BR112015005911B1 - EXPRESSION VECTOR AND METHOD TO IMPROVE THE PRODUCTION OF A RECOMBINANT PROTEIN IN A PLANT - Google Patents

Abstract

VECTORS AND METHODS TO IMPROVE EXPRESSION OF RECOMBINANT PROTEINS IN PLANTS. Expression vectors and methods of using them to improve the production of recombinant proteins in plants or plant cells are described. Production can be improved by co-expressing the tomato bushy stunt virus gene silencing P19 suppressor. Preferably, the recombinant proteins are therapeutic enzymes and/or antibodies, and methods are carried out on Nicotiana benthamiana - optionally an RNAi-based glycomodified strain - or on the Nicotiana tabacum cultivar Little Crittenden.

Description

Disclosure Field

[0001] The present application relates to a set of expression vectors designed to increase the production of recombinant proteins in plants and methods for using the same.

Fundamentals of Disclosure

[0002] Plant gene silencing mechanisms are involved in regulating the expression of endogenous transcribed genes, as well as reducing or eliminating the effects of invading pathogens such as viruses (Baulcombe, 2004; Reinhart et al, 2002). As a countermeasure to this defense mechanism, viruses encode proteins that act as suppressors of gene silencing (SGS). Tomato Bushy Stunt Virus (TBSV) P19 is an example of proteins known to function as a potent suppressor of gene silencing in plants as well as animals (Scholthof, 2006; Voinnet et al., 1999). Plants also react to most transfer DNA (T-DNA) transgenes that invade their genomes by initiating a post-transcriptional gene silencing response (Baulcombe, 2004; Brodersen and Voinnet, 2006). The inhibitory effect of P19 on the gene silencing pathway has been explored to improve the expression levels of recombinant proteins in plants (Voinnet et al., 2003), but its use has been limited to transient expression, mainly due to the deleterious effects of this protein. protein when constitutively expressed at high levels in a transgenic configuration (Siddiqui et al., 2008).

[0003] There are two main mechanisms of cellular gene silencing in plants, the small interfering RNA (siRNA) and micro RNA (miRNA) silencing pathways (Carthew and Sontheimer, 2009), which are collectively referred to as RNA interference. (RNAi). The two systems show much similarity in their mechanisms of action, as they share some key enzymes (Brodersen and Voinnet, 2006). Both systems identify their nucleic acid target (viral RNA, viral DNA, transgene mRNA, endogenous mRNA) by a complex known as RNA-induced silencing complex (RISC). RISC carries a complementary single strand of the RNA probe to its target, which upon binding, is blocked or degraded.

[0004] The mechanism of action of P19 to suppress gene silencing at the molecular level has become better understood in recent times (Burgyan et al., 2004), but certain aspects still remain unclear. P19 is a multifunctional protein that is active as a dimer and found in the cytoplasm and nucleus (Park et al., 2004). It is able to bind siRNA and miRNA molecules non-specifically (Dunoyer et al., 2004). Since there is an increase in virus-derived siRNA levels in plants in response to infection (Scholthof et al., 1995), P19 acts to reduce the amount of free siRNA duplex through nonspecific binding and suppress the silent response by interfering with RISC siRNA loading (Hsieh et al., 2009). Studies on TBSV mutants with low levels of P19 have shown that a high concentration of the protein is essential to exert its biological activity (Qiu et al., 2002; Scholthof et al., 1999). Despite the nonspecific binding of P19 siRNA, the effects caused by this protein show host specificity (Ahn et al., 2011; Anjo et al., 2011; Siddiqui et al., 2008).

[0005] Nicotiana species show a variation in the induction of the hypersensitive response (HR) to TBSV P19 protein, which is indicated by a discoloration of the initial leaf leading to necrosis at the site of infection (Angel et al., 2011). In N. tabacum cv. Samsun, s HR discoloration develops within 2-3 days after infiltration of leaves with P19, leading to fully desiccated spots by day 7, while the same treatment yields no necrosis or discoloration in N. benthamiana. Stable transgene expression of P19, however, does not elicit HR in any N. tabacum cv. Xanthi or N. benthamiana, indicating that a high concentration of P19 is required to trigger this response (Siddiqui et al., 2008). The difference in HR generated in N. tabacum and N. benthamiana in response to P19 has been attributed to a host protein that is the product of a putative resistance (R) gene (Jovel et al., 2011). The putative gene product R is thought to identify P19 and trigger a cascade of events leading to local necrosis to slow the spread of the virus. Although the R gene product that specifically interacts with P19 has not been identified, experiments show that the resistance conferred by this gene product is dominantly inherited (Jovel et al., 2011).

[0006] As P19 increases, expression appears to vary for different recombinant proteins. Several reports indicate that the expression of Green Fluorescent Protein (GFP), commonly used to inform, is increased about 50-fold when it is co-expressed with P19 (Voinnet et al., 2003; Zheng et al., 2009). Expression of antibodies and other therapeutic proteins, on the other hand, were only enhanced five-fold (Saxena et al., 2011; Zheng et al., 2009).

[0007] In the context of plant-derived therapeutic proteins, another very important consideration is their glycan profile, since this post-translational modification impacts the effectiveness of therapeutic proteins and can be an important factor in lots of variability of recombinant therapeutic proteins. (Gomord et al., 2010; Schiestl et al., 2011). Specific plant sugar residues in the N-glycan core, namely α1,3-fucose and β1,2-xylose core, are immunogenic in mammals (Bardor et al., 2003; Jin et al., 2008). As a result, a great deal of effort has been directed towards creating plants with humanized modified glycosylation patterns (Cox et al., 2006; Sourrouille et al., 2008; Strasseret al., 2008). For the most part, glycomodified plants were created through RNAi silencing technology, mainly due to the existence of multiple endogenous fucosyltransferase and xylosyltransferase genes and in most plants (Cox et al., 2006; Sourrouille et al., 2008; Strasser et al., 2008; Strasser et al. ., 2008). Consequently, interference in the siRNA pathway by P19 becomes a concern when genetic fundamentals generated by RNAi are to be used as expression to produce therapeutic proteins, especially since in an unrelated case, P19 has been shown to suppress knockdown of a line. of transgenic RNAi and previously established (Ahn et al., 2011).

Disclosure Summary

[0008] The present inventors have designed and tested a set of plant expression vectors that are suitable for enhancing recombinant protein expression in transient expression and stable transgenic plants. The unique combination of promoter, 5' UTR and 3' UTR/terminator in these high levels of heterologous plant protein expression vector units, including Nicotiana benthamiana and Nicotiana tabacum.

[0009] In this sense, the present resource provides an expression vector that comprises: (a) a promoter selected from (i) the cauliflower mosaic virus (CaMV) 35S promoter or (ii) the gene promoter ribulose bisphosphate carboxylase (rbc) small subunit of Chrysanthemum morifoliun, (b) a 5' untranslated region (UTR) selected from (i) the 35S 5' UTR of CaMV or (ii) the 5' UTR of the CaMV gene. small subunit of the rbc small subunit of the C. morifoliurrr gene, and (c) a 3' UTR and terminator sequence selected from (i) the 3' UTR and terminator sequence of the nopaline synthase gene (nos) from Agrobacterium, (ii) ) from the 3' UTR and terminator sequence of the osmotin gene (osm) from Oryza sativa, (iii) from the 3' UTR and terminator sequence from the small subunit gene of the rbc from C. morifolium or (iv) from a truncated version, for 162 bp as defined by a BspEl recognition site, the 3' UTR and terminator sequence of the C. rbc small subunit gene. morifolium.

[0010] In one embodiment, a nucleic acid sequence encoding a recombinant protein has been cloned into the aforementioned vectors.

[0011] The present additional resource provides a method of enhancing the production of a recombinant protein in a plant comprising: (i) introducing an expression vector comprising (a) a promoter selected from (i) the mosaic virus 35S promoter from the cauliflower (CaMV) or (ii) the Chrysanthemum morifolium' small subunit ribulose bisphosphate carboxylase (rbc) gene promoter, (b) a 5' untranslated region (UTR) selected from the (i) 35S 5' UTR of CaMV or (ii) the 5' UTR of the rbc small subunit gene of the C. morifolium- gene, (c) a 3' UTR and terminator sequence selected from (i) the 3' UTR and terminator sequence of the nopaline synthase gene (nos) from Agrobacterium, (ii) from the 3' UTR and terminator sequence from the osmotin gene (osm) from Oryza sativa, (iii) from the 3' UTR and terminator sequence from the small subunit gene from the C. morifolium rbc or (iv) a truncated version, by 162 bp as defined by a recon site BspEβ, 3' UTR and terminator sequence from the C. morifolium-rbc small subunit gene, and (d) a nucleic acid sequence encoding a recombinant protein in a plant or a plant cell; and (ii) culturing the plant or plant cell to obtain a plant that expresses the recombinant protein.

[0012] In one embodiment, the recombinant protein is co-expressed with the tomato bushy stunt virus (TBSV) protein gene silencing P19 suppressor.

[0013] Other features and advantages of the present invention will be evident from the following detailed description. It is to be understood, however, that the detailed description and specific examples, when indicating the preferred embodiments of the present invention, are presented by illustration only, since the various changes and modifications within the principle and scope of the present invention will become apparent to those skilled in the art of this detailed description.

Brief Description of Figures

[0014] Figure 1: Diagram of the expression cassettes used in Example 1. The expression cassettes shown here were situated in the T-DNA region of binary vectors. Vector 102mAb was the only vector carrying trastuzumab light (LC) and heavy (HC) chains on the same T-DNA. When expressing Trastuzumab with 103mAb-106mAb vectors, HC and LC were co-expressed to produce fully assembled IgG molecules.

[0015] Figure 2: Western blot analysis of Trastuzumab transiently expressed with non-plant expression vectors in N. benthamiana. Expression of the 103-106mAb vectors was analyzed for 6 days. The plants were treated by vacuum infiltration. Each strip represents a pooled swatch, created by mixing three sheet swatches. Vectors were also expressed alone (A), or together with P19 (B). All vector sets carried the same codes for the HC and LC of Trastuzumab along with different RTUs. Different dynamic expressions were observed when vectors were expressed alone or together with P19, as determined by ELISA (C).

[0016] Figure 3: Western blot analysis of trastuzumab transiently expressed with (A) 102mAb and with (virus-based) expression vectors (B) TMV/PVX in N. benthamiana. The plants were treated by local infiltration. The pooled samples were generated by combining three infiltrated spots. Two pooled samples (taken at 5 DPI) are shown for each treatment. Similar to 106mAb, co-expression of P19 did not affect the level of Trastuzumab expressed with either vector.

[0017] Figure 4: Western blot analysis showing the dose-dependent effect of P19 on enhancing recombinant antibody expression in N. benthamiana. The 103mAb vectors were co-expressed with P19 at three different concentrations of Agrobacterium, OD600= 0.2, 0.02 and 0.002. The plants were treated by local infiltration. The pooled samples were generated by combining three infiltrated spots. Each band represents a pooled sample. The effect stimulating P19 was more prominent when applied at the highest concentration, regardless of the concentration of 103mAb. P19 had no effect of increasing antibody expression when applied at OD600=0.002.

[0018] Figure 5: Differential response of N. tabacum and N. benthamiana to P19. Western blot analysis, showing transient expression of trastuzumab alone or together with P19 in N. benthamiana and five differences in N. tabacum (A) and N. tabacum (B) cultivars. The plants were treated by local infiltration. Samples were grouped by combining three infiltrated spots. Each band represents a pooled sample. Co-expression of 103mAb with P19 resulted in a significant reduction in antibody expression in all tobacco cultivars except CSF. Decreased antibody expression indicates an enhanced state of RNAi silencing. Crossing between N. tabacum 1-64 and LCR, and N. benthamiana and N. tabacum and 1-64 (NBT) showed a similar drop in antibody expression when P19 was co-expressed with 103mAb (B). All Nicotiana species that showed a drop in antibody expression in the presence of P19 also showed discoloration at the site due to infection, leading to necrosis by day 3 after infection (C). Images here show the patches infiltrated 5 days after infection. XAN, N. tabacum cv. Xanthi; PH, N. tabacum cv. Petite Havana H4; LCR, N. tabacum cv. Little Crittenden; BEN, N. benthamiana', NBT, N. benthamian x N. tabacum cv. I-64.

[0019] Figure 6: Profiles of N-glycan of 103mAb expressed in N. benthamiana WT (A) and in ΔXTFT without (B) and (C) with P19 (C). N-glycan analyzes were performed by electrospray liquid chromatography ionization mass spectrometry (LC-ESI-MS) of tryptic glycopeptides, as described previously (Stadlmann et al., 2008; Strasser et al., 2008). Note, that incomplete tryptic digestion results in the generation of two glycopeptides that differ by 482 Da. Glycopeptide 1 is indicated with asterisks (*). See http://www.proglycan.com for N-glycan abbreviations.

[0020] Figure 7: Transient co-infiltration of the P19 expression vector greatly enhances the expression of two more therapeutic antibodies in Nicotiana benthamiana. Coding sequences for anti-HIV mAb 4E10 and bevacizumab were locally infiltrated, with and without P19, into N.benthamiana leaf tissue and harvested after 7 days. Each Agrobacterium strain was applied to an OD600 end of 0.2. Tissue harvests for each treatment included 3 or 4 points, which were pooled and total soluble proteins (TSP) were extracted, as described in Garabagi et al. (2012a,b). A 10% non-reducing SDS-PAGE gel was run that included 10μg TSP for each plant sample. Electrophoretically separated proteins were subsequently electroblotted onto the PVDF membrane and analyzed with anti-y and anti-K combined antibody probes of alkaline phosphatase conjugates (also described in Garabagi et al., 2012a). The results indicate that this co-expression of P19 greatly increases the expression of both antibodies independently of the antibody expression vector. The gel loading scheme is tabulated above the immunoblot image, and the size of each molecular weight marker band in lane 1 is given on the left in kDa. The standard human serum immunoglobulin quantitation in lane 10 is 500 ng. mAb = monoclonal antibody; HC = heavy chain vector; LC = light chain vector. Note that the p105T vector contains a truncated 3' UTR compared to the original p105 vector, with 162 fewer base pairs (bps) due to a BspEI-BspEI deletion.

[0021] Figure 8: Transient expression of human butyrylcholinesterase (BChE) in N. benthamiana is greatly enhanced by the co-expression of P19. Two different BChE expression vectors were constructed in p105T: (1) with the Arabidopsis basic chitinase (abc) signal sequence and a BChE synthetic of the sequence optimized for expression in coding plants referred to as E2, i.e. abc-BChE2 ; and (2) with the native human BChE signal sequence (hSS) and another synthetic BChE sequence optimized for expression in plants code referred to as E3, ie, hSS-BChE3. These were introduced into all N. benthamiana plants by vacuum infiltration (Garabagi et al, 2012a,b), with or without the P19 expression vector described in this application. Samples were collected at 5, 7 and 9 days after infiltration (DPI) and BChE activity was measured using the Ellman assay (Ellman et al., 1961). All histogram bars show BChE values in mg BChE leaf tissue/kg, converting activity measurements to enzyme mass using the specific activity conversion factor of 718.3 activity units per mg BChE determined in Weber et al. (2010). Note that bedding readings (as determined with extracts from the untreated plants) have been subtracted to present this data. The histogram bars indicate the mean BChE activity measured in 2 samples from 2 plants (total of 4 replicates of each) with associated standard error bars.

[0022] Figure 9: Diagram of one of the expression cassettes used in Figure 7 and Figure 8. The 105 mAb expression cassette of Figure 1 is shown at the top of the figure. Insertion of a coding sequence for a recombinant protein to be expressed in plants is performed using restriction endonuclease BspEI to ligate the 3' end of that coding sequence, resulting in a 162 bp deletion of the 5' end of Rbc 3 ' UTR and terminator. The resulting 105T (T=truncated) of the expression cassette is shown at the bottom of the figure.

Detailed description of the disclosure

[0023] As described above, the present inventors have designed and tested a set of plant expression vectors that are suitable for enhancing recombinant protein expression in plants. The unique combination of promoter, 5' UTR and 3' UTR/terminator in these high levels of heterologous plant protein expression vector units, including Nicotiana benthamiana and Nicotiana tabacum.

I. Expression Vectors

[0024] In one embodiment, the application provides an expression vector comprising: (a) a promoter selected from (i) the cauliflower mosaic virus (CaMV) 35S promoter or (ii) the gene promoter the small subunit of ribulose bisphosphate carboxylase (rbc) from Chrysanthemum morifolium; (b) a 5' untranslated region (UTR) selected from (i) the 35S 5' UTR of CaMV or (ii) the 5' UTR of the rbc small subunit gene small subunit of the C. morifoliurrr gene, and (c) a 3' UTR and terminator sequence selected from (i) the 3' UTR and terminator sequence of the Agrobacterium nopaline synthase (nos) gene, (ii) the 3' UTR and terminator sequence of the osmotin gene (osm ) from Oryza sativa, (iii) from the 3' UTR and terminator sequence of the C. morifolium rbc small subunit gene, or (iv) from a truncated version, by 162 bp as defined by a BspEI recognition site, from the 3' ' UTR and terminator sequence of the C. morifolium rbc small subunit gene.

[0025] As used herein, the term "vector expression" means that a nucleic acid molecule, such as a plasmid, comprising regulatory elements and a site for the introduction of transgenic DNA, which is used to introduce said transgenic DNA that is in a host cell. The transgenic DNA can encode a heterologous protein, which can be expressed in and isolated from plant cells.

[0026] Regulatory elements include promoters, 5' and 3' untranslated regions (UTRs) and terminator sequences or respective truncations. The normative elements of the present invention can be selected from the 35S promoter and 5' UTR of cauliflower mosaic virus (CaMV; Genbank accession: AF140604), the promoter and 5' UTR ribulose bisphosphate carboxylase (rbc) small subunit gene. Chrysanthemum morifolium (Genbank membership: AY163904.1), the heat shock promoter (Hsp81.1) from Arabidopsis thaliana, the 3' UTR and terminator sequences of the Agrobacterium nopaline synthesis (nos) gene (Genbank membership: V00087.1) , the 3' UTR and terminator sequences from the osmotin (osm) gene from Oryza sativa (Genbank accession: L76377.1) and the 3' UTR and terminator sequences from the C. morifolium rbc gene. In one embodiment, the Arabidopsis Hsp81.1 promoter is placed directly above one of the other promoters.

[0027] In one embodiment, the expression vector comprises the CaMV 35S promoter, operably linked to the CaMV 35S 5' UTR and the Agrobacterium nos gene 3' UTR terminator sequence. This expression vector may also be referred to as p103.

[0028] In another embodiment, the expression vector comprises the 35S promoter of CaMV, operably linked to the 35S 5' UTR of CaMV and the 3' UTR terminator sequence of the osm of the Oryza sativa gene. This expression vector may also be referred to as p104.

[0029] In another embodiment, the expression vector comprises the CaMV 35S promoter, operably linked to the CaMV 35S 5' UTR and the 3' UTR terminator sequence from the C. morifolium rbc small subunit gene. This expression vector may also be referred to as p105.

[0030] In another embodiment, the expression vector comprises the 35S promoter of CaMV, operably linked to the 35S 5' UTR of CaMV and a 162 bp truncated version as defined by a BspE\ local recognition of the terminator and 3' sequence C. morifolium rbc small subunit gene UTR. This expression vector may also be referred to as p105T.

[0031] In another embodiment, the expression vector comprises the C. morifolium rbc small subunit gene promoter, operably linked to the 5' UTR of the C. morifolium rbc small subunit gene, and the terminator 3' UTR sequence of the C. morifolium rbc gene. C. morifolium rbc small subunit gene. This expression vector may also be referred to as p106.

[0032] As used herein, the term "nucleic acid molecule" designates a sequence of nucleoside or nucleotide monomers consisting of naturally occurring bases, sugar bonds, and intersugar (structure). The term also includes modified or substituted sequences, comprising the occurrence of monomers or unnatural parts thereof. The nucleic acid sequences of the present invention may be deoxyribonucleic acid (DNA) sequences or ribonucleic acid (RNA) sequences and may include naturally occurring bases including adenine, guanine, cytosine, thymidine and uracil. The sequences may contain modified bases. Examples of such modified bases include aza and deaza adenine, guanine, cytosine, thymidine and uracil; and xanthine and hypoxanthine.

[0033] In one embodiment, the application provides an expression vector comprising: (d) a promoter selected from (i) the cauliflower mosaic virus (CaMV) 35S promoter or (ii) the gene promoter small subunit of ribulose bisphosphate carboxylase (rbc) from Chrysanthemum morifoliun, (e) a 5' untranslated region (UTR) selected from (i) the 35S 5' UTR of CaMV or (ii) the 5' UTR of the CaMV gene. small subunit of the rbc small subunit of the C. morifoliunr gene, (f) a 3' UTR and terminator sequence selected from (i) the 3' UTR and terminator sequence of the Agrobacterium nopaline synthase gene (nos), (ii) from the 3' UTR and terminator sequence of the osmotin gene (osm) from Oryza sativa, (iii) from the 31 UTR and terminator sequence from the small subunit gene of C. morifolium rbc or (iv) from a truncated version, by 162 bp as defined by a BspEl recognition site, the 3' UTR and terminator sequence of the C. morifoliu rbc small subunit gene m and (g) a nucleic acid sequence encoding a recombinant protein.

[0034] As used herein, the term "recombinant protein" means any polypeptide that can be expressed in a plant cell, wherein said polypeptide is encoded by transgenic DNA introduced into the plant cell through the use of an expression vector. In a preferred embodiment, the expression vector is p103. In another preferred embodiment, the expression vector is p105 or p105T.

[0035] In one embodiment, the recombinant protein is an antibody or antibody fragment. In a specific embodiment, the antibody is trastuzumab or a modified form, composed of 2 heavy (HC) and 2 light (LC) chains. Trastuzumab (Herceptin® Genentech Inc., San Francisco, CA) is a humanized murine G1K immunoglobulin K antibody that is used in the treatment of metastatic breast cancer.

[0036] In another specific embodiment, the antibody is bevacizumab or a modified form, composed of 2 heavy chains (HC) and 2 light chains (LC). Bevacizumab (brand name Avastin, Genentech/Roche) is an angiogenesis inhibitor, a drug that slows the growth of new blood vessels. It is licensed to treat a variety of cancers, including colorectal, lung, breast, glioblastoma, kidney, and ovary.

[0037] In another specific embodiment, the recombinant protein is an enzyme as a therapeutic enzyme. In a specific embodiment, the therapeutic enzyme is butyrylcholinesterase. Butyrylcholinesterase (also known as pseudocholinesterase, plasma cholinesterase, BCHE or BuChE) is a nonspecific cholinesterase enzyme that hydrolyzes many different choline esters. In humans, it is mainly found in the liver and is encoded by the BCHE gene. It is being developed as an antidote to nerve gas poisoning.

[0038] The nucleic acid molecules encoding the HC and LC of an antibody or antibody fragment or the coding sequence of a therapeutic enzyme may be incorporated separately into each expression vector or incorporated together into a single expression vector, comprising several expression cassettes.

[0039] As used herein, the term "expression cassette" means a unique, operably linked set of regulatory elements that includes a promoter, a 5' UTR, a transgenic DNA insertion site, a 3' UTR, and a DNA sequence. terminator.

[0040] As used herein, the term "antibody fragment" includes, without limitation, Fab, Fab', F(ab') 2 , scFv, dsFv, ds-scFv, dimers, minibodies, diabodies and respective fragments of bispecific antibodies.

[0041] In one embodiment, a peptide signal directing the polypeptide to the secretory pathway of plant cells can be placed at the amino terminus of recombinant proteins, including HCs and/or LCs antibodies. In a specific embodiment, the basic chitinase (SP) signal peptide Arabidopsis thaliana, i.e. MAKTNLFLFLIFSLLLSLSSA (SEQ ID NO:2), is placed at the amino (N-) terminus of both HC and LC (Samac et al. , nineteen ninety).

[0042] In another embodiment, the native signal peptide human butyrylcholinesterase (SP), i.e. MHSKVTIICIRFLFWFLLLCMLIGKSHT SEQ ID NO:3, is placed at the amino (N-) terminus of a therapeutic enzyme such as butyrylcholinesterase (GenBank: AAA99296.1).

[0043] Other peptide signals can be extracted from GenBank [http://www.ncbi.nlm.nih.gov/genbank/] or other such databases, and their sequences added to the N-terminus of the HC or LC, nucleotide sequences for these being optimized for plant-preferred codons as described above and then synthesized. The functionality of an SP string can be predicted using freeware online, such as the SignalP program [http://www.cbs.dtu.dk/services/SignalP/],

[0044] In a specific embodiment, the nucleic acid constructs encoding recombinant proteins, including antibodies HCs and/or LCs, and therapeutic proteins such as enzymes are optimized for plant codon usage. In particular, the nucleic acid sequence encoding the heavy chain and the light chain can be modified to incorporate codons from the preferred plant. In a specific embodiment, coding sequences for the HC and LC, including the SP in both cases, were optimized for expression in Nicotiana species. The first objective of this procedure was to make the coding sequences more similar to the Nicotiana species. Codon optimizations were performed using online freeware, ie the Protein Back Translation (Entelchon) program and Nicotiana Preferences encoding sequence. Thus, the codons with the highest frequencies for each amino acid in Nicotiana species were incorporated (Nakamura, 2005). In addition, potential intervening splice site acceptor sequence and donor motifs were identified (Shapiro et al., 1987; CNR National Research Council) and later removed by nucleotide substitution which resulted in codons encoding the same amino acids. Inverted repeat sequences were analyzed using the Genebee RNA secondary structure software package (Brodsky et al.; GeneBee Molecular Biology Server); nucleotides were altered to reduce the free energy (kilocalories per mole) of the secondary structure potential while maintaining the polypeptide sequence. Likewise, repeated elements were analyzed (CNR National Research Council) and replaced when present. Potential methylation sites (ie, CXG and CpG; Gardiner-Garden et al.) were substituted whenever possible and always without altering the encoded amino acid sequence. An optimized Kozak (Kozak, 1984) translation start site was designed. Plant polyadenylation sites (ie, AATAAA, AATGAA, AAATGGAAA, and AATGGAAATG; Li et al.; Rothnie) and elements of ATTTA RNA instability (Ohme-Takagi et al.) were likewise avoided.

[0045] Selectable marker genes can also be linked to T-DNA, such as the kanamycin resistance gene (also known as the neomycin phonphatase II gene, or nptll), Basta resistance gene, hygromycin resistance gene or others.

II. P19 squelch suppressor

[0046] In one embodiment the recombinant protein, such as an antibody or therapeutic enzyme, is co-expressed with the P19 protein of the Tomato Bushy Stunt Virus (TBSV; GenBank Accession: M21958). In a preferred embodiment, the TBSV P19 protein is expressed from a nucleic acid molecule, which has been modified to improve expression levels in tobacco plants. In a specific embodiment, the modified P19-encoding nucleic acid molecule has the sequence shown in SEQ ID NO: 1.

[0047] In one embodiment, the P19-encoding nucleic acid is incorporated into one of the expression vectors of the present invention. In a preferred embodiment, the expression vector is p103, p105, or p105T.

[0048] The P19 protein can be expressed from an expression vector, comprising a single expression cassette, or from an expression vector that contains one or more additional cassettes, in which one or more additional cassettes comprise transgenic DNA encoding one or more more recombinant proteins.

III. Plant transformation method

[0049] The inventors have demonstrated that they can achieve high levels of expression of recombinant proteins using the vectors described herein.

[0050] Accordingly, the present additional resource provides a method of enhancing the production of a recombinant protein in a plant comprising: (i) introducing an expression vector comprising (a) a promoter selected from (i) the 35S promoter of the virus from the cauliflower mosaic (CaMV) or (ii) from the Chrysanthemum morifolium- ribulose bisphosphate carboxylase (rbc) small subunit gene promoter, (b) a 5' untranslated region (UTR) selected from (i) ) 35S 5' UTR of CaMV or (ii) the 5' UTR of the small subunit gene of the rbc small subunit of the gene of C. morifolium-, (c) a 3' UTR and terminator sequence selected from (i) the 3 ' UTR and terminator sequence from the nopaline synthase gene (nos) from Agrobacterium, (ii) from the 3' UTR and terminator sequence from the osmotin gene (osm) from Oryza sativa, (iii) from the 3' UTR and terminator sequence from the gene from small subunit of C. morifolium rbc, or (iv) a truncated version, by 162 bp as defined by u a BspEl recognition site of the 3' UTR and terminator sequence of the C. morifolium-rbc small subunit gene, and (d) a nucleic acid sequence encoding a recombinant protein in a plant or a plant cell; and (ii) culturing the plant or plant cell to obtain a plant that expresses the recombinant protein.

[0051] In one embodiment, the recombinant protein is the heterologous protein only expressed in the plant or plant cell. In a preferred embodiment, the recombinant protein is co-expressed with the TBSV P19 protein. Expression vectors and P19 protein for expressing them are described above.

[0052] In one embodiment, the recombinant protein is an antibody or antibody fragment, comprising a heavy chain variable region and a light chain variable region. In a specific embodiment, the antibody is Trastuzumab. In another specific embodiment, the antibody is bevacizumab.

[0053] In another specific embodiment, the recombinant protein is an enzyme such as butyrylcholinesterase.

[0054] In one embodiment, the heavy chain variable region nucleic acid encoding molecule and the light chain variable region nucleic acid encoding molecule may be introduced into the plant cell in separate expression vectors. In another embodiment, the heavy chain variable region nucleic acid encoding molecule and the light chain variable region nucleic acid encoding molecule can be introduced into the plant cell on the same expression vector. In such an embodiment, the heavy chain and the light chain would be expressed separately and then combined in the plant cell to prepare the desired antibody or antibody fragment.

[0055] “The phrase “introduce” an expression vector into a plant or a plant cell” includes both the stable integration of the recombinant nucleic acid molecule into the genome of a plant cell to prepare a transgenic plant, as well as the transient integration of the recombinant nucleic acid in a plant or part thereof.

[0056] The expression vectors can be introduced into the plant cell using techniques known in the art, including, without limitation, electroporation, an accelerated particle delivery method, a cell fusion method, or by any other method to deliver the expression vectors. expression to a plant cell, including Agrobacterium-mediated delivery, or other bacterial delivery such as Rhizobium sp. NGR234, Sinorhizobium meliloti and Mesorhizobium loti (Chung et al, 2006).

[0057] The plant cell may be any plant cell, including, without limitation, tobacco plants, tomato plants, corn plants, alfalfa plants, Nicotiana benthamiana, Nicotiana tabacum, Nicotiana tabacum of cv. Little Crittenden, rice plants, large Lemnas or lesser Lemnas (duckweeds), safflower plants or any other plants that are agriculturally propagated and amenable to genetic modification for the expression of recombinant or foreign proteins.

[0058] In one embodiment, the recombinant protein is transiently expressed, with or without P19, in N. benthamiana. In another embodiment, the recombinant protein nucleic acid encoding molecule is integrated into the genome of a N. tabacum plant, which can later be used for transgenic expression. In a preferred embodiment, the N. tabacum plant is from cv. Little Crittenden (LCR) and the recombinant protein are co-expressed with P19. As described in example 1, LCR was the only culture identified that did not induce a hypersensitive response (HR) in the presence of P19. This tobacco crop, therefore, can be used effectively in conjunction with P19-based transgenic expression systems.

[0059] In one embodiment, the recombinant protein and P19 are co-expressed in an RNAi-based glycomodified tobacco plant. In a preferred embodiment, the plant is a N. benthamiana plant. In a more preferred embodiment the N. benthamiana plant exhibits the RNAi-induced silencing genes of the endogenous fucosyltransferase (FT) and xylosyltransferase (XT) genes. As shown in Example 1, P19 can safely be used with glycomodified RNAi-based N. benthamiana expression hosts for the production of recombinant proteins such as antibodies without altering the glycan profile of the recombinant protein.

[0060] As used herein, the phrase "RNAi-based glycomodified tobacco plant" means a tobacco plant that expresses polypeptides with altered glycan profiles, in which altered profiles result from the use of RNA gene silencing technology (RNAi) interfering. Specific plant sugar residues in the N-glycan core, namely α1,3-fucose and β1,2-xylose core, are immunogenic in mammals (Bardor et al., 2003; Jin et al., 2008). Due to the existence of multiple endogenous FT XT genes and in most plants, preferentially modified glycosylation patterns are created using RNAi technology (Cox et al., 2006; Sourrouille et al., 2008; Strasser et al. , 2008).

[0061] The phrase "growth of a plant or plant cell to obtain a plant that expresses a recombinant protein" includes both growth of transgenic plant cells into a mature plant, as well as growth or cultivation of a mature plant that has received the molecules encoding the nucleic acid of the recombinant protein. One skilled in the art can readily determine the proper growth conditions in each case.

[0062] In a specific embodiment, expression vectors containing the recombinant nucleic acid molecules of the A. tumefaciens strain are introduced by electroporation procedures. N. benthamiana plants can be vacuum infiltrated according to the protocol described by Marillonnet et al. (2005) and Giritch et al. (2006) with several modifications. Briefly, all cultures can be grown at 28° and 220 rpm to a final optical density at 600 nm (OD600) of 1.8. Equal volumes are combined and pelleted by centrifugation at 8,000 rpm for 4 minutes, resuspended and diluted by 103 in acid infiltration buffer (10 mM 1-(/\/.-Morpholins)ethanesulfonic acid (MES) pH 5.5, 10 mM MgSO4 ). Alternatively, each of the 5 Agrobacterium cultures could be grown to lower OD values, and Beer's law could be applied to determine the volumes of each culture needed to make a bacterial cocktail suspension, whereby the concentrations of all bacterial strains were equivalent. Alternatively, lower or higher concentrations of the expression vectors could be used to improve expression of the recombinant protein. Alternatively, higher or lower dilutions with infiltration buffer could be used.

[0063] The six-week-old aerial parts of the /V. benthamiana are submerged in a chamber containing the Agrobacterium tumefaciens resuspension of solution, after which a vacuum (0.5 to 0.9 bar) is applied for 90 seconds, followed by a slow release of the vacuum, after which the plants have been returned to the greenhouse for 8 days before being harvested. Alternatively, longer or shorter periods, under vacuum, and/or vacuum release, could both/or/and be used. Alternatively, they could be used for longer or shorter growing periods in the greenhouse. Alternatively, an enhanced horticultural pattern of growth, maximized for recombinant protein production could be used (see Colgan et al., 2010).

[0064] Alternatively, instead of transiently introducing expression vectors containing the HC and LC coding sequences of an antibody, or the butyrylcholinesterase coding sequence, stable transgenic plants could be produced using a vector in which the coding molecule of the heavy chain variable region nucleic acid and the light chain variable region nucleic acid encoding molecule may be introduced together in the same construct. In one embodiment, the heavy chain variable region nucleic acid encoding molecule may be ligated to the light chain variable region nucleic acid encoding molecule of a linker to prepare a single chain variable region fragment (scFv).

[0065] In another embodiment, the heavy chain nucleic acid encoding molecule and the light chain nucleic acid encoding molecule may be introduced into the plant cell on separate expression vector nucleic acid constructs. In such an embodiment, the heavy chain and the light chain would be expressed from the separate transgenic loci and then combine in the plant cell to prepare the antibody or antibody fragment.

[0066] Expression vector(s) that contain antibody HC and LC genes will be introduced into Agrobacterium tumefaciens At542 or other appropriate Agrobacterium isolates or other suitable bacterial species capable of introducing DNA to plants for transformation such as Rhizobium sp., Sinorhizobium meliloti, Mesorhizobium loti and other species (Broothaerts et al. 2005; Chung et al., 2006), by electroporation or other bacterial transformation procedures. Agrobacterium clones containing expression vectors would be propagated on Luria-Bertani (LB) plates containing rifampicin (30 mg/l) and kanamycin (50 mg/l) or other selectable media, depending on the nature of the selectable marker genes in the vector. . Leaf disc-mediated Agrobacterium transformation (Horsch et al. 1985; Gelvin, 2003), or similar protocols involving wound tobacco (/V. tabacum, variety 81V9 or tissue from other tobacco varieties such as those listed in Conley et al., 2009) or N. benthamiana or other plant species such as Solanaceae, maize, safflower, Lemna spp., etc. could be infected with the Agrobacterium culture (OD600 = 0.6) and plated on Murashige and Skoog plus half vitamins (MS; Sigma), supplemented with agar (5.8%; Sigma) and containing kanamycin (100 mg/l) or cefotaxime 500 (mg/L) or other selectable media, depending on the nature of the selectable marker genes in the expression vector, for the selection of transformed plant cells. Shoot production would be induced with naphthalene acetic (NAA; 0.1 mg/l; Sigma) and benzyl adenine (BA; 1 mg/l; Sigma) in the medium. For root induction, newly formed shoots were transferred to Magenta boxes (Sigma-Aldrich, Oakville, ON) in MS medium (as above) that was lacking NAA and BA. After roots form, the plants could be transplanted into the ground and grown in greenhouse culture. For plant transformation, as many as possible or at least 25 of the primary transgenic plants would be produced. ELISA and quantitative immunoblots would be performed on all plants to characterize the total levels and active antibodies produced by the plants, respectively (Almquist et al., 2004; 2006; McLean et al., 2007; Olea- Popelka et al., 2005; Makvandi- Nejad et al., 2005).

[0067] After the selection of the primary transgenic plants expressing antibody, or simultaneous with the selection of the plants expressing antibody, the derivation of stable homozygous lines from the transgenic plants would be performed. Primary transgenic plants would be grown to maturity, allowed to self-pollinate, and produce seeds. Homozygosity would be verified by observing 100% resistance of seedlings on kanamycin (50 mg/L) plates, or another selectable drug as indicated above. A homozygous line with unique T-DNA inserts, which are shown by molecular analysis to produce the most amounts of antibodies, would be chosen for homozygous breeding and seed production, ensuring subsequent seed sources for homogeneous antibody production by the transgenic culture. or stable genetically modified (Olea-Popelka et al., 2005; McLean et al., 2007; Yu et al., 2008).

[0068] Alternatively, the expression vector with both HC and LC genes, or 2 expression vectors (one with one HC gene and one with one LC gene), could be used to transiently infect a plant, or plant tissues, such as described above, and tissues harvested as described above for subsequent antibody purification.

[0069] The antibody or antibody fragment or enzyme can be purified or isolated from plants using techniques known in the art, including homogenization, homogenate clarification and affinity purification. Homogenization is any process that crushes or breaks up the tissue and cell factory and produces homogeneous liquids from plant tissues, such as using a blender or juicer, or grinder or sprayer such as a mortar and pestle, etc. Clarification involves either/and/or centrifugation, filtration, etc. Affinity purification uses Protein A or Protein G or Protein L or antibodies that bind to antibodies; Affinity purification by enzymes uses ligands that bind to them, such as procainamide or huprine.

[0070] The following non-limiting examples are illustrative of the present invention:

EXAMPLE 1 Experimental Procedures Plant Expression Vectors

[0071] Four expression cassettes, ie 103-106, were synthesized and cloned into the plCH14011 region of T-DNA creating plasmids p103-p106 for the production of recombinant proteins in Nicotiana species. The structures of expression cassettes are described in Figure 1. Expression cassettes 103-105 contain the 35S promoter and 5' UTR of cauliflower mosaic virus (CaMV; GenBank Accession: AF140604), while 106 contain the promoter and 51 UTR ribulose bisphosphate carboxylase (rbc) small subunit gene Chrysanthemum morifolium (GenBank Accession: AY163904.1). Cassette 103 contains the 3' UTR and terminator sequences of the Agrobacterium nopaline synthase (nos) gene (GenBank Accession: V00087.1), cassette 104 contains the 3' UTR and terminator sequences of the osmotin gene (osm) from Oryza sativa (GenBank Accession: L76377.1), and cassettes 105 and 106 carry the 3' UTR and terminator sequences of the C. morifolium rbc gene (GenBank Accession: AY163904.1). The structures of another expression cassette are depicted in Figure 9. This expression cassette was derived from p105 by inserting a coding sequence for a recombinant protein to be expressed in plants using restriction endonuclease BspE\ for ligation of the 3' end of the than the coding sequence, resulting in a 162 bp deletion of the 5' end of the Rbc 3' UTR and terminator. The resulting plasmid is known as p105T.

[0072] The Tomato Bushy Stunt Virus P19 protein (TBSV; GenBank Accession: M21958) was cloned into cassette 103. Trastuzumab heavy and light chains (Grohs et al, 2010) were cloned separately into expression cassettes 103-106 . The heavy and light chains were both fused to the signal sequence of the Arabidopsis thaliana basic chitinase gene (Genbank Accession: AY054628) for secretion into the apoplast. All protein sequences were codon optimized for expression in N. benthamiana. The codon P19 optimized nucleic acid coding molecule has the sequence shown in SEQ ID NO: 1. The trastuzumab heavy and light chains were also cloned into a single binary vector, designated as 102mAb, in which the heavy chain was driven by the Arabidopsis thaliana deactin2 promoter (Genbank Accession: NM_112764) with A. thaliana actin2 UTRs and terminator region, and light chain driven by chimeric octopine and mannopine synthase promoter (Genbank Accession: EU181146.1) with UTRs and terminator region of the gene from A thaliana ubiquitin 10 (ubq10) (Genbank Accession: L05361).

Bacterial Culture and Transformation

[0073] Competent Agrobacterium tumefaciens A136 cells were transformed with the above-mentioned expression cassettes by a standard heat shock method. Bacterial cultures were grown overnight at 28°C in YEP medium (10 g Bacto peptone, 10 g yeast extract, and 5 g sodium chloride per liter, pH 7.0) supplemented with antibiotics. Unless otherwise indicated, cultures during dense nights (up to OD600= 2.5) for each vector were adjusted to an OD600 of 0.2 in Agro Infiltration Buffer (AIB) containing 10 mM 2-(4-morpholino)-acid. ethanesulfonic acid (MES), 10 mM MgSO4, pH 5.5 and mixed together to create an Agrobacterium Infiltration Cocktail (AIC) for the treatment of plants.

Transient Expression of the Assay and Sample Preparation

[0074] Plants were grown in a greenhouse and fed high nitrate fertilizer (N:P:K = 20:08:20) daily at 1 g/l (Vegetable Products, Brampton, Ontario, Canada), adjusted to pH 6.0 with 20% H3PO4. To transiently express trastuzumab, an AIC containing two strains of Agrobacterium, each harboring one of the antibody chains, were used to infiltrate plant leaves. All plants were treated in the 4 to 6 week phase, either by site or whole plant infiltration. Soon after the treatment, the plants were placed in a greenhouse for a certain period of harvest, depending on the expression vector ahead of time. During this period, the plants were fed only with water. When the crop had fully infiltrated the plants, newly emerged leaves were discarded and the infiltrated leaves were separated from the stems and stored at -80°C until further processing. To detect the infiltrations, 100 mg of leaf tissue from the infiltrated area was weighed and stored at -80°C until further processing.

[0075] Approximately 100 mg of leaf tissue was mixed with 300 μl of extraction buffer, containing phosphate buffered saline (PBS: 8 g NaCl, 0.2 g KCI, 1.44 g Na2HPO4, and 0.24 g KH2PO4 per liter) and 10 mM EDTA , pH 6.8 (PBSE buffer). Samples were stopped in a 2 ml microcentrifuge tube containing two stainless steel ball bearings for 5 minutes using a TissueLyser (Qiagen) to prepare an extract of the crude protein, which was aliquoted in small volumes and stored at -20° Ç.

Western Blotting

[0076] The frozen aliquot was thawed and spun in a refrigerated bench top centrifuge at >13,000 rpm for 1 minute to clarify the crude extract for protein quantification. A BCA assay (Pierce) or a Bradford assay was used to determine the protein concentration of the crude extracts once thawed. 30 μg of total soluble protein (TSP) per sample was loaded into each well on an 8% SDS polyacrylamide gel. The separated proteins were disrupted on a polyvinylidene fluoride (PVDF) membrane and probed for the presence of the antibody with an alkaline phosphatase conjugated mixture of anti-human θ antibodies K (Sigma Aldrich, Cat# A3312 and A3813), diluted in 1:10,000 in PBS (pH 7.4), using NBT/BCIP (Thermo Scientific, Cat# 34042) as substrate. Blots were developed for 2-5 minutes, depending on experience.

ELISA

[0077] Enzyme-linked immunosorbent assay (ELISA) was used to measure the amount of antibodies present in the crude protein extract of the treated plants. ELISA plates were coated overnight at 4°C, with a polyclonal mouse anti-human IgG1 (Sigma-Aldrich, Cat# I5885) capturing the antibody in 0.6 µg/ml PBS. Human IgG1 Standard (Athens Research and Technology, Cat# 16-16-090707) spiked at 5 pg of untreated crude protein extract was used as a standard. The standard curve was generated using human IgG1, which allowed for antibody detection over a range spanning three orders of magnitude (0.1-100 ng/well). Crude extract from each treated sample was loaded onto an ELISA plate as two dilutions in triplicate. Final antibody concentration was calculated by averaging the average antibody concentration for three dilutions of the crude extract. A second rabbit HRP-conjugated anti-human antibody (Abeam, Cat # ab6759) was used for detection, using TMB-ELISA (Thermo Scientific, Cat # 34022) as a substrate. The plates were allowed to develop for 15 minutes before the reaction was stopped with 0.5M H2SO4.

Antibody Purification

[0078] Antibodies were purified essentially as described by Grohs et al. (2010).

N glycosylation analysis

[0079] N-glycan analyzes of purified mAbs were performed by electrospray liquid chromatography from ionization mass spectrometry (LC-ESI-MS) of glycopeptides from recently described tryptics (Stadlmann et al., 2008). Briefly, the purified samples were subjected to SDS PAGE reduction and the corresponding 55 kD band so that the HC was cut from the gel, S alkylated, digested with trypsin, eluted from the gel fragment with 50% acetonitrile and separated on a Biobasic column. C18 (150 x 0.32 mm, Thermo Electron) with a gradient of 1%-80% acetonitrile containing 65 mM ammonium formate pH 3.0. Positive ions were detected with an Ultima Global Q TOF mass spectrometer (Águas, Milford, MA, USA). The summed and deconvoluted spectra of the elution range of glycopeptides were used for the identification of glycoforms. This method generates two glycopeptides that differ by 482 Da (glycopeptide 1, EEQYNSTYR; glycopeptide 2, TKPREEQYNSTYR).

Results The Untranslated Regions used in Trastuzumab Recombination Expression significantly impact Antibody Accumulation.

[0080] Trastuzumab is a therapeutic antibody used in the treatment of HER2+ breast cancer (Baselga et al., 1998; Lewis et al., 1993). To produce this antibody in Nicotine hosts, its heavy (HC) and light (LC) chains were cloned into plant expression cassettes and placed in a single binary vector (102mAb) or separated from the binary vectors (103-106HC and 103LC- 106), in which case they were co-expressed (referred to as 103mAb-106mAb vector sets) to produce the fully assembled antibody. The different expression cassettes were designed to carry different combinations of promoters, 5'UTRs and 3'UTR/terminators (Figure 1). Trastuzumab was transiently expressed in N. benthamiana using 103mAb-106mAb vector pool to compare levels of recombinant antibody production. The time course of expression at 7 days with vacuum infiltration of the whole plant showed a significant difference in dynamic and maximal antibody expression between the sets of four vectors (Figure 2A). The 105mAb and 106mAb vectors resulted in greater maximum antibody accumulation compared to 103mAb and 104mAb. Antibody expression reached a post-infection peak at 3-4 days (d.p.i) for 103mAb and 104mAb and at 4-5 d.p.i. for 105mAb, whereas 106mAb showed a constant increase in post-infection expression for up to 7 days. Maximum antibody levels were achieved with the 105mAb and 106mAb vector sets, estimated by ELISA at =1% of the TSP. The protein content of tobacco leaves has been estimated to be about 2% of the fresh weight (Stevens et al., 2000), therefore, antibody expression in 1% TSP translates to =200 mg of antibody per kg of fresh weight (FW). An accumulation of the antibody was observed on a 20-fold scale when compared to the different vectors. Therefore, different UTR elements merged to codes for the heavy and light chains of trastuzumab that significantly affect the accumulation of the fully assembled antibody when transiently expressed. In addition, N-glycosylation of mAbs profiles was determined by LC-ESI-MS (Ionization Mass Spectrometry Electrospray Liquid Chromatography). Typically mAbs exhibited a broadly homogeneous oligosaccharide pattern GnGnXF3 with plant-specific β1,2 xylose and α1,3 core fucose residues (see last section of results).

P19 does not have a Similar Stimulus Effect and Trastuzumab Expression of Different Expression Vectors

[0081] The effect of co-expressing P19 with 103mAb-106mAb vectors was analyzed for 7 days in N. benthamiana (Figure 2B and 2C) to determine if the different combinations of UTR had any effect on the ability of P19 to increase the antibody expression, as previously reported (Saxena et al., 2011; Vezina et al., 2009). All Agrobacterium cultures used in this experiment were adjusted to an OD600 of 0.2. Not all vector sets were positively affected by P19 (Figure 2, Table 1). For 103mAb and 104mAb, P19 resulted in a 15-fold increase in Trastuzumab concentration, which despite maximal expression was almost 3-fold higher with 103mAb compared to 104mAb, without and with P19. For 105mAb, P19 only resulted in a =2-fold increase in Trastuzumab concentration, from 1% to approximately 2.1% TSP. Accumulation of antibodies with vector-defined 106mAb, which contained only plant-derived UTRs, was affected by P19. Antibody expression peaked at 103mAb and 105mAb when co-expressed with P19 at just over 2% of the TSP. It was also observed that P19 changed the peak expression time for the 103mAb, 104mAb and 105mAb vectors (Figure 2C). The ability of P19 to increase Trastuzumab expression with 102mAb vector was also tested. 102mAB is similar to 106mAb, that is, it contains only plant-derived UTRs (Figure 1). Similar to 106mAb, P19 did not affect the level of 102mAb antibody expression (Figure 3A). P19 was also found to have no stimulated effect on trastuzumab expressed with tobacco mosaic virus (TMV) and potato virus X (PVX) based deconstructed vectors (Grohs et al, 2010) (Figure 3B).

Increasing the effect of P19 on Recombinant Antibody Expression is Concentration Dependent

[0082] It is believed that in order for P19 to exert its biological function for a successful TBSV infection, it has to accumulate beyond a certain threshold concentration of plant cells (Qiu et al., 2002; Scholthof et al., 1999). When transiently expressed, co-expression of P19 with 103mAb at an Agrobacterium concentration of OD600=0.2 significantly boosted antibody production. Since the expression level of the recombinant proteins is largely the lowest for a transgenic vs transient expression, co-infiltration of 103mAb with P19 was examined at the lower concentrations of Agrobacterium to simulate transgenics with levels of P19 accumulation in N benthamiana. Infiltration of 103mAb vectors alone at OD6OO values of 0.2, 0.02 and 0.002 resulted in different levels of antibody production, with a direct correlation between applied grobacterium concentration and antibody expression level (Figure 4). The ability of P19 to increase antibody expression with 103mAb progressively decreased when P19 was applied at lower concentrations, co-expressing P19 at OD6oo=0.2 resulted in a significant increase in antibody expression regardless of 103mAb concentration (Figure 4). Thus, unless P19 can be expressed at very high levels, its utility in transgenic production of recombinant proteins may be limited due to its concentration-dependent mode of action.

Tobacco Varieties Respond Differently to P19

[0083] To utilize P19 for production of recombinant transgenic proteins in plants, it is imperative that P19 will not impair plant growth and more importantly, gene expression. As discussed, when expressed transiently at high levels in N. benthamiana, P19 effectively increases recombinant protein levels. However, due to having a much larger biomass, N. tabacum is often selected over N. benthamiana for transgenic production. The disadvantage of using N. tabacum is the development of necrosis at the site of infection for 7 days after the introduction of recombinant P19 to leaf cells via Agroinfiltration (Angel et al., 2011). The reaction that is triggered by P19 N. tabacum, also known as the hypersensitivity response, has been well documented but only tested in two tobacco cultivars (Angel et al., 2011; Jonatan et al, 2011; Siddiqui et al., 2008). To identify a tobacco that could be used with P19 in a transgenic expression system, five cultivars were selected for the development of the hypersensitive response. Trastuzumab was transiently expressed with 103mAb, alone or together with P19 by local infiltration of 5-week-old plants. Four or five tobacco cultivars, namely I-64, TI-95, Xanthi and Petite Havana H4, showed a marked decrease in antibody expression at day 6 when co-expressed with P19, compared to antibody expression without P19. (figure 5A). On the other hand, the co-expression of P19 with 103mAb in N. tabacum cv. Little Crittenden (LCR) resulted in a significant increase in trastuzumab expression (Figure 5B). Furthermore, tobacco cultivars that showed a decrease in antibody expression in the presence of P19 also showed marked discoloration of the treated areas after 3 days, while the areas infiltrated by N. benthamiana and N. tabacum cv. CSF were affected up to 10 days post-infection (shown in Figure 5 at 5 d.p.i). These results indicate that N. tabacum cv. Little Crittenden can be used as a host for the transgenic production of recombinant proteins using P19.

[0084] Reciprocal crosses were made between tobacco cultivars I-64 and LCR to look at the way in which the induction of the hypersensitive response by P19 is inherited in N. tabacum. Response induction in a sterile cross between N. benthamiana and N. tabacum, called NBT, was also tested. Five-week-old seedlings were infiltrated with 103mAb, with or without P19. Trastuzumab level has been reduced at all crosses by 5 d.p.i. when 103mAb was co-expressed with P19 (Figure 5B). This reduction in antibody expression correlated with discoloration of the treated leaves, followed by necrosis (Figure 5C). These results indicate that the putative R gene responsible for triggering the HR is nuclear, and the CSF is homozygous recessive for that gene.

P19 does not affect the silencing of fucosyltransferase and xylomodified xylosyltransferase activity based on RNAi Nicotiana benthamiana

[0085] RNAi-based silencing is a commonly used method to modify the N-glycosylation pattern in the human sense like structures in plants (Cox et al., 2006; Sourrouille et al., 2008; Strasser et al., 2008). This strategy has also been applied to eliminate plant-specific N-glycan residues (i.e., xylose and a1,3 fucoce core) in Nicotiana benthamiana (ΔXTFT) by the down-regulation of the respective fucosyltransferase and xylosyltransferase enzymes (Cox et al., 2006). ; Sourrouille et al., 2008; Strasser et al., 2008). The possible adverse effects of P19 on such plants have not yet been determined. Thus, ΔXTFT mutants were infiltrated with mAb103 vectors with or without P19. Trastuzumab was purified 5 days post-infiltration and analyzed by LC-ESI-MS to determine the N-glycosylation pattern (Figure 6B, C). Interestingly, both 103mAb versions carried an identical N-glycosylation profile, lacking the plant-specific oligosaccharides. This suggests that P19 does not affect the RNAi silencing pathway responsible for silencing FT and XT in ΔXTFT as it interferes with the silencing pathway of genes that reduce transgene expression. These results indicate that P19 can be used to increase the levels of recombinant proteins expressed in an RNAi-based expression host without altering the glycan profile of the protein.

The transient co-infiltration of the P19 expression vector greatly enhances the expression of two more therapeutic antibodies in Nicotiana benthamiana.

[0086] To demonstrate that improvements in P19 expression of other antibodies, coding sequences for the light and heavy chains of anti-HIV mAb 4E10 and bevacizumab were synthesized for expression in plants (as above). 4E10 anti-HIV mAb was first described in Buchacher et al. (1994) with its light chain sequence, being available from GenBank (http://www.ncbi.nlm.nih.gov/) as input Gl:122920218 and its heavy chain as an Fd/VH in Gl input: 61680025. This antibody can be used as an anti-HIV vaccine or as a diagnostic reagent. The bevacizumab light and heavy chain sequences are available from Drugbank (http://www.druqbank.ca/) as entry DB00112. Bevacizumab is used with standard chemotherapy for metastatic colon cancer; It has also been approved for use in certain types of lung cancer, kidney cancer, and glioblastoma multiforme of the brain. Heavy chain coding sequence for mAb 4E10 and both light and heavy chain coding sequences for bevacizumab were cloned downstream of the basic Arabidopsis chitinase signal peptide (as above) and inserted into vectors 103 and 105. The coding sequence light chain by mAb 4E10 was also cloned downstream of the basic chitinase Arabidopsis peptide signal and inserted into vector 105 and a version of vector 105 in which a pair of base 162 deletions from the 5' end of the terminator sequence of the gene C. morifolium rbc was caused by cleavage of a fispEI site; this latter vector is known as p105T (i.e., 105-truncated). All eight vectors were introduced into Agrobacterium tumefaciens At542 strain (as above), then locally infiltrated, with and without P19 (as above), into N.benthamiana leaf tissues in the combinations indicated in Figure 7 and harvested after 7 days. . Each Agrobacterium strain was applied to an OD600 end of 0.2. Tissue harvests for each treatment included 3 or 4 points, which were pooled and total soluble proteins (TSP) were extracted, as described in Garabagi et al. (2012a,b). A 10% non-reducing SDS-PAGE gel was run that included 10 mg TSP for each plant sample. Electrophoretically separated proteins were subsequently electroblotted onto the PVDF membrane and analyzed with combined anti-y and anti-K antibody probes of alkaline phosphatase conjugates (also described in Garabagi et al., 2012a). The results indicate that this co-expression of P19 greatly increases the expression of both antibodies independently of the antibody expression vector. In Figure 7, the gel loading scheme is tabulated above the immunoblot image, and the size of each molecular weight marker band in lane 1 is given on the left in kDa; quantitation of standard human serum immunoglobulins in range 10 is 500 ng; mAb = monoclonal antibody; HC = heavy chain vector; LC = light chain vector.

The transient expression of a therapeutic enzyme, human butyrylcholinesterase (BChE) is greatly enhanced by the co-expression of P19.

[0087] Butyrylcholinesterase is a non-specific cholinesterase enzyme that hydrolyzes many different choline esters. In humans, it is found primarily in the liver and is encoded by the BCHE gene. It is being developed as an antidote to nerve gas poisoning. Two different BChE expression vectors were constructed in p105T (described above): (1) with the Arabidopsis basic chitinase (abc) signal sequence and a BChE synthetic of the sequence optimized for expression in coding plants referred to as E2, i.e. , abc-BChE2; and (2) with the native human BChE signal sequence (hSS) and another synthetic BChE sequence optimized for expression in plants code referred to as E3, ie, hSS-BChE3. These were introduced into all N. benthamiana plants by vacuum infiltration (according to Garabagi et al., 2012a, b), with or without P19 (as above). Samples were collected at 5, 7 and 9 days after infiltration (DPI) and BChE activity was measured using the Ellman assay (Ellman et al., 1961). Results of this experiment are shown in Figure 8, where the histogram bars show BChE values in mg of BChE leaf tissue/kg, converting activity measurements to enzyme mass using the specific activity conversion factor of 718.3 activity units per mg of BChE determined in Weber et al. (2010). Note that bedding readings (as determined with extracts from the untreated plants) have been subtracted to present this data. The histogram bars in Figure 8 indicate the mean BChE activity measured in 2 samples from 2 plants (total of 4 replicates of each) with associated standard error bars. These data indicate that P19 co-expression greatly increases BChE expression.

Discussion

[0088] In this example, three important issues are addressed regarding the application of P19 to improve the production of recombinant proteins in plants: ability of P19 to sufficiently increase the expression of recombinant proteins; their potential adverse physiological effects on the expression host; and interference with the silencing state of genes in RNAi-based glycomodified plants. The results described herein indicate that all three requirements are met and that P19 can be used effectively for transient expression of recombinant glycoproteins in RNAi-based expression hosts.

[0089] Reports of higher antibody expression using data gene silencing suppressors have been in the transient expression of mAb 2G12 with P19 at 400 mg/kg FW (Saxena et al., 2011) and mAb C5-1 with HcPro in 757 mg/kg FW (Vezina et al., 2009). Both of these mAbs were retained on the ER by the addition of C-terminal helper tags. In the context of biosimilar therapeutic antibodies, however, ER retention signals are problematic since they add extra amino acids to the primary sequence of the novel protein. Furthermore, typical oligomannisidic ER of glycosylation is for more atypical and therefore undesirable therapeutic proteins.

[0090] P19 is shown here to enhance the expression of the therapeutic model of trastuzumab mAb that is targeted to the apoplast using classical binary vectors at about 2.3% of the TSP, or mg/kg of -460 FW. Furthermore, regulatory genetic elements used in recombination constructs determine whether or not P19 can increase expression. This was demonstrated by co-expression of P19 together with trastuzumab heavy and light chains cloned into different expression vectors containing different 5' and 3' UTRs. The results described herein indicate that transcripts of at least one virus-derived UTR, such as 103mAb, 104mAb and 105mAb, were driven by P19. This suggests that transcripts from these expression cassettes are subject to RNAi silencing, albeit to different degrees, and therefore are boosted in the presence of a suppressor of gene silencing. In contrast, transcripts that contained only plant-derived UTRs, such as 106mAb and 102mAb, were unaffected by P19, suggesting that they were not subject to any significant RNAi silencing during the observation period. These findings may have direct implications for the design of expression vectors.

[0091] The P19 here is also shown to increase the expression of another therapeutic mAb, namely bevacizumab, using two of the vectors described in this application. P19 here is also shown to increase expression of another therapeutic mAb, namely anti-HIV mAb 4E10, using three of the vectors described in this application. These three examples illustrate the potential for P19 to enhance the expression of no further antibodies using the vector system disclosed in this application.

[0092] P19 is also shown herein to increase expression of a potential therapeutic enzyme, namely butyrylcholinesterase, using one of the vectors described in this application with either the Arabidopsis basic kinase signal sequence or the native human butyrylcholinesterase signal sequence. and using either of two synthetic coding sequences, optimized for plant expression of the identical butyrylcholinesterase polypeptide therefrom. This example illustrates the potential for P19 to enhance the expression of therapeutic proteins other than antibodies, such as enzymes.

[0093] It is evident that the vectors described in this application can produce different therapeutic proteins, and that the expression of proteins from these vectors in the plant can be enhanced by the co-expression of the P19 gene.

[0094] It is also apparent from several reports on constitutive transgene expression of P19 that the onset of adverse effects occurs only when the protein is used at high titers, especially since high-level constitutive expression of P19 is known to be lethal in Arabidopsis (Dunoyer et al., 2004). This dose-dependent functionality of P19 is supported by the fact that transgenic tobacco cv. Xanthi is tolerant to P19 at low levels (Siddiqui et al., 2008), while the protein generates necrosis in tobacco cvs. Samsun leaves and NC95 when transiently expressed at high titers (Angel et al., 2011). Inducible expression systems that are capable of producing high levels of recombinant protein have been used to circumvent the lethality caused by producing high titers of P19 in transgenic systems. However, unfavorable effects such as malformed leaves and flowers appear when P19 is expressed with such systems at high levels, such as the pOp/LhG4 transactivation systems described by Stav et al. (2009). Since transgenes are generally of higher expression in transients as opposed to transgenic configurations (Garabagi et al. 2012, in press), the amount of P19 protein produced by transient infiltration at concentrations of OD60O= 0.02 and less has been shown not to increase significantly trastuzumab levels. On the other hand, high concentrations of P19 (OD600=0.2) caused a 15-fold increase in antibody levels (Figure 4). These results support the idea of dose-dependent functionality of P19 in the context of increasing expression of recombinant proteins. However, the titer at which P19 exerts its stimulating effect causes a hypersensitive response in most tobacco cultivars (Figure 5A).

[0095] Recent reports on the induction of the hypersensitive response in N. tabacum cvs. Samsun and NC95 describe a physiological response that involves induction of the RNAi silencing site (Jovel et al, 2011) followed by necrosis (Angel et al., 2011). This response is likely triggered by the product of a putative R gene (Angel et al., 2011). As described in the present example, a tobacco cultivar, Little Crittenden, was identified that did not trigger a hypersensitivity response when exposed to high titers of P19 (Figure 5A and 5C). All other tobacco cultivars tested showed a marked decrease in antibody production in the presence of P19 compared to the expression of antibody vectors alone, indicating the induction of an RNAi silencing mechanism that replaces the deletion of the silencer gene by P19. . These results are in agreement with the latest reports on the induction of the hypersensitivity response in N. tabacum, which includes an induction of the RNAi silencing site (Angel et al, 2011; Jovel et al, 2011). The results described in this document also indicate a dominant mode of inheritance for this trait, also in accordance with the previously described characteristics of the R genes (Moffett, 2009) and that CSF cultivar has a recessive mutation in this gene. Thus, this tobacco genotype and others like it that have R gene mutations can lend themselves to transgenic expression of recombinant proteins using O P19 when used with a system capable of generating high titers of protein. LCR can be used as a model to determine the number of genes involved in the P19 hypersensitivity response.

[0096] Despite the ability of plants to perform complex glycosylation, a possible funnel to its use as a versatile expression platform for therapeutic antibodies is the presence of plant-specific N-glycan residues, namely xylose and a1,3-nucleus. fucose. Such non-mammalian oligosaccharides can alter the biological activity of a given protein or even induce unwanted adverse side effects upon therapeutic request. As expected, during the experiments described in this document, typical plant N glycosylation was detected in Trastuzumab. To circumvent this problem RNAi technology was used to generate a plant line that lacks the unwanted N-glycan residues of specific plants (Strasser et al., 2008). The monoclonal antibodies produced in this mutant (ΔXTFT) carry complex human-like N-glycans without plant-specific glycosylation. Furthermore, mAbs with a glyco-engineered profile also showed increased effector functions compared to their mammalian cell-derived counterparts (Forthal et al, 2010; Zeitlin et al, 2011). Thus, such glycosylation mutant plants can serve as valuable expression platforms for the production of therapeutic mAbs. However, whether the use of P19 disrupted XT and FT silencing in ΔXTFT mutants has not been investigated yet. Based on previous reports on cellular targets of P19, including a documented case of interference with the siRNA silencing pathway in a transgenic plant line (Ahn et al., 2011), P19 was expected to interfere with the silencing gene induced by P19. XT and FT RNAi in glycomodified N. benthamiana. Surprisingly, the mAbs expressed in ΔXTFT with and without P19 were in both cases totally devoid of xylose and fucose residues. The virtually identical glycan profiles of the two antibodies indicate that FT and XT silencing is affected by P19 (Figure 6). Thus, it appears that P19 can be used effectively in combination with RNAi-based glycomodified hosts for the production of therapeutic glycoproteins in both transient and stable expression systems.

[0097] While the present invention has been described with reference to what are presently considered preferred examples, it is to be understood that the invention is not limited to the disclosed examples. Rather, the invention is intended to encompass various modifications and equivalent arrangements included within the meaning and scope of the appended claims.

LISTAGEM DE SEQUÊNCIA SEQ ID NO: 1 sequência de nucleotídeos P19 dos códons otimizados para a expressão em Nicotiana. ATGGAAAGGGCTATTCAGGGAAATGATGCTAGAGAGCAGGCTAA TTCTGAAAGATGGGATGGTGGATCTGGTGGAACTACTTCTCCATTCAA GCTTCCAGATGAGTCTCCATCTTGGACTGAGTGGAGGCTTCATAACGA TGAGACTAACTCCAATCAGGATAACCCACTCGGATTCAAAGAATCTTGG GGATTCGGAAAGGTTGTGTTCAAGCGTTACCTTAGGTATGATAGGACT GAGGCTTCACTTCATAGGGTTCTCGGATCTTGGACTGGTGATTCTGTTA ACTACGCTGCTTCTCGTTTTTTTGGATTCGATCAGATCGGATGCACTTA CTCTATTAGGTTCAGGGGAGTGTCTATTACTGTTTCTGGTGGATCTAGG ACTCTTCAACACCTTTGCGAGATGGCTATTAGGTCTAAGCAAGAGCTTC TTCAGCTTGCTCCAATTGAGGTTGAGTCTAACGTTTCAAGAGGATGTCC AGAAGGTACTGAGACTTTCGAGAAAGAATCCGAGTGA FULL CITATIONS FOR REFERENCES REFERRED I Ü IN I HE SPECIFICATION Ahn JW, Lee JS, Davarpanah SJ, Jeon JH, Park Yl, Liu JR and Jeong WJ (2011) Host-dependent suppression of RNA silencing mediated by the viral suppressor p19 in potato. Planta. Almquist K. C., Niu Y., McLean M. D., Mena F. L., Yau K. Y., Brown K., Brandie J. E. and Hall J. C. (2004) Immunomodulation confers herbicide resistance in plants. Plant Biotechnol J 2, 189-97. Angel CA, Hsieh YC and Schoelz JE (2011) Comparative analysis of the capacity of tombusvirus P22 and P19 proteins to function as avirulence determinants in Nicotiana species. Mol Plant Microbe Interact 24:91-99. Bardor M, Faveeuw C, Fitchette AC, Gilbert D. Galas L. Trottein F, Faye L and Lerouge P (2003) Immunoreactivity in mammals of two typical plant glyco-epitopes, core alpha(1,3)-fucose and core xylose. Glycobiology 13:427-434. Baselga J, Norton L, Albanell J, Kim YM and Mendelsohn J (1998) Recombinant humanized anti-HER2 antibody (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res 58:28252831. Baulcombe D (2004) RNA silencing in plants. Nature 431:356-363. Brodersen P and Voinnet O (2006) The diversity of RNA silencing pathways in plants. Trends Genet 22:268-280. Brodsky, L. I.; Ivanov, V. V.; Kalaidzidis, Y. L.; Leontovich, A. M.; Nikolaev, V. K.; Feranchuk, S. I.; Drachev, V. A. GeneBee-NET: internet-based server for analyzing biopolymers structures. Biochemestry 1995, 60, 923-928. Broothaerts W, Mitchell H J, Weir B, Kaines S, Smith L M A, Yang W, Mayer J E, Roa-Rodriguez C, Jefferson R A (2005) Gene transfer to plants by diverse species of bacteria, Nature 433:629-633. Buchacher, A., R. Predl, K. Strutzenberger, W. Steinfellner, A. Trkola, M. Purtscher, G. Gruber, C. Tauer, F. Steindl, A. Jungbauer, and H. Katinger. 1994. Generation of human monoclonal antibodies against HIV-1 proteins; electrofusion and Epstein-Barr virus transformation for peripheral blood lymphocyte immortalization. AIDS Research and Human Retroviruses 10:359-69. Burgyan J, Lakatos L, Szittya G and Silhavy D (2004) Molecular mechanism of RNA silencing suppression mediated by p19 protein of tombusviruses. Embo Journal 23:876-884. Carthew RW and Sontheimer EJ (2009) Origins and Mechanisms of miRNAs and siRNAs Cell 136:642-655. Chung S. M., Vaidya M. and Tzfira T. (2006) Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria. Trends Plant Sci11. 1-4. Colgan R., Atkinson C. J., Paul M.. Hassan S., Drake P. M., Sexton A. L. Santa-Cruz S., James D.. Hamp K., Gutteridge C. and Ma J. K. Optimisation of contained Nicotiana tabacum cultivation for the production of recombinant protein pharmaceuticals. Transgenic Res 19, 241-56. Cox KM. Sterling JD. Regan JT. Gasdaska JR, Frantz KK, Peele CG, Black A. Passmore D. Moldovan-Loomis C. Srinivasan M. Cuison S. Cardarelli PM and Dickey LF (2006) Glycan optimization of a human monoclonal antibody in the aquatic plant Lemna minor. Nature biotechnology 24:1591-1597. Dunoyer P, Lecellier CH, Parizotto EA. Himber C and Voinnet O (2004) Probing the microRNA and small interfering RNA pathways with virus-encoded suppressors of RNA silencing. Plant Cell 16:1235-1250. Ellman, G.L., Courtney. K.D., Andres. V.. Jr., Featherstone, R.M., A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7: 88-95, 1961. Forthal DN, Gach JS, Landucci G. Jez J, Strasser R, Kunert R and Steinkellner H (2010) Fc-glycosylalion influences Fcgamma receptor binding and cell-mediated anti-HIV activity of monoclonal antibody 2G12. Journal of immunology 185:6876-6882. Gardiner-Garden. M.; Frommer, M. CpG islands in vertebrate genomes. J. Mol. Biol. 1987, 196. 261-282. Garabagi, F„ E. Gilbert. A. Loos, M.D. McLean, and J.C. Hall. 2012a. Utility of the P19 suppressor of gene-silencing protein for production of therapeutic antibodies in Nicotiana expression hosts. Plant Biotechnol J 10:1118-28. Garabagi, F., M.D. McLean, and J.C. Hall. 2012b. Transient and stable expression of antibodies in Nicotiana species. Methods Mol Biol 907:389-408. Gelvin S R (2003) Agrobacterium-mediated plant transformation: the biology behind the "gene-jockeying" tool. Microbiol Mol Biol Rev 67, 16-37. Giritch A., Marillonnet S., Engler C., van Eldik G., Botterman J., Klimyuk V. and Gleba Y. (2006) Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors. Proc Natl Acad Sci U SA 1 03, 14701-6. Gomord V, Fitchette AC, Menu-Bouaouiche L, Saint-Jore-Dupas C, Plasson C, Michaud D and Faye L (2010) Plant-specific glycosylation patterns in the context of therapeutic protein production. Plant Biotechnol J 8:564-587. Grohs BM, Niu Y, Veldhuis LJ, Trabelsi S, Garabagi F, Hassell JA, McLean MD and Hall JC (2010) Plant-produced trastuzumab inhibits the growth of HER2 positive cancer cells. J Agric Food Chem 58:10056-10063. Horsch R.B., Fry J.E., Hoffmann N.L., Eichholtz D., Rogers S.G. and Fraley R.T. 1985. A simple and general method for transferring genes into plants. Science 227: 1229-1231. Hsieh YC, Omarov RT and Scholthof HB (2009) Diverse and newly recognized effects associated with short interfering RNA binding site modifications on the Tomato bushy stunt virus p19 silencing suppressor. J Virol 83:2188-2200. Jin C, Altmann F, Strasser R, Mach L, Schahs M, Kunert R, Rademacher T, Glossl J and Steinkellner H (2008) A plant-derived human monoclonal antibody induces an anti-carbohydrate immune response in rabbits. Glycobiology 18:235-241. Jovel J, Walker M and Sanfacon H (2011) Salicylic acid-dependent restriction of Tomato ringspot virus spread in tobacco is accompanied by a hypersensitive response, local RNA silencing, and moderate systemic resistance. Mol Plant Microbe Interact 24:706-718. Kozak M. (1984) Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Ros 12. 857- 72. Lewis GD, Figari I, Fendly B, Wong WL, Carter P, Gorman C and Shepard HM (1993) Differential responses of human tumor cell lines to antipl 85HER2 monoclonal antibodies. Cancer Immunol Immunother 37.255-263. Li, Q.; Hunt, A. A near-stream element in a plant polyadenylation signal consist of more than six nucleotides. Plant Mol. Biol. 1995, 28, 927-934. Moffett P (2009) Mechanisms of recognition in dominant R gene mediated resistance. Adv Virus Res 75:1-33. Makvandi-Nejad S., McLean M. D., Hirama T., Almquist K. C., Mackenzie C. R. and Hall J. C. (2005) Transgenic tobacco plants expressing a dimeric single-chain variable fragment (scfv) antibody against Salmonella enterica serotype Paratyphi B. Transgenic Res 14, 785-92. Marillonnet, S., Thoeringer, C., Kandzia, R., Klimyuk, V., and Gleba, Y. (2005). Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plants. Nat. Biotechnol 23, 718-723. McLean, M. D., Almquist, K C., Niu, Y., Kimmel, R., Lai, Z., Schreiber, J. R., and Hall, J. C. (2007). A Human Anti-Pseudomonas aeruginosa Serotype O6ad Immunoglobulin G1 Expressed in Transgenic Tobacco Is Capable of Recruiting Immune System Effector Function In Vitro. Antimicrob. Agents Chemother. 51. 3322-3328. Nakamura, Y. Codon usage database. Available on-line at www.kazusa.or.jp/codon; 2005. Ohme-Takagi. M.; Taylor, C.; Newman, T.; Green, P. The effect of sequences with high AU content on mRNA stability intobacco. Proc. Natl. Acad. Sci. U.S.A. 1993, 90. 11811-11815. Olea-Popelka, F„ McLean. M. D., Horsman, J.. Almquist, K., Brandie, J. E.. and Hall, J. C. (2005). Increasing expression of an anti-picloram single-chain vanable fragment (ScFv) antibody and resistance to pidoram in transgenic tobacco (Nicotiana tabacum). J. Agπc. Food Chem 53, 6683- 6690. Park JW, Faure-Rabasse S, Robinson MA, Desvoyes B and Scholthof HB (2004) The multifunctional plant viral suppressor of gene silencing P19 interacts with itself and an RNA binding host protein. Virology 323.49-58. Qiu W, Park JW and Scholthof HB (2002) Tombusvirus P19-mediated suppression of virus-induced gene silencing is controlled by genetic and dosage features that influence pathogenicity. Mol Plant Microbe Interact 15:269-280. Reinhart BJ, Weinstein EG, Rhoados MW, Bartel B and Bartel DP (2002) MicroRNAs in plants. Genes Dev 16:1616-1626. Rothnie, H. M. Plant mRNA 3 i-end formation. Plant Mol. Biol. 1996. 32, 43-61. Samac. D. A.. Hironaka, C. M.. Yallaly, P. E.. and Shah, D. M. (1990). Isolation and Characterization of the Genes Encoding Basic and Acidic Chitinase in Arabidopsis thaliana. Plant Physiol 93, 907-914. Saxena P. Hsieh YC. Alvarado VY, Sainsbury F. Saunders K, Lomonossoff GP and Scholthof HB (2011) Improved foreign gene expression in plants using a virus-encoded suppressor of RNA silencing modified to be developmentally harmless. Plant Biotechnol J 9:703-712. Schiestl M, Stangler T, Torella C. Cepeljnik T, Toll H and Grau R (2011) Acceptable changes in quality attributes of glycosylated biopharmaceuticals. Nature Biotechnology 29:310-312. Scholthof HB (2006) The Tombusvirus-encoded P19: from irrelevance to elegance. Nat Rev Microbiol 4:405-411. Scholthof HB. Desvoyes B. Kuecker J and Whitehead E (1999) Biological activity of two tombusvirus proteins translated from nested genes is influenced by dosage control via context-dependent leaky scanning. Mol Plant Microbe In 12:670-679. Scholthof KBG, Scholthof HB and Jackson AO (1995) The Effect of Defective Interfering Rnas on the Accumulation of Tomato Bushy Stunt Virus Proteins and Implications for Disease Attenuation. Virology 211:324-328. Shapiro, M. B.; Senapathy, P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 1987, 5. 7155-7174. Siddiqui SA, Sarmiento C, Truve E. Lehto H and Lehto K (2008) Phenotypes and functional effects caused by various viral RNA silencing suppressors In transgenic Nicotiana benthamiana and N. tabacum. Mol Plant Microbe Interact 21:178-187. Sourrouille C, Marquet-Blouin E, D’Aoust MA. Kiefer-Meyer MC. Seveno M, Pagny-Salehabadi S, Bardor M, Durambur G. Lerouge P, Vezina L and Gomord V (2008) Down-regulated expression of plant-specific glycoepitopes in alfalfa. Plant Biotechnol J 6:702-721. Stadlmann J, Pabst M, Kolarich D, Kunert R and Altmann F (2008) Analysis of immunoglobulin glycosylation by LC-ESI-MS of glycopeptides and oligosaccharides. Proteomics 8:2858-2871. Stevens LH, Stoopen GM, Elbers IJ. Molthoff JW. Bakker HA. Lommen A, Bosch D and Jordi W (2000) Effect of climate conditions and plant developmental stage on the stability of antibodies expressed in transgenic tobacco Plant Physiol 124:173-182. Strasser R, Stadlmann J, Schahs M, Stiegler G, Quendler H, Mach L. Glossl J, Weterings K, Pabst M and Steinkellner H (2008) Generation of glycoengineered Nicotiana benthamiana for the production of monoclonal antibodies with a homogeneous human-like N-glycan structure. Plant Biotechnol J 6:392-402. Vezina LP, Faye L, Lerouge P, D'Aoust MA, Marquet-Blouin E, Burel C, Lavoie PO, Bardor M and Gomord V (2009) Transient co-expression for fast and high-yield production of antibodies with human-like N-glycans in plants. Plant Biotechnol J 7:442-455. Voinnet O, Pinto YM and Baulcombe DC (1999) Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proc Natl Acad Sci U S A 96:14147-14152. Voinnet O, Rivas S, Mestre P and Baulcombe D (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33:949-956. Weber, A., H. Butterweck, U. Mais-Paul, W. Teschner, L. Lei, E.M. Muchitsch, D. Kolarich, F. Altmann, H.J. Ehrlich, and H.P. Schwarz. 2010. Biochemical, molecular and preclinical characterization of a double- virus-reduced human butyrylcholinesterase preparation designed for clinical use. Vox Sang 100:285-97. Yu D., McLean M. D., Hall J. C. and Ghosh R. (2008) Purification of a human immunoglobulin G1 monoclonal antibody from transgenic tobacco using membrane chromatographic processes. J Chromatogr A 1187, 128-37. Zeitlin L, Pettitt J, Scully C, Bohorova N, Kim D, Pauly M, Hiatt A, Ngo L, Steinkellner H, Whaley KJ and Olinger GG (2011) Enhanced potency of a fucose-free monoclonal antibody being developed as an Ebola virus immunoprotectant. Proc Natl Acad Sci U S A 108:20690-20694. Zheng N, Xia R, Yang C, Yin B, Li Y, Duan C, Liang L, Guo H and Xie Q (2009) Boosted expression of the SARS-CoV nucleocapsid protein in tobacco and its immunogenicity in mice. Vaccine 27:5001-5007.[0098] All publications, patents and patent applications are hereby incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Table 1 - Maximum trastuzumab level produced with different expression vectors.

SEQUENCE LISTING SEQ ID NO: 1 P19 nucleotide sequence of codons optimized for expression in Nicotiana. ATGGAAAGGGCTATTCAGGGAAATGATGCTAGAGAGCAGGCTAA TTCTGAAAGATGGGATGGTGGATCTGGTGGAACTACTTCTCCATTCAA GCTTCCAGATGAGTCTCCATCTTGGACTGAGTGGAGGCTTCATAACGA TGAGACTAACTCCAATCAGGATAACCCACTCGGATTCAAAGAATCTTGG GGATTCGGAAAGGTTGTGTTCAAGCGTTACCTTAGGTATGATAGGACT GAGGCTTCACTTCATAGGGTTCTCGGATCTTGGACTGGTGATTCTGTTA ACTACGCTGCTTCTCGTTTTTTTGGATTCGATCAGATCGGATGCACTTA CTCTATTAGGTTCAGGGGAGTGTCTATTACTGTTTCTGGTGGATCTAGG ACTCTTCAACACCTTTGCGAGATGGCTATTAGGTCTAAGCAAGAGCTTC TTCAGCTTGCTCCAATTGAGGTTGAGTCTAACGTTTCAAGAGGATGTCC AGAAGGTACTGAGACTTTCGAGAAAGAATCCGAGTGA FULL CITATIONS FOR REFERENCES REFERRED I Ü IN I HE SPECIFICATION Ahn JW, Lee JS, Davarpanah SJ, Jeon JH, Park Yl, Liu JR and Jeong WJ (2011) Host-dependent suppression of RNA silencing mediated by the viral suppressor p19 in potato. Plant. Almquist KC, Niu Y., McLean MD, Mena FL, Yau KY, Brown K., Brandie JE and Hall JC (2004) Immunomodulation confers herbicide resistance in plants. Plant Biotechnol J 2, 189-97. Angel CA, Hsieh YC and Schoelz JE (2011) Comparative analysis of the capacity of tombusvirus P22 and P19 proteins to function as avirulence determinants in Nicotiana species. Mol Plant Microbe Interact 24:91-99. Bardor M, Faveeuw C, Fitchette AC, Gilbert D. Galas L. Trottein F, Faye L and Lerouge P (2003) Immunoreactivity in mammals of two typical plant glyco-epitopes, core alpha(1,3)-fucose and core xylose. Glycobiology 13:427-434. Baselga J, Norton L, Albanell J, Kim YM and Mendelsohn J (1998) Recombinant humanized anti-HER2 antibody (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res 58:28252831. Baulcombe D (2004) RNA silencing in plants. Nature 431:356-363. Brodersen P and Voinnet O (2006) The diversity of RNA silencing pathways in plants. Trends Genet 22:268-280. Brodsky, LI; Ivanov, VV; Kalaidzidis, YL; Leontovich, AM; Nikolaev, VK; Feranchuk, SI; Drachev, VA GeneBee-NET: internet-based server for analyzing biopolymer structures. Biochemistry 1995, 60, 923-928. Broothaerts W, Mitchell HJ, Weir B, Kaines S, Smith LMA, Yang W, Mayer JE, Roa-Rodriguez C, Jefferson RA (2005) Gene transfer to plants by diverse species of bacteria, Nature 433:629-633. Buchacher, A., R. Predl, K. Strutzenberger, W. Steinfellner, A. Trkola, M. Purtscher, G. Gruber, C. Tauer, F. Steindl, A. Jungbauer, and H. Katinger. 1994. Generation of human monoclonal antibodies against HIV-1 proteins; electrofusion and Epstein-Barr virus transformation for peripheral blood lymphocyte immortalization. AIDS Research and Human Retroviruses 10:359-69. Burgyan J, Lakatos L, Szittya G and Silhavy D (2004) Molecular mechanism of RNA silencing suppression mediated by p19 protein of tombusviruses. Embo Journal 23:876-884. Carthew RW and Sontheimer EJ (2009) Origins and Mechanisms of miRNAs and siRNAs Cell 136:642-655. Chung SM, Vaidya M. and Tzfira T. (2006) Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria. Trends Plant Sci11. 1-4. Colgan R., Atkinson CJ, Paul M.. Hassan S., Drake PM, Sexton AL Santa-Cruz S., James D.. Hamp K., Gutteridge C. and Ma JK Optimization of contained Nicotiana tabacum cultivation for the production of recombinant protein pharmaceuticals. Transgenic Res 19, 241-56. Cox KM. Sterling JD. Regan JT. Gasdaska JR, Frantz KK, Peele CG, Black A. Passmore D. Moldovan-Loomis C. Srinivasan M. Cuison S. Cardarelli PM and Dickey LF (2006) Glycan optimization of a human monoclonal antibody in the aquatic plant Lemna minor. Nature biotechnology 24:1591-1597. Dunoyer P, Lecellier CH, Parizotto EA. Himber C and Voinnet O (2004) Probing the microRNA and small interfering RNA pathways with virus-encoded suppressors of RNA silencing. Plant Cell 16:1235-1250. Ellman, GL, Courtney. KD, Andres. V.. Jr., Featherstone, RM, A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7: 88-95, 1961. Forthal DN, Gach JS, Landucci G. Jez J, Strasser R, Kunert R and Steinkellner H (2010) Fc-glycosylalion influences Fcgamma receptor binding and cell-mediated anti-HIV activity of monoclonal antibody 2G12 . Journal of Immunology 185:6876-6882. Gardiner-Garden. M.; Frommer, M. CpG islands in vertebrate genomes. J. Mol. Biol. 1987, 196, 261-282. Garabagi, F„ E. Gilbert. A. Loos, MD McLean, and JC Hall. 2012a. Utility of the P19 suppressor of gene-silencing protein for production of therapeutic antibodies in Nicotiana expression hosts. Plant Biotechnol J 10:1118-28. Garabagi, F., MD McLean, and JC Hall. 2012b. Transient and stable expression of antibodies in Nicotiana species. Methods Mol Biol 907:389-408. Gelvin SR (2003) Agrobacterium-mediated plant transformation: the biology behind the "gene-jockeying" tool. Microbiol Mol Biol Rev 67, 16-37. Giritch A., Marillonnet S., Engler C., van Eldik G., Botterman J., Klimyuk V. and Gleba Y. (2006) Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors. Proc Natl Acad Sci U SA 103, 14701-6. Gomord V, Fitchette AC, Menu-Bouaouiche L, Saint-Jore-Dupas C, Plasson C, Michaud D and Faye L (2010) Plant-specific glycosylation patterns in the context of therapeutic protein production. Plant Biotechnol J 8:564-587. Grohs BM, Niu Y, Veldhuis LJ, Trabelsi S, Garabagi F, Hassell JA, McLean MD and Hall JC (2010) Plant-produced trastuzumab inhibits the growth of HER2 positive cancer cells. J Agric Food Chem 58:10056-10063. Horsch RB, Fry JE, Hoffmann NL, Eichholtz D., Rogers SG and Fraley RT 1985. A simple and general method for transferring genes into plants. Science 227: 1229-1231. Hsieh YC, Omarov RT and Scholthof HB (2009) Diverse and newly recognized effects associated with short interfering RNA binding site modifications on the Tomato bushy stunt virus p19 silencing suppressor. J Virol 83:2188-2200. Jin C, Altmann F, Strasser R, Mach L, Schahs M, Kunert R, Rademacher T, Glossl J and Steinkellner H (2008) A plant-derived human monoclonal antibody induces an anti-carbohydrate immune response in rabbits. Glycobiology 18:235-241. Jovel J, Walker M and Sanfacon H (2011) Salicylic acid-dependent restriction of Tomato ringspot virus spread in tobacco is accompanied by a hypersensitive response, local RNA silencing, and moderate systemic resistance. Mol Plant Microbe Interact 24:706-718. Kozak M. (1984) Compilation and analysis of upstream sequences from the translational start site in eukaryotic mRNAs. Nucleic Acids Ros 12. 857-72. Lewis GD, Figari I, Fendly B, Wong WL, Carter P, Gorman C and Shepard HM (1993) Differential responses of human tumor cells lines to antipl 85HER2 monoclonal antibodies. Cancer Immunol Immunother 37,255-263. Li, Q.; Hunt, A. A near-stream element in a plant polyadenylation signal consists of more than six nucleotides. Plant Mol. Biol. 1995, 28, 927-934. Moffett P (2009) Mechanisms of recognition in dominant R gene mediated resistance. Adv Virus Res 75:1-33. Makvandi-Nejad S., McLean MD, Hirama T., Almquist KC, Mackenzie CR and Hall JC (2005) Transgenic tobacco plants expressing a dimeric single-chain variable fragment (scfv) antibody against Salmonella enterica serotype Paratyphi B. Transgenic Res 14, 785-92. Marillonnet, S., Thoeringer, C., Kandzia, R., Klimyuk, V., and Gleba, Y. (2005). Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plants. nat. Biotechnol 23, 718-723. McLean, MD, Almquist, KC., Niu, Y., Kimmel, R., Lai, Z., Schreiber, JR, and Hall, JC (2007). Human Anti-Pseudomonas aeruginosa Serotype O6ad Immunoglobulin G1 Expressed in Transgenic Tobacco Is Capable of Recruiting Immune System Effector Function In Vitro. antimicrobial Agents Chemother. 51, 3322-3328. Nakamura, Y. Codon usage database. Available online at www.kazusa.or.jp/codon; 2005. Ohme-Takagi. M.; Taylor, C.; Newman, T.; Green, P. The effect of sequences with high AU content on mRNA stability intobacco. process natl. academy Sci. USA 1993, 90. 11811-11815. Olea-Popelka, F„ McLean. MD, Horsman, J. Almquist, K., Brandie, JE. and Hall, JC (2005). Increasing expression of an anti-picloram single-chain vanable fragment (ScFv) antibody and resistance to pidoram in transgenic tobacco (Nicotiana tabacum). J. Agπc. Food Chem 53, 6683-6690. Park JW, Faure-Rabasse S, Robinson MA, Desvoyes B and Scholthof HB (2004) The multifunctional plant viral suppressor of gene silencing P19 interacts with itself and an RNA binding host protein. Virology 323.49-58. Qiu W, Park JW and Scholthof HB (2002) Tombusvirus P19-mediated suppression of virus-induced gene silencing is controlled by genetic and dosage features that influence pathogenicity. Mol Plant Microbe Interact 15:269-280. Reinhart BJ, Weinstein EG, Rhoados MW, Bartel B and Bartel DP (2002) MicroRNAs in plants. Genes Dev 16:1616-1626. Rothnie, HM Plant mRNA 3 i-end formation. Plant Mol. Biol. 1996. 32, 43-61. Samac. GIVES. Hironaka, CM. Yallaly, PE. and Shah, DM (1990). Isolation and Characterization of the Genes Encoding Basic and Acidic Chitinase in Arabidopsis thaliana. Plant Physiol 93, 907-914. Saxena P. Hsieh YC. Alvarado VY, Sainsbury F. Saunders K, Lomonossoff GP and Scholthof HB (2011) Improved foreign gene expression in plants using a virus-encoded suppressor of RNA silencing modified to be developmentally harmless. Plant Biotechnol J 9:703-712. Schiestl M, Stangler T, Torella C. Cepeljnik T, Toll H and Grau R (2011) Acceptable changes in quality attributes of glycosylated biopharmaceuticals. Nature Biotechnology 29:310-312. Scholthof HB (2006) The Tombusvirus-encoded P19: from irrelevance to elegance. Nat Rev Microbiol 4:405-411. Scholthof HB. Desvoyes B. Kuecker J and Whitehead E (1999) Biological activity of two tombusvirus proteins translated from nested genes is influenced by dosage control via context-dependent leaky scanning. Mol Plant Microbe In 12:670-679. Scholthof KBG, Scholthof HB and Jackson AO (1995) The Effect of Defective Interfering Rnas on the Accumulation of Tomato Bushy Stunt Virus Proteins and Implications for Disease Attenuation. Virology 211:324-328. Shapiro, MB; Senapathy, P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 1987, 5, 7155-7174. Siddiqui SA, Sarmiento C, Truve E. Lehto H and Lehto K (2008) Phenotypes and functional effects caused by various viral RNA silencing suppressors In transgenic Nicotiana benthamiana and N. tabacum. Mol Plant Microbe Interact 21:178-187. Sourrouille C, Marquet-Blouin E, D'Aoust MA. Kiefer-Meyer MC. Seveno M, Pagny-Salehabadi S, Bardor M, Durambur G. Lerouge P, Vezina L and Gomord V (2008) Down-regulated expression of plant-specific glycoepitopes in alfalfa. Plant Biotechnol J 6:702-721. Stadlmann J, Pabst M, Kolarich D, Kunert R and Altmann F (2008) Analysis of immunoglobulin glycosylation by LC-ESI-MS of glycopeptides and oligosaccharides. Proteomics 8:2858-2871. Stevens LH, Stoopen GM, Elbers IJ. Molthoff JW. Baker HA. Lommen A, Bosch D and Jordi W (2000) Effect of climate conditions and plant developmental stage on the stability of antibodies expressed in transgenic tobacco Plant Physiol 124:173-182. Strasser R, Stadlmann J, Schahs M, Stiegler G, Quendler H, Mach L. Glossl J, Weterings K, Pabst M and Steinkellner H (2008) Generation of glycoengineered Nicotiana benthamiana for the production of monoclonal antibodies with a homogeneous human-like N -glycan structure. Plant Biotechnol J 6:392-402. Vezina LP, Faye L, Lerouge P, D'Aoust MA, Marquet-Blouin E, Burel C, Lavoie PO, Bardor M and Gomord V (2009) Transient co-expression for fast and high-yield production of antibodies with human-like N-glycans in plants. Plant Biotechnol J 7:442-455. Voinnet O, Pinto YM and Baulcombe DC (1999) Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proc Natl Acad Sci USA 96:14147-14152. Voinnet O, Rivas S, Mestre P and Baulcombe D (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33:949-956. Weber, A., H. Butterweck, U. Mais-Paul, W. Teschner, L. Lei, EM Muchitsch, D. Kolarich, F. Altmann, HJ Ehrlich, and HP Schwarz. 2010. Biochemical, molecular and preclinical characterization of a double-virus-reduced human butyrylcholinesterase preparation designed for clinical use. Vox Sang 100:285-97. Yu D., McLean MD, Hall JC and Ghosh R. (2008) Purification of a human immunoglobulin G1 monoclonal antibody from transgenic tobacco using membrane chromatographic processes. J Chromatogr A 1187, 128-37. Zeitlin L, Pettitt J, Scully C, Bohorova N, Kim D, Pauly M, Hiatt A, Ngo L, Steinkellner H, Whaley KJ and Olinger GG (2011) Enhanced potency of a fucose-free monoclonal antibody being developed as an Ebola virus immunoprotectant. Proc Natl Acad Sci USA 108:20690-20694. Zheng N, Xia R, Yang C, Yin B, Li Y, Duan C, Liang L, Guo H and Xie Q (2009) Boosted expression of the SARS-CoV nucleocapsid protein in tobacco and its immunogenicity in mice. Vaccine 27:5001-5007.

Claims (11)

1. Expression vector, characterized in that it comprises: (a) the cauliflower mosaic virus (CaMV) 35S promoter; (b) the 5' UTR 35S of CaMV; (c) a 3' UTR and terminator sequence selected from (i) the 3' UTR and terminator sequence of the Agrobacterium nopaline synthase gene (nos), (ii) the 3' UTR and terminator sequence of the osmotin gene (osm ) from Oryza sativa, (iii) from the 3' UTR and terminator sequence of the C. morifolium rbc small subunit gene, or (iv) from a truncated version, by 162 bp as defined by a BspEI recognition site, from the 3' ' UTR and terminator sequence of the C. morifolium rbc small subunit gene; (d) a nucleic acid molecule encoding the Tomato Bushy Stunt Virus (TBSV) P19 protein, wherein the nucleic acid molecule encoding the P19 protein has the sequence shown in SEQ ID NO:1, and (e) a sequence of nucleic acid encoding a recombinant protein, wherein the recombinant protein is an antibody or antibody fragment or a therapeutic enzyme. 2. Expression vector according to claim 1, characterized in that the vector comprises: the 35S promoter of CaMV, operatively linked to the 5' UTR 35S of CaMV and to the 3' UTR and terminator sequence of the Agrobacterium nos gene ; the CaMV 35S promoter, operably linked to the CaMV 35S 5' UTR and to the 3' UTR and terminator sequence of the Oryza sativa osm gene; the CaMV 35S promoter, operably linked to the CaMV 35S 5' UTR and to the 3' UTR and terminator sequence of the C. morifolium rbc small subunit gene; or the CaMV 35S promoter, operably linked to the CaMV 35S 5' UTR and a 162 bp truncated version as defined by a BspEI recognition site of the 3' UTR and terminator sequence of the C rbc small subunit gene .morifolium. 3. Expression vector according to claim 1 or 2, characterized in that the antibody is trastuzumab or bevacizumab. 4. Expression vector according to claim 1 or 2, characterized in that the therapeutic enzyme is butyrylcholinesterase. 5. Expression vector according to any one of claims 1 to 4, characterized in that it further comprises the Arabidopsis heat shock promoter (Hsp81.1). 6. Method for improving the production of a recombinant protein in a plant, characterized in that it comprises: (a) introducing an expression vector defined in any one of claims 1 to 5 into a plant or a plant cell; and (b) culturing the plant or plant cell to obtain a plant that expresses the recombinant protein. 7. Method according to claim 6, characterized in that the recombinant protein is trastuzumab or bevacizumab. 8. Method according to claim 6, characterized in that the recombinant protein is butyrylcholinesterase. 9. Method according to any one of claims 6 to 8, characterized in that the plant is a tobacco plant. 10. Method according to claim 9, characterized in that the tobacco plant is N. benthamiana or N. tabacum. 11. Method according to claim 10, characterized in that N. tabacum is cv. Little Crittenden.

Images