicts construction pMON68537.

Figure 22 depicts construction pMON68539.

Detailed Description of the Invention

Description of nucleic acid sequences

SEQ ID NO: 1 is a nucleic acid sequence of a FAD2-1A intron 1.

SEQ ID NO: 2 is a nucleic acid sequence of an FAD2-1B intron 1.

SEQ ID NO: 3 is a nucleic acid sequence of a FAD2-1B promoter.

SEQ ID NO: 4 is a nucleic acid sequence of a FAD2-1A clonegenomic.

SEQ ID NO: 5 and 6 are 3'UTR and 5'UTR nucleic acid sequences of FAD2-1A, respectively.

SEQ ID NO: 7-13 are nucleic acid sequences of the FAD3-1A introns1, 2, 3A, 4, 5, 3B and 3C, respectively.

SEQ ID NO: 14 is a nucleic acid sequence of an FAD3-1C intron 4.

SEQ ID NO: 15 is a nucleic acid sequence of a partial genomic clone of FAD3-1A. SEQ ID NO: 16 and 17 are 3'UTR and 5 'UTR nucleic acid sequences of FAD3-1A. respectively.

SEQ ID NO: 18 is a nucleic acid sequence of a partial genomic clone of FAD3-1B.

SEQ ID NO: 19-25 are nucleic acid sequences of FAD3-1B introns 1, 2, 3A, 3B, 3C, 4 and 5, respectively.

SEQ ID NO: 26 and 27 are 3'UTR and 5 'UTR nucleic acid sequences of FAD3-1B, respectively.

SEQ ID NO: 28 is a nucleic acid sequence of a FATB-1 genomic clone.

SEQ ID NO: 29-35 are nucleic acid sequences of the FATB-1 introns I, II, III, IV, V, V1 and V11, respectively.

SEQ ID NO: 36 and 37 are 3'UTR and 5 'UTR FATB-1 nucleic acid sequences, respectively.

SEQ ID NO: 38 is a nucleic acid sequence of a Cuphea pulcherrima KAS I gene.

SEQ ID NO: 39 is a nucleic acid sequence of a KASIV Cuphea pulcherrima gene.

SEQ ID NO: 40 and 41 are degenerate nucleic acid sequences of delta-9 desaturase from Ricinus communis and Simmondsia chinen-sis.

SEQ ID NO: 42 is a FATB-2 cDNA nucleic acid sequence.

SEQ ID NO: 43 is a nucleic acid sequence of a FATB-2 genomic clone.

SEQ ID NO: 44-47 are nucleic acid sequences of FATB-2 introns I, II, III and IV, respectively.

SEQ ID NO: 48-60 are PCR primer nucleic acid sequences.

SEQ ID NO: 61 and 62 are soybean FAD3-1C 3'UTR and 5'UTR nucleic acid sequences, respectively.

"ACΡ" refers to an acyl grouping carrier protein. "Altered seed oil composition" refers to a seed oil composition, derived from a transgenic or transformed plant of the invention, which has altered or modified fatty acid levels therein with respect to a seed oil, derived from a plant with a similar genetic background but not transformed.

"Antisense suppression" refers to specific gene silencing induced by the introduction of an antisense RNA molecule.

"Coexpression of more than one agent, such as mRNA or protein" refers to the simultaneous expression of an agent at overlapping time intervals and in the same cell or tissue as another agent. "Coordinated expression of more than one agent" refers to too much co-expression of one agent when the production of transcripts and proteins from these agents is conducted using a shared or identical promoter.

"Complement" of a nucleic acid sequence refers to the complement of the sequence along its full length.

"Co-suppression" is the reduction in expression levels, usually at the RNA level, of a particular endogenous gene or family of genes by expression of a homologous sense construct capable of transcribing mRNA with the same quality as transcript tape. endogenous gene. Napoli et al., Plant Cell 2: 279-289 (1990); van der Krol et al., Plant Cell 29: 291-299 (1990).

"Crude soybean oil" refers to soybean oil extracted from grain that has been unrefined, processed or mixed, although degummed.

"CTP" refers to chloroplastic transit peptide encoded by the "chloroplastic transit peptide coding sequence".

In this document, when referring to proteins and nucleic acids, the term "derivative" refers either directly (for example, to the sequence of a known protein or nucleic acid and the preparation of a protein or nucleic acid of similar sequence, but in part from the protein sequence of the known protein or nucleic acid) or indirectly (for example, by obtaining a protein or nucleic acid from an organism related to a protein or nucleic acid with known) to obtain a protein or nucleic acid from a known protein or nucleic acid. Other methods of "derivatizing" a protein or nucleic acid from a known protein or nucleic acid are known to any person skilled in the art.

Double-stranded RNA ("dsRNA"), Double-stranded interfering RNA ("dsRNAi") and interfering RNA ("RNAi") all refer to specific degene silencing induced by the introduction of a construct capable of at least partially transcribing , a double-stranded RNA molecule. One "dsRNA molecule" and one "RNAi molecule" both refer to a region of an RNA molecule that contains segments with complementary nucleotide sequences and therefore they can hybridize to each other and form double-stranded RNA. These phytaduple RNA molecules are capable, when introduced into a cell or organism, to at least partially deduce the level of a type of mRNA present in a cell or cell of an organism. In addition, dsRNA may be created after in vivo assembly of appropriate DNA fragments by illegitimate recombination and site-specific recombination, as described in International Application No. PCT / US2005 / 004681, filed February 11, 2005, which content is incorporated herein in its entirety by reference in this application.

"Exon" refers to the normal meaning of the term, meaning a segment of nucleic acid molecules, usually DNA, that encodes part or an entire expressed protein.

"Fatty acid" refers to fatty acids and fatty acyl groups.

"Gene" refers to a nucleic acid sequence that includes a 5 'promoter region associated with gene product expression, any intron and exon regions, and 3' and 5 'untranslated regions associated with gene product expression.

"Gene silencing" refers to the suppression of dogene expression or down-regulation of gene expression.

A "gene family" is two or more genes in an organism that encode proteins that exhibit similar functional attributes, and a "gene family member" is any gene family gene found in plant genetic material, for example, A 'member of the FAD2 gene family' is any FAD2 gene found in the genetic material of the plant. An example of two members of a gene family is FAD2-1 and FAD2-2. A gene family can be further classified by similar nucleic acid sequences. A gene, FAD2, for example, includes alleys at that locus Preferably, a member of the gene family exhibits at least 60%, more preferably at least 70%, more preferably at least 80% sequence identity. nucleic acid in the coding sequence of the gene.

"Heterologist" means that it does not occur naturally together.

A nucleic acid molecule is said to be "introduced" if inserted into the cell or organism as a result of human manipulation, no matter how indirect. Examples of introduced nucleic acid molecules include, but are not limited to, nucleic acids that have been introduced into cells by transformation, transfection, injection and projection, and those that have been introduced into an organism by methods including, but not limited to, conjugation, endocytosis and phagocytosis. "Intron" refers to the normal meaning of the term, meaning a segment of nucleic acid molecules, usually DNA, that does not encode part or all of an expressed protein and which, under endogenous conditions, is transcribed into RNA molecules, however, it is separated from endogenous RNA before RNA is transcribed into a protein. An "intronde dsRNA molecule" and an "RNAi intron molecule" both refer to a double-stranded RNA molecule capable of, when introduced into a cell or organism, at least partially reducing the level of mRNA types present in a cell or cell of an organism, when the double-stranded RNA molecule exhibits sufficient identity with respect to an intron of a gene present in the cell or organism to reduce the level of an mRNA containing that intron sequence.

A "low saturated" oil composition contains 3.6 and 8 percent saturated fatty acids.

A "medium oleic acid soybean seed" is slightly between 50% and 85% oleic acid present in the seed oil composition.

A "low linolenic acid" oil composition contains less than approximately 3% linolenic acid per total fatty acid weight.

The term "non-coding" refers to sequences of nucleic acid molecules that do not encode part or all of a expressed protein. Non-coding sequences include, but are not limited to, introns, driving regions, 3 'untranslated regions (3'UTRs) and 5' untranslated regions (5'UTRs).

The term "oil composition" refers to fatty acid levels.

A promoter that is "operably linked" to one or more nucleic acid sequences is capable of directing expression of one or more nucleic acid sequences, including multiple encoding or noncoding nucleic acid sequences, arranged in polycistronic configuration.

"Physically linked" nucleic acid sequences are nucleic acid sequences found in an isolated nucleic acid molecule.

A "plant" includes reference to whole plants, plant organs (eg, leaves, stems, roots, etc.), seeds, and plant cells and progeny thereof.

The term "plant cell" includes, but is not limited to, suspended seed cultures, embryos, meristematic regions, callus tissue, leaves, roots, aerial parts, gametophytes, sporophytes, pollen and microspores.

"Plant promoters" include, but are not limited to, plant viral promoters, plant derived promoters, and synthetic promoters capable of functioning in a plant cell to promote expression of ummRNA.

A "polycistronic gene" or "polycistronic mRNA" is any gene or mRNA that contains transcribed nucleic acid sequences that correspond to nucleic acid sequences of more than one gene targeted for suppression or expression. It is understood that these polycistronic mRNA genes or sequences may contain sequences corresponding to introns, 5'UTRs, 3 'UTRs, traffic peptide coding sequences, exons, or combinations thereof, and that a recombinant polycistronic gene or mRNA could, for example, be unrestricted. , contain sequences that correspond to one or more RTUs of one gene and one or more introns of a second gene.

A "seed-specific promoter" refers to a promoter that is preferably or exclusively active in a seed. "Preferred activity" refers to the activity of a promoter that is substantially greater in seed than in other plant tissues, organs, or organelles. "Mind-specific" includes, but is not limited to, activity in the aleurone layer, endosperm and / or seed embryo.

"Intron sense suppression" refers to gene silencing induced by the introduction of an intron sense or fragment thereof. Intron sense suppression is described, for example, by Fillatti in PCT WO01 / 14538 A2.

"Simultaneous expression" of more than one agent, such as an mRNA or protein, refers to the expression of one agent at the same time as another agent. This expression can be superimposed only in part and can also occur in different tissue or at different levels.

"Total oil level" refers to the total amount of all fatty acids, regardless of the type of fatty acid. As used herein, total oil level does not include the glycerol backbone.

"Transgene" refers to a nucleic acid sequence associated with the expression of a gene introduced into an organism. Transgene includes, among others, an endogenous gene or a gene that does not occur naturally in the body. "Transgenic plant" is any plant that incorporates a transgene in a manner that facilitates the transmission of that plant's transgene by any sexed or asexual method.

A "zero saturated level" oil composition contains between 3.6 and 8 percent saturated fatty acids.

In this disclosure, when referring to proteins and nucleic acids, the use of capital letters, for example "FAD2", indicates a reference to an enzyme, protein, polypeptide or peptide, and italic letters, for example, nFADZ are used for references. to nucleic acids, including, but not limited to, genes, cDNAs and mRNAs. A cell or organism may have a family of more than one gene encoding a particular enzyme, and the capital letter which is gene terminology (A, B, C) is used to denote the family member, ie FAD2 -1A and FAD2-1Bare different members of the same family.

As used herein, any defined lane includes lane endpoints unless otherwise stated.

A. Agents

The agents of the invention will preferably be "biologically reactive" with respect to a structural feature such as the ability of one nucleic acid molecule to hybridize to another nucleic acid molecule or the ability of a protein to bind to an antibody. (or decompose with another molecule by this bond). Alternatively, this feature may be catalytic and thus involve the agent's ability to mediate a chemical reaction or response. The agents will preferably be "substantially purified". The term "substantially purified" as used in this disclosure refers to a molecule substantially separate from all other molecules normally associated with same under conditions of its native environment. More preferably, a substantially purified molecule is the predominant type present in a preparation. A substantially purified molecule may be more than 60% free, more than 75% free, preferably more than 90% free, even more preferably more than 95% free of the other molecules (excluding the solvent) present in the molecule. natural blend. The term "substantially purified" is not intended to include molecules present under conditions of their native environment.

The agents of the invention may also be recombinant. As used in this disclosure, the term "recombinant" means any agent (for example including, but not limited to, DNA or peptide), derived from or resulting, no matter how indirectly of human manipulation of a nucleic acid molecule. It is also understood that the agents of the invention may be labeled with reagents that facilitate agent detection, for example, fluorescent labels, chemical labels and / or modified bases.

Agents of the invention include nucleotide sequence DNA molecules capable of being transcribed in sense and antisense orientations, and which form at least one RNA molecule that is at least in part double stranded. In a preferred embodiment, an agent of the invention is a double stranded RNA molecule with a nucleotide sequence that is a fragment of FAD2, FATB or FAD2e FATB. In another embodiment, an agent of the present invention is a DNA molecule capable of being transcribed to produce sense and antisense orientations of a nucleotide sequence in a host cell. In another embodiment, a nucleic acid molecule may have an antisense sense and sense orienting nucleotide sequence or, in another embodiment, a nucleic acid molecule may have an antisense sense or sense orienting nucleotide sequence. These nucleotide sequences may be operably linked to the same promoter, different promoters, a single promoter or more than one promoter. These nucleotide sequences may be a single DNA molecule or more than one DNA molecule.

Agents of the invention include nucleic acid molecules comprising at least 50%, 60%, or 70% DNA sequence identical throughout, to a coding or non-coding region of a plant, or a sequence of nucleic acid complementary to the coding or non-coding region of a plant. Most preferred DNA sequences are those which, to their full extent, are at least 80% identical; at least 85% identical; at least 90% identical; at least 95% identical; at least 97% identical; at least 98% identical, at least 99% identical; or 100% identical to a non-coding region of a plant, or to a nucleic acid sequence complementary to a plant coding or non-coding region.

"Identity," as is well understood in the art, and a relationship between two or more polypeptide sequences or two or more nucleic acid molecules, as determined by sequence comparison.

In the art, "identity" also means the degree of interrelationship between polypeptide or nucleic acid molecules, as determined by the combination of chains of these sequences. "Identity" can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, ed., Oxford University Press, New York 1988; Biocomputing: Informatics and Ge-name Projects, Smith, ed., Academic Press, New York 1993; Computer Analysis of Sequence Data, Part I, Griffin and Griffin, eds., Humana Press, New Jersey 1994; Sequence Analysis in Molecular Biology, von Heinje, Aca-demic Press 1987; Sequence Analysis Primer, Gribskov and Devereux, eds., Stockton Press, New York 1991; and Carillo and Lipman, SIAM J. Applied Mat, 48: 1073 1988.

Identity determination methods are designed to provide the greatest match between the sequences tested. In addition, identity determination methods are coded in commercially available programs. Computer programs that can be used to determine identity between two sequences include, but are not limited to, GCG; a series of five BLAST programs, three designed to search for nucleotide sequences (BLASTN, BLASTX, and TBLASTX) and two designed to search for protein sequences (BLASTP and TBLASTN). The BLASTX program is publicly available from NCBI and other sources, for example, BLAST Manual, Altschul et al., NCBI NLM NIH, Bethesda, MD 20894; Alts-chul et al., J. Moi Biol. 215: 403-410 (1990). Smith Waterman's well-known algorithm can also be used to determine identity.

Parameters for comparing polypeptide sequences typically include the following: Algorithm: Needleman and Wunsch, J. Mol.Biol. 48: 443-453 (1970); Comparison Matrix: BLOSSUM62 from Hentikoff eHentikoff, Proc. Nati Acad. Know. USA 89: 10915-10919 (1992); Gap Penalty: 12; Gap Extension Penalty: 4. A program that can be used with these parameters is publicly available as the "gap" program provided by the Genetics Computer Group ("GCG"), Madison, Wisconsin. The above parameters, together with absence of final gap penalty, are the standard parameters for peptide comparisons.

Parameters for comparison between nucleic acid molecule sequences include the following: Algorithm: Needleman and Wunsch, J.Mol. Biol. 48: 443-453 (1970); Comparison matrix: concordances - +10; 15 disagreements = 0; Gap Penalty: 50; Gap Extension Penalty: 3. As used in this exhibit, the "% Identity" is determined with the above parameters, such as the default parameters, for comparisons between nucleic acid molecule sequences and the "gap" program. GCG version 10.2.

Subsets of the nucleic acid sequences of the present invention include fragments of nucleic acid molecules. "Nucleic Acid Demolecule Fragment" refers to a portion of a larger nucleic acid molecule and may be comprised of a significant portion (s) or, in fact, most of the larger nucleic acid molecule. The nucleic acid molecule fragment may comprise a smaller oligonucleotide with approximately 15 to approximately 400 contiguous nucleotides, more preferably, approximately 15 to approximately 45 contiguous nucleotides, approximately 20 to approximately 45 contiguous nucleotides, approximately 15 to approximately 30 contiguous nucleotides. 21 to approximately 30 contiguous nucleotides, approximately 21 to approximately 25 contiguous nucleotides, approximately 21 to approximately 24 contiguous nucleotides, approximately 19 to approximately 25 contiguous nucleotides, or approximately 21 contiguous nucleotides. Fragments of nucleic acid molecules may be made up of a significant part (s) of, or indeed most of, a coding or noncoding region of a plant or, alternatively, may be made of smaller oligonucleotides.

In a preferred embodiment, a fragment exhibits 100% identity with the coding or non-coding region of the plant. In another preferred embodiment, a fragment comprises a part of a larger nucleic acid sequence. In another feature, a nucleic acid molecule fragment has a nucleic acid sequence of at least 15, 25, 50, 100, 200, 300 or 400 contiguous nucleotides of a nucleic acid molecule of the present invention. . In a preferred embodiment, a nucleic acid molecule has a nucleic acid sequence of at least 15, 25, 50, 100, 200, 300, or 400 nucleotides contiguous with a coding or non-coding region. a plant. In one of the most preferred embodiments, a nucleic acid molecule has a nucleic acid sequence of at least 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80 or 90% of the contiguous nucleotides of a nucleic acid. coding or non-coding region complete. In a preferred embodiment, a complete coding or non-coding region may be an elementogenic selected from a complete gene, a single exon, a single intron, a signal sequence, or an untranslated region (RTU). A gene element that does not have the complete sequence of a complete genetic element can be a fragment of a gene element. In a preferred feature of the present invention, the extension of an elementogenic comprises at least 40 nucleotides. In one feature of the present invention, a fragment of a gene is a part of the complete gene element, and this fragment contains approximately 1, 2, 5, 10,20, 30, 40, 50, 60, 70, 80. or 90% of the contiguous nucleotides of the complete elementogen. In a feature of the present invention, a nucleic acid molecule fragment has from about 5% to about 80%, about 10% to about 70%, about 10% to about 60%, about - about 10% - about 50%, about 25% - about 60%, about 25% - about 50%, about 40% - about 60%, about 40% - about 80% , approximately 50% to approximately 90% of the length of a complete gene element.

In a preferred embodiment, a deFAD2-1 intron fragment has from about 20 to about 420, about 30 to about 420, about 40 to about 320, about 50 to about 200, about 50 to about approximately 400, approximately 50 to approximately 420, approximately 60 to approximately 320, approximately 70 to approximately 220, approximately 100 to approximately 200, approximately 100 to approximately 320, approximately 150 to approximately 200, approximately 150 to approximately 150, approximately 220, between about 150 and about 400, between about 200 and about 300, or between about 300 and about 400 contiguous nucleotides. In another preferred embodiment, the length of an FAD2-1 intron fragment is approximately 100, approximately 150, approximately 200, approximately 220, approximately 300, approximately 300, or approximately 350 contiguous nu-cleotides. In another preferred embodiment, the length of an FAD2-1 intron fragment is smaller by about 20, about 40, about 60, about 80, about 100, about 120, about 140, about 160, about 160, about 180, approximately 200, approximately 220, approximately 240, approximately 260, approximately 280, approximately 290, approximately 300, approximately 320, approximately 340, approximately 360, approximately 380, approximately 400 contiguous nucleotides, as compared to the length of SEQID NO. 1. For all of these FAD2-1 intron fragments, truncation or deletion may begin at the 5 'end, at the 3' end, or be internal to a FAD2-1 intron. For all of these FAD2-1 intron fragments, the sequence of an FAD2-1 intron may be SEQ ID NO: 1.

In a preferred embodiment, a fragment of a FATB gene has about 80 to about 450, about 100 to about 500, about 70 to about 500, about 200 to about 400, about 150 to about 300, about 250 to about approximately 350, approximately 200 to approximately 350 contiguous nucleotides of a FATB gene. In a preferred embodiment, a FATB fragment is derived from one half of the total nucleotides present in FATB starting at the 5 'end. For all these FATB fragments, the truncation or deletion may begin at the 5 'end, at the 3' end or be internal to that of FATB. In one preferred embodiment, a FATB fragment is derived from one half of all nucleotides in FATB, starting at the 5 'end of FATB, is derived from one third of all nucleotides closest to the 5' end, in FATB. In an especially preferred embodiment, a FATB fragment contains a transit peptide coding sequence, which preferably encodes the chloroplastic transit peptide. In an especially preferred embodiment, a FATB fragment contains a transit peptide coding sequence, which preferably encodes chloroplastic transit opeptide. In another especially preferred embodiment, a FATB fragment further includes approximately 20, approximately 25, approximately 30, approximately 35, 38, 39, 40, 41.42, 43, approximately 45, approximately 50, approximately 55, or approximately 60 contiguous nucleotides of approximately 40 µg. a 5 'FATB RTU. In one of the most preferred embodiments, a fragment includes a combination of two or more discrete fragments or separate gene elements, such as a FATB 3 'UTR fused to a FATB 5' UTR. Agents of the invention include molecules of nucleic acid. For example, among others, in a feature of the present invention, the nucleic acid molecule of the present invention comprises an intronda sequence SEQ ID NO: 19, 20, 21, 22, 23, 25, 32, 33, 34, 35, 44 , 45, 46 or 47, or fragments or additions thereof. In another feature of the invention, the nucleic acid molecule comprises a nucleic acid sequence that, when introduced into a cell or organism, is able to suppress the production of an RNA or protein while simultaneously expressing, co-expresses or co-expresses another RNA or protein. In a feature of the present invention, the nucleic acid molecule comprises a sequence of nucleic acid, which, when introduced into a cell or organism, is capable of suppressing, at least partially reducing, reducing, substantially reducing or effectively eliminating. expression of FAD2, FAD3 or FATB RNAs endows us, while co-expressing, co-expressing simultaneously or co-ordinately producing at least one RNA from a beta-ketoacyl-ACP synthase I, beta-ketoacil -ACP synthase IV, delta-9 desaturases and / or CP4 EPSPS or protein.

By suppressing, reducing at least partially, reducing, substantially reducing or effectively eliminating the expression of at least one or more endogenous genes, the amount of FAD2 and / or FAD3 available in a plant is decreased, that is, the steady state levels of the plant. protein are reduced, and a lower percentage of polyunsaturated fatty acids such as iinoleate (C18: 2) and iinolenate (C18: 3) can be supplied. Modifications to the fatty acid pool, available for incorporation into triglycerides, may similarly affect the composition of oils in the plant cell. Therefore, a decrease in the expression of FAD2 and / or FAD3 may result in increased proportion of fatty acid monounsaturated acids such as oleate (C18: 1). When the amount of FATB decreases in a plant cell, a decreased amount of fatty acids such as palmitate and stearate may be supplied. Therefore, a decrease in FATB expression may result in an increased proportion of unsaturated fatty acids such as oleate (C18: 1). Simultaneous suppression of FAD2, FAD3 and FATB expression, therefore, directs the FAS aviation to the overall increase of 18-carbon chain monounsaturated fatty acids, such as oleate (C18: 1). See U.S. Patent No. 5,955,650.

By increasing the amount of beta-ketoacyl ACP synthase I (KAS I) and / or beta-ketoacyl ACP synthase IV (KAS IV) available in a plant, the percentage of 16: 0-ACP can be decreased, leading to a 18: 0-ACP percentage increase. A larger amount of 18: 0-ACP, combined with the simultaneous suppression of one or more of FAD2, FAD3 and FATB, helps to direct the composition of the oil to a general increase in oleate (C18: 1). Increasing the amount of delta-9 desatu-rase available in a plant can increase the percentage of unsaturated fatty acids resulting in a general decrease in total unsaturated stearate.

These combinations of increased or decreased expression of enzymes can be engineered to produce oil compositions, including fatty acids, with increased oleate level and decreased levels of linoleate, linolenate, stearate and / or palmitate, as well as decreased overall saturated level. . Intensification of gene expression in plants may occur by introducing extra copies of gene coding sequences into the plant cell or, preferably, incorporating extra copies of gene coding sequences into the plant genome. Overexpression may also occur by increasing the action. regulatory mechanisms that regulate gene expression, that is, positive regulation of gene expression.

Production of CP4 EPSPS in a plant cell will provide resistance or tolerance to the plant cell glyphosate, thereby providing a convenient method for identifying successful transformants by glyphosate tolerance selection.

Suppression of gene expression in plants, also known as gene silencing, occurs at both the transcriptional and post-transcriptional levels. There are several methods for suppressing endogenous sequence expression in a host cell, including, but not limited to, antisense suppression, co-suppression, ribozymes, combinations of antisense sensee (double-stranded RNAi), promoter silencing, and protein binding. DNA, such as zinc finger proteins (zinc ίϊηςβή. (See, for example, WO 98/53083, WO 01/14538 and US Patent 5 759 829 (Shewma-ker)). Some of these mechanisms are associated with nu-cletic acid homology. DNA or RNA level This homology refers to the sequence similarity of DNA or protein within the same species or between different species.Genetic silencing occurs if the DNA sequence introduced into a host cell is sufficiently homologous to a gene or gene. -genogen, so that transcription of the introduced DNA sequence induces transcriptional or post-transcriptional gene deletion of the endogenous gene.

Sufficient homology for suppression of equilibrium expression levels may be at least 50%, approximately 60%, or approximately 70% identical over the entire length of the DNA sequence with respect to a coding or non-coding region of an expression. plant, or in relation to a nucleic acid sequence that is complementary to a coding or non-coding region of a plant. The most preferred DNA sequences are those which, over their entire length, are at least 80% identical; at least 85% identical; at least 90% identical; at least 95% identical; at least 97% identical; at least 98% identical; at least 99% identical; or 100% identical to a plant coding or non-coding region, or a nucleic acid sequence complementary to a plant coding or non-coding region. In plants, double-stranded RNA molecules can induce sequence-specific deletion. Gene silencing has often been referred to as double-stranded RNA ("dsRNAi"), in plants such as interfering RNA or RNAi, in Caenorhabditis elegans and in animals and asquelling in fungi.

In a preferred embodiment, the nucleic acid molecule of the present invention comprises a first set of DNA sequences, each exhibiting sufficient homology to one or more coding or non-coding sequences of a plant gene, so that when it is expressed it is capable of effectively eliminating, substantially reducing or at least partially reducing the level of a demRNA transcript or protein encoded by the gene from which the coding sequence or non-coding was derived, or any gene that has homology to the coding sequence or not coding intended.

In a preferred embodiment, the nucleic acid molecule of the present invention comprises (a) a first set of DNA sequences, each exhibiting sufficient homology to one or more coding or non-coding sequences of a plant gene, such that when it is expressed, is capable of effectively eliminating, substantially reducing or at least partially reducing the level of a demRNA transcript or protein, encoded by the gene from which the coding or non-coding sequence was derived, or any gene having sequence homology. (b) a second set of DNA sequences, each exhibiting sufficient homology to a plant gene so that, when expressed, it is capable of partially enhancing, increasing, enhancing, substantially enhancing the level of a mRNA transcript or protein encoded by the gene.

As used in this exposure, "a set" of DNA sequences may be one or more sequences that encode or not a protein. For example, a first set of DNA sequences may consist of only one promoter, one non-coding region and one terminator. A second set of DNA sequences may or may not be present after or before a first set of DNA sequences.

As used herein, "a reduction" in the level or amount of an agent, such as a protein or mRNA, means that the level or amount is reduced relative to a cell or organism that does not have a DNA sequence capable of reducing the agent. . For example, "at least partial reduction" refers to a reduction of at least 25%, "substantial reduction" refers to a reduction of at least 75% and "effective elimination" refers to a reduction greater than 95%, all of which are reductions in the level or amount of agent, relative to a cell or organism that does not have a DNA sequence capable of reducing the agent.

As used herein, "intensified" or "increased" level or amount of an agent, such as a protein or mRNA, means that the level or amount of the agent present in a cell, tissue, or plant with a similar genetic background, but devoid of an introduced nucleic acid molecule encoding the protein or mRNA. For example, a "at least partially enhanced" level refers to an increase of at least 25%, and a "substantially enhanced" level refers to at least 100% increase, all of which are increases in the level or quantity of an agent, relative to the level or amount of the agent present in a cell, tissue or plant of similar genetic background but lacking an introduced nucleic acid molecule encoding the protein or mRNA. In a preferred embodiment, an increase in expression may be any expression wherein the protein is heterologous to the system. For example, any expression of CP4 EPSPS may be an increase in expression if there was no expression in the plant prior to introduction of a nucleic acid molecule that encodes the protein.

When levels of an agent are compared, this comparison is preferably conducted between organisms with similar genetic background. Preferably, a similar genetic background is that the organisms being compared share 50% or more, more preferably 75% or more, and even more preferably 90% or more of sequence identity of nuclear genetic material. In another preferred feature, a similar genetic background is that in which the organisms being compared are plants, and isogenic plants, except for any genetic material originally introduced employing plant transformation techniques. Measurement of the level or amount of an agent may be conducted by any suitable method, non-limiting examples of which include comparisons of mRNA transcript, protein or peptide and / or phenotype, especially oil content. As used in this disclosure, mRNA transcripts include processed and unprocessed mRNA transcripts, and proteins or peptides include proteins or peptides with or without post-translational modification.

The DNA sequences of the first set of DNA sequences may be coding sequences, intron sequences, 3'UTR sequences, 5'UTR sequences, promoter sequences, other non-coding sequences, or any combination of the foregoing. The first set of DNA sequences encode one or more sequences which, when expressed, are capable of selectively reducing either or both protein and transcript encoded by a gene selected from the group consisting of FAD2, FAD3 and FATB. In a preferred embodiment, the first set of DNA sequences is capable of expressing antisense RNA, wherein each of the antisense sequences may be linked in one transcript or may be unbound in individual transcripts. In yet another preferred embodiment, the first set of DNA sequences are physically linked sequences capable of expressing a single dsRNA molecule. In a different preferred embodiment, the first set of DNA sequences is capable of expressing co-suppression RNA, wherein each of the sense sequences may be linked in one transcript or may be unbound in individual transcripts. Examples of embodiments of the first set of DNA sequences are described in Part B of the Detailed Description and Examples.

The second set of DNA sequences encodes one or more sequences which, when expressed, are capable of increasing one or both protein and transcript, encoded by a gene selected from the group consisting of beta-ketoacyl-ACP synthase I (KAS I), beta -Ketoacyl ACPsynthase IV (KAS IV), delta-9 desaturase and CP4 EPSPS. DNA sequences from the second set of DNA sequences can be physically linked sequences. Examples of embodiments of the second set DNA sequences are described below in Parts C and D of the Detailed Description.

Accordingly, the present invention provides methods for altering fatty acid composition and compounds containing such fatty acids, such as oils, waxes and fats. The present invention also provides methods for the production of fatty acids in particular in host cell plants. These methods employ the use of the expression cassettes described in this disclosure for modifying the FAS pathway in the plant host cell.

B. First set of DNA sequences

In a feature of the present invention, a nucleic acid molecule comprises a first set of DNA sequences, which, when introduced into a cell or organism, expresses one or more sequences capable of effectively eliminating, substantially reducing, or at least partially reducing mRNA transcript levels. or proteins encoded by one or more genes. Preferred features include as an endogenous gene, a plant gene and a non-viral gene. In one feature of the present invention, a gene is a FAD2, FAD3or FATB gene.

In one feature, a nucleic acid molecule of the present invention comprises a DNA sequence that exhibits sufficient homologies to one or more coding or non-coding sequences of a plant gene, which, when introduced into a plant cell or expressed and expressed, is capable of effectively eliminating, substantially reducing or at least partially reducing the level of an mRNA or protein transcript, encoded by the gene from which the coding or non-coding sequence (s) was derived / derived. DNA sequences from the first set of DNA sequences transcribe RNA sequences or RNA fragments that exhibit at least 90%, preferably at least 95%, more preferably at least 98%, or more preferably 100. % of identity with respect to a coding or non-coding region derived from the gene to be deleted. This percent identity may be compared to any other nucleic acid fragment. Preferably, the non-coding sequence is a 3 'UTR, 5'UTR, a fraction of a sequence encoding a protein or an intron of a plant gene. More preferably, the non-coding sequence is a promoter sequence, 3 'UTR, 5'UTR or an intron of a plant genus. The intron may be located between exons or in the space between 5'or 3 'of a plant gene. The coding sequence is preferably a fraction of a structure encoding a protein.

The sequence (s) of the first set of DNA sequences may be created to produce dsRNA, a suppressor RNA, or an antisense RNA, or suppress any other transcript for seating the desired effect when introduced into a plant cell or plant. These DNA sequence (s) may be fragments of nucleic acid molecules.

A plant intron can be any plant intron from a gene, whether endogenous or introduced. Nucleic acid sequences from these organism introns can be obtained from or derived from a variety of sources, including, but not limited to, databases such as EMBL and Genbank which can be found on the Internet at e-bi.ac.uk/swisprot/; expasy.ch/; embl-heidelberg.de/; and ncbi.nlm.nih.gov. Nucleic acid consequences of these introns can also be derived, among others, from sources such as the GENSCAN program that can be found on the Internet at genes.mit.edu/GENSCAN.html.

Additional introns may also be obtained by methods including, but not limited to, selecting from a genomic library with a known sequence of exon or intron, comparing genomic sequence with its corresponding cDNA sequence, or cloning an intron such as a soybean cDNA by alignment with a genomic sequence of another organism, such as Arabidopsis. In addition, other intron nucleic acid consequences will become apparent to any person skilled in the art. The methods described above may also be used to derive and obtain other non-coding sequences, including, but not limited to, promoter sequences, 3'UTR sequences, and 5'UTR sequences.

A "FAD2 '," Δ12 desaturase "or" Omega-6 desaturase "gene encodes an enzyme (FAD2) capable of catalyzing the insertion of a double strand into an acyl fatty group at the twelfth position, counted from the terminal carboxyl. FAD2-1 "is used to refer to a naturally expressed FAD2 gene specifically in seed tissue, and the term" FAD2-2 'is used to refer to a FAD2 gene that is (a) a different from a FAD2-1 gene and (b ) is naturally expressed in multiple tissues including the seed. Representative sequences of FAD2 include, but are not limited to, those set forth in U.S. Patent Application No. 10/176 149, filed June 21, 2002, and SEQ ID NOs: 1-6.

A "FAD3 '," Δ15 desaturase "or" Omega-3 desaturase "gene encodes an enzyme (FAD3) capable of catalyzing the insertion of a double strand into an acyl fatty group in the fifteenth position, counted from the terminal dacarboxyl. FAD3-1, FAD3-A, FAD3-B and FAD3-C 'are used to refer to members of the FAD3 gene family that are naturally expressed in multiple tissues, including seed. Representative sequences of FAD3 include, but are not limited to, those set forth in U.S. Patent Application No. 10/176 149, filed June 21, 2002, and SEQ ID NOs: 7-27.

A "FATB 'or" palmitoyl-ACP thioesterase "gene encodes an enzyme (FATB) capable of catalyzing the hydrolytic cleavage of the thioester carbon-sulfur bond in the prosthetic palmitoyl-ACP pantothene group, as its preferred reaction. Hydrolysis of other ACP thioesters Fatty acid may also be catalyzed by this enzyme Representative sequences of FATB-I include, but are not limited to, those disclosed in US Patent Application No. 60/390 185, filed June 21, 2002; 5,955,329; 5,723,761; 5,955,650 and 6,331,664; and SEQ ID NOs: 28-37 Representative sequences of FATB-2 include, but are not limited to, those set forth in SEQ ID NOs: 42-47.

C. Second set of DNA sequences

In a feature of the present invention, a nucleic acid molecule comprises a second set of DNA1 sequences which, when introduced into a cell or organism, is capable of partially enhancing, enhancing, or substantially enhancing mRNA or protein transcript levels, encoded by one or more genes. In one feature of the present invention, a gene is an endogenous gene. In one feature of the present invention, a gene is a gene endogenous. In a preferred feature, heterologous and endogenous genes may be in the same nucleic acid molecule. In a feature of the present invention, a gene is a plant gene. In another feature of the present invention, a gene is a truncated gene wherein the truncated gene is capable of catalyzing the reaction catalyzed by the complete gene. In a feature of the present invention, a gene is a beta-ketoacyl-ACP synthase I gene, beta-ketoacyl-ACP synthase IV gene, delta-9 such-turase gene, CP4 EPSPS gene, or a combination of these genes.

A gene of the present invention may be any gene, either endogenous or introduced. The nucleic acid sequences of these genes can be derived from a variety of sources, including but not limited to databases such as EMBL and Genbank which can be found on the Internet at ebi.ac.uk/swisprot/; expasy.ch/; embl-heidelberg.de/; encbi.nlm.nih.gov. The nucleic acid sequences of these genes can also be derived, among others, from sources such as the GENSCAN program that. can be found on the Internet at genes.mit.edu/GENSCAN.html.

Additional genes may also be obtained by methods which include, inter alia, selection in a genomic library or DNA library with a known gene sequence probe, cloning of an umgene by alignment with a gene or probe from another organism, such as Arabidopsis. In addition, other nucleic acid sequences will be apparent to anyone skilled in the art. Additional genes may, for example, without restriction, be amplified by polymerase chain reaction (PCR) and used in an embodiment of the present invention. In addition, other nucleic acid sequences will be apparent to any person skilled in the art. Automatic nucleic acid synthesizers may be employed for this purpose and to create a nucleic acid molecule, which is also found in a cell or organism. Instead of this synthesis, nucleic acid molecules can be used to define a primer pair that can be used with PCR to amplify and obtain any desired nucleic acid molecule or fragment of a first gene.

A "KAS Γ" or "beta-ketoacyl ACP synthase I" gene encodes an enzyme (KAS I) capable of catalyzing the elongation of an acylgrax group to palmitoyl ACP (C16: 0). among others, those set forth in US Patent No. 5,475,099 and PCTPublication WO 94/10189, and SEQ ID NO: 38.

A "KAS IV" or "beta-ketoacyl ACP synthase IV" gene encodes an enzyme (KAS IV) capable of catalyzing the condensation of mid-acyl ACPs and enhancing production of 18: 0-ACP Representative KAS IV sequences include, but are not limited to, those set forth in PCT Publicati-on WO 98/46776, and SEQ ID NO: 39.

A "delta-9 desaturase" or "stearoyl-ACP desaturase" or "Omega-9 desaturase" gene encodes an enzyme capable of catalyzing the insertion of a double strand into an acyl fatty group in the ninth position, counted from A delta-9 desaturase of the present invention is that of a plant or cyanobacterium, and more preferably a delta-9 desaturase also found in an organism selected from the group consisting of Cartharmus tinctorius, Ricinus communis, Simmon-sia chinensis. and Brassica campestris Representative sequences of delta-9 desaturase include, but are not limited to, those set forth in US Patent No. 5,723,595 and SEQ ID NOs: 40-41.

A 'CP4 EPSPS' or 'CP4 5-enolpiruvyishikimato-3-phosphate synthase' gene encodes an enzyme (CP4 EPSPS) capable of conferring significant glyphosate resistance to plant cells and their generated plants. The sequence of CP4 EPSPS can be a sequence of CP4EPSPS derived from CP4 or a variant or synthetic form thereof of Agro-bacterium tumefaciens sp., as described in US Patent No. 5,633,435. Representative sequences of CP4 EPSPS include, but are not limited to, those disclosed in US Patent Nos. 5,627,061 and 5,633,435.

D. Recombinant Vectors and Constructs

In the transformation or transfection of plants can be used

of one or more nucleic acid constructs of the invention. Levels of products, such as transcripts or proteins, can be increased or decreased throughout an organism, such as a plant, or located in one or more specific organs or tissues of the organism. For example, product levels may be increased in one or more tissues and organs of a plant, including but not limited to: roots, tubers, stems, leaves, stems, fruit, grains, nuts, bark, pods, seeds and flowers. A preferred organ is seriously. For example, exogenous genetic material can be transferred to a plant cell and it regenerates into a fertile or sterile whole plant or plant part.

"Exogenous genetic material" is any genetic material, whether naturally occurring or not, derived from any source, capable of being inserted into any organism. Such exogenous genetic material includes, among others, nucleic acid molecules and constructs of the present invention. Exogenous genetic material can be transferred to a host cell by means of a vector or DNA construct created for that purpose. Similarly, a virus can transfer exogenous genetic material to a host cell. Exogenous genetic material may have a DNA sequence identical to that of the endogenous gene, but have been re-introduced into the host cell by means of a vector or DNA construct to suppress endogenous gene expression. Design of such a vector is generally included in the art (See, for example, PlantMolecuIarBioIogy: A Laboratory Manual, Clark (ed.), Springer, New York (1997)). In a preferred embodiment, the exogenous genetic material is recombinant DNA.

A construct or vector may include a plant cell acting promoter, or a plant promoter, to express a chosen nucleic acid molecule. Some plant cell-acting promoters have been described in the literature, and CaMV 35S and FMV promoters are preferred for plant use. Other examples of preferred promoters include bean marcelin and 7S alpha. Other preferred promoters are amplified or duplicate versions of the CaMV 35S and FMV 35S promoters. Odell et al., Nature 313: 810-812 (1985); U.S. Patent No. 5,378,619. Additional promoters that may be used are disclosed, for example, in U.S. Patent 5,378,619; 5,391,725; 5,428,147; 5,447,858; 5,608,144; 5,608,144; 5,614,399; 5,633,441; 5,633,435 and 4,633,436. In addition, a tissue-specific intensifier may be used.

Especially preferred promoters may also be used to express a nucleic acid molecule of the present invention in seeds or fruits. Indeed, in a preferred embodiment, the promoter used is a seed specific promoter. Examples of such promoters include the 5 'regulatory regions of genes such as napina (Kridl et al., Se-ed. Res. 1: 209-219 (1991)), phaseoline, stearoyl ACP desaturase, 7Soc, 7soc' (Chen et al. , Proc. Nati Acad. Sci., 83: 8560-8564 (1986)), USP, arceline and oleosin. Preferred promoters for seed expression are the 7Soc, 7Soc \ napin and FAD2-1A promoters.

Constructs or vectors may also include other genetic elements, including, but not limited to, 3 'transcriptional terminators, 3' polyadenylation signal sequences, other translated nucleic acid sequences, selection or investigation markers, promoters, enhancers, and operators. Constructs or vectors may also contain a promoter-free gene that may utilize an endogenous promoter in the insert.

Nucleic acid molecules that may be used in plant transformation or transfection may be any of the nucleic acid molecules of the present invention. The illustrated embodiments do not intend to restrict the present invention. Examples of nucleic acid molecules were set forth in Part A of the Detailed Description; and other non-limiting examples of nucleic acid molecules are described below illustrated in FIGS. 1-4 and in the Examples.

Referring now to the drawings, embodiments of the nucleic acid molecule of the present invention are shown in FIGS. 1-4. As explained above, the nucleic acid molecule comprises (a) a first set of DNA sequences and (b) a second set of DNA1 sequences located on one or more of T-DNA1 each flanked by a right edge and a left edge. In all regions of T-DNA, the direction of transcription is shown by arrows. DNA sequences from nucleic acid molecules can be arranged in monocistronic or polycistronic configurations. Preferred embodiments include that in which the first set of DNA sequences and the second set of DNA sequences are located in a single region of the T-DNA.

In each of the illustrated embodiments, the first set of DNA sequences comprises one or more sequences which, when expressed, are capable of selectively reducing one, two or all proteins and transcripts encoded by a gene selected from the group consisting of FAD2, FAD3 and FATB. Preferably, each sequence in the first set of DNA sequences is capable, when expressed, of suppressing the expression of a different gene, including, but not limited to, different members of the gene family. Sequences may include coding sequences, intron sequences, 3 'UTR sequences, 5' UTR1 sequences or other non-coding sequences or any combination of the foregoing. The first set of DNA sequences can be expressed in any suitable form, including as dsRNA construct, deco-suppression sense construct, or antisense construct. The first set of DNA sequences is operably linked to at least one promoter because it directs expression of the sequences, which may be any plant functional promoter or any plant promoter. Preferred promoters include, but are not limited to, a napin promoter, 7Sa promoter, 7Sa 'promoter, arcelin promoter or a FAD2-1A promoter.

The second set of DNA sequences comprises coding sequences, each of which a DNA sequence that encodes a sequence which, when expressed, is capable of increasing protein or transcript, or both, encoded by a gene selected from the group-constituted. by KAS I, KAS IV, delta-9 desaturase and CP4 EPSPS. Each coding sequence is associated with a promoter, which may be any functional promoter in a plant or any plant promoter.

Preferred promoters for use in the second set of DNA sequences are an FMV promoter and / or seed specific promoters. Especially preferred promoters include, but are not limited to, a napin promoter, 7Sa promoter, 7Sa 'promoter, arcelin promoter, a dedelta-9 desaturase promoter or a FAD2-1A promoter.

In the embodiments depicted in FIGS. 1 and 2, the first set of DNA sequences, when expressed, is capable of forming a dsRNA molecule that is capable of suppressing expression of the protein or transcript, or both, encoded or transcribed from a gene selected from the group consisting of FAD2, FAD3 and FATB. The first set of DNA sequences depicted in FIG. 1, comprises non-coded ras sequences, each expressing an RNA sequence (not shown) that expresses identity with a non-coding region of a gene selected from the group consisting of the FAD2, FAD3 and FATB genes. Non-coding sequences each express an RNA sequence that exhibits at least 90% identity with a non-coding region of a gene selected from the group consisting of the FAD2, FAD3 and FATB genes. The first set of DNA sequences also comprises three antisense sequences, each expressing an antisense RNA sequence (not shown), capable of forming a double-stranded RNA molecule with its corresponding RNA sequence (as shown in Figure 1). expressed by non-coding sequences).

Non-coding sequences may be separated from antisense sequences by a spacer sequence, preferably one that promotes the formation of a dsRNA molecule. Examples of such spacer sequences include those set forth in Wesley et al., Plant J., 27 (6): 581-90 (2001) and Hamilton et al., PIantJ., 75: 737-746 (1988). In a preferred feature, the spacer sequence is capable of forming a hairpin structure as illustrated in Wesley et al, supra. Especially preferred spacer sequences in this context are introns of plants or parts thereof. A particularly preferred plant intron is a spliceable intron. Spliceable introns include, but are not limited to, an intron selected from the group consisting of PDK intron, FAD3-1A FAD3-1B, FAD3 intron # 1, FAD3 intron # 3A, FAD3 intron # 3B, FAD3 intron # 3C, FAD3 intron # 4, FAD3 intron # 5, FAD2 intron # 1 and FAD2-2 intron. Preferred spliceable introns include, but are not limited to, an intron selected from the group consisting of FAD3 intron # 1, FAD3 intron # 3A, FAD3 intron # 3B, FAD3 intron # 3C and FAD3 intron # 5. Other preferred spliceable introns include, among others, an intron whose length is from about 0.75 kb to about 1.1 kb and which is capable of facilitating a noRNA harpin structure. FAD3 intron # 5 is one of the especially preferred examples of spliceable deintron.

The non-coding molecules in sense orientation may optionally be separated from the corresponding molecules in antisense orientation by a DNA spacer segment. The spacer segment may be an artificial gene or DNA fragment. The spacer segment may be short to facilitate hairpin dsRNA formation, or long to facilitate hairpin structure dsRNA formation. The spacer may be provided by increasing the extent of one of the sense or antisense molecules as set forth in US 2005/0176670 A1. Alternatively, a right-edge-right-edge ("RB-RB") sequence may be created after insertion into the plant genome as set forth in patent application U.S.2005 / 0183170.

Referring now to FIG. 1, the nucleic acid molecule comprises two regions of the T-DNA, each flanked by a right edge and a left edge. The first region of the T-DNA comprises the first set of DNA sequences that is operatively linked to a promoter, and the first region of the T-DNA further comprises a first part of the second set of DNA sequences that comprises a first promoter operably linked to a first coding sequence, and a second promoter operably linked to a second coding sequence. The second region of the T-DNA comprises a second part of the second set of DNA sequences that comprises a third promoter operably linked to a third coding sequence. In a preferred embodiment depicted in FIG. 2, the nucleic acid molecule comprises a single region of T-DNA, flanked by a right edge and a left edge. The first and second sets of DNA sequences are both located in the single region of T-DNA.

In the dsRNA expressing embodiments shown in the FLGS. 1 and 2, the sequence order can be changed from that illustrated and written, however, non-coding sequences and antisense sequences are preferably arranged around the spacer sequence so that, when expressed, the first non-coding sequence can be To hybridize to the first antisense sequence, the second non-coding sequence can hybridize to the second antisense sequence, and the third non-coding sequence can hybridize to the third antisense sequence so that only a single dsRNA molecule can be formed. . Preferably, the non-coding sequences are in sense orientation and the antisense sequences in antisense orientation are related to the promoter. The number of non-coding, anti-coding antisense sequences, and the various relative positions thereof in the T-DNA region (s) may be appropriately altered to achieve the objects of the present invention.

Referring now to FIGS. 3 and 4, the illustrated nucleic acid molecule comprises a region of the T-DNA flanked by a right edge and a right edge, on which the first and second set of DNA sequences are located. The first set of DNA sequences is operably linked to a promoter and a transcriptional termination signal. The second set of DNA sequences comprises a first promoter operably linked to a first coding sequence, a second promoter operably linked to a second coding sequence, and a third promoter operably linked to a third coding sequence. The transcriptional termination signal may be either functional in a plant or any transcriptional plant determination signal. Preferred transcriptional termination signals include, but are not limited to, a 3 'E9 Rubisco pea sequence, a 3' Brassica napin sequence, a 3 'tml sequence, and a 3' sequence of nos.

In the embodiment depicted in FIG. 3, the first set of DNA sequences, when expressed, is capable of forming a sense co-suppression construct capable of suppressing expression of the protein or transcript, or both, encoded or transcribed from a gene selected from the FAD2 group. , FAD3 and FATB. The first set of DNA sequences comprises three noncoding sequences, each expressing an RNA sequence (not shown) that exhibits identity with one or more noncoding regions of a gene selected from the group consisting of the FAD2, FAD3, and FATB genes. . The non-coding ras sequences each express an RNA sequence that exhibits at least 90% identity with one or more non-coding regions of a selected gene from the group consisting of the FAD2, FAD3 and FATB genes. The order of the noncoding sequences in the first set of DNA sequences may be altered from that illustrated and described in this exposition, but the noncoding sequences are arranged in sense orientation relative to the promoter.

FIG. 4 depicts one embodiment in which the first set of DNA sequences, when expressed, is capable of forming an antisense construct capable of suppressing the expression of one or more other transcribed proteins, encoded or derived from a gene selected from the FAD2 group, FAD3 and FATB. The first set of DNA sequences comprises three antisense sequences, each expressing an RNA sequence (not shown) that exhibits identity with one or more non-coding regions of a gene selected from the group consisting of FAD2, FAD3 and FATB genes. The antisense sequences each express an antisense RNA sequence that exhibits at least 90% immunity with one or more non-coding regions of a selected gene from the group FAD2, FAD3, and FATB. The order of antisense sequences in the first set of DNA sequences can be changed from that illustrated and described in this exhibition, but antisense sequences are arranged in antisense orientation relative to the promoter.

The nucleic acid molecules described above are preferred embodiments that address the object, aspects and advantages of the present invention. The illustrated embodiments are not intended to restrict the present invention. The arrangement of the sequences in the first and second set of DNA sequences in the nucleic acid molecule is not limited to the illustrated and described arrangements and may be altered in any suitable manner so that the objects, aspects and advantages of the present one. invention, as described and illustrated in the accompanying drawings, are achieved. Transgenic organisms and their production methods

Any of the inventive nucleic acid molecules and constructs may be introduced into a plant or plant cell in a permanent or transient manner. Preferred nucleic acid molecules and constructs of the present invention are described above, in Parts A to D of the Detailed Description, and in the Examples. Another embodiment of the invention is directed to a method of producing transgenic plants, which generally comprises the steps of selecting a suitable plant or plant cell, transforming the plant or plant cell with a recombinant vector and obtaining a transformed host cell.

In a preferred embodiment, the plant or cell is a plant, or derivative thereof, involved in the production of vegetable oils for food and industrial use. Seasonal oilseed crops are especially preferred. Plants of interest include, among others, rapeseed (canola and Erucic Acid Rich varieties), corn, soybeans, crambe, mustard, castor, peanuts, sesame, cotton, flax, saffron, oil palm, flax, sunflower and coconut. The invention also applies to monocotyledonous and dicotyledonous species, and may be readily applied to new and / or improved transformation techniques and regulators.

Methods and technology for introducing DNA into plant cells are well known to those skilled in the art, and the use of virtually any method by which nucleic acid molecules can be introduced into a cell is suitable in the present invention. Non-limiting examples of suitable methods include: Chemical methods; physical methods such as microinjection, electroporation, gene gun, microparticle bombardment and vacuum infiltration; viral vectors and receptor-mediated mechanisms. Other methods of cell transformation can be used as well, including but not limited to introducing plant DNA by direct transfer of pollen DNA, direct injection of DNA into reproductive organs of a plant, or direct injection of DNA into immature embryo cells, followed by by rehydration of dried embryos.

Agrobacterium-mediated transfer is a broad spectrum system that can be applied to gene introduction into plant cells. See, for example, Fraley et al., Bio / Technology 3: 629-635 (1985); Rogers et al., Methods Enzymol. 753: 253-277 (1987). The DNA region to be transferred is defined by the edge sequences and the intervening DNA is usually inserted into the plant genome. Spielmann et al., MoLGeri. Genet. 205: 34 (1986). Modern Agrobacterium transformation vectors are able to replicate in E. coli as well as Agrobacterium, allowing for convenient manipulations. Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell (eds.), Springer-Verlag, New York, pp. 179-203 (1985).

Plant regeneration, development and cultivation, derived from transformants from a single plant protoplast or from various transformed explants, are known in the art. See, generally, Maliga et al., Methods in Plant Molecular Biology, Cold Spring HarborPress (1995); Weissbach and Weissbach, In: Methods for Molecular Plant Biology, Aeademic Press, San Diego, CA (1988). Plants of the present invention may be part of or generated from an breeding program, and may also be reproduced by apomixis. Methods for producing apomitic plants are known in the art. See, for example, U.S. Patent 5,811,636.

In a preferred embodiment, a plant of the present invention which includes nucleic acid sequences which, when expressed, are capable of selectively reducing the level of a FAD2, FAD3 and / or FATB protein and / or a FAD2, FAD3 and / or transcript. FATB is cross-linked with another plant of the present invention which includes nucleic acid sequences which, when expressed, are capable of overexpressing another enzyme. Preferably, the other enzyme is selected from the group consisting of beta-ketoacyl ACP synthase I, beta-ketoacyl ACP synthase IV, delta-9 desaturase eCP4 EPSPS.

In another feature, a plant of the present invention may be crossed with another plant, transgenic or not. A plant of the present invention may be cross-bred with another plant having an oil composition containing modified levels of fatty acids, for example, among others, a lower oil composition variety. In a preferred embodiment, a plant of the present invention is cross-bred with a variety of less than 3 wt% acid, or in another embodiment, a plant of the present invention is crossed with another plant of more than 20 wt%. of stearic acid. These plants, containing modified levels of fatty acids, are known in the art, and described, for example, in Hawkins and Kridl (1998) Plant Journal 13 (6): 743-752 and US Patent No. 6,365,802. F. Products of the present invention

The plants of the present invention may be used in whole or in part. Preferred parts of plants include breeding or depositing parts. The term "plant parts" as used in this exhibition includes, but is not limited to, seed, endosperm, ovum, pollen, roots, tubers, stems, leaves, stems, fruit, grains, nuts, bark, pods, seeds. efflores. In an especially preferred embodiment of the present invention, part of the plant is a seed.

Any plant or parts thereof of the present invention may be processed to produce feed, food, protein or oil preparation. In a preferred embodiment of the present invention, a plant may be one whose oil has fatty acid composition of the present invention. An especially preferred part of the plant for this purpose is a seed. In a preferred embodiment, the feed, food, protein or oil preparation is created for domestic animals, fish or humans, or any combination. Methods for producing feed, food, protein or oil preparations are known in the art. See, for example, U.S. Patents 4,957,748, 5,100,679, 5,219,596, 5,936,069, 6005,076, 6,146,669 and 6,156,227. In a preferred embodiment, the protein preparation is high in protein. This protein rich preparation preferably has a protein content above 5% w / v, more preferably 10% w / v and even more preferably 15% w / v.

In a preferred oil preparation, the oil preparation is oil-rich oil derived from a plant or part thereof of the present invention, above 5% w / v, more preferably 10% w / v even more. preferably 15% w / v. In a preferred embodiment, the oil preparation is liquid and with a volume greater than 1, 5, 10 or 50 liters. The present invention provides an oil, produced from plants of the present invention or generated by a method of the present invention. This oil may exhibit enhanced oxidative stability. In addition, this oil may be one of the major or secondary components of any resulting product.

In addition, this oil can be mixed with other oils. In a preferred embodiment, the oil, produced from plants of the present invention or generated by a method of the present invention, constitutes more than 0.5%, 1%, 5%, 10%, 25%, 50%, 75% or 90%. % by volume or weight of the oil component of any product. In another embodiment, the oil preparation may be mixed and make up more than 10%, 25%, 35%, 50% or 75% of the mixture by volume. Oil produced from a plant of the invention may be mixed with one or more organic solvents or oil distillates.

Plant seeds can be placed in a container. Container as used in this exhibit is any object capable of containing these seeds. A container preferably contains above about 500, 1,000, 5,000 or 25,000 seeds, wherein at least about 10%, 25%, 50%, 75% or 100% of the seeds are derived from a plant of the present invention. . The present invention also provides a container of more than about 10,000, more preferably about 20,000 and even more preferably about 40,000 seeds, wherein more than about 10%, more preferably about 25%, more preferably about 50%. % and even more preferably approximately 75% or 90% of the seeds are seeds derived from a plant of the present invention. The present invention also provides a container of more than about 10 kg, more preferably about 25 kg and even more preferably about 50 kg of seeds, wherein more than about 10%, more preferably about 25%. more preferably 50% and even more preferably approximately 75% or 90% of the seeds are seeds derived from a plant of the present invention.

F. Oil Compositions

For many oil applications, the saturated fatty acid levels are preferably less than 8% by weight and even more preferably approximately 2-3% by weight. Saturated fatty acids have high melting points, undesirable in many applications. When used as raw material or fuel, saturated fatty acids cause turbidity at low temperatures and impart unfavorable cold flow properties such as pour point and cold filter plugging points to the fuel. Consumers and the food industry may prefer oil products containing low levels of fatty acids because these are considered healthier and / or because they are identified as "saturated fat free" according to FDA guidelines. In addition, oils with low saturated levels reduce or eliminate the need to be adapted for food applications such as parasitized oils. In biodiesel and lubricant applications, oils with low levels of saturated fatty acids confer improved cold flow properties and do not cloud at low temperatures.

The factors that control the physical properties of a particular oil are complex. Palmitic acid, stearic acid and other saturated fatty acids are typically solid at room temperature, as opposed to unsaturated fatty acids that remain liquid. Since saturated fatty acids do not have double bonds in the acyl chain, they remain stable to oxidation at elevated temperatures. Fatty acid acids are important components in margarines and chocolate formulas, but for many food applications, reduced levels of saturated fatty acids are desired.

Oleic acid has a double bond, but is still relatively stable at high temperatures, and oil with high levels of oleic acid is suitable for cooking and other processes that require heating. Increased consumption of oleic acid-rich oils has recently been recommended because oleic acid appears to decrease blood levels of low-density liproproteins ("LDLs") without affecting high-density delipoprotein ("HDLs") levels. some limit on oleic acid levels may be desired, because when it is degraded at high temperatures it creates compounds with unpleasant taste and diminishes the pleasing tastes created by oxidation of linoleic acid. Neff et al., JA-OCS1 77: 1303-1313 (2000); Warner et al., J. Agric. Food Chem. 49: 899-905 (2001). Preferred oils have oleic acid levels of 65-85% or less by weight to limit the release of flavors in food applications such as frying oil and fried food. In other preferred oils, oleic acid levels are above 55% by weight to improve oxidative stability.

Linoleic acid is one of the major polyunsaturated fatty acids in foods and is an essential nutrient for humans. It is a desired component of many food applications because it is an important precursor to fried food flavoring substances, such as 2.4 decadienal, which makes fried foods tasty. However, the stability of linoleic acid is limited when heated. Preferred oils for food have linoleic acid levels of 10% or more by weight to increase the formation of desired substances that impart flavor to the fried food, and also 25% less by weight to reduce the formation of unpleasant slumps. Linoleic acid also has cholesterol-lowering properties, although dietary excess may reduce the ability of human cells to protect against oxidative injury, thereby increasing the risk of cardiovascular disease. Toborek et al., Am J.Clin. J. 75: 119-125 (2002). See generally Flavor Chemistry of Lipid Foods, editors D.B. Min & T.H. Smouse, Am Oil Chem. Soc., Cham-Paign, IL (1989).

Linoleic acid with a lower melting point than oleic acid further contributes to better cold flow properties, desirable in biodiesel and biolubricant applications. Preferred oils linoic acid levels for most applications are 30% or less by weight because linoleic acid oxidation limits shelf life for storing or using the oil for frying, food, feed, fuel produced and lubricant. See generally Physical Propertiesof Fatsl Oilsl and Emulsifiers, -eô. N. Widlak, AOCS Press (1999); Erhan & Asadauskas, Lubricant Basestocks from Vegetable Oils, Industrial Crops and Products, 11: 277-282 (2000). In addition, high levels of linoleic acid in livestock may lead to undesirable high levels of milk cattle nolite linoleic acid and therefore poor oxidative stability and unpleasant taste. Timmons et al., J. Dairy Sci. 84: 2440-2449 (2001). An extended use oil composition has linoleic acid levels of 10-25% by weight.

Linolenic acid is also an important component of the human diet. It is used to synthesize the ω-3 family of long chain fatty acids and the prostaglandins derived from them. However, their double bonds are highly susceptible to oxidation, so high linolenic acid oils deteriorate rapidly when exposed to exposure, especially at high temperatures. Partial hydrogenation of these oils is often necessary before they can be used in food products to slow the formation of unpleasant tastes and smells when the oil is heated, but hydrogenation creates harmful trans fatty acids that can contribute to cardiovascular disease. For better oxidative stability to be achieved and to reduce the need to hydrogenate the oil, the linolenic acid levels of preferred oils are 8% or less by weight, 6% or less, 4% or less, less than about 3%, and more preferably. 0.5-2% by weight of the total fatty acids in the oil of the present invention.

The soybean oil of the present invention may also be used as blending raw material in the production of blended oil. Raw material for blending means that the soybean oil of the present invention can be blended with other vegetable oils to enhance characteristics such as fatty acid composition, oxidative taste and stability other oils. The amount of soybean oil of the present invention that may be used will depend upon the desired properties desired in the resulting final product of the oil. Examples of compound oils produced include, but are not limited to, margarines, vegetable shortening, frying oils, salad oils, etc. The soybean oil of the present invention may be a compounded oil, synthesized oil or, in a preferred embodiment, an oilseed oil of an appropriate composition. An oil generated directly from an oilseed is an unmixed oil. In another feature, an oil is derived directly from a mature oilseed seed. In this feature, mature seed is defined as that harvested in the field for commercial agricultural activities, such as sale for sale. In a preferred embodiment, the oil is soybean oil. The oil may be crude, such as raw soybean oil, or may be processed, for example, may be refined, bleached, deodorized and / or prepared for winter. "Refin" as used in this exposure refers to a process of treating fat or oil naturally or processed to remove impurities, and may be carried out by treatment with caustic soda of fat or oil, with caustic soda, followed by by centrifugation, washing with water and heating under vacuum. "Bleaching" refers to a process of treating fat or oil to remove or reduce levels of dye materials in fat or oil. Bleaching can be accomplished by treating fat or oil with activated charcoal or Fullers earth (diatomite). "Deodorization" refers to a process of removing grease or oil components which contribute unpleasant tastes or odors to the final product, and may be carried out by high vacuum or superheated steam washing. "Winter preparation" refers to a process of removing saturated glycerides from an oil, and can be accomplished by cooling and removing solidified portions of fat from an oil.

A preferred oil of the present invention has low saturated or zero saturated composition. In other preferred embodiments, oils of the present invention have increased levels of oleic acid, reduced levels of saturated fatty acids and reduced levels of polyunsaturated fatty acids. In still other preferred embodiments, oils of the present invention have increased levels of oleic acid and reduced levels of saturated fatty acids. In a preferred embodiment, the oil is soybean oil. The percentages of fatty acid content, or fatty acid levels as used in this exposition, refer to percentages by weight.

In a first embodiment, an oil of the present invention preferably has a composition of 55 to 80% oleic acid, approximately 12 to 43% polyunsaturated and 2 to 8% saturated fatty acids; more preferably, a composition of 55 to 80% oleic acid, approximately 14 to 42% polyunsaturated and 3 to 6% saturated fatty acids; and most preferably it has a composition of 55 to 80% oleic acid, approximately 16.5 to 43% polyunsaturated and 2 to 3.6% saturated fatty acids.

In a second embodiment, an oil of the present invention preferably has a composition of 65 to 80% oleic acid, approximately 12 to 33% polyunsaturated and 2 to 8% saturated fatty acids; more preferably, a composition having 65 to 80% oleic acid, approximately 14 to 32% polyunsaturated and 3 to 6% saturated fatty acids; and most preferably it has a composition of 65 to 80% oleic acid, approximately 16.5 to 33% polyunsaturated and 2 to 3.6% saturated fatty acids.

In a third embodiment, an oil of the present invention preferably has a composition having from about 42 to about 85% oleic acid and from about 8% to about 1.5% saturated fatty acids; more preferably the oil composition has a combined amount of oleic acid and lynolenic acid equivalent to approximately 65% to approximately 95% by weight of the total oil composition. Even more preferably, the oil composition of the present invention has a combined amount of oleic acid and linolenic acid equivalent of from about 75% to about 90%, about 75% to about 95%, about 75%. approximately 85%, approximately 65% to approximately 90%, approximately 70% to approximately 90% by weight of the total oil composition.

In a fourth embodiment, an oil of the present invention has a composition with approximately 42 to approximately 85% oleic acid, approximately 8% to approximately 1.5% saturated fatty acids and approximately 6% to approximately 15% by weight linolenic acid; more preferably, the oil composition is from about 42 to about 85% of oleic acid, about 8% to about 1.5% of saturated fatty acids and less than 35% by weight of linolenic acid; and even more preferably, the oil composition is approximately 42 to approximately 85% oleic acid, approximately 8% to approximately 1.5% saturated fatty acids and approximately 9% by weight linolenic acid.

In a fifth embodiment, an oil of the present invention has an oil composition of about 50% to about 85% oleic acid and about 8% to about 1.5% saturated fatty acids; more preferably from about 50% to about 85% oleic acid, from about 8% to about 1.5% saturated fatty acids and from about 4% to about 14% by weight linolenic acid; more preferably it has an oil composition of from about 50% to about 85% of oleic acid, about 8% to about 1.5% of saturated fatty acids and less than 35% by weight of linolenic acid, and even more preferably a composition of oleic acid. oil from about 42 to about 85% oleic acid, from about 8% to about 1.5% of saturated fatty acids and from about 2% to about 45% by weight linolenic acid.

In another embodiment, an oil of the present invention has composition with approximately 65-80% oleic acid, approximately 3-8% saturated and approximately 12-32% polyunsaturated. In another embodiment, an oil of the present invention has composition with approximately 65-80% oleic acid, approximately 2-3.5% unsaturated and approximately 16.5-33% polyunsaturated.

In an especially preferred embodiment, an oil of the present invention has a composition of approximately 47-83% of oleic acid and approximately 5% of saturated; approximately 60-80% oleic acid and approximately 5% saturated; approximately 50-85% oleic acid and approximately 2-7% saturated; approximately 55-85% oleic acid and approximately 2.5-7% saturated, approximately 47-88% oleic acid and approximately 3-7% saturates; approximately 43-85% oleic acid and approximately 5-7% saturated; approximately 81-85% oleic acid and approximately 5% saturated; approximately 74-83% oleic acid and about 6% saturated; approximately 65-87% oleic acid and approximately 6% saturated; approximately 66-80% o-lactic acid and approximately 6% saturated; approximately 42-77% oleic acid and approximately 5-8% saturated; approximately 60-77% oleic acid and approximately 6% saturated; approximately 70-81% oleic acid and approximately 5-7% saturated; approximately 52-71% oleic acid and approximately 5-7% saturated, approximately 44-71% oleic acid and approximately 6% saturates; approximately 61-71% oleic acid and approximately 8% unsaturated; approximately 57-71% oleic acid and approximately 7% saturated; approximately 23-58% oleic acid and approximately 8-14% saturated; approximately 20-70% oleic acid and approximately 6% saturated; approximately 21-35% oleic acid and approximately 5-6% saturated; or approximately 19-28% oleic acid and approximately 5% saturated.

In other embodiments the percentage of oleic acid is 50% or greater; 55% or greater; 60% or greater; 65% or greater; 70% or greater; 75% or higher; or 80% or greater; or in a range of 50 to 80%; 55 to 80%; 55 to 75%; 55 to 65%; 60 to 85%; 60 to 80%; 60 to 75%; 60 to 70%; 65 to 85%; 65 to 80%; 65 to 75%; 65 to 70%; or from 69 to 73%. Suitable percentage ranges for the oleic acid content of oils of the present invention also include those in which the lower limit is selected from the following percentages: 50, 51, 52, 53, 54, 55, 56, 57 , 58, 59, 60, 61, 62, 63, 64, 65, 66, 67.68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80 percent; and the upper limit is selected from the following percentages: 60, 61, 62, 63, 64, 65, 66.67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 , 79, 80, 81, 82, 83, 84, 85, 86.87, 88, 89 or 90 percent.

In these other embodiments, the percentage of linoleic acid in an oil of the present invention ranges from 10 to 40%; 10 to 39%; 10 to 30%; 10 to 29%; 10 to 28%; 10 to 25%; 10 to 21%; 10 to 20%; 11 to 30%; 12 to 30%; 15 to 25%; 20 to 25%; 20 to 30% or 21 to 24%. Suitable percentage ranges for linoleic acid content in oils of the present invention also include those in which the lower limit is selected from the following percentages: 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26.27, 28, 29 or 30 percent; and the upper limit is selected from the following percentages: 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35.36, 37, 38 , 39 or 40 percent.

In these other embodiments, the percentage of linolenic acid in an oil of the present invention is 10% or less; 9% or less; 8% or less; 7% or less; 6% or less; 5% or less; 4.5% or less; 4% or less; 3.5% or less; 3% or less; 3.0% or less; 2.5% or less; or 2% or less; or ranges from 0.5 to 2%; 0.5 to 3%; 0.5 to 4.5%; 0.5% to 6%; 3 to 5%; 3 to 6%; 3 to 8%; 1 to 2%; 1 to 3%; or from 1 to 4%. In these other embodiments, the percentage of saturated fatty acids in an oil composition of the present invention is 15% or less; 14% or less; 13% or me; 12% or less, 11% or less; 10% or less; 9% or less; 8% or less; 7% or less; 6% or less; 5% or less; 4% or less; or 3.6% or less; or ranges from 2 to 3%; 2 to 3.6%; 2 to 4%; 2 to 8%; 3 to 15%; 3 to 10%, 3 to 8%; 3 to 6%; 3.6 to 7%; 5 to 8%; 7 to 10%; or from 10 to 15%.

In other embodiments, the oil-saturated fatty acids of the present invention include the combination of palmitic and stearic fatty acids. In one embodiment, the percentage of saturated fatty acids varies from approximately 10% less; approximately 9% less, approximately 8% less; approximately 7% less; approximately 6% less; approximately 5% less; approximately 4.5% less; approximately 4% less; approximately 3.5% mild; approximately 3% less; approximately 3.0% less, approximately 2.5% less; or approximately 2% less; or is in a range of 0.5 to 2%; 0.5 to 3%; 0.5 to 4.5%; 0.5 to 6%; 0.5 to 7%, 0.5 to 8%; 0.5 to 9%; 1 to 4%; 1 to 5%; 1 to 6%; 1 to 7%; 1 to 8%; 1 to 9%; 1.5 to 5%; 1.5 to 6%; 1.5 to 7%; 1.5 to 8%; 1.5 to 9%; 2 to 5%; 2 to 6%; 2 to 7%; 2 to 8%; 2 to 9%; 3 to 5%; 3 to 6%; 3 to 7%; 3 to 8%; 3 to 9%; 4 to 7%; 4 to 8%; 4 to 9%; 5 to 7%; 5 to 8%; and from 5 to 9%. In these embodiments, suitable percentage ranges for oil-saturated fatty acid content of the present invention also include those wherein the lower limit is selected from the following percentages: 0.5; 1; 1.5; 2; 2.5; 3; 3.5; 4; 4.5; 5; 5.5; 6 or 6.5 percent; and the upper limit is selected from the following percentages: 11; 10; 9; 8; 7; 6; 5; 4.5; 4; 3.5; 3; 2.5; 2; 1.5; 1 or 0.5 percent. In other embodiments, the percentage of palmitic fatty acid in an oil composition of the present invention ranges from 6% less; 5% less; 4.5% less; 4% less; 3.5% less; 3% less, 3.0% less; 2.5% less; or 2% less; or is in a range of 0.5 to 2%; 0.5 to 3%; 0.5 to 4.5%; 0.5 to 6%; 1 to 3%; 1 to 4%; 1 to 5%; 1 to 6%; 1.5 to 2%; 1.5 to 3%; 1.5 to 4%; 1.5 to 4.5%; 1.5 to 5%; 1.5 to 5.5%; 1.5 to 6%; 1.5 to 6.5%; 1.5 to 7%; 2 to 3%; 2 to 3.5%; 2 to 4%; 2 to 4.5%; 2 to 5%; 2 to 6%; 2 to 7%; 2 to 8%; 3 to 5%; 3 to 6%; 3 to 7%; 3 to 8%; 3 to 9%. In these embodiments, suitable percentage ranges for linoleic acid content in oils of the present invention also include those in which the lower limit is selected from the following percentages: 0.5; 1; 1.5; 2; 2.5; 3, 3.5; 4; 4.5; 5; 5.5; 6; 6.5; 7 or 7.5 percent; and the upper limit is selected from the following percentages: 11; 10; 9; 8; 7; 6; 5; 4.5; 4; 3.5; 3 or 2 percent.

In other embodiments, the percentage of stearic fatty acid in the composition of an oil of the present invention ranges from 3% less, 3.0% less; 2.5% less; or 2% less; or is in a range of 0.5 to 1%; 0.5 to 1.5%; 0.5 to 2%; 0.5 to 2.5%; 0.5 to 3%; 0.5 to 4%; 1 to 2%, 1 to 3%; 1 to 4%; 1.5 to 2%; 1.5 to 3%; or from 1.5 to 4%. In these embodiments, suitable percentage ranges for linoleic acid content in oils of the present invention also include those in which the lower limit is selected from the following percentages: 0.5; 1; 1.5; 2; 2.5; 3 or 3.5; and the upper limit is selected from the following percentages: 3.5; 3; 2.5; 2 or 1.5 percent.

An oil of the present invention is especially suitable for use as a cooking or frying oil. Because of its reduced content of polyunsaturated fatty acids, the oil of the present invention does not require extensive processing of conventional oils because a smaller number of unpleasant odor or color compounds are present.

In addition, the low saturated fatty acid content of this oil improves the cold flow properties of the oil, and avoids the need to heat the stored oil to prevent it from crystallizing or solidifying. Improved cold flow also enables better oil drainage of fried food once it is removed from the grinding oil, resulting in at least a lower fat product. See, Bouchon et al., J. Food Science66: 918-923 (2001). Low levels of linolenic acid in this oil are especially beneficial in grinding to reduce unpleasant flavors.

This oil is also quite suitable for use as desalted oil (an oil that maintains clarity at refrigerated temperatures of 40-50 degrees Fahrenheit). Its improved clarity at chilled temperatures due to its low saturated fatty acid content and moderate linoleic acid content reduces or eliminates the need for winter oil preparation before use as salad oil.

In addition, the moderate and low linoleic acid content of this oil makes this oil very suitable for the production of vegetable fat, margarine and other semi-solid vegetable fats used in food products. The production of these fats typically involves hydrogenation of unsaturated oils such as soybean oil, corn oil or canola oil. The oxidative stability and improved taste of this oil means that it does not need to be hydrogenated as much as the typical vegetable oil is for margarine and vegetable shortening, thereby reducing processing costs and producing health-related isomers. .

An oil of the present invention is also suitable for use as a feedstock for biodiesel production, especially since bio-diesel made from this oil has better cold flow, better ignition quality (number of ketones), better oxidative stability and reduced nitric oxide emissions. Biodiesel is an alternative diesel fuel, composed primarily of saturated mono-unsaturated and polyunsaturated C1-C22 fatty acid methyl esters. The number of ketones is a measure of ignition quality - the shorter the fuel ignition delay time in the engine, the greater the number of ketones. TheASTM standard specification for biodiesel fuel (D 6751-02) requires a minimum number of 47 ketones. The use of biodiesel in conventional diesel engines results in substantial reductions in pollutants such as sulfates, carbon monoxide and particulate compared to diesel fuel derived from diesel. and use on school buses greatly reduces children's exposure to toxic diesel exhaust. A limitation on the use of 100% conventional biodiesel as fuel is the high point of conventional soy-derived biodiesel mist (2 degrees C) compared to number 2 diesel (-16 degrees C). Dunn et al., Recent. Res. Deveri, in Oil Chem., 1: 31-56 (1997). Biodiesel made from the oil of the present invention has improved (reduced) fog point and wire filter plugging point, and can also be used in blends to improve the biodiesel-made cold temperature properties from cheap but highly saturated sources. fat, animal fat (wax, animal fat, chicken fat) and palm oil.

Biodiesel can also be blended with petroleum derived diesel at any level.

Biodiesel is typically obtained by extracting, filtering and refining soybean oil to remove free fats and phospholipids and then transesterification of the oil with methanol to form fatty acid methyl esters. See, for example, U.S. Patent No. 5,891,203. Resulting soymethyl esters are commonly referred to as "biodiesel".

The oil of the present invention may also be used as a diesel fuel without the formation of methyl esters, for example by mixing the acetals and the oil. See, for example, U.S. Patent No. 6,013,144. Thanks to its improved cold flow properties and oxidative stability, the oil of the present invention may also be used as a diesel fuel additive lubricant. See, for example, U.S. Patent Nos. 5,888,947, 5,454,842 and 4,557,734.

The use of soybeans and soybean oils of the present invention is also suitable in a variety of soy foods made from soybeans such as soy milk, soybean butter, natto and tem-peh, and soy foods, made from processed soy and soy oil, including, soy food, soy flour, soy protein concentrate, soy protein isolates, soy textured protein concentrate, hydrolyzed soy protein, cream, soybean oil cooking, room oil, fat and lecithin. Soybean kernels are edible as well, typically being sold to raw, roasted or edamame consumers. Soymilk, typically produced by dipping and grinding whole soybeans, can be consumed in the state, powdered or processed to form soy yogurt, soy cheese, tofu or yuba. This soybean or oil may be advantageously used in these and other soy foods, thanks to its improved oxidative stability, the reduction of unpleasant taste precursors and its low level of saturated fatty acids. Modulation or Suppression

Another embodiment of the invention is directed to a method of modulating gene suppression levels. Modulation of genomic suppression may result in more or less gene suppression. Suppression of a gene product may result from the insertion of a construct of the present invention into the genome of a plant. Similarly, gene suppression modulation may result from the insertion of a construct of the present invention into the genome of a plant. Other examples of methods for modulating gene suppression include, but are not limited to, antisense, co-suppression, interfering RNA (dsRNA1) techniques, transgenic animals, hybrids, and boozymes employing a construct of the present invention. The following examples are provided by way of illustration and are not intended to limit the present invention.

The deletion of a gene can be modulated by altering the strain of the DNA to be transcribed and used for deletion, the sequence of which is derived from the targeted gene for deletion. Many methods can be used to suppress a gene by employing post-transcriptional degene silencing mechanisms. Without being bound by theory, these methods supposedly have in common the expression of an RNA molecule that hybridizes to another RNA molecule. Surprisingly, it may be advantageous to employ an RNA molecule of specified extensions to modulate or moderate suppression of steady state expression levels of a target endogenous gene.

FAD2-1 gene suppression leads to elevated levels of oleic acid and reduction of linoleic acid levels. When FAD2-1 is strongly suppressed, oleic acid levels may be greater than 65%, leading to a reduction in palmitic acid and linolenic acid levels. For example, when FAD2-1 is suppressed, oleic acid levels can reach 85%, and the combined palmitic and stearic acid levels are reduced to about 10%. Similarly, down-regulation of FATB results in decreased levels of primarily palmitate saturated fatty acids. When FAD2 and FATB are suppressed so that oleic acid levels are 85%, saturated levels are approximately 10%. When FAD2 and FATB are suppressed such that oleic acid levels are above 85%, saturated levels may decrease below 10%.

In light of the present invention, saturated levels may be reduced to less than 10% without increasing oleic acid to above 85%. In one embodiment, FAD2 suppression is modulated by reducing the extension of the FAD2-1 intron introduced into the plant. Less FAD2 suppression results in moderate levels of oleic acid, approximately 40-85%. FAD2 suppression is reduced as the extension of the FAD2-1 intron fragment is reduced. For example, an FAD2-1 intronde whose length has been reduced by at least 100 contiguous nucleotides may reduce FAD2 suppression and the corresponding increase in oleic acid levels and decrease in linoleic acid levels.

The relationship between the decrease in endogenous gene suppression and the increase in homologous DNA extension can be determined empirically by introducing different DNA extensions. For example, the level of suppression reduction to be obtained by reducing the length of the introduced homologous DNA can be determined by deleting increasing parts of the homologous DNA being introduced, and expression analysis of the target gene.

The present invention includes a method for moderating FAD2 suppression while still dramatically reducing saturated levels in a plant. In these plants, oleic acid levels can range from 40-80%. Similarly, less than full FATB suppression occurs when 3 'and 5' untranslated regions are introduced, compared to when the full FATB gene is introduced into a host cell. Similarly, FATB suppression levels are reduced when the 5 'portion of the open reading chain encoding most of the chloroplastic transit peptide is introduced into a host cell. In cells with suppressed FAD2 and FATB, by methods according to the invention, oleic acid levels may be 40-85%, while saturated levels may be between 1 and 9 percent.

In one embodiment, the present invention is directed to a gene suppression modulation method for reducing suppression relative to the suppression of a complete gene element, wherein the complete gene element may be a complete gene, a gene. complete exon, a complete intron, a complete signaling sequence, or a complete RTU, and then a recombinant nucleic acid molecule is constructed comprising a fragment of the endogenous sequence of the gene element and expression of the acid molecule is initiated. recombinant nucleic acid in a host cell and suppressing the endogenous gene with the recombinant nucleic acid molecule. The gene to be deleted can be any gene, including FAD2 and FATB. In one embodiment, the present invention is directed to a method of modulating FAD2 or FATB expression, comprising: expressing a partial sequence of FAD2 or FATB gene element in a host cell, wherein the FAD2 or FATB gene element is from an endogenous FAD2 or FATB gene in the host cell, and the sequence of a FAD2 or FATB gene element may be a FAD2or FATB gene, a FAD2or FATB exon, a FAD2 or FATB intron, a transit peptide coding region. FAD2orFATB or a FAD2 or FATB RTU; and the partial sequence of the FAD2 or FATB elementogen is shorter than the complete sequence of the FAD2 or FATB gene element; and the suppression of endogenous FAD2 or FATB with the partial sequence of the FAD2 or FATBi gene element in which the endogenous FAD2 or FATB gene suppression levels are lower than the endogenous FAD2or FATB gene suppression levels in a host cell with a similar genetic background, and a second nucleic acid sequence of FAD2 or FATB comprising the complete sequence of the FAD2 or FATB gene element of the FAD2or FATB gene element.

In another embodiment, the present invention is directed to a method for altering the oil composition of a plant by transforming a plant cell with a recombinant nucleic acid molecule which comprises a DNA sequence that suppresses endogenous FAD2 expression. , FATB or FAD2 and FATB, wherein the DNA sequence comprises a FAD2, FATB or FAD2 and FATB nucleic acid sequence shorter than the complete sequence of a complete gene element, selected from gene, exon, intron, region forward peptide encoder, 3 'UTR, 5' UTR and an open reading strand; and developing a plant cell under conditions in which transcription of said DNA sequence is initiated, whereby the composition of the oil is altered from a plant cell with a similar genetic background but devoid of the recombinant nucleic acid molecule. The extension of a FAD2 or FATB gene element may be shortened by 50, 75, 100, 150,175, 200, 250, 300, 350, 400, 450, 500, 600, 800, 1000, 2000, 3000, or 4000 nucleotides. The length of a FAD2 or FATB gene element may be shortened by 50, 75, 100, 150, 175, 200, 250, 300, 350, 400, 450, 500,550, 600, 800, or 1000 nucleotides.

In another embodiment, the present invention is directed to a method of increasing oleic acid content and reducing fatty acid content in seed of a plant by: i) shortening the length of an exogenous FAD2 DNA sequence to a host cell until the level of FAD2 expression suppression of a transformed plant is at least partially reduced relative to suppression of FAD2 expression in a host cell with a similar genetic background and a DNA sequence of the exogenous FAD2 gene; and ii) developing a plant with a nucleic acid molecule comprising the shortened FAD2 DNA sequence, wherein the FAD2 DNA shortened sequence at least partially suppresses endogenous FAD2 expression; and iii) cultivation of a plant that produces seed with reduced saturated fatty acid content in relation to the seed of a plant with similar genetic background, but without the shortened FAD2 DNA sequence. The amount by which the exogenous FAD2 DNA sequence is shortened to at least partially reduce endogenous FAD2 suppression can be empirically determined by the introduction of different DNA extensions. For example, the level of suppression reduction to be obtained by reducing the extent of introduced homologous DNA can be determined by deleting increasing portions of the homologous DNA being introduced, and expression analysis of the target gene. The level of suppression of FAD2 expression can be obtained as an average of three or more, six or more, ten or more, fifteen or more, or twenty or more seeds of a plant.

In another embodiment, the present invention is directed to a method of producing a seed-transformed plant exhibiting the reduction of saturated fatty acids by transforming a plant cell with a recombinant nucleic acid molecule, comprising a DNA sequence that suppresses the endogenous expression of FAD2 eFATB, wherein the DNA sequence comprises a shorter FAD2 nucleic acid sequence than the entire complete gene element sequence, selected from gene, exon, intron, transit peptide coding region, and RTU ; and development of the transformed plant, wherein the transformed plant produces reduced fatty acid seed relative to the seed of a plant of similar genetic background but devoid of said recombinant nucleic acid molecule.

In another embodiment, the present invention is directed to a method of modulating the oil fatty acid composition of a temperate climate oilseed seed by isolating at least 40 nucleotides in length. whereas it is capable of suppressing the expression of an endogenous gene in the pathway of fatty acid synthesis; generation of more than one shortened fragment of the elementogenic; introduction of each of the shortened fragments into a temperate climate oleaginous grain cellulose for plantastransgenic production; and selecting a transgenic plant comprising a shortened fragment of determined length and sequence that alters the desired fatty acid composition in the seed oil. In a preferred embodiment, the above method also includes constructing a recombinant DNA with at least two finger shortened fragments of different endogenous genes that effect the desired different modifications in the seed oil fatty acid composition; introduction of recombinant DNA construct into a plant cell of climate-de-oilseed culture to produce transgenic plants; and selecting a transgenic plant comprising at least two shortened fragments and a fatty acid composition in the seed oil of more than one desired modification by at least the two shortened fragments.

In another embodiment, the present invention is directed to slightly soybean, exhibiting strongly reduced fatty acid content and moderately increased oleic acid oil composition, with a DNA sequence that suppresses endogenous FAD2 expression in a host cell. , wherein the DNA sequence has a shorter FAD2 nucleic acid sequence than the full sequence of a complete gene element selected from gene, exon, intron, transit peptide coding region, and RTU.

The following examples are illustrative and are not intended to be restrictive at all.

All publications, patents and patent applications mentioned in this disclosure are incorporated herein by reference in this application to the same extent as if each publication, patent or patent application had been specifically and individually indicated to be incorporated by reference.Examples

Example 1 - Isolation of FATB-2 Sequences

Leaf tissue is obtained from soybean variety A3244 Asgrow, crushed in liquid nitrogen and stored at -80 ° C until use. Seisml of SDS Extraction Buffer (650 mL sterile ddH20, 100 mL 1 M Tris-Cl, pH 8, 100 mL 0.25 M EDTA, 50 mL 20% SDS, 100 mL 5 M NaCl, 4 μΙ beta-mercaptoethanol) is added to 2 ml frozen / ground leaf tissue and the mixture is incubated at 65 ° C for 45 minutes. The sample is stirred every 15 minutes. 2 ml of 5 M ge potassium acetate is added to the sample which is stirred and then incubated for 20 minutes. 3 ml of CHCl3 is added to the sample which is stirred for 10 minutes.

The sample is centrifuged at 10,000 rpm for 20 minutes and the supernatant is collected. 2 ml of isopropanol are added to the supernatant and mixed. The sample is then centrifuged at 10,000 rpm for 20 minutes and the supernatant is drained. The pellet is resuspended in 200 μΙ RNase and incubated at 65 ° C for 20 minutes. 300 μΙ of ammonia acetate / isopropanol (1: 7) are added and mixed. The sample is then centrifuged at 10,000 rpm for 15 minutes and the supernatant discarded. The pellet is washed with 500 μΙ 80% ethanol and allowed to dry. The genomic DNA pellet is then resuspended in 200 μΙ of T10E1 (10 mM Tris: 1 mM EDTA).

A soybean FATB-2 cDNA contig sequence (SEQ ID NO: 42) is used to create thirteen oligonucleotides that include the gene: F1SEQ ID NO: 48), F2 (SEQ ID NO: 49), F3 (SEQ ID NO : 50), F4 (SEQ ID NO: 51), F5 (SEQ ID NO: 52), F6 (SEQ ID NO: 53), F7 (SEQ ID NO: 54), R1 (SEQ ID NO: 55), R2 (SEQ ID NO: 56), R3 (SEQ ID NO: 57), R4 (SEQ ID NO: 58), R5 (SEQ ID NO: 59), and R6 (SEQ ID NO: 60). Oligonucleotides are used in pairs for PCR amplification of genomic DNA alone: pair 1 (F1 + R1), pair 2 (F2 + R1), pair 3 (F3 + R2), pair 4 (F4 + R3), pair 5 ( F5 + R4), pair 6 (F6 + R5) and pair 7 (F7 + R6). PCR amplification of pair 5 is conducted as follows: 1 cycle, 95 ° C for 10 minutes, 30 cycles, 95 ° C for 15 seconds, 43 ° C for 30 seconds, 72 ° C for 45 seconds, 1 cycle, 72 ° C for 7 minutes. For all other oligo pairs, PCR amplifications are conducted as follows: 1 cycle, 95 ° C for 10 minutes; 30 cycles, 95 ° C for 15 seconds, 48 ° C for 30 seconds, 72 ° C for 45 seconds, 1 cycle, 72 ° C for 7 minutes. Positive fragments are obtained from primer pairs 1, 2, 4, 5, 6 and 7. Each fragment is cloned into pCR2.1 vector (Invitrogen). Fragments 2, 4, 5 and 6 are confirmed and sequenced. These four sequences are aligned to form a genomic sequence for the FATB-2 gene (SEQ ID NO: 43).

Four introns are identified in the soybean FATB-2 gene by comparing the genomic sequence to the cDNA sequence: intron 1 (SEQ ID NO: includes from base 119 to base 1333 of the genomic sequence (SEQID NO: 43) and has 1215 bp in length ; intron Il (SEQ ID NO: 45) included base 2231 to base 2568 of genomic sequence (SEQ ID NO: 43) and pos-sui 338 bp in extension; intron Ill (SEQ ID NO: 46) includes base 2702 to base 3342 of the genomic sequence (SEQ ID NO: 43) and has 641 bp in extension, intron IV (SEQ ID NO: 47) includes from base 3457 to base 3823 of genomic sequence (SEQ ID NO: 43) and has 367 bp in length Example 2 - Suppression Constructions2A - FAD2-1 Constructions

FAD2-1A intron # 1 (SEQ ID NO: 1) is cloned into the expression cassette, pCGN3892, in sense and antisense orientations. The pCGN3892 vector contains the soybean 7S promoter and pea rbcS 3 'promoter. Both gene fusions are then ligated separately into pCGN9372, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter. Resulting expression constructs (pCGN5469 sense and pCGN5471 antisense) are used for soy transformation.

FAD2-1B intron (SEQ ID NO: 2) is fused to the 3 'end of FAD2-1A intron # 1 in plasmid pCGN5468 (contains soybean 7S promoter, fused to FAD2-1A intron (sense) and an rbcS 3 pea ') or pCGN5470 (contains the FAD2-1A intron-fused soybean 7S promoter (antisense) and a pea rbcS 3') in sense and antisense orientation, respectively. The fusions resulting from the intron combination are then ligated separately into pCGN9372, a vector containing the PCR4 EPSPS gene, regulated by the FMV promoter. The resulting expression constructs (pCGN5485, FAD2-1A and FAD2-1B intron sense and pCGN5486, FAD2-1A and FAD2-1B antisense intron) are used for soy transformation.

2B. - FAD3-1 Constructions

FAD3-1A introns # 1, # 2, # 4, and # 5 (SEQ ID NOs: 7, 8, 10, and 11, respectively), and # 3C introns (SEQ ID NO: 23), and # 4 (SEQ ID NO: 24) of FAD3-1A are all separately connected to pCGN3892 in sense or antisense orientation. PCGN3892 contains the soybean 7S promoter and pea rbcS3 'promoter. These fusions are ligated into pCGN9372, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, for transformation into soybean. The resulting expression constructs (pCGN5455, FAD3-1A senson intron # 4, pCGN5459, FAD3-1A antisense intron # 4] pCGN5456, FAD3 \ pCGN5460 in-tron # 5 sense intron # 5] pCGN5466 , FAD3-1A antisense intron # 2, pCGN5473, FAD3-1A antisense intron # 1) are used for soybean transformation.

2C. - FATB Constructions

The soybean FATB-I intron II sequence (SEQ ID NO: 30) is amplified by PCR using a partial FATB-1 genomic clone as a model. PCR amplification is conducted as follows: 1 cycle, 95 ° C for 10 min; 25 cycles, 95 ° C for 30 seconds, 62 ° C for 30 seconds, 72 ° C for 30 seconds; 1 cycle, 72 ° C for 7 min. PCR amplification results in a product of 854 bp in length, including reconstructed restriction sites, at both ends. The PCR product is cloned directly into the pCGN3892 expression cassette in orientation, through Xho \ sites, constructed at the 5 'ends of the PCR primers, to form pMON70674. The vector pCGN3892 contains the soybean 7S and pea rbcS 3 'promoter. PMON7Q674 is then cut with NotI and ligated into pMON41164, a vector containing the CP4EPSPS gene, regulated by the FMV promoter. The resulting gene expression construct, pMON70678, is used for soybean transformation using Agrobacterium methods.

Two other expression constructs containing the soybean FATB-1 intron II sequence (SEQ ID NO: 30) are created. PMON70674 is cut with NotI and ligated into pMON70675 which contains the CPVEPSPS gene, regulated by the FMV promoter, and the KAS IV gene, regulated by the promoter torin, resulting in pMON70680. The expression vector pMON70680 is then cut with SnaBI and ligated with a jojoba genedelta-9 desaturase fusion gene (SEQ ID NO: 41) in sense orientation, regulated by the 7S promoter. Expression constructs pMON70680 and epMON70681 are used for soybean transformation using Agrobacterium methods.

2D - Combined Constructions

Expression constructs are produced, containing various permutations of a first set of DNA sequences. The first set of DNA sequences includes any of the sequences described or illustrated in FIGS. 5 and 6, or any other set of DNA sequences containing various combinations of FAD2, FAD3, and FATB sense, antisense, or sense and non-coding regions, such that they are capable of forming dsRNA constructs, constructs of constructs. sense suppression, antisense constructs or various combinations of the foregoing.

Figures 5 (a) - (c) depict several first sets of DNA sequences capable of expressing sen-co-suppression constructs or antisense constructs according to the present invention, the non-coding sequences of which are non-coding. described in Tables 1 and 2 below. Noncoding sequences may be single sequences, sequence combinations (for example, 5'UTR linked to 3'UTR), or any combination of the preceding ones. To express a co-suppression construct, all non-coding sequences are sense sequences, and to express antisense construct, all non-coding sequences are antisense sequences. FIG. (D) depicts a first set of DNA1 sequences capable of expressing sense and antisense constructs according to the present invention.

Figures 6 (a) - (c) depict several first sets of DNA sequences capable of expressing dsRNA constructs according to the present invention, the non-coding sequences of which are described in Tables 1 and 2 below. The first set of DNA sequences depicted in FIG. 6, comprises pairs of sense and antisense sequences, arranged such that, for example, RNA expressed by the first sense sequence is capable of forming a double-stranded RNA as antisense RNA expressed by the first antisense sequence. For example, with reference to FIG. 6 (a) and illustrative combination N5 1 (from Table 1), the first set of DNA sequences comprises a FAD2-1 sense sequence, a FAD3-1 sense sequence, a FAD2-1 antisense sequence, and a FAD3- antisense sequence. 1. The two antisense sequences correspond to the sense sequences, so that the expression products of the first set of DNA sequences are capable of forming a double-stranded RNA together. The sense sequences may be separated from antisense sequences by a spacer sequence, preferably one that promotes the formation of a dsRNA molecule. Examples of these spacer sequences include those set forth in Wesley et al., Supra and Hamilton et al., Piant J., 75: 737-746 (1988). The promoter is any functional in a plant or any plant promoter. Non-restrictive examples of suitable promoters are described in Part D of the Detailed Description.

The first set of DNA sequences is inserted into an expression construct, either in sense or antisense orientation, employing a variety of DNA manipulation techniques. If convenient restriction sites are present in the DNA sequences, they are inserted into the expression construct by digestion with the restriction and binding endonucleases in the construct that has been digested at one or more of the available decon sites. If there are no convenient restriction sites available in DNA1 sequences, the DNA of the construct or DNA sequences is modified in a variety of ways to facilitate cloning of DNA sequences into the construct. Examples of methods for modifying the DNA include by PCR1 synthetic ligand or adapter binding, site-directed in vitro muphagenesis, substitution or clipping of 5 'or 3' ends, and similar. These and other DNA manipulation methods are well known to anyone skilled in the art.

PMON97552 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), which is reduced to 140 contiguous nucleotides from the 3' end, linked operatively. to 42 contiguous nucleotides from a FATB-1 5 'UTR, followed by a FATB-1a CTP coding region operably linked to 70 FAD3-1 A intron 4 nucleotides operably linked to a region antisense-oriented FATB-1 A CTP coding followed by 42 contiguous nucleotides from a 5 'UTR of FATB-1 A in antisense orientation, followed by a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 140 contiguous nucleotides from the 3 'end and antisense orientation, operatively linked to a 3' H6 polyadenylation segment with a CP4 EPSPS gene, operably linked to an EFMV pro-engine and sequence of 3 'end of Rubisco E9 pea, all flanked by one RB (right edge) and one LB (edge). to the left). The resulting gene expression construct is used for transformation, employing methods as described in this exposure. PMON93758 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 160 contiguous nucleotides from the 5 'end and linked to a 3' FATB-1a RTU, followed by a 5 'FATB-1a RTU, operably linked to 70 FAD3-1A intron 4 nucleotides, operably linked to a 5'UTR FATB-1 antisense orientation, followed by a 3 'UTR deFATB-1 A, antisense orientation, followed by a FAD2-1A intron 1 flush (SEQ ID NO: 1), reduced by 160 contiguous nucleotides since 5 'shaking and antisense orientation, operatively linked to a 3' H6 polyadenylation segment with a CP4 EPSPS gene, operatively linked to an EFMV promoter and 3 'termination sequence of the Ru-cookie E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exposure.

PMON97553 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), which is reduced to 200 contiguous nucleotides from the 3' end, linked operatively. to 42 contiguous nucleotides from a FATB-1 5 'UTR, followed by a FATB-1a CTP coding region operably linked to 70 FAD3-1A intron 4 nucleotides operably linked to a coding region of FATB-1 A CTP in antisense orientation followed by 42 contiguous nucleotides of a 5 'UTR of FATB-1 A in antisense orientation followed by a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 200 contiguous nucleotides from the 3 'end and antisense orientation, operably linked to a 3' H6 polyadenylation segment with a CP4 EPSPS gene, operably linked to an EFMV pro-motor and termination sequence 3 'from the Rubisco E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exhibit.

PMON93770 contains a soybean 7Scc 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 240 contiguous nucleotides from the 3' end and linked to a 3 'FATB-1a UTR , followed by a 5 'FATB-1α RTU, operably linked to 70 nucleotides from FAD3-1A intron 4, operatively linked to a FATB-1 α 5' RTU, in antisense orientation, followed by a 3 'FATB-3 RTU 1a, in antisense orientation, followed by a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 240 contiguous nucleotides from the 3 'end and in antisense orientation, operatively linked to a 3' H6 polyadenylation segment with a gene CP4 EPSPS, operatively linked to an EFMV promoter and 3 'terminus sequence of Rubis E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exposure.

PMON93759 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 240 contiguous nucleotides from the 5' end and linked to a 3 'FATB-1a UTR , followed by a 5 'FATB-1a RTU, operably linked to 70 nucleotides from FAD3-1A intron 4, operably linked to a FATB-1a 5' RTU, in antisense orientation, followed by a 3 'FATB-1A RTU, in antisense orientation, followed by a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 240 contiguous nucleotides from the 5 'end and in antisense orientation, operatively linked to a H6 3' polyadenylation segment with a CP4 EPSPS gene , operatively linked to an EFMV promoter and 3 'termination sequence of the Rubis E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exposure.

PMON97554 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), which is reduced to 260 contiguous nucleotides from the 3' end, linked operatively. to 42 contiguous nucleotides from a FATB-1a 5 'UTR, followed by a FATB-1a CTP coding region operably linked to 70 nucleotides from FAD3-1A intron 4, operably linked to an antisense orientated FATB-1A CTP coding region, followed by 42 contiguous nucleotides of an antisense FATB-1 5 'UTR, followed by a soybean FAD2-1A intron 1 (SEQID NO : 1), reduced by 260 contiguous nucleotides from the 3 'end and antisense orientation, operably linked to a 3' H6 polyadenylation segment with a CP4 EPSPS gene, operably linked to an EFMV promoter and pea 3 'termination sequence Rubisco E9, all flanked by RB and LB on the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exhibit.

PMON93771 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 300 contiguous nucleotides from the 3' end and linked to a 3 'FATB-1 RTU a, followed by a 5 'FATB-1a RTU, operably linked to 70 nucleotides from FAD3-1A intron 4, operatively linked to a FATB-1 5' RTU, in antisense orientation, followed by a 3 'FATB-3 RTU 1a, in antisense orientation, followed by a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 300 contiguous nucleotides from the 3 'end and in antisense orientation, operatively linked to a 3' H6 polyadenylation segment with a CP4 EPSPS gene, operatively linked to an EFMV promoter and 3 'terminus sequence of the Rubis E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exposure.

PMON97555 contains a soybean 7Soc 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), which is reduced to 320 contiguous nucleotides from the 3' end, linked operatively. to 42 contiguous nucleotides from a FATB-1α 5 'UTR, followed by a FATB-1α CTP coding region operably linked to 70 nucleotides from FAD3-1A intron 4, operably linked to an antisense orientated FATB-1 A CTP coding region, followed by 42 contiguous nucleotides from an antisense 5 FATB-1 α RTU, followed by a soybean FAD2-1A intron 1 (SEQID NO: 1), reduced by 320 contiguous nucleotides from the 3 'end and in antisense orientation, operably linked to a 3' H6 polyadenylation segment with a CP4 EPSPS gene, operably linked to an EFMV promoter and termination sequence 3 'from the Rubisco E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation using the methods described in this exposure. ΡΜΟΝ937ΘΟ contains a soybean 7Sa 'promoter operably linked to a reduced soybean FAD2-1A intron 1 (SEQ ID NO: 1) at 320 contiguous nucleotides from the 5 'end and linked to a 3' FATB-1a RTU, followed by a 5 'FATB-1 RTU, operably linked to 70 nucleotides from FAD3-1A intron 4, operably linked to a 5' UTR FATB-1a in antisense orientation followed by a 3 'FATB-1A RTU in antisense orientation followed by a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 320 contiguous nucleotides from 5' end and in antisense orientation, operatively linked to a H6 3 'polyadenylation segment with a CP4 EPSPS gene, operatively linked to an EFMV promoter and 3' terminus sequence of pea Rubis E9, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exposure.

PMON93772 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 360 contiguous nucleotides from the 3' end and linked to a 3 'FATB-1 UTR UTR followed by a FATB-1 5 'UTR operably linked to 70 nucleotides from FAD3-1 A intron 4 operatively linked to a FATB-1 5' UTR in antisense orientation followed by a FATB-1 3 'UTR , in antisense orientation, followed by a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by contiguous nucleotides from the 3 'end and in antisense orientation, operatively linked to a 3' H6 polyadenylation segment with a CP4 gene EPSPS, operatively linked to an EFMV promoter and 3 'terminus sequence of Rubis E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exposure.

PMON97556 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), which is reduced to 380 contiguous nucleotides from the 3' end, linked operatively. to 42 contiguous nucleotides from a FATB-1 5 'UTR, followed by a FATB-1a CTP coding region operably linked to 70 nucleotides from FAD3-1A intron 4, operably linked to an antisense orientated FATB-1A CTP coding region, followed by 42 contiguous nucleotides of an antisense FATB-1a 5 'RTU, followed by a soybean FAD2-1A intron 1 (SEQID NO: 1) , reduced by 380 contiguous nucleotides from the 3'and end in antisense orientation, operatively linked to a 3 'H6 polyadenylation segment with a CP4 EPSPS gene, operably linked to an EFMV promoter and 3' terminus sequence of the Rubisco E9 pea, all flanked by RB and LB on the same DNA molecule. The resulting gene expression construct is used for transformation employing the methods described in this exhibit.

PMON93764 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 400 contiguous nucleotides from the 3' end and linked to a FATB-CTP coding region. 1a, followed by a FATB-2a deCTP coding region, operably linked to 70 nucleotides from the FAD3-1A intron4, operatively linked to a FATB-2a CTP coding region, in antisense orientation, followed by a FATB CTP coding region -1a, in antisense orientation, followed by a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 400 contiguous nucleotides from the 3 'end and in antisense orientation, operably linked to a FATB-2a CTP coding region in antisense orientation, followed by 42 contiguous nucleotides from a 5 'FATB-2a 5' RTU, in 3 'H6 with a CP4 EPSPS gene, operably linked to an EFMV pro-engine and a 3' terminus sequence of Rubisco E9 pea, allflank by RB and LB in the same DNA molecule. The resulting gene expression construct is used for transformation using the methods described in this exhibition. <table> table see original document page 83 </column> </row> <table> <table> table see original document page 84 </ column > </row> <table> <table> table see original document page 85 </column> </row> <table> <table> table see original document page 86 </column> </row> <table> <table > table see original document page 87 </column> </row> <table> Example 3 - Combined Constructions

In Figures 7-15, promoters are indicated by arrows, coding sequences (coding and non-coding), pentagons that point in the direction of transcription, sense sequences are identified in normal text, and antisense sequences in inverted text. Abbreviations used in these Figures include: 7Sa = 7Sa promoter; 7Sa '= promoter7Sa'; Br napin = Brassica napin promoter; FMV = FMV promoter; ARC = arcelin promoter; RBC E9 3 '= Rubisco E9 termination signal; Nos 3 '= termination nos signal; TML 3 '= tml termination signal; napina 3 '= napin termination signal; '3 (in the same box as FAD or FAT) = 3' UTR; 5 '(in the same box as FAD or FAT) = 5'UTR; Cr = Cuphea puicherrima-, Gm = Glycine max; Rc = Ricinus communis; FAB2 = FAB2 allele of a genedelta 9 stearoyl desaturase; and Intr or Int = intron.

3A. DsRNA constructs

Figures 7-9 depict nucleic acid molecules of the present invention in which the first sets of DNA sequences are capable of expressing dsRNA constructs. The first set of DNA sequences depicted in FIGS. 7-9, comprises pairs of related antisense and sense sequences arranged so that, for example, the RNA expressed by the first sense sequence is capable of forming a double stranded RNA with the antisense RNA expressed by the first antisense sequence. The sense sequences may be adjacent to the antisense sequences or separated from them by a spacer sequence, as shown in FIG. 9

The second set of DNA sequences comprises coding sequences, each of which a DNA sequence that encodes a sequence which, when expressed, is capable of increasing protein or transcript, or both, encoded by a gene selected from the group-constituted. by KAS I, KAS IV, delta-9 desaturase and CP4 EPSPS. Each coding sequence is associated with a promoter, which may be any functional promoter in a plant or any plant promoter, may be an FMV promoter, a napin promoter, a 7S (7Sα or 7Sα ') promoter, an arcelin promoter, a delta-9 desaturase promoter or a deFAD2-1A promoter.

Referring now to FIG. 7, the sequences of intron 1 deFAD2-1 (SEQ ID NO: 1 or 2), 3 'UTR of FAD3-1A (SEQ ID NO: 16) and 3'UTR of soybean FATB-jI (SEQ ID NO: 36) are PCR amplified to yield products that include restriction sites reconstructed at both ends. PCR products are directly cloned, sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron 5 (SEQ ID NO: 11), into a vector containing the soybean 7Soc' promoter and tml 3 'termination sequence, through the Xho \ sites constructed at the 5 'ends of the PCR primers. The vector is then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. Vectors containing a C. pulcher-rima KAS IV gene (SEQ ID NO: 39), regulated by Brassica napin promoter and a 3 'terminus sequence of Brassica, and an R delta-9 desaturase (FAB2) gene communis (SEQ ID NO: 40), regulated by a soybean deFAD2 promoter and a 3 'termination sequence, are cut with appropriate restriction enzymes and ligated into pMON41164. The resulting gene expression construct, pMON68539, is depicted in FIG. 7 and used for transformation employing the methods as described in this exposition.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A intron 4 (SEQ ID NO: 10) and soybean FATB-1 intron II (SEQID NO: 30) are amplified by PCR to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron (SEQ ID NO: 11), into a vector containing the soybean 7Sa 'promoter and termination sequence. 3 'via the Xho \ sites constructed at the 5' ends of the PCR primers. The vector is then cut with Notí and linked to nopMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV pro-motor and a 3 'terminus sequence of the Rubisco E9 pea. The resulting gene expression construct, pMON68540, is depicted in the FLG. 7 and used for transformation using the methods as described in this exhibition.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A intron 4 (SEQ ID NO: 10) and soybean FATB-1 intron II (SEQID NO: 30) are amplified by PCR to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron 5 (SEQ ID NO: 11), into a vector containing the soybean 7Soc 'promoter and termination sequence 3 'via the Xho \ sites constructed at the 5' ends of the PCR primers. The vector is then cut with NotI and linked to nopMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV pro-motor and a 3 'termination sequence of the Rubisco E9 pea. A vector containing a C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by a Brassica napin promoter and a Brassica 3'napine termination sequence, is cut with appropriate restriction enzymes and ligand pMON41164. The resulting gene expression construct, pMON68544, is depicted in FIG. 7 and used for transformation employing the methods as described in this disclosure.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A intron 4 (SEQ ID NO: 10), FATB-1 intron Il (SEQ ID NO: 30), edo Soybean FAD3-1B intron 4 (SEQ ID NO: 24) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are directly cloned, in sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron 5 (SEQ ID NO: 11), into a vector containing the soybean 7Sa' promoter and tml 3 'termination sequence, through the Xho \ sites constructed at the 5 'ends of the PCR primers. The vector is then cut with Noft and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct, pMON68546, is depicted in FIG. 7 and used for transformation, employing the methods as described in this exhibit.

Referring now to FIG. 7, the intron 1 sequences of FAD2-1 (SEQ ID NO: 1 or 2), 3 'UTR of FAD3-1A (SEQ ID NO: 16) and the 3'UTR of FATB-1 of Soybeans (SEQ ID NO: 36) are PCR amplified to yield products that include restriction sites reconstructed at both ends. PCR products are directly cloned, sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron 5 (SEQ ID NO: 11), into a vector containing the soybean 7Soc' promoter and tml 3 'termination sequence, through the Xho \ sites constructed at the 5 'ends of the PCR primers. The vector is then cut with Λ / ofl and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct, pMON68536, is depicted in FIG. 8 and used for transformation, employing the methods as described in this disclosure.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A 3'UTR (SEQ ID NO: 16) and soybean FATB-1 3 'UTR (SEQ IDNO: 36) are amplified by PCR to yield products that include restriction sites reconstructed at both ends. DaPCR products are cloned directly, in sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron (SEQ ID NO: 11) into a vector containing the soybean 7Sa 'promoter and tml 3 termination sequence 'through the Xho' sites constructed at the 5 'ends of the PCR primers. A vector containing an R.communis delta-9 desaturase (FAB2) gene (SEQ ID NO: 40), regulated by a soybean FAD2 promoter and a 3 'terminus, is cut with appropriate restriction enzymes and immediately afterwards, upwards, termination sequence 3 'tml. The vector is then cut with NotI eligible in pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'terminus sequence of the RubiscoΕ9 pea. The resulting gene expression construct, pMON68537, is depicted in FIG. 8 and used for transformation using the methods as described in this exhibition.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A 3'UTR (SEQ ID NO: 16) and soybean FATB-1 3 'UTR (SEQ IDNO: 36) are amplified by PCR to yield products that include restriction sites reconstructed at both ends. DaPCR products are cloned directly, in sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron (SEQ ID NO: 11) into a vector containing the soybean 7Sa 'promoter and tml 3 termination sequence 'through the Xho' sites constructed at the 5 'ends of the PCR primers. The vector is then cut with NotI and linked to nopMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV pro-motor and a 3 'termination sequence of the Rubisco E9 pea. A vector containing a C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by Brassica napin promoter and Brassica 3 'napin termination sequence, is cut with appropriate restriction enzymes and ligated nopMON41164. The resulting gene expression construct, pMON68538, is depicted in FIG. 8 is used for transformation employing the methods as described in this disclosure.

Referring now to FIG. 7, the sequences of the 3 'UTR deFAD2-1 (SEQ ID NO: 5), the 3' UTR of FATB-1 (SEQ ID NO: 36), the 3 'UTR of FAD3-1A (SEQ ID NO : 16), and the soybean FAD3-1B 3 'RTU (SEQ ID NO: 26) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron 5 (SEQ ID NO: 11), into a vector containing the soybean 7Sa 'promoter and tml 3' termination sequence by in the middle of the Xho \ sites constructed at the 5 'ends of the PCR primers. The vector is then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct, pMON80622, is depicted in FIG. 9 is used for transformation, employing the methods as described in this exposition.

The sequences of the 3 'RTF of FAD2-1 (SEQ ID NO: 5), the 3' RTU of FATB-1 (SEQ ID NO: 36) and the 3 'RTU of soybean FAD3-1A (SEQ ID NO: 16) are PCR-amplified to yield products that include reconstruction-restricted sites at both ends. PCR products are cloned directly, in sense and antisense orientations, separated by a spliceable soybean FAD3-1A intron 5 (SEQ ID NO: 11), into a vector containing the soybean 7Sa 'promoter and tml 3 \ termination sequence in -term of the Xho \ sites, constructed at the 5 'ends of the PCR primers. The vector is then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct, pMON80623, is depicted in FIG. 9 is used for transformation, employing the methods as described in this exposition.

The FAD2-1 5 'UTR-3' UTR sequences (SEQ ID NO: 6 and 5, joined), FAJB-I 5'UTR-3'UTR (SEQ ID NOs: 37 and 36, joined), 3 FAD3-1A RTU (SEQ ID NO: 16) and soybean FAD3-1B 5 'UTR-3' RTU (SEQ IDNO: 27 and 26, united) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense and antisense orientations, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence, via the Xho \ sites, constructed at the 5 'ends. PCR primers. The vector is then cut with NoÜ and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'terminus sequence of the RubiscoE9 pea. The resulting gene expression construct, 05, is depicted in FIG. 9 is used for transformation using the methods as described in this disclosure.

The sequences of the 5 'UTR-3' UTR of FAD2-1 (SEQ ID NO: 6 and 5, united), 5'UTR-3'UTR of FATB-1 (SEQ ID NOs: 37 and 36, united) and the Soybean FAD3-1A 3'UTR (SEQ ID NO: 16) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are directly cloned, in sense and antisense orientations, into a vector containing the 7Sa 'disjoint promoter and tml 3' termination sequence by means of the Xho \ sites constructed at the 5 'ends of the PCR primers. The vector is then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. A vector containing a C. pulcher-rima KAS IV gene (SEQ ID NO: 39), regulated by a Brassica napin promoter and a Brassica 3'napin termination sequence, is cut with restriction self-ligating enzymes and ligated into the pMON41164. The resulting gene expression construct 06 is depicted in FIG. 9 is used for transformation employing the methods as described in this disclosure.

3B. - sense co-sweat constructs

Figures 10-13 and 19-20 depict nucleic acid molecules of the present invention in which the first sets of DNA sequences are capable of expressing sense co-suppression constructs. The second set of DNA sequences comprises ras-coded sequences, each of which is a DNA sequence that encodes a sequence which, when expressed, is capable of increasing the protein or transcript, or both, encoded by a gene selected from the group consisting of by KASI, KAS IV, delta-9 desaturase and CP4 EPSPS. Each coding sequence is associated with a promoter, which may be any functional promoter in a plant or any plant promoter, which may be an FMV promoter, a napin promoter, a 7S (7Sa or 7Sa ') promoter, an arcelin promoter, a delta promoter. -9 desaturase or a FAD2-1A promoter.

Referring now to FIG. 10, the intron 1 sequences of FAD2-1 (SEQ ID NO: 1 or 2), intron 4 of FAD3-1C (SEQ ID NO: 14), intronIl of FATB-1 (SEQ ID NO: 30), intron 4 of FAD3-1A (SEQ ID NO: 10) and soybean FAD3-1B dointron 4 (SEQ ID NO: 24) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are directly cloned, in sense orientation, into a vector containing the 7Soc 'soybean promoter and 3' pea Rubisco E9 termination sequence, via the Xho \ sites, constructed at the 5 'ends of the PCR primers. The vector is then cut with Noti and linked in pM0N41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct, pMON68522, is depicted in FIG. 10 is used for transformation, employing the methods as described in this disclosure.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A intron 4 (SEQ ID NO: 10), FAD3-1B intron 4 (SEQ ID NO: 24) and Soybean FATB-1 intron (SEQ ID NO: 30) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence, via Xho \ sites, constructed on the 5 'ends of the PCR primers. The vector is then cut with / Vofle linked in pMON41164, a vector containing the CP4 EPSPS gene, ruled by the FMV promoter and a 3 'terminus sequence of the Rubis-co E9 pea. Vectors containing a C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by Brassica napin promoter and a Brassica 3 'termination sequence, and a delta-9 desaturase gene (FAB2) of phi. communis (SEQ ID NO: 40), regulated by a soybean FAD2 promoter and a 3 'terminus sequence, are cut with appropriate restriction enzymes and ligated into pMON41164. The resulting gene expression construct, pMON80614, is depicted in FIG. 10 is used for transformation employing the methods as described in this disclosure.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A 3'UTR (SEQ ID NO: 16) and soybean FATB-1 3 'UTR (SEQ IDNO: 36) are amplified by PCR to yield products that include restriction sites reconstructed at both ends. DaPCR products are cloned directly, in sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence by means of Xho \ sites constructed at the 5 'ends of PCR primers. The vector is then cut with Not1 and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct, pMON68531, is depicted in FIG. 10 is used for transformation employing the methods as described in this disclosure.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A 3'UTR (SEQ ID NO: 16) and soybean FATB-1 3 'UTR (SEQ IDNO: 36) are amplified by PCR to yield products that include restriction sites reconstructed at both ends. DaPCR products are cloned directly, in sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence by means of Xho \ sites constructed at the 5 'ends of PCR primers. The vector is then cut with Not 1 and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'termination sequence of the Rubisco E9 pea. Vectors containing a C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by Brasica s napina promoter and a Brassica 3 'termination sequence, and an R. delta-9 desaturase (FAB2) gene. communis (SEQ ID NO: 40), regulated by a soybean FAD2 promoter and a 3 'termination sequence, are cut with appropriate restriction enzymes and ligated into pMON41164. The resulting gene expression construct, pMON68534, is depicted in FIG. 10 is used for transformation using the methods as described in this disclosure.

The sequences of intron 1 α and FAD2-1 (SEQ ID NO: 1 or 2), 3'UTR of FAD3-1A (SEQ ID NO: 16) and 3 'UTR of soybean FATB-1 (SEQ IDNO: 36) are amplified by PCR to yield products that include restriction sites reconstructed at both ends. DaPCR products are cloned directly, in sense orientation, into a vector containing the soy 7Scc 'promoter and tml 3' termination sequence by Xftol1 sites constructed at the 5 'ends of PCR primers. The vector is then cut with Λ / ofl and ligated into pM0N41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'termination sequence of the Rubisco E9 pea. A vector containing an R. communis delta-9 desaturase (FAB2) gene (SEQ ID NO: 40), regulated by a soybean FAD2 promoter and a 3 'terminus sequence, is cut with appropriate restriction enzymes and ligated. in pMON41164. The resulting gene expression construct, pMON68535, is depicted in FIG. 10 is used for transformation using the methods described in this disclosure.

Referring now to FIG. 11, the sequences of the 3 'UTR deFAD2-1 (SEQ ID NO: 5), the 3' UTR of FAD3-1A (SEQ ID NO: 16) and the 3 'FATB-1 soybean RTU (SEQ ID NO: 36) they are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' determination sequence, via Xho \ sites, constructed at the 5 'ends of the PCR primers. The vector is then cut with NoÜ and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'terminus sequence of the RubiscoE9 pea. The resulting gene expression construct, pMON80605, is depicted in FIG. 11 is used for transformation employing the methods as described in this disclosure.

The sequences of the 3 'RTF of FAD2-1 (SEQ ID NO: 5), the 3' RTU of FAD2-1A (SEQ ID NO: 16) and the 3 'RTU of soybean FATB-I (SEQ ID NO: 36) are PCR-amplified to yield products that include reconstruction-restricted sites at both ends. PCR products are cloned directly, in sense orientation, into a vector containing 7Soc 'soybean opromotor and tml 3' termination sequence, via Xho \ sites, constructed at the 5 'ends of PCR primers. The vector is then cut with NoÜ and linked in pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'determination sequence of the Rubisco E9 pea. A vector containing a KAS IV deC gene. pulcherrima (SEQ ID NO: 39), regulated by a Brasica sia napin promoter and a Brassica 3 'napina termination sequence, is cut appropriate restriction enzymes and ligated into pMON41164. The resulting gene expression construct, pMC> N80606, is depicted in FIG. 11 is used for transformation employing the methods as described in this disclosure.

The sequences of the 3 'RTF of FAD2-1 (SEQ ID NO: 5), the 3' RTU of FAD2-1A (SEQ ID NO: 16) and the 3 'RTU of FATB-1 soybean (SEQ ID NO: 36) are PCR-amplified to yield products that include reconstruction-restricted sites at both ends. PCR products are cloned directly, in sense orientation, into a vector containing 7Soc 'soybean opromotor and tml 3' termination sequence, via Xho \ sites, constructed at the 5 'ends of PCR primers. The vector is then cut with Noft and ligated into pM0N41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'determination sequence of the Rubisco E9 pea. A vector containing an R. communis delta-9 desaturase (FAB2) gene (SEQ ID NO: 40), regulated by a soybean FAD2 promoter and a 3 'terminus sequence, is cut with appropriate restriction enzymes and ligated. in pMON41164. The resulting gene expression construct, pMON80607, is depicted in FIG. 11 is used for transformation using the methods as described in this exhibition.

The sequences of the 3 'RTF of FAD2-1 (SEQ ID NO: 5), the 3' RTU of FAD2-1A (SEQ ID NO: 16) and the 3 'RTU of FATB-1 soybean (SEQ ID NO: 36) are PCR-amplified to yield products that include reconstruction-restricted sites at both ends. PCR products are cloned directly, in sense orientation, into a vector containing 7Sa 'soybean opromotor and tml 3' termination sequence, via Xho \ sites, constructed at the 5 'ends of PCR primers. The vector is then cut with Noft and linked in pMON41164, a vector that contains the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'determination sequence of the Rubisco E9 pea. Vectors containing a KAS IV deC gene. pulcherrima (SEQ ID NO: 39), regulated by Brassicae napina promoter a Brassica 3 'termination sequence, and an R. communis delta-9 desatase-rase (FAB2) gene (SEQ ID NO: 40), regulated by a soybean deFAD2 promoter and a 3 'terminus sequence are cut with appropriate restriction enzymes and ligated into pMON41164. The resulting gene expression construct, pMON80614, is depicted in FIG. 11 and used for transformation employing the methods as described in this disclosure.

Referring now to FIG. 12, the sequences of the 3 'UTR deFAD2-1 (SEQ ID NO: 5), the 3' UTR of FATB-I (SEQ ID NO: 36) and the 3 'UTR deFAD3-1A of soy (SEQ ID NO: 16) they are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense orientation, into a vector containing the soy 7Soc promoter and tml 3 'determination sequence, via Xho \ sites, constructed at the 5' ends of the PCR primers. The vector is then cut with Not 1 and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'terminus sequence of the RubiscoE9 pea. The resulting gene expression construct, pMON80629, is depicted in FIG. 12 is used for transformation employing the methods as described in this disclosure.

The sequences of FAD2-1 intron 1 (SEQ ID NO: 1 or 2), FAD3-1A intron 4 (SEQ ID NO: 10), FATB-1 intron II (SEQ ID NO: 30) and intron 1 Soybean FAD3-1A 4 (SEQ ID NO: 10) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense orientation, into a vector containing the soy 7Soc promoter and tml 3 'termination sequence, via the Xho \ sites, constructed on the 5' ends of the PCR primers. The vector is then cut with NotIe linked in pMON41164, a vector containing the CP4 EPSPS gene, ruled by the FMV promoter and a 3 'termination sequence of the Rubis-co Ε9 pea. The resulting gene expression construct, pMON81902, is depicted in FIG. 12 is used for transformation using the methods as described in this disclosure.

The FAD2-1 5 'UTR-3' UTR sequences (SEQ ID NO: 6 and 5, united), FATB-1 5'UTR-3'UTR (SEQ ID NOs: 17 and 16, united, or 27 and 26, joined), and soybean FATB-1 5'UTR-3'UTR (SEQ ID NOs: 37 and 36, joined) are PCR amplified to yield products that include reconstructed restriction sites at both ends. The deFAD2-1 PCR product is cloned directly, in sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence by means of the Xho \ sites constructed at the 5 'ends of the PCR primers. Similarly, the FAD3-1 PCR product is cloned directly, in sense orientation, into a vector containing the soy 7Sa promoter and tml 3 'termination sequence, via the Xho \ sites, constructed at the extremities. 5 'of the PCR primers. The FATB-1 PCR product is cloned directly, in sense orientation, into a vector containing the arceline promoter and tml 3 'termination sequence, via the Xho \ sites, constructed at the 5' ends of the PCR primers. . These vectors are then cut with Nofi and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct, 01, is depicted in FIG. 12 and used for transformation employing the methods as described in this disclosure.

The FAD2-1 5 'UTR-3' UTR sequences (SEQ ID NO: 6 and 5, united), FATB-1 5'UTR-3'UTR (SEQ ID NOs: 17 and 16, united, or 27 and 26, joined), and soybean FATB-1 5'UTR-3'UTR (SEQ ID NOs: 37 and 36, joined) are PCR amplified to yield products that include reconstructed restriction sites at both ends. The deFAD2-1 PCR product is cloned directly, in sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence by Xftol1 sites constructed at the 5 'ends of the PCR primers. Similarly, the FAD3-1 PCR product is cloned directly, in sense orientation, into a vector containing the soy 7Soc promoter and tml 3 'termination sequence, via the Xho \ sites, constructed at the extremities. 5 'of the PCR primers. The FATB-1 PCR product is cloned directly, in sense orientation, into a vector containing the arceline promoter and tml3 'termination sequence via the Xho \ sites constructed at the 5' ends of the PCR primers. These vectors are then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. A vector containing a C. pul-cherrima KAS IV gene (SEQ ID NO: 39), regulated by a Brassica napin promoter and a Brassica 3 'napin termination sequence, is cut with appropriate restriction enzyme and ligated into pMON41164. The resulting gene expression construct 02 is depicted in FIG. 12 and used for transformation, employing the methods as described in this disclosure.

Referring now to FIG. 13, the sequences of the 5 'UTR deFAD2-1 (SEQ ID NO: 6 and 5, united), 5'UTR-3'UTR of FATB-1 (SEQ ID NOs: 37 and 36, united), 3' UTR of FAD3-1A (SEQ ID NO: 16) and the 5 'UTR-3' soybean FAD3-1B RTU (SEQ ID NO: 27 and 26, united) are amplified by PCR to yield products that include reconstructed restriction sites. at both ends. PCR products are cloned directly, in sense orientation, into a vector containing the 7Sa 'soybean promoter and tml3' termination sequence, via the Xho 'sites, constructed at the 5' ends of the PCR primers. The vectors are then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. A vector containing a C. pulcher-rima KAS IV gene (SEQ ID NO: 39), regulated by a Brassica napin promoter and a Brassica 3'napin termination sequence, is cut with restriction self-ligating enzymes and ligated into the pMON41164. The resulting gene expression construct, 07, is depicted in FIG. 13 is used for transformation employing the methods as described in this disclosure.

Soybean FAD2-1 intron 1 (SEQ ID NO: 1) is amplified by PCR and results in products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence, via Xho \ sites, constructed on the 5 'ends of the PCR primers. The sequences of the 5 'UTR-3' UTR deFATB-I (SEQ ID NO: 37 and 36, united), 3 'FAD3-1A UTR (SEQ ID NO: 16) and the 5' UTR-3 'FAD3 UTR -1B soybeans (SEQ ID NO: 27 and 26, united) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are directly cloned, in sense orientation, into a vector containing the 7Scc soybean promoter and 3 'termination sequence via Xho \ sites constructed at the 5' ends of the PCR primers. The vectors are then cut with Nofi and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'termination sequence of the Rubisco E9 pea. A vector containing a C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by a Brassica napin promoter and a Brassica 3 'napin termination sequence, is cut with appropriate restriction enzymes and ligated into pMON41164. The resulting gene expression construct, 09, is depicted in FIG. 13 and used for transformation employing the methods as described in this exposition.

Referring now to FIG. 19, FATB-2 non-coding sequences (SEQ ID NO: 44-47), FAD2-1 non-coding sequences (SEQ ID NOs: 1 and 5-6), and soybean FATB-1 non-coding sequences (SEQ ID NOs: 29-37) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in a sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence via the XhcA sites constructed at the 5 'ends of the PCR primers. The vectors are then cut with Nofi and ligated nopMON80612, a vector containing the CP4 EPSPS gene, regulated by the FMV pro-motor and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct is depicted in FIG. 19-A is used for transformation employing the methods as described in this disclosure.

A DNA sequence, containing a delta-9 desaturase, re-guided by a 7S alpha promoter and a 3 'TML termination sequence, is cut using the appropriate restriction enzymes and ligated into the above expression construct. The resulting gene expression construct is depicted in FIG. 19-B is used for transformation using the methods as described in this disclosure.

A vector containing a C. pulcherrima KAS IV gene (SEQ IDNO: 39), regulated by a bean arcelin promoter and a 3 'napin determination sequence, is cut with appropriate restriction enzymes and ligated into the above expression construct. The resulting gene expression construct is depicted in FIG. 19-C is used for transformation using the methods as described in this exhibit.

Referring now to FIG. 20, FATB-2 non-coding sequences (SEQ ID NO: 44-47), FAD2-1 non-coding sequences (SEQ ID NOs: 1 and 5-6), FATB-I non-coding sequences (SEQ IDNOs: 29 -37), non-coding sequences of FAD3-1A (SEQ ID NOs: 7-13e -16-17) and non-coding sequences of soybean FAD3-1 (SEQ ID NOs: 19-27) are PCR amplified to yield products that include restraint sites reconstructed at both ends. DaPCR products are cloned directly, in sense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence by means of Xho \ sites constructed at the 5 'ends of PCR primers. The vectors are then cut with Noti and ligated into pMON80612, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct is depicted in FIG. 20-A is used for transformation using the methods as described in this disclosure.

A DNA sequence, containing a delta-9 desaturase, regulated by a 7S alpha promoter and a 3 'TML termination sequence, is cut using the appropriate restriction enzymes and ligated into the above expression construct. The resulting gene expression construct is depicted in FIG. 20-B and used for transformation using the methods as described in this disclosure.

A vector containing a C. pulcherrima KAS IV gene (SEQ IDNO: 39), regulated by a Brassica bean arcelin promoter and a 3 'napkin terminating sequence, is cut with appropriate restriction enzymes and ligated into the above expression construct. . The resulting gene expression construct is depicted in FIG. 20-C is used for transformation employing the methods as described in this disclosure.

PMON93501 contains a soybean FAD2-1A intron 1 (SEQ IDNO: 1), operatively linked to a soybean 7Sa 'promoter and a H6 3' termination sequence, a C. pulcherrima KAS IV gene KAS IV gene ( SEQ ID NO: 39), operatively linked a Brassica napin promoter to a Brassica 3 'napin termination sequence, the Ricinus communis delta 9 gene (Turkish Patent Publication No.2003 / 00229918 A1), linked operably to a soybean 7SA promoter and a 3 'termination sequence and a CP4 EPSPS gene, operatively linked to an EFMV promoter (constitutive promoter derived from the scrofular mosaic virus) and a 3' terminus sequence to peaRubisco E9, all flanked by T-DNA border elements from Agro-bacterium T-DNA, that is, a right edge DNA (RB) and a left edge DNA (LB). The resulting gene expression construct is used for transformation using the methods described in this exhibition.3C - Antisense constructs

FIG. 14 depicts nucleic acid molecules of the present invention in which the first sets of DNA sequences are capable of expressing antisense constructs, and FIGs. 15 to 18 depict nucleic acid molecules of the present invention in which the first sets of DNA sequences are capable of expressing sense and antisense combinations. The second set of DNA sequences comprises coding sequences, each of which is a DNA sequence that encodes a sequence that, when expressed, is capable of augmenting the protein or transcript, or both, encoded by a gene selected from the group consisting of KAS I , KAS IV, delta-9 desaturase and CP4 EPSPS. Each coding sequence is associated with a promoter, which may be any functional promoter in a plant or any plant promoter, and may be an FMV promoter, a napin promoter, a 7S promoter ( 7a or 7Soc '), an arcelin promoter, a delta-9 desaturase promoter or a FAD2-1A promoter.

Referring now to FIG. 14, the sequences of the 3 'RTF deFAD2-1 (SEQ ID NO: 5), the 3' RTU of FATB-1 (SEQ ID NO: 36) and the 3 'RTF of soybean FAD3-1A (SEQ ID NO: 16) are amplified by PCR to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in antisense orientation, into a vector containing the soy 7Sa 'promoter and tml 3' termination sequence, via the Xho \ sites, constructed at the 5 'ends of the PCR primers. The vector is then cut with Not \ eligible in pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'termination sequence of the RubiscoE9 pea. The resulting gene expression construct, pMON80615, is depicted in FIG. 14 is used for transformation employing the methods as described in this disclosure.

The sequences of 3 'FAD2-1 RTU (SEQ ID NO: 5), 3' deFATB-1 RTU (SEQ ID NO: 36) and 3 'soybean FAD3-1A RTU (SEQ ID NO: 16) are PCR-amplified to yield products that include reconstruction restriction sites at both ends. PCR products are cloned directly, in antisense orientation, into a vector containing the 7Scc 'soybean opromotor and tml 3' termination sequence, via the Xho \ sites, constructed at the 5 'ends of the PCR primers. The vector is then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'determination sequence from the Rubisco E9 pea. A vector containing a KAS IV deC gene. pulcherrima (SEQ ID NO: 39), regulated by a Brasica sia napin promoter and a Brassica 3 'napina termination sequence, is cut appropriate restriction enzymes and ligated into pMON41164. The resulting gene expression construct, pMON80616, is depicted in FIG. 14 is used for transformation employing the methods as described in this disclosure.

The sequences of 3 'FAD2-1 RTU (SEQ ID NO: 5), 3' deFATB-1 RTU (SEQ ID NO: 36) and 3 'soybean FAD3-1A RTU (SEQ ID NO: 16) are PCR-amplified to yield products that include reconstruction restriction sites at both ends. PCR products are cloned directly, in antisense orientation, into a vector containing 7Soc 'soybean opromotor and tml 3' termination sequence, via the Xho \ sites, constructed at the 5 'ends of the PCR primers. The vector is then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'determination sequence from the Rubisco E9 pea. A vector containing an R. communis delta-9 desaturase (FAB2) gene (SEQ ID NO: 40), regulated by a soybean FAD2 promoter and a 3 'terminus sequence, is cut with appropriate restriction enzymes and ligated into pMON41164. The resulting gene expression construct, pMON80617, is depicted in FIG. 14 is used for transformation using the methods as described in this disclosure.

The sequences of the 3 'RTF of FAD2-1 (SEQ ID NO: 5), the 3' RTU of FATB-I (SEQ ID NO: 36) and the 3 'RTU of FAD3-1A (SEQ ID NO: 16) are PCR-amplified to yield products that include reconstruction restriction sites at both ends. PCR products are cloned directly, in antisense orientation, into a vector containing the 7Sa soybean opromotor and tml 3 'termination sequence, via the Xho \ sites, constructed at the 5' ends of the PCR primers. The vector is then cut with NotI and ligated into pMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'determination sequence from the Rubisco E9 pea. The resulting gene expression construct, pMQN80630, is depicted in FIG. 14 is used for transformation employing the methods as described in this disclosure.

The FAD2-1 5 'UTR-3' UTR sequences (SEQ ID NO: 6 and 5, joined), FATB-1 5'UTR-3'UTR (SEQ ID NOs: 37 and 36, joined), 3 FAD3-1A RTU (SEQ ID NO: 16) and Soy FAD3-1B 5 'UTR-3' RTU (SEQ IDNO: 27 and 26, joined) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in antisense orientation, into a vector containing the soy 7Sa 'promoter and tml3' termination sequence, via Xho \ sites, constructed at the 5 'ends of the PCR primers. The vector is then cut with Λ / ofl and ligated nopMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV pro-motor and a 3 'termination sequence of the Rubisco E9 pea. A vector containing a C. pulcherrima KAS IV gene (SEQ ID NO: 39), regulated by a Brassica napin promoter and a Brassica 3'napine termination sequence, is cut with appropriate restriction enzymes and ligand pM0N41164. The resulting gene expression construct, 08, is depicted in FIG. 14 is used for transformation using the methods as described in this disclosure.

Referring now to FIG. 15, the sequences of the 5 'UTR deFAD2-1 (SEQ ID NO: 6 and 5, united), 5'UTR-3'UTR of FAD3-1 (SEQ ID NOs: 17 and 16, united), 5'UTR- FATB-1 3'UTR (SEQ ID NOs: 37 and 36, joined) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly, in sense and antisense orientation, into a vector containing the soy 7Soc 'promoter and tml 3' termination sequence, with an additional 7Sa promoter, located between the sense and antisense sequences through the Xho \ sites. , constructed at the 5 'ends of the PCR primers. The vector is then cut with Noti and ligated nopMON41164, a vector containing the CP4 EPSPS gene, regulated by the FMV pro-motor and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct, 03, is depicted in FIG. 15 and used for transformation employing the methods as described in this disclosure.

The FAD2-1 5 'UTR-3' UTR sequences (SEQ ID NO: 6 and 5, united), FAD3-1A 5'UTR-3'UTR (SEQ ID NOs: 27 and 26, united), 5 FATB-1 'UTR-3'UTR (SEQ ID NOs: 37 and 36, joined) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are directly cloned, in sense and antisense orientation, into a vector containing the 7Sa 'disjoint promoter and tml 3' termination sequence, with an additional 7Sa promoter, located between the sense and antisense sequences, via the sites. deXho \, constructed at the 5 'ends of the PCR primers. The vector is then cut with NotI and ligated into pMON41164, a vector containing the geneCP4 EPSPS, regulated by the FMV promoter and a 3 'termination sequence of the Rubisco E9 pea. A vector containing a C. pulcher-rima KAS IV gene (SEQ ID NO: 39), regulated by a Brassica napin promoter and a Brassica 3'napin termination sequence, is cut with restriction self-ligating enzymes and ligated into the pMON41164. The resulting gene expression construct, 04, is depicted in FIG. 15 and used for transformation employing the methods as described in this disclosure.

Referring now to FIG. 16, the non-coding sequences of FATB-2 (SEQ ID NO: 44-47), non-coding sequences of FATB-1 (SEQ ID NOs: 29-37), and the non-coding sequences of soybean FAD2-1 (SEQ ID NOs: 1 and 5-6) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly in sense eantisense orientation into a vector containing the soy 7Sa 'promoter and a tml 3' termination sequence. The vector is then cut with an appropriate restriction endonucleae and ligated into pMON80612, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'termination sequence of the Rubisco E9 pea. The resulting gene expression construct is depicted in FIG. 16-A is used for transformation using the methods as described in this disclosure.

A DNA1 sequence containing a delta-9 desaturase, re-guided by a 7S alpha promoter and a TML 3 'termination sequence is cut employing the appropriate restriction enzymes and ligated into the above expression construct. The resulting gene expression construct is depicted in FIG. 16-B and used for transformation using the methods as described in this disclosure.

A vector containing a C. pulcherrima KAS IV gene (SEQ IDNO: 39), regulated by a bean arcelin promoter and a 3 'napin determination sequence, is cut with appropriate restriction enzymes and ligated into the above expression construct. The resulting gene expression construct is depicted in FIG. 16-C is used for transformation using the methods as described in this disclosure.

Referring now to FIG. 17, FATB-2 non-coding sequences (SEQ ID NO: 44-47), FATB-1 non-coding sequences (SEQ ID NOs: 29-37), FAD2-1 non-coding sequences (SEQ IDNOs: 1 and 5 -6) and non-coding soybean FAD3-1A sequences (SEQ IDNOs: 7-13 and 16-17) are PCR amplified to yield products that include reconstructed restriction sites at both ends. PCR products are cloned directly in sense orientation and antisense into a vector containing the soy 7Sa 'promoter and a tml 3' termination sequence. The vector is then cut with an appropriate restriction restriction endonuclease and ligated into pMON80612, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'termination sequence from the Rubisco E9 pea. The resulting gene expression construct is re-treated in FIG. 17-A is used for transformation using the methods as described in this exposure.

A DNA sequence, containing a delta-9 desaturase, regulated by a 7S alpha promoter and a 3 'TML termination sequence, is cut using the appropriate restriction enzymes and ligated into the above expression construct. The resulting gene expression construct is depicted in FIG. 17-B and used for transformation using the methods as described in this disclosure.

A vector containing a C. pulcherrima KAS IV gene (SEQ IDNO: 39), regulated by a bean arcelin promoter and a 3 'napin determination sequence, is cut with appropriate restriction enzymes and ligated into the above expression construct. The resulting gene expression construct is depicted in FIG. 17-C is used for transformation using the methods as described in this disclosure.

Referring now to FIG. 18, FATB-2 non-coding sequences (SEQ ID NO: 44-47), FATB-1 non-coding sequences (SEQ ID NOs: 29-37), FAD2-1 non-coding sequences (SEQ IDNOs: 1 and 5 -6) and non-coding sequences of soybean FAD3-1A (SEQ IDNOs: 7-13 and -16-17) and non-coding sequences of soybean FAD3-1B (SEQ ID NOs: 19-27) are PCR amplified to resulting in products that include reconstructed restriction sites at both ends. PCR products are cloned directly in sense orientation and antisense into a vector containing the soy 7Soc 'promoter and a tml 3' termination sequence. The vector is then cut with an appropriate restriction restriction endonuclease and ligated into pMON80612, a vector containing the CP4 EPSPS gene, regulated by the FMV promoter, and a 3 'termination sequence from the Rubisco E9 pea. The resulting gene expression construct is re-treated in FIG. 18-A is used for transformation using the methods as described in this exposure.

A DNA sequence, containing a delta-9 desaturase, regulated by a 7S alpha promoter and a 3 'TML termination sequence, is cut using the appropriate restriction enzymes and ligated into the above expression construct. The resulting gene expression construct is depicted in FIG. 18-B and used for transformation using the methods as described in this disclosure.

A vector containing a C. pulcherrima KAS IV gene (SEQ IDNO: 39), regulated by a bean arcelin promoter and a 3 'napin determination sequence, is cut with appropriate restriction enzymes and ligated into the above expression construct. The gene expression construct is depicted in FIG. 18-C and used for transformation using the methods as described in this disclosure. The nucleic acid molecules described above are preferred embodiments with which the objects, aspects and advantages of the present invention are achieved. The illustrated embodiments are not intended to restrict the present invention. The sequence arrangement in the first and second set of DNA sequences in the nucleic acid molecule is not limited to the illustrated and described arrangements and may be altered in any manner suitable so that the objects, aspects and advantages of present invention are attained as described in the accompanying drawings and covered by the claims.

3D.- Assembly in vivo

A feature of the present invention includes a DNA construct that is assembled into a recombinant transcription unit on an in plant plant chromosome capable of forming double stranded RNA. Assembly of these constructs and methods of assembling a recombinant transcription unit for gene suppression in vivo are set forth in International Patent Application No. PCT / US2005 / 00681, incorporated herein in its entirety by reference in this application.

PMON93505 is a construct used for inventive assembly and has two T-DNA segments, each flanked by elements bordering Agrobacterium T-DNA, or right edge DNA (RB) and left edge DNA (LB). The first T-DNA segment contains a soybean 7Sa' promoter operably linked to a soybean FAD2-1A intron 1 (SEQ IDNO: 1), reduced by 100 contiguous nucleotides from the 3 'end eligible to 3' FATB RTU followed by a 5 'FATB-Ia RTU, a C. puicherrima KAS IV gene (SEQ ID NO: 39), operatively linked to a Brassica napin engine, and a Brassica 3' napin termination sequence, the delta 9 gene Ricinus communis desaturase (US Patent Publication No. 2003/00229918 A1), operatively linked to a soy 7SA promoter and a 3 'termination sequence, and a PCR4 EPSPS gene, operably linked to an EFMV promoter and sequence 3 'terminus of Rubisco E9 pea, all flanked by T-DNA Agrobacterium edge elements, ie, a right edge DNA (RB) and a left edge DNA (LB). In the same construct, in the second segment of T-DNA, flanked by another RB and LB1 there is an H6 3 \ determination sequence operably linked to an FAD2-1A intron 1 flush (SEQ ID NO: 1), reduced by 100 contiguous nucleotides from 3 'end and bound to 3' FATB-Ia RTU, followed by a 5 'FATB-Ia RTU. The resulting gene expression construct is used for transformation using the methods described in this disclosure.

When the two T-DNA segments of the above construct are inserted into a single Iocus of the chromosome of a host organism in orientation from RB to RB, the assembled transcription unit has a 7Soc 'soybean operably linked in sense and angled orientation. -tisense, to FAD2-1A and FATB-Ia intron 1 DNA fragments from so-ja. When transcribed, operably linked sense and antisense RNA sequences are capable of forming double-stranded RNA, effective for FAD2-1A and FATB suppression.

PMON93506 is a construct used for inventive assembly and has two T-DNA segments, each flanked by elements abutting Agrobacterium T-DNA, or right-edge DNA (RB) and left-edge DNA (LB). The first T-DNA segment contains a soybean promoter 7Sa 'operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 100 contiguous nucleotides from the 3' end and linked to 3 FATB-1 'UTR, followed by a 5' FATB-1a RTU, a Ricinus communis delta 9 desaturase gene (US Patent Application Publication No. 2003/00229918 A1), operatively linked to a 7SA soybean engine and a 3 'termination sequence, and a EPS4 geneCP4 operably linked to an eFMV promoter and a 3' terminus sequence of Rubisco E9 pea, all flanked by LB and RB. In the same vector, in the second T segment -DNA, there is a 3 'H6 determination sequence operably linked to an FAD2-1A intron 1 flush (SEQ ID NO: 1), reduced by 100 contiguous nucleotides from the 3' end and bound to the 3 'FATB RTU it, followed by a 5 'UTR of FATB-1a, flanked by another RB and LB. The resulting gene expression construction is used for transformation, using the methods described in this exhibition.

When the two T-DNA segments of the above construct are inserted into a single Iocus of the chromosome of a host organism in orientation from RB to RB, the assembled transcription unit has a 7Sa 'soybean operably linked in sense and angled orientation. -tisense, to FAD2-1A and FATB-Ia intron 1 DNA fragments from so-ja. When transcribed, operably linked sense and antisense RNA sequences are capable of forming double-stranded RNA, effective for FAD2-1A and FATB suppression.

PMON93829 is a construct used for inventive assembly and has two T-DNA segments, each flanked by elements on the Agrobacterium T-DNA, namely Right Edge (RB) and Left Edge (LB) DNA. The first segment of T-DNA contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 100 contiguous nucleotides from the 3' end and linked to 42 contiguous nucleotides of one FATB-1 5 'UTR, followed by the FATB-Ia Chloroplastic Transit Peptide ("CTP") coding region and a CP4 EPSPS gene, operatively linked to an EFMV promoter and a 3' terminus sequence from the RubiscoE9 pea flanked by Agrobacterium T-DNA edge elements, ie Right Edge DNA (RB) and Left Edge DNA (LB). In the same vector, in the second T-DNA segment, flanked by another RB and LB, there is a 3 'H6 termination sequence operably linked to a reduced soybean FAD2-1A intron1 (SEQ ID NO: 1) in 100 contiguous nucleotides from the 3 'end and linked to 42 contiguous nucleotides of a FATB-1a 5'UTR, followed by the FATB-1a transitochloroplastic peptide ("CTP") coding region. The resulting gene expression construct is used for transformation employing the methods described in this disclosure.

When the two T-DNA segments of the above construct are inserted into a single Iocus of the chromosome of a host organism, in orientation from RB to RB1, the assembled transcription unit has a 7Sa 'soybean operably linked in sense and antisense orientation. tisense, to FAD2-1A and FATB-Ia intron 1 DNA fragments. When transcribed, operably linked sense and antisense RNA sequences are capable of forming double-stranded RNA, effective for FAD2-1A and FATB suppression.

PMON97595 is a construct used for inventive assembly and has two T-DNA segments, each flanked by elements on the Agrobacterium T-DNA, ie Right Edge DNA (RB) and Left Edge DNA (LB). The first T-DNA segment contains a soybean 7Soc 'engine operably linked to a displaced FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 320 contiguous nucleotides from the 3' end and linked to 42 contiguous nucleotides of a 5 'RTF deFATB-1a, followed by the FATB-Ia Chloroplastic Transit Peptide ("CTP") coding region and a CP4 EPSPS gene, operably linked to an EFMV promoter and a 3' terminus sequence from the RubiscoE9 pea , all flanked by Agrobacterium T-DNA edge elements, ie Right Edge DNA (RB) and Left Edge DNA (LB). In the second segment of the T-DNA, flanked by another RB and LB, there is a 3 'H6 termination sequence operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 320 contiguous nucleotides from the 3 'end and linked to 42 contiguous nucleotides from a FATB-1 5' RTU, followed by the FATB-1 CTP coding region. The resulting gene expression construct is used for transformation using the methods described in this exposition.

When the two T-DNA segments of the above construct are inserted into a single Iocus of the chromosome of a host organism in orientation from RB to RB, the assembled transcription unit has a 7Sa 'soybean operably linked in sense and angled orientation. -tisense, to FAD2-1A intron 1 DNA fragments and so-ja FATB-1a fragments. When transcribed, operably linked sense and antisense RNA sequences are capable of forming double-stranded RNA, effective for FAD2-1A and FATB suppression.

PMON97581 is a construct used for inventive assembly and has two T-DNA1 segments each flanked by elements abutting Agrobacterium T-DNA, ie Right Edge DNA (RB) and Left Edge DNA (LB). The first T-DNA segment contains a soybean 7Sa 'engine operably linked to a displaced FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 320 contiguous nucleotides from the 3' end and linked to the coding region of the FATB-Ia Chloro-Plastic Transit Peptide (mCTPd) and a CP4 EPSPS gene, operably linked to an EFMV promoter and a 3 'pea termination sequenceRubisco E9, all flanked by Agro T-DNA border elements -bacterium, ie right edge DNA (RB) and left edge DNA (LB). In the same construct, in the second segment of T-DNA1 flanked by another RB and LB1 there is a 3 'H6 termination sequence operatively linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 320 nucleotides. contiguous from the 3 'end and linked to the CTP coding region to FATB-1 a. The resulting gene expression construct is used for transformation employing the methods described in this disclosure.

When the two T-DNA segments of the above construct are inserted into a single Iocus of the chromosome of a host organism in orientation from RB to RB, the assembled transcription unit has a 7Soc 'soybean operably linked in sense and angled orientation. -tisense, to FAD2-1A and FATB-Ia intron 1 DNA fragments from so-ja. When transcribed, operably linked sense and antisense RNA sequences are capable of forming double-stranded RNA, effective for FAD2-1A and FATB suppression.

PMON97596 is a construct used for inventive assembly and has two T-DNA segments, each flanked by elements on the Agrobacterium T-DNA, ie Right Edge DNA (RB) and Left Edge DNA (LB). The first T-DNA segment contains a soybean 7Soc 'engine operably linked to a displaced FAD2-1A intron 1 (SEQ ID NO: 1), reduced by contiguous nucleotides from the 3' end and bound to 180 bp of 5 'of the FATB-1a Chloroplastic Transit Peptide ("CTP") coding region, and a CP4 EPSPS gene, operatively linked to an EFMV promoter and a Rubisco E9 3'-pea termination sequence, all flanked by T border elements -Agrobacterium DNA, ie right-edge DNA (RB) and left-edge DNA (LB). In the same construct, in the second T-DNA segment, flanked by another RB and LB1 there is a 3 'H6 termination sequence, operatively linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), fused to 320 contiguous nucleotides from the 3 'end and linked to the 180 bp of the 5' of the FATB-1a CTP coding region. The resulting gene expression construct is used for transformation employing the methods described in this exhibit.

When the two T-DNA segments of the above construct are inserted into a single Iocus of the chromosome of a host organism in orientation from RB to RB, the assembled transcription unit has a 7Sa 'soybean operably linked in sense and angled orientation. -tisense, to FAD2-1A intron 1 DNA fragments and so-ja FATB-1a fragments. When transcribed, operably linked sense and antisense RNA sequences are capable of forming double-stranded RNA, effective for FAD2-1A and FATB suppression.

PMON97597 is a construct used for inventive assembly and has two T-DNA segments, each flanked by elements on the Agrobacterium T-DNA, ie Right Edge (RB) and Left Edge (LB) DNA. The first T-DNA segment contains a soybean 7Soc 'engine operably linked to a disrupting FAD2-1A intron 1 (SEQ ID NO: 1), reduced by contiguous nucleotides from the 3' end and bound to 120 bp of the 5 'of the FATB-1a Chloroplastic Transit Peptide ("CTP") coding region, and a CP4 EPSPS gene, operatively linked to an EFMV promoter and a Rubisco E9 3'-pea termination sequence, all flanked by T border elements -Agrobacterium DNA, ie right-edge DNA (RB) and left-edge DNA (LB). In the same construct, in the second segment of T-DNA1 flanked by another RB and LB, there is a 3 'H6 termination sequence, operatively linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), fused to 320 contiguous nucleotides from the 3 'end and linked to the 120' bp of the 5 'of the FATB-1a CTP coding region. The resulting gene expression construct is used for transformation employing the methods described in this exhibit.

When the two T-DNA segments of the above construct are inserted into a single Iocus of the chromosome of a host organism in orientation from RB to RB, the assembled transcription unit has a 7Soc 'soybean operably linked in sense and angled orientation. -tisense, to FAD2-1A and FATB-Ia intron 1 DNA fragments from so-ja. When transcribed, operably linked sense and antisense RNA sequences are capable of forming double-stranded RNA, effective for FAD2-1A and FATB suppression.

PMON97598 is a construct used for inventive assembly and has two T-DNA segments, each flanked by elements on the Agrobacterium T-DNA, ie Right Edge DNA (RB) and Left Edge DNA (LB). The first T-DNA segment contains a soybean 7Soc 'engine operably linked to a displaced FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 340 contiguous nucleotides from the 3' end and linked to the coding region of the FATB-Ia Chloroplastic Transit Peptide ("CTP") and a CP4 EPSPS gene, operably linked to an EFMV promoter and a 3 'pea termination sequenceRubisco E9, all flanked by T-DNA border elements Agro-bacterium, ie right-edge DNA (RB) and left-edge DNA (LB). In the same construct, in the second T-DNA segment, flanked by another RB and LB, there is a 3 'H6 termination sequence operatively linked to a reduced soybean FAD2-1A intron 1 (SEQ ID NO: 1) in340 nucleotides contiguous from the 3 'end and linked to the FATB-1a CTP coding region. The resulting gene expression construct is used for transformation employing the methods described in this disclosure.

When the two T-DNA segments of the above construct are inserted into a single Iocus of the chromosome of a host organism in orientation from RB to RB, the assembled transcription unit has a 7Sa 'soybean operably linked in sense and angled orientation. -tisense, to FAD2-1A and FATB-Ia intron 1 DNA fragments from so-ja. When transcribed, operably linked sense and antisense RNA sequences are capable of forming double-stranded RNA, effective for FAD2-1A and FATB suppression.

Example 4 - Plant Transformation and Analysis

The constructs of Examples 2 and 3 are stably introduced into soybean (e.g., A4922 Asgrow variety or A3244Asgrow variety or A3525 Asgrow variety) by the methods described above, including the methods of McCabe et al., Bio / Technology, 6. : 923-926 (1988), or Agrobacterium-mediated transformation. Transformed soybean plants are identified by selection in glyphosate-containing medium. Analysis of fatty acid compositions of soybean strains transformed with the constructs is performed by gas chromatography. In addition, either construct may contain other sequences of interest as well as different combinations of promoters.

For some applications, modified fatty acid compositions are detected in developing seeds, while in other circumstances, such as for oil profile analysis, detection of later fatty acid modifications in the FAS pathway, or detection of minimal changes to the composition. of fatty acids, fatty acid or mature seed oil analysis is preferred. In addition, analysis of individual seed oil and / or fatty acid content may be desired, especially in detecting oil modification in differentiated R1 seed populations. Generation R0, as used in this exhibit, indicates the plant emerged from transformation / regeneration protocols described in this exposure, generation R1 indicates seeds grown in the self-fertilized R0 transgenic plant. R1 plants are developed from R1 seeds.

Fatty acid compositions are determined for both soybean strains transformed with the constructs of Example 3. One to ten seeds of each transgenic and control soybean lineage are individually ground using a tissue homogenizer (Pro Scientific) for oil extraction. Crushed soybean seed oil is extracted overnight in 1.5 ml heptane containing triheptadecaine (0.50 mg / ml). 200 μΙ aliquots of the extracted oil are paramethyl ester derivatives with the addition of 500 μΙ sodium methoxide in methanol ab-solute. The bypass reaction is allowed to progress for 20 minutes at 50 ° C. The reaction is stopped by the simultaneous addition of 500 μΙ 10% (w / v) sodium chloride and 400 μΙ heptane. The resulting fatty acid methyl esters extracted in hexane are determined by gas chromatography (GC) on a Hewlett-Packard 6890 GC model (Paio Alto, CA). AGC was equipped with a Supelcowax 250 column (30 m; 0.25 mm id; 0.25 microfilm thickness) (Supelco, Bellefonte, PA). The spray temperature is 175 ° C at injection, and the set temperature is 175 ° C to 2450 ° C to 175 ° C at 40 ° C / min. Injector and detector temperatures are 250 ° C and 270 ° C, respectively.

Example 5 - Synthesized fuel oil with improved biodiesel properties

A synthetic fuel oil fatty acid composition is prepared with the following mixtures of fatty acid methyl esters: 73.3% oleic acid, 21.4% linoleic acid, 2.2% palmitic acid, 2.1% linolenic acid and 1.0% stearic acid (all by weight). Purified fatty acid methylesters are obtained from Nu-Chek Prep, Inc., Ely-sian, MN, USA. The cetane number and delay in ignition of this composition is determined by the Research Institute with an Ignition Quality Test ("IQT") 613 (Southwest Research Institute, San Antonio, Texas, USA).

An IQT consists of an electrically heated, constant-volume combustion compartment, a fuel injection system, and a computer that controls the experiment, records the data, and provides data interpretation. The fuel injection system includes a fuel injector nozzle that forms an inlet for combustion compartment. A sensor raises a needle in the fuel injector nozzle, sensing the flow of fuel into the combustion chamber. A pressure transducer, attached to the combustion compartment, measures the cylinder pressure, the pressure within the combustion compartment. The basic concept of an IQT is the measurement of the time from the start of fuel injection into the combustion chamber until the start of combustion. The thermodynamic conditions in the combustion compartment are precisely controlled so that the ignition delay time measurement is consistent.

For a cetane number and ignition delay test, the fuel under test is filtered with a 5 micron filter. The fuel tank, injection tube and nozzle are purged with pressurized nitrogen. The fuel tank is then cleaned with a lint-free cloth. A portion of the fuel under test is squirted into the fuel tank, injection tube and nozzle. The tank is filled with the fuel under test and all air is drawn from the system. The reservoir is pressurized to 50 psig. The method basically consists of injecting a precisely measured amount of the fuel under test, under high pressure, into the combustion compartment, charged with air to the desired pressure and temperature. The measurement is to determine the time from the start of the injection to the onset of combustion, commonly referred to as the ignition delay time. This determination is based on the measured needle lift pressures and the combustion compartment. The normal ketane classification procedure requires a cutaneous temperature of 567.5 sC and atmospheric pressure of 2.1 MPa.

A known injection delay fuel is tested on the IQT combustion pump early in the day to ensure that the unit is operating within normal parameters. The synthetic under test is then executed. Known fuel is retested to verify that the system has not changed. Once the fuel tank is reconnected with the fuel injection pump, the test procedure is started on the PC controller. The computer controls the entire procedure, including atmospheric loading, fuel injection, and exhaust events. 32 combustion repetition events are undertaken.

Ignition delay is the time from the start of the injection until the start of the ignition. It is determined from the needle lift and cylinder pressure data. Raising the injection needle signals the start of the injection. Cylinder pressure drops slightly / due to cooling effect of fuel vaporization. The start of combustion is defined as the cylinder pressure recovery time - increases in combustion currents for pressure immediately before fuel injection.

The measured ignition delay times are then used for the number of ketones based on the calibration curve that is incorporated into data acquisition and reduction software. The calibration curve, consisting of cetane number as a function of time of ignition, is generated employing mixtures of the reference primary fuels and the NEG verification fuels. In the case of test fuels which are liquid under ambient conditions, the calibration curve is checked daily using at least one known ketone check fuel (Ryan, "Correlation of Physical and Chemical Ignition Delay to Cetane Numbef, SAE Paper 852103"). (1985); Ryan, "Diesel Fuel Ignition Quality as Determined in a Constant Volume Bomb Bomb, SAE Paper 870586 (1986); Ryan," Development of a Portable Fuel Quality Monitor Monitor Belvoir Fuels and Lubricants Researchability Facility Report No. 277, May ( 1992); Ryan, "Engine and Constant Volume Pump Studies of Diesel Ignition and Combustion", SAE Paper 881616 (1988); and Allard et al, "Diesel Fuel Ignition Quality as Determined in the Ignition Quality Tester (" IQT ")" , SAE Paper 961182 (1996).) As shown in Table 3, the composition of the synthesized oil displays ketone numbers and ignition delays, the use of which is suitable, for example, as a biodiesel oil.

Table 3

<table> table see original document page 122 </column> </row> <table>

The so-called "Check-High" fuel is a self-calibrating fuel. Its ketane number should be 49.3 ± 0.5. The unit is checked with calibration before and after running the synthetic fuel under test.

Density determination (ASTM D-4052), mist point (ASTM D-2500), pour point (ASTM D-97) and cold filter plugging point (IP 309 / ASTM D-6371) are determined. for synthesized oil using ASTM D protocols. ASTM D protocols are obtained from ASTM 100 Barr Harbor Drive, West Conshohocken, PA, USA. The results of these tests are presented in Table 4. As shown in Table 4, the composition of the synthesized oil displays numbers suitable for use such as, for example, biodiesel oil.

<table> table see original document page 123 </column> </row> <table>

Nitric oxide emission levels are estimated by assessing the unsaturation levels of a biofuel, by measuring fuel density and indirectly calculating the estimated emission levels, or by direct measurement. Standard protocols are also available for directly measuring nitric oxide emission levels. Synthesized oil is estimated to have lower levels of oxidonitric emissions than fatty acid methyl esters made from conventional soybean oil based on an assessment of the overall unsaturation level in synthesized oils. Oils containing higher numbers of double bonds, ie with higher unsaturation levels, tend to produce higher nitric oxide emissions. The oil has a total of 123 double bonds compared to the total of 153 double bonds of conventional soybean oil as shown in Table 5.

Table 5

<table> table see original document page 123 </column> </row> <table> As reported by the National Renewable Energy Laboratory Contract Ns ACG-8-17106-02 Final Report, The Effect OfBiodieseIComposition On Engine Emissions From A DDC Series 60 Diesel Engine, (June 2000), the nitric acid emissions from biodisel compositions are predicted by the formula y = 46,959 χ - 36,388, where y is the emission of oxide in grams / hours of effective power; and χ is the density of biodiesel.

The formula is based on a regression analysis of nitric acid emission data in a test involving 16 biodiesel fuels. The bump test of a 1991 calibration engine, production number 60, model of Detroit Diesel Corporation.

The density of synthesized oil is determined by the SouthwestResearch Institute using the ASTM D4052 method. The result presented in Table 4 is used in the above equation to predict a nitric oxide emission value of 4.89 g / bhp-h. This result is compared to that of a soybean control product. The National Renewable Energy Laboratory report provides the density and nitric oxide emissions of a soybean control biodiesel (IGT soybean methyl ester). The control biodiesel density is 0.8877 g / ml, providing a calculated emission of nitric oxide of 5.30 g / bhp-h. This calculated emission value is similar to the experimental value for nitric oxide emission of 5.32 g / bhp-h. The composition of synthesized oil exhibits better numbers compared to the control and is suitable for use, for example among others, as biodiesel oil.

Example 6 - Optimal Fatty Acid Composition for Healthy Delipid Healthy Levels

The cholesterol-lowering properties of vegetable compositions are determined to identify more favorable effect fatty acid compositions on serum lipid levels than conventional soybean oil (ie, lower LDL-cholesterol and higher HDL-cholesterol). published on the basis of 27 clinical studies (Mensink, RP eKatan, MB Arteriosclerosis and Thrombosis, 12: 911-919 (1992)) are used to compare the effects on human lipid levels of new seed compositions. oilseeds with those of normal soybean oil.

Table 6 below presents the results of the change in serum lipid levels where 30% of the dietary energy from carbohydrate is replaced by lipids. The results show that soybean oil already has favorable effects on serum lipids when replacing carbohydrates in the diet. Improvements in this composition are possible by reducing saturated fat levels and obtaining a level of linoleic acid between 10-30% of total fatty acids, preferably approximately 15-25% of total fatty acids. When the proportion of linoleic acid is less than 10% of total fatty acids, the new composition raises LDO-cholesterol compared to control soybean, even if saturated fat content is decreased to 5% of acids. total fat. When the proportion of linoleic acid is increased, the ability of the composition to raise serum HDL levels is reduced. Therefore, the preferred linoleic acid composition is determined to be approximately 15-25% of the total fatty acids. <table> table see original document page 126 </column> </row> <table> <table> table see original document page 127 </column> </row> <table> <table> table see original document page 128 </column> </row> <table> Example 7

The following fourteen steps illustrate the construction of the pMON68537 vector, created for plant transformation, to suppress the FAD2, FAD3 and FATB genes and overexpress delta-9 desaturase in soybean. In particular, the construct comprises a 7S alpha promoter, operably linked to intron and 3 'soybean RTUs in sense orientation, i.e., FAD2-1A intron # 1, FAD3-1A 3'UTR, FATB-3'UTR 1, spliceable intron staple strap-maker and a complementary series of intron and 3 'UTRs turn out in antisense orientation, ie 3' FATB-1 RTU, 3 'FAD3-1A RTU and FAD2 intron # 1 -1A and the soybean FAUl promoter, boosting delta 9 desaturase.

Step 1 - Soybean FAD3-1A intron # 5, which serves as the spliceable intron apart from the dsRNAi construct, is PCR amplified employing soybean genomic DNA as a template, with the following primers:

5 'primer = 19037 = ACTAGTATATTGAGCTCATATTCCACTGCAGTGGA-TATT

GTTTAAACATAGCTAGCATATTACGCGTATATTATACAAGCTTATATTCCCGGGATATTGTCGACATATTAGCGGTACATTTTATTGCTTATTCAC3 'primer = 19045 = ACTAGTATATTGAGCTCATATGTGTGTGTGTGTGTGTTACTAGTTACTAG

These primers add cloning sites at the 5'and 3 'ends. For the 5 'end: Spel, Saci, BstXI, Pmel, Nhel, MIul, Hindlll, Xmal, Smal, Sal. For the 3 'end: Spel, Saci, Sse8387l, XhoL The PCR product of soybean FAD3-1A intron # 5 is cloned into pCR2.1, resulting in KAWHIT03.0065. KAWHIT03.0065 is then digested with Spel and the ends are filled with Pfu polymerase, epMON68526 (empty chloramphenicol resistant vector (hereinafter CM)) is digested with Hindlll and the ends are filled with Pfu polymerase.KAWHIT03.0065 and pMON68526 They are then ligated to create opMON68541 (SAD FADQAtK intron # 5 with multiple Amp-resistant vector cloning sites).

Step 2 - The soybean FATB-I 3 'UTR is amplified with the following primers: 18662 = TTTTAATTACAATGAGAATGAGATTTACTGC (adding Bsp120l to the 5' end) and 18661 = GGGCCCGATTTGAA-ATGGTTAACG. The PCR product is then ligated into pCR2.1 to produce KAWHIT03.0036.

Step 3 - KAWHIT03.0036 is then digested with Bsp120le EcoRI and then cloned into KAWHIT03.0032 (CM-resistant empty vector with multiple cloning site) to produce KAWHIT03.0037 (3 'UTR deFATB-1 in resistant empty vector) to CM).

Step 4 - The 3 'UTR of soybean FAD3-1 is amplified with the following primers: 18639 = GGGCCCGTTTCAAACl 1 lIGG (adding Bsp120l to the 5' end) and 18549 = TGAAACTGACAATTCAA. The PCR product is then ligated into pCR2.1 to produce KAWHIT03.0034.

Step 5 - KAWHIT03.0034 is then digested with Bsp120le EcoRI and then cloned into KAWHIT03.0032 (CM-resistant empty vector with multiple cloning site) to produce KAWHIT03.0035 (3 'UTR deFATB-1 in resistant empty vector) to CM).

Step 6-0 intron # 1 of soybean FAD 2-1A is amplified by

PCR, using soybean genomic DNA as a template, with the following primers: 5 "primer = 18663 = GGGCCCGGTAAATTAAATTGTGC (from Bsp120l site added to 5 'end); and 3' primer = 18664 = CTGTGTCAA-AGTATAAACAAGTTCAG. The resulting product by PCR is cloned empCR 2.1, creating KAWHIT03.0038.

Step 7-0 PCR product of soybean FAD 2-1A intron # 1 in KAWHIT03.0038 is cloned into KAWHIT03.0032 (multiple cloning site aCM resistant vector) employing the restriction sites Bsp1201 and Eco RI. The resulting plasmid is KAWHIT03.0039 (intron # 1 deFAD 2-1A soybean in CM-resistant empty vector).

Step 8 - KAWHIT03.0039 is digested with Ascl and Hindlll, and opMON68541 (ds-RNAi FAD3-1A AMP and intron-resistant basic vector # 5) is digested with Mlul and Hindlll. Soybean FAD 2-1A intron # 1 is then directionally cloned into pMON68541 to generate KA-WHIT03.0071 (soybean FAD2-1A intron # 1 with FAD3-1A intron # 5 clears).

Step 9 - KAWHIT03.0035 (FAD3-1A 3 'UTR resistant to CM vector) is digested with Ascl and Hindlll, and KAWHIT03.0071 (FAD2-1A intron and FAD3 intron # 5 resistant AMP and intron # 5 basic vector) -1A dsR-NA1) is digested with M1I and HindIII. The 3 'UTR of soybean FAD 3-1A is then directionally cloned into KAWHIT03.0071 to generate KA-WHIT03.0072 (soybean FAD2-1A intron # 1 and sojacon intron FAD3-1A 3TRU # 5 of soybean FAD3-1A).

Step 10 - KAWHIT03.0037 (3 'UTR of ΡΛ7Β-1 in CM-resistant vector) is digested with Ascl and Hindlll, and KAWHIT03.0072 is digested with M1ul and Hindlll. The 3 'FATB-I RTU is then directionally cloned into KAWHIT03.0072 to produce KAWHIT03.0073 (FAD2-1A intron deso, 3' FAD3-1A RTU, 3 'soybean intron FATB-1 RTU # 5 ofFAD3-1A).

Step 11 - KAWHIT03.0073 is digested with BstXI and SalI, and FADZ-1α intron-containing digest, F4D3-1A 3 'UTR and F / 47B-1 3'UTR are gel purified. In a different tube, KAWHIT03.0073 is digested with Xhol and Sse8387l. The intron / 3'UTR fragment is cloned back into KAWHIT03.0073 in the opposite orientation at the other site of soybean FAD3-1A intron # 5 to create KAWHIT03.0074 (soybean FAD2-1A intron # 1 sense, 3 'UTR soybean FAD3-1A sense, 3'UTR so-ja FATB-I sense, soybean FAD3-1A spliceable intron # 5, FATB-I antisense 3 'UTR clears, 3' FAD3-1A antisense UTR soybean, SAD FAD2-1A antisense intron # 1).

Step 12 - To link the dsRNAi construct to the 7Salfa 'promoter and TML 3', KAWHIT03.0074 and pMON68527 (7Sa '/ TML3' cassette) are Sacl-digested and joined to produce pMON68563 (7S alpha'-intron # 1 promoter) FAD2-1A Sense, 3 'UTR Soybean FAD3-1A Sense, 3' Soybean FATB-I UTRsense, 3 'Splicable Soybean FATB-1 Antisense UTR, 3'Bean FAD3-1A Antisense UTR, soybean FAD2-1A antisense intron # 1 ').

Step 13 - To introduce the nopMON70682 dsRNAi assembled construct, pMON68563 and pMON70682 are digested with Notl and joined to form pMON68536, comprising a 7S alpha 'promoter, operatively linked to the double stranded RNA-forming construct (FAD2-1a intron # 1sense). Soybean FAD3-1A Sense UTR Sense, Soybean FAD3-1 Sense UTR Sense, Soybean FAD3-1A Spliceable Intron # 3, Soybean FATB-1 Sense Antron, 3'FAD3- Antisense Sense UTR Soybean 1A, soybean FAD2-1A anti-sense intron # and TML3 terminator ').

Step 14-0 pMON68536 is then digested with Ascl eRsrll, and pMON68529 (which contains the selectable marker CP4, fused to the FMV promoter and the 3 'RBCS promoter, and the delta 9 desaturase boosting soybean FAD2 promoter) is digested with SanDI and Ascl. The dsRNAi nopMON68536 portion is then directionally cloned into pMON68529 to create pMON68537 (7S alpha 'promoter, operably linked to the FAD2-1A, 3' UTRsense intron # 1 sense RNA construct Soybean -1A, 3 'soybean FATB-1 Sense UTR, soya FAD3-1A spli-ceable intron # 5, soybean FATB-1 antisense STR, 3' soybean FAD3-1A UTRantisense, soybean FAD2-1A antisense intron # 1 (TML3 'terminator and soybean FAD2 promoter, boosting delta 9 desaturase).

The following fifteen steps illustrate the construction of the pMON68539 vector (Figure 22), created for plant transformation, to suppress the FAD2, FAD3, and FATB genes and overexpress delta-9 desaturase and KASIV enzyme in soybean. In particular, the construct comprises a 7S alpha promoter operably linked to intron and 3 'soybean RTUs in sense orientation, ie FAD2-1A intron # 1, 3' FAD3-1A RTU, 3 ' DeFATB-1 RTU, intron spliceable staple loop former and a complementary series of intron and 3 'antisense soybean RTUs, ie 3' FATB-1 RTU, 3 'FAD3-1A RTU and intron # 1 of FAD2-1A and the soybean FAUl promoter, boosting delta 9 desaturase and the Napina KASIV-boosting promoter.

Step 1 - Soybean FAD3-1A intron # 5, which serves as the spliceable intron apart from the dsRNAi construct, is PCR amplified using genomic DNA as a template, with the following parameters: 5 'primer = 19037 = ACTAGTATATTGAGCTCATATTCCACTGCAGTGGA-TATTG

TTTAAACATAGCTAGCATATTACGCGTATATTATACAAGCTTATATTCCCGGGATATTGTCGACATATTAGCGGTACATTTTATTGCTTATTCAC3 'primer = 19045 = ACTAGTATATTGAGCTCATATTCCTGCAGGA-TATTCATG

ATATTCACGGTAGTAATCTCCAAGAACTGGTTTTGCTGCTTGTGTCTGCAGTGAATC.

These primers add cloning sites at the 5'and 3 'ends. For the 5 'end: Spel, Saci, BstXI, Pmel, Nhel, Mlul, Hindlll, Xmal, Smal1 Sal. For the 3 'end: Spel, Saci, Sse8387l, XhoI. The PCR product of soybean FAD3-1A intron # 5 is cloned into pCR2.1, resulting in KAWHIT03.0065. KAWHIT03.0065 is then digested with Spel and the ends are filled with Pfu polymerase, epMON68526 (CM-resistant empty vector is digested with Hindlll and the ends are filled with Pfu polymerase. KAWHIT03.0065 epMON68526 are then ligated. to create pMON68541 (intron # 5 deF / AD3-1A soybean with multiple Amp resistant vector cloning sites).

Step 2 - The 3 'UTR of soybean FATB-1 is amplified with the following primers: 18662 = TTTTAATTACAATGAGAATGAGATTTACTGC (adding Bsp120l to the 5' end) and 18661 = GGGCCCGATTTGAA-ATGGTTAACG. The PCR product is then ligated into pCR2.1 to produce KAWHIT03.0036.

Step 3 - KAWHIT03.0036 is then digested with Bsp120le EcoRI and then cloned into KAWHIT03.0032 (CM-resistant empty vector with multiple cloning site) to produce KAWHIT03.0037 (3 'UTR deFATB-1 in resistant empty vector) to CM).

Step 4 - The 3 'UTR of soybean FAD3-1 is amplified with the following primers: 18639 = GGGCCCGTTTCAAACTTTTTGG (adding Bsp1201 to the 5' end) and 18549 = TGAAACTGACAATTCAA. The PCR product is then ligated into pCR2.1 to produce KAWHIT03.0034.

Step 5 - KAWHIT03.0034 is then digested with Bsp120le EcoRI and then cloned into KAWHIT03.0032 (CM-resistant empty vector with multiple cloning site) to produce KAWHIT03.0035 (3 'UTR deFATB-1 in resistant empty vector) to CM).

Step 6-0 soybean FAD 2-1A intron # 1 is amplified by PCR, employing soybean genomic DNA as a template, with the following primers: 5 'primer = 18663 = GGGCCCGGTAAATTAAATTGTGC (Added from Bsp120l site at 5' end); and 3 'primer = 18664 = CTGTGTCAA-AGTATAAACAAGTTCAG. The resulting product by PCR is cloned empCR 2.1, creating KAWHIT03.0038.

Step 7-0 PCR product of soybean FAD 2-1A intron # 1 in KAWHIT03.0038 is cloned into KAWHIT03.0032 (multiple cloning site aCM resistant vector) employing the Bsp1201 and EcoRI restriction sites. The resulting plasmid is KAWHIT03.0039 (intron # 1 deFAD 2- 1A soybean in CM resistant empty vector).

Step 8 - KAWHIT03.0039 is digested with Ascl and Hindlll, and opMON68541 (ds-RNAi FAD3-1A AMP and intron-resistant basic vector # 5) is digested with Mlul and Hindlll. Soybean FAD 2-1A intron # 1 is directionally cloned into pMON68541 (F / ID3-1A intron # 5 in resis-25 try Amp with multiple cloning sites) to generate KAWHIT03.0071 (intron # 1 of soybean FAD2-1A with soybean FAD3-1A intron # 5).

Step 9 - KAWHIT03.0035 (FAD3-1A 3 'UTR resistant to CM vector) is digested with Ascl and Hindlll, and KAWHIT03.0071 (FAD2-1A intron and FAD3 intron # 5 resistant AMP and intron # 5 basic vector) -1A dsR-NA1) is digested with M1I and HindIII. The soybean FAD 3-1A 3 'RTU is then directionally cloned into KAWHIT03.0071 to generate KA-WHIT03.0072 (soybean FAD2-1A intron # 1 and sojacon intron FAD3-1A 3TRU # 5 of soybean FAD3-1A).

Step 10 - KAWHIT03.0037 (3 'UTR-resistant FATBA 3' UTR) is digested with Ascl and Hindlll, and KAWHIT03.0072 is digested with M1ul and Hindlll. The 3 'FATB-I RTU is then directionally cloned into KAWHIT03.0072 to produce KAWHIT03.0073 (FAD2-1A intron deso, 3' FAD3-1A RTU, 3 'soybean intron FATB-1 RTU # 5 ofFAD3-1A).

Step 11 - KAWHIT03.0073 is digested with BstXI and SalI and F.ADIAA intron-containing digest, FAÜÒA 3 'UTR and 3'UTR deFATBA is gel purified. In a different tube, KAWHIT03.0073 is digested with Xhol and Sse8387l. The intron / 3'UTR fragment is cloned back into KAWHIT03.0073 in the opposite orientation at the other site of soybean FAD3-1A intron # 5 to create KAWHIT03.0074 (soybean FAD2-1A intron # 1 sense, 3 'UTR soybean FAD3-1A sense, 3'UTR so-ja FATB-1 sense, soybean FAD3-1A spliceable intron # 5, FATB-1 antisense 3 'UTR clears, 3' FAD3-1A antisense UTR soybean, SAD FAD2-1A antisense intron # 1).

Step 12 - To link the dsRNAi construct to the 7Salfa 'promoter and TML 3', KAWHIT03.0074 and pMON68527 (cassette 7Sa7TML3 ') are Sacl-digested and joined to produce pMON68563 (7AD alpha'-intron # 1 sense promoter of FAD2 -1A, 3 'soybean FAD3-1A Sense UTR, 3' soybean FATB-1 Sense UTRsense, 3 'soybean FATB-1 spliceable antisense RTU, soybean FAD3-1A antisense 3'UTR, intron # 1 soybean FAD2-1A antisense ').

Step 13 - To introduce the nopMON70682 dsRNAi assembled construct, pMON68563 and pMON70682 are digested with Notl and joined to form pMON68536, comprising a 7S alpha 'promoter, operatively linked to the double stranded RNA-forming construct (FAD2-1a intron # 1sense). Soybean FAD3-1A Sense UTR Sense, Soybean FAD3-1 Sense UTR Sense, Soybean FAD3-1A Spliceable Intron # 3, Soybean FATB-1 Sense Antron, 3'FAD3- Antisense Sense UTR Soybean 1A, soybean FAD2-1A anti-sense intron # and TML3 'terminator.) Step 14-0 pMON68536 is then digested with Ascl eRsrlI, and pMON68529 (which contains the selectable marker CP4, fused to the FMV promoter and RBCS 3 ', and soybean FAUl promoter boosting delta 9 desaturase) is digested with SanDI and Ascl. The dsRNAi nopMON68536 portion is then directionally cloned into pMON68529 to create pMON68537 (7S alpha 'promoter, operatively linked to the FAD2-1A, 3' UTRsense intron # 1 sense RNA construct -1A soybean, 3 'soybean FATB-1 Sense UTR, spli-ceable soybean FAD3-1A intron # 5, soybean FATB-1 antisense 3TR, 3' soybean FAD3-1A UTRantisense, soybean FAD2-1A antisense intron # 1 (TML3 'terminator and soybean FAD2 promoter, boosting delta 9 desaturase).

Step 15 - pMON68537 is then digested with SanDI eAscl, and pMON70683 (Napina boosting KaslV) is digested with Ascl eRsrlI. The Napina / KaslV fragment is then directionally cloned into nopMON68537 to create pMON68539 (7S alpha 'promoter, operatively linked to the double stranded RNA-forming construct (intron # 1 sense of FAD2-1A, 3' UTR sense of FAD3 -1A Soybean, 3 'FATB-1 Sense UTR Sense, Spliceable FAD3-1A Sintereable Intron # 5, 3' Soybean FATB-1 Antisense UTR, 3 'Soybean FAD3-1A Antisense UTR, # 1 soybean FAD2-1A antisense and TML3 'terminator, soybean FAD2 promoter, boosting delta 9 desaturase, and Napina promoter boosting KaslV).

Example 9

This example illustrates the transformation of plants to production of suppressed gene soybean plants.

A transformation vector, pMON68537, as prepared in Example 7, is used to introduce an intron / 3'UTR double-stranded RNA construct into soybean for suppression of the Δ12 de-turase, Δ15 desaturase, and FATB genes. The pMON68537 vector also contains the delta-9 desaturase (FAB2) and the CP4 genes. The vector is stably introduced into soybean (variety A4922 Asgrow) via the A-grobacterium tumefaciens strain ABI (Martinell, U.S. Patent No. 6,384,301). The CP4 selectable marker allows transformed soybean plants to be identified by selection in medium containing glyphosate herbicide.

Analysis of fatty acid compositions of soybean seed seeds transformed with the dsRNAi intron / 3'UTR expression constructs is performed by gas chromatography. Pooled Ri-seed and single-seed oil compositions Ri demonstrate that the mono- and polyunsaturated fatty acid compositions are altered in the seed oil of transgenic soybean lines compared to those of the unprocessed soybean (See Table 7). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester decomposed; FAD3 suppression provides plants with decreased linolenic acid ester compounds and FATB suppression provides plants with reduced saturated fatty ester compounds, for example palmitates and stearates. Selections can be made between these strains, depending on the desired relative fatty acid composition. Fatty acid composition analysis of soybean seed-line seeds transformed with the constructs is performed by gas chromatography.

Example 10

This example illustrates the transformation of plants to production of suppressed gene soybean plants.

A transformation vector, pMON68539, as prepared in Example 3, is used to introduce an intron / 3'UTR double strand RNA-forming construct into soybean, for suppression of the Δ12 de-turase, Δ15 desaturase and FATB genes. The vector pMON68539 also contains the KasIVe CP4 genes. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, U.S. Patent No. 6,384,301). The selectable marker CP4 allows transformed soybean plants to be identified by selection in glyphosate-containing herbicide.

Analysis of fatty acid compositions of soybean seed seeds transformed with the dsRNAi intron / 3'UTR expression constructs is performed by gas chromatography. Pooled Ri-seed and single-seed oil compositions Ri demonstrate that the mono- and polyunsaturated fatty acid compositions are altered in the seed oil of transgenic soybean lines compared to those of the unprocessed soybean (See Table 8). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester decomposed; FAD3 suppression provides plants with decreased linolenic acid ester compounds and FATB suppression provides plants with reduced saturated fatty ester compounds, for example palmitates and stearates. Selections can be made between these strains, depending on the desired relative fatty acid composition. Fatty acid composition analysis of soybean seed-line seeds transformed with the constructs is performed by gas chromatography.

Table 7. Fatty acid composition of seeds isolated from R1 resulting from pMON68537 Events

<table> table see original document page 138 </column> </row> <table> Construction Event 18: 1 18: 3 16: 0 18: 0 18: 2PMON68537 GM. A36306 17.41 8.88 13.35 3.85 55.63PMON68537 GM. .A36307 77.22 3.71 6.8 2.77 8.5PMON68537 GM. A36307 76.79 3.65 6.76 2.85 8.75PMON68537 GM. A36307 71.44 4.54 7.2 3.58 12.17PMON68537 GM. A36307 18.83 8.62 13.94 4.02 53.61PMON68537 GM. A36307 18.81 8.38 13.27 3.7 54.97PMON68537 GM. A36307 15.68 9.97 14.06 4.55 54.79PMON68537 GM. _A36307 15.28 10.64 14.68 4.43 53.97PMON68537 GM. A36307 14.08 9.36 14.39 4.31 56.89PMON68537 GM. _A36309 78.67 3.53 6.09 2.5 8.18PMON68537 GM. A36309 75.43 3.96 6.7 2.53 10.3PMON68537 GM. A36309 71.41 4.19 6.92 2.74 13.67PMON68537 GM. _A36309 70.51 4.14 6.85 3.16 14.33PMON68537 GM. A36309 67.51 5.01 7.45 3.15 15.69PMON68537 GM. A36309 66.99 4.92 7.15 3.9 15.79PMON68537 GM. _A36309 20.09 8.46 12.41 5 52.97PMON68537 GM. _A36309 15.15 9.73 14.61 3.85 55.79PMON68537 GM. _A36310 74.28 4.77 7.31 1.85 10.9PMON68537 GM. _A36310 74.03 5.43 8.23 1.63 9.66PMON68537 GM. _A36310 73.07 5.09 7.37 1.76 11.75PMON68537 GM. _A36310 71.83 5.04 7.78 1.86 12.54PMON68537 GM. _A36310 68.01 6.26 9.8 1.97 13.13PMON68537 GM. _A36310 67.22 6.28 8.71 3.28 13.45PMON68537 GM. _A36310 65.37 6.87 10.01 1.94 14.9PMON68537 GM. _A36310 15.76 10.09 13.4 4.28 55.52PMON68537 GM. _A36311 77.87 3.56 5.9 2.46 9.05PMON68537 GM. _A36311 75.8 3.87 5.91 2.93 10.22PMON68537 GM. _A36311 75.61 3.71 6.21 2.56 10.75PMON68537 GM. A36311 73.68 4.06 6 3.09 11.98PMON68537 GM. _A36311 72.66 4.11 6.41 3.14 12.48ΡΜ0Ν68537 GM. _A36311 70.89 4.39 6.52 3.11 13.93Construction Event 18: 1 18: 3 16: 0 18: 0 18: 2PMON68537 GM_ A36311 70.82 3.97 6.52 3.18 14.29PMON68537 GM_ A36311 16.67 9.39 13.65 4.44 54.77PMON68537 GM_ A36312 78.32 4.3 6.36 1.79 8.16PMON68537 GM_ A36312 77.55 4.46 6.51 2.13 8.23PMON68537 GM_ .A36312 77.43 4.17 6.31 1.81 9.24PMON68537 GM_ A36312 76.98 4.29 6.25 2.27 9.05PMON68537 GM_ A36312 76.43 4.55 6.82 2.16 8 , 96PMON68537 GM_ A36312 76.38 4.5 6.46 2.04 9.54PMON68537 GM. A36312 75.25 4.27 6.41 1.97 11.06PMON68537 GM_ .A36312 18.24 9.4 13.6 3.07 54.75PMON68537 GM. A36313 80.18 4.07 6.17 2.59 5.85PMON68537 GM_ .A36313 79.96 4.16 6.03 2.59 6.11PMON68537 GM_ .A36313 78.88 3.9 5.6 2.8 7.65PMON68537 GM_ .Α36313 78.76 3.92 5.44 2.91 7.82PMON68537 GM_ _A36313 77.64 4.22 5.88 2.9 8.25PMON68537 GM. _A36313 76.15 4.14 6.06 3.13 9.42PMON68537 GM. A36313 19.05 8.87 13.45 3.71 54.03PMON68537 GM. _A36313 18.47 8.46 13.13 3.63 55.41PMON68537 GM. _A36314 80.27 3.17 5.77 3.4 6.03PMON68537 GM. _A36314 79.66 3.24 5.72 3.19 6.91PMON68537 GM. _A36314 79.5 3.45 5.83 3.23 6.74PMON68537 GM. _A36314 77.42 3.52 5.76 3.57 8.42PMON68537 GM. _A36314 77.33 3.71 6.36 3.34 8.01PMON68537 GM. _A36314 76.83 3.71 6.38 3.24 8.59PMON68537 GM. _A36314 16.6 9.3 12.63 4.43 55.99PMON68537 GM. _A36314 15.26 8.59 13.71 4.54 56.84PMON68537 GM. _A36315 20.21 8.25 13.61 3.59 53.37PMON68537 GM. _A36315 17.47 9.22 13.46 3.35 55.57PMON68537 GM. _A36315 16.75 9.3 13.61 3.66 55.75PMON68537 GM. _A36315 16.54 9.18 13.54 3.88 55.9PMON68537 GM. _A36315 16.06 10.07 13.44 4.01 55.42Construction Event 18: 1 18: 3 16: 0 18: 0 18: 2PMON68537 GM. _A36315 16.05 9.58 12.82 4.25 56.29PMON68537 GM. _A36315 15.95 10.42 13.12 3.63 55.91PMON68537 GM. _A36315 15.5 10.22 13.25 3.78 56.3PMON68537 GM. _A36316 79.61 3.56 5.79 2.94 6.87PMON68537 GM. A36316 75.11 4.01 6.45 3.44 9.76PMON68537 GM. _A36316 75.07 4.25 6.74 3.09 9.64PMON68537 GM. _A36316 73.92 3.97 6.53 3.56 10.75PMON68537 GM. _A36316 17.26 9.59 13.1 4.26 54.78PMON68537 GM. A36316 17.15 9.03 12.81 4.04 55.97PMON68537 GM. _A36316 16.62 9.2 13.15 3.99 56.03PMON68537 GM. _A36316 16.6 9.44 13.19 3.95 55.84PMON68537 GM. _A36317 18.96 7.55 13.2 3.75 55.51PMON68537 GM. _A36317 16.19 9.43 13.33 3.96 56.04PMON68537 GM. _A36317 16.05 9.1 14.02 3.94 55.91PMON68537 GM. _A36317 15.33 9.4 13.91 4.22 56.11PMON68537 GM. _A36317 15.28 9.2 13.87 4.27 56.36PMON68537 GM. A36317 14.58 10.15 13.74 4.38 56.15PMON68537 GM. _A36317 13.95 9.47 13.98 4.76 56.79PMON68537 GM. _A36317 13.91 9.88 14.26 4.62 56.25PMON68537 GM. A36318 78.82 3.64 5.7 2.77 7.87PMON68537 GM. A36318 77.94 3.73 5.9 2.94 8.29PMON68537 GM. A36318 75.18 4.11 6.08 3.48 9.95PMON68537 GM. A36318 75.1 3.93 6.02 3.04 10.75PMON68537 GM_ .A36318 75.01 4.22 6.57 3.29 9.72PMON68537 GM_ _A36318 74.17 4.2 6.51 3.27 10 , 68PMON68537 GM. A36318 73.47 4.27 6.7 3.22 11.16PMON68537 GM_ .A36318 30.57 10.54 14.83 5.55 36.92PMON68537 GM. _A36319 80 3.65 5.83 2.31 7.02PMON68537 GM. A36319 79.89 3.65 5.64 2.35 7.26PMON68537 GM. _A36319 79.4 3.59 5.73 1.76 8.46PMON68537 GM. .A36319 78 3.87 6.11 2.35 8.5Construction Event 18: 1 18: 3 16: 0 18: 0 18: 2PMON68537 GM. A36319 76.08 4.22 6.5 2.35 9.74PMON68537 GM_ .A36319 75.56 3.89 6.41 1.78 11.3PMON68537 GM_ .A36319 75.26 4.27 6.47 2.37 10.5PMON68537 GM_ .A36319 75.16 4.1 6.48 2.49 10.66PMON68537 GM_ .A36320 81.27 3.19 5.84 2.4 6.09PMON68537 GM_ _A36320 80.21 3.27 5.18 2.44 7.76PMON68537 GM. .A36320 79.64 3.38 5.5 2.67 7.63PMON68537 GM_ .A36320 79.46 3.38 5.82 2.67 7.42PMON68537 GM. .A36320 78.5 3.59 6.24 2.49 8PMON68537 GM_ .A36320 73.83 3.79 6.72 2.78 11.74PMON68537 GM_ .A36320 73.1 3.95 6.9 2.39 12, 48ΡΜ0Ν68537 GM. _A36320 22.99 8.03 12.19 4.81 50.89PMON68537 GM. GM A36324 75.93 3.77 6.58 2.76 9.76PMON68537 GM. _A36324 75.1 4.05 7.01 2.83 9.8PMON68537 GM. A36324 17.83 8.79 12.78 4.11 55.49PMON68537 GM. A36324 16.46 8.88 12.84 4.48 56.29PMON68537 GM. _A36324 16.35 9.25 13.51 4.17 55.66PMON68537 GM. A36324 15.25 8.99 13.73 4.28 56.69PMON68537 GM. A36324 14.16 10.17 13.95 4.11 56.58PMON68537 GM. _A36324 13.59 9.87 14.61 4.5 56.33PMON68537 GM. _A36357 80.19 3.03 5.59 3.2 6.62PMON68537 GM. _A36357 79.78 3.19 5.51 3.24 6.89PMON68537 GM. .A36357 78.5 3.55 5.75 3.17 7.71PMON68537 GM. _A36357 77.48 3.68 5.71 3.55 8.23PMON68537 GM. _A36357 77.28 3.79 5.66 3.48 8.46PMON68537 GM. _A36357 77.1 3.51 5.43 3.65 8.99PMON68537 GM. _A36357 71.9 4.24 6.47 3.67 12.39PMON68537 GM. _A36357 17.66 9.32 13.26 4.21 54.51PMON68537 GM. _A36359 77.91 3.35 5.67 3.24 8.53PMON68537 GM. _A36359 77.85 3.29 5.42 3.29 8.87PMON68537 GM. _A36359 76.71 3.65 6.07 3.35 8.95Construction Event 18: 1 18: 3 16: 0 18: 0 18: 2PMON68537 GM_ .A36359 71.73 4.01 6.79 3.49 12.68PMON68537 GM_A36359 69.32 4.51 6.99 3.66 14.13PMON68537 GM. A36359 68.63 4.44 6.91 3.76 14.89PMON68537 GM. A36359 18.87 8.03 13.38 3.86 54.81PMON68537 GM_ .A36359 16.81 9.83 13.08 4.68 54.55PMON68537 GM. A36360 79.34 3.29 5.99 3.15 6.88PMON68537 GM_ .A36360 75.42 3.47 6.47 3.08 10.26PMON68537 GM_ _A36360 75.3 3.86 6.69 3.2 9 , 64PMON68537 GM. .A36360 74.51 3.8 6.39 3.32 10.67PMON68537 GM_ .A36360 21.49 6.95 13.07 3.92 53.46PMON68537 GM. A36360 20.05 7.4 13.09 3.83 54.57PMON68537 GM_ _A36360 16.08 9.14 13.02 4.64 56.03PMON68537 GM. A36360 15.86 9.07 13.44 4.49 56.04PMON68537 GM_ .A36361 82.13 2.83 5.67 3.13 4.81PMON68537 GM_ .A36361 80.99 3.2 5.79 3.01 5.64PMON68537 GM_AA36361 74.39 3.85 6.33 3.5 10.59PMON68537 GM. A36361 18.01 8.46 13.18 3.92 55.41PMON68537 GM. _A36361 17.99 8.11 13.05 4.09 55.7PMON68537 GM_ _A36361 17.35 8.31 13.4 4 55.88PMON68537 GM. A36361 16.81 10.2 12.9 4.32 54.87PMON68537 GM_ .A36361. 16.55 8.5 13.22 4.22 56.45PMON68537 GM_ .A36362 78.05 3.89 6.29 2.81 7.76PMON68537 GM. _A36362 76.89 3.69 6.32 3.12 8.76PMON68537 GM. _A36362 76.1 4 6.57 3.02 9.24PMON68537 GM_ .A36362 76.01 4.08 6.24 3.03 9.48PMON68537 GM. .A36362 75.86 3.76 5.68 3.56 9.95PMON68537 GM. A36362 75.79 4.07 6.43 3.15 9.34PMON68537 GM_ _A36362 74.89 4.14 6.63 3.11 10.07PMON68537 GM. _A36362 17.22 8.8 13.75 3.77 55.54PMON68537 GM. A36363 79.15 3.57 6.2 3.03 6.84PMON68537 GM. .A36363 75.69 3.83 7.07 2.73 9.53Construction Event 18: 1 18: 3 16: 0 18: 0 18: 2PMON68537 GM. _A36363 73.97 4.22 6.82 3.39 10.33PMON68537 GM. A36363 72.53 4.31 6.64 3.7 11.59PMON68537 GM. A36363 68.42 4.5 7.05 3.95 14.79PMON68537 GM. _A36363 18.39 8.7 13.61 4.1 54.28PMON68537 GM. A36363 17.54 8.87 14.08 4.07 54.56PMON68537 GM. _A36363 15.87 9.66 14.56 4.2 54.69PMON68537 GM. _A36365 78.79 3.11 5.87 1.27 9.9PMON68537 GM. _A36365 76.76 3.86 5.79 1.66 10.91PMON68537 GM. _A36365 75.41 3.49 6.06 1.83 12.15PMON68537 GM. A36365 73.57 3.65 6.11 1.5 14.19PMON68537 GM. A36365 71.55 3.56 6.62 1.24 16.08PMON68537 GM. _A36365 70.41 4 6.07 2.15 16.33PMON68537 GM. A36365 66.66 3.9 6.84 1.5 20.21PMON68537 GM. _A36365 63.96 4.22 7.08 2.27 21.52PMON68537 GM. _A36366 75.44 4.33 6.49 3.21 9.32ΡΜ0Ν68537 GM. .A36366 74.75 4.21 6.87 2.71 10.33PMON68537 GM. A36366 74.69 4.65 6.91 3.06 9.65PMON68537 GM. _A36366 73.23 4.89 7.23 2.99 10.52PMON68537 GM. _A36366 72.53 4.76 7.42 3.26 10.85PMON68537 GM. A36366 67.15 5.05 7.47 3.33 15.87PMON68537 GM. .A36366 65.81 5.6 7.9 3.37 16.09PMON68537 GM. _A36366 62.31 6.19 8.71 3.22 18.55PMON68537 GM. _A36367 80.56 3.3 6.07 2.58 6.34PMON68537 GM. GM36367 77.78 3.58 6.47 2.66 8.45PMON68537 GM. _A36367 77.78 3.46 6.25 2.84 8.51PMON68537 GM_ .A36367 77.39 3.81 6.71 2.86 8.11PMON68537 GM_ _A36367 77.32 3.74 6.17 3.12 8, 47PMON68537 GM. .A36367 75.93 3.97 6.23 3.43 9.29PMON68537 GM .A36367 72.82 4.09 6.85 3.25 11.88PMON68537 GM. .A36367 19.31 7.58 13.7 3.59 55PMON68537 GM_ .A36410 21.67 7.62 13.38 3.43 53.1Construction Event 18: 1 18: 3 16: 0 18: 0 18: 2 PMON68537 GM_A36410 20.9 8.33 12.93 3.64 53.33PMON68537 GM_A36410 20.21 8.04 13.28 3.66 53.66PMON68537 GM_A36410 20.02 8.71 12.79 3.71 53.87PMON68537 GM_A36410 18, 96 8.95 13.3 3.77 54.15PMON68537 GM_A36410 18.18 8.98 13.56 54.66PMON68537 GM_A36410 17.61 9.29 12.93 4.12 55.13PMON68537 GM_A36410 16.78 9 .8 8.78 3.92 54.83PMON68537 GM_A36411 75.06 4.33 6.49 2.93 10.08PMON68537 GM_A36411 74.32 4.46 6.76 2.96 10.38PMON68537 GM_A36411 73.41 4.76 6.91 3.11 10.78PMON68537 GM_A36411 73.24 4.87 7.28 2.89 10.67PMON68537 GM_A36411 22.38 8.17 13.47 3.6 51.51PMON68537 GM_A36411 18.26 9.07 14, 14 3.81 54.02PMON68537 GM_A36411 17.52 10.1 13.1 4.03 54.36PMON68537 GM_A36411 17.02 9.71 13.45 4.02 54.89A3244 A3244 18.29 7.79 13.69 4 . 15.08A3244 A3244 17.54 8.19 13.32 4.32 55.57A3244 A3244 17.13 8.13 13.24 4.46 56.04A3244 A3244 15.57 13.54 4.43 56.46A3244 A3244 15.17 8.95 13 79 4.3 56.78A3244 A3244 15.05 9.03 14.16 4.01 56.8A3244 A3244 13.51 10.07 12.95 5.07 57.3A3244 A3244 13.49 9.91 13.31 4.56 57.67

Table 8. Fatty acid composition of seeds isolated from R1 resulting from pMON68539 Events

Construction Event 16: 0 18: 0 18: 1 18: 2 18: 3PMON68539 GM_A36448 4.51 2.65 79.64 8.66 3.55PMON68539 GM_A36448 4.62 2.64 78.35 9.99 3.77PMON68539 GM_A36448 5.89 2.65 76.86 9.79 3.84ΡΜ0Ν68539 GM_A36448 4.92 2.62 72.61 14.61 4.01PMON68539 GM_A36448 5.48 2.86 71.07 15.63 4.16Construction Event 16: 0 18: 0 18: 1 18: 2 18: 3PMON68539 GM_A36448 13.5 4.2 16.28 56.86 8.29PMON68539 GM_A36448 14.49 4.67 14.88 56.56 9.07PMON68539 GM_A36449 5.16 2 .42 81.91 6.54 3.12PMON68539 GM_A36449 4.26 2.41 79.99 8.4 3.94PMON68539 GM_A36449 4.26 2.72 79.07 9.32 3.38PMON68539 GM_A36449 5.01 2.54 75.71 11.94 3.9PMON68539 GM_A36449 4.34 2.76 75.07 12.75 4.16PMON68539 GM_A36449 11.57 3.52 44.08 35.22 4.98PMON68539 GM_A36449 13.42 3.84 21, 35 52.38 8.17PMON68539 GM_A36449 13.25 3.99 15.3 57.04PMON68539 GM_A36450 3.28 2.6 82.21 7.26 3.95ΡΜ0Ν68539 GM_A36450 4.16 2.51 80.93 7 .72 3.76PMON68539 GM_A36450 4.3 3.42 78.78 8.43 4.22PMON68539 GM_A36450 4.84 3.16 77.07 9.6 4.22PMON68539 GM_A36450 5.11 3.1 75.21 10.98 4.49P MON68539 GM_A36450 13.74 4.26 17.31 54.32 10.11PMON68539 GM_A36450 13.82 4.34 17.16 54.46 9.47PMON68539 GM_A36450 13.56 3.63 17.06 56.7 8.6PMON68539 GM_A36705 9.73 1.83 75.04 8.23 4.27PMON68539 GM_A36705 10.85 1.74 72.89 9.29 4.53PMON68539 GM_A36705 10.05 1.78 72.68 9.83 4.48PMON68539 GM_A36705 10, 02 1.77 72.57 10.04 4.36PMON68539 GM_A36705 10.75 1.75 72.37 9.68 4.77PMON68539 GM_A36705 10.58 1.78 70.35 11.64 4.43PMON68539 GM_A36705 7.69 5 .63 16.21 60.39 8.85PMON68539 GM_A36705 8.02 5.69 15.58 60.65 8.86 A3244 13.03 4.31 21.23 52.61 7.77 A3244 12.69 3.98 20.71 55.12 6.53 A3244 15.2 5.02 19.83 49.96 8.83 A3244 12.63 4.84 19.55 53.18 8.66 A3244 13.27 4.48 18, 28 54.4 8.5Construction

Event 16: 0 18: 0 18: 1 18: 2 18: 3A3244 13.22 4.91 17.38 54.73 8.63A3244 13.44 4.81 15.46 56.49 8.91

Example 11

The pMON95829 construct, as described in Example 3D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the Fad2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide. Subsequently, the genomes of transformed plants are selected for concomitant tandem insertion of the first T-DNA and the second T-DNA, that is, the "right edge to right edge" set. Selection is performed with Sou-thern hybridization mapping methods. Transformed soybean plants containing the preferred configuration in their genome are transferred to a seed greenhouse.

For example, leaf tissue was taken from R0 plants, transformed with construct pMON95829 and Southern analysis performed. Probes and restriction enzyme digested material are chosen to identify events containing a right-edge-right-edge ("RB-RB") assembly of the two T-DNAs. Typically, approximately 25% of all transformants have properly assembled RB-RB T-DNAs.

Fatty acid compositions are analyzed from soybean strains transformed with a pMON95829 construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six R1 seeds, collected from soybean plants transformed with the pMON95829 construct, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. Positive minds are gathered and averaged for each event.

The pooled positive means show that the monounsaturated and polyunsaturated fatty acid compositions are altered in transgenic soybean seed oil compared to those of transformed soybean seed (See Table 9). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 9. Fatty acid composition of seeds isolated from R1, resulting from pMON95829 Events

<table> table see original document page 148 </column> </row> <table>

Example 12

The pMON935C> 5 construct as described in Example 3D is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the Fad2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide. Subsequently, the genomes of transformed plants are selected for concomitant tandem insertion of the first T-DNA and the second T-DNA, that is, the "right edge to right edge" set. Selection is performed with Sou-thern hybridization mapping methods. Transformed soybean plants containing the preferred configuration in their genome are transferred to a seed greenhouse.

For example, leaf tissue was taken from R0 plants, transformed with the pMON93505 construct and Southern analysis performed. Probes and restriction enzyme digested material are chosen to identify events containing a right-to-right-edge ("RB-RB") assembly of the two T-DNAs. Typically, approximately 25% of all transformants have properly assembled RB-RB T-DNAs.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON93505 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds collected from soybean plants transformed with the pMON93505 construct are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 10). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 10. Fatty acid composition of seeds isolated from R1, resulting from pMON935Q5 Events

<table> table see original document page 150 </column> </row> <table>

Example 13

The pMON93506 construct, as described in Example 3D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Subsequently, the genomes of transformed plants are selected for concomitant tandem insertion of the first T-DNA and the second T-DNA, that is, the "right edge to right edge" set. Selection is performed with Sou-thern hybridization mapping methods. Transformed soybean plants containing the preferred configuration in their genome are transferred to a seed greenhouse.

For example, leaf tissue was taken from R0 plants, transformed with the pMQN93506 construct and Southern analysis performed. Probes and restriction enzyme digested material are chosen to identify events containing a right-to-right-edge ("RB-RB") assembly of the two T-DNAs. Typically, approximately 25% of all transformants have properly assembled RB-RB T-DNAs.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON93506 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six R1 seeds, collected from soybean plants transformed with construct pMON93506, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. Positive minds are gathered and averaged for each event.

The pooled positive means demonstrate that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to the transformed soybean seed (See Table 11). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 11. Fatty acid composition of seeds isolated from R1, resulting from pMQN93506 Events

<table> table see original document page 151 </column> </row> <table> <table> table see original document page 152 </column> </row> <table>

Example 14

The pMON93501 construct as described in Example 3D is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON93501 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six R1 seeds, collected from soybean plants transformed with the pMON93501 construct, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. Positive minds are gathered and averaged for each event.

The pooled positive averages demonstrate that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to the transformed soybean seed (See Table 12). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 12. Fatty acid composition of seeds isolated from R1 resulting from pMQN93501 events

<table> table see original document page 153 </column> </row> <table> <table> table see original document page 154 </column> </row> <table>

Example 15

The pMON97552 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains transformed with a pMON97552 construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds collected from soybean plants transformed with the pMON97552 construct are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 13). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 13. Fatty acid composition of seeds isolated from R1, resulting from pMON97552 events

Example 16

The pMON93758 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON93758 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds collected from soybean plants transformed with construct pMON93758 are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 14). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.Table 14. Fatty acid composition from isolated R1 seeds resulting from pMON93758 events

<table> table see original document page 156 </column> </row> <table>

Example 17

The pMON97553 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON97553 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds collected from soybean plants transformed with construct pMON97553 are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 15). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 15. Fatty acid composition of seeds isolated from R1 resulting from pMON97553 events

<table> table see original document page 157 </column> </row> <table> <table> table see original document page 158 </column> </row> <table>

Example 18

The pMON93770 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON93770 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six R1 seeds, collected from soybean plants transformed with the construction (pMC) N93770, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 16). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 16. Fatty acid composition of seeds isolated from R1 resulting from pMQN93770 events

<table> table see original document page 159 </column> </row> <table>

Example 19

The pMON93759 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, U.S. Patent No. 6,384,301).

The selectable marker CP4 allows transformed soybean plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains transformed with a pMON93759 construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds collected from soybean plants transformed with construct pMON93759 are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 17). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 17. Fatty acid composition of seeds isolated from R1, resulting from pMON93759 events

<table> table see original document page 160 </column> </row> <table> Example 20

The pMON97554 construct as described in Example 2D is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON97554 construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six R1 seeds, collected from soybean plants transformed with the pMON97554 construct, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 18). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 18. Fatty acid composition of seeds isolated from R1 resulting from pMON97554 events

<table> table see original document page 161 </column> </row> <table> <table> table see original document page 162 </column> </row> <table>

Example 21

The pMON93771 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, U.S. Patent No. 6,384,301).

The selectable marker CP4 allows transformed soybean plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains transformed with a pMON93771 construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds, collected from soybean plants transformed with the pMON93771 construct, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. Positive minds are gathered and averaged for each event.

The pooled positive means demonstrate that the monounsaturated and polyunsaturated fatty acid compositions are altered in transgenic soybean seed oil compared to transformed soybean seed (See Table 19). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.

Table 19. Fatty acid composition of seeds isolated from R1, resulting from pMON93771 events

<table> table see original document page 162 </column> </row> <table> <table> table see original document page 163 </column> </row> <table>

Example 22

The pMON97555 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON97555 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds collected from soybean plants transformed with construct pMON97555 are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 20). For example, suppression of FAD2 provides plants with increased amounts of oleic acid ester compounds.Table 20. Fatty acid composition from isolated R1 seeds resulting from pMON97555 events

<table> table see original document page 164 </column> </row> <table>

Example 23

The pMON93760 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON93760 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds, collected from soybean plants transformed with the pMON93760 construct, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. Positive minds are gathered and averaged for each event.

The pooled positive means demonstrate that the monounsaturated and polyunsaturated fatty acid compositions are altered in the seed oil of transgenic soybean seeds compared to those of the transformed soybean seed (See Table 21). For example, FAD2-1 intron with reduced length in contiguous 320 nucleotides from the 5 'end of (SEQ ID NO: 1) and capable of forming dsRNA at least partially suppresses FAD2.

Table 21. Fatty acid composition of seeds isolated from R1, resulting from pMQN93760 events

<table> table see original document page 165 </column> </row> <table>

Example 24

The pMON93772 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains transformed with a pMON93772 construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds collected from soybean plants transformed with the pMON93772 construct are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 22). For example, intron of FAD2-1 with reduced length in contiguous 360 nucleotides from the 3 'end of (SEQ ID NO: 1) and capable of forming dsRNA, at least partially suppresses FAD2 of some events.

Table 22. Fatty acid composition of seeds isolated from R1 resulting from pMON93772 events

<table> table see original document page 19 </column> </row> <table> <table> table see original document page 167 </column> </row> <table>

Example 25

The pMON97556 construct, as described in Example 2D, is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON97556 construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six Ri seeds collected from soybean plants transformed with construct pMON97556 are harvested and the fatty acid composition of each seed is determined. The plants R1. of each event are separated for transgenes and therefore produce conventional soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 23). For example, FAD2-1 intron reduced in length to 200 contiguous nucleotides from the 3 'end of (SEQ ID NO: 1) and capable of forming dsRNA, at least partially suppresses FAD2 of some events.

Table 23. Fatty acid composition of seeds isolated from R1 resulting from pMON97556 events

<table> table see original document page 168 </column> </row> <table>

Example 26

The pMON93764 construct as described in Example 2D is used to introduce a FAD2-1 deintron double stranded RNA construct into soybean for suppression of the FAD2 gene. The vector is stably introduced into soybean (variety A4922 Asgrow) via the Agrobacterium tumefaciens strain ABI (Martinell, US Patent No. 6,384,301). The selectable marker CP4 allows soybean transformed plants to be identified by selection in medium containing glyphosate herbicide.

Fatty acid compositions are analyzed from soybean strains, transformed with a pMON93764 construct, with gas chromatography as described in Example 4, to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six R1 seeds, collected from soybean plants transformed with the pMON93764 construct, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are separated for transgenes and therefore produce conventionally composed soybean seeds as well as modified versions. The positive seeds are pooled and averaged for each event. The pooled positive averages show that the monounsaturated and polyunsaturated fatty acid compositions are altered in the transgenic soybean seed oil compared to those of the transgenic soybean. transformed soybean seed (See Table 24). For example, intron of FAD2-1 reduced to 400 contiguous nucleotides from the 3 'end of (SEQ ID NO: 1) and capable of forming dsRNA, at least partially suppresses FAD2 of some events.

Table 24. Fatty acid composition of seeds isolated from R1, resulting from pMON93764 events

<table> table see original document page 169 </column> </row> <table> Example 27

TaqMan is an assay that quantifies nucleic acids by selective amplification and real-time fluorescence measurements (also called real-time PCR). This procedure is used to determine the extent of target transcript suppression in developing transgenic seeds. To determine the absolute levels of target mR-NA transcripts in a sample, a standard curve is established for each experiment by the TaqMan technique. For this purpose, different amounts of the cloned sequence of the target soybean gene, diluted in 20 ng of canola total RNA, are amplified in parallel with samples of unknown target quantities. The accuracy of the number of transcript copies determined in this manner has a 25% margin of error.

For model material, total RNA is extracted with ABI 6100Nucleic Acid Prep Station, and 20 ng is used per TaqMan sample. Samples are analyzed on an ABI700 Sequence Detection apparatus employing ABI Prism-One Step RT-PCR Maximum Mix Chemistry. TaqMan Count (Ct) values at the end of the TaqMan PCR reaction are plotted against the target synthetic sequence knowledge amount to calculate a linear regression, such as the amount of FAD2-1 target DNA in an unknown sample. can be determined from the TaqMan Ct values at the end of each TaqMan PCR reaction.

Plants were transformed with pMON68540, pMON68546or pMON80623, all of which suppress FAD2-1A (see Section 3A and Figure 7 for descriptions of constructs).

Total RNA is obtained from null and transformed plants employing ABI 6100 Nucleic Acid Prep Station. Transformed plants are third generation homozygous and have levels of oleic acid above 50%. FAD2-1A primers, FAD2-1B primers or FAD2-2Α primers are added in separate TaqMan samples for total RNA from each plant to be tested. Samples are analyzed on an ABI 700 Sequence Detection apparatus employing ABI Prism-One Step RT-PCR Maximum Mix Chemistry.

All transgenic plants substantially suppress FAD2-1A and FAD2-1B transcript levels. None of the transgenic plants even partially reduced FAD2-2A or FAD2-2B levels.

Plant comparisons of FAD2-1A transcript levels in null plants determine the natural variation between plants. FAD2-1A OmRNA from developing seeds is analyzed using PCR primers, which produce the Probe sequence in multiple plants. Seeds, the size of which is 0.2 g fresh weight, are taken from four R2 separate null plants of a different strain. R2 seed seeds of the same size class and four different null separate groups are tested. . PCR reactions are performed in triplicate and the results normalized against the 18S RNA amount in each sample. The biological variability between plants in terms of FAD2-1A transcripts is low. Three of the four samples have a TaqMan Count (Ct) normalized value of approximately 65, and one of the samples has a TaqMan Ct normalized value of approximately 50.

Example 28

A fragment of the sequence containing 200 contiguous FAD2-1 dointron 1 (SEQ ID NO: 1) nucleotides is PCR amplified to yield PCR products that include the first 200 nucleotides of SEQID NO: 1, starting at the 5 'end. daPCR products are cloned directly, in sense orientation, into a vector containing the 7Soc 'soybean promoter and tml 3' termination sequence by means of the Xho \ sites constructed at the 5 'ends of the PCR primers. . The carrier is then cut with a restriction enzyme and ligated into a carrier containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'terminating sequence of the Rubisco E9 pea. The resulting gene expression construct is used for transformation employing the methods described in this exposition.

Fatty acid compositions are analyzed from soybean strains transformed with this construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six R1 seeds, harvested from soybean plants transformed with this construct, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are transgene separated and therefore produce seeds with conventional soybean composition as well as modified versions. Positive seeds are gathered and the average is calculated for each event. The positive averages gathered demonstrate that saturated fatty acid compositions are altered in the seed oil of transgenic soybean strains compared with those of the unprocessed soybean seed.

Example 29

A fragment of the FAD2-1 contiguous 180 nucleotide sequence from FAD2-1 (SEQ ID NO: 1) is PCR amplified to yield PCR products that include the first 180 nucleotides of SEQID NO: 1, starting at the 3 'end. of daQ ID NO: 1. daPCR products are cloned directly, in sense orientation, into a vector containing the soy 7Soc 'promoter and tml 3' termination sequence by restriction sites constructed at the 5 'ends of PCR primers. The ovector is then cut with a restriction enzyme and ligated into a vector containing the CP4 EPSPS gene, regulated by the FMV promoter and a 3 'terminus of the Rubisco E9 pea. The resulting gene expression construct is used for transformation employing the methods described in this disclosure.

Fatty acid compositions are analyzed from soybean strains transformed with this construct with gas chromatography as described in Example 4 to identify methyl esters of fatty acid compounds extracted from seeds. Initially, six R1 seeds, harvested from soybean plants transformed with this construct, are harvested and the fatty acid composition of each seed is determined. The Ri plants of each event are transgene separated and therefore produce seeds with conventional soybean composition as well as modified versions. Positive seeds are gathered and the average is calculated for each event. The positive averages gathered demonstrate that saturated fatty acid compositions are altered in the seed oil of transgenic soybean strains compared with those of the unprocessed soybean seed.

Example 30

PMON97562 contains a soybean 7Sa 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 100 contiguous nucleotides from the 3' end and linked to a FAD3- 5 'UTRde. 1A, followed by a 3 'UTR of FAD3-1A, attached to a 5'UTR of FAD3-1B, followed by a 3' UTR of FAD3-1B, followed by a 5 'UTR of FAT3-1a, followed by a 3' UTR of FATB-1a, operably linked to 70 nucleotides of FAD3-1A intron 4, operatively linked to a 3'UTR of FATB-1a in antisense orientation, followed by a 5 'UTR in antisense orientation of FATB-1a, linked to a 3' 'FAD3-1B RTU emanisense, followed by a 5' FAD3-1B RTU in antisense, linked to a 3 'FAD3-1A RTU in antisense, followed by a 5' RTU of FAD3-1A emanisense, followed by an intron 1 soybean FAD2-1A (SEQ ID NO: 1), reduced to 100 contiguous nucleotides from the 3 'end and in antisense orientation, operatively linked to a 3' H6 polyadenylation segment with a CP4 EPSPS gene, operably linked to an EFMV promoter and 3 'terminus sequence of the Rubisco E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for soybean transformation using the methods described in this exhibition. Fatty acid compositions are determined from seed of transformed soybean lineages of this construction employing gas chromatography as described in Example 5. Table 25 provides representative seed compositions. The 18: 3 level is reduced by approximately 1%.

Table 25. Fatty acid composition of seeds isolated from R1 resulting from pMON97562 events

<table> table see original document page 174 </column> </row> <table>

Example 31

PMON97563 contains a soybean 7Scx 'promoter operably linked to a soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 100 contiguous nucleotides from the 3' end and linked to a 5 'FAD3- UTRde. 1A, followed by a 3 'FAD3-1A RTU, connected to a 5' RTU of FAD3-1B, followed by a 3 'RTU of FAD3-1B, attached to a 5' RTU of FAD3-1C, followed by a 3 'RTU of FAD3-1C, followed by a FATB-1a CTP coding region, followed by a FATB-2a deCTP coding region, operably linked to 70 nucleotides of deFAD3-1A intron 4, operatively linked to a FATB-2a CTP coding region in antisense orientation, followed by an antisense-oriented FATB-Ia CTP coding region, attached to a 3 'UTR in FAD3-1C antisense, followed by a 5' UTR in FAD3-1C antisense, attached to a 3 ' FAD3-1B antisense RTU, followed by a 5 'FAD3-1B antisense RTU, attached to a 3' FAD3-1A antisense RTU, followed by a 5 'UTR antisense RTD FAD3-1A sense, followed by soybean FAD2-1A intron 1 (SEQ ID NO: 1), reduced by 100 contiguous nucleotides from 3 'end and in antisense orientation, operatively linked to a 3' H6 polyadenylation segment with a CP4 gene EPSPS, operatively linked to an EFMV promoter and 3 'terminus sequence of Rubis E9 pea, all flanked by RB and LB in the same DNA molecule. The resulting gene expression construct is used for plant transformation using the methods described in this exhibition. Fatty acid compositions are determined from seed of soybean strains transformed with this construct using gas chromatography as described in Example 5. Table 26 provides representative seed compositions. The 18: 3 level is reduced by approximately 1%.

Table 26. Fatty acid composition of seeds isolated from R1 resulting from pMON97563 events

<table> table see original document page 175 </column> </row> <table>

All compositions and / or methods set forth and claimed in this application may be made and performed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that variations may be applied to the compositions and / or methods and in the steps or sequence of the method described herein without departing from them. of concept, spirit and scope of invention. More specifically, it will become apparent that certain agents that are chemically and physiologically related may be substituted by the agents described herein, while the same and the like results would be achieved. All such similar substitutions and modifications, apparent to those skilled in the art, are considered to be included within the spirit, scope and concept of the invention as defined by the appended claims.

Claims (30)

1. Soybean seed exhibiting a fatty acid composition Seed oil comprises oleic acid content of approximately 42% to approximately 85% by weight of total fatty acids, and saturated fatty acid content of less than 8% by weight of total fatty acids. The soybean seed of claim 1, wherein said further comprises a genome with a nucleic acid sequence that suppresses the expression of soybean endogenous FAD2-1 and FATB, wherein said nucleic acid sequence comprises a fragment. deFAD2-1 soybean intron, which extends from about 20 to about 420 nucleotides, and a soybean FATB gene fragment, which extends from about 40 to about 450 nucleotides; and said genome further comprises a nucleic acid sequence that enhances expression of beta-ketoacyl ACP synthase IV or delta-9 desaturase, or both. The soybean seed of claim 2, wherein said soybean FAD2-1 intron fragment and said FATB fragment are each transcribed in sense and antisense orientations, resulting in at least in part RNA from Double tape The soybean seed of claim 2, wherein said nucleic acid sequence suppressing the expression of soybean FAD2-1 and FATB is assembled as a transcriptional functional unit after insertion into a plant chromosome. . The soybean seed of claim 1, wherein said further comprises a nucleic acid sequence genome including a soybean FAD2-1 intron fragment, the length of which is approximately 20 to about 420 contiguous nucleotides. , and a fragment of the soybean FATB gene, which is approximately 40 to about 450 contiguous nucleotides in length. The soybean seed of claim 5, wherein said soybean FAD2-1 intron fragment and said FATB fragment are each transcribed in sense and antisense orientations, resulting in at least partially double-stranded RNA1. ribbon. The soybean seed of claim 5, wherein said nucleic acid sequence is assembled as a functional transcription unit after insertion into a plant chromosome. The soybean seed of claim 1, wherein said further comprises a genome with a nucleic acid sequence that suppresses the expression of endogenous soybean FAD2-1, comprising a soybean FAD2-1 intron fragment whose extension is between about 20 and about 420 nucleotides; and said genome further comprises a nucleic acid sequence which increases the expression of beta-ketoacyl ACP synthase IV or delta-9 desaturase, from both. 9. Method for reducing the level of FAD2 gene suppression relative to the level of FAD2 gene suppression, obtained by expressing a dsRNAi construct with a heterologous FAD2 sequence, consisting of a full FAD2 intron or a full FAD2 RTU, the method by (i) expressing a heterologous FAD2 sequence in a plant cell, wherein said heterologous FAD2 sequence is derived from an endogenous FAD2 gene in a plant cell and consists of a FAD2 intron fragment or a FAD2 UTR fragment, and ii) suppression of an endogenous FAD2 gene with said heterologous FAD2 sequence, wherein the level of FAD2 gene suppression is lower than the level of gene expression, obtained by expression of a heterologous FAD2 sequence, consisting of the complete extension of a FAD2 intron or the full length of a FAD2 RTU. The method of claim 9, wherein said FAD2 intron fragment has from about 40 to 320 contiguous nucleotides of a full FAD2 intron 1 and said FAD2 UTR fragment has from about 100 to about 140 contiguous nucleotides of all of them. 3 'FAD2 RTU. A method for altering the oil composition of a plantavegetal, comprising: transforming a plant cell with a heterologous FAD2 sequence derived from part of an endogenous FAD2 gene, wherein said heterologous FAD2 sequence consists of a FAD2 intron fragment or FAD2 RTU fragment, and development of said plant cell, under conditions in which transcription of said heterologous FAD2 sequence is initiated, whereby said oil composition is altered relative to a prior plant cell genetic similarity, but lacking said heterologous FAD2 sequence. A method for increasing oleic acid content and reducing saturated fatty acid content in a plant seed, comprising: i) shortening the length of a first heterologous FAD2 sequence until the level of FAD2 gene suppression of a plant transformed with the said first heterologous FAD2 sequence is at least partially reduced relative to the dogene FAD2 suppression level in a plant cell with similar genetic background, and a second heterologous FAD2 sequence, wherein said second heterologous FAD2 sequence consists of more sequence endogenous FAD2 than said first heterologous FAD2 sequence; (ii) expression of a heterologous FATB sequence capable of at least reducing FATB gene expression in a plant relative to FATB suppression in a plant cell of similar genetic background, but without said FATB sequence. Heterologous FATB; iii) developing a plant with a genome containing said first heterologous FAD2 sequence and said heterologous FATB sequence; and iv) cultivating a plant producing seed with a reduced saturated fatty acid content relative to the seed of a plant with a similar genetic background, but devoid of said first hematological FAD2 sequence and said heterologous FATB sequence. A method of modulating the fatty acid composition of a temperate oilseed culture seed comprising the isolation of a genetic element fragment of at least 40 nucleotides in length capable of suppressing expression of an endogenous gene. in the pathway of fatty acid synthesis; introducing said genetic element into a plant cell of said temperate climate oilseed crop; production of a transgenic plant, and selection of a transgenic plant seed comprising said genetic element that modulates the fatty acid composition of said seed oil. The method of claim 13, wherein said endogenous gene is two or more endogenous genes in the fatty acid synthesis pathway. The method of claim 13, wherein said elementogenetic is selected from the group consisting of intron, exon, transit peptide coding DNA sequence, 3'UTR, 5 'UTR, open reading frame or transcript of said endogenous gene in pathway of fatty acid synthesis. The method of claim 13, wherein said endogenous gene is selected from the group consisting of FAD2-1, FAD3, FATB and combinations thereof. The method of claim 13, wherein said temperate de-oleaginous climate crop is selected from the group consisting of soybean, canola, sunflower, peanut, corn and cotton. 18. A soybean cell having a fatty acid composition whose seed oil comprises oleic acid content of approximately 42% to approximately 85% by weight of the fatty acids, and saturated fatty acid content of less than 8% by weight of the total fatty acids. . 19. Recombinant nucleic acid molecule, comprising a soybean FAD2-1 intron fragment of approximately 20 to about 420 contiguous nucleotides, and a soybean FATB gene fragment of approximately 40 and approximately 450 contiguous nucleotides. 20. Recombinant nucleic acid molecule, comprising a nucleic acid sequence with a FAD2-1 intron fragment desoja, which is approximately 20 to about 420 nucleotides, a fragment of the soybean FA TB gene, which is approximately 40 to approximately 40 450 nucleotides, and a nucleic acid sequence that enhances expression of beta-ketoacyl-ACP feel IV or delta-9 desaturase or both. 21. Unmixed soybean oil with fatty acid composition comprising oleic acid content from approximately 42% to approximately 85% by weight of total fatty acids, and saturated fatty acid content of less than 8% by weight of total fatty acids. 22. Soybean food derived from a soybean seed having a fatty acid composition whose seed oil comprises oleic acid content of approximately 42% to approximately 85% by total fatty acid weight, and saturated fatty acid content of less than 8% by weight. of total fatty acids. A method for decreasing linolenic acid content of soybean, comprising: i) introducing into a soybean a heterologous nucleic acid molecule, comprising a nucleic acid sequence with at least two members of the soybean family; FAD3 gene \ ii) expression of a FAD3 umgene nucleic acid sequence capable of at least partially reducing endogenous FAD3 gene expression in a plant cell iii) development of a plant cell comprising a genome with said acid sequence nucleic acid of at least two members of said FAD3 gene family; and (eiv) cultivating said reduced linolenic acid plant cell in relation to a plant cell with a similar genetic background but lacking said at least two members of said family. of the FAD3 gene. The method of claim 23, wherein said dog family FAD3 is selected from the group consisting of FAD3-1A, FAD3-1B and FAD3-1C. The method of claim 23, wherein said DNA fragments are 5 'or 3'-RTU from a transcribed region of FAD3. 26. A recombinant DNA construct comprising DNA fragments of at least two members of the FAD3 gene family. The recombinant DNA construct of claim 26, further comprising a soybean FAD2-1 intron fragment, which is approximately 20 to about 420 contiguous nucleotides, and a soybean FATB gene fragment, which is approximately proximal in length 40 and approximately 450 contiguous nucleotides. 28. Fatty acid composition unmixed soybean oil comprising oleic acid content of from about 42% to approximately 85% by weight of the total fatty acids, and saturated fatty acid content of less than 8% by weight of the total fatty acids, linolenic acid eteor of approximately 1.5% or less by weight of total fatty acids. Soybean seed comprising the recombinant DNA construct of claim 26. Soybean feed derived from the soybean seed of claim 29.