BRPI0215958B1 - methionine production methods - Google Patents

Abstract

"Methods of modulating the production of a sulfur-containing compound by a microorganism and of producing methionine, transgenic expression cassette, vector, and transgenic host cell." Nucleic acid molecules, called mr nucleic acid molecules, which encode new corynebacterium glutamicum mr proteins are described which are involved in the biosynthesis of a fine chemical compound, for example in methionine biosynthesis. The invention also provides antisense nucleic acid molecules, vectors and transgenic expression cassettes containing mr nucleic acid molecules and host cells into which expression vectors or cassettes have been introduced. The invention further provides methods of producing methionine from microorganisms, for example c. glutamicum, which involves culturing recombinant microorganisms that overexpress or underexpress at least one mr molecule of the invention under conditions such that methionine is produced. Also disclosed are methods of producing a fine chemical compound, for example methionine, which involves culturing recombinant microorganisms having deleted or mutated selected mr genes under conditions such that the fine chemical compound, for example methionine, is produced.

Description

“METHODS FOR PRODUCTION OF ΜΕΉΟΝΙΝΑ” [0001] Methionine is currently produced as a racemic mixture of DL-methionine by a well-established chemical process. Most DL-methionine is being produced by variations of the same chemical procedure method involving toxic, hazardous, flammable, unstable, and highly odorous starting materials or intermediates. The starting materials for chemical synthesis are: acrolein, methyl mercaptan and hydrogen cyanide. Chemical synthesis involves the reaction of methyl mercaptan and acrolein producing the intermediate 3-methyl mercapto-propionaldehyde (MMP). In the other process the MMP reacts with hydrogen cyanide to form 5- (2-methylthioethyl) hydantoin, which can then be hydrolyzed using 2 equivalents of caustic agents such as NaOH along with equivalent medium of Na2CC> 3 to give sodium DL methioninate and one equivalent of Na2CC> 3 one equivalent of NH3 and one half equivalent of CO2. In the next step sodium DL-methioninate is neutralized with 1.5 equivalents of sulfuric acid and 1 equivalent of Na 2 CC 3 to give DL methionine, Na 2 SC 4 and CO2. It is obvious that such a chemical process gives a large molar excess of unused salts compared to the amount of methionine that is produced. This fact poses an economic and ecological challenge.

Fermentation processes are usually based on the cultivation of microorganisms on nutrients including carbohydrate source (eg sugars such as glucose, fructose and sucrose), nitrogen sources (eg ammonia) and sulfur sources (eg sulfate). or thiosulfate) together with other necessary media components. The process gives only the natural product L-methionine and only biomass as a byproduct. Since nontoxic, non-hazardous, non-flammable, stable, and not highly odorous starting materials are being used and no salt is produced by a fermentation process, there is an advantage of this process over the chemical synthesis of methionine. Methionine can be produced in organisms such as E. coli or Corynebacter (Kase H., Nakayama K. (1975) Agric. Biol. Chem. 39 pp 153-160; Chatteijee et al. (1999) Acta Biotechnol. 14, pp. Harma S. Gomes, (2001) J. Eng. Life Sci. 1 pp. 69-73, JP 50031092, DE 2105189).

All living cells possess complex anabolic catabolic and metabolic capabilities with many interconnected routes. In order to maintain a balance between the various parts of this extremely complex metabolic network, the cell employs a finely tuned regulatory network. By regulating enzyme synthesis and enzyme activity, both independently and simultaneously, the cell is able to control the activity of uncontrolled metabolic pathways to reflect the changing needs of the cell. Induction or repression of enzyme synthesis may occur at any level of transcription or translation, or both. Gene expression in prokaryotes is regulated by various mechanisms at the transcriptional level (for review see for example Lewin, B (1990) Genes IV, Part 3: "Controlling prokaryotic genes by transcription", Oxford University Press: Oxford, p. 213 -301, and references thereof, and Michal, G. (1999) "Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology", John Wiley & Sons). All such known regulatory processes are mediated by additional genes, which in themselves respond to external influences of varying types (eg, temperature, nutrient availability, or light). Exemplary protein factors that have been implicated in this type of regulation include transcription factors. These are proteins that bind to DNA, thereby either increasing the expression of a gene (up-regulation) or decreasing gene expression (down-regulation). These expression-modulation transcription factors may themselves be subject to regulation. Their activity may be, for example, regulated by the binding of low molecular weight compounds to the DNA binding protein, thereby stimulating or inhibiting the binding of these proteins to the appropriate DNA binding site (see, for example, Helmann, JD and Chamberlin, MJ (1988) "Structure and function of bacterial sigma factors", Ann. Rev. Biochem. 57: 839-872; Adhya, S. (1995) "The lac and gal operons today" and Boos, W. et al. ., 'The maltose system', both in: "Regulation of Gene Expression in Escherichia coli" (Lin, ECC & Lynch, AS, eds.) Chapman & Hall: New York, pp. 181-200 and 201-229; and Moran, CP (1993) "RNA polymerase and transcription factors" in: "Bacillus subtilis and other gram-positive bacteria", Sonenshein, AL et al., Eds. ASM: Washington, DC, p. 653-667).

The entire genome of Corynebacterium glutamicum ATCC 13032 is published under GeneBank Acc.-No .: AP005283. However, no indication is given for specific methionine biosynthesis regulators.

Up- or down-regulation of gene transcription and translation may be governed by cellular and extracellular levels of various factors, such as substrates, catabolites, and end products. Typically, the expression of enzyme-encoding genes required for the activity of a specific route is induced by high levels of substrate molecules for that route. Similarly, such gene expression tends to be suppressed when there are high intracellular levels of route end product (Snyder, L. and Champness, W. (1997) "The Molecular Biology of Bacteria" ASM: Washington). Gene expression may also be regulated by other internal and external factors, such as environmental conditions (eg, heat, oxidative stress, lack of water and food; see, for example, Lin, ECC and Lynch, AS, eds. (1995) "Regulation of Gene Expression in Escherichia coli", Chapman & Hall: New York). 100061 A thorough understanding of regulatory networks governing cellular metabolism in microorganisms is critical for the production of high yield chemical compounds by fermentation. Control systems for down-regulating metabolic rollers may be removed or reduced to improve synthesis of desired chemical compounds, and similarly those for down-regulating metabolic pathways to a desired product may be constitutively activated or optimized in activity ( as shown in Hirose, Y. and Okada, H. (1979) "Microbial Production of Amino Acids" in: Pcppler, HJ. and Perlman, D. (cds.) Microbial Technology 2 "ed. Vol. 1, ch. 7 Academic Press: New York).

However, for methionine biosynthesis so far no methods have been described for the effective production of methionine based on modification of a regulatory system for methionine biosynthesis. In all cases reported methods for fermentative methionine production yields appear to be too low for economical production. Therefore, an improved method is required.

Summary of the Invention The invention provides novel methods for modulating biosynthesis of fine chemical compounds preferably sulfur-containing compounds such as methionine. It has been found that the regulatory metabolic ("MR") molecules of the invention are involved in the biosynthesis of a fine chemical compound, preferably sulfur-containing compounds such as methionine.

In particular, it has been found that the MR RXA00655 molecule is a negative regulator, for example transcriptional regulator, methionine biosynthesis, cysteine biosynthesis, and / or sulfur reduction pathway. It has also been found that the MR RXN02910 molecule is a positive regulator, for example transcriptional regulator, of methionine biosynthesis. The nucleotide sequence of RXA00655 is described herein as SEQ ID NO: 1 and the polypeptide sequence of RXA00655 is described herein as SEQ ID NO: 2. The nucleotide sequence of RXN02910 is described herein as SEQ ID NO: 5 and RXA00655 polypeptide sequence is described herein as SEQ ID NO: 6. RXA00655 homologous proteins are described herein as SEQ ID NO: 19, 21 and 23. The nucleotide sequences of said homologous proteins RX02910 are described herein as SEQ ID NO: 18, 20 and 22.

Modulation of MR nucleic acid expression of the invention, for example, increased expression of RXN0291 nucleic acid molecule or increased activity of RXN02910 protein, suppression of expression of RXN00655 nucleic acid molecule or RXA00655 protein activity, or modification of the sequence of the MR nucleic acid molecules of the invention to alter the activity of the MR nucleic acid molecule, can be used to modulate, for example, increase the production of a fine chemical compound, for example. , methionine, cysteine, and / or other compounds of the methionine biosynthetic pathway, sulfur reduction pathway, and / or cysteine biosynthetic pathway of a microorganism (for example, to improve the yield or production of a fine chemical compound , for example methionine or other compounds of the methionine biosynthetic route of a Corynebacterium or Brevibacterium species). In another embodiment, increasing expression or activity of the RXN0291 protein or nucleic acid and suppressing expression or activity of the RXA00655 protein or nucleic acid, in combination, may be used to modulate, for example, increase the production. of a fine chemical compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic pathway, sulfur reduction pathway, and / or the cysteine biosynthetic pathway of a microorganism (for example, a Corynebacterium species or Brevibacterium).

The present invention provides methods of modulating the production of a sulfur-containing compound by a microorganism comprising culturing a microorganism with modulated activity or expression of at least one methionine biosynthesis regulator under conditions such that the production of a compound containing sulfur is modulated. Preferably said sulfur-containing compound is selected from the group consisting of methionine, cysteine, S-adenosyl methionine and homocysteine. Even more preferably, the production of said sulfur-containing compound (for example methionine) is increased.

The present invention provides methods of increasing the production of a sulfur-containing compound by a microorganism comprising cultivating a microorganism that overexpresses a positive methionine biosynthesis regulator, for example, RXN02910, under conditions such that the production of the compound containing sulfur is increased. Still further, the present invention provides methods of increasing the production of a sulfur-containing compound by a microorganism comprising cultivating a microorganism that under-expresses a negative methionine biosynthesis regulator, for example, RXA00655, under conditions such that the production of the compound containing sulfur is increased.

Accordingly, the present invention provides methods of producing methionine as well as other compounds of the methionine biosynthetic route. Such methods include culturing microorganisms by overexpressing the RXN02910 gene product under conditions such that methionine, or other methionine biosynthetic pathway compounds are produced. Such methods also include culturing microorganisms with inhibited expression of the RXA00655 gene product such that methionine, or other compounds of the methionine biosynthetic pathway, sulfur reduction pathway, and / or cysteine biosynthetic pathway are produced. The present invention also provides methods for producing a fine chemical compound comprising culturing microorganisms by overexpressing the RXN0291 gene product in combination with microorganisms with inhibited expression of the RXN00655 gene product.

MR proteins are capable, for example, of performing a function involved in regulating transcription, translation, or post-translation of proteins important for the normal metabolic functioning of cells. Given the bioavailability of cloning vectors for use in Corynebacterium glutamicum (such as those exemplified below) the nucleic acid molecules of the invention can be used in the genetic engineering of this organism to make it a better or more efficient producer of a fine chemical compound. for example methionine.

This improved yield, yield and / or production efficiency of a fine chemical compound, for example methionine, may be due to a direct manipulation effect of a gene of the invention, for example RXA00655 or RXN02910, or may be due to an indirect effect of such manipulation. Specifically, changes in C. glutamicum MR proteins that normally regulate yield, production and / or production efficiency of the methionine metabolic pathways may have a direct impact on the production or overall production rate of a fine chemical compound. for example, methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction route, and / or the cysteine biosynthetic route from this organism. Changes in proteins involved in the metabolic pathway of methionine may also have an indirect impact on yield, yield and / or production efficiency of a fine chemical compound, for example methionine. The regulation of metabolism is necessarily complex, and regulatory mechanisms governing different routes can intersect at multiple points such that more than one route can be quickly adjusted according to a specific cellular event. This allows modification of a regulatory protein to one route to also have an impact on the regulation of many other routes, some of which may be involved in the biosynthesis or degradation of a desired fine chemical, for example methionine. In this indirect mode, the modulation of action of an MR protein has an impact on the production of a fine chemical compound produced by a different route than one that the MR protein directly regulates.

The nucleic acid and protein molecules of the invention may be used to directly improve the yield, production, and / or production efficiency of Corynebacterium glutamicum methionine. Using recombinant genetic techniques well known in the art, one or more of the regulatory proteins of the invention may be engineered such that their function or expression is modulated. For example, mutation of an MR protein, for example, RXA00655, which is involved in repressing transcription of a gene, for example, the metY gene, encoding a polypeptide that is required for biosynthesis of an amino acid, for example, methionine, such that it is no longer able to suppress transcription may result in an increase in the production of that amino acid. Similarly, altering the activity of an MR protein resulting in increased translation or activation of post-translational modification of a C. glutamicum protein involved in the biosynthesis of a desired fine chemical, for example methionine, may in turn increase the production of that chemical compound. The opposite situation may also be beneficial: by increasing transcriptional or translational repression, or by negatively modifying post-translation of a C. glutamicum protein involved in regulating a degradation pathway for a compound, one may increase the production of this chemical compound. In each case, the yield or total production rate of the desired fine chemical compound may be increased.

It is also possible that such changes in the protein or nucleotide molecules of the invention may improve the yield, production and / or production efficiency of fine chemical compounds, for example methionine, by indirect mechanisms. The metabolism of any compound is necessarily intertwined with other biosynthesis and degradation routes within the cell, and cofactors, intermediates, or substrates required in one route are equally provided or limited by another such route. Therefore, by modulating the activity of one or more of the regulatory proteins of the invention, the production or activity efficiency of another fine chemical compound degradation or biosynthesis pathway may be impacted. Further, manipulation of one or more regulatory proteins may increase the total capacity of the cell to grow and multiply in culture, particularly in large-scale fermentative culture, where growth conditions may be suboptimal. For example, by mutating an MR protein of the invention that would normally cause a suppression of nucleotide biosynthesis in response to suboptimal extracellular nutrient supplies (thereby preventing cell division) such that it is decreased in repressive capacity. increase nucleotide biosynthesis and perhaps increase cell division. Changes in MR proteins that result in increased cell division and growth in culture may result in increased yield, yield, and / or production efficiency of one or more desired fine chemical compounds from the culture, due at least to the number increased cells producing the chemical compound in the culture.

[00018] The invention provides novel transgenic expression cassettes comprising in combination with a regulatory sequence a nucleic acid molecule encoding a metabolic pathway protein [protein (MR)] or fragment thereof, said regulatory sequence being capable of of mediating the expression of said nucleic acid molecule, preferably in a microorganism. Preferably said regulatory sequence is a homologous promoter with respect to said nucleic acid molecule. Preferably said regulatory sequence is a functional promoter sequence in Corynebacterium glutamicum.

MR proteins are capable, for example, of performing an enzymatic step involved in the regulation by transcription, translation, or post-translation of metabolic pathways in C. glutamicum. Nucleic acid molecules encoding an MR protein are referred to herein as MR nucleic acid molecules. In a preferred embodiment, the MR protein participates in the regulation by transcription, translation, or post-translation of one or more metabolic pathways.

In an especially preferred embodiment, the MR nucleic acid molecule is selected from the group consisting of: a) a nucleic acid molecule comprising a nucleotide sequence that is at least 60% identical to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a complement thereof; b) a nucleic acid molecule comprising a fragment of at least 30 nucleotides of a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a complement thereof; c) a polypeptide-encoding nucleic acid molecule comprising an amino acid sequence at least about 60% identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23; and d) a nucleic acid molecule encoding a fragment of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, wherein the fragment comprises at least 10 amino acid residues of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23.

The transgenic expression cassette may comprise the MR protein coding nucleic acid molecule (e.g., RXA00655 or RXA02910) in antisense or sense orientation with respect to said promoter sequence.

In a preferred embodiment of the invention the MR protein-encoding nucleic acid molecule (e.g., RXA00655 or RXA02910) encodes a polypeptide comprising the amino acid sequence described in EQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23. Especially preferred, said nucleic acid molecule comprises the nucleotide sequence described in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO. : 22. The nucleic acid molecule may also encode a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence described in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23.

Another aspect of the invention relates to a vector comprising at least one of the transgenic expression cassettes of the invention. Preferably the vector is an expression vector.

Still another aspect of the invention relates to a host cell transfected or transformed with at least one of the transgenic expression cassettes of this invention or at least one of the vectors of the invention or expression vectors. Preferably, the host cell belongs to the genus Corynebacterium or Brevibacterium. In one embodiment, such a host cell is used to produce an MR protein by culturing the host cell in a suitable medium. The MR protein may then be isolated from the medium or host cell.

Yet another aspect of the invention relates to a genetically altered microorganism into which an MR gene has been introduced or altered. In one embodiment, the genome of the microorganism has been altered by introducing a nucleic acid molecule of the wild type or mutated MR sequence coding invention as a transgene. In another embodiment, an endogenous MR gene within the microorganism genome has been altered, for example, subjected to functional disruption by homologous recombination with an altered MR gene. In another embodiment, an endogenous or introduced MR gene into a microorganism has been altered by one or more point mutations, deletions, or inversions, but still encodes a functional MR protein. In yet another embodiment, one or more regulatory regions (e.g., a promoter, repressor, or inducer) of an MR gene in a microorganism have been altered (e.g., by deletion, truncation, inversion, or point mutation). such that MR gene expression is modulated. In a preferred embodiment, the microorganism belongs to the genus Corynebacterium or Brevibacterium, with Corynebacterium glutamicum being particularly preferred. In a preferred embodiment, the microorganism is also used for the production of a desired compound, such as an amino acid, with methionine, being particularly preferred.

Another aspect of the invention relates to a method for producing a fine chemical compound. This method involves culturing a cell containing an expression directing vector of an MR nucleic acid molecule of the invention such that a fine chemical compound is produced. In a preferred embodiment, this method further includes the step of obtaining a cell containing such a vector, in which a cell is transfected with an expression driver vector of an MR nucleic acid. In another preferred embodiment, this method further includes the step of recovering the fine chemical compound, for example methionine, from the culture. In a particularly preferred embodiment, the cell is of the genus Corynebacterium or Brevibacterium, or is selected from those strains described in Table 1.

Another aspect of the invention relates to methods for modulating the production of a molecule of a microorganism. Such methods include contacting the cell with an agent that modulates MR protein activity or MR nucleic acid expression such that cell-associated activity is altered from the same activity in the absence of the agent. In a preferred embodiment, the cell is modulated to one or more C. glutamicum metabolic pathway regulatory systems such that the yield or rate of production of a desired fine chemical compound, e.g. methionine, is thereby improved. microorganism. The agent that modulates MR protein activity may be an agent that stimulates MR protein activity or MR nucleic acid expression. Examples of agents that stimulate MR protein activity or MR nucleic acid expression include small molecules, active MR proteins, and MR protein-encoding nucleic acids that have been introduced into the cell. Examples of agents that inhibit MR expression or activity include small molecules and antisense MR nucleic acid molecules.

Another aspect of the invention relates to methods for modulating the yields of a desired compound from a cell, involving the introduction of a wild type or mutant MR gene into a cell, either lying on a separate or integrated plasmid. within the genome of the host cell. If integrated within the genome, such integration may be random, or may occur by homologous recombination such that the native gene is replaced by the introduced copy, causing the production of desired compound from the cell to be modulated. In a preferred embodiment, said yields are increased. In another preferred embodiment, said chemical compound is a fine chemical compound. In a particularly preferred embodiment, said fine chemical compound is an amino acid. In especially preferred embodiments, said amino acid is mctionin.

BRIEF DESCRIPTION OF THE DRAWING Figure 1 shows the principle of a homologous recombination-based self-cloning technique that is used for the preparation of a Corynebacterium ghitamicum deficient strain on methionine biosynthesis negative regulator (RXA00655. Described as SEQ ID NO: 1).

Detailed Description of the Invention The present invention provides regulatory metabolic (MR) protein and nucleic acid molecules, for example, RXA00655 and RXN02910 nucleic acid protein and molecules. which are involved in the regulation of metabolism in microorganisms, for example Corynebacterium glutamicum. including regulating the metabolism of fine chemical, for example methionine biosynthesis, for example, by regulating the transcription of genes, for example the metY gene, involved in the methionine biosynthetic pathway, the sulfur reduction pathway. and / or the cysteine biosynthetic route.

Accordingly, the present invention provides methods based on the manipulation of the methionine biosynthetic route, the sulfur reduction route, and / or the cysteine biosynthetic route in a microorganism such that a fine chemical compound is produced, for example. a sulfur-containing compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction route, and / or the cysteine biosynthetic route.

The term "methionine biosynthetic route" includes a route involving methionine biosynthetic enzymes (e.g., polypeptides encoded by the biosynthetic enzyme coding genes), compounds (e.g., precursors, substrates, intermediates or products), cofactors and the like, used in the formation or synthesis of methionine. Methionine is an amino acid nutritionally required by mammals. Bacteria synthesize their own methionine from amino acids and their biosynthetic intermediates (Escherichia Coli and Salmonella: Cellular and Molecular Biology, Neidhardt, Frederick C. Curtiss, Roy Ingraham, John L. Eds, 2nd ed. 1996, ASM Press and Hwang BJ Yeom HJ Kim Y Lee Lee Journal of Bacteriology 184 (5): 1277-86, 2002). The term "cysteine biosynthetic route" includes a route involving cysteine biosynthetic enzymes (e.g., polypeptides encoded by biosynthetic enzyme coding genes), compounds (e.g., precursors, substrates, intermediates or products), cofactors and the like, used in the formation or synthesis of cysteine. The term "sulfur reduction route" includes a route involving enzymes that function to metabolize inorganic compounds such as sulfur and its derivatives. RXA00655 has been found to be a negative regulator, for example, a transcriptional regulator of fine chemical biosynthesis, for example methionine biosynthesis. Therefore, suppression or inhibition of RXA0655 gene expression or knockout of the RXA00655 gene results in increased production of a fine chemical compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction route. and / or the cysteine biosynthetic route in microorganisms, for example Corynebacterium glutamicum. Introduction of a mutation that reduces or inhibits RXA00655 gene expression or RXA00655 polypeptide activity also causes increased production of a fine chemical compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic pathway. sulfur reduction and / or cysteine biosynthetic pathway in microorganisms, for example Corynebacterium glutamicum.

It has also been found that EXN02910 is a positive regulator, for example a transcription regulator, of fine chemical biosynthesis, for example methionine biosynthesis. Consequently, overexpression of the RXN02910 gene results in increased production of methionine and other compounds of the methionine biosynthetic pathway in microorganisms, for example Corynebacterium glutamicum. Introduction of mutation that increases RXN02910 gene expression or RXN02910 polypeptide activity also causes increased production of methionine and other methionine biosynthetic pathway compounds and other methionine biosynthetic pathway compounds in microorganisms, for example, Corynebacterium glutamicum.

Further, suppression or inhibition of RXA00655 expression or knockout of the RXA00655 gene in combination with overexpression of the RXN02910 gene in a microorganism also results in increased production of a fine chemical, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction route, and / or cysteine biosynthetic route by the microorganism. In addition, culture of RXA00655 suppressed or inhibited expression microorganisms or of a knockout gene of the RXA00655 gene, along with microorganisms that overexpress the RXN02910 gene also results in increased production of fine chemical compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction route, and / or cysteine biosynthetic route by the microorganism.

Accordingly, an aspect of the present invention relates to methods of producing fine chemical compounds, for example methionine or other compounds of the methionine biosynthetic route, which includes culturing a microorganism that overexpresses RXN02910 under conditions such as these. A fine chemical compound is produced, for example methionine or other compounds of the methionine biosynthetic route. An overexpressing microorganism RXN02910 includes a microorganism that has been engineered such that RXN02910 is overexpressed.

The terms "overexpressed" or "overexpressed" include expression of a gene product (e.g., gene product RXN02910) at a higher level than expressed prior to manipulation of the microorganism or in a comparable microorganism other than has been manipulated. For example, overexpression of a specific gene, e.g., RXN02910, includes the expression that is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than gene expression by an organism that has not been manipulated to overexpress the specific gene. Intermediate ranges and identity values of the above percentages are included by the present invention. In one embodiment, the microorganism may be genetically engineered (e.g., genetically engineered) to overexpress a higher gene product level than expressed prior to manipulation of the microorganism or into a comparable microorganism that has not been manipulated. Genetic manipulation may include, but is not limited to, alteration or modification of regulatory sequences or sites associated with expression of a specific gene (for example, by the addition of strong promoters, inducible promoters or multiple promoters or the removal of regulatory sequences from such as expression is constitutive), modification of the chromosomal location of a specific gene, alteration of nucleic acid sequences adjacent to a specific gene such as a ribosome binding site, increase in copy number of a specific gene, modification of proteins (e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like) involved in transcribing a specific gene and / or translating a specific gene product, or any other conventional means of deregulating expression of a routine. specific gene in the art (including but not limited to the use of antisense nucleic acid molecules, for example to block the expression of repressor proteins).

In another aspect, the present invention relates to a method of producing a fine chemical compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction route, and / or the cysteine biosynthetic pathway, which includes culturing a microorganism that has suppressed or inhibited RXA0655 expression under conditions such that a fine chemical compound is produced, for example methionine, cysteine, and / or other biosynthetic pathway compounds. methionine, sulfur reduction route, and / or cysteine biosynthetic route. A microorganism that has suppressed RXA00655 expression includes a microorganism that has been engineered such that RXA00655 expression is suppressed or inhibited.

The terms "expression suppression", "expression inhibition", or "underexpression" include expression of a gene product (e.g., gene product RXA00655 or gene product RNA02910) at a lower level than than that expressed prior to manipulation of the microorganism or into a comparable microorganism that has not been manipulated. In one embodiment, suppressing or inhibiting gene expression includes manipulating a microorganism such that the gene is no longer expressed. For example, underexpression of a specific gene, e.g., RXA00655, includes the expression that is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, less than gene expression by a microorganism that has not been manipulated to underexpress the specific gene. Intermediate ranges and identity values of the above percentages are included by the present invention. In one embodiment, the microorganism may be genetically engineered (e.g., genetically engineered) to express a lower gene product level than that expressed prior to manipulation of the microorganism or into a comparable microorganism that has not been manipulated. Genetic manipulation may include, but is not limited to, alteration or modification of regulatory sequences or sites associated with expression of a specific gene, alteration of nucleic acid sequences adjacent to a specific gene such as a ribosome binding site, decreased copy number of a specific gene, modification of proteins (eg, regulatory proteins, suppressors, enhancers, transcription activators and the like) involved in transcribing a specific gene and / or translating a specific gene product, use of antisense nucleic acid molecules, target gene knockout, or any other conventional means of deregulating the expression of a specific gene routine in the art. A microorganism that is deficient in RXA00655 gene expression or RNA02910 gene expression includes a microorganism that has suppressed or inhibited the expression of RXA00655 or RXN02910.

In another aspect, the present invention relates to a method of producing a fine chemical compound, for example methionine, which includes cultivating a microorganism that has increased RXN02910 activity under conditions such that a compound is produced. fine chemical, for example methionine. A "microorganism that has increased RXN02910 activity" includes a microorganism that has been engineered such that the activity of RXN02910 is increased.

In yet another aspect, the present invention relates to a method of producing a fine chemical compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction route, and / or the cysteine biosynthetic route, which includes culturing a microorganism that has decreased RXA00655 activity under conditions such that a fine chemical compound is produced, for example methionine, cysteine, and / or other compounds of the biosynthetic pathway. methionine, the sulfur reduction route, and / or the cysteine biosynthetic route. A "microorganism that has decreased RXA00655 activity" includes a microorganism that has been engineered such that RXA00655 activity is suppressed or inhibited.

The term "RXN02910 activity" includes any activity that results in biosynthesis of fine chemical compounds, for example methionine biosynthesis. Activity of RXN02910 includes, but is not limited to, up-regulation of the methionine biosynthetic route resulting in methionine biosynthesis or biosynthesis of other compounds of the methionine biosynthetic route. Positive regulation of methionine biosynthetic route may be by any means, including, but not limited to, transcriptional or translational regulation as well as protein regulation, via, for example, protein binding. Increased activity includes activity at a higher level than that demonstrated prior to manipulation of the microorganism or a comparable microorganism that has not been manipulated. The term "RXA00655 activity" includes any activity that results in fine chemical biosynthesis, for example, methionine biosynthesis. An example of RXA00655 activity includes, but is not limited to, down-regulation of the methionine biosynthetic route, sulfur reduction route, and / or cysteine biosynthetic route as described in Escherichia Coli and Salmonella: Cellular and Molecular Biology, Neidhardt, Frederick C. Curtiss, Roy III Ingraham, John L. Eds, 2nd ed. 1996, ASM Press, resulting in decreased methionine biosynthesis, decreased biosynthesis of other compounds of the methionine biosynthetic route, sulfur reduction route, or cysteine biosynthetic route. Down regulation of the methionine biosynthetic route, sulfur reduction route, and / or cysteine biosynthetic route may be by any means, including, but not limited to, transcriptional and translational regulation as well as protein regulation, via for example protein binding. Decreased or suppressed activity includes activity at a level lower than that demonstrated prior to manipulation of the microorganism or a comparable microorganism that has not been manipulated.

The present invention relates to methods of increasing the production of a sulfur-containing compound by a microorganism comprising culturing a microorganism that overexpresses a positive methionine biosynthesis regulator, for example, RXN02910, under conditions such that sulfur-containing compound is increased. The present invention also relates to methods of increasing the production of a sulfur-containing compound by a microorganism comprising cultivating a microorganism that underexpresses a negative methionine biosynthesis regulator, for example, RXA00655, under conditions such that the production of the compound containing sulfur is increased.

The term "sulfur containing compound" includes any sulfur containing compound or a derivative thereof. Sulfur-containing compounds include amino acids, including, but not limited to, methionine, cysteine, S-adenosyl methionine, and homocysteine. The nucleotide sequence of RXA00655 is described herein as SEQ ID NO: 1 and the polypeptide sequence of RXA00655 is described herein as SEQ ID NO: 2. The nucleotide sequence of RXN02910 is described herein as SEQ ID NO: 5 and the sequence of RXN02910 polypeptide is described herein as SEQ ID NO: 6. RXA00655 homologous protein is described herein as SEQ ID NO: 19, 21 and 23. The nucleotide sequence of said RXN02910 homologous protein is described herein as SEQ ID NO: 18 , 20 and 22.

SEQ ID NOs: 16 and 17 represent the mutated RXN02910 nucleic acid and amino acid sequences, respectively. The RXN02910 molecule described in SEQ ID NO: 16 contains a single nucleotide change from a guanine (G) to an adenine (A) at nucleotide residue 556 in the coding region, which results in a change of an aspartic acid (D) to an asparagine (N) at amino acid residue 186 of the encoded protein, described as SEQ ID NO: 17. This polymorphism may cause modulation of regulation of fine chemical biosynthesis, for example methionine biosynthesis by RXN02910, for example, decreased methionine biosynthesis.

The molecules of the invention may be used in modulating the production of fine chemical compounds, for example methionine, from microorganisms such as C. glutamicum, either directly (e.g., where modulating the activity of a regulatory protein methionine biosynthesis has a direct impact on the yield, production, and / or the efficiency of methionine production from that organism), or may have an indirect impact which however results in an increase in yield, production and / or the efficiency of production of the desired compound (for example, where modulation of regulation of a nucleotide biosynthesis protein has an impact on the production of an organic acid or fatty acid from bacteria, perhaps due to concomitant regulatory changes in biosynthesis or degradation routes of these chemical compounds in response to altered regulation of nucleotide biosynthesis). Aspects of the invention are further exemplified below.

The term 'fine chemical compound' is recognized in the art and includes molecules produced by an organism that have applications in various industries, such as, but not limited to, pharmaceutical, agricultural and cosmetic industries. Such compounds include organic acids such as tartaric acid, itaconic acid, and diamino-pimelic acid, both proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases, nucleosides, nucleotides (as described in Kuninaka, A. (1996) "Nucleotides and related compounds ", p. 561-612, in Biotechnology vol. 6, Rehm et al., eds. VCH: Weinheim, and references therein), lipids, both saturated and unsaturated fatty acids (eg, arachidonic acid) , diols (eg propane diol, and butane diol), carbohydrates (eg hyaluronic acid and trehalose), aromatic compounds (eg aromatic amines, vanillin, and indigo), vitamins and cofactors (as described in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A27, Vitamins, pp. 443-613 (1996) VCH: Weinheim and references thereof, and Ong, AS, Niki, E. & Packer, L. (1995). ) "Nutrition, Lipids, Health, and Disease" "Proceedings of the UNESCO / Confederation of Scientific and Technological Associations in Malaysia, and the Society for Free Radical Research - Asia ", held Sept. 1-3, 1994 in Penang, Malaysia, AOCS Press, (1995)), Enzymes, Polycetides (Cane et al. (1998) Science 282: 63-68), and all other chemical compounds described in Gutcho (1983) " Chemicals by Fermentation ", Noyes Data Corporation, ISBN: 0818805086 and the references contained therein. The metabolism and uses of certain of these Fine chemical compounds are further explained below).

Elements and Methods of the Invention The present invention is based, at least in part, on the functional characterization of previously unknown function molecules, referred to herein as MR protein and nucleic acid molecules. for example, RXA00655 protein and nucleic acid molecules and RXN02910 protein and nucleic acid molecules, which regulate or modulate one or more C. glutamicum half-metabolic pathways, for example, the methionine biosynthetic pathway. RXA00655 is a negative regulator of the methionine biosynthetic route, sulfur reduction route, and cysteine biosynthetic route, while RXN02910 is a positive regulator of the methionine biosynthetic route. Accordingly, the present invention relates to methods of producing a fine chemical compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic pathway, sulfur reduction pathway, and / or biosynthetic pathway. cysteine and modulating the production of a fine chemical compound, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction route, and / or the cysteine biosynthetic route. Such methods include culturing microorganisms overexpressing the RXN02910 gene product or with increased RXN02910 activity under conditions such that a fine chemical compound is produced, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic route, sulfur reduction and / or cysteine biosynthetic pathway. Such methods also include culturing microorganisms with inhibited expression of the RXA00655 gene product or inhibited RXA00655 activity such that a fine chemical compound is produced, for example methionine, cysteine, and / or other compounds of the methionine biosynthetic pathway. sulfur reduction route, and / or the cysteine biosynthetic route. The present invention also provides methods for producing a fine chemical compound, for example methionine, comprising culturing microorganisms by overexpressing the RXN02910 gene product and simultaneously exhibiting inhibited expression of the RXA00655 gene product or inhibited RXA00655 activity. Still further, the present invention also provides methods for producing a fine chemical compound, for example methionine, comprising culturing microorganisms by overexpressing the RXN02910 gene product in combination with microorganisms with inhibited expression of the RXA00655 gene product or inhibited RXA00655 activity.

In one embodiment, the MR molecules of the invention regulate the transcription, translation or post-translation of a metabolic pathway in C. glutamicum. In a preferred embodiment, the activity of the MR molecules of the present invention to regulate one or more C. glutamicum metabolic pathways has an impact on the production of a fine chemical compound, for example methionine, by this organism. In a particularly preferred embodiment, the MR molecules of the invention are modulated in activity such that the C. glutamicum metabolic pathways that the MR proteins of the invention regulate are modulated in efficiency or production, which either directly or indirectly modulates the yield. the production, and / or production efficiency of a fine chemical compound, for example methionine, by C. glutamicum.

The terms "MR protein" or "MR polypeptide" include proteins that regulate the transcription, translation, or post-translation of a metabolic pathway in C. glutamicum. The terms "MR gene" or "MR nucleic acid sequence" include nucleic acid sequences encoding an MR protein, which consist of a coding region and also corresponding untranslated 3 'and 5' sequence regions. The terms "production" or "productivity" are recognized in the art and include the concentration of the fermentation product (e.g. the desired fine chemical compound) formed within a given time and a given fermentation volume (e.g. kg of product per hour per liter). The term "production efficiency" includes the time required for a specific level of production to be reached (for example, how long it takes for the cell to reach a specific production rate of a fine chemical compound). The terms "yield", "product / carbon yield", or "production" are recognized in the art and include the efficiency of converting the carbon source into the product (ie methionine). This is generally written as, for example, kg product per kg carbon source. By increasing the yield or compound yield, the amount of recovered molecules, or useful recovered molecules of that compound in a given amount of culture over a given amount of time is increased.

The terms "degradation" or a "degradation route" are recognized in the art and include the decomposition of a compound, preferably an organic compound, by a cell for degradation products (generally smaller or less complex molecules) in the art. which can be a multi-step and highly regulated process. The term "metabolism" is recognized in the art and includes all biochemical reactions that occur in an organism. Metabolism of a specific compound, then (e.g., metabolism of an amino acid such as glycine) comprises the complete biosynthesis, modification, and degradation pathways in the cell related to this compound. The term "regulation" is recognized in the art and includes the activity of one protein to govern or modulate the activity of another protein. The term "transcriptional regulation" is recognized in the art and includes the activity of a protein to prevent or activate the conversion of a DNA encoding a target protein to mRNA. The term, "translation regulation" is recognized in the art and includes the conversion of an mRNA encoding a target protein to a protein molecule. The term, "post-translational regulation" is recognized in the art and includes the activity of a protein to prevent or enhance the activity of a target protein by covalently modifying the target protein (e.g., by methylation, glycosylation, or phosphorylation, or by binding to the target protein).

In another embodiment, the MR molecules of the invention are capable of modulating the production of a desired molecule, such as a fine chemical compound, for example methionine, in a microorganism such as C. glutamicum. Using recombinant genetic techniques, one or more regulatory proteins of the invention may be engineered such that their function is modulated. For example, a biosynthetic enzyme may be improved in efficiency or its allosteric control region destroyed in such a way that inhibition of feedback from compound production is avoided. Similarly, a degrading enzyme may be deleted or modified by substitution, deletion, or addition such that its degrading activity is reduced to the desired compound without impairing cell viability. In each case, the yield or total production rate of one or more of these fine chemical compounds may be increased.

It is also possible that such changes in the protein and nucleotide molecules of the invention may improve the production of fine chemical compounds, for example methionine, in an indirect manner. The regulatory mechanisms of metabolic pathways in the cell are necessarily interconnected, and activation of one pathway may lead to repression or activation of another pathway in a concomitant manner. Thus, by modulating the activity of one or more of the proteins of the invention, the production or efficiency of the activity of another degrading or biosynthetic pathway of fine chemical may be affected. For example, by decreasing the ability of an MR protein to suppress transcription of a gene encoding a specific amino acid biosynthetic protein, other biosynthetic amino acid routes can be concomitantly activated because these routes are interrelated. Further, by modifying the MR proteins of the invention, the growth and division of cells from their extracellular neighborhoods can be turned off to a certain degree; by decreasing an MR protein that normally suppresses nucleotide biosynthesis when extracellular conditions are suboptimal for cell growth and division so that it is now lacking this function, growth can be allowed to occur even when extracellular conditions are unsatisfactory. This is of particular relevance in large-scale fermentative growth, where conditions within the culture are often suboptimal in terms of temperature, nutrient supply or aeration, but will still support cell growth and division if cellular regulatory systems for these factors are eliminated.

Isolated nucleic acid sequences of the invention are contained within the genome of a strain of Corynebacterium glutamicum available from the American Type Culture Collection under the designation ATCC 13032. The nucleotide and amino acid sequences of RXA00655 are shown in SEQ. . ID NOs: 1, 18, 20, 22 and 2, 19, 21, 23, respectively, the nucleotide and amino acid sequences of RXN02910 are shown in SEQ. ID NOs: 5 and 6, respectively. SEQ ID NOs: 16 and 17 represent mutated RXN02910 nucleic acid and amino acid sequences, respectively. The molecule RXN02910 shown in SEQ ID NO: 16 contains a single nucleotide change from a guanine (G) to an adenine (A) at nucleotide residue 556 in the coding region, which results in a modification of an aspartic acid (D) paras. an asparagine (N) at amino acid residue 186 of the encoded protein, described as SEQ ID NO: 17. This polymorphism may cause modulation of the regulation of methionine biosynthesis or other fine chemical compounds by RXN02910, for example, decreased methionine biosynthesis.

The present invention also relates to proteins having an amino acid sequence that is substantially homologous to an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19 , SEQ ID NO: 21, or SEQ ID NO: 23. As used herein, a protein having an amino acid sequence that is substantially homologous to a selected amino acid sequence is at least about 50% homologous to the selected amino acid sequence, for example, the entire selected amino acid sequence. A protein having an amino acid sequence that is substantially homologous to a selected amino acid sequence may also be at least about 50-60%, preferably at least about 60-70%, and more preferably at least about 70-60%. 80%, 80-90%, or 90-95%, and more preferably at least about 90%, 91%, 82%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the selected amino acid sequence.

The MR protein or a portion thereof or a biologically active fragment (o) thereof may regulate by transcription, translation or post-translation a metabolic pathway in C. glutamicum, for example, the metabolic pathway of methionine, or have one or more of the activities described herein.

Various aspects of the invention are described in more detail in the following subsections: A. Vectors, transgenic expression cassettes and host cells. The invention provides novel transgenic expression cassettes comprising in combination with a regulatory sequence a nucleic acid molecule. encoding a metabolic pathway protein [protein (MR)] or fragment thereof, wherein said regulatory sequence is able to mediate expression of said nucleic acid molecule. Preferably, said regulatory sequence is a heterologous promoter with respect to said nucleic acid molecule. Preferably the regulatory sequence is a functional promoter sequence in Corynebacterium glutamicum.

[00058] MR proteins are capable of, for example, performing an enzymatic step involved in the regulation of transcription, translation, or post-translation of metabolic pathways in C. glutamicum.

Nucleic acid molecules encoding an MR protein are referred to herein as MR nucleic acid molecules. In a preferred embodiment, the MR protein participates in regulating transcription, translation, or post-translation of one or more metabolic pathways.

In an especially preferred embodiment, the MR nucleic acid molecule is selected from the group consisting of: a) a nucleic acid molecule comprising a nucleotide sequence that is at least 60% identical to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a complement thereof; b) a nucleic acid molecule comprising a fragment of at least 30 nucleotides of a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a complement thereof; c) a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence at least about 60% identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23; and d) a nucleic acid molecule encoding a fragment of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, wherein the fragment comprises at least 10 amino acid residues of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23.

The transgenic expression cassette may comprise the MR protein-encoding nucleic acid molecule (e.g., RXA00655 or RXA02910) in antisense or sense orientation with respect to said promoter sequence.

In a preferred embodiment of the invention the MR protein-encoding nucleic acid molecule (for example, RXA00655 or RXA02910) encodes a polypeptide comprising the amino acid sequence described in EQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23. Especially preferred, said nucleic acid molecule comprises the nucleotide sequence described in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO. : 22. The nucleic acid molecule may also encode a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence described in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23.

As used herein, the term "nucleic acid molecule" is intended to include DNA molecules (eg cDNA or genomic DNA) and RNA molecules (eg mRNA) and DNA or RNA analogs generated using nucleotide analogs. This term also includes the untranslated sequence located at both the 3 'and 5' ends of the gene coding region: at least about 100 nucleotides of the sequence upstream of the 5 'end of the coding region and at least about 20 nucleotides of the sequence. downstream of the 3 'end of the gene coding region. The nucleic acid molecule may be single stranded or double stranded DNA, but preferably is double stranded DNA.

As used herein, the term "transgenic expression cassette" is intended to include all types of nucleic acid constructs obtained by molecular biology methods, wherein in said constructs either (a) MR nucleic acid or part thereof ( for example, a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a complement thereof, or part of the above), either b) the regulatory sequence (for example, the promoter sequence) combined with (a), or c) both (a) and (b) are not located within their environment genetic, natural, or are modified by molecular biology or gene techniques. Such modification may include replacement, addition, deletion, inversion or insertion of one or more nucleotide residues. "Natural genetic environment" is intended to describe the natural genetics of a specific gene. For example, a transgenic expression construct may include the combination of an MR nucleic acid in combination with its natural promoter sequence, provided that this combination is isolated from its natural genomic context and / or positioned in a different genomic context. Preferably, the promoter sequence is heterologous to said MR nucleic acid.

"Heterologist" is intended to describe the combination of an MR nucleic acid with a promoter sequence, and said promoter sequence is not naturally regulating very similar MR nucleic acid expression.

"Transgenic" with respect to a vector or host organism is intended to describe vector or host organisms comprising a transgenic expression cassette as defined above.

An "isolated" nucleic acid molecule is one that is separate from the other nucleic acid molecules that are present in the natural source of the nucleic acid.

The nucleic acid molecule of the present invention, for example, a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a portion thereof, may be isolated using standard molecular biology techniques and the sequence information provided herein. For example, a C. glutamicum MR DNA may be isolated from a C. glutamicum library using all or a portion of one of the sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 as a hybridization probe and standard hybridization techniques (for example, as described in Sambrook, J., Fritsh, EF, and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Further, a nucleic acid molecule including all or a portion of one of the sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 may be isolated by polymerase chain reaction using designed oligonucleotide primers based on this sequence (for example, a nucleic acid molecule including all or a portion of one of the sequences of SEQ ID NO: 1, SEQ ID NO: 5 , SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 may be isolated by polymerase chain reaction using designed oligonucleotide primers based on this same sequence as SEQ ID NO: 1, SEQ SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22). For example, mRNA may be isolated from normal bacterial cells (for example by the guanidinium thiocyanate extraction procedure of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and DNA may be prepared using reverse transcriptase (e.g., Moloney MLV reverse transcriptase available from Gibco / BRL, Bethesda, MD; or AMV reverse transcriptase available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers for polymerase chain reaction amplification can be designed based on one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22. A nucleic acid of the invention may be amplified using cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid thus amplified can be cloned into a suitable vector and characterized by DNA sequence analysis. Further, oligonucleotides corresponding to an MR nucleotide sequence may be prepared by standard synthesis techniques, for example using an automated DNA synthesizer.

In a preferred embodiment, a transgenic expression cassette comprises one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20 , or SEQ ID NO: 22. The sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 correspond to the Corynebacterium glutamicum MR DNAs of the invention. This DNA comprises MR protein coding sequences (i.e., the "coding region" indicated in each sequence in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22), as well as the 5 'untranslated sequences and 3' untranslated sequences, also indicated in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22. Alternatively, the nucleic acid molecule may comprise only the coding region of any of the sequences in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, or SEQ ID NO: 20, or SEQ ID NO: 22.

In another embodiment, a transgenic expression cassette of the invention comprises a nucleic acid molecule that is a complement to one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a portion thereof. A nucleic acid molecule that is complementary to one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO. : 22 is one that is sufficiently complementary to one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO. : 22 such that it can hybridize to one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, thus forming a stable duplex.

In yet another preferred embodiment, a transgenic expression cassette of the invention comprises a nucleic acid sequence that is at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57. %, 58%, 59%, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%, with greater preferably at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85% , 86%, 87%, 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99% or more homologous to a nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a portion of it. Intermediate ranges and identity values of the ranges cited above (for example, 70-90% identical or 80-95% identical) are also intended to be included by the present invention. For example, identity value ranges using a combination of any of the above values as upper and / or lower limits are intended to be included. In a further embodiment, a transgenic expression cassette of the invention comprises a nucleotide sequence which hybridizes, for example, hybridizes under stringent conditions, to one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or a portion thereof.

Further, the transgenic expression cassette of the invention may comprise only a portion of the coding region of one or more of the sequences in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, for example a fragment which may be used as a probe or primer or a fragment encoding a biologically active portion of an MR protein.

Nucleotide sequences determined from the cloning of C. glutamicum MR genes allow the generation of probes and primers designed for use in the identification and / or cloning of MR homologs into other cell types and organisms, as well as homologues. MR of other Corynebacteria or related species. The probe / primer typically comprises substantially purified oligonucleotide. The oligonucleotide typically comprises a nucleotide sequence region that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 40, 50 or 75 consecutive nucleotides of a sense strand of one of the sequences described in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, an antisense sequence of one of the sequences described in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, or their naturally occurring mutants. Primers based on a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 may be used in reactions. PCR to clone MR homologues. MR nucleotide sequence-based probes may be employed to detect transcripts or genomic sequences encoding the same or homologous proteins. In preferred embodiments, the probe may further comprise a marker group attached thereto, for example the marker group may be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor. Such probes can be used as a part of a diagnostic test kit for identifying cells that express an MR protein poorly, such as by measuring a level of an MR encoding nucleic acid in a cell sample, for example, detecting cells. MR mRNA levels or determination of whether a genomic MR gene has been mutated or deleted.

In one embodiment, the transgenic expression cassette comprises a nucleic acid molecule encoding a protein or portion thereof that includes an amino acid sequence that is sufficiently homologous to an amino acid sequence of SEQ ID NO: 2, SEQ ID SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23 such that the protein or portion thereof retains the ability to regulate by transcription, translation or post-translation a metabolic route in C. glutamic.

As used herein, the term "sufficiently homologous" refers to proteins or portions thereof having amino acid sequences that include a minimum number of amino acid residues (for example an amino acid residue having a similar side chain as one of an amino acid residue in one of the identical or identical SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 21, or SEQ ID NO: 23) equivalent to an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23 such that the protein or a portion thereof is capable of regulating by transcription, translation or post-translation a metabolic route, for example methionine biosynthesis, in C. glutamicum. Protein members of such metabolic pathways as described herein may function to regulate biosynthesis or degradation of one or more fine chemical compounds. Examples of such activities are also described herein. Thus, "the function of an MR protein" contributes to the total regulation of one or more metabolic pathways of fine chemical compound, or contributes, either directly or indirectly, to the yield, production, and / or production efficiency of a or more fine chemical compounds, for example methionine.

In another embodiment, the protein is at least about 50-60%, preferably at least about 60-70%, and more preferably at least about 70-80%, 80-90%, 90-95. %, and more preferably at least about 96%, 97%, 98%, 99% or more homologous to an entire amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23.

As described above, homologous MR proteins, preferably homologous RXA00655 or RXB02910 proteins may be derived from other microorganisms, preferably from prokaryotic microorganisms.

The term "prokaryotic microorganism" is intended to include gram-negative and gram-positive bacteria. Preferably the term includes all genera and all species of the Enterobacteriaceae or Norcardiaceae family, for example the Enterobacteriaceae family species: Escherichia, Serratia, Proteus, Enterobacter, Klebsiella, Salmonella, Shigella, Edwardsielle, Citrobacter, Morganella, Providencia and Yersinia. Even more preferred are the species Pseudomonas, Burkholderia, Nocardia, Acetobacter, Streptomyces, Gluconobacter, Corynebacterium, Brevibacterium, Bacillus, Clostridium, Cyanobacter, Staphylococcus, Aerobacter, Alcaligenes, Rhodococcus and Penicillium. Most preferred are Corynebacterium and Streptomyces species such as, for example, the Corynebacterium species exemplified in Table 1, Corynebacterium diphtheriae, Corynebacterium efficiens and Streptomyces_coelicolor.

Examples of homologous MR proteins may include: a) Corynebacterium diphtheriae protein RXA00655, preferably described by an amino acid sequence comprising the sequence of SEQ ID NO: 19. b) Corynebacterium efficiens YS-314 Number RXA00655 protein Accession Code AP005223, preferably described by the amino acid sequence comprising the sequence of SEQ ID NO: 21. c) Streptomyces_coelicolor protein RXA00655, GenBank Accession Number NC_003888, preferably described by an amino acid sequence comprising SEQ ID NO. : 23.

Preferably, RXN02910 is intended to describe polypeptides encoding a nucleic acid molecule comprising a nucleic acid molecule selected from the group consisting of: a) a nucleic acid molecule comprising a nucleotide sequence that is at least 60% identical the nucleotide sequence of SEQ ID NO: 5 or 16; b) a nucleic acid molecule comprising a fragment of at least 30 nucleotides of a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 5 or 16; c) a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence at least about 60% identical to the amino acid sequence of SEQ ID NO: 6 or 17; d) a nucleic acid molecule encoding a polypeptide fragment comprising the amino acid sequence of SEQ ID NO: 6 wherein the fragment comprises at least 10 contiguous amino acid residues of the amino acid sequence of SEQ ID NO: 6 or 17.

Preferably, RXA00655 is intended to describe polypeptides encoded by a nucleic acid molecule comprising a nucleic acid molecule selected from the group consisting of: a) a nucleic acid molecule comprising a nucleotide sequence that is at least 60% identical to that of nucleotide sequence of SEQ ID NO: 1, 18, 20 or 22; b) a nucleic acid molecule comprising a fragment of at least 30 nucleotides of a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, 18, 20 or 22; c) a polypeptide-encoding nucleic acid molecule comprising an amino acid sequence at least about 60% identical to the amino acid sequence of SEQ ID NO: 2, 19, 21 or 23; d) a nucleic acid molecule encoding a polypeptide fragment comprising an amino acid sequence of SEQ ID NO: 2, 19, 21 or 23 wherein the fragment comprises at least 10 contiguous amino acid residues of SEQ ID NO: 2, 19 , 21 or 23.

Portions of proteins encoded by the MR nucleic acid molecules of the invention are preferably biologically active portions of one of the MR molecules. As used herein, the term "biologically active portion of an MR protein" is intended to include a portion, for example, a domain / motif, of an MR protein that regulates by transcription, translation or post-translation a metabolic pathway in C. glutamicum, or has an activity as described herein. To determine whether an MR protein or biologically active portion thereof can regulate by transcription, translation or post-translation a metabolic pathway in C. glutamicum, an enzyme activity assay can be performed. Such assay methods are well known to those skilled in the art as detailed in Example 8 of the Exemplification.

Additional nucleic acid fragments encoding biologically active portions of an MR protein may be prepared by isolating a portion of one of the sequences in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23 expressing the encoded portion of the MR protein or MR peptide (e.g. recombinant expression in vitro) and evaluation of the activity of the coded portion of the MR protein or MR peptide.

The invention further includes nucleic acid molecules that differ from one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 (and portions thereof) due to the degeneration of the genetic code and therefore encode the same MR protein as that encoded by the sequences. of nucleotides shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22. In another embodiment, an isolated nucleic acid molecule of the invention has a protein-encoding nucleotide sequence having an amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23. In still another embodiment, the nucleic acid molecule of the invention encodes a C. glutamicum full length protein that is substantially homologous to an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23 (encoded by an open reading array shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18 , SEQ ID NO: 20, or SEQ ID NO: 22).

In one embodiment, the invention includes nucleotide and amino acid sequences having a percent identity to a nucleotide or amino acid sequence that is greater than that of a prior art sequence (e.g., the GenBank sequence (or protein encoded by such a sequence.) One ordinarily skilled in the art will be able to calculate the lower limit of percent identity for any given sequence of the invention by examining the percent identity results calculated by GAP for each of the top three hits for a given sequence. given sequence, and by subtracting the highest percent GAP-calculated percent identity.A person ordinarily skilled in the art will also recognize that nucleic acid and amino acid sequences having percent identities greater than the lower limit thus calculated (e.g. at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59 %, or 60%, preferably at least about 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%, more preferably at least about 71%. %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87% 88%, 89%, or 90%, or 91%, 92%, 93%, 94%, and even more preferably at least about 95%, 96%, 97%, 98%, 99% or more identical) are also included by the invention.

In addition to the C. glutamicum MR nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO. : 22, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 will be recognized by those ordinarily skilled in the art that DNA sequence polymorphisms that cause changes in the amino acid sequence of MR proteins may exist within a population (for example, the population of C. glutamicum). Such genetic polymorphism in the MR gene may exist among individuals within a population due to natural variation. As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding an MR protein, preferably a C. glutamicum MR protein. Such natural variations may typically result in 1-5% variance in the MR gene nucleotide sequence. Any and all such variations of nucleotides and amino acid polymorphisms resulting in MR which are the result of natural variation and which do not alter the functional activity of MR proteins are intended to be within the scope of the invention.

Nucleic acid molecules corresponding to natural variants and non-C homologues. C. glutamicum MR DNA glutamicum of the invention can be isolated based on its homology to the C. glutamicum MR nucleic acid described herein using the C. glutamicum DNA, or a portion thereof, as a hybridization probe according to with standard hybridization techniques under stringent hybridization conditions. Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention is at least 15 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22. In other embodiments, the nucleic acid is at least 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180 , 190, 200, 210, 220, 225 or more nucleotides. As used herein, the term "hybridize under stringent conditions" is intended to describe conditions for hybridization and washing under which at least 60% homologous nucleotide sequences typically remain hybridized to each other. Preferably, the conditions are such that the sequences at least about 65%, more preferably at least about 70%, and even more preferably at least about 75% or more homologues to each other typically remain hybridized to each other. Such stringent conditions are known to those of ordinary skill in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.Ιό.3.6. A preferred, non-limiting example of stringent hybridization conditions is 6X sodium chloride / sodium citrate (SSC) hybridization at about 45 ° C, followed by one or more washes in 0.2 x SSC, 0.1% SDS. at 50-65 ° C. Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to a sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, or SEQ ID NO: 20, or SEQ ID NO: 22, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 corresponds to a naturally occurring nucleic acid molecule. As used herein, a "naturally occurring nucleic acid molecule" refers to an RNA or DNA molecule having a naturally occurring nucleotide sequence (e.g., encoding a natural product). In one embodiment, the nucleic acid encodes a natural C. glutamicum MR protein.

In addition to the naturally occurring variants of the MR sequence that may exist in the population, one ordinarily skilled in the art will additionally recognize that changes may be introduced by mutation in a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 thereby causing changes in the amino acid sequence of the coded MR protein without altering the functional capacity of the MR protein. For example, nucleotide substitutions causing amino acid substitutions at "nonessential" amino acid residues may be made in a sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22. A "nonessential" amino acid residue is a residue that can be changed from the wild-type sequence of one of the MR proteins (SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19 , SEQ ID NO: 21, or SEQ ID NO: 23, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23) without changing the activity of said MR protein, while an "essential" amino acid residue "is required for MR protein activity. Other amino acid residues, however, (for example, those which are not conserved or are only semi-conserved in the domain having MR activity) may not be essential for activity and thus are probably less susceptible to change without altering MR activity.

Accordingly, another aspect of the invention relates to MR protein-encoding nucleic acid molecules that contain changes in amino acid residues that are not essential for MR activity. Such MR proteins differ in amino acid sequence from a sequence contained in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23 still retain at least one of the MR activities described herein. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 50% homologous to an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23 and is capable of transcriptional, translational, or post-translational regulation of a metabolic pathway in C. glutamicum, or has one or more activities described herein. Preferably, the protein encoded by the nucleic acid molecule is at least about 50-60% homologous to one of the sequences in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, more preferably at least about 60-70% homologous to one of the sequences in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO : 19, SEQ ID NO: 21, or even more preferably SEQ ID NO: 23 is at least about 70-80%, 80-90% homologous to one of the sequences in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, and more preferably is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to one of the sequences in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , or SEQ ID NO: 23.

To determine the percent homology of two amino acid sequences (for example one of the sequences of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23 and a mutant thereof) or two nucleic acids, the sequences are aligned for optimal comparison purposes (for example, gaps may be introduced into the sequence of a protein or nucleic acid for optimal alignment with the another protein or other nucleic acid). Amino acid residues or nucleotides at amino acid positions or nucleotide positions are then compared. When a position in a sequence (for example, one of the sequences of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23 ) is occupied by the same amino acid or nucleotide residue as the corresponding position in the other sequence (for example, a mutant form of the selected sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23), so the molecules are homologous at that position (that is, as used herein amino acid or nucleic acid "homology" is equivalent to amino acid or acid "identity" nucleic acid). Percent homology between the two sequences is a function of the number of identical positions shared by the sequences (ie,% homology = number of identical positions / total number of positions x 100).

An isolated nucleic acid molecule encoding an MR protein homologous to a protein sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , or SEQ ID NO: 23 may be formed by introducing one or more nucleotide substitutions, additions or deletions into a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO. : 18, SEQ ID NO: 20, or SEQ ID NO: 22 such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into one of the sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22 by standard techniques such as as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made on one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g. tyrosine, phenyl alanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in an MR protein is preferably replaced by another amino acid residue of the same side chain family. Alternatively, in another embodiment, mutations may be introduced randomly throughout or part of the MR coding sequence, such as by saturation mutagenesis, and the resulting mutants may be screened for an MR activity described herein to identify mutants that retain the activity. MR. Following mutagenesis of one of the following sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22, the encoded protein may be recombinantly expressed and protein activity can be determined using, for example, assays described herein (see Example 6 of the Exemplification).

The invention also provides MR fusion or chimeric proteins. As used herein, an "MR chimeric protein" or "fusion protein" comprises an MR polypeptide operably linked to a non-MR polypeptide. An "MR polypeptide" refers to a polypeptide having an amino acid sequence corresponding to an MR protein, while a "non-MR polypeptide" refers to a polypeptide having an amino acid sequence corresponding to a protein that is not substantially homologous to an MR protein, for example, a protein that is different from the MR protein and which is derived from the same or a different organism. Within fusion protein, the term "operably linked" is intended to indicate that the MR polypeptide and non-MR polypeptide are fused into matrix one another. Non-MR polypeptide may be fused at the N-terminus or C-terminus of the MR polypeptide. For example, in one embodiment the fusion protein is a GST-MR fusion protein in which the MR sequences are fused at the C-terminus of the GST sequences. Such fusion proteins facilitate the purification of recombinant MR proteins. In another embodiment, the fusion protein is an MR protein containing an N-terminus heterologous signal sequence. In certain host cells (e.g., mammalian host cells), the expression and / or secretion of an MR protein may be increased. through the use of a heterologous signal sequence.

Preferably, an MR fusion or chimeric protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments encoding different polypeptide sequences are ligated together in-matrix according to conventional techniques, for example by employing blunt-end or blunt-end terminations for ligation, restriction enzyme digestion to provide the same. appropriate terminations, cohesive end fill as appropriate, alkaline phosphatase treatment to prevent unwanted joints, and enzymatic binding. In another embodiment, the fusion gene may be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be performed using anchor primers that produce complementary overhangs between two consecutive gene fragments that can be subsequently looped and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols). in Molecular Biology, eds Ausubel et al John Wiley & Sons: 1992). Further, many expression vectors are commercially available which already encode a fusion group (e.g., a GST polypeptide). An MR encoding nucleic acid may be cloned into such an expression vector such that the fusion group is attached in-matrix to the MR protein.

MR protein homologs can be generated by mutagenesis, for example, discrete point mutation or truncation of the MR protein. As used herein, the term "homologue" refers to a variant form of the MR protein that acts as an agonist or antagonist of MR protein activity. An MR protein agonist may retain substantially the same or a subset of the MR protein biological activities. An MR protein antagonist may inhibit one or more of the naturally occurring form activities of the MR protein, for example, by competitive binding on a downstream limb or upstream of the MR regulatory cascade that includes the MR protein. Thus, the C. glutamicum MR protein and its homologues of the present invention can modulate the activity of one or more metabolic pathways that MR proteins regulate in this microorganism.

In an alternative embodiment, MR protein homologs can be identified by screening combinatorial mutant libraries, for example, truncation mutants, MR protein for MR protein agonist or antagonist activity. In one embodiment, a variegated library of MR variants is generated by combinatorial nucleic acid mutagenesis and is encoded by a variegated gene library. A variegated library of MR variants may be produced, for example, by enzymatic ligation of a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential MR sequences is expressible as individual polypeptides, or alternatively as a set of larger fusion proteins (eg for phage display) containing the set of MR sequences therein. There are a variety of methods that can be used to produce potential MR homologue libraries from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence may be conducted on an automated DNA synthesizer, and the synthetic gene may then be ligated into an appropriate expression vector. Use of a degenerate set of genes allows the provision, in a mixture, of all coding sequences of the desired set of potential MR sequences. Methods for the synthesis of degenerate oligonucleotides are shown in the art (see, for example, Narang, SA (1983) Tetrahedron 39: 3; Itakura et al. (1984) Annu. Rev. Biochem. 53: 323; Itakura et al. ( 1984) Science 198: 1056 (Ike et al. (1983) Nucleic Acid Res. 11: 477).

In addition, libraries of MR protein encoding fragments can be used to generate a variegated population of MR fragments for screening and subsequent selection of homologues of an MR protein. In one embodiment, a coding sequence fragment library may be generated by treating a double stranded PCR fragment of an MR coding sequence with a nuclease under conditions in which shear occurs only approximately once per molecule, DNA denaturation of stranded DNA. double stranding, DNA renaturation to form double stranded DNA which may include sense / antisense pairs of different cut products, removal of individual strand portions of the S1 nuclease reformed duplexes, and ligation of the resulting fragment library into a Expression vector. By this method, an expression library can be derived which encodes the internal, N-terminal, and C-terminal fragments of various sizes of the MR protein.

Various techniques are known in the art for screening combinatorial library gene products prepared by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of gene libraries generated by combinatorial mutagenesis of MR homologues. The most widely used high throughput analysis techniques for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting vector library, and gene expression. combinatorial conditions under which detection of a desired activity facilitates the isolation of the coding vector of the gene whose product has been detected. Recursive ensemble mutagenesis (REM), a novel technique that enhances the frequency of functional mutants in libraries, may be employed in combination with screening assays to identify MR homologs (Arkin and Yourvan (1992) PNAS <S9: 7811-7815 Delgrave et al (1993) Protein Engineering 6 (3): 327-331).

In another embodiment, cell-based assays may be explored to analyze a variegated MR library using methods well known in the art.

In addition to the MR protein-encoding nucleic acid molecules described above, another aspect of the invention relates to isolated nucleic acid molecules which are antisense to those. An "antisense" nucleic acid comprises a nucleotide sequence that is complementary to a "sense" nucleic acid encoding a protein, for example complementary to the coding strand of a double-stranded DNA molecule or complementary to a sequence of mRNA. Consequently, an antisense nucleic acid may be bonded by hydrogen bridges to a sense nucleic acid. Antisense nucleic acid may be complementary to an entire MR coding tape, or only a portion thereof. In one embodiment, an antisense nucleic acid molecule is antisense to a "coding region" of the coding strand of a nucleotide sequence coding for an MR protein. The term "coding region" refers to the region of the nucleotide sequence comprising codons that are translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is antisense to a "non-coding region" of the coding strand of an MR coding nucleotide sequence. The term "non-coding region" refers to the 3 'and 5' sequences flanking the coding region that are not translated into amino acids (ie also referred to as the 3 'and 5' untranslated regions) · [000100 ] Given the coding tape sequences encoding the MR molecules described herein (for example, the sequences described in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22), the antisense nucleic acids of the invention may be designed according to the Watson and Crick base pairing rules. The antisense nucleic acid molecule may be complementary to the entire MR mRNA coding region, but more preferably is an oligonucleotide that is antisense to only a portion of the MR mRNA coding or non-coding region. For example, the antisense oligonucleotide may be complementary to the region surrounding the MR mRNA translation initiation site. An antisense oligonucleotide may be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention may be constructed using chemical synthesis and enzymatic binding reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) may be chemically synthesized using naturally occurring nucleotides or variably modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex. formed between the antisense and sense nucleic acids. Alternatively and preferably, the antisense nucleic acid may be biologically produced using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e. RNA transcribed from the inserted nucleic acid will be from a antisense orientation to a target nucleic acid of interest, further described in the following subsection).

Another aspect of the invention relates to vectors, preferably expression vectors, containing at least one transgenic expression cassette of the invention comprising a nucleic acid encoding an MR protein (or a portion thereof).

As used herein, the term "vector" refers to a nucleic acid molecule capable of carrying another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA segment to which additional DNA segments may be ligated. Another type of vector is a viral vector, in which additional DNA segments can be linked in the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (for example bacterial vectors having origin of bacterial replication). Other vectors are integrated into the genome of a host cell upon introduction into the host cell, and thus replicated together with the host genome. Further, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors useful in recombinant DNA techniques are often in the form of plasmids. In the present descriptive report, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors as phage vectors that serve equivalent functions.

The transgenic expression vectors of the invention comprise a transgenic expression cassette of the invention in a form suitable for expression of MR nucleic acid in a host cell.

The transgenic expression cassette includes one or more regulatory sequences (promoters), selected based on the host cells to be used for expression, which is operably linked in the nucleic acid sequence to be expressed. . Within a "operably linked" transgenic expression cassette is intended to mean that the nucleic acid sequence of interest is linked in the regulatory sequence (s) in a manner that allows expression of the nucleotide sequence ( for example, in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). 1000105] The term "regulatory sequence" is intended to include promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Gocddel; Gene Expression Technology: Melhods in Enzymology 185. Academic Press. San Diego, CA (1990) and Vasicova P. Patek M. Nesvera J. Sahm H. Eikman B. Journal of Bacteriology (1999) 181 (19): 6188-91, Patek M. et al (1996) Microbiology 142 : 1297-309, and in Mateos et al. (1994) Journal of Bacteriology 176: 7362-71. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many host cell types and those that direct nucleotide sequence expression only in certain host cells. Regulatory sequences are, for example, promoters such as cos-, tac-, trp-, tel-, irp-tel-, lpp-, lac-, Ipp-lac-, lad'1-, T7-, T5-. T3-, gal-, tre-, ara-, SP6-, arny, SP02, λ-Ρι <- or λ-Ρι., Which are preferably used in bacteria. It is also possible to use artificial promoters. It will be appreciated by one of ordinary skill in the art that the expression vector design may depend on factors such as the choice of host cell to be transformed, the desired protein expression level, etc. Expression vectors of the invention may be introduced into host cells to thereby produce proteins or peptides, including peptides or fusion proteins, encoded by nucleic acids as described herein (e.g., MR proteins, mutant forms of MR proteins, fusion proteins). , etc.).

The transgenic expression vectors or expression cassettes of the invention may be designed for expression of MR proteins in prokaryotic or eukaryotic cells. For example, MR genes may be expressed in bacterial cells such as C. glutamicum, insect cells (using baculovirus expression vectors), yeast cells and other fungal cells, algal cells and multicellular plant cells, or cell. mammals. Suitable host cells are further discussed in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Alternatively, the transgenic expression vector or expression cassette can be transcribed and translated in vitro, for example using T7 and T7 polymerase regulatory sequences.

Protein expression in prokaryotes is often conducted with vectors containing inducible or constitutive promoters directing both fusion and non-fusion protein expression.

Fusion vectors add numerous amino acids to a protein encoded therein, usually at the amino terminus of the recombinant protein. Typical fusion expression vectors may fuse glucationa S-transferase (GST), maltose-binding protein E, or protein A, respectively, into the target recombinant protein.

Examples of suitable E. coli expression vectors include pTrc (Amann et al., (1988) Gene 69: 301-315) pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pHS2, pPLc236 , pMBL24, pLG200, pUR290, ρΙΝ-ΠΙ113-Β1, λgtll, pBdCl, and pETld (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89; and Pouwels et al., Eds. (1985) Cloning Vectors, Elsevier: New York ISBN 0 444 904018).

[000110] Other examples of bifunctional expression vectors in E. coli and C. glutamicum can be found in Eikmanns B.J., et al. (1991) Gene 102: 93-8. Suitable cloning vectors for use in Corynebacterium glutamicum are, for example, those described in Sinskey et al., US Patent No. 4,649,119, and techniques for genetic manipulation of C. glutamicum and related Brevibacterium species (eg lactofermentum) ( Yoshihama et al, J. Bacteriol. 162: 591-597 (1985); Katsumata et al., J. Bacteriol. 159: 306-311 (1984); and Santamaria et al., J. Gen. Microbiol. 130: 2237 -2246 (1984)).

Target gene expression of the pTrc vector is based on transcription of host RNA polymerase from a hybrid trp-lac fusion promoter. For transformation of other varieties of bacteria, suitable vectors can be selected. For example, plasmids piJ101, pIJ364, pIJ702 and pIJ361 are known to be useful in the transformation of Streptomyces, while plasmids pUB10, pC194, or pBD214 are suitable for the transformation of Bacillus species. Various plasmids for use in transferring genetic information into Corynebacterium include pHM1519, pBL1, pSA77, or pAJ667 (Pouwels et al., Eds. (1985) Cloning Vectors, Elsevier: New York IBSN 0 444 904018). One strategy for maximizing recombinant protein expression is to express the protein in a host bacterium with a weakened ability to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California ( 1990) 119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferably used in the bacterium chosen for expression, such as C. glutamicum (Wada et al. (1992) Nucleic Acids Res. 20: 2111-2118). Such alteration of nucleic acid sequences of the invention may be accomplished by standard DNA synthesis techniques.

Another aspect of the invention relates to transgenic host cells into which an expression vector or transgenic expression cassette of the invention has been introduced. The terms "host cell" and "transgenic host cell" are used interchangeably herein. Such terms are understood to refer not only to the specific object cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to both environmental and mutation influences, such progeny may not actually be identical to the parent cell, but are still included within the scope of the term as used herein.

A host cell can be any eukaryotic or prokaryotic cell. For example, an MR protein may be expressed in bacterial cells such as C. glutamicum, insect cells, yeast or mammalian cells. Other suitable host cells are known to one of ordinary skill in the art. Corynebacterium glutamicum-related microorganisms that may conveniently be used as host cells for the nucleic acid and protein molecules of the invention are described in Table 1.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transfection or transformation techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., linear DNA or RNA (e.g., a linearized vector or a gene construct alone without a vector) or nucleic acid in the form of a vector (for example, a plasmid, phage, plasmid, phagemid, transposon or other DNA) in a host cell, including calcium phosphate or chloride co-precipitation Calcium, DEAE-dextran-mediated transfection, lipofection, or electroporation Suitable methods for transformation or transfection of host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and other laboratory manuals.

For the transformation of microorganisms, it is known that, depending on the expression vector and the transformation technique used, only a small fraction of cells can incorporate foreign DNA either with an episomal localization or into their genome by processes involving recombination. For the purpose of identifying and selecting these transformants, a gene encoding a selectable marker (e.g., antibiotic resistance) is generally introduced into host cells along with the gene of interest. Preferred selectable markers include those that confer drug resistance, such as kanamycin, tetracycline, bleomycin, chloramphenicol, lincomycin. ✓ Nucleic acid encoding a selectable marker may be introduced into a host cell over the same vector as that encoding an MR protein or may be introduced into a separate vector. Cells transformed with the introduced nucleic acid can be identified by, for example, drug selection (e.g., cells that have the selectable marker gene incorporated will survive, while the other cells will die).

Examples of antibiotic resistance genes that can be used in C. glutamicum can be found in: Tauch A. Puhler A. Kalinowski J. Thierbach G. Plasmid 44 (3): 285-91, 2000, Kim HJ. Kim Y. Lee MS. Lee HS. Molecules & Cells 12 (1): 112-6, 2001 Guerrero C. Mateos LM. Malumbres M. Martin JF. Applied Microbiology & Biotechnology 36 (6): 759-62, 1992, Eikmanns BJ. Kleinertz E. Liebl W. Sahm H. Gene 102 (1): 93-8, 1991, Yoshihama M. Higashiro K. Rao EA. Akedo M. Shanabruch WG. Follettie MT. Walker GC. Sinskey AJ. Journal of Bacteriology 162 (2): 591-7, 1985. Tauch A. Zheng Z. Puhler A. Kalinowski J. Plasmid 40 (2): 126-39, 1998, Cadenas RF. Martin JF. Gil JA. Gene 98 (1): 117-21, 1991.

In another embodiment, transgenic host organisms (preferably microorganisms) may be produced which contain selected systems that allow for regulated expression of the introduced gene. For example, the inclusion of an MR gene in a vector by placing it under the control of the lac operon allows expression of the MR gene only in the presence of IPTG. Such regulatory systems are well known in the art and are described in for example, Eikmanns B.J. et al. (1991) Gene 102: 93-8.

A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, may be used to produce (i.e. express) an MR protein. Accordingly, the invention further provides methods for producing MR proteins using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of the invention (into which an expression vector or transgenic expression cassette encoding an MR protein has been introduced, or into whose genome a gene encoding an MR protein has been introduced. a wild type or modified MR protein) in an appropriate medium until the MR protein is produced.

In another embodiment, the method further comprises isolating MR proteins from the medium or host cell.

B. Methods for Suppressing Expression of an MR Protein

There are numerous methods known to the person skilled in the art for introducing deficiency with respect to a specific gene into an organism or for suppressing or reducing the expression or activity of said gene or corresponding gene product. It is a preferred embodiment within this invention to apply said methods to a negative methionine biosynthesis regulator (e.g., RXA00655), thereby increasing methionine biosynthesis.

Said methods may include one or more of the methods selected from the following group of methods consisting of: a) knockout of the gene coding for said MR protein (e.g. negative regulatory protein); b) mutagenesis of the gene coding for said MR protein (e.g., negative regulatory protein), wherein said mutation may be induced in the coding, non-coding, or regulatory regions of said gene; c) expressing an antisense RNA, wherein said antisense RNA is complementary to at least part of the RNA encoding said MR protein (e.g., negative regulatory protein); d) expression of DNA binding proteins by blocking or reducing expression of the gene encoding said MR protein (e.g., negative regulatory protein); e) expression of protein binding factors by blocking or reducing expression of the gene encoding said MR protein (e.g., negative regulatory protein); f) expressing a dominant negative variant of said MR protein (e.g., negative regulatory protein); and g) destabilization of the mRNA encoding said MR protein (e.g., negative regulatory protein).

In a preferred embodiment, an endogenous MR gene in a host cell is subjected to disruption (e.g., by homologous recombination or other genetic means known in the art) such that expression of its protein product does not occur. In another embodiment, an endogenous or introduced MR gene in a host cell has been altered by one or more of point mutations, deletions, or inversions. Said MR gene may further encode a functional MR protein but may also encode a non-functional MR protein or a modified (e.g., increased or decreased) MR protein. In yet another embodiment, one or more of the regulatory regions (for example, a promoter, repressor, or inducer) of an MR gene in a microorganism have been altered (for example, by deletion, truncation, inversion, or point mutation) of such a gene. so that MR gene expression is modulated. One of ordinary skill in the art will recognize that host cells containing more than one of the described MR protein and gene modifications can be readily produced using the methods of the invention, and are intended to be included in the present invention.

To form a homologous recombinant microorganism, a vector is prepared which contains at least a portion of an MR gene into which a deletion, addition or substitution has been introduced to thereby alter, for example, disruption. functional, the MR gene. Preferably, this MR gene is a Corynebacterium glutamicum MR gene, but may be a homologue of a related bacterium or even an insect, yeast or mammalian source. In a preferred embodiment, the vector is designed such that, under homologous recombination, the endogenous MR gene is subjected to functional disruption (i.e. no longer encoding a functional protein; also referred to as a "knockout" vector). Alternatively, the vector may be designed such that, under homologous recombination, the endogenous MR gene is mutated or differently altered (for example, the upstream regulatory region may be altered to thereby alter the expression of the endogenous MR protein). In the homologous recombination vector, the altered portion of the MR gene is flanked at its 3 'and 5' ends by additional nucleic acid of the MR gene to allow for homologous recombination to occur between the vector-borne exogenous MR gene and an endogenous MR gene within of a microorganism. The additional flanking MR nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, flanking DNA should have lengths between 100 base pairs and a few kilobases (both at the 3 'and 5' ends) that are included in the vector (see for example, Thomas, KR, and Capecchi, MR (1987) Cell 51. : 503 for a description of homologous recombination vectors). In addition methods are known in which other selection can be used to construct chromosomal recombinations in which the selection marker is retrieved by a positive selection method. Schafer A. Tauch A. Jager W. Kalinowski J. Thierbach G. Puhler A. Gene. 145 (1): 69-73, 1994. The vector is introduced into a microorganism (e.g., by electroporation) and cells in which the introduced MR gene has been homologously recombined with the endogenous MR gene are selected using techniques known in the art. .

Decreased expression of an MR protein may be achieved by expression of antisense RNA directed against the MR encoding mRNA. Said antisense RNA is described above. Methods for regulating gene expression using antisense genes are well known to the person skilled in the art (see, for example, Weintraub, H. et al., "Antisense RNA as a molecular tool for genetic analysis", Reviews - Trends in Genetics, Vol. 1 (1) 1986). Antisense nucleic acid molecules of the invention are typically administered to a cell or regenerated in situ such that they hybridize to or bind to the cellular mRNA and / or genomic DNA encoding an MR protein to thereby inhibit expression. protein, for example by inhibiting transcription and / or translation. Hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds on DNA duplexes, through specific interactions in the larger helix groove. duplex. The antisense molecule may be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, for example by binding the antisense nucleic acid molecule to a peptide or to an antigen. an antibody that binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of antisense molecules, vector constructs in which the antisense nucleic acid molecule is positioned under the control of a strong prokaryotic, viral, or eukaryotic promoter are preferred.

In yet another embodiment, the antisense nucleic acid molecule of the invention is an α-anomeric nucleic acid molecule. An α-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, unlike the usual β-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15: 6625-6641). The antisense nucleic acid molecule may also comprise a 2'-o-methyl ribonucleotide (Inoue et al (1987) Nucleic Acids Res. 15: 6131-6148) or a chimeric RNA-DNA analog (Inoue et al (1987) FEBS Lett. 215: 327-330).

In yet another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are ribonuclease activity catalytic RNA molecules that are capable of cleaving an individual strand nucleic acid, such as an mRNA, for which they have complementary regions. Thus, ribozymes (e.g., hammerhead ribozymes (described in Gerlach (1988) Nature 334: 585-591)) can be used to catalytically cleave MR mRNA transcripts to thereby inhibit MR mRNA translation. A ribozyme having specificity for an MR encoding nucleic acid may be designed based on the nucleotide sequence of an MR DNA described herein (i.e., SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22). For example, a Tetrahymena L-19 IVS RNA derivative may be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved into an MR encoding mRNA. See, for example, Cech et al. U.S. Patent 4,987,071 and Cech et al. U.S. Patent 5,116,742. Alternatively, MR mRNA can be used to select a catalytic RNA having a ribonuclease activity specific to a collection of RNA molecules. See, for example, Bartel, D. and Szostak, J.W. (1993) Science 261: 1411-1418.

Alternatively, MR gene expression may be inhibited by screening nucleotide sequences complementary to the regulatory region of an MR nucleotide sequence (eg, an ME promoter and / or enhancers) to form triple helical structures that prevent transcription. of an MR gene in target cells. See generally Helene, C. (1991) Anticancer Drug Des. 6 (6): 569-84; Helene, C. et al. (1992) Ann. N.Y. Acad. Know. 660: 27-36; and Maher, L.J. (1992) Bioassays 14 (12): 807-15.

In yet another embodiment, alternative or additional methods known to the person skilled in the art may be used to modulate, for example suppress or increase, the expression of a gene (e.g., a gene encoding a negative biosynthesis regulator of methionine) or to modulate, for example, increase or suppress or inhibit the activity of the corresponding gene product.

One method that may be used is the expression of a dominant negative variant of the gene product (e.g., a gene encoding a negative methionine biosynthesis regulator) to suppress activity, for example a negative regulator of methionine biosynthesis.

A negative methionine biosynthesis regulator (e.g. RXA00655 as exemplified by SEQ ID NO: 1, 18, 20 or 22) is preferably a transcriptional regulator. Transcriptional regulators are known to exist as dimers that bind to opposite parts of DNA in structures that may contain repeated sequences in so-called dyad symmetry. DNA binding activity is determined within the amino acid sequence of the transcription regulator. Structurally based examples of dimeric binding of such transcriptional regulators can be found in Schumacher M.A. and Brennan R.G. (2002) Molecular Microbiology. 45: 885-93. For example, the expression of different alleles of the same protein in a cell by the production of heterodimeric proteins consisting of an unchanged allele and a mutated allele of a regulatory protein confers a dominant negative phenotype to such an organism. Examples of methods for constructing a dominant mutant negative repressor protein in organisms also expressing mutated alleles of the same gene can be found in Journal of Molecular Biology (2002) 322 (2): 311-24, and in Journal of Biological Chemistry ( 1994). 269 (11): 8246-54. For example, the DNA binding domain of said methionine biosynthesis negative regulator may be inactivated. In another embodiment, mRNA stabilization and destabilization may be used as a method for either increasing or decreasing the lifetime of a given mRNA molecule. Methods for influencing the lifetime of a given mRNA can be found in Smolke C.D. and Keasling J.D. (2002) Biotechnology & Bioengineering. 78 (4): 412-24, in Smolke C.D. et al. (2001) Metabolic Engineering 3 (4): 313-21, and in Carrier T.A. and Keasling J.D. (1999) Biotechnology Progress 15 (1): 58-64. Another method that can be used to modulate the expression of a gene includes the expression of DNA binding proteins by increasing or blocking or reducing the expression of DNA binding proteins by increasing or blocking or reducing gene expression, for example of a gene encoding. of a regulatory protein of methionine biosynthesis.

Blocking or reducing gene expression, for example of a gene encoding a negative regulatory protein of methionine biosynthesis, may be accomplished by the use of specific DNA-binding proteins, for example, of the class of zinc finger protein from transcription factors. These factors may be directed to, for example, regulatory regions of the gene to be suppressed. The use of these factors allows expression suppression without altering the corresponding gene sequence. Methods are known to the person skilled in the art to construct artificial DNA binding factors capable of binding in a specific target sequence. Enhanced gene expression, for example encoding a negative methionine biosynthesis regulator, can be accomplished by using the artificial DNA binding factors described above by fusing them into a transcriptional activation domain to thereby form an artificial primer. of the transcript. (Dreier B et al. (2001) J. Biol. Chem. 276 (31): 29466-78; Dreier B et al. (2000) J Mol Biol 303 (4): 489-502; Beerli RR et al. ( 2000) Proc Natl Acad Sci USA 97 (4): 1495-1500 Beerli RR et al (2000) J. Biol Chem 275 (42): 32617-32627 Segai DJ and Barbas CF 3rd. (2000) Curr Opin Opin Chem Biol 4 (1): 34-39; Kang JS Chem Kim JS (2000) J. Biol Chem 275 (12): 8742-8748 Beerli RR et al. (1998) Proc. Natl. Acad. Sci. USA 95 (25): 14628-14633; Kim JS et al. (1997) Proc. Natl. Acad. Sci. USA 94 (8): 3616-3620; J. Mol. Biol 293 (2): 215-218; Tsai SY et al. (1998) Adv. Drug Deliv. Rev. 30 (1-3): 23-31; Mapp AK et al. (2000) Proc Natl Acad Sci USA 97 (8): 3930-3935 Sharrocks AD et al (1997) Int J Biochem Cell Biol 29 (12) 1371-1387 Zhang L et al. (2000) J. Biol. Chem. 275 (43): 33850-33860). Gene expression suppression can also be accomplished by the use of low molecular weight custom synthetic compounds, for example of the polyamide type (Dervan PB and Bürli RW (1999) Current Opinion in Chemical Biology 3: 688-693; Gottesfeld JM et (2000) Gene Expr. 9 (1-2): 77-91). These compounds may be adopted on a rational basis for any specific DNA target sequence allowing for deletion or, if the compound is used in fusion with a transcriptional activation domain, initiation of gene expression. Methods of constructing artificial DNA binding factors capable of binding in a specific target sequence are known to the person skilled in the art (Bremer RE et al. (2001) Bioorg. Med. Chem. 9 (8): 2093-103; Ansari AZ et al. (2001) Chem. Biol. 8 (6): 583-92; Gottesfeld JM et al. (2001) J. Mol. Biol. 309 (3): 615-29; Wurtz NR et al. 2001) Org Lett 3 (8): 1201-3; Wang CC et al. (2001) Bioorg. Med. Chem. 9 (3): 653-7; Urbach AR and Dervan PB (2001) Proc. Natl. Acad. Sci USA 98 (8): 4343-8; Chiang SY et al (2000) J. Biol. Chem. 275 (32): 24246-54). In another embodiment, expression of protein binding factors may be used by activating or blocking or reducing the expression or activity of the gene encoding a methionine biosynthesis regulatory protein.

Suitable protein binding factors for the binding of methionine biosynthesis regulators and thus for activity suppression may be RNA based such as, for example, aptamers (Famulok M and Mayer G (1999) Curr. Top Microbiol. Immunol. 243: 123-36), antibodies, antibody fragments, or single chain antibodies. Methods for the construction and use of these protein binding factors are known to the person skilled in the art. C. Uses and Methods of the Invention The nucleic acid molecules, proteins, protein homologs, fusion proteins, primers, transgenic expression cassettes, expression vectors, and host cells described herein may be used in one or more of the following following methods: modulating cell production of a desired compound, such as a fine chemical compound, for example methionine; identification of C. glutamicum or related organisms; genome mapping of C. glutamicum-related organisms; identification and localization of C. glutamicum sequences of interest; evolutionary studies; determination of MR protein regions required for function; modulation of an MR protein activity; and modulating the activity of one or more metabolic pathways.

The MR nucleic acid molecules of the invention have a variety of uses. Manipulation of the MR nucleic acid molecules of the invention, for example, suppression or increase of expression or activity of nucleic acid or protein molecules, respectively, results in modulation of methionine biosynthesis. For example, a strain of Corynebacterium glutamicum that overexpresses or has increased expression of RXN-2910, a positive methionine biosynthesis regulator, shows a significant increase in methionine production or other compounds of the methionine biosynthetic pathway. Further, a strain of Corynebacterium glutamicum that is deficient in or has suppressed expression of RXN00655, a negative regulator of methionine biosynthesis, also shows a significant increase in methionine production or other compounds of the methionine biosynthetic pathway.

Further, manipulation of the nucleic acid molecules of the invention may lead to the production of MR proteins having functional differences from wild-type MR proteins. These proteins may be improved in efficiency or activity, may be present in larger numbers in the cell than usual, or may be decreased in efficiency or activity.

[000135] The invention provides methods for screening molecules that modulate the activity of an MR protein, either by interacting with the protein itself or with an MR protein substrate or binding partner, or by modulating the transcription or translation of an MR protein molecule. MR nucleic acid of the invention. In such methods, a microorganism expressing one or more MR proteins of the invention is contacted with one or more test compounds, and the effect of each test compound on MR protein activity or expression level is evaluated.

Such changes in activity may directly modulate the yield, yield and / or production efficiency of one or more fine chemical compounds of C. glutamicum, for example methionine. For example, by optimizing the activity of an MR protein, for example a positive methionine biosynthesis regulator, for example, RXN02910, which activates the transcription or translation of a gene encoding a biosynthetic protein to a desired fine chemical compound, or by damaging or nullifying the activity of an MR protein, for example a negative methionine biosynthesis regulator, for example, RXA00655, which suppresses the transcription or translation of such a gene, the activity or rate of such a gene may also be increased. of activity of that biosynthetic route. Similarly, by altering the activity of an MR protein such that it is constitutively inactivated after translation a protein involved in a degradation pathway to a fine chemical compound, or by altering the activity of an MR protein such that it is constructively suppressed. By transcribing or translating such a gene, the yield and / or rate of production of the fine chemical compound of the cell may be increased due to the increased degradation of the compound.

Further, by modulating the activity of one or more MR proteins, one can indirectly stimulate production or improve the rate of production of one or more fine chemical compounds in the cell due to the interrelationship of very different metabolic pathways. For example, by increasing the yield, production, and / or production efficiency by activating the expression of one or more lysine biosynthesis enzymes, the expression of other chemical compounds such as other amino acids may be concomitantly increased. the cell would naturally require in larger quantities. Also, cell-wide metabolism regulation can be altered such that the cell is able to grow or replicate better under the environmental conditions of the fermentative culture (where nutrient and oxygen supplies may be unsatisfactory and possibly products). toxic waste in the environment may be at high levels). For example, by mutating an MR protein that suppresses the synthesis of molecules required for cell membrane production in response to high levels of extracellular waste products (in order to block cell growth and division under suboptimal growth conditions). ) so that there is no longer the ability to suppress such synthesis, cell growth and multiplication in cultures can be increased even when growth conditions are suboptimal. Such enhanced growth or viability (a) should also increase the yields and / or the rate of production of a desired fine chemical compound from the reader culture, due to the relatively large number of cells producing this compound in the culture. 1000138] The above mentioned mutagenesis strategies for MR proteins to result in increased yields of a fine chemical compound. for example methionine from C. glutamicum are not mentioned to be limiting; Variations in these strategies will be readily apparent to a person ordinarily skilled in the art. Using such strategies, and incorporating mechanisms described herein, the nucleic acid and protein molecules of the invention may be used to generate C. glutamicum or related strains of bacteria expressing mutated MR protein and nueleic acid molecules of such a type. such that the yield and / or production efficiency of a desired compound is improved. This desired compound can be any natural C. glutamicum product, which includes the end products of the biosynthetic pathways and the naturally occurring metabolic roller intermediates, as well as the naturally occurring molecules in C. glutamicum metabolism, but which are produced by a C. glutamicum strain of the invention. 1000139] The MR molecules of the invention may also be used to identify an organism as Corynebacterium glutamicum or a close relative thereof. Also, they can be used to identify the presence of C. glutamicum or a relative in a mixed population of microorganisms. The invention provides the nucleic acid sequences of numerous C. glutamicum genes; By probing genomic DNA extracted from a culture of a single or mixed population of microorganisms under stringent conditions with a probe spreading over a region of a C. glutamicum gene that is unique to this organism, one can verify whether this organism is gift.

The nucleic acid and protein molecules of the invention may also serve as markers for specific regions of the genome. This is useful not only for genome mapping but also for functional studies of C. glutamicum proteins. For example, to identify the region of the genome in which a specific C. glutamicum DNA binding protein binds, the C. glutamicum genome can be digested, and fragments incubated with the DNA binding protein. Those that bind to the protein may be further probed with the nucleic acid molecules of the invention, preferably with readily detectable markers; Binding of such a nucleic acid molecule into the genome fragment allows the fragment to be located on the C. glutamicum genome map and, when performed multiple times with different enzymes, facilitates rapid determination of the nucleic acid sequence to which the protein binds. . Further, the nucleic acid molecules of the invention may be sufficiently homologous to related species sequences such that these nucleic acid molecules may serve as markers for constructing a genomic map in related bacteria, such as Brevibacterium lactofermentum.

[000141] This invention is further illustrated by the following examples which are not to be construed as limiting. The contents of all references, figure, patent applications, patents, published patent applications, Tables, and Sequence Listings cited throughout this application are hereby incorporated by reference. EXAMPLES Example 1: PREPARATION OF TOTAL GENETIC CORYNEBACTERIUM GLUTAMICUM DNA ATCC 13032 A culture of Corynebacterium glutamicum (ATCC 13032) was grown overnight at 30 ° C with vigorous shaking in BHI medium (Difco). Cells were harvested by centrifugation, the supernatant was discarded and cells were resuspended in 5 ml buffer-I (5% original culture volume - all indicated volumes have been calculated to 100 ml culture volume). Composition of Buffer I: sucrose 140.34 g / 1, MgSCL x 7H2 O 2.46 g / 1, 10 mg / 1 KH2PO4 solution (100 g / 1, adjusted to pH 6.7 with KOH), concentrated M12 50 mg / 1 ((NPL ^ hSCMO g / 1, 1 g / 1 NaCl, MgSCL x 7H 2 O 2 g / 1, CaCl 0.2 g / 1, yeast extract 0.5 g / 1 (Difco), mixture of elements trace 10 mg / 1 (FeSCL x H2O 200 mg / 1, ZnSC> 4 x 7 H2O 10 mg / 1, MnCL x 4 H2O 3 mg / 1, H3BO33O mg / 1, COCl2 x 6 H2O 20 mg / 1, N1Cl2 x 6 H2O 1 mg / 1, Na2MoC> 4 x 2 H2O 3 mg / 1, complexing agent (EDTA or citric acid) 500 mg / 1, vitamin mix 100 mg / 1 (biotin 0.2 mg / 1, folic acid 0 , 2 mg / 1, p-amino benzoic acid 20 mg / 1, riboflavin 20 mg / 1, Ca pantothenate 40 mg / 1, nicotinic acid 140 mg / 1, pyridoxol hydrochloride 40 mg / 1, myo-inositol 200 Lysozyme was added to the suspension to a final concentration of 2.5 mg / ml After an incubation of approximately 4 h at 37 ° C, the cell wall was degraded and the resulting protoplasts were harvested by centrifugation. washed once with 5 ml buffer-I and once with 5 ml TE-buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8). The pellet was resuspended in 4 ml TE-buffer and 0.5 ml SDS solution (10%) and 0.5 ml NaCl solution (5 M) were added. After the addition of proteinase K to a final concentration of 200 pg / ml, the suspension was incubated for about 18 h at 37 ° C. DNA was purified by phenol, phenol-chloroform-isoamyl alcohol extraction and chloroform-isoamyl alcohol extraction using standard procedures. Then, the DNA was precipitated by the addition of 1/50 volume of 3 M sodium acetate and 2 volumes of ethanol, followed by a 30 min incubation at -20 ° C and a 30 min centrifugation at 12,000 rpm in a centrifuge. high speed using an SS34 (Sorvall) rotor. The DNA was dissolved in 1 ml TE-buffer containing 20 μg / ml RNaseA and dialyzed at 4 ° C against 1,000 ml TE-buffer for at least 3 hours. During this time, the buffer was changed 3 times. In 0.4 ml aliquots of dialyzed DNA solution, 0.4 ml of 2 M LiCl and 0.8 ml of ethanol were added. After a 30 min incubation at -20 ° C, DNA was collected by centrifugation (13,000 rpm, Biofuge Fresco, Heraeus, Hanau, Germany). The DNA pellet was dissolved in TE-buffer. The DNA prepared by this procedure could be used for all purposes, including Southern Blotting or genomic library construction.

Example 2: CONSTRUCTION OF GENOMIC LIBRARIES IN ESCHERICHIA COLIA FROM CORYNEBACTERIUM GLUTAMICUM ATCC 13032 [000143] Using DNA prepared as described in Example 1, cosmid and plasmid libraries were constructed according to known and well-established methods (see, for example). , Sambrook, J. et al. (1989) "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, or Ausubel, FM et al. (1994) "Current Protocols in Molecular Biology", John Wiley & Sons.) Any plasmid or cosmid may be used. Of particular use were plasmids pBR322 (Sutcliffe, J.G. (1979) Proc. Natl. Acad. Sci. USA, 75: 3737-3741); pACYC177 (Change & Cohen (1978) J. Bacteriol 134: 1141-1156), pBS series plasmids (pBSSK +, pBSSK- et al; Stratagene, LaJolla, USA), or cosmids such as SuperCosl (Stratagene, LaJolla, USA) or Loristó (Gibson, TJ, Rosenthal A. and Waterson, RH (1987) Gene 53: 283-286. Gene libraries specifically for use in C. glutamicum can be constructed using plasmid pSL109 (Lee, H.-S. and AJ Sinskey (1994) J. Microbiol Biotechnol 4: 256-263).

Example 3: DNA SEQUENCING AND COMPUTER ANALYSIS

[000145] Genomic libraries as described in Example 2 were used for DNA sequencing according to standard methods, in particular by the chain termination method using ABI377 sequencing machines (see, for example, Fleischman, RD et al. (1995 ) Whole Genome Random Sequencing and Assembly of Haemophilus influenzae Rd., Science, 269: 496-512). The following sequencing primers were used with the nucleotide sequences: 5'-GGAAACAGTATGACCATG-3 * (SEQ ID NO: 18) or 5'-GTAAAACGACGGCCAGT-3 '(SEQ ID NO: 19).

Example 4: MUTAGENESIS IN VIVO

In vivo mutagenesis of Corynebacterium glutamicum can be performed by passing plasmid DNA (or another vector) through E. coli or other microorganisms (e.g. Bacillus spp. Or yeast such as Saccharomyces cerevisiae) that are hindered in their ability to maintain the integrity of your genetic information. Typical mutant strains have mutations in the genes for the DNA repair system (eg, mutHLS, mutD, mutT, etc.; for reference, see Rupp, WD (1996) "DNA repair mechanisms, in: Escherichia coli and Salmonella", pp. 2277-2294, ASM: Washington.) Such strains are well known to a person ordinarily skilled in the art. The use of such strains is illustrated, for example, in Greener, A. and Callahan, M. (1994) Strategies 7: 32-34.

Example 5: CORYNEBACTERIUM GLUTAMICUM GROWTH MEANS AND CULTURE CONDITIONS

Corynebacteria are grown in natural or synthetic growth media. Numerous different growth media for Corynebacteria are both well known and readily available (Lieb et al. (1989) Appl. Microbiol. Biotechnol., 32: 205-210; von der Osten et al. (1998) Biotechnology Letters, 11: 11-16; DE 4,120,867; Liebl (1992) The Genus Corynebacterium, in: The Procaryotes, Volume II, Balows, A. et al., Eds. Springer-Verlag). These media consist of one or more carbon sources, nitrogen sources, inorganic salts, vitamins and trace elements Preferred carbon sources are sugars such as mono-, di- or polysaccharides For example glucose, fructose, mannose, galactose, ribose, sorbose, ribulose , lactose, maltose, sucrose, raffinose, starch or cellulose serve as very good carbon sources.You can also supply the media with sugar via complex compounds such as molasses or other sugar refining by-products. different carbon Other possible carbon sources are alcohols and organic acids, such as methanol, ethanol, acetic acid or lactic acid. Nitrogen sources are usually inorganic or organic nitrogen compounds, or materials containing these compounds. Exemplary nitrogen sources include ammonia gas or ammonium salts such as NH4CI or (NH4 SCL, NH4OH, nitrates, urea, amino acids or complex nitrogen sources such as macerated corn liquor, soybean flour, soybean protein , yeast extract, meat extract and others.

Inorganic salt compounds which may be included in the media include salts of calcium chloride, phosphorus or sulphate of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron. Chelating compounds may be added in the medium to keep the metal ions in solution. Particularly useful chelating compounds include dihydroxy phenols, such as catechol or protocatecuate, or organic acids, such as citric acid. It is typical that media also contain other growth factors, examples of which include biotin, riboflavin, thiamine, folic acid, nicotinic acid, pantothenate and pyridoxine. Growth factors and salts often originate from complex media components such as yeast extract, molasses, macerated corn liquor and others. The exact composition of media compounds largely depends on the immediate experiment and is individually decided for each specific case. Information on media optimization is available in the textbook “Applied Microbiol. Physiology, A Practical Approach "(eds. PM Rhodes, PF Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). It is also possible to select growth media from commercial suppliers as standard 1 (Merck) or BHI (grain core infusion, DIFCO) or others.

All media components are sterilized either by heat (20 minutes at 150 kPa and 121 ° C) or by sterile filtration. The components may be either sterilized together or, if necessary, separately. All media components may be present at the beginning of growth or may be optionally added continuously or in batch.

[000150] Culture conditions are defined separately for each experiment. The temperature must be within a range of 15 ° C to 45 ° C. The temperature may be kept constant or may be changed during the experiment. The pH of the medium should be within the range of 5 to 8.5, preferably around 7.0, and can be maintained by adding buffers to the media. An exemplary buffer for this purpose is a potassium phosphate buffer. Synthetic buffers such as MOPS, HEPES, ACES and others may alternatively or simultaneously be used. It is also possible to maintain a constant culture pH by adding NaOH or NH 4 OH during growth. If complex components such as yeast extract are used, the need for additional buffers may be reduced due to the fact that many complex compounds have high buffering capacities. If a fermenter is employed to grow the microorganisms, the pH can also be controlled using gaseous ammonia.

[000151] Incubation time is usually within the range of several hours to several days. This time is selected for the purpose of allowing the maximum amount of product to accumulate in the broth. The described growth experiments can be conducted in a variety of vessels, such as microtiter plates, glass tubes, glass vials or different size metal or glass fermenters. To screen large numbers of clones, microorganisms should be grown in microtiter plates, glass tubes or shake flasks, either with or without deflectors. Preferably 100 ml shake flasks are used, filled with 10% (by volume) of the required growth medium. The vials should be shaken on a rotary shaker (25mm amplitude) using a speed range of 100-300 rpm. Losses by evaporation can be reduced by maintaining a humid atmosphere; Alternatively, a mathematical correction for evaporative losses must be performed.

If genetically modified clones are tested, an unmodified control clone or control clone containing the basic plasmid without any insert should also be tested. The medium is inoculated at an OD of 0.5-1.5 using cells grown on agar plates such as CM plates (glucose 10 g / 1, NaCl 2.5 g / 1, urea 2 g / 1, polypeptone 10 g / 1, yeast extract 5 g / 1, meat extract 5 g / 1, NaCl 22 g / 1, urea 2 g / 1, polypeptone 10 g / 1, yeast extract 5 g / 1, meat extract 5 g / 1, 22 g / 1 agar, pH 6.8 with 2M NaOH) which have been incubated at 30 ° C. Media inoculation is performed either by introducing a saline suspension of C. glutamicum cells from CM plates or by adding a liquid preculture of this bacterium.

Example 6 IN VITRO ANALYSIS OF MUTANT PROTEIN FUNCTION

The activity of DNA binding proteins can be measured by several well-established methods, such as DNA band shift assays (also called gel retardation assays). The effect of such proteins on the expression of other molecules can be measured using reporter gene assays (such as that described in Kolmar, H. et al. (1995) EMBO J. 14: 3895-3904 and references cited therein) . Reporter gene testing systems are well known and well established for applications in both prokaryotic and eukaryotic cells using enzymes such as beta-galactosidase, green fluorescent protein, and several others.

Example 7 ANALYSIS OF THE IMPACT OF THE MUTANT PROTEIN ON DESIRED PRODUCT PRODUCTION

[000154] The effect of genetic modification on C. glutamicum on the production of a desired compound (such as an amino acid) can be assessed by growth of the modified microorganism under suitable conditions (such as those described above) and by analysis of the medium and / or the cellular component for increased production of the desired product (i.e. an amino acid). Such analytical techniques are well known to one of ordinary skill in the art, and include spectroscopy, thin layer chromatography, staining methods of various types, microbiological and enzymatic methods, and analytical chromatography such as high performance liquid chromatography (see, for example). Ullman, Encyclopedia of Industrial Chemistry, vol. A2, pp. 89-90 and p. 443-613, VCH: Weinheim (1985); Fallon, A. et al. (1987) Applications of HPLC in Biochemistry ”In:" Laboratory to Techniques in Biochemistry and Molecular Biology ", vol. 17; Rchm et al (1993)" Biotechnology ", vol. 3, Chapter III:" Product recovery and purification ", pages 469-714, VCH: Weinheim; Belter, PA et al (1988) "Bioseparations: downstream processing for biotechnology", John Wiley and Sons; Kennedy, JF and Cabral. JMS (1992) "Recovery processes for biological materials", John Wiley and Sons; Shaeiwitz, JA and Henry, JD (1988) "Biochemical separations" in: "Ulm Ann's Encyclopedia of Industrial Chemistry, "vol. B3 Chapter II pages 1-27, VCH: Weinheim; and Dcchow, F.J. (1989) "Scparation and purification techniques in biotechnology", Noyes Publications).

In addition to measuring the final fermentation product, it is also possible to analyze other components of the metabolic pathways used for the production of the desired compound, such as intermediates and by-products, to determine total yield, production, and / or compound production efficiency. Methods of analysis include measurements of nutrient levels in the medium (eg, sugars, hydrocarbons, nitrogen sources, phosphate, and other ions), measurements of biomass composition and growth, analysis of common biosynthetic pathway metabolite production, c measurement of gases produced during fermentation. Standard methods for these measurements are described in "Applied Microbial Physiology. A Practical Approach", P.M. Rhodes and P.F. Stanbury, eds., IRL Press. P. 103-129; 131-163; and 165-192 (ISBN: 0199635773) and the references cited therein.

Example 8 PURIFICATION OF THE DESIRED PRODUCT OF C. GLUTAM1CUM CULTURE

Recovery of the desired product from C. glutamicum cells or the culture supernatant described above can be accomplished by various methods well known in the art. If the desired product is not secreted from the cells, the cells may be harvested from the culture by slow speed centrifugation, the cells may be lysed by standard techniques such as mechanical force or sonication. Cell fragments are removed by centrifugation, and the supernatant fraction containing the soluble proteins is retained for further purification of the desired compound. If the product is secreted from C. glutamicum cells then the cells will be removed from the culture by low speed centrifugation and the supernatant fraction will be retained for further purification.

The supernatant fraction of any purification method is chromatographed with a suitable resin, in which the soluble molecule is either retained on a chromatography resin while many of the impurities in the sample are not retained or the impurities are retained. by the resin while the sample is not. Such chromatography steps may be repeated if necessary using the same chromatography resins or different chromatography resins. One of ordinary skill in the art will be well versed in selecting appropriate chromatographic resins and in their most effective application for a particular molecule to be purified. The purified product may be concentrated by filtration or ultrafiltration, and stored at a temperature at which product stability is maximized.

There are a wide variety of purification methods known in the art and the foregoing purification method does not mean to be limiting. Such purification techniques are described, for example, in Bailey, J.E. & Ollis, D.F. "Fundamental Biochemical Engineering", McGraw-Hill: New York (1986).

The identity and purity of the isolated compounds can be assessed by standard techniques in the art. These include high performance liquid chromatography (HPLC), spectroscopic methods, scanning methods, thin layer chromatography, NIRS, enzymatic assay, or microbiological assay. Such analysis methods are reviewed in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140; Malakhova et al. (1996) Biotekhnologiya 11: 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. "Ulmams Encyclopedia of Industrial Chemistry", (1996) vol. A27, VCH: Weinheim, p. 89-90, p. 521-540, p. 540-547, p. 559-566, 575-581 and p. 581-587; Michal, G. (1999) "Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology", John Wiley and Sons; Fallon, A. et al. (1987) "Applications of HPLC in Biochemistry" in: "Laboratory Techniques in Biochemistry and Molecular Biology", vol. 17

Example 9 ANALYSIS OF GENE SEQUENCES OF THE INVENTION

Sequence comparison and percent homology determination between two sequences are techniques known in the art, and can be performed using a mathematical algorithm, such as the Karlin and Altschul (1990) Proc. Natl. Acad. Know. USA 87: 2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Know. USA 90: 5873-77. Such an algorithm is incorporated into the NBLAST and XBLAST (version 2.0) programs of Altschul, et al. (1990) J. Mol. Biol. 215: 403-10. BLAST nucleotide searches can be performed using the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to the MR nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3, to obtain amino acid sequences homologous to the MR protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25 (17): 3389-3402. When using BLAST and Gapped BLAST programs, one of ordinary skill in the art will know how to optimize program parameters (e.g., XBLAST and NBLAST) for the specific sequence being analyzed.

[000161] Another analysis of a mathematical algorithm used for sequence comparison is the algorithm of Meyers and Miller ((1988) Comput. Appl. Biosci. 4: 11-17). One such algorithm is incorporated in the ALIGN (version 2.0) program that is part of the GCG sequence alignment computer program package. When using the ALIGN program for amino acid sequence comparison, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 may be used. . Additional algorithms for sequence analysis are known in the art, and include ADVANCE and ADAM. described in Torelli and Robotti (1994) Comput. Appl. Biosci 10: 3-5; and FASTA, described in Pearson and Lipman (1988) P.N.A.S. 85: 2444-8.

Percent homology between two amino acid sequences can also be performed using the GAP program in the GCG computer program package (available at http://www.gcg.com) using either a Blosum 62 matrix or a PAM250 matrix. , and a gap weight of 12, 10, 8, 6, or 4 and a length weight of 2, 3, or 4. Percentage homology between two amino acid sequences can be performed using the GAP program in the GCG computer program package using standard parameters such as a gap weight of 50 and a length weight of 3.

Example 10: CONSTRUCTION AND OPERATION OF MICRO DNA ARRANGEMENTS

The sequences of the invention may be further used in the construction and application of DNA microarrays (the design, methodology, and uses of DNA arrays are well known in the art, and are described, for example, in Schena, M. et al. (1995) Science 270: 467-470; Wodicka, L. et al. (1997) Nature Biotechnology 15: 1359-1367; DeSaizieu, A. et al. (1998) Nature Biotechnology 16: 45-48 and DeRisi, JL et al. (1997) Science 278: 680-686).

DNA microarrays are flexible or solid supports consisting of nitrocellulose, nylon, glass, silicone, or other materials. Nucleic acid molecules can be fixed to the surface in an orderly manner. Following appropriate labeling, other nucleic acids or nucleic acid mixtures may be hybridized to immobilized nucleic acid molecules, and labeling may be used to monitor and measure the individual signal intensities of the hybridized molecules in defined regions. This methodology allows simultaneous quantification of the absolute or relative amount of all or selected nucleic acids in the applied nucleic acid mixture or sample. DNA microarrays therefore allow for analysis of multiple nucleic acid expression (as much as 6,800 or more) in parallel (see, for example, Schena, M. (1996) BioEssays 18 (5): 427-431).

The sequences of the invention may be used to design oligonucleotide primers that are capable of amplifying defined regions of one or more C. glutamicum genes by a nucleic acid amplification reaction such as the polymerase chain reaction. The choice and design of suitable 3 'or 5' oligonucleotide primers or appropriate linkers allows covalent attachment of the resulting PCR products to the surface of a support medium described above (and also described, for example, in Schena, M. et al. (1995) Science 270: 467-470).

Nucleic acid microarrays can also be constructed by unsuccessful oligonucleotide synthesis as described by Wodicka, L. et al. (1997) Nature Biotechnology 15: 1359-1367. By photolithographic methods, precisely defined regions of the matrix are exposed to light. Protective groups that are photolabile are thus activated and nucleotide-added, while regions that are light-masked are unchanged. Subsequent light protection and activation cycles allow the synthesis of different oligonucleotides at defined positions. Small, defined regions of the genes of the invention may be synthesized over microarrays by solid phase oligonucleotide synthesis.

The nucleic acid molecules of the invention present in a nucleotide sample or mixture may be hybridized to the microarrays. These nucleic acid molecules may be labeled according to standard methods. In summary, nucleic acid molecules (e.g., mRNA molecules or DNA molecules) are marked by incorporation of isotopic or fluorescently labeled nucleotides, for example during reverse transcription or DNA synthesis. Microarray-labeled nucleic acid hybridization is described (eg, Schena, M. et al. (1995) supra ·, Wodicka, L. et al. (1997), supra ·, and DeSaizieu A. et al. (1998 ), supra). Detection and quantitation of the hybridized molecule is adjusted to the specific incorporated label. Radioactive labels can be detected, for example, as described in Schena, M. et al. (1995) supra) and fluorescent markers can be detected, for example, by the method of Shalon et al. (1996) Genome Research 6: 639-645).

Application of the sequences of the invention in DNA microarray technology, as described above, allows comparative analyzes of strains other than C. glutamicum or other Corynebacteria. For example, studies of inter-strain variations based on individual transcript profiles and the identification of genes that are important for desired and / or specific strain properties such as pathogenicity, productivity and stress tolerance are facilitated by nucleic acid array methodologies. . Also, comparisons of the gene expression profile of the invention during the course of a fermentation reaction are possible using DNA array technology.

Example 11 ANALYSIS OF CELL PROTEIN POPULATION (PROTEOMIC) DYNAMICS The genes, compositions, and methods of the invention may be applied to study the interactions and dynamics of protein populations, called 'proteomics'. Protein populations of interest include, but are not limited to, the total protein population of C. glutamicum (for example, compared to protein populations of other organisms), those proteins that are active under specific metabolic or environmental conditions. (eg during fermentation, at low or high temperature, or at low or high pH), or to those proteins that are active during specific growth and development phases.

Protein populations can be analyzed by various well known techniques, such as gel electrophoresis. Cellular proteins may be obtained, for example, by lysis or extraction, and may be separated from one another using a variety of electrophoretic techniques.

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) separates proteins largely based on their molecular weight. Isoelectric Focusing Polyacrylamide Gel Electrophoresis (IEF-PAGE) separates proteins by their isoelectric point (which reflects not only the amino acid sequence but also the post-translational modifications of the proteins). Another most preferred method of protein analysis is the consecutive combination of both IEF-PAGE and SDS-PAGE, known as 2-D-gel electrophoresis (described for example in Hermann et al. (1998) Electrophoresis 19: 3217-3221. Fountoulakis et al (1998) Electrophoresis 19: 1193-1202 Langen et al (1997) Electrophoresis 18: 1184-1192 Antelmann et al (1997) Electrophoresis 18: 1451-1463). Other separation techniques may also be used, such as capillary gel electrophoresis; Such techniques are well known in the art.

Proteins separated by these methodologies can be visualized by standard techniques such as staining or labeling. Suitable dyes are known in the art, and include Coomassie Bright Blue, silver dye, or fluorescent dyes such as Sypro Ruby (Molecular Probes). Inclusion of radiolabelled amino acids or other protein precursors (e.g., 34S-methionine, 35S-cysteine, 14C-labeled amino acids, 14N-amino acids, 15NC> 3 or 15NH3 or 15NH4 + or 13C-labeled amino acids) in C medium Glutamicum allows the labeling of the proteins of these cells prior to their separation. Similarly, fluorescent markers may be employed. These labeled proteins can be extracted, isolated and separated according to the previously described techniques.

Proteins visualized by these techniques can be further analyzed by measuring the amount of dye or marker used. The amount of a given protein may be quantitatively determined using, for example, optical methods and may be compared to the amount of other proteins in the same gel or other gels. Protein comparisons on gels can be made, for example, by optical comparison, spectroscopy, image scanning and gel analysis, or by using photographic screens and films. Such techniques are well known in the art.

[000173] To determine the identity of any given protein, direct sequencing or other standard techniques may be employed. For example, N- and / or C-terminal amino acid sequencing (such as Edman degradation) may be used, similarly mass spectrometry (in particular MALDI and ESI techniques (see, for example Langen et al. (1997) Electrophoresis 18: 1184-1192)). The protein sequences provided herein may be used for the identification of C. glutamicum proteins by these techniques.

The information obtained by these methods may be used to compare patterns of protein presence, activity, or modification between different samples of various biological conditions (eg, different organisms, fermentation time, medium conditions, or different biotypes, among others). Data obtained from such experiments alone, or in combination with other techniques, can be employed in various applications, such as to compare the behavior of various organisms in a given (eg metabolic) situation, to increase the productivity of strains producing the same. fine chemicals or to increase the efficiency of the production of fine chemicals.

Example 12 PREPARATION OF A CY YNEBA CTERIUM GLUTAMICUM DEFICIENT CUP IN THE METHYTHIN BIOSYNTHESIS NEGATIVE REGULATOR (RXA00655) [000175] The preparation of a negative biosynthesis regulator Corynebacterium glutamicum strain is performed by methionine5 (R5A )5. use of a self-cloning technique based on homologous recombination. The principle of such a technique is visualized in Figure 1.

The plasmid named pS_delta655 (SEQ ID NO: 3) for the preparation of a Corynebacterium glutamicum deficient strain on the negative methionine biosynthesis regulator (RXA00655) is constructed by ligation of fragments from the 5 'and 3' regions of RXA00655. (SEQ ID NO: 1), PCR amplified, in the pCLiK5MCS_integrativ_sacB vector (SEQ ID NO: 4) using standard methods (Sambrook et al. (1989), "Molecular Cloning. A Laboratory Manual", Cold Spring Harbor; Innis et al (1990) "PCR Protocols. A Guide to Methods and Applications", Academic Press). The PCR amplified 5 'fragment is flanked at its 5' end by a primer-introduced XhoI site and at its 3 'end by an endogenous Nhel site. The PCR-amplified 3 'fragment is flanked at its 5' end by an Nhel site followed by a TAA terminator codon, which are introduced by the primer, and at its 3 'end by a MluI site introduced by the primer.

[000177] pS_delta655 (SEQ ID NO: 3) is electroporated into C. glutamicum strain ATCC13032 as described (Liebl et al. (1989) FEMS Microbiol Let 53: 299-303). Transformants with integrated plasmids via intermolecular homologous recombination are selected on CM agar plates supplemented with 50 mg / l kanamycin.

CM Agar: 10.0 g / 1 D-glucose 2.5 g / 1 NaCl 2.0 g / 1 urea 10.0 g / 1 peptone bacto (Difco) 5.0 g / 1 yeast extract (Difco) 5.0 g / 1 meat extract (Difco) 22.0 g / 1 autoclaved agar (Difco) (20 min. 121 ° C) [000179] Kanamycin resistant clones are non-selectively incubated (without kanamycin) overnight in medium CM to achieve plasmid excision along with chromosomal copy of RXA00655. The cultures are plated on CM agar containing 10% sucrose. Only those clones in which the integrated pS_delta655 plasmid is excised can grow on sucrose-containing CM agar, because the sacB gene in pS_delta655 converts sucrose to levane sucrase, which is toxic to C. glutamicum. On excision both the RXA00655 deletion construct and the RXA00655 chromosomal copy are deleted together with the plasmid.

[000180] To identify a clone that has deleted the chromosomal copy of RXA00655, chromosomal DNAs from all potential clones are prepared Tauch et al (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828) and controlled with a Southern Blot analysis according to Sambrook et al. (1989), "Molecular Cloning. A Laboratory Manual", Cold Spring Harbor. The knockout strain is called ATCC13032_delta_rxa00655.

Example 15: Preparation of methionine with ATCC13032_DELTA_RXA00655 [000181] The ATCC13032 and ATCC13032-delta-rxa00655 strains are incubated on a CM agar plate for 2 days at 30 ° C. The cells are scraped from the plate and suspended in saline. For the main culture 10 ml of medium II and 0.5 g of autoclaved CaC03 (Riedel de Haen) in a 100 ml conical flask are inoculated with the cell suspension to a final OD 100 nm. Culture is performed at 30 ° C for 72 h.

Medium II: 40 g / l sucrose 60 g / l molasses (calculated based on 100% sugar content) 25 g / l (NH4) 2 SO4 0.4 g / l MgSO4 * 7H20 0.6 g / l KH2PO4 0.3 mg / l thiamine * HCl 1 mg / l biotin (from a sterile filtered 1 mg / ml solution adjusted to pH 8.0 with NLLOH) 2 mg / l FeSO4 2 mg / l MnSO 4 [000183] The pH is brought to pH 7.8 with NH4 OH. Then the medium is autoclaved (121 ° C, 20 min.). Additional vitamin B12 from a stock solution (200 pg / ml, sterile filtered) is added to a final concentration of 200 pg / l).

[000184] The amount of methionine formed was determined with an Agilent 1100 series LC system HPLC according to an Agilent method. Pre-column ortho-formaldehyde-derived amino acids are separated on a Hypersil AA (Agilent) column. The ATCC13032_delta_rxa00655 strain produces significantly more methionine than ATCC13032.

Example 16 PREPARATION OF A CORYNEBACTERIUM GLUTAMICUM CUP OVERCOMING METITIN BIOSYNTHESIS POSITIVE REGULATOR (RXN02910) [000185] The plasmid called pGrxn2910 (SEQ ID NO: 3) to overexpress the positive methionine biosynthesis regulator SEN ID10; : 5 or 6) is constructed by ligating a PCR-amplified fragment of RXN02910 (SEQ ID NO: 9) into the pG vector (SEQ ID NO: 12) using standard methods (Sambrook et al. (1989), "Molecular Cloning. A Laboratory Manual ", Cold Spring Harbor; Innis et al. (1990)" PCR Protocols. A Guide to Methods and Applications ", Academic Press). The following pair of oligonucleotide primers were used for amplification: sense primer (SEQ ID NO: 7): 5'-GAG AGACTCGAGTGGTTTAGGGGATGAGAAACCG-3 'antisense primer (SEQ ID NO: 8): 5' -CTCTC ACT AGTCT ACCGCGCC A AC A AC AGCG-3 '[000186] The PCR amplified fragment is flanked at its 5' end by a primer-introduced XhoI site and at its 3 'end by a primer-introduced BcuI site. The amplified fragments contain the RXN02910 open reading matrix (ORF) with additional 5 'regions of the corresponding gene including the promoter.

The resulting plasmid pGrxn02910 (SEQ ID NO: 13) is electroporated into C. glutamicum strain ATCC13032 as described (Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303). Transformants are selected on CM agar plates supplemented with 50 mg / l kanamycin (see above). The resulting strain is called ATCC 13032 / pGrxn02910.

Example 17 PREPARATION OF METIONIN WITH ATCC13032 / PGRXN02910 [000188] The ATCC 13032 and ATCC13032 / pGrxn02910 strains are incubated on a CM agar plate for 2 days at 30 ° C. The cells are scraped from the plate and suspended in saline. For the main culture 10 ml of medium II (see above) and 0.5 g of autoclaved CaCO3 (Riedel de Haen) in a 100 ml conical flask are inoculated with the cell suspension to a final OD 100 µm. Culture is performed at 30 ° C for 72 h. In the case of ATCC13032 / pGrxn02910 all plates and cultures contain additional 50 pg / l kanamycin. The amount of methionine formed was determined with an Agilent 1100 series LC system HPLC according to an Agilent method. Pre-column ortho-formaldehyde-derived amino acids are separated on a Hypersil AA (Agilent) column. The ATCC13032 / pGxm02910 strain produces significantly more methionine than ATCC13032.

EXAMPLE 18 PREPARATION OF A CORYNEBACTERIUM GLUTAMICUM CUP DEFICIENT IN THE METITIN BIOSYNTHESIS POSITIVE REGULATOR (RXN02910) [000189] The preparation of a deficient Corynebacterium glutamicum strain on the methionine dex10 (10X10) positive biosynthesis regulator is performed (RXN02910). vector selectable by kanamycin.

The plasmid called plntegrativ_delta2910 (SEQ ID NO: 15) for the preparation of a C. glutamicum strain deficient in the methionine biosynthesis regulator (rxn02910) is constructed by PCR amplified fragment binding of rxn02910 at Integrativ vector (SEQ ID NO: 14) using standard methods (Sambrook et al. (1989), "Molecular Cloning. A Laboratory Manual", Cold Spring Harbor; Innis et al. (1990) "PCR Protocols. A Guide to Methods and Applications, Academic Press "). The PCR amplified fragment (SEQ ID NO: 11) is flanked at its 5 'end by a primer-introduced XhoI site and at its 3' end by a primer-introduced EcoRV site.

Plntegrativ_delta2910 (SEQ ID NO: 15) is electroporated into the C. glutamicum ATCC strain 13032 as described (Liebl et al. (1989) FEMS Microbiol Let 53: 299-303). Integrated plasmid transformants via intermolecular homologous recombination are selected on CM agar plates supplemented with 50 mg / l kanamycin. To identify a clone that has an integrated plasmid and therefore the disrupted chromosomal copy of RXN02910, chromosomal DNAs from potential clones are prepared (Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994). Microbiotogy 140: 1817-1828) are controlled with a Southern Blot analysis according to Sambrook et al. (1989), Molecular Cloning. The Laboratory Manual, Cold Spring Harbor. 1000192] The knockout strain is called ATCC13032_delta_rxn02910. The amount of methionine formed was determined with an Agilent 1100 series LC system HPLC according to the Agilent method. Pre-column ortho-formaldehyde-derived amino acids are separated on a Hypcrsil AA (Agilent) column.

The ATCC13032_delta_rxn02910 strain produces significantly less methionine than ATCC 13032. thus demonstrating that rxn () 2910 is indeed a positive regulator of methionine biosynthesis.

Equivalents Those skilled in the art will recognize, or be able to evaluate using no more than routine experimentation, many equivalent to the specific embodiments of the invention described herein. Such equivalents are intended to be included in the following claims.

Table 1: Corynehacteriunt and Brevihacterium strains that can be used in the practice of the invention ATCC: American Typc Culture Collection, Rockville, MD, USA FERM: Fermentation Research Institute, Chiba, Japan NRRL: ARS Culture Collection, Northern Regional Research Laboratory, Peoria , IL, USA CECT: Spanish Type Culture Collection, Valencia, Spain NCIMB: National Collection of Industrial and Marine Bacteria Ltd., Aberdeen, UK CBS: Centraalbureau voor Schimmelcultures, Baam, NL NCTC: National Collection of Type Cultures, London, UK DSMZ: Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany.

[000195] For reference see Sugawara, H. et al. (1993) "World Directory of Collections of Cultures of Microorganisms: Bacteria, Fungi and Yeasts (4 * edn), World Federation for Culture Collections World Data Center on Microorganisms", Saimata, Japan.

LIST OF SEO <110> BASF Aktiengesellschaft <120> Methods for methionine production <130> AE20020777 AE20020776 <140> <141> <160> 23 <I70> Patentln Ver. 2.1 <210> 1 <211> 761 <2l2> DNA <213> Corynebacterium glutamicum <220>

<221> CDS <222> (101) .. (739} <223> methionine biosynthesis negative regulator encoder <40Q> 1 ttgcctgtgg attaaaact tacgaaccgg tttgtctata ttggtgttag acagttcgga 60 gtatcttgaa ac gaggac Ser Ala 1 5 tea ggc aag agt aaa aca agt gcc ggg gea aac cgt cgc aat cga 163 Ser Gly Lys Ser Lys Thr Ser Ala Gly Ala Asn Arg Arg Asn Arg 10 15 20 cca age ccc cag cgt ctc gat age gea acc aac ctt ttc acc 211 Pro Ser Pro Arg Gin Arg Read Leu Asp Ser Wing Asa Thr Asn Leu Phe Thr 25 30 35 aca gaa ggt att cgc gtt att gat cgt up ctc cgt gaa gct 259 Thr Glu Gly Ile Arg Go Ile Gly Ile Asp Arg Ile Leu Arg Glu Wing 40 45 50 gac gtg gcg aag gcg age etc tat tcc ctt ttc gga tcg aag gac gcc 307 Asp Go Ala Lys Ala Ser Leu Tyr Ser Leu Phe Gly Ser Lys Asp Ala 55 60 65 ttg gtt att gea tac ctg gag aac etc gat cag ctg tgg cgt gaa gcg 355 Leu Go Ile Wing Tyr Leu Glu Asn Leu Asp Gin Leu Trp Arg Glu Ala 70 75 80 85 tgg cgt gag cgc acc gtc g gt atg aag gat ccg gaa gat aaa till 403 Trp Arg Glu Arg Thr Go Gly Met Lys Asp Pro Glu Asp Lys Ile Ile 90 95 100 gcg ttc ttt gat cag tgc att gag gaa gaa cca gaa aaa gat ttc cgc 451 Ala Phe Phe Asp Gin Cys Ile Glu Glu Glu Pro Glu Lys Asp Phe Arg 105 110 115 ggc tcg cac ttt cag aat gcg gct agt gag tac ccg ccc gaa act 499 Gly Be His Phe Gin Asn Wing Ala Ser Glu Tyr Pro Arg Pro Glu Thr 120 125 130 gat age gaa aag ggc att gtt gea gea gtg tta gag cac cgc gag tgg 547 Asp Ser Glu Lys Gly Ile Go Wing Ala Go Leu Glu His Arg Glu Trp 135 140 145 tgt cat aag act ctg act gat ttg ctc act gag aag aac ggc tac cca 595 Cys His Lys Thr Leu Thr Asp Leu Thr Leu Thr Glu Lys Asn Gly Tyr Pro 150 155 160 165 ggc acc acc cag gcg aat cag ttg gtg ttc ctt gat ggt gga ctt 643 Gly Thr Thr Gin Ala Asn Gin Leu Leu Go Phe Leu Asp Gly Gly Leu 170 175 180 180 gct gga tet cga ttg gtc cac aac till agt cct gtt gag acg cgc 691 Wing Gly Ser Arg Leu Go His Asn Ile Ser Pro Leu Glu Thr Ala 185 185 195 gat ttg gct cgg cag ttg ttg tcg gct cca cct gcg gac tac tca att 739 Asp Leu Wing Ala Arg Gin Leu Sera Wing Pro Pro Asp Tyr Ser Ile 200 205 210 tagtttcttc attttccgaa ggg 762 <210> 2 <211> 213 <212> PRT <213 > Corynebacterium glutamícum <400> 2 Go Wing Wing Be Wing Be Gly Lys Be Wing Lys Thr Be Wing Gly Wing Asn 15 10 15 Arg Arg Arg Asn Arg Pro Be Pro Arg Gin Arg Read Le Asp Be Wing 20 25 30 Thr Asn Leu Phe Thr Thr Glu Gly Ile Arg Go Ile Gly Ile Asp Arg 35 40 45 Ile Leu Arg Glu Wing Asp Go Wing Lys Wing Be Leu Tyr Be Leu Phe 50 55 60 Gly Ser Lys Asp Wing Leu Go Ile Tyr Leu Glu Asn Leu Asp Gin 65 70 75 80 Leu Trp Arg Glu Wing Trp Arg Glu Arg Thr Go Gly Met Lys Asp Pro 85 90 95 Glu Asp Lys Ile Ile Wing Phe Phe Asp Gin Cys Ile Glu Glu Glu Pro 100 105 110 Glu Lys Asp Phe Arg Gly Be His Phe Gin Asn Wing Ward Be Glu Tyr 115 120 125 Pro Arg Pro Glu Thr Asp Be Glu Lys Gly Ile Go Wing Wing Go Leu 130 135 140 Glu His Arg Glu Trp Cys His Lys Thr Leu Thr Asp Leu Thr Glu 145 150 155 160 Lys Asn Gly Tyr Pro Gl y Thr Thr Gin Asn Gin Wing Read Leu Go Phe 165 170 175 Leu Asp Gly Gly Leu Wing Gly Be Arg Leu Go His Asn Ile Be Pro 180 185 190 Leu Glu Thr Wing Arg Asp Leu Arg Wing Leu Ser Ala Pro Pro 195 200 205 Asp Wing Tyr Ser Ile 210 <210> 3 <211> 4900 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Knockout Vector Construct pS_delta655 <220> <221> Varied Character < 222> (14) .. (295) <223> 5'-fragment of RXA00655 sequence <220> <221> miscellaneous feature <222> (305) .. (614) <223> RXA0655 sequence fragment-3 ' <220> <221> miscellaneous feature <222> Complement ((3003) .. (4424)) <223> Bacillus subtilis levane sucrase (sacB) encoder <220> <221> promoter <222> Complement ((4425) .. (4887)) <220> <221> miscellaneous feature <222> (1042) .. (1833) <223> kanamycin resistance encoder <220> <221> promoter <222> Complement ((4425) .. (4887)) <223> promoter region for sacB <220> <221> miscellaneous feature <222> ( 1042) .. (1833) <223> Tn5 kanamycin resistance <220> <221> miscellaneous feature <222> Complement ((2100) .. (2960)) <223> pMB Ori for replication in E.coli < 400> 3 tttaaatctc gagtgccggt ggcggcttga tcttcagctt catcacatgt ctgattggtg 60 ctgtcatttt gctgacgatc gtgcagttct tcactcggaa gaagtaatct gctttaaatc 120 cgtagggcct gttgatattt cgatatcaac aggccttttg gtcattttgg ggtggaaaaa 180 gcgctagact tgcctgtgga ttaaaactat acgaaccggt ttgtctatat tggtgttaga 240 cagttcgtcg tatcttgaaa cagaccaacc cgaaaggacg tggccgaacg tggctgctag 300 ctaatccttg atggtggact tgctggatct cgattggtcc acaacatcag tcctcttgag 360 acggctcgcg atttggctcg gcagttgttg tcggctccac ctgcggacta ctcaatttag 420 tttcttcatt ttccgaaggg gtatcttcgt tgggggaggc gtcgataagc cccttctttt 480 tagctttaac ctcagcgcga cgctgcttta agcgctgcat ggcggcgcgg ttcatttcac 540 gttgcgtttc gcgcctcttg ttcgcgattt ctttgcgggc ctgttttgct tcgttgattt 600 cggcagtacg ggttacgcgt catatgacta gttcggacct agggatatcg tcgacatcga 660 tgctcttctg cgttaattaa caattgggat cctctagacc cgggatttaa atcgctagcg 720 ggctgctaaa ggaagcggaa cacgtagaaa gccagtccgc agaaacggtg ctgaccccgg 780 atgaatgtca gctactgggc tatctggaca agggaaaacg caagcgcaaa gagaaagcag 840 gtagcttgca gtgggcttac atggcgatag ctagactggg cggttttatg gacagcaagc 900 gaaccggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac 960 tggatggctt tcttgccgcc aaggatctga tggcgcaggg gatcaagatc tgatcaagag 1020 acaggatgag gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc 1080 gcttgggtgg agaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat 1140 gccgccgtgt tccggctgtc agcgcagggg cgcccggttc tttttgtcaa gaccgacctg 1200 tccggtgccc tgaatgaact gcaggacgag gcagcgcggc tatcgtggct ggccacgacg 1260 ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgcta 1320 ttgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta 1380 tccatcatgg ctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc 1440 gaccaccaag cgaaacatcg catcgagcga gcacgtactc ggatggaagc cggtcttgtc 1500 gatcaggatg atctggacga agagcatcag gggctcgcgc cagccgaact gttcgccagg 1560 ctcaaggcgc gcatgcccga cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg 1620 ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtgg ccggctgggt 1680 gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga agagcttggc 1740 ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc 1800 atcgccttct atcgccttct tgacgagttc ttctgagcgg gactctgggg ttcgaaatga 1860 ccgaccaagc gacgcccaac ctgccatcac gagatttcga ttccaccgcc gccttctatg 1920 aaaggttggg cttcggaatc gttttccggg acgccggctg gatgatcctc cagcgcgggg 1980 atctcatgct ggagttcttc gcccacgcta gcggcgcgcc ggccggcccg gtgtgaaata 2040 ccgcacagat gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact 2100 gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta 2160 atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag 2220 caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc 2280 cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta 2340 taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 2400 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc 2460 tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac 2520 gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac 2580 ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg 2640 aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga 2700 aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt 2760 agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag 2820 cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct 2880 gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg 2940 atcttcacct agatcctttt aaaggccggc cgcggccgcc atcggcattt tcttttgcgt 3000 ttttatttgt taactgttaa ttgtccttgt tcaaggatgc tgtctttgac aacagatgtt 3060 ttcttgcctt tgatgttcag caggaagctc ggcgcaaacg ttgattgttt gtctgcgtag 3120 aatcctctgt ttgtcatata gcttgtaatc acgacattgt ttcctttcgc ttgaggtaca 3180 gcgaagtgtg agtaagtaaa ggttacatcg ttaggatcaa gatccatttt taacacaagg 3240 ccagtt TTGT tcagcggctt gtatgggcca gttaaagaat tagaaacata accaagcatg 3300 taaatatcgt tagacgtaat gccgtcaatc gtcatttttg atccgcggga gtcagtgaac 3360 aggtaccatt tgccgttcat tttaaagacg ttcgcgcgtt caatttcatc tgttactgtg 3420 tcagcggttt catcactttt ttcagtgtgt ttagatgcaa aatcatcgtt tagctcaatc 3480 ataccgagag cgccgtttgc taactcagcc gtgcgttttt tatcgctttg cagaagtttt 3540 tgactttctt gacggaagaa tgatgtgctt ttgccatagt atgctttgtt aaataaagat 3600 tcttcgcctt ggtagccatc ttcagttcca gtgtttgctt caaatactaa gtatttgtgg 3660 cctttatctt ctacgtagtg aggatctctc agcgtatggt tgtcgcctga gctgtagttg 3720 ccttcatcga tgaactgctg tacattttga tacgtttttc cgtcaccgtc aaagattgat 3780 ttataatcct ctacaccgtt gatgttcaaa gagctgtctg atgctgatac gttaacttgt 3840 gcagttgtca gtgtttgttt gccgtaatgt ttaccggaga aatcagtgta gaataaacgg 3900 atttttccgt cagatgtaaa tgtggctgaa cctgaccatt cttgtgtttg gtcttttagg 3960 atagaatcat ttgcatcgaa tttgtcgctg tctttaaaga cgcggccagc gtttttccag 4020 ctgtcaatag aagtttcgcc gactttttga tagaacatgt aaatcgatgt gtcatccgca 4080 tttttaggat c tccggctaa tgcaaagacg atgtggtagc cgtgatagtt tgcgacagtg 4140 ccgtcagcgt tttgtaatgg ccagctgtcc caaacgtcca ggccttttgc agaagagata 4200 tttttaattg tggacgaatc aaattcagaa acttgatatt tttcattttt ttgctgttca 4260 gggatttgca gcatatcatg gcgtgtaata tgggaaatgc cgtatgtttc cttatatggc 4320 ttttggttcg tttctttcgc aaacgcttga gttgcgcctc ctgccagcag tgcggtagta 4380 aaggttaata ctgttgcttg ttttgcaaac tttttgatgt tcatcgttca tgtctccttt 4440 tttatgtact gtgttagcgg tctgcttctt ccagccctcc tgtttgaaga tggcaagtta 4500 gttacgcaca ataaaaaaag acctaaaata tgtaaggggt gacgccaaag tatacacttt 4560 gccctttaca cattttaggt cttgcctgct ttatcagtaa caaacccgcg cgatttactt 4620 ttcgacctca ttctattaga ctctcgtttg gattgcaact ggtctatttt cctcttttgt 4680 ttgatagaaa atcataaaag gatttgcaga ctacgggcct aaagaactaa aaaatctatc 4740 tgtttctttt cattctctgt attttttata gtttctgttg catgggcata aagttgcctt 4800 tttaatcaca attcagaaaa tatcataata tctcatttca ctaaataata gtgaacggca 4860 ggtatatgtg atgggttaaa aaggatcggc ggccgctcga 4900 <210> 4 < 211> 4323 <212> DNA <213> Sequence artificial strength <220>

<223> Description of artificial sequence: pCLiK5MCS \ integrativ \ sacB vector <220> <221> miscellaneous feature <222> Complement ((2418) .. (3839)) <223> Levilline sucrase (sacB) encoder from Bacillus subtilis < 220> <221> promoter <222> Complement ((3840) .. (4302)) <223> sacB promoter <220> <221> miscellaneous feature <222> (457) .. (1248) <223> resistance to Tn5 kanamycin <220> <221> miscellaneous feature <222> Complement ((1515) .. (2375)) <223> pMB Ori for replication in E.coli <400> 4 tcgagaggcc tgacgtcggg cccggtacca cgcgtcatat gactagttcg gaccccgggatgctcggctcggctcggctcggctcggctcggctcggctcggcgg ttctgcgtta attaacaatt gggatcctct agacccggga 120 tttaaatcgc tagcgggctg ctaaaggaag cggaacacgt agaaagccag tccgcagaaa 180 cggtgctgac cccggatgaa tgtcagctac tgggctatct ggacaaggga aaacgcaagc 240 gcaaagagaa agcaggtagc ttgcagtggg cttacatggc gatagctaga ctgggcggtt 300 ttatggacag caagcgaacc ggaattgcca gctggggcgc cctctggtaa ggttgggaag 360 ccctgcaaag taaactggat ggctttcttg ccgccaagga tctgatggcg 420 caggggatca agatctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga tggattgcac 480 gcaggttctc cggccgcttg ggtggagagg ctattcggct atgactgggc acaacagaca 540 atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt 600 gtcaagaccg acctgtccgg tgccctgaat gaactgcagg acgaggcagc gcggctatcg 660 tggctggcca cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac tgaagcggga 720 agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct 780 cctgccgaga aagtatccat catggctgat gcaatgcggc ggctgcatac gcttgatccg 840 gctacctgcc cattcgacca ccaagcgaaa catcgcatcg agcgagcacg tactcggatg 900 gaagccggtc ttgtcgatca ggatgatctg gacgaagagc atcaggggct cgcgccagcc 960 gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt cgtgacccat 1020 ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg attcatcgac 1080 tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac ccgtgatatt 1140 gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg tatcgccgct 1200 cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg agcgggactc 1260 tggggttcga aat gaccgac caagcgacgc ccaacctgcc atcacgagat ttcgattcca 1320 ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc ggctggatga 1380 tcctccagcg cggggatctc atgctggagt tcttcgccca cgctagcggc gcgccggccg 1440 gcccggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc 1500 gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct 1560 cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg 1620 tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc 1680 cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga 1740 aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct 1800 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg 1860 gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag 1920 ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat 1980 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac 2040 aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac 2100 tacggctaca ctagaagga c agtatttggt atctgcgctc tgctgaagcc agttaccttc 2160 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt 2220 tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc 2280 ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg 2340 agattatcaa aaaggatctt cacctagatc cttttaaagg ccggccgcgg ccgccatcgg 2400 cattttcttt tgcgttttta tttgttaact gttaattgtc cttgttcaag gatgctgtct 2460 ttgacaacag atgttttctt gcctttgatg ttcagcagga agctcggcgc aaacgttgat 2520 tgtttgtctg cgtagaatcc tctgtttgtc atatagcttg taatcacgac attgtttcct 2580 ttcgcttgag gtacagcgaa gtgtgagtaa gtaaaggtta catcgttagg atcaagatcc 2640 atttttaaca caaggccagt tttgttcagc ggcttgtatg ggccagttaa agaattagaa 2700 acataaccaa gcatgtaaat atcgttagac gtaatgccgt caatcgtcat ttttgatccg 2760 cgggagtcag tgaacaggta ccatttgccg ttcattttaa agacgttcgc gcgttcaatt 2820 tcatctgtta ctgtgttaga tgcaatcagc ggtttcatca cttttttcag tgtgtaatca 2880 tcgtttagct caatcatacc gagagcgccg tttgctaact cagccgtgcg ttttttatcg 2940 ctttgcagaa gtttttgact TTCT tgacgg aagaatgatg tgcttttgcc atagtatgct 3000 ttgttaaata aagattcttc gccttggtag ccatcttcag ttccagtgtt tgcttcaaat 3060 actaagtatt tgtggccttt atcttctacg tagtgaggat ctctcagcgt atggttgtcg 3120 cctgagctgt agttgccttc atcgatgaac tgctgtacat tttgatacgt ttttccgtca 3180 ccgtcaaaga ttgatttata atcctctaca ccgttgatgt tcaaagagct gtctgatgct 3240 gatacgttaa cttgtgcagt tgtcagtgtt tgtttgccgt aatgtttacc ggagaaatca 3300 gtgtagaata aacggatttt tccgtcagat gtaaatgtgg ctgaacctga ccattcttgt 3360 gtttggtctt ttaggataga atcatttgca tcgaatttgt aaagacgcgg cgctgtcttt 3420 ccagcgtttt tccagctgtc aatagaagtt tcgccgactt tttgatagaa catgtaaatc 3480 gatgtgtcat ccgcattttt aggatctccg gctaatgcaa agacgatgtg gtagccgtga 3540 tagtttgcga cagtgccgtc agcgttttgt aatggccagc tgtcccaaac gtccaggcct 3600 tttgcagaag agatattttt aattgtggac gaatcaaatt cagaaacttg atatttttca 3660 tttttttgct gttcagggat ttgcagcata tcatggcgtg taatatggga aatgccgtat 3720 gtttccttat atggcttttg gttcgtttct ttcgcaaacg cttgagttgc gcctcctgcc 3780 agcagtgcgg tagtaaaggt taatactgtt gcttgttttg caaacttttt gatgttcatc 3840 gttcatgtct ccttttttat gtactgtgtt agcggtctgc ttcttccagc cctcctgttt 3900 gaagatggca agttagttac gcacaataaa aaaagaccta aaatatgtaa ggggtgacgc 3960 caaagtatac actttgccct ttacacattt taggtcttgc ctgctttatc agtaacaaac 4020 ccgcgcgatt tacttttcga cctcattcta ttagactctc gtttggattg caactggtct 4080 attttcctct tttgtttgat agaaaatcat aaaaggattt gcagactacg ggcctaaaga 4140 actaaaaaat ctatctgttt cttttcattc tctgtatttt ttatagtttc tgttgcatgg 4200 gcataaagtt gcctttttaa tcacaattca gaaaatatca taatatctca tttcactaaa 4260 taatagtgaa cggcaggtat atgtgatggg ttaaaaagga tcggcggccg ctcgatttaa 4320 to 4323 <210> 5 <211> 828 <212> DNA <213> Corynebacterium glutamicum <

<221> CDS <222> (101) .. (805) <223> code for positive methionine biosynthesis regulator (RXA02910) <400> 5 aacctaggcc gatacccatg tggaaatctc gacgtcttaa atggacgatt Go Glu Ile Arg Trp 1 5 ttg gaa ggc ttt till gcg gtc gcg gaa gaa ttg cac ttt agt aat gct 163 Leu Glu Gly Phe Ile Ala Go Ala Glu Glu Leu His Phe Ser Asn Ala 10 15 20 gcg att cgt ttg ggg atg ccg caa tcg ccg ttg agt cag ttg up to cgg 211 Ala Ile Arg Leu Gly Met Pro Gin Ser Pro Leu Ser Gin Leu Ile Arg 25 30 35 cgg ttg gag ttg gag cg aag ctt ttt gat cgc agt acc cgg 259 Arg Leu Glu Ser Glu Leu Gly Gin Lys Leu Phe Asp Arg Ser Thr Arg 40 45 50 tcg gtg gag tta act gcc gcg ggt cgg ttt ttg cca cat gcc agg 307 Be Go Glu Leu Thr Wing Ala Gly Arg Wing Phe Leu Pro His Wing Arg 55 60 65 ggg att gtg gcg age gct gcg gtg gcg agg gaa gct gtg aat gct gcc 355 Gly Ile Go Wing Be Wing Wing Go Wing Arg Wing Glu Wing Go Asn Wing Wing 70 75 80 85 gag ggg gag a you gtt ggt gtt gtt cgc att ggt ttt tet ggt gtg ctg 403 Glu Gly Glu Ile Go Gly Go Go Arg Ile Gly Phe Ser Gly Goes Read 95 95 100 aac tat tcc acg ctg ccg ctt gtg cat aaa cgg ctt 451 Asn Tyr Be Thr Read Leu Pro Read Leu Thr Be Glu Go His Lys Arg Leu 105 110 115 cct aat gtg gag ttg gag ctc gtt ggt cag aag ttg acg gaa gcg 499 Pro Asn Go Glu Leu Glu Leu Go Gly Gin Lys Leu Thr Arg Glu Ala 120 125 130 gta agt ttg ctg cgc ttg ggg gcg ttg gat att acg ttg atg ggt ttg 547 Will Be Leu Leu Arg Leu Gly Alu Leu Asp Ile Thr Leu Met Gly Leu 135 140 145 ccc att gag gat cca gag att gag act cgg ctg att agt ttg gaa gag 595 Pro Ile Glu Asp Pro Ile Glu Ile Glu Thr Arg Leu Ile Ser Leu Glu Glu 150 155 160 165 ttt tgc gtg gtg ttg ccg aag gat cat cgt ggg gaa gga gtg 643 Phe Cys Go Leu Pro Lys Asp His Arg Read Ala Gly Glu Gly Go 170 175 180 180 gtg gat ttg gtg gat ctg gct aaa gat ggg ttt gtg acg acg ccg gag 691 Go Asp Leu Go Asp Leu Alys Lys Asp Gly Phe Go Thr Thr Pro Glu 185 190 195 ttt gcg ggg tct gtg ttt agg aat tcc acc ttt cag ttg tgt gct 739 Phe Ala Gly Will Go Phe Arg Asn Ser Thr Phe Gin Leu Cys Ala Glu 200 205 210 gct ggt ttt gtg ccg agg till age cag caa gtt aat gat cct tac atg 787 Gly Phe Wing Go To Arg Ile Be Gin Gin Go Asn Asp Pro Tyr Met 215 220 225 gcg ctg ttg ttg gcg cgg tagtcaatca tggggagta tcc 828 Wing Leu Read Leu Wing Arg 230 235 <210> 6 <211> 235 <212> PRT <213> Corynebacterium glutamicum <400> 6 Go Glu Ile Arg Trp Read Glu Gly Phe Ile Wing Go Wing Glu Glu Leu 15 10 15 His Phe Ser Asn Wing Ile Arg Leu Gly Met Pro Gin Be Pro Leu 20 25 30 Ser Gin Leu Ile Arg Arg Leu Glu Be Glu Leu Gly Gin Lys Leu Phe 35 40 45 Asp Arg Be Thr Arg Be Go Glu Leu Thr Wing Wing Gly Arg Wing Phe 50 55 60 Leu Pro His Wing Arg Gly Ile Go Wing Be Wing Wing Go Wing Arg Glu 65 70 75 80 Wing Go Asn Wing Glu Wing Gly Glu Ile Go Gly Go Arg Ile Gly 85 90 95 Phe Be Gly Go Leu Asn Tyr Be Thr Leu Pro Read Leu Thr Be Glu 100 105 110 Go His Lys Arg Leu Pro Asn Go Glu Leu Glu Leu Go Gly Gin Lys 115 120 125 Leu Thr Arg Glu Wing Will Be Leu Leu Arg Leu Gly Wing Leu Asp Ile 130 135 140 Thr Leu Met Gly Leu Pro Ile Glu Asp Pro Glu Ile Glu Thr Arg Leu 145 150 155 160 Ile Ser Leu Glu Glu Phe Cys Go Go Read Leu Pro Lys Asp His Arg Leu 165 170 175 Wing Gly Glu Gly Go Go Asp Leu Go Asp Leu Wing Lys Asp Gly Phe 180 185 190 Go Go Thr Thr Pro Glu Phe Wing Gly Be Go Phe Arg Asn Be Thr Phe 195 200 205 Gin Leu Cys Wing Glu Wing Gly Phe Go To Arg Ile Be Gin Gin Go 210 215 220 Asn Asp Pro Tyr Met Wing Leu Read Leu Wing Arg 225 230 235 <210> 7 <211> 34 <212> DNA < 213> Artificial sequence <220> <223> Description of artificial sequence: oligonucleotide primer <220> <221> miscellaneous feature <222> (1) .. (34) <223> sense primer <400> 7 gagagactcg agtggtttag gggatgagaa accg 34 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: oligonucleotide primer <220> <221> miscellaneous feature <222> (1) .. (31) < 223> start antisense pain <400> 8 ctctcactag tctaccgcgc caacaacagc g 31 <210> 9 <211> 990 <212> DNA <213> Corynebacterium glutamicum <220> <221> miscellaneous feature <222> (1) .. (12) <223> PCR linked synthetic linker <220> <221> miscellaneous feature <222> (980) .. (990) <223> PCR linked synthetic linker <220> <221> promoter <222> (13) .. (271) <223> rxa02910 <220> gene promoter and untranslated region <220>

<221> CDS <222> (272) .. (976) <223> coding for the positive regulator of methionine biosynthesis (rxa02910) <400> 9 gagagactcg agtggtttag gggatgagaa accggacaca cgtgccaaaa cttcggcttt 60 ttcgccaatc ttgtcacgcc tgtctggttt gcctcggatg aggtgatttc atggccaaga 120 cttctaaaag ttcgacctcg caggatcgct tctaagggcc tttagcggac caacctaggc 180 cgatacccat gtggaaatct cgacgtctta aatggacgat tggagctaaa accacgaaca 240 gctgggattt tccacgatag gattgggtct c gtg gag att cgt tgg ttg gaa 292 will Glu Ile Arg Trp Leu Glu 1 5 ggc ttt ate gcg gtc gcg gaa gaa ttg cac ttt agt aat gct gcg att 340 Gly Phe Ile Ala Go Ala Glu Glu Leu His Phe Ser Asn Ala Ala Ile 10 15 20 cgt ttg ggg atg ccg caa tcg ccg ttg agt cag ttg 388 Arg Leu Gly Met Pro Gin Ser Pro Leu Ile Arg Arg Read 25 30 35 gag tcg gag ttg ggg cag aag ctt ttt gat cgc agt acc cgg tcg gtg 436 Glu Ser Glu Leu Gly Gin Lys Leu Phe Asp Arg Ser Thr Arg Ser Go 40 45 50 55 gag tta act gcc ggg cgg gcg ttt ttg cca cat gcc agg ggg att 484 Glu Leu Thr Ala Ala Gly Arg Ala Phe Leu Pro His Ala Arg Gly Ile 60 65 70 gtg gcg age gct gcg ggg agg gaa gct gtg aat gct gcc gag ggg 532 Go Ala Ser Ala Go Ala Arg Glu Ala Go Asn Ala Glu Gly 75 80 85 gag till gtt ggt gtt gtt cgc att ggt ttt tet ggt gtg ctg aac tat 580 Glu Ile Go Gly Go Go Arg Ile Gly Phe Ser Gly Go Read Asn Tyr 90 95 100 tcc acg ctg ccg ctt ttg acc agag gtg cat aaa cgg ctt cct aat 628 Ser Thr Leu Pro Leu Thr Read Glu Go His Lys Arg Leu Pro Asn 105 110 115 gtg gag ttg gag etc gtt ggt cag aag ttg acg gaa gcg gta agt 676 Go Glu Leu Glu Leu Go Gly Gin Lys Leu Thr Arg Glu Ala Will Be 120 125 130 135 ttg ctg cgc ttg ggg gcg ttg gat att acg ttg atg ggt ttg ccc att 724 Leu Leu Arg Leu Gly Alu Leu Asp Ile Thr Leu Met Gly Leu Pro Ile 140 145 150 gag gat cca gag att gag act cgg ctg att agt ttg gaa gag ttt tgc 772 Glu Asp Pro Glu Ile Glu Thr Arg Leu Ile Ser Leu Glu Glu Phe Cys 155 160 165 gtg gtg ttg ccg cat cat cgt ggg gaa gga gtg 8 gt20 Go Go Leu Pro Lys Asp His Arg Leu Wing Gly Glu Gly Goes Go Asp 170 175 180 180 ttg gtg gat ctg aaa gat ggg ttt gtg acg acg ccg gag ttt gcg 868 Leu Goes Asp Leu Wing Alys Lys Asp Gly Phe Goes Thr Thr Pro Glu Phe Ala 185 190 195 ggg tet gtg ttt agg aat tcc acc ttt cag ttg tgt gct gag gct 916 Gly Will Go Phe Arg Asn Ser Thr Phe Gin Leu Cys Ala Glu Ala Gly 200 205 210 215 ttt gtg ccg agg till age cag caa gtt aat gat cct tac atg gcg ctg 964 Phe Go To Arg Ile Be Gin Gin Go Asn Asp Pro Tyr Met Ala Leu 220 225 230 ttg ttg gcg cgg tagactagtg agag 990 Leu Leu Arg Wing 235 <210> 10 <211> 235 <212> PRT <213> Corynebacterium glutamicum <400> 10 Go Glu Ile Arg Trp Leu Glu Gly Phe Ile Wing Go Wing Glu Glu Leu 15 10 15 His Phe Ser Asn Wing Ile Arg Leu Gly Met Pro Gin Ser Pro Leu 20 25 30 Ser Gin Leu Ile Arg Arg Leu Glu Be Glu Leu Gly Gin Lys Leu Phe 35 40 45 Asp Arg Ser Xhr Arg Be Go Glu Leu Thr Wing Wing Gly Arg Wing Phe 50 55 60 Leu Pro His Wing Arg Gly Ile Go Wing Be Wing Ala Go Wing Arg Glu 65 70 75 80 Wing Go Asn Wing Wing Glu Gly Glu Ile Go Gly Go Go Arg Ile Gly 85 90 95 Phe Ser Gly Go Read Asn Tyr Be Thr Leu Pro Leu Thr Be Glu 100 105 110 Go His Lys Arg Leu Pro Asn Go Glu Leu Glu Leu Go Gly Gin Lys 115 120 125 Leu Thr Arg Glu Wing Will Be Leu Leu Arg Leu Gly Wing Leu Asp Ile 130 135 140 Thr Leu Met Gly Leu Pro Ile Glu Asp Pro Glu Ile Glu Thr Arg Leu 145 150 155 160 Ile Ser Leu Glu Glu Phe Cys Go Go Read Leu Pro Lys Asp His Arg Leu 165 170 175 Wing Gly Glu Gly Go Go Asp Leu Go Asp Leu Wing Lys Asp Gly Phe 180 185 190 Go Go Thr Thr Pro Glu Phe Ala Gly Be Go Phe Arg Asn Be Thr Phe 195 200 205 Gin Leu Cys Wing Glu Wing Gly Phe Go To Arg Ile Be Gin Gin Go 210 215 220 Asn Asp Pro Xyr Met Wing Leu Leu Leu Wing Arg 225 230 235 <210> 11 <211> 439 <212> DNA <213 > Artificial sequence <220> <223> Description of artificial sequence: knockout PCR fragment rxa02910 <400> 11 tatactcgag ttgatcgcag tacccggtcg gtggagttaa ctgccgcggg tcgggcgttt 60 ttgccacatg ccggggggg taggggggg gctgcggtgg cgagggaagc tgtgaatgct 120 gccgaggggg agatcgttgg tgttgttcgc attggttttt ctggtgtgct gaactattcc 180 acgctgccgc ttttgaccag tgaggtgcat aaacggcttc ctaatgtgga gttggagctc 240 gttggtcaga agttgacgag ggaagcggta agtttgctgc gcttgggggc gttggatatt 300 acgttgatgg gtttgcccat tgaggatcca gagattgaga ctcggctgat tagtttggaa 360 gagttttgcg tggtgttgcc gaaggatcat cgtcttgcgg gggaaggagt ggtggatttg 420 gtggatctgg atatcagag 439 <210> 12 <211> 5156 <212> DNA <213> Artificial Sequence <220>

<223> Description of artificial sequence: vector for Corynebacterium glutamicum pG <220> <221> terminator <222> (125) .. (184) <223> GroEL terminator <220> <221> miscellaneous feature <222> (534) .. (1325) <223> Tn5 kanamycin resistance gene <220> <221> miscellaneous feature <222> (3606) .. (4727) <223> Rep gene for C.glutamicum replication <220> <221> miscellaneous feature <222> (2598) .. (3272) <223> 0RF1 for replication in C.glutamicum <220> <221> miscellaneous feature <222> Complement ((1592) .. (2452)) <223> pMB Ori for E.coli replication <400> 12 tcgatttaaa tctcgagagg cctgacgtcg ggcccggtac cacgcgtcat atgactagtt 60 cggacctagg gatatcgtcg acatcgatgc tcttctgcgt taattaacaa ttgggatcct 120 ctagagttct gtgaaaaaca ccgtggggca gtttctgctt cgcggtgttt tttatttgtg 180 gggcactaga cccgggattt aaatcgctag cgggctgcta aaggaagcgg aacacgtaga 240 aagccagtcc gcagaaacgg tgctgacccc ggatgaatgt cagctactgg gctatctgga 300 caagggaaaa cgcaagcgca aagagaaagc aggtagcttg cagtgggctt acatggcgat 360 agctagactg ggcggtttta tggacagcaa gcgaaccgga attgccagct ggggcgccct 420 ctggtaaggt tgggaagccc tgcaaagtaa actggatggc tttcttgccg ccaaggatct 480 gatggcgcag gggatcaaga tctgatcaag agacaggatg aggatcgttt cgcatgattg 540 aacaagatgg attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg 600 actgggcaca acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg 660 ggcgcccggt tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg 720 aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg 780 ttgtcactga agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc 840 tgtcatctca c cttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc 900 tgcatacgct tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc 960 gagcacgtac tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc 1020 aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg 1080 atctcgtcgt gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct 1140 catcgactgt ggccggctgg gtgtggcgga tttctggatt ccgctatcag gacatagcgt 1200 tggctacccg tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc 1260 tttacggtat cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt 1320 tcttctgagc gggactctgg ggttcgaaat gaccgaccaa gcgacgccca acctgccatc 1380 acgagatttc gattccaccg ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg 1440 ggacgccggc tggatgatcc tccagcgcgg ggatctcatg ctggagttct tcgcccacgc 1500 tagcggcgcg ccggccggcc cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc 1560 gcatcaggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 1620 ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata 1680 acgcaggaaa gaacatgtg the gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 1740 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 1800 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 1860 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 1920 tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt 1980 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 2040 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 2100 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 2160 tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc 2220 tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 2280 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 2340 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 2400 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaaggccg 2460 gccgcggccg cgcaaagtcc cgcttcgtga aaattttcgt gccgcgtgat tttccgccaa 2520 aaactttaac gaacgttcgt tata atggtg tcatgacctt cacgacgaag tactaaaatt 2580 ggcccgaatc atcagctatg gatctctctg atgtcgcgct ggagtccgac gcgctcgatg 2640 ctgccgtcga tttaaaaacg gtgatcggat ttttccgagc tctcgatacg acggacgcgc 2700 cagcatcacg agactgggcc agtgccgcga gcgacctaga aactctcgtg gcggatcttg 2760 aggagctggc tgacgagctg cgtgctcggc cagcgccagg aggacgcaca gtagtggagg 2820 atgcaatcag ttgcgcctac tgcggtggcc tgattcctcc ccggcctgac ccgcgaggac 2880 ggcgcgcaaa atattgctca gatgcgtgtc gtgccgcagc cagccgcgag cgcgccaaca 2940 aacgccacgc cgaggagctg gaggcggcta ggtcgcaaat ggcgctggaa gtgcgtcccc 3000 cgagcgaaat tttggccatg gtcgtcacag agctggaagc ggcagcgaga attatcgcga 3060 tcgtggcggt gcccgcaggc atgacaaaca tcgtaaatgc cgcgtttcgt gtgccgtggc 3120 cgcccaggac gtgtcagcgc cgccaccacc tgcaccgaat cggcagcagc gtcgcgcgtc 3180 gaaaaagcgc acaggcggca agaagcgata agctgcacga atacctgaaa aatgttgaac 3240 gccccgtgag cggtaactca cagggcgtcg gctaaccccc agtccaaacc tgggagaaag 3300 cgctcaaaaa tgactctagc ggattcacga gacattgaca caccggcctg gaaattttcc 3360 gctgatctgt tcgacaccca tcccgagctc gcgctgcgat cacgtggctg gacgagcgaa 3420 gaccgccgcg aattcctcgc tcacctgggc agagaaaatt tccagggcag caagacccgc 3480 gacttcgcca gcgcttggat caaagacccg gacacggaga aacacagccg aagttatacc 3540 gagttggttc aaaatcgctt gcccggtgcc agtatgttgc tctgacgcac gcgcagcacg 3600 cagccgtgct tgtcctggac attgatgtgc cgagccacca ggccggcggg aaaatcgagc 3660 acgtaaaccc cgaggtctac gcgattttgg agcgctgggc acgcctggaa aaagcgccag 3720 cttggatcgg cgtgaatcca ctgagcggga aatgccagct catctggctc attgatccgg 3780 tgtatgccgc agcaggcatg agcagcccga atatgcgcct gctggctgca acgaccgagg 3840 aaatgacccg cgttttcggc gctgaccagg ctttttcaca taggctgagc cgtggccact 3900 gcactctccg acgatcccag ccgtaccgct ggcatgccca gcacaatcgc gtggatcgcc 3960 tagctgatct tatggaggtt gctcgcatga tctcaggcac agaaaaacct aaaaaacgct 4020 atgagcagga gttttctagc ggacgggcac gtatcgaagc ggcaagaaaa gccactgcgg 4080 aagcaaaagc acttgccacg cttgaagcaa gcctgccgag cgccgctgaa gcgtctggag 4140 agctgatcga cggcgtccgt gtcctctgga ctgctccagg gcgtgccgcc cgtgatgaga 4200 cggcttttcg ccacgctttg actgtgggat accag ttaaa agcggctggt gagcgcctaa 4260 aagacaccaa gggtcatcga gcctacgagc gtgcctacac cgtcgctcag gcggtcggag 4320 gaggccgtga gcctgatctg ccgccggact gtgaccgcca gacggattgg ccgcgacgtg 4380 tgcgcggcta cgtcgctaaa ggccagccag tcgtccctgc tcgtcagaca gagacgcaga 4440 gccagccgag gcgaaaagct ctggccacta tgggaagacg tggcggtaaa aaggccgcag 4500 aacgctggaa agacccaaac agtgagtacg cccgagcaca gcgagaaaaa ctagctaagt 4560 ccagtcaacg acaagctagg aaagctaaag gaaatcgctt gaccattgca ggttggttta 4620 tgactgttga gggagagact ggctcgtggc cgacaatcaa tgaagctatg tctgaattta 4680 gcgtgtcacg tcagaccgtg aatagagcac ttaaggtctg cgggcattga acttccacga 4740 ggacgccgaa agcttcccag taaatgtgcc atctcgtagg cagaaaacgg ttcccccgta 4800 gggtctctct cttggcctcc tttctaggtc gggctgattg ctcttgaagc tctctagggg 4860 ggctcacacc ataggcagat aacgttcccc accggctcgc ctcgtaagcg cacaaggact 4920 gctcccaaag atcttcaaag ccactgccgc gactgccttc gcgaagcctt gccccgcgga 4980 aatttcctcc accgagttcg tgcacacccc tatgccaagc ttctttcacc ctaaattcga 5040 gagattggat tcttaccgtg gaaattcttc gcaaaaatcg tcccctgatc gcccttgcga 5100 cgttggcgtc ggtgccgctg gttgcgcttg gcttgaccga cttgatcagc ggccgc 5156 <210> 13 <211> 6087 <212> DNA <213> Artificial sequence <220> <223> Description of Artificial Sequence: pGrxb2010 Vector for Overexpression of Methionine Biosynthesis Positive Regulator (rxn2910) <220> <221> miscellaneous feature <222> (1465) .. (2256) <223> Tn5 kanamycin resistance <220> <221> miscellaneous difference <222> (3529) .. (4203) <223> Orfl for replication in C.glutamicum <220> <221> miscellaneous feature <222> (4537) .. (5658) <223> Rep gene for C.glutamicum replication <220> <221> miscellaneous feature <222> Complement ((2523) .. (3383)) <223> pMB Ori for E.coli replication <220> <221> terminator <222> (1056) .. (1115) <223> C.glutamicum GroEl terminator <220> <221> miscellaneous feature <222> (268) .. (984) <223> rxn02910 encoder <220> <221> promoter <222> (19). . (267) <223> rxn02910 gene promoter <400> 13 tcgatttaaa tctcgagtgg tttaggggat gagaaaccgg acacacgtgc caaaacttcg 60 gctttttcgc caatcttgtc acgcctgtct ggtttgcctc ggatgaggtg atttcatggc 120 caagacttct aaaagttcga cctcgcagga tcgcttctaa gggcctttag cggaccaacc 180 taggccgata cccatgtgga aatctcgacg tcttaaatgg acgattggag ctaaaaccac 240 gaacagctgg gattttccac gataggattg ggtctcgtgg agattcgttg gttggaaggc 300 tttatcgcgg tcgcggaaga attgcacttt agtaatgctg cgattcgttt ggggatgccg 360 caatcgccgt tgagtcagtt gatccggcgg ttggagtcgg agttggggca gaagcttttt 420 gatcgcagta cccggtcggt ggagttaact gccgcgggtc gggcgttttt gccacatgcc 480 agggggattg tggcgagcgc tgcggtggcg agggaagctg tgaatgctgc cgagggggag 540 atcgttggtg ttgttcgcat tggtttttct ggtgtgctga actattccac gctgccgctt 600 ttgaccagtg aggtgcataa acggcttcct aatgtggagt tggagctcgt tggtcagaag 660 ttgacgaggg aagcggtaag tttgctgcgc ttgggggcgt tggatattac gttgatgggt 720 ttgcccattg aggatccaga gattgagact cggctgatta gtttggaaga gttttgcgtg 780 gtgttgccga aggatcatcg tcttgcgggg gaaggagtgg tggatttggt ggatctggct 840 aaagatgggt t tgtgacgac gccggagttt gcggggtctg tgtttaggaa ttccaccttt 900 cagttgtgtg ctgaggctgg ttttgtgccg aggatcagcc agcaagttaa tgatccttac 960 atggcgctgt tgttggcgcg gtagactagt tcggacctag ggatatcgtc gacatcgatg 1020 ctcttctgcg ttaattaaca attgggatcc tctagagttc tgtgaaaaac accgtggggc 1080 agtttctgct tcgcggtgtt ttttatttgt ggggcactag acccgggatt taaatcgcta 1140 gcgggctgct aaaggaagcg gaacacgtag aaagccagtc cgcagaaacg gtgctgaccc 1200 cggatgaatg tcagctactg ggctatctgg acaagggaaa acgcaagcgc aaagagaaag 1260 caggtagctt gcagtgggct tacatggcga tagctagact gggcggtttt atggacagca 1320 agcgaaccgg aattgccagc tggggcgccc tctggtaagg ttgggaagcc ctgcaaagta 1380 aactggatgg ctttcttgcc gccaaggatc tgatggcgca ggggatcaag atctgatcaa 1440 gagacaggat gaggatcgtt tcgcatgatt gaacaagatg gattgcacgc aggttctccg 1500 gccgcttggg tggagaggct attcggctat gactgggcac aacagacaat cggctgctct 1560 gatgccgccg tgttccggct gtcagcgcag gggcgcccgg ttctttttgt caagaccgac 1620 ctgtccggtg ccctgaatga actgcaggac gaggcagcgc ggctatcgtg gctggccacg 1680 acgggcgttc cttgcgcag c tgtgctcgac gttgtcactg aagcgggaag ggactggctg 1740 ctattgggcg aagtgccggg gcaggatctc ctgtcatctc accttgctcc tgccgagaaa 1800 gtatccatca tggctgatgc aatgcggcgg ctgcatacgc ttgatccggc tacctgccca 1860 ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta ctcggatgga agccggtctt 1920 gtcgatcagg atgatctgga cgaagagcat caggggctcg cgccagccga actgttcgcc 1980 aggctcaagg cgcgcatgcc cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc 2040 ttgccgaata tcatggtgga aaatggccgc ttttctggat tcatcgactg tggccggctg 2100 ggtgtggcgg accgctatca ggacatagcg ttggctaccc gtgatattgc tgaagagctt 2160 ggcggcgaat gggctgaccg cttcctcgtg ctttacggta tcgccgctcc cgattcgcag 2220 cgcatcgcct tctatcgcct tcttgacgag ttcttctgag cgggactctg gggttcgaaa 2280 tgaccgacca agcgacgccc aacctgccat cacgagattt cgattccacc gccgccttct 2340 atgaaaggtt gggcttcgga atcgttttcc gggacgccgg ctggatgatc ctccagcgcg 2400 gggatctcat gctggagttc ttcgcccacg ctagcggcgc gccggccggc ccggtgtgaa 2460 ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc 2520 actgactcgc tgcgctcggt cgtt cggctg cggcgagcgg tatcagctca ctcaaaggcg 2580 gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 2640 cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 2700 ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 2760 ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 2820 ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 2880 agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 2940 cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 3000 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 3060 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 3120 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 3180 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 3240 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 3300 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 3360 aggatcttca cctagatcct tttaaaggcc ggccgcggcc ccgcttcgtg gcgcaaagtc 3420 aaaattttcg tgccgcgtga ttttccgcca aaaactttaa cgaacgttcg ttataatggt 3480 gtcatgacct tcacgacgaa gtactaaaat tggcccgaat catcagctat ggatctctct 3540 gatgtcgcgc tggagtccga cgcgctcgat gctgccgtcg atttaaaaac ggtgatcgga 3600 tttttccgag ctctcgatac gacggacgcg ccagcatcac gagactgggc cagtgccgcg 3660 agcgacctag aaactctcgt ggcggatctt gaggagctgg ctgacgagct gcgtgctcgg 3720 ccagcgccag gaggacgcac agtagtggag gatgcaatca gttgcgccta ctgcggtggc 3780 ctgattcctc cccggcctga cccgcgagga cggcgcgcaa aatattgctc agatgcgtgt 3840 cgtgccgcag ccagccgcga gcgcgccaac aaacgccacg ccgaggagct ggaggcggct 3900 aggtcgcaaa tggcgctgga agtgcgtccc ccgagcgaaa ttttggccat ggtcgtcaca 3960 gagctggaag cggcagcgag aattatcgcg atcgtggcgg tgcccgcagg catgacaaac 4020 atcgtaaatg ccgcgtttcg tgtgccgtgg ccgcccagga cgtgtcagcg ccgccaccac 4080 ctgcaccgaa tcggcagcag cgtcgcgcgt cgaaaaagcg cacaggcggc aagaagcgat 4140 aagctgcacg aatacctgaa aaatgttgaa cgccccgtga gcggtaactc acagggcgtc 4200 ggctaacccc cagtccaaac ctgggagaaa gcgct caaaa atgactctag cggattcacg 4260 agacattgac acaccggcct ggaaattttc cgctgatctg ttcgacaccc atcccgagct 4320 cgcgctgcga tcacgtggct ggacgagcga agaccgccgc gaattcctcg ctcacctggg 4380 cagagaaaat ttccagggca gcaagacccg cgacttcgcc agcgcttgga tcaaagaccc 4440 ggacacggag aaacacagcc gaagttatac cgagttggtt caaaatcgct tgcccggtgc 4500 cagtatgttg ctctgacgca cgcgcagcac gcagccgtgc ttgtcctgga cattgatgtg 4560 ccgagccacc aggccggcgg gaaaatcgag cacgtaaacc ccgaggtcta cgcgattttg 4620 gagcgctggg cacgcctgga aaaagcgcca gcttggatcg gcgtgaatcc actgagcggg 4680 aaatgccagc tcatctggct cattgatccg gtgtatgccg cagcaggcat gagcagcccg 4740 aatatgcgcc tgctggctgc aacgaccgag gaaatgaccc gcgttttcgg cgctgaccag 4800 gctttttcac ataggctgag ccgtggccac tgcactctcc gacgatccca gccgtaccgc 4860 tggcatgccc agcacaatcg cgtggatcgc ctagctgatc ttatggaggt tgctcgcatg 4920 atctcaggca cagaaaaacc taaaaaacgc tatgagcagg agttttctag cggacgggca 4980 cgtatcgaag cggcaagaaa agccactgcg gaagcaaaag cacttgccac gcttgaagca 5040 agcctgccga gcgccgctga agcgtctgga gagctgatcg acggcgtccg tgtcctctgg 5100 actgctccag ggcgtgccgc ccgtgatgag acggcttttc gccacgcttt gactgtggga 5160 taccagttaa aagcggctgg tgagcgccta aaagacacca agggtcatcg agcctacgag 5220 cgtgcctaca ccgtcgctca ggcggtcgga ggaggccgtg agcctgatct gccgccggac 5280 tgtgaccgcc agacggattg gccgcgacgt gtgcgcggct acgtcgctaa aggccagcca 5340 gtcgtccctg ctcgtcagac agagacgcag agccagccga ggcgaaaagc tctggccact 5400 gtggcggtaa aaaggccgca gaacgctgga atgggaagac aagacccaaa cagtgagtac 5460 gcccgagcac agcgagaaaa actagctaag tccagtcaac gacaagctag gaaagctaaa 5520 ggaaatcgct tgaccattgc aggttggttt atgactgttg agggagagac tggctcgtgg 5580 ccgacaatca atgaagctat gtctgaattt agcgtgtcac gtcagaccgt gaatagagca 5640 cttaaggtct gcgggcattg aacttccacg aggacgccga aagcttccca gtaaatgtgc 5700 catctcgtag gcagaaaacg gttcccccgt agggtctctc tcttggcctc ctttctaggt 5760 cgggctgatt gctcttgaag ctctctaggg gggctcacac cataggcaga taacgttccc 5820 caccggctcg cctcgtaagc gcacaaggac tgctcccaaa gatcttcaaa gccactgccg 5880 cgactgcctt cgcgaagcct tgccccgcgg aaatttcctc caccga gttc gtgcggggggcggggggggggggggggggg <210> 14 <211> 2406 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: pINTEGRATIV vector <220> <221> miscellaneous feature <222> (457) .. (1248) <223> Tn5 kanamycin resistance gene <220> <221> miscellaneous feature <222> Complement ((1515) .. (2375)) <223> pMB Ori for E.coli replication <400> 14 tcgagaggcc tgacgtcggg cccggtacca cgcgtcatat gactagttcg gacctaggga 60 tatcgtcgac atcgatgctc ttctgcgtta attaacaatt gggatcctct agacccggga 120 tttaaatcgc tagcgggctg ctaaaggaag cggaacacgt agaaagccag tccgcagaaa 180 cggtgctgac cccggatgaa tgtcagctac tgggctatct ggacaaggga aaacgcaagc 240 gcaaagagaa agcaggtagc ttgcagtggg cttacatggc gatagctaga ctgggcggtt 300 ttatggacag caagcgaacc ggaattgcca gctggggcgc cctctggtaa ggttgggaag 360 ccctgcaaag taaactggat ggctttcttg ccgccaagga tctgatggcg caggggatca 420 agatctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga tggattgcac 480 gcaggttctc cggccgcttg ggtggagagg ctattcggct atgactgggc acaacagaca 540 atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt 600 gtcaagaccg acctgtccgg tgccctgaat gaactgcagg acgaggcagc gcggctatcg 660 tggctggcca cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac tgaagcggga 720 agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct 780 cctgccgaga aagtatccat catggctgat gcaatgcggc ggctgcatac gcttgatccg 840 gctacctgcc c attcgacca ccaagcgaaa catcgcatcg agcgagcacg tactcggatg 900 gaagccggtc ttgtcgatca ggatgatctg gacgaagagc atcaggggct cgcgccagcc 960 gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt cgtgacccat 1020 ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg attcatcgac 1080 tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac ccgtgatatt 1140 gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg tatcgccgct 1200 cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg agcgggactc 1260 tggggttcga aatgaccgac caagcgacgc ccaacctgcc atcacgagat ttcgattcca 1320 ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc ggctggatga 1380 tcctccagcg cggggatctc atgctggagt tcttcgccca cgctagcggc gcgccggccg 1440 gcccggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc 1500 gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct 1560 cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg 1620 tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc 1680 cataggctcc gcccccctg the aaaaatcgac gctcaagtca gaggtggcga cgagcatcac 1740 aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct 1800 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg 1860 gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag 1920 ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat 1980 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac 2040 aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac 2100 tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc 2160 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt 2220 aaaaaaggat tttgtttgca agcagcagat tacgcgcaga ctcaagaaga tcctttgatc 2280 ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg 2340 agattatcaa aaaggatctt cacctagatc cttttaaagg ccggccgcgg ccgctcgatt 2400 2406 taaatc <210> 15 <211> 2772 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequence: vector pINTEGRATIV_deltaRXA02910 for methionine biosynthesis positive regulator knockout rxa02910 <220> <221> miscellaneous feature <222> (457) .. (1248) <223> Tn5 kanamycin resistance gene <220> <221> miscellaneous feature <222> Complement ((1515) .. (2375)) <223> pMB Ori for E.coli replication <220> <221> miscellaneous feature <222> (1) .. (61) <223> rxa02910 fragment (cont. Of bp 2772 in circular plasmid) circular plasmid) <220> <221> miscellaneous feature <222> (2407) .. (2772) <223> from rxa02910 (Part tp is con.bp 1-61 in circular plasmid) <400> 15 ggtgttgccg aaggatcatc ggaaggagtg gtggatttgg tggatctgga gtcttgcggg 60 tatcgtcgac atcgatgctc ttctgcgtta attaacaatt gggatcctct agacccggga 120 tttaaatcgc tagcgggctg ctaaaggaag cggaacacgt agaaagccag tccgcagaaa 180 cggtgctgac cccggatgaa tgtcagctac tgggctatct ggacaaggga aaacgcaagc 240 gcaaagagaa agcaggtagc ttgcagtggg cttacatggc gatagctaga ctgggcggtt 300 ttatggacag caagcgaacc ggaattgcca gctggggcgc cctctggtaa ggttgggaag 360 ccctgcaaag taaactggat ggctttcttg ccgccaagga tctgatggcg caggggatca 420 agatctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga tggattgcac 480 gcaggttctc cggccgcttg ggtggagagg ctattcggct atgactgggc acaacagaca 540 atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc ggttcttttt 600 gtcaagaccg acctgtccgg tgccctgaat gaactgcagg acgaggcagc gcggctatcg 660 tggctggcca cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac tgaagcggga 720 agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc tcaccttgct 780 cctgccgaga aagtatccat catggctgat gcaatgcggc ggctgcatac gcttgatccg 840 gctacctgcc c attcgacca ccaagcgaaa catcgcatcg agcgagcacg tactcggatg 900 gaagccggtc ttgtcgatca ggatgatctg gacgaagagc atcaggggct cgcgccagcc 960 gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt cgtgacccat 1020 ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg attcatcgac 1080 tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac ccgtgatatt 1140 gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg tatcgccgct 1200 cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg agcgggactc 1260 tggggttcga aatgaccgac caagcgacgc ccaacctgcc atcacgagat ttcgattcca 1320 ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc ggctggatga 1380 tcctccagcg cggggatctc atgctggagt tcttcgccca cgctagcggc gcgccggccg 1440 gcccggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc 1500 gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct 1560 cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg 1620 tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc 1680 cataggctcc gcccccctg the aaaaatcgac gctcaagtca gaggtggcga cgagcatcac 1740 aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct 1800 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg 1860 gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag 1920 ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat 1980 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac 2040 aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac 2100 tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc 2160 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt 2220 tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc 2280 ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg 2340 agattatcaa aaaggatctt cacctagatc cttttaaagg ccggccgcgg ccgctcgatt 2400 taaatctcga gttgatcgca gtacccggtc ggtggagtta actgccgcgg gtcgggcgtt 2460 tttgccacat gccaggggga ttgtggcgag cgctgcggtg gcgagggaag ctgtgaatgc 2520 tgccgagggg gagatcgttg GTGT tgttcg cattggtttt tctggtgtgc tgaactattc 2580 cacgctgccg cttttgacca gtgaggtgca taaacggctt cctaatgtgg agttggagct 2640 cgttggtcag aagttgacga gggaagcggt aagtttgctg cgcttggggg cgttggatat 2700 tacgttgatg ggtttgccca ttgaggatcc agagattgag actcggctga ttagtttgga gt 2772 2760 agagttttgc <210> 16 <211> 717 <212> DNA <213> Corynebacterium glutamicum <220> <221> CDS <222> (10) .. (714) <220> <221> mutation <222> (556) <223> G-> A mutation resulting in D / N polymorphism <400> 16 ttgggtctc gtg gag att cgt tgg ttg gaa ggc ttt till gcg gtc gcg gaa 51 Go Glu Ile Arg Trp Leu Glu Gly Phe Ile Ala Go Ala Glu 15 10 gaa ttg cac ttt agt aat gcg att cg tg caa tcg 99 Glu Read His Phe Ser Asn Wing Ala Ile Arg Leu Gly Met Pro Gin Ser 15 20 25 30 ccg ttg agt cag ttg to cgg cgg ttg gag ttg ggg cag aag 147 Pro Leu Ser Gin Leu Ile Arg Arg Leu Glu Ser Glu Leu Gly Gin Lys 35 40 45 ctt ttt gat cgc agt acc cgg gtg gag tta act gcc gcg ggt cgg 195 Leu Phe Asp Arg Ser Thr Arg Will Go Glu Leu Thr Wing Ala Gly Arg 50 55 60 gcg ttt ttg cca cat gcc agg ggg att gtg gcg age gct gcg gtg gcg 243 Phe Wing Leu Pro His Wing Arg Gly Ile Go Wing Be Wing Wing Go Wing 65 70 75 agg gaa gct gtg aat gct gcc gag gag up gtt ggt gtt cgc 291 Wing Go Asn Wing Wing Glu Gly Glu Ile Go Gly Go Go Arg 80 85 90 att ggt ttt tet ggt gtg ctg aac tat tcc acg cg ct ttg acc 339 Ile Gly Phe Ser Gly Go Read Asn Tyr Ser Thr Read Leu Thr 95 100 105 110 agt ga gtg cat aaa cgg ctt cct aat gtg gag ttg gag ctc gtt ggt 387 Ser Glu Go His Lys Arg Leu Pro Asn Go Glu Leu Glu Leu Go Gly 115 120 125 cag aag ttg acg gaa gcg gta agt ttg cgc tg gtg ttg 435 Gin Lys Leu Thr Arg Glu Ala Will Be Leu Leu Arg Leu Gly Ala Leu 130 135 140 gat att acg tg tg ttg ccc att gag gat cca gag att gag act 483 Asp Ile Thr Leu Met Gly Leu Pro Ile Glu Asp Pro Glu Ile Glu Thr 145 150 155 cgg ctg att agt ttg gaa gag ttt tgc gtg gtg ttg ccg aag gat cat 531 Arg Leu Ile Ser Leu Glu Phe Cys Go Go Read Pro Lys Asp His 160 165 170 cgt ctt gcg ggg gaa gga gtg gtg aat ttg gtg gat ctg gct aaa gat 579 Arg Leu Ala Gly Glu Gly Go Go Asn Leu Go Asp Leu Ala Lys Asp 175 180 185 190 ggg ttt gtg acg acg cc gag ttt gcg ggg ttt agg aat tcc Ply 627 Gly Thr Thr Pro Glu Phe Ala Gly Gonna Go Phe Arg Asn Ser 195 200 205 acc ttt cag ttg tgt gg gt ggt ttt gtg ccg agg till age cag 675 Thr Phe Gin Leu Cys Ala Glu Gly Phe Go To Arg Ile Ser Gin 210 21 5 220 caa gtt aat gat cct tac atg gcg ctg ttg ttg gcg cgg tag 717 Gin Go Asn Asp Pro Tyr Met Leu Leu Leu Ala Arg 225 230 235 <210> 17 <211> 235 <212> PRT <213> Corynebacterium glutamicum <400> 17 Go Glu Ile Arg Trp Read Glu Gly Phe Ile Wing Go Wing Glu Glu Leu 15 10 15 His Phe Ser Asn Wing Ile Arg Wing Read Gly Met Pro Gin Be Pro Leu 20 25 30 Ser Gin Read Leu Ile Arg Arg Leu Glu Be Glu Leu Gly Gin Lys Leu Phe 35 40 45 Asp Arg Be Thr Arg Be Thr Glu Leu Thr Wing Gly Arg Wing Phe 50 55 60 Leu Pro His Wing Arg Gly Ile Go Wing Be Wing Ala Go Wing Arg Glu 65 70 75 80 Wing Go Asn Wing Wing Glu Gly Glu Ile Go Gly Go Go Arg Ile Gly 85 90 95 Phe Ser Gly Go Read Asn Tyr Be Thr Leu Pro Leu Thr Be Glu 100 105 110 Go His Lys Arg Leu Pro Asn Go Glu Leu Glu Leu Go Gly Gin Lys 115 120 125 Leu Thr Arg Glu Wing Will Be Leu Leu Arg Leu Gly Wing Leu Asp Ile 130 135 140 Thr Leu Met Gly Leu Pro Ile Glu Asp Pro Glu Ile Glu Thr Arg Leu 145 150 155 160 Ile Ser Leu Glu Glu Phe Cys Goes Going Leu Pro Lys Asp His Arg Leu 165 170 175 Wing Gly Glu Gly Going Asn Leu Going Asp Leu Wing Lys Asp Gly Phe 180 185 190 Going Thr Thr Pro Glu Phe Wing Gly Being Going Phe Arg Asn Being Thr Phe 195 200 205 Gin Leu Cys Al Glu Wing Gly Phe Go To Arg Ile Be Gin Gin Go 210 215 220 Asn Asp Pro Tyr Met Wing Read Leu Read Wing Arg 225 230 235 <210> 18 <211> 627 <212> DNA <213> Corynebacterium diphtheriae <220> <221> CDS <222> (1) .. (624) <223> protein homologue RXA00655 <400> 18 ttg gcc gag gcg aaa age acg aag acg acg act cgt cga cgt aac cgt 48 Leu Wing Glu Wing Lys Ser Thr Lys Thr Thr Arg Arg Asn Arg 15 10 15 ccg age cct cag cgc cta ttg gat ggc gea acg cag ctt ttt acc 96 Pro Be Pro Arg Arg Arg Read Leu Asp Gly Ala Thr Gin Leu Phe Thr 20 25 30 acc gag gga att cgg gtg up ggc att gat cgc att ttg cgt gag gtt 144 Thr Glu Gly Ile Arg Go Ile Gly Ile Asp Arg Ile Leu Arg Glu Ala 35 40 45 gat gta gcc aag gcg agt ttg tac tcc ttc gga tcc aag gat gcg 192 Asp Go Ala Lys Ala Ser Leu Tyr Ser Leu Phe Gly Ser Lys Asp Ala 50 55 60 ctg gtt att gcc tat ttg cag aac ttg gat gaa aag tgg cgt gag cag 240 Leu Go Ile Ala Tyr Leu Gin Asn Leu Asp Glu Lys Trp Arg Glu Gin 65 70 75 80 tat tac gag cgc act ggt tcg cca age gag aaa att ctc 288 Tyr Tyr Glu Arg Thr Ala Glu Met Gly Pro To Be Glu Lys Ile Leu 85 90 95 gcg ttt ttt gat cag tgt att gat gag gag ccg aag gat tat cgc 336 Ala Phe Phe Asp Gin Cys Ile Asp Glu Pro Leu Lys Asp Tyr Arg 100 105 110 ggt tcg cac ttc cag aat gct gct aac gag tac ccg cgc cca gag acg 384 Gly Ser His Phe Gin Asn Ala Wing Asn Glu Tyr Pro Arg Pro Glu Thr 115 120 125 gat agt gag cgc gag up to gtg tcg gtt gtg atg gaa cat cgc cgg tgg 432 Asp Be Glu Arg Glu Ile Will Be Go Go Met Glu His Arg Arg Trp 130 135 140 tgt ttg gag acg tta act cag ttg acg gag aac ggg tat ccc 480 Cys Leu Glu Thr Leu Thr Gin Leu Thr Glu Lys Asn Gly Tyr Pro 145 150 155 160 ggc act gtt cag gct aat cag ttg atg gtt ttt ctg gat ggt ggt ctt 528 Gly Thr Go Gin Ala Asn Gin Leu Met Go Phe Leu Asp Gly Gly Leu 165 170 175 gcg ggt tgt cgg aat cgc tcg gtg gag tcg ttg aag act gct cgg 576 Ala Gly Cys Arg Leu Asn Arg Will Go Glu Be Leu Lys Thr Ala Arg 180 185 190 gat ctt gcg gtt cag ttg ctg cc tt gct gat tat tcg att 624 Asp Wing Go Gin Read Leu Be Pro Wing Pro Wing Asp Tyr Ser Ile 195 200 205 tag 627 <210> 19 <211> 208 <212> PRT <213> Corynebacterium diphtheriae <400> 19 Leu Wing Glu Wing Lys Thr Thr Lys Thr Thr Be Arg Arg Arg Asn Arg 15 10 15 Pro Be Pro Arg Arg Gin Read Le Asp Gly Wing Thr Gin Leu Phe Thr 20 25 30 Thr Glu Gly Ile Arg Go Ile Gly Ile Asp Arg Ile Leu Arg Glu Wing 35 40 45 Asp Go Ala Lys Wing Be Leu Tyr Be Leu Phe Gly Be Lys Asp Wing 50 55 60 Leu Go Ile Ala Tyr Leu Gin Asn Leu Asp Glu Lys Trp Arg Glu Gin 65 70 75 80 Tyr Tyr Glu Arg Thr Wing Glu Met Gly Be Pro Be Glu Lys Ile Leu 85 90 95 Phe Phe Wing Asp Gin Cys Ile Asp Glu Glu Pro Read Lys Asp Tyr Arg 100 105 110 Gly Be His Phe Gin Asn Wing Asn Glu Tyr Pro Arg Pro Glu Thr 115 120 125 Asp Be Glu Arg Glu Ile Will Be Go Go Met Glu His Arg Arg Trp 130 135 140 Cys Leu Glu Thr Leu Thr Gin Leu Leu Thr Glu Lys Asn Gly Tyr Pro 145 150 155 160 Gly Thr Go Gin Ala Asn Gin Leu Met Go Phe Leu Asp Gly Gly Leu 165 170 175 Ala Gly Cys Arg Leu Asn Arg Be Go Glu Be Leu Lys Thr Ala Arg 180 185 190 Asp Leu Ala Go Gin Leu Leu Be Ala Pro Pro Ala Asp Tyr Ser Ile 195 200 205 <210> 20 <211> 639 <212> DNA <213> Corynebacterium efficiens YS-314 <220> <221> CDS <222> (1) .. (636) <223> protein homolog coder RXA00655 <400> 20 gtg gct gtc age gct tea gga aag agt agg acc agt aca ggg ggc agg 48 Go Wing Go Go Wing Go Gly Lys Be Arg Thr Be Thr Gly Arg 15 10 15 cga cgt gat cgc ccg cgg cag cgt ctg etc gac age gea acg 96 Arg Arg Asp Arg Pro Ser Pro Arg Gin Arg Read Le Asp Ser Ala Thr 20 25 30 aat ctg ttc acc acc gag ggc up ggc up gg cgt up 144 Asn Leu Phe Thr Thr Glu Gly Ile Arg Go Ile Gly Ile Asp Arg Ile 35 40 45 ctt cgt gag gcg gat gtg gcc aag gcc age ctg tac tcc etc ttc ggt 192 Leu Arg Glu Ala Asp Go Ala Lys Ala Ser Leu Pyr Gly 50 55 60 tcc aag gat gct ctg gtg till gcc tac ctg gaa aat ctg gat cag cag 240 Ser Lys Asp Ala Leu Go Ile Tyr Leu Glu Asn Leu Asp Gin Gin 65 70 75 80 tgg cgt gat gcg tgg cat gag cgg cag cag cag ag gac ccg gag 288 Trp Arg Asp Ala Trp His Glu Arg Thr Asp Gin Leu Lys Asp Pro Glu 85 90 95 gat aag until gcc ttc ttc gac cag tgc until gag gag gag ccg aag 336 Asp Lys Ile Ia Ala Phe Phe Asp Gin Cys Ile Glu Glu Glu Pro Lys 100 105 110 aag ggc ttc cgg ggg tcc cac ttc cag aat gcg gcg aat gag tat cca 384 Lys Gly Phe Arg Gly Ser His Phe Gin Asn Ala Wing Asn Glu Tyr Pro 115 120 125 cgt ccg gag acg gaa tcc gag ag gc gcc gcc atg gag 432 Arg Pro Glu Thr Glu Be Glu Lys Gly Ile Go Wing Ward Go Met Glu 130 135 140 cac cgt cgt tgg tgt cat cag acg ctg acc gat ctg acg gag aag 480 His Arg Trp Cys His Gin Thr Leu Thr Asp Leu Leu Thr Glu Lys 145 150 155 160 aat ggt tat ccc ggc acc acc cag gtg aat cag ctg gtg ttc ctt 528 Asn Gly Tyr Pro Gly Thr Thr Gin Ala Asn Gin Leu Leu Go Phe Leu 165 170 175 gat ggt ggt ctg gcg ggg tcg agg ctg gtt cag aat until ggc ccc ttg 576 Asp Gly Gly Leu Ala Gly Ser Arg Leu Go Gin Asn Ile Gly Pro Leu 180 185 190 gaa acg gcc cgg gcc cgg cag ttg ctg tcc gea cca cc24 Arg Wing Asp Leu Arg Wing Gin Leu Read Ser Wing Pro Pro Wing 195 200 205 gat tac tcg up to tag 639 Asp Tyr Ser Ile 210 <210> 21 <211> 212 <212> PRT <213> Corynebacterium efficiens YS-314 <400> 21 Go Wing Go Wing Go Be Gly Lys Be Arg Thr Be Thr Gly Gly Arg 15 10 15 Arg Arg Asp Arg Pro Be Pro Arg Gin Leu Read Asp Be Wing Thr 20 25 30 Asn Leu Phe Thr Thr Glu Gly Ile Arg Go Ile Gly Ile Asp Arg Ile 35 40 45 Leu Arg Glu Wing Asp Go Wing Lys Wing Be Leu Tyr Be Leu Phe Gly 50 55 60 Be Lys Asp Wing Leu Go Ile Wing Tyr Leu Asp Gin Gin 65 70 75 80 Trp Arg Asp Ala Trp His Glu Arg Asp Gin Leu Lys Asp Pro Glu 85 90 95 Asp Lys Ile Ile Ala Phe Phe Asp Gin Cys Ile Glu Glu Pro Lys 100 105 110 Lys Gly Phe Arg Gly Be His Phe Gin Asn Ala Wing Asn Glu Tyr Pro 115 120 125 Arg Pro Glu Thr Glu Be Glu Lys Gly Ile Go Wing Ward Go Met Glu 130 135 140 His Arg Arg Trp Cys His Gin Thr Read Le Thr Asp Read Leu Thr Glu Lys 145 150 155 160 Asn Gly Tyr Pro Gly Thr Thr Gin Wing Asn Gin Leu Leu Go Phe Leu 165 170 175 Asp Gly Gly Leu Wing Gly Ser Arg Leu Go Gin Asn Ile Gly Pro Leu 180 185 190 Glu Thr Wing Arg Asp Leu Arg Wing Leu Ser Ala Pro Pro Wing 195 200 205 Asp Tyr Ser Il and 210 <210> 22 <211> 588 <212> DNA <213> Streptomyces coelicolor <220> <221> CDS <222> (1) .. (585) <223> protein homolog coder RXA00655 <400> 22 atg aca tcg acc gcc gcc aga ccg ggc aga gtg gag aag ctg ccg cc 48 Met Thr Ser Xhr Ala Wing Ala Arg Pro Gly Arg Go Ala Lys Leu Pro Pro 15 10 15 cgc gag cgc up to ctc gac gcg gcc gag gag gag ctc ttc cag ggc gag ggc 96 Arg Glu Arg Ile Leu Asp Wing Ala Glu Glu Leu Phe Gin Gly Glu Gly 20 25 30 up to cga cgc gtg ggg gtc cag gcg up to gcc gag cgg gcc gag acc acc 144 Ile Arg Arg Go Gly Go Gin Ala Ile Ala Glu Arg Ala Glu Thr Thr 35 40 45 aag atg gcg till tac cgg cac ttc gag acc aag gac gtc gtc gcc 192 Lys Met Ala Ile Tyr Arg His Phe Glu Thr Lys Asp Ala Leu Go Ala 50 55 60 gaa tgg ctg cgg up to ctg gcc gcc gag tac cag gcg gcc ttc gac cgc 240 Glu Trp Leu Arg Ile Leu Wing Ala Glu Tyr Gin Wing Ala Phe Asp Arg 65 70 75 80 gtc gag gcc ggc cgg ccg gg cag cgg cgg ctc 288 Go Glu Wing Glu His Pro Gly Arg Pro Arg Glu Gin Ile Leu Gly Leu 85 90 95 gcc cgc ttc to gcc gac ggg ctg cctg tcg cac cgg ggc tgc 336 Ala Arg Phe Ile Ala Asp Gly Leu Pro Gly Leu Ser His Arg Gly Cys 100 105 110 ccc ttc up to aac tcc ctc gcc gag ctg ccc gac cgc tcc cac ccc gcg 384 Pro Phe Ile Asn Ser Leu Ala Glu Leu Pro Asp Arg Ser His Pro Ala 115 120 125 cga cgg gtg up to gag gag cac ag gcc cgc cag acc cgc agg ctg gtc 432 Arg Arg Go Ile Glu Glu His Lys Wing Arg Gin Thr Arg Arg Leu Go 130 135 140 ggc atg tgt gcc gag gcg ggg atg ccc gac ccc gaa cag gtc gcg gcc 480 Gly Met Cys Ala Glu Ala Gly Met Pro Asp Pro Glu Gin Go Ala Wing 145 150 155 160 cag till acc ttc gtc ctc gaa ggg cag gtc age acg cag aac gea 528 Gin Ile Thr Phe Will Read Glu Gly Ala Gin Will Be Thr Gin Asn Ala 165 170 175 acts up to gac cgg gcg ggg gag cgg ttg atg cgc until gtc gag gcg until 576 Ser Ile Asp Arg Wing Gly Glu Arg Leu Met Arg Ile Go Glu Wing Ile 180 185 190 gtc gac cag tag 588 Go Asp Gin 195 <210> 23 <211> 195 <212> PRT <213> Streptomyces coelicolor <400> 23 Met Thr Be Thr Wing Ala Arg Pro Gly Arg Go Ala Lys Leu Pro Pro 15 10 15 Arg Glu Arg Ile Leu Asp Wing Glu Glu Leu Phe Gin Gly Glu Gly 20 25 30 Ile Arg Arg Go Gly Go Gin Ala Ile Wing Glu Arg Wing Glu Thr Thr 35 40 45 Lys Met Wing Ile Tyr Arg His Phe Glu Thr Lys Asp Wing Leu Go Wing 50 55 60 Glu Trp Leu Arg Ile Leu Wing Wing Glu Tyr Gin Wing Phe Asp Arg 65 70 75 80 80 Go Glu Wing Glu His Pro Gly Arg Pro Arg Glu Gin Ile Leu Gly Leu 85 90 95 Wing Arg Phe Ile Wing Asp Gly Leu Pro Gly Leu Be His Arg Gly Cys 100 105 110 Pro Phe Ile Asn Be Leu Wing Glu Leu Pro Asp Arg Be His Pro Wing 115 120 125 Arg Arg Go Ile Glu Glu His Lys Wing Arg Gin Thr Arg Arg Leu Goes 130 135 140 Gly Met Cys Wing Glu Wing Gly Met Pro Asp Pro Glu Gin Go Wing Ala 145 150 155 160 Gin Ile Thr Phe Go Read Leu Glu Gly Wing Gin Go Thr Thr Asn Wing 165 170 175 Be Ile Asp Arg Wing Gly Glu Arg Leu Met Arg Ile Go Glu Wing Ile 180 185 190 Go Asp Gin 195 CLAIMS

Claims (8)

Method for increasing methionine production by a Corynebaceryium giiitamicum microorganism, characterized in that it comprises culturing a Corynebaceryium glutamicum microorganism under conditions such that methionine is produced, wherein the Corynebaceryium glutamicum microorganism has a disrupted or disrupted gene. encodes a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, wherein expression of the polypeptide is reduced or absent when compared to a microorganism Corynebacerium glutamicum in which the endogenous gene is not deleted or disrupted. Method according to claim 1, characterized in that the polypeptide is encoded by a nucleic acid molecule consisting of the nucleic acid sequence of SEQ ID NO: 1. A method according to claim I. characterized in that the endogenous gene is disrupted by transforming a Corynebacerium glutamicum microorganism with a plasmid comprising a nucleotide sequence of SEQ ID NO: 3. Method according to claim 1, characterized in that the endogenous gene disruption or disruption is achieved by a method selected from the group consisting of: a) endogenous gene knockout; and b) endogenous gene mutagenesis. Method according to claim 1, characterized in that the microorganism Corynebacerium glutamicum is transformed with a vector encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 6. Method for the production of methionine, characterized in that it comprises culturing a Corynebacterium glutamicum microorganism under conditions such that methionine is produced, wherein the Corynebacterium glutamicum microorganism has a deleted or disrupted gene encoding a polypeptide consisting of the sequence of amino acids of SEQ ID NO: 2, wherein expression of the polypeptide is reduced or absent when compared to a Corynebacterium glutamicum microorganism in which the endogenous gene is not deleted or disrupted. Method according to claim 1, 5 or 6, characterized in that it further comprises methionine recovery. Method according to claim 6, characterized in that the production of methionine has been increased with respect to a Corynebacterium glutamicum microorganism in which the endogenous gene is not subjected to disruption.