BR102017014956A2 - FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHYTHIN FROM WASTE FROM BIOFUEL PRODUCTION - Google Patents

Abstract

The present invention describes the fermentative process for the production of the amino acid 1-methionine from biofuel industry residues using the microorganism Escherichia coli. The present invention also provides the genetic modifications necessary for the bacterium Escherichia coli to satisfactorily consume the raw material and thereby produce the amino acid 1-methionine. The process of genetic modification in the bacterium e. coli. The present invention also describes the production process of 1-methionine, which occurs in aerobic regime and in fed batches. Methionine production by the method described here aims to harness industrial waste in a sustainable and low environmental impact manner.

Description

(54) Title: FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS (51) Int. Cl .: C12P 13/12; C12N 9/15; 1/12 C12N; C12R 1/19 (73) Holder (s): NATBIO LTDA ME (72) Inventor (s): BERNARDO DE LEÃO ROSENMANN (57) Abstract: The present invention describes the fermentation process for the production of the amino acid L-methionine from waste from the biofuel industry using the microorganism Escherichia coli. The present invention also presents the necessary genetic modifications so that the bacterium Escherichia coli can satisfactorily consume the raw material and, in the same way, produce the amino acid L-methionine. The process of genetic modification in E. coli bacteria is described. The present invention also describes the process of producing L-methionine, which occurs in an aerobic regime and in fed batches. The production of methionine by the method described here aims to take advantage of industrial waste in a sustainable manner and with low environmental impact.

1/38

FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS

FIELD OF THE INVENTION [001] The present invention deals with a fermentative process for the bacterial production of amino acids, more specifically the amino acid L-methionine, through fermentative techniques and use of glycerinated water from the production of biodiesel. The present invention applies to any industrial area that aims at the sustainable production of amino acids, in particular L-methionine, taking advantage of a low cost residue.

[002] The invention describes the application of genetic engineering to obtain a superproductive and excretory bacterial strain of methionine, in a fermentative process from residual glycerin water from the biodiesel production process.

BACKGROUND OF THE INVENTION AND STATUS OF THE TECHNIQUE [003] Industrial bacterial fermentation processes are used to produce a wide variety of metabolites of commercial interest, including, for example, amino acids, organic acids, antibiotics, nucleotides, vitamins and some biodegradable polymers (Wendisch et al ., 2016) [004] The availability of genomic information on bacteria usually used in fermentation processes allows the use of metabolic engineering through gene deletions or the introduction of homologous and heterologous genes, aiming at increasing the production of amino acids without generating deleterious secondary mutations by random mutagenesis methods (Wright, 2000).

[005] In addition, genomic information serves as a basis for building computational models of bacterial metabolism, allowing to simulate the yield of a given product in a modified strain (Edwards et al., 2002).

[006] Therefore, it prevents the occurrence of interferences in the growth and in the tolerance to stress by the bacteria that can occur when a technique of

Petition 870170048524, of 7/12/2017, p. 5/55

2/38 random mutation is used, through the use of ultraviolet (UV) light or alkylating chemical agents.

[007] To make the present invention sustainable, the use of glycerinated water obtained from the synthesis of biodiesel as a carbon source is described. [008] L-methionine is an essential amino acid for human and animal nutrition. In addition, methionine is applied in several industrial areas, including food, pharmaceutical and cosmetic industries. Thus, the great worldwide demand for methionine makes it a biotechnological product of interest for large-scale industrial production.

[009] The main limitations in increasing the production of amino acids by bacterial fermentation are to identify and eliminate the restrictions imposed by intrinsic regulatory mechanisms of each bacterium and, generally, present specificities depending on the type of bacteria used in the process.

[010] The bacterium Escherichia coli is one of the most used microorganisms for the production of amino acids in fermentation processes (Ikeda, 2003; Wendisch, 2014; Wendisch et al., 2006). The biosynthesis and metabolism of L-methionine has been well studied in this bacterium (WO2009043803A2), revealing functional details of the regulatory factors involved in the control of synthesis (Usuda and Kurahashi, 2005). At the transcriptional level, the expression of the genes involved in the synthesis of methionine is repressed by the repressor MetJ and its co-repressor SAM (S-adenosyl-Lmethionine).

[011] An important factor to consider when genetically modifying a bacterial strain for the production of amino acids is which efflux system would be the most suitable for the excretion of the amino acid in question. Escherichia coli has an ABC methionine uptake system expressed by the well-characterized metN, metI and metQ genes (Kadner, 1977; Merlin et al., 2002; Zhang et al., 2003). However, the ABC MetNIQ transporter does not operate in the direction of methionine efflux, only for its capture. Therefore, new efflux transporters have been characterized and applied to maximize the excretion of L-methionine in E. coli and other microorganisms.

Petition 870170048524, of 7/12/2017, p. 6/55

3/38 [012] The BrnFE transporter (expressed by the brnFE operon) of Corynebacterium glutamicum was characterized as an efflux transporter for methionine and branched chain amino acids, including L-valine, L-isoleucine and L-leucine (Lange et al., 2012; Trotschel et al., 2005). Overexpression of the BrnFE transporter led to a greater excretion of L-methionine in C. glutamicum, reaching 6.3 g / L in 64h of fermentation (Qin et al., 2015).

[013] In E. coli an efflux system homologous to the BrnFE transporter of C. glutamicum called YgaZH (expressed by the ygaZH genes) was found (Park et al., 2007). The YgaZH transporter was initially characterized as a specific transporter for L-valine (Park et al., 2007), however several patents employ its use to increase the excretion of L-methionine in E. coli as well (Dischert et al., 2016 ; Figge et al., 2016; Park et al., 2008).

[014] Recently, a new amino acid efflux transporter called yjeH was characterized in E. coli. Overexpression of the transporter in the E. coli mutant strain without the metJ gene led to increased methionine excretion in shaken flask experiments (Liu et al., 2015). The US2009 / 0298135A1 from Consortium fur Elektrochemische Industrie GmbH claims the use of the yjeH gene in some applications (Maier et al., 2009). The authors of this patent demonstrated the production of up to 4.8 g / L of L-methionine in 5 L fermenters using glucose as a carbon source and under conditions of high aeration and high cell density.

[015] Several patents have already described gene modifications to increase the production of L-methionine (WO2007077041, WO2009043803, WO2007012078, US9034611, US20080194030), but none with the use of specific carriers to improve the performance of the process. Patents from companies Evonik, Metabolic Explorer, BASF, CJ, among others describe the processes using pure and plant-based carbon sources, such as glucose, dextrose, inverted sugar, among others. The invention described here will preferably use glycerinated water, in its different concentrations, being able to use a carbon source of vegetable origin as a start of the process, aiming at a faster production start.

Petition 870170048524, of 7/12/2017, p. 7/55

4/38 [016] The patents of the company Metabolic Explorer, where the maximum yield quoted is up to 19% (WO2009043803) or 12.65% (US9034611B2), as well as the patent WO2007077041, use glucose or sucrose as a carbon source. In these patents, the modifications occur preferably in Coryne bacterium and E. coli, increasing the expression of some genes, among them cysA, cysU, cysT, cysM, cysL, cysC, cysE, cysI, cysJ, cysM, cysK. There is also an overexpression of the metE, metH, glyA, gvcTHP and metR genes. The metA and metJ genes are deleted and a metA gene with feedback change is inserted (WO2007077041). In its improvements, the company changes the genes pykA, pykF, lpd, serA, serB, serC and glyA (WO2009043803), in addition to changing pntA, pntB, udhA, metF, thrA, thrA with feedback changes, purU, yncA and uses promoters inductive (US9034611B2).

[017] The BASF company, in patent WO2007012078, cites production of up to 25 g / L of L-methionine in 72 hours of fermentation. For this, the metQ, metK and pepcK genes are changed and reinserted in the body. The genes metX, metY, metB, metH, metF, metE, zwf, asK, horn, frpA, pyc, asd, cysE, cysK, cysM, cysZ, cysC, cysG, cysN, cysD and cysH.

[018] The patent WO2002010209 of the company Evonik also aims at the production of L-methionine, using glucose as a carbon source. For that, he mentions genetic changes in the genes metH, lysC, pgk, pyc, metA, metB, glyA, aecD, etY, thrB, thrC, ddh.

[019] The fermentative process for the production of L-methionine has been reported using different microorganisms including bacteria and fungi (Gomes, J .; Kumar, D. Production of l-methionine by submerged fermentation: A review. Enzyme and Microbial Technology, v. 37, n. 1, p. 3-18, 2005; Willke, T. Methionine production --- a critical review. Applied Microbiology and Biotechnology, v. 98, n. 24, p. 9893-9914, 2014) . Among these, bacteria of the genus Corynebacterium or Brevibacterium have a simpler regulatory mechanism and have been applied to the production of methionine (WO2009043372A1), bacteria of the species Escherichia coli (Shakoori, FR; Butt, AM; Ali, NM; et al. Optimization of fermentation media for enhanced amino acids production by bacteria isolated from natural sources.Pak J Zool, v. 44, n. 4, p. 1145-1157, 2012; Ozulu, US; Nwanah, OU; Ekwealor, CC; et al. New Approach to Screening for MethioninePetition 870170048524, of 12/07/2017, page 8/55

5/38

Producing Bacteria. , 2012) and breeding strategies have been applied to bacteria of the species Escherichia coli (WO2007077041A1; WO2012055798A1; Huang, J.-F .; Liu, Z.-Q .; Jin, L.-Q .; et al. Metabolic engineering of Escherichia coli for microbial production of L-methionine. Biotechnology and Bioengineering, p. n / a - n / a, 2016). As a carbon source, the use of glucose has been reported.

[020] Glycerol is a by-product from the transesterification of triglycerides for biodiesel production, the fraction of which represents 10% of the esters produced (Yang, F .; Hanna, MA; Sun, R. Value-added uses for crude glycerol-a byproduct of biodiesel production. Biotechnology for Biofuels, v. 5, n. 1, p. 13, 2012).

[021] The composition of glycerol depends on conditions of biodiesel production and use of different substrates. Crude glycerol is a viscous brown liquid, which contains a mixture of glycerol, alcohol (usually methanol), free fatty acids, water, inorganic salts and other materials such as impurities (Sivasankaran, C .; Ramanujam, PK; Balasubramanian, B. ; Mani, J. Recent progress on transforming crude glycerol into high value chemicals: a critical review. Biofuels, v. 0, n. 0, p. 16, 2016).

[022] Crude glycerol has a low market value due to the presence of impurities. However, pure glycerol has high value with a wide application (Thompson, JC; He, BB Characterization of crude glycerol from biodiesel production from multiple feedstocks. Fuel (g), v. 98, p. 0-23, 2006; Yang, F .; Hanna, MA; Sun, R. Value-added uses for crude glycerol - a byproduct of biodiesel production. Biotechnology for Biofuels, v. 5, n. 1, p. 13, 2012). Purification of crude glycerol for industrial application has a high cost, about three times the value of the product, therefore it is not an economically viable solution (Venkataramanan, KP; Boatman, JJ; Kurniawan, Y .; Et al. Impact of impurities in biodiesel-derived crude glycerol on the fermentation by Clostridium pasteurianum ATCC 6013. Applied Microbiology and Biotechnology, v. 93, n. 3, p. 1325-1335, 2012; Yazdani, SS; Gonzalez, R. Anaerobic fermentation of glycerol: a path to economic viability for the biofuels industry. Current Opinion in Biotechnology, v. 18, n. 3, p. 213-219, 2007).

Petition 870170048524, of 7/12/2017, p. 9/55

6/38 [023] Thus, strategies have been used to convert crude glycerol into products with high added value. The large amount generated decreased the value of glycerol, making it a competitive substrate used in fermentation processes in relation to sugars (Przystatowska, H .; Lipiriski, D .; Stomski, R .; et al. Biotechnological conversion of glycerol from biofuels to 1, 3-propanediol using Escherichia coli (Acta Biochimica Polonica, v. 62, n. 1, p. 23-34, 2015). Several microorganisms have been reported to be able to use crude glycerol as a carbon source for the synthesis of metabolic compounds such as dihydroacetone, organic acids, ethanol, propanediol, among others (Sivasankaran, C .; Ramanujam, PK; Balasubramanian, B .; Mani, J. Recent progress on transforming crude glycerol into high value chemicals: a critical review. Biofuels, v. 0, n. 0, p. 1-6, 2016).

[024] Patents related to the production of amino acids, including L-methionine using glycerol as substrate can be cited:

[025] The patent WO2008002053A1 reports a microorganism capable of producing amino acids using glycerol as a substrate. The microorganism reported is E. coli, which has inactivated the galR and / or glpR genes to produce the amino acids threonine and methionine. In the present invention the difference is in the genetic modifications carried out in the E. coli bacterium, as well as the method of production of L-methionine using fed batch strategy, growth of the bacterium using culture medium similar to the production and method of purification of the amino acid.

[026] The patent US20090317876 reports the production of L-amino acids in a culture medium containing glycerol using bacteria from the Enterobacteriaceae family, Escherichia and Pantoea genera. In these microorganisms, the activity of the enzymes glycerol kinase and glycerol 3-phosphate dehydrogenase is modified. The amino acids L-phenylalanine, L-tyrosine and L-tryptophan are produced. The amino acid L-methionine is cited. The present invention differentiates in the production of the amino acid L-methionine using a bacterium with different modifications as described in the present invention.

[027]

DESCRIPTION OF THE INVENTION

Petition 870170048524, of 7/12/2017, p. 10/55

7/38 [028] As mentioned in the state of the art of the invention, several strains of the E. coli bacterium are used for metabolic engineering aiming at greater production of amino acids. As the E. coli K-12 MG1655 strain had its genome fully sequenced and annotated (Blattner et al., 1997), in addition to several metabolic models already being available (Orth et al., 2011), this invention will use this bacterium as a strain that will be referred to from that point throughout the document as a chassis strain.

[029] The E. coli K-12 MG1655 bacterium is defined by a chassis strain according to the genome sequenced by Blattner et al. (1997) and any spontaneous mutations that have been generated until the beginning of the genetic modification steps described below.

[030] In order to increase the metabolic flow for the production of Lmethionine, a series of gene deletions were performed on the MG1655 strain. Deletions were performed with the transduction system using the P1 phage, according to Thomason et al., 2007. The principle of the technique is initially caused by the infection of the donor strain with the gene of interest deleted from the genome with the P1 phage. After cell disruption, phage purification and subsequent infection of the target strain is performed, so that after infection, the deletion occurs through homologous recombination of the DNA with the deletion carried by the P1 phage with the genomic DNA of the target strain. . The sequence of deletions follows as described below.

[031] The metJ gene is deleted from strain MG1655 using strain JW3909-1 as the donor strain. The resulting strain was named NB1701. The metJ gene codes for the transcriptional factor that suppresses the expression of the metA, metB, metC and metL genes, essential for the production of L-methionine, as cited in the patent JP2000157267.

[032] The metA gene is deleted from strain NB1701 using strain JW3973-1 as the donor strain. The resulting strain was named NB1702. The protein resulting from the expression of the metA gene, under native conditions, is negatively regulated by methionine and S-adenosyl-methionine, so that a mutated metA ^fd isoform is overexpressed avoiding negative regulation.

Petition 870170048524, of 7/12/2017, p. 11/55

8/38 [033] The metI gene is deleted from strain NB1702 using strain KW0194-1 as the donor strain. The resulting strain was named NB1703. The metI gene codes for an importer of L-methionine, so that the strain generated with this mutation is unable to transport methionine from the extracellular medium to the cytosol, differing from the cited patents.

[034] The lysA gene is deleted from strain 1703, differently from WO2002010209 which deletes the lysC gene, using strain JW28061 as donor strain. The resulting strain was named NB1704. The lysA gene codes for the protein diaminopimelate decarboxylase, involved in the last stage of the L-lysine production pathway. The production of L-lysine uses L-homoserine as an initial precursor, which is also used for the production of L-methionine. Thus, strain 1704, auxotrophic for lysine, has the metabolic flow directed towards the production of L-methionine.

[035] The pta gene is deleted from strain 1704 using strain JW2294-1 as the donor strain. The resulting strain was named NB1705. The pta gene codes for the enzyme phosphate acetyltransferase, associated with the acetate production pathway using acetyl-CoA as a precursor. This modification allows the NB1705 strain to have greater availability of acetyl-CoA and less production of acetate, reducing the generation of by-products.

[036] The ackA gene is deleted from strain 1705 using strain JW2293-1 as the donor strain. The resulting strain was named NB1706. The ackA gene codes for the enzyme acetate kinase, associated with the acetate production pathway using acetyl phosphate as a precursor. This modification allows the NB1706 strain to have less acetate production.

[037] The arcA gene is deleted from strain 1706 using strain JW4364-1 as the donor strain. The resulting strain was named NB1707. The arcA gene codes for the transcription factor that, together with arcB, acts as a global negative regulator of the citric acid cycle, suppressing it under conditions of anaerobia or microoxygenation. This modification allows strain 1707 to be able to withstand more limited oxygenation conditions compared to previous strains, allowing the acid cycle cycle to remain active, keeping the metabolic flow constant for the production of L-methionine.

Petition 870170048524, of 7/12/2017, p. 12/55

9/38 [038] The arcB gene is deleted from strain 1707 using strain JW5536-1 as the donor strain. The resulting strain was named NB1708. This modification, as described for strain 1707, allows strain NB1708 to be able to keep the citric acid cycle functional under limited oxygenation conditions, keeping the metabolic flow constant for the production of L-methionine.

[039] The ptsG gene is deleted from strain 1708 using strain JW1087-2 as the donor strain. The resulting strain was named NB1709. The ptsG gene codes for the IIBC component of the specific glucose PTS enzyme, an enzyme involved in the glucose assimilation process as a carbon source. This domain, when phosphorylated, binds to the enzyme glycerol kinase, inhibiting its activity. This modification allows the strain NB1709 to be able to metabolize both glycerol and glucose simultaneously, since there is no inhibition of glycerol kinase.

[040] The alteration in the arcA, arcB and ptsG genes differs from the other cited patents, keeping the citric acid cycle active and allowing the stripe to metabolize glycerol and glucose.

[041] The thrB gene is deleted from strain 1716 using strain JW0002-3 as the donor strain. The resulting strain was named NB1717. The thrB gene codes for the enzyme homoserine kinase, which consumes L-homoserine as a precursor for the synthesis of threonine. This modification allows the strain 1717, auxotrophic for threonine, to have the metabolic flow directed towards the production of Lmethionine.

[042] The donor strains for the deletions come from the Coli Genetic Stock Center.

[043] In addition to the deletions already mentioned, other modifications help to increase the production of methionine.

[044] In order to increase the availability of NADPH, the pntA and pntB genes, which convert NADP + and NADH into NADPH and NAD +, respectively, were inserted into the genome together with the sthA gene, which converts NAD + and NADPH into NADH and NADP +, respectively , as well as in US9034611. The three genes were inserted into the genome in an operon condition and are under the control of the constitutive synthetic promoter J23118.

Petition 870170048524, of 7/12/2017, p. 13/55

10/38 [045] The glyA gene, as mentioned in the WO2007077041 and WO2009043803 patents, has its expression increased causing the transfer of a methyl group to the tetrahydrofolate molecule, a key intermediate in methionine biosynthesis. This gene, together with the aspC gene, which codes for the protein aspartate aminotransferase and promotes the formation of oxaloacetate from aspartate, was inserted into the genome in an operon condition, unlike the patents cited. Both genes are under the control of the constitutive synthetic promoter J23118, so that the availability of tetrahydrofolate and oxaloacetate are increased, directing the metabolic flow to the formation of methionine.

[046] The ftsA and ftsZ genes, involved in the formation of the ring structure responsible for promoting cell division, have their expression increased so that cells maintain the cell division process even when there is a signal to stop proliferation caused mainly by cell-cell contact. Both genes were inserted into the genome in an operon condition, and their expression is controlled by the constitutive synthetic promoter J23118 in order to maintain their constant expression. These modifications do not occur in L-methionine production patents. This modification allows the cell culture to remain in the growth phase even at high density. The metK * gene generates the enzyme methionine adenosyltransferase, which generates S-adenosylmethionine from methionine, a molecule of interest in this patent. Thus, the metK * gene has mutations that reduce the activity of this enzyme by approximately 90%, affecting the accumulation of biomass, however, not using methionine, which is transported to the extracellular medium.

[047] The yjeH gene, described as an exporter of L-methionine to the extracellular medium, also modified in the patent US20090298135, has its expression increased due to the insertion of an additional copy in the genome, this gene being under the control of the constitutive synthetic promoter J23118. Constituting an operon under the control of the same promoter, a copy of the pyc gene from Rizhobium etli, which codes for the enzyme pyruvate carboxylase, was also inserted, promoting the formation of oxaloacetate directly from pyruvate. These two modifications are intended to reduce the intracellular accumulation of methionine, as well as to promote the

Petition 870170048524, of 7/12/2017, p. 14/55

11/38 transport of this amino acid to the extracellular environment, and increase the availability of intracellular oxaloacetate, an essential intermediate in the methionine synthesis pathway. [048] L-methionine biosynthesis is a costly energy process that involves different intermediates from several other pathways. The carbon skeleton is derived from aspartate while the sulfur comes from cysteine. In order to increase the metabolic flow for cysteine production, the cysM and cysE genes that code for the enzymes cysteine synthesis and serine acetyltransferase, respectively, have been overexpressed, as well as in the patents WO2007077041, WO2007012078 and US9034611. However, differently from the other cited patents, the invention described here, in the case of the cysE gene, a variant of the gene with mutations in positions T167A, G245S and M256I, was used in order to attenuate the inhibition by the cysteine product.

[049] The aspC and metL genes, which code for the enzymes aspartate transaminase and aspartate kinase II were overexpressed in order to increase the metabolic flow for the production of homoserine, a key intermediate for the production of methionine. Then, homoserine is converted to O-succinyl homoserine by the action of the enzyme homoserine-O-succinyl transferase, encoded from the metA gene. A variant of the metA-metA ^fd gene ( ^fd- desensitized feedback) containing triple mutation (Arg ²⁷ , Iso ²⁹⁶ and Pro ²⁹⁸ ) was used in order to attenuate the inhibition by the products L-methionine and S-adenosyl-methionine.

[050] O-succinyl homoserine is subsequently converted to L-methionine in reactions with the cysteine and 5-methyltetrahydrofolate intermediates in three steps involving the metB, metC or malY and metH genes, which code for the enzymes O-succinylmoserin-lyase, cystathione-beta-lyase, bifunctional beta-cystathione and methionine synthase, respectively. These genes had their expression increased in order to increase / direct the metabolic flow for the production of L-methionine.

[051] Aiming at increasing the metabolic flow for the production of the intermediate 5methyltetrahydrofolate, the metF gene encoding the enzyme 5,10methylene tetrahydrofolate reductase was overexpression.

[052] The metK * gene has its expression attenuated by a site-directed mutation in the -10 region and decreased catalytic activity of the methionine protein

Petition 870170048524, of 7/12/2017, p. 15/55

12/38 adenosyltransferase by means of a double mutation in regions 554 and 1132, different from the patent EP1715055, where the gene deletion occurs.

[053] A major differentiation of the present invention is the alteration of the ydhU gene, so that the availability of sulfur is increased for the production of cysteine, the ydhU gene has its expression increased, leading to the production of the subunit b of the cytochrome YdhYVWXUT oxidoreductase complex, aiming at the conversion of thiosulfate to sulfite with greater efficiency, being this intermediate for the formation of cysteine, and subsequent incorporation to L-methionine.

[054] As the preferred carbon source is glycerol, so that it can be imported more efficiently from the culture medium, the glpF gene, a glycerol transporter for the intracellular medium, together with the glpK ^fd gene, which promotes phosphorylation of glycerol, forming glycerol-3-phosphate, are inserted into the genome in the form of an operon and both show expression controlled by the same constitutive synthetic promoter J23118. The glpK ^ID mutated gene is desensitized to frutose1,6 bisphosphate and non-phosphorylated form of the enzyme // ^GLC, thereby allowing the strain containing this mutant gene is capable of assimilating glucose and glycerol as carbon sources simultaneously, unlike the patent mentioned, where they use glucose as a carbon source. Table 1 shows the strains constructed with their modifications.

Table 1 - Genetically modified strains for the production of L-methionine.

NB1701 AmetJ NB1702 AmetJ, AmetA NB1703 AmetJ, AmetA, AmetI; NB1704 AmetJ, AmetA, AmetI, AlysA, NB1705 AmetJ, AmetA, AmetI, AlysA, Apta, NB1706 AmetJ, AmetA, AmetI, AlysA, Apta, AackA NB1707 AmetJ, AmetA, AmetI, AlysA, Apta, AackA, AarcA, NB1708 AmetJ, AmetA, AmetI, AlysA, Apta, AackA, AarcA, AarcB, NB1709 AmetJ, AmetA, AmetI, AlysA, Apta, AackA, AarcA, AarcB, AptsG NB1710 AmetJ, AmetA, AmetI, AlysA, Apta, AackA, AarkA, AarkB, AptsG, PJ23118 glpK glpF NB1711 AmetJ, AmetA, AmetI, AlysA, Apta, AackA, AarcA, AarcB, AptsG, PJ23118 glpK glpF, PJ23118 pntAB sthA, NB1712 AmetJ, AmetA, AmetI, AlysA, Apta, AackA, AarcA, AarcB, AptsG, PJ23118 glpK glpF, PJ23118 pntAB sthA, PJ23118 aspC glyA

Petition 870170048524, of 7/12/2017, p. 16/55

13/38

NB1713 AmetJ, AmetA, AmetI, AlysA, Apt, AackA, AarcA, AarcB, AptsG, PJ23118_glpK_glpF_, PJ23118_pntAB_sthA, PJ23118_aspC_glyA, PJ23118 pyc yjeH NB1714 AmetJ, AmetA, AmetI, AlysA, Fit, AackA, AarcA, AarcB, AptsG, PJ23118_glpK_glpF_, PJ23118_pntAB_sthA, PJ23118_aspC_glyA, PJ23118 pyc yjeH, PJ23118 ftsAts NB1715 AmetJ, AmetA, AmetI, AlysA, Apta, AackA, AarcA, AarcB, AptsG, PJ23118_glpK_glpF_, PJ23118_pntAB_sthA, PJ23118_aspC_glyA, PJ23118 pyc yjeH, PJ23118 ftsAts NB1716 AmetJ, AmetA, AmetI, AlysA, Apta, AackA, AarcA, AarcB, AptsG, PJ23118_glpK_glpF_, PJ23118_pntAB_sthA, PJ23118_aspC_glyA, PJ23118 pyc yjeH, PJ23118 metH cysE NB1717 AmetJ, AmetA, AmetI, AlysA, Fit, AackA, AarcA, AarcB, AptsG, AthrB, PJ23118_glpK_glpF_, PJ23118_pntAB_sthA, PJ23118_aspC_glyA, PJ23118 pyc yjeH, cJE118 NB1718 AmetJ, AmetA, AmetI, AlysA, Fit, AackA, AarkA, AarkB, AptsG, AthrB, PJ23118_glpK_glpF_, PJ23118_pntAB_sthA, PJ23118_aspC_glyA, PJ23118 pyc yjeH, pJ23118, fJ23118 NB1719 AmetJ, AmetA, AmetI, AlysA, Fit, AackA, AarkA, AarkB, AptsG, AthrB, PJ23118_glpK_glpF_, PJ23118_pntAB_sthA, PJ23118_aspC_glyA, PJ23118_pyc_yje_, PJ23118_pyc_yjeH, PJ23, PJ23118_pyc_yjeH, PJ2311

[055] The terms increased gene expression, improved gene expression or gene overexpression are used throughout the text and have a similar meaning.

[056] To increase the expression of a gene, different molecular biology techniques can be used: increasing the number of copies of the vector; increase in the number of copies of the gene on the chromosome, use of an inducible promoter aiming at a high level of gene expression, attenuating or repressing the transcription of repressors; change in the promoter region.

[057] The gene can be expressed from chromosomal or extrachromosomal DNA. When the gene is located on the chromosome, several copies of the gene can be introduced using different recombination techniques. Different plasmids that differ in relation to the origin of replication, and therefore, their number of copies in the cell. These plasmids present in the cell can vary from 5 to 20 copies (pSB3C5), about 100 (pSB1C3), or up to 500 copies (pUC57, pUC57bricks) depending on the nature of the plasmid.

Petition 870170048524, of 7/12/2017, p. 17/55

14/38 [058] The coding sequences for the described genes were either chemically synthesized or obtained by PCR. To construct the transcriptional units in plasmids, the groups of recombinant genes and the different promoters were assembled using the Biobrick® method and previously described protocols (Sambrook, 1989).

[059] For the construction of the vector pNB01, the metA ^fd gene the prefix and suffix Biobrick® is cloned into plasmid pUC57 using the restriction endonuclease sites EcoRI and PstI, under control of the native promoter.

[060] The yjeH gene containing the Biobrick® prefix and suffix was cloned in the plasmid pNB01_pmet_metA ^atm using the restriction endonuclease sites EcoRI and PstI, originating the construction pNB02_ pmet_metA ^atm _yjeH.

[061] To obtain the pNB03 construct, the metA ^atm _yjeH gene group containing the Biobrick® prefix and suffix was obtained from the pNB02 vector using the XbaI and PstI restriction endonuclease sites and cloned downstream of the metH and metL genes obtained from the vector pUC57 using XbaI and PstI restriction endonucleases. The gene set metL_metH_metA ^atm _yjeH was cloned into the pUCbrick vector downstream of the constitutive promoter J23118 giving rise to the vector p NB03_pJ23118_metL_metH_metA ^atm _yjeH.

[062] The cysM, cysE, metB, metC, ydhU and metF genes containing the Biobrick® prefix and suffix were obtained from the pUC57 vector using the XbaI and PstI restriction endonuclease sites and subsequently cloned into the pNB03 vector giving rise to the pNB04 construct . To obtain the pNB05 construct, the malY gene was cloned downstream from the metB gene, in the same position as the metC gene.

Table 2 - Gene constructions.

01 pNB01_pmet_metA ^fd 02 pNB02_ pmet_metA ^fd _yjeH 03 pNB03_pJ23118_metL_metH_metA ^fd _yjeH 04 pNB04_pJ23118_cysM_cysE_metL_metH_metB_metC_ydhU_metF_metA ^fd 05 pNB05_pJ23118_cysM_cysE_metL_metH_metB_malY_ydhU_metF_metA ^fd 06 pNB05_pJ23118_cysM_metL_metB_malY_metF_metA ^fd

Petition 870170048524, of 7/12/2017, p. 18/55

15/38

L-METHIONINE PRODUCTION PROCESS [063] The amino acid L-methionine is produced as described in the invention by the bacterium Escherichia coli using residues from the biofuel industry as a carbon source. Additional substrates to carbon source such as simple, complex carbohydrates, starch, glycerol, fatty acids, among others can be added and combined with the residues. Other nutrients are added to the culture medium, as a source of nitrogen, and yeast extract, urea, corn steeping water, inorganic salts such as NH4NO3, KNO3, NaNO3 and NH4Cl can be used. Since L-methionine is a sulfur amino acid, supplementation with a sulfur source is necessary. The salts added to the medium as a sulfur source, can be Na2SO4, MgSO4, H2S, (NH4) 2SO4 or Na2S2O3. Additional nutrients are required such as phosphorus, magnesium, calcium, molybdenum, boric acid, cobalt, copper, manganese, zinc, iron and B vitamins.

[064] The E. coli inoculum is grown in a culture medium similar to the L-methionine production medium to adapt the bacteria to the culture medium and thus, there is a productivity gain during the process by reducing the lag phase of bacterial growth .

[065] In the present invention, the genetically modified E. coli bacterium is preferably used as previously described. The growth of the microorganism is carried out at a temperature between 30 ° C and 40 ° C, pH between 6.8 and 7.2, with constant agitation. This step can be performed in agitated flasks or in bioreactors with mechanical agitation and forced aeration with sterile air. To guarantee the quality of bacterial growth, temperature, pH, dissolved oxygen control systems are used. The monitoring of bacterial growth is done by optical density, viable cells and dry biomass.

[066] As the pre-inoculum and inoculum priority are the growth of microorganisms, each of these phases lasts 24 hours, being able to operate in batch or batch mode fed by substrate pulses.

[067] The fermentation process, for product formation, takes place in a bioreactor with a mechanical stirring system and forced aeration between 1 and 2 vvm (volume of air per volume of culture medium per minute). The fermentation process is subjected to temperature conditions between 30 ° C and 40 ° C, pH between 6.8 and 7.2,

Petition 870170048524, of 7/12/2017, p. 19/55

16/38 controlled by means of phosphate buffer solution or similar, or by the addition of base solution (NaOH, NH4OH, among others) or acid solution (HCl, among others).

[068] In the fermentation and L-methionine production stage, the reactor operates in a batch-fed way, that is, the carbon source and / or other nutrients are fed throughout the process so that there is an increase in the yield of the amino acid L -methionine. The duration of this step is 48 to 72 hours.

[069] The laboratory-scale process, according to the present invention, is developed on a larger scale in bioreactors. The scale increase is carried out at a fixed volume rate and with the use of a similar culture medium, already described in the present invention, so that there is an environment and adaptation of the microorganism.

[070] As the fermentation process is developed in a sterile environment, the culture medium is sterilized inside the bioreactor with live steam so that contamination does not occur during fermentation. To avoid contamination, the raw material is previously sterilized by chemical or physical means, such as the use of rapid heat or specific antibiotics. The concentration of the carbon source in the culture medium should not exceed 100 g / L to avoid repression of the microorganism by excess substrate.

[071] The stages of development of the inoculum, bacterial growth, occur in batch mode, as described, that is, the culture medium including the carbon source and other nutrients are added at the beginning of the process.

[072] In the pre-inoculum and inoculation steps the carbon source, preferably glycerol, is added in batches, that is, all the necessary quantity will enter together with the other salts. Inoculum growth can also be accomplished by powered batching. Optimal growth conditions will be maintained by controlling temperature, pH, oxygen and agitation, as described previously in the invention.

[073] For the fermentation process, where the formation of the products will occur, the bioreactor must be kept between temperatures of 30 ^o C and 40 ^o C for better growth of the microorganism and production of L-methionine. In order for the pH to remain between 6.8 and 7.2, control is carried out by means of sensors and correction

Petition 870170048524, of 7/12/2017, p. 20/55

17/38 using basic or acidic solution as already described. The air injection must be kept constant.

[074] In fermentation for the production of L-methionine, the bioreactor operates in a batch-fed way, that is, the carbon source and / or other nutrients are fed throughout the fermentation process, so that its yield is increased. Fermentation is a stage lasting 48 to 72 hours.

L-METHIONINE RECOVERY AND PURIFICATION PROCESS [075] The present invention also deals with the recovery and purification of the amino acid L-methionine from the fermented broth and thus obtaining a product with a high degree of purity. The fermented broth is sent to a lung tank where the bacterial cell inactivation process occurs.

[076] The fermented broth containing the amino acid L-methionine is subjected to a separation process in order to remove the biomass and other suspended solids present. The separation process can be carried out by the centrifugation process, as well as by the filtration, microfiltration or ultrafiltration process. The supernatant, containing L-methionine, proceeds to the purification process while the biomass is a residue of the process.

[077] According to the invention, the broth is subjected to a purification process using an ion exchange resin of the cationic type. For this process, the broth must have its pH decreased to a value that is less than the pKa of the amino acid Lmethionine, which converts the amino acid to the acid form. The ion exchange resin adsorbs the amino acid at acidic pH and elutes at alkaline pH. The contact time of the broth with the resin for adsorption of the amino acid is between 45 to 120 minutes. Then, water is passed through the resin and then the adsorbed amino acid is eluted using a basic ammonium hydroxide solution, for the same time the product passes.

[078] The eluted product can undergo an evaporation process in order to increase the concentration of solids in the solution and thus obtain a final product in liquid form.

[079] To obtain a product in solid form, there is the spray drying process. In spray drying, the broth must contain a

Petition 870170048524, of 7/12/2017, p. 21/55

18/38 minimum amount of solids of 10 to 12%. This minimum amount of solids can be obtained by evaporating the broth or by eluting the broth from the ion exchange resin with concentrated base solutions.

[080] WO 2013083934A1 purifies methionine by the following methods: a) clarification of the fermented broth and removal of insoluble and soluble solids by flocculation, sedimentation, microfiltration, ultrafiltration, nanofiltration, reverse osmosis and centrifugation; b) optionally, demineralization of the clarified broth in order to remove cations and anions; c) crystallization of the methionine from the broth. In the present invention, the process of separating biomass and insoluble solids is similar to that described in the patent. However, the process of obtaining L-methionine in solid form differs by using the spray drying method instead of crystallization.

EXAMPLES

Example 1:

[081] The methionine-producing strains described in Table 1 were grown in Erlemeyer-type flasks containing 50 mL of the NB01 culture medium (Table 03), at 37 ° C, for 48 h. After fermentation, the culture supernatant was centrifuged and the cell pellet was discarded. The quantification of methionine present in the culture supernatant was carried out by H ¹ proton and C ¹³ carbon analyzes by nuclear magnetic resonance (NMR) spectrometry. Table 04 presents the results for different strains producing methionine.

Table 3 - Description of NB01 medium

Compound Concentration (g L ^-1 ) KH2PO4 3 Na2HPO4-7H2O 12.8 MgSO4 0.24 Yeast extract 5 NaCl 0.5 CaCl2 0.011 NH4Cl 1

Petition 870170048524, of 7/12/2017, p. 22/55

19/38

(NH4) 2SO4 16 Na2S2O3 1 Glycerol 20 Vitamin B1 0.001 Vitamin B7 0.001 B12 vitamin 0.001

Table 04 - Results obtained in shaken bottles.

Strain DO600 48 h L-methionine g / L 48 h NB1701 9.3 ± 1 0.09 ± 0.02 NB1703 + pNB01_pmet_metA ^atm 8.4 ± 0.5 0.65 ± 0.1 NB1704 + pNB01_pmet_metA ^atm 6.7 ± 0.43 1.9 ± 0.22 NB1706 + pNB03_pJ23118_metL_metH_metA ^{at m} _yjeH 6.8 ± 0.89 3.2 ± 0.19 NB1712 + pNB05_pJ23118_cysM_cysE_metL_ metH_metB_malY_metF_metA ^atm _yje H 7.6 ± 0.54 5.4 ± 0.12

Example 2:

[082] The best strains producing in shaken flasks were evaluated in a 5 L Minifors fermenter. The volume of medium (NB01) used was 1.6 L, supplemented with the amino acid L-lysine (0.146 g L ^-1 ). Feedings were performed every 12 h using a concentrated solution (500 g L ^-1 glycerol, ammonium sulphate 16 g L ^-1 , sodium thiosulfate 23.8 g L ^-1 , yeast extract 1 g L ' ¹ , vitamins B1, B7 and B7 0.032 g L ^-1 , L-lysine 4.3 g L ^-1 The pH was automatically adjusted and maintained at 6.8 using ammonium hydroxide, fermentation was maintained at 30 ° C, with a aeration rate of 3 L.min ^-1 , with agitation governed by cascade control associated with dissolved oxygen concentration, with adjusted set point

Petition 870170048524, of 7/12/2017, p. 23/55

20/38 by 20%. Table 5 shows the results obtained in the described experiment.

Table 05 - Experiment results Example 2.

Strain Biomass Wet g / L (72 h) L-methionine g / L 72 h NNB1704 + pNB01_pmet_metA ^atm 60 4.3 ± 0.6 NB1706 + pNB03_pJ23118_metL_metH_metA ^atm _yjeH 56 6.9 ± 1.2 NB1712 + pNB05_pJ23118_cysM_cysE_metL_metH_ mmetB_malY_metF_metA ^atm _yjeH 49 11.8 ± 0.8

DEFINITIONS [083] It is described here that the aforementioned "glycerol", "glycerin" and "glycerin water" are the carbon source used, varying only the concentration of C3H8O3 in its composition.

[084] The term “methionine” refers to the sulfur amino acid of the chemical formula HO2CCH (NH2) CH2CH2SCH3 and CAS number 59-51-8 or 63-68-3 specifically for the L isomer.

[085] A microorganism can be modified to express exogenous genes if those genes are introduced into the microorganism with all the elements for its expression. Modifying the microorganism with exogenous DNA is a routine task for experts in the art.

[086] The term microorganism used here refers preferably to E. coli. [087] The terms downstream and purification are equivalent, referring to the methods, after fermentation, to obtain the product in its final form.

[088] The deoxynucleotide sequence identified in the genome of the chassis strain as b3938 is defined by the metJ gene, among deoxynucleotides 4,128,078 to 4,128,395.

[089] A deoxynucleotide sequence is defined as any polynucleotide chain consisting of single-stranded or double-stranded deoxynucleotides and which will be referred to in the invention as only DNA sequence.

Petition 870170048524, of 7/12/2017, p. 24/55

21/38 [090] The DNA sequence identified in the genome of the chassis strain as b4013 is defined by the metA gene, between nucleotides 4,214,280 to 4,215,209 according to the reference genome (Blattner et al., 1997) .

[091] The variant with three point mutations in nucleotides C79T (cytosine at position 79 is replaced by a thymine), T887G and C893T is defined by metA ^fd . These three mutations lead to the exchange of amino acids R27C (arginine of position 27 of the polypeptide exchanged for a cysteine), I296S (isoleucine of position 296 for serine) and P298L (proline of position 298 for leucine) and desensitize the enzyme MetA from feedback inhibition negative effect caused by L-methionine.

[092] The DNA sequence identified in the genome of the chassis strain as b2838 is defined by the lysA gene, between nucleotides 2977637 to 2978899 according to the reference genome (Blattner et al., 1997).

[093] The DNA sequence identified in the genome of the chassis strain as b4401 is defined by the arcA gene, between nucleotides 4639590 to 4640306 according to the reference genome (Blattner et al., 1997).

[094] The DNA sequence identified in the genome of the chassis strain as b3210, between nucleotides 3350689 to 3353025, is defined by the arcB gene according to the reference genome (Blattner et al., 1997).

[095] The DNA sequence identified in the genome of the chassis strain as b1101 is defined by the ptsG gene, between nucleotides 1157859 to 1159302 according to the reference genome (Blattner et al., 1997).

[096] The DNA sequence identified in the genome of the chassis strain as b0003 is defined by thrB gene, between nucleotides 2801 to 3733 according to the reference genome (Blattner et al., 1997).

[097] The DNA sequence identified in the genome of the chassis strain as b0004, between nucleotides 3734 to 5020, is defined by the thrC gene according to the reference genome (Blattner et al., 1997).

[098] The DNA sequence identified in the genome of the chassis strain as b2297, between nucleotides 2414747 to 2416891, is defined by the pta gene according to the reference genome (Blattner et al., 1997).

Petition 870170048524, of 7/12/2017, p. 25/55

22/38 [099] The DNA sequence identified in the genome of the chassis strain as b2296, between nucleotides 2413470 to 2414672, is defined by the ackA gene according to the reference genome (Blattner et al., 1997).

[100] The yjeH gene is defined as the sequence identified as b4141 and located between nucleotides 4369156 to 4370412 in the reference genome (Blattner et al., 1997).

[101] The sequence identified as b3941 and located between nucleotides 4132616 to 4133506 in the reference genome is defined as the metF gene (Blattner et al., 1997).

[102] The sequence identified as b4019 and located between nucleotides 4223828 to 4227511 in the reference genome is defined as the metH gene (Blattner et al., 1997).

[103] The sequence identified as b3940 and located between nucleotides 4129835 to 4132267 in the reference genome is defined as the metL gene (Blattner et al., 1997).

[104] The sequence identified as b3607 and located between nucleotides 3781741 to 3782562 in the reference genome is defined as the cysE gene (Blattner et al., 1997).

[105] The variant with three point mutations in nucleotides A721G (adenine of position 721 is replaced by a guanine), G727A (guanine of position 727 is replaced by an adenine) and G955A (guanine of position 955) are defined as the cysE ^fd gene. is replaced by an adenine). These mutations lead to the exchange of amino acids T167A (tyrosine of position 167 of the polypeptide exchanged for an alanine), G245S (glycine of position 245 of the polypeptide exchanged for a serine) and M254I (methionine of position 254 of the polypeptide exchanged for an isoleucine) and desensitize the cysE enzyme of negative feedback inhibition caused by L-cysteine.

[106] The sequence identified as b2421 and located between nucleotides 2538672 to 2539583 in the reference genome is defined as cysM gene (Blattner et al., 1997).

[107] The sequence identified as b2942 and located between nucleotides 3086076 to 3087860 in the reference genome is defined as the metK gene (Blattner et al., 1997).

Petition 870170048524, of 7/12/2017, p. 26/55

23/38 [108] The variant with two point mutations in the T554A nucleotides (thymine of position 554 is replaced by an adenine) and deletion of the cytosine at position 1132 are defined by metK *. These two mutations lead to the exchange of amino acids V185E ( valine of position 185 of the polypeptide exchanged for a glutamic acid) and alteration of the reading phase substituting an arginine for an alanine at position 378 and formation of an early stop codon, attenuating the activity of the enzyme methionine adenosyltransferase.

[109] The aspC gene is defined as the sequence identified as b0928 and located between nucleotides 984519 to 985709 in the reference genome (Blattner et al., 1997).

[110] The ftsA gene is defined as the sequence identified as b0094 and located between nucleotides 103982 to 105244 in the reference genome (Blattner et al., 1997).

[111] The ftsZ gene is defined as the sequence identified as b0095 and located between nucleotides 105305 to 106456 in the reference genome (Blattner et al., 1997).

[112] The sequence identified as b3927 and located between nucleotides 4117245 to 4118090 in the reference genome is defined as the glpF gene (Blattner et al., 1997).

[113] The sequence identified as b3926 and located between nucleotides 4115714 to 4117222 in the reference genome is defined as the glpK gene (Blattner et al., 1997).

[114] The variant with a point mutation in the G913A nucleotide is defined as the glpK ^fd gene, generating the G305S substitution (glycine at position 305 replaced by a serine). This change allows the desensitization of this protein to enzymes of the glucose-specific phosphotransferase system, allowing the strain containing this mutation to be able to metabolize glycerol and glucose simultaneously.

[115] The glyA gene is defined as the sequence identified as b2551 and located between nucleotides 2684254 to 2685507 in the reference genome (Blattner et al., 1997).

Petition 870170048524, of 7/12/2017, p. 27/55

24/38 [116] The malY gene is defined as the sequence identified as b1622 and located between nucleotides 1700957 to 1702129 in the reference genome (Blattner et al., 1997).

[117] The sequence identified as b3939 and located between nucleotides 4128672 to 4129832 in the reference genome is defined as the metB gene (Blattner et al., 1997).

[118] The sequence identified as b3008 and located between nucleotides 3152236 to 3153413 in the reference genome is defined as the metC gene (Blattner et al., 1997).

[119] The sequence identified as b1603 and located between nucleotides 1676371 to 1677903 in the reference genome is defined as the pntA gene (Blattner et al., 1997).

[120] The pntB gene is defined as the sequence identified as b1602 and located between nucleotides 1674972 to 1776360 in the reference genome (Blattner et al., 1997).

[121] The sthA gene is defined as the sequence identified as b3962 and located between nucleotides 4159390 to 4160790 in the reference genome (Blattner et al., 1997).

[122] The ydhU gene is defined as the sequence identified as b1670 and located between nucleotides 1749563 to 1750348 in the reference genome (Blattner et al., 1997).

[123] The pyc gene is defined as the sequence identified as RHECIAT_CH0004290 and located between nucleotides 4367027 to 4370491 in the reference genome (Gonzalez et al., 2006).

[124] Genetic parts are defined as any sequence of DNA that can be joined to another part to generate a genetic device that aims to express a certain gene or regulate its expression.

[125] The term BioBrick ^® refers to a trademark of the BioBricks Foundation. The genetic parts in BioBrick ^® format are DNA sequences obtained so that each part has the same prefix pattern (sequence for the restriction endonuclease sites EcoRI, Notl and Xbal, 5 'GAATTCGCGGCCGCTTCTAGA 3') and “suffix (sequence for sites of

Petition 870170048524, of 7/12/2017, p. 28/55

25/38 Spel, Notl and PstI restriction endonucleases, 5 'TACTAGTAGCGGCCG CTGCAG 3') (Shetty et al., 2008).

SEQUENCES OF THE GENES CITED IN THIS PATENT

Following Article 1 (ASPC):

atgtttgagaacattaccgccgctcctgccgacccgattctgggcctggccgatctgtttcgtgccgatgaacgtccc ggcaaaattaacctcgggattggtgtctataaagatgagacgggcaaaaccccggtactgaccagcgtgaaaa aggctgaacagtatctgctcgaaaatgaaaccaccaaaaattacctcggcattgacggcatccctgaatttggtcg ctgcactcaggaactgctgtttggtaaaggtagcgccctgatcaatgacaaacgtgctcgcacggcacagactcc ggggggcactggcgcactacgcgtggctgccgatttcctggcaaaaaataccagcgttaagcgtgtgtgggtgag caacccaagctggccgaaccataagagcgtctttaactctgcgggtctggaagttcgtgaatacgcttattatgatg cggaaaatcacactcttgacttcgatgcactgattaacagcctgaatgaagctcaggctggcgacgtagtgctgttc catggctgctgccataacccaaccggtatcgaccctacgctggaacaatggcaaacactggcacaactctccgtt gagaaaggctggttaccgctgtttgacttcgcttaccagggttttgcccgtggtctggaagaagatgctgaaggact gcgcgctttcgcggctatgcataaagagctgattgttgccagttcctactctaaaaactttggcctgtacaacgagcg tgttggcgcttgtactctggttgctgccgacagtgaaaccgttgatcgcgcattcagccaaatgaaagcggcgattc gcgctaactactctaacccaccagcacacggcgcttctgttgttgccaccatcctgagcaacgatgcgttacgtgcg atttgggaacaagagctgactgatatgcgccagcgtattcagcgtatgcgtcagttgttcgtcaatacgctgc aaga aaaaggcgcaaaccgcgacttcagctttatcatcaaaagaaga

Following Article 2 (cysE ^*):

[126] atgtcgtgtgaagaactggaaattgtctggaacaatattaaagccgaagccagaacgctggcggactgt gagccaatgctggccagtttttaccacgcgacgctactcaagcacgaaaaccttggcagtgcactgagctacatg ctggcgaacaagctgtcatcgccaattatgcctgctattgctatccgtgaagtggtggaagaagcctacgccgctg acccggaaatgatcgcctctgcggcctgtgatattcaggcggtgcgtacccgcgacccggcagtcgataaatact caaccccgttgttatacctgaagggttttcatgccttgcaggcctatcgcatcggtcactggttgtggaatcaggggc gtcgcgcactggcaatctttctgcaaaaccaggtttctgtgacgttccaggtcgatattcacccggcagcaaaaatt

Petition 870170048524, of 7/12/2017, p. 29/55

26/38 ggtcgcggtatcatgcttgaccacgcgacaggcatcgtcgttggtgaagcggcggtgattgaaaacgacgtatcg attctgcaatctgtgacgcttggcggtacgggtaaatctggtggtgaccgtcacccgaaaattcgtgaaggtgtgat gattggcgcgggcgcgaaaatcctcggcaatattgaagttgggcgcggcgcgaagattggcgcaggttccgtgg tgctgcaaccggtgccgccgcataccaccgccgctggcgttccggctcgtattgtcagtaaaccagacagcgata agccatcaatggatatagaccagcatttcaacggtattaaccatacatttgagtatggggatgggatctaa

Following paragraph 3 (cysM):

gtgagtacattagaacaaacaataggcaatacgcctctggtgaagttgcagcgaatggggccggataacggca gtgaagtgtggttaaaactggaaggcaataacccggcaggttcggtgaaagatcgtgcggcactttcgatgatcgt cgaggcggaaaagcgcggggaaattaaaccgggtgatgtcttaatcgaagccaccagtggtaacaccggcatt gcgctggcaatgattgccgcgctgaaaggctatcgcatgaaattgctgatgcccgacaacatgagccaggaacg ccgtgcggcgatgcgtgcttatggtgcggaactgattcttgtcaccaaagagcagggcatggaaggtgcgcgcga tctggcgctggagatggcgaatcgtggcgaaggaaagctgctcgatcagttcaataatcccgataacccttatgcg cattacaccaccactgggccggaaatctggcagcaaaccggcgggcgcatcactcattttgtctccagcatgggg acgaccggcactatcaccggcgtctcacgctttatgcgcgaacaatccaaaccggtgaccattgtcggcctgcaa ccggaagagggcagcagcattcccggcattcgccgctggcctacggaatatctgccggggattttcaacgcttctc tggtggatgaggtgctggatattcatcagcgcgatgcggaaaacaccatgcgcgaactggcggtgcgggaagg aatattctgtggcgtcagctccggcggcgcggttgccggagcactgcgggtggcaaaagctaaccctgacgcgg tggtggtggcgatcatctgcgatcgtggcgatcgctacctttctaccggggtgtttggggaagagcattttagccagg gggcggggatttaa

Sequence No. 4 (France Télécom SA) [127] atgatcaaggcgacggacagaaaactggtagtaggactggagattggtaccgcgaaggttgccgcttt agtaggggaagttctgcccgacggtatggtcaatatcattggcgtgggcagctgcccgtcgcgtggtatggataaa ggcggggtgaacgacctcgaatccgtggtcaagtgcgtacaacgcgccattgaccaggcagaattgatggcag attgtcagatctcttcggtatatctggcgctttctggtaagcacatcagctgccagaatgaaattggtatggtgcctattt ctgaagaagaagtgacgcaagaagatgtggaaaacgtcgtccataccgcgaaatcggtgcgtgtgcgcgatga gcatcgtgtgctgcatgtgatcccgcaagagtatgcgattgactatcaggaagggatcaagaatccggtaggactt tcgggcgtgcggatgcaggcaaaagtgcacctgatcacatgtcacaacgatatggcgaaaaacatcgtcaaag cggttgaacgttgtgggctgaaagttgaccaactgatatttgccggactggcatcaagttattcggtattgacggaag atgaacgtgaactgggtgtctgcgtcgtcgatatcggtggtggtacaatggatatcgccgtttataccggtggggcat tgcgccacactaaggtaattccttatgctggcaatgtcgtgaccagtgatatcgcttacgcctttggcacgccgccaa gcgacgccgaagcgattaaagttcgccacggttgtgcgctgggttccatcgttggaaaagatgagagcgtggaa

Petition 870170048524, of 7/12/2017, p. 30/55

27/38 gtgccgagcgtaggtggtcgtccgccacggagtctgcaacgtcagacactggcagaggtgatcgagccgcgct ataccgagctgctcaacctggtcaacgaagagatattgcagttgcaggaaaagcttcgccaacaaggggttaaa catcacctggcggcaggcattgtattaaccggtggcgcagcgcagatcgaaggtcttgcagcctgtgctcagcgc gtgtttcatacgcaagtgcgtatcggcgcgccgctgaacattaccggtttaacggattatgctcaggagccgtattatt cgacggcggtgggattgcttcactatgggaaagagtcacatcttaacggtgaagctgaagtagaaaaacgtgtta cagcatcagttggctcgtggatcaagcgactcaatagttggctgcgaaaagagttttaa

Sequence No. 5 (FtsZ) [128] atgtttgaaccaatggaacttaccaatgacgcggtgattaaagtcatcggcgtcggcggcggcggcggt aatgctgttgaacacatggtgcgcgagcgcattgaaggtgttgaatttttcgcggtaaataccgatgcacaagcgct gcgtaaaacagcggttggacagacgattcaaatcggtagcggtatcaccaaaggactgggcgctggcgctaatc cagaagttggccgcaatgcggctgatgaggatcgcgatgcattgcgtgcggcgctggaaggtgcagacatggtc tttattgctgcgggtatgggtggtggtaccggtacaggtgcagcaccagtcgtcgctgaagtggcaaaagatttggg tatcctgaccgttgctgtcgtcactaagcctttcaactttgaaggcaagaagcgtatggcattcgcggagcagggga tcactgaactgtccaagcatgtggactctctgatcactatcccgaacgacaaactgctgaaagttctgggccgcggt atctccctgctggatgcgtttggcgcagcgaacgatgtactgaaaggcgctgtgcaaggtatcgctgaactgattac tcgtccgggtttgatgaacgtggactttgcagacgtacgcaccgtaatgtctgagatgggctacgcaatgatgggtt ctggcgtggcgagcggtgaagaccgtgcggaagaagctgctgaaatggctatctcttctccgctgctggaagatat cgacctgtctggcgcgcgcggcgtgctggttaacatcacggcgggcttcgacctgcgtctggatgagttcgaaacg gtaggtaacaccatccgtgcatttgcttccgacaacgcgactgtggttatcggtacttctcttgacccggatatgaatg acgagctgcgcgtaaccgttgttgcgacaggtatcggcatggacaaacg tcctgaaatcactctggtgaccaata agcaggttcagcagccagtgatggatcgctaccagcagcatgggatggctccgctgacccaggagcagaagc cggttgctaaagtcgtgaatgacaatgcgccgcaaagggcgactagatgatgatta

Sequence No. 6 (glpF) [129] atgagtcaaacatcaaccttgaaaggccagtgcattgctgaatttctcggtaccgggttgttgattttcttcgg tgtgggttgcgttgcagcactaaaagtcgctggtgcgtcttttggtcagtgggaaatcagtgtcatttggggactgggg gtggcaatggccatctacctgaccgcaggggtttccggcgcgcatcttaatcccgctgttaccattgcattgtggctgt ttgcctgtttcgacaagcgcaaagttattccttttatcgtttcacaagttgccggcgctttctgtgctgcggctttagtttac gggctttactacaatttatttttcgacttcgagcagactcatcacattgttcgcggcagcgttgaaagtgttgatctggct ggcactttctctacttaccctaatcctcatatcaattttgtgcaggctttcgcagttgagatggtgattaccgctattctgat

Petition 870170048524, of 7/12/2017, p. 31/55

28/38 ggggctgatcctggcgttaacggacgatggcaacggtgtaccacgcggccctttggctcccttgctgattggtctact gattgcggtcattggcgcatctatgggcccattgacaggttttgccatgaacccagcgcgtgacttcggtccgaaag tctttgcctggctggcgggctggggcaatgtcgcctttaccggcggcagagacattccttacttcctggtgccgcttttc ggccctatcgttggcgcgattgtaggtgcatttgcctaccgcaaactgattggtcgccatttgccttgcgatatctgtgtt gtggaagaaaaggaaaccacaactccttcagaacaaaaagcttcgctgtaa

Sequence No. 7 (glpK ^d) [130] atgactgaaaaaaaatatatcgttgcgctcgaccagggcaccaccagctcccgcgcggtcgtaatgga tcacgatgccaatatcattagcgtgtcgcagcgcgaatttgagcaaatctacccaaaaccaggttgggtagaaca cgacccaatggaaatctgggccacccaaagctccacgctggtagaagtgctggcgaaagccgatatcagttccg atcaaattgcagctatcggtattacgaaccagcgtgaaaccactattgtctgggaaaaagaaaccggcaagccta tctataacgccattgtctggcagtgccgtcgtaccgcagaaatctgcgagcatttaaaacgtgacggtttagaagatt atatccgcagcaataccggtctggtgattgacccgtacttttctggcaccaaagtgaagtggattctcgaccatgtgg aaggctctcgcgagcgtgcacgtcgtggtgaattgctgtttggtacggttgatacgtggcttatctggaaaatgactc agggccgtgtccatgtgaccgattacaccaacgcctctcgtaccatgttgttcaacatccataccctggactgggac gacaaaatgctggaagtgctggatattccgcgcgagatgctgccagaagtgcgtcgttcttccgaagtatacggtc agactaacattggcggcaaaggcggcacgcgtattccaatctccgggatcgccggtgaccagcaggccgcgct gtttggtcagttgtgcgtgaaagaagggatggcgaagaacacctatggcactggctgctttatgctgatgaacactg gcgagaaagcggtgaaatcagaaaacggcctgctgaccaccatcgcctgcggcccgactggcgaagtgaact atgcgttggaaagtgcggtgtttatggcaggcgcatccattcagtggctgcgcg atgaaatgaagttgattaacgac gcctacgattccgaatatttcgccaccaaagtgcaaaacaccaatggtgtgtatgtggttccggcatttaccgggct gggtgcgccgtactgggacccgtatgcgcgcggggcgattttcggtctgactcgtggggtgaacgctaaccacatt atacgcgcgacgctggagtctattgcttatcagacgcgtgacgtgctggaagcgatgcaggccgactctggtatcc gtctgcacgccctgcgcgtggatggtggcgcagtagcaaacaatttcctgatgcagttccagtccgatattctcggc acccgcgttgagcgcccggaagtgcgcgaagtcaccgcattgggtgcggcctatctcgcaggcctggcggttgg cttctggcagaacctcgacgagctgcaagagaaagcggtgattgagcgcgagttccgtccaggcatcgaaacc actgagcgtaattaccgttacgcaggctggaaaaaagcggttaaacgcgcgatggcgtgggaagaacacgac gaataa

Sequence No. 8 (glyA) [131] atgttaaagcgtgaaatgaacattgccgattatgatgccgaactgtggcaggctatggagcaggaaaaa gtacgtcaggaagagcacatcgaactgatcgcctccgaaaactacaccagcccgcgcgtaatgcaggcgcag

Petition 870170048524, of 7/12/2017, p. 32/55

29/38 ggttctcagctgaccaacaaatatgctgaaggttatccgggcaaacgctactacggcggttgcgagtatgttgatat cgttgaacaactggcgatcgatcgtgcgaaagaactgttcggcgctgactacgctaacgtccagccgcactccgg ctcccaggctaactttgcggtctacaccgcgctgctggaaccaggtgataccgttctgggtatgaacctggcgcatg gcggtcacctgactcacggttctccggttaacttctccggtaaactgtacaacatcgttccttacggtatcgatgctac cggtcatatcgactacgccgatctggaaaaacaagccaaagaacacaagccgaaaatgattatcggtggtttctc tgcatattccggcgtggtggactgggcgaaaatgcgtgaaatcgctgacagcatcggtgcttacctgttcgttgatat ggcgcacgttgcgggcctggttgctgctggcgtctacccgaacccggttcctcatgctcacgttgttactaccaccac tcacaaaaccctggcgggtccgcgcggcggcctgatcctggcgaaaggtggtagcgaagagctgtacaaaaa actgaactctgccgttttccctggtggtcagggcggtccgttgatgcacgtaatcgccggtaaagcggttgctctgaa agaagcgatggagcctgagttcaaaacttaccagcagcaggtcgctaaaaacgctaaagcgatggtagaagtg ttcctcgagcgcggctacaaagtggtttccggcggcactgataaccacctgttcctggttgatctggttgataaaaac ctgaccggtaaagaagcagacgccgctctgggccgtgctaacatcaccgtcaacaaaaacagcgtaccgaac gatccgaagagcccgtttgtgacctccggtattcgtgtaggtactccggcgattacccgtcgcggcttta aagaagc cgaagcgaaagaactggctggctggatgtgtgacgtgctggacagcatcaatgatgaagccgttatcgagcgca tcaaaggtaaagttctcgacatctgcgcacgttacccggtttacgcataaaaaaaaaaaa

Sequence No. 9 (Maly) [132] atgttcgatttttcaaaggtcgtggatcgtcatggcacatggtgtacacagtgggattatgtcgctgaccgttt cggcactgctgacctgttaccgttcacgatttcagacatggattttgccactgccccctgcattatcgaggcgctgaat cagcgcctgatgcacggcgtatttggctacagccgctggaaaaacgatgagtttctcgcggctattgcccactggtt ttccacccagcattacaccgccatcgattctcagacggtggtgtatggcccttctgtcatctatatggtttcagaactga ttcgtcagtggtctgaaacaggtgaaggcgtggtgatccacacacccgcctatgacgcattttacaaggccattga aggtaaccagcgcacagtaatgcccgttgctttagagaagcaggctgatggttggttttgcgatatgggcaagttgg aagccgtgttggcgaaaccagaatgtaaaattatgctcctgtgtagcccacagaatcctaccgggaaagtgtgga cgtgcgatgagctggagatcatggctgacctgtgcgagcgtcatggtgtgcgggttatttccgatgaaatccatatg gatatggtttggggcgagcagccgcatattccctggagtaatgtggctcgcggagactgggcgttgctaacgtcgg gctcgaaaagtttcaatattcccgccctgaccggtgcttacgggattatagaaaatagcagtagccgcgatgcctat ttatcggcactgaaaggccgtgatgggctttcttccccttcggtactggcgttaactgcccatatcgccgcctatcagc aaggcgcgccgtggctggatgccttacgcatctatctgaaagataacctgacgtatatcgcagataaaatgaacg ccgcgtttcctgaactcaactggcagatcccacaatc cacttatctggcatggcttgatttacgtccgttgaatattgac gacaacgcgttgcaaaaagcacttatcgaacaagaaaaagtcgcgatcatgccggggtatacctacggtgaag

Petition 870170048524, of 7/12/2017, p. 33/55

30/38 aaggtcgtggttttgtccgtctcaatgccggctgcccacgttcgaaactggaaaaaggtgtggctggattaattaac gccatccgcgctgttcgttaa

Sequence No. 10 (meth ^d) [133] atgccgattcgtgtgccggacgagctacccgccgtcaatttcttgcgtgaagaaaacgtctttgtgatgac aacttcttgtgcgtctggtcaggaaattcgtccacttaaggttctgatccttaacctgatgccgaagaagattgaaact gaaaatcagtttctgcgcctgctttcaaactcacctttgcaggtcgatattcagctgttgcgcatcgattcccgtgaatc gcgcaacacgcccgcagagcatctgaacaacttctactgtaactttgaagatattcaggatcagaactttgacggtt tgattgtaactggtgcgccgctgggcctggtggagtttaatgatgtcgcttactggccgcagatcaaacaggtgctg gagtggtcgaaagatcacgtcacctcgacgctgtttgtctgctgggcggtacaggccgcgctcaatatcctctacgg cattcctaagcaaactcgcaccgaaaaactctctggcgtttacgagcatcatattctccatcctcatgcgcttctgac gcgtggctttgatgattcattcctggcaccgcattcgcgctatgctgactttccggcagcgttgattcgtgattacaccg atctggaaattctggcagagacggaagaaggggatgcatatctgtttgccagtaaagataagcgcattgcctttgtg acgggccatcccgaatatgatgcgcaaacgctggcgcaggaatttttccgcgatgtggaagccggactagaccc ggatgtaccgtataactatttcccgcacaatgatccgcaaaatacaccgcgagcgagctggcgtagtcacggtaa tttactgtttaccaactggctcaactattacgtctaccagagcacgctatacgatctacggcacatgaatccaacgct ggattaa

Sequence No. 11 (metB) [134] atgacgcgtaaacaggccaccatcgcagtgcgtagcgggttaaatgacgacgaacagtatggttgcgtt gtcccaccgatccatctttccagcacctataactttaccggatttaatgaaccgcgcgcgcatgattactcgcgtcgc ggcaacccaacgcgcgatgtggttcagcgtgcgctggcagaactggaaggtggtgctggtgcagtacttactaat accggcatgtccgcgattcacctggtaacgaccgtctttttgaaacctggcgatctgctggttgcgccgcacgactg ctacggcggtagctatcgcctgttcgacagtctggcgaaacgcggttgctatcgcgtgttgtttgttgatcaaggcgat gaacaggcattacgggcagcgctggcagaaaaacccaaactggtactggtagaaagcccaagtaatccattgtt acgcgtcgtggatattgcgaaaatctgccatctggcaagggaagtcggggcggtgagcgtggtggataacacctt cttaagcccggcattacaaaatccgctggcattaggtgccgatctggtgttgcattcatgcacgaaatatctgaacg gtcactcagacgtagtggccggcgtggtgattgctaaagacccggacgttgtcactgaactggcctggtgggcaa acaatattggcgtgacgggcggcgcgtttgacagctatctgctgctacgtgggttgcgaacgctggtgccgcgtatg gagctggcgcagcgcaacgcgcaggcgattgtgaaatacctgcaaacccagccgttggtgaaaaaactgtatc acccgtcgttgccggaaaatcaggggcatgaaattgccgcgcgccagcaaaaaggctttggcgcaatgttgagtt

Petition 870170048524, of 7/12/2017, p. 34/55

31/38 ttgaactggatggcgatgagcagacgctgcgtcgtttcctgggcgggctgtcgttgtttacgctggcggaatcattag ggggagtggaaagtttaatctctcacgccgcaaccatgacacatgcaggcatggcaccagaagcgcgtgctgc cgccgggatctccgagacgctgctgcgtatctccaccggtattgaagatggcgaagatttaattgccgacctggaa aatggcttccgggctgcaaacaaggggtaa

Sequence No. 12 (metC) [135] atggcggacaaaaagcttgatactcaactggtgaatgcaggacgcagcaaaaaatacactctcggcg cggtaaatagcgtgattcagcgcgcttcttcgctggtctttgacagtgtagaagccaaaaaacacgcgacacgtaa tcgcgccaatggagagttgttctatggacggcgcggaacgttaacccatttctccttacaacaagcgatgtgtgaac tggaaggtggcgcaggctgcgtgctatttccctgcggggcggcagcggttgctaattccattcttgcttttatcgaaca gggcgatcatgtgttgatgaccaacaccgcctatgaaccgagtcaggatttctgtagcaaaatcctcagcaaactg ggcgtaacgacatcatggtttgatccgctgattggtgccgatatcgttaagcatctgcaaccaaacactaaaatcgt gtttctggaatcgccaggctccatcaccatggaagtccacgacgttccggcgattgttgccgccgtacgcagtgtgg tgccggatgccatcattatgatcgacaacacctgggcagccggtgtgctgtttaaggcgctggattttggcatcgatg tttctattcaagccgccaccaaatatctggttgggcattcagatgcgatgattggcactgccgtgtgcaatgcccgttg ctgggagcagctacgggaaaatgcctatctgatgggccagatggtcgatgccgataccgcctatataaccagcc gtggcctgcgcacattaggtgtgcgtttgcgtcaacatcatgaaagcagtctgaaagtggctgaatggctggcaga acatccgcaagttgcgcgagttaaccaccctgctctgcctggcagtaaaggtcacgaattttggaaacgagacttt acaggcagcagcgggctattttcctttgtgcttaagaaaaaactca ataatgaagagctggcgaactatctggata acttcagtttattcagcatggcctactcgtggggcgggtatgaatcgttgatcctggcaaatcaaccagaacatatcg ccgccattcgcccacaaggcgagatcgattttagcgggaccttgattcgcctgcatattggtctggaagatgtcgac gatctgattgccgatctggacgccggttttgcgcgaattgtataa

Sequence No. 13 (metformin) [136] atgagcttttttcacgccagccagcgggatgccctgaatcagagcctggcagaagtccaggggcagatt aacgtttcgttcgagtttttcccgccgcgtaccagtgaaatggagcagaccctgtggaactccatcgatcgccttagc agcctgaaaccgaagtttgtatcggtgacctatggcgcgaactccggcgagcgcgaccgtacgcacagcattatt aaaggcattaaagatcgcactggtctggaagcggcaccgcatcttacttgcattgatgcgacgcccgacgagctg cgcaccattgcacgcgactactggaataacggtattcgtcatatcgtggcgctgcgtggcgatctgccgccgggaa gtggtaagccagaaatgtatgcttctgacctggtgacgctgttaaaagaagtggcagatttcgatatctccgtggcg gcgtatccggaagttcacccggaagcaaaaagcgctcaggcggatttgcttaatctgaaacgcaaagtggatgc cggagccaaccgcgcgattactcagttcttcttcgatgtcgaaagctacctgcgttttcgtgaccgctgtgtatcggcg

Petition 870170048524, of 7/12/2017, p. 35/55

32/38 ggcattgatgtggaaattattccgggaattttgccggtatctaactttaaacaggcgaagaaatttgccgatatgacc aacgtgcgtattccggcgtggatggcgcaaatgttcgacggtctggatgatgatgccgaaacccgcaaactggttg gcgcgaatattgccatggatatggtgaagattttaagccgtgaaggagtgaaagatttccacttctatacgcttaacc gtgctgaaatgagttacgcgatttgccatacgctgggggttcgacctggtttataa

Sequence No. 14 (Meth) [137] gtgagcagcaaagtggaacaactgcgtgcgcagttaaatgaacgtattctggtgctggacggcggtatg ggcaccatgatccagagttatcgactgaacgaagccgattttcgtggtgaacgctttgccgactggccatgcgacc tcaaaggcaacaacgacctgctggtactcagtaaaccggaagtgatcgccgctatccacaacgcctactttgaag cgggcgcggatatcatcgaaaccaacaccttcaactccacgaccattgcgatggcggattaccagatggaatcc ctgtcggcggaaatcaactttgcggcggcgaaactggcgcgagcttgtgctgacgagtggaccgcgcgcacgcc agagaaaccgcgctacgttgccggtgttctcggcccgaccaaccgcacggcgtctatttctccggacgtcaacga tccggcatttcgtaatatcacttttgacgggctggtggcggcttatcgagagtccaccaaagcgctggtggaaggtg gcgcggatctgatcctgattgaaaccgttttcgacacccttaacgccaaagcggcggtatttgcggtgaaaacgga gtttgaagcgctgggcgttgagctgccgattatgatctccggcaccatcaccgacgcctccgggcgcacgctctcc gggcagaccaccgaagcattttacaactcattgcgccacgccgaagctctgacctttggcctgaactgtgcgctgg ggcccgatgaactgcgccagtacgtgcaggagctgtcacggattgcggaatgctacgtcaccgcgcacccgaa cgccgggctacccaacgcctttggtgagtacgatctcgacgccgacacgatggcaaaacagatacgtgaatgg gcgcaagcgggttttctcaatatcgtcggcggctgctgtggcaccacgccacaacatattgcag cgatgagtcgtg cagtagaaggattagcgccgcgcaaactgccggaaattcccgtagcctgccgtttgtccggcctggagccgctga acattggcgaagatagcctgtttgtgaacgtgggtgaacgcaccaacgtcaccggttccgctaagttcaagcgcct gatcaaagaagagaaatacagcgaggcgctggatgtcgcgcgtcaacaggtggaaaacggcgcgcagattat cgatatcaacatggatgaagggatgctcgatgccgaagcggcgatggtgcgttttctcaatctgattgccggtgaa ccggatatcgctcgcgtgccgattatgatcgactcctcaaaatgggacgtcattgaaaaaggtctgaagtgtatcca gggcaaaggcattgttaactctatctcgatgaaagagggcgtcgatgcctttatccatcacgcgaaattgttgcgtcg ctacggtgcggcagtggtggtaatggcctttgacgaacagggacaggccgatactcgcgcacggaaaatcgag atttgccgtcgggcgtacaaaatcctcaccgaagaggttggcttcccgccagaagatatcatcttcgacccaaaca tcttcgcggtcgcaactggcattgaagagcacaacaactacgcgcaggactttatcggcgcgtgtgaagacatca aacgcgaactgccgcacgcgctgatttccggcggcgtatctaacgtttctttctcgttccgtggcaacgatccggtgc gcgaagccattcacgcagtgttcctctactacgctattcgcaatggcatggatatggggatcgtcaacgccgggca actggcgatttacgacgacctacccgctgaactgcgcgacgcggtggaagatgtgattcttaatcgtcgcgacgat ggcaccgagcgtttactggagcttgccgagaaatatcgcggcagcaaaaccgacgacaccgccaacg cccag

Petition 870170048524, of 7/12/2017, p. 36/55

33/38 caggcggagtggcgctcgtgggaagtgaataaacgtctggaatactcgctggtcaaaggcattaccgagtttatc gagcaggataccgaagaagcccgccagcaggctacgcgcccgattgaagtgattgaaggcccgttgatggac ggcatgaatgtggtcggcgacctgtttggcgaagggaaaatgttcctgccacaggtggtcaaatcggcgcgcgtc atgaaacaggcggtggcctacctcgaaccgtttattgaagccagcaaagagcagggcaaaaccaacggcaag atggtgatcgccaccgtgaagggcgacgtccacgacatcggtaaaaatatcgttggtgtggtgctgcaatgtaac aactacgaaattgtcgatctcggcgttatggtgcctgcggaaaaaattctccgtaccgctaaagaagtgaatgctg atctgattggcctttcggggcttatcacgccgtcgctggacgagatggttaacgtggcgaaagagatggagcgtca gggcttcactattccgttactgattggcggcgcgacgacctcaaaagcgcacacggcggtgaaaatcgagcaga actacagcggcccgacggtgtatgtgcagaatgcctcgcgtaccgttggtgtggtggcggcgctgctttccgatacc cagcgtgatgattttgtcgctcgtacccgcaaggagtacgaaaccgtacgtattcagcacgggcgcaagaaacc gcgcacaccaccggtcacgctggaagcggcgcgcgataacgatttcgcttttgactggcaggcttacacgccgc cggtggcgcaccgtctcggcgtgcaggaagtcgaagccagcatcgaaacgctgcgtaattacatcgactggac accgttctttatgacctggtcgctggccgggaagtatccgcgcattctggaagatgaagtggtgggcgttgaggcgc agcggctgttt aaagacgccaacgacatgctggataaattaagcgccgagaaaacgctgaatccgcgtggcgtg gtgggcctgttcccggcaaaccgtgtgggcgatgacattgaaatctaccgtgacgaaacgcgtacccatgtgatc aacgtcagccaccatctgcgtcaacagaccgaaaaaacaggcttcgctaactactgtctcgctgacttcgttgcgc cgaagctttctggtaaagcagattacatcggcgcatttgccgtgactggcgggctggaagaggacgcactggctg atgcctttgaagcgcagcacgatgattacaacaaaatcatggtgaaagcgcttgccgaccgtttagccgaagcctt tgcggagtatctccatgagcgtgtgcgtaaagtctactggggctatgcgccgaacgagaacctcagcaacgaag agctgatccgcgaaaactaccagggcatccgtccggcaccgggctatccggcctgcccggaacatacggaaa aagccaccatctgggagctgctggaagtggaaaaacacactggcatgaaactcacagaatctttcgccatgtgg cccggtgcatcggtttcgggttggtacttcagccacccggacagcaagtactacgctgtagcacaaattcagcgcg atcaggttgaagattatgcccgccgtaaaggtatgagcgttaccgaagttgagcgctggctggcaccgaatctgg ggtatgacgcggactga

Sequence No. 15 (Metl) [138] atgagtgtgattgcgcaggcaggggcgaaaggtcgtcagctgcataaatttggtggcagtagtctggctg atgtgaagtgttatttgcgtgtcgcgggcattatggcggagtactctcagcctgacgatatgatggtggtttccgccgc cggtagcaccactaaccagttgattaactggttgaaactaagccagaccgatcgtctctctgcgcatcaggttcaac aaacgctgcgtcgctatcagtgcgatctgattagcggtctgctacccgctgaagaagccgatagcctcattagcgct tttgtcagcgaccttgagcgcctggcggcgctgctcgacagcggtattaacgacgcagtgtatgcggaagtggtgg gccacggggaagtatggtcggcacgtctgatgtctgcggtacttaatcaacaagggctgccagcggcctggcttg

Petition 870170048524, of 7/12/2017, p. 37/55

34/38 atgcccgcgagtttttacgcgctgaacgcgccgcacaaccgcaggttgatgaagggctttcttacccgttgctgcaa cagctgctggtgcaacatccgggcaaacgtctggtggtgaccggatttatcagccgcaacaacgccggtgaaac ggtgctgctggggcgtaacggttccgactattccgcgacacaaatcggtgcgctggcgggtgtttctcgcgtaacc atctggagcgacgtcgccggggtatacagtgccgacccgcgtaaagtgaaagatgcctgcctgctgccgttgctg cgtctggatgaggccagcgaactggcgcgcctggcggctcccgttcttcacgcccgtactttacagccggtttctgg cagcgaaatcgacctgcaactgcgctgtagctacacgccggatcaaggttccacgcgcattgaacgcgtgctgg cctccggtactggtgcgcgtattgtcaccagccacgatgatgtctgtttgattgagtttcaggtgcccgccagtcagg atttcaaactggcgcataaagagatcgaccaaatcctgaaacgcgcgcaggtacgcccgctggcggttggcgta cataacgatcgccagttgctgcaattttgctacacctcagaagtggccgacagtgcgctgaaaatcctcgacgaa gcgggattacctggcgaactgcgcctgcgtcaggggctggcgctggtggcgatggtcggtgcaggcgtcacccg taacccgctgcattgccaccgcttctggcagcaactgaaaggccagccggtcgaatttacctggcagtccgatga cggcatcagcctggtggcagtactgcgcaccggcccgaccgaaagcctgattcaggggctgcatcagtccgtctt c ccgcgcagaaaaacgcatcggcctggtattgttcggtaagggcaatatcggttcccgttggctggaactgttcgcc gtgagcagagcacgctttcggcacgtaccggctttgagtttgtgctggcaggtgtggtggacagccgccgcagc ctgttgagctatgacgggctggacgccagccgcgcgttagccttcttcaacgatgaagcggttgagcaggatgaa gagtcgttgttcctgtggatgcgcgcccatccgtatgatgatttagtggtgctggacgttaccgccagccagcagctt gctgatcagtatcttgatttcgccagccacggtttccacgttatcagcgccaacaaactggcgggagccagcgaca gcaataaatatcgccagatccacgacgccttcgaaaaaaccgggcgtcactggctgtacaatgccaccgtcggt gcgggcttgccgatcaaccacaccgtgcgcgatctgatcgacagcggcgatactattttgtcgatcagcgggatctt ctccggcacgctctcctggctgttcctgcaattcgacggtagcgtgccgtttaccgagctggtggatcaggcgtggc agcagggcttaaccgaacctgacccgcgtgacgatctctctggcaaagacgtgatgcgcaagctggtgattctgg cgcgtgaagcaggttacaacatcgaaccggatcaggtacgtgtggaatcgctggtgcctgctcattgcgaaggcg gcagcatcgaccatttctttgaaaatggcgatgaactgaacgagcagatggtgcaacggctggaagcggcccgc gaaatggggctggtgctgcgctacgtggcgcgtttcgatgccaacggtaaagcgcgtgtaggcgtggaagcggt gcgtgaagatcatccgttggcatcactgctgccgtgcgataacgtctttgccatcgaaagccgctggtatcgcgata accctctggtgatccgcggacctggcgctgggcgcgacgtcaccgccggggcgattcagtcggatatcaaccgg ctggcac agttgttgtaa

Sequence No. 16 (pntA) [139] atgcgaattggcataccaagagaacggttaaccaatgaaacccgtgttgcagcaacgccaaaaacag tggaacagctgctgaaactgggttttaccgtcgcggtagagagcggcgcgggtcaactggcaagttttgacgata aagcgtttgtgcaagcgggcgctgaaattgtagaagggaatagcgtctggcagtcagagatcattctgaaggtca

Petition 870170048524, of 7/12/2017, p. 38/55

35/38 atgcgccgttagatgatgaaattgcgttactgaatcctgggacaacgctggtgagttttatctggcctgcgcagaatc cggaattaatgcaaaaacttgcggaacgtaacgtgaccgtgatggcgatggactctgtgccgcgtatctcacgcg cacaatcgctggacgcactaagctcgatggcgaacatcgccggttatcgcgccattgttgaagcggcacatgaat ttgggcgcttctttaccgggcaaattactgcggccgggaaagtgccaccggcaaaagtgatggtgattggtgcgg gtgttgcaggtctggccgccattggcgcagcaaacagtctcggcgcgattgtgcgtgcattcgacacccgcccgg aagtgaaagaacaagttcaaagtatgggcgcggaatttctcgagctggattttaaagaggaagctggcagcggc gatggctatgccaaagtgatgtcggacgcgttcatcaaagcggaaatggaactctttgccgcccaggcaaaaga ggtcgatatcattgtcaccaccgcgcttattccaggcaaaccagcgccgaagctaattacccgtgaaatggttgact ccatgaaggcgggcagtgtgattgtcgacctggcagcccaaaacggcggcaactgtgaatacaccgtgccggg tgaaatcttcactacggaaaatggtgtcaaagtgattggttataccgatcttccgggccgtctgccgacgcaatcctc acagctttacggcacaaacctcgttaatctgctgaaactgttgtgcaaagagaaagacggcaatatcactgttgatt ttgatgatgtggtgattcgcggcgtgaccgtgatccgtgcgggcgaaattacctggccggcaccgccgattcaggt atcagctcagccgcaggcggcacaaaaagcggcaccggaagtgaaaactgaggaaaaatgtacctgctcac cgt ggcgtaaatacgcgttgatggcgctggcaatcattctttttggctggatggcaagcgttgcgccgaaagaatttc ttgggcacttcaccgttttcgcgctggcctgcgttgtcggttattacgtggtgtggaatgtatcgcacgcgctgcataca ccgttgatgtcggtcaccaacgcgatttcagggattattgttgtcggagcactgttgcagattggccagggcggctgg gttagcttccttagttttatcgcggtgcttatagccagcattaatattttcggtggcttcaccgtgactcagcgcatgctga aaatgttccgcaaaaattaa

Sequence No. 17 (pntB) [140] atgtctggaggattagttacagctgcatacattgttgccgcgatcctgtttatcttcagtctggccggtctttcg aaacatgaaacgtctcgccagggtaacaacttcggtatcgccgggatggcgattgcgttaatcgcaaccatttttgg accggatacgggtaatgttggctggatcttgctggcgatggtcattggtggggcaattggtatccgtctggcgaaga aagttgaaatgaccgaaatgccagaactggtggcgatcctgcatagcttcgtgggtctggcggcagtgctggttgg ctttaacagctatctgcatcatgacgcgggaatggcaccgattctggtcaatattcacctgacggaagtgttcctcgg tatcttcatcggggcggtaacgttcacgggttcggtggtggcgttcggcaaactgtgtggcaagatttcgtctaaacc attgatgctgccaaaccgtcacaaaatgaacctggcggctctggtcgtttccttcctgctgctgattgtatttgttcgcac ggacagcgtcggcctgcaagtgctggcattgctgataatgaccgcaattgcgctggtattcggctggcatttagtcg cctccatcggtggtgcagatatgccagtggtggtgtcgatgctgaactcgtactccggctgggcggctgcggctgc gggctttatgctcagcaacgacctgctgattgtgaccggtgcgctggtcggttcttcgggggctatcctttcttacattat gtgtaaggcgatgaaccgttcctttatcagcgttattgcgggtggtttcggcaccgacggctcttctactggcgatgat caggaagtgggtgagcaccgcgaaatcaccgcagaagagacagcggaactgctgaaaaactcccattcagtg

Petition 870170048524, of 7/12/2017, p. 39/55

36/38 atcattactccggggtacggcatggcagtcgcgcaggcgcaatatcctgtcgctgaaattactgagaaattgcgcg ctcgtggtattaatgtgcgtttcggtatccacccggtcgcggggcgtttgcctggacatatgaacgtattgctggctga agcaaaagtaccgtatgacatcgtgctggaaatggacgagatcaatgatgactttgctgataccgataccgtactg gtgattggtgctaacgatacggttaacccggcggcgcaggatgatccgaagagtccgattgctggtatgcctgtgct ggaagtgtggaaagcgcagaacgtgattgtctttaaacgttcgatgaacactggctatgctggtgtgcaaaacccg aa ctgttcttcaaggaaaacacccacatgctgtttggtgacgccaaagccagcgtggatgcaatcctgaaagctctgt

Sequence No. 18 (PyC) [141] ttgcccatttccaagatactcgttgccaatcgctctgaaatagccatccgcgtgttccgcgcggccaacga gcttggaataaaaacggtggcgatctgggcggaagaggacaagctggcgctgcaccgcttcaaggcggatga gagttatcaggtcggccgcggtccgcatctggcccgcgatctcgggccgatcgagagctatctgtcgatcgacga ggtgatccgggtcgccaagctttcgggtgccgacgccattcaccccggttacggcctcttgtccgaaagcccgga atttgtcgatgcctgcaacaaggccgggatcatcttcatcggcccgaaggccgatacgatgcgccagctcggcaa caaggtcgcggcgcgcaatctggcgatctcggtcggcgtgcccgtcgtgccggcgaccgagccgctaccggac gatatggccgaagtggcgaagatggcggcagcaatcggctatcccgtcatgctgaaagcctcctggggcggcg gcggccgcggcatgcgcgtcatccgcgccgaagccgatctcgcccgcgaggtgacggaggccaagcgcgag gcgatggccgccttcggcaaggacgaggtctatctggaaaagctggtcgagcgcgcccgccacgtcgaaagcc agatcctcggcgacacacacggcaatgtcgtgcatctgttcgagcgcgactgctcgatccagcgccgcaaccag aaggtcgtcgagcgcgcgcccgcgccctacctctcagaggcgcagcgccaggaactcgccgcctattcgctga agatcgcagcggcgaccaactatatcggcgccggcaccgtcgaatatctgatggatgccgataccggcaaattct g acttcatcgaggtcaatccgcgcatccaggtcgagcacacggtgaccgaagtcgtcaccggtatcgacatcgtca gcgcagatccacatcctcgacggcgctgcgatcggcacgccggaatcgggcgttcccgctcaggccgatatc cggctcaacggccatgcgctgcaatgccgcatcaccaccgaagatcccgaacacaatttcattccggactacgg ccgcatcaccgcctatcgctcggcttccggcttcggcatccggcttgacggcggcacctcctattccggcgccatca ttacccgttattatgatccgctgctcgtcaaggtcacggcctgggcgccgaacccgtccgaagcgatttcccgtatg gaccgggcgctgcgcgaatttcgcatccgcggcgtcgccaccaacctgaccttcctcgaagcgatcatcggccat ccgaagttccgcgacaacagctacaccacccgcttcatcgacaccacgccggaactcttccagcaggtcaagc gccaggaccgcgcgacgaagctcttgacctatctcgccgatgtcaccatcaatggccatcccgaggccaaggac aggccgaagcccctcgaaaacgccgccaagccggtggtgccctatgccaatggcaacggggtcaaggatggc acgaagcagctgctcgacacgctcggcccgaagaaattcggcgaatggatgcgcaatgagaagcgcgtgcttc tgaccgatacgacgatgcgcgacgcccaccagtcgctgctcgccactcgcatgcgcacctatgacatcgccagg

Petition 870170048524, of 7/12/2017, p. 40/55

37/38 atcgccggcacctatgcgcacgcgctgccgaatctcttgtcgctcgaatgctggggtggcgccaccttcgacgtctc catgcgcttcctcaccgaagatccgtgggagcggctggcgctgatccgcgagggcgcgccgaacctgctcctgc aaatgctgttgcgcggcgccaacggcgtcggctacaccaactatcccgacaatgtcgtcaaatatttcgtccgcca ggcggccagaggcggcatcgatcttttccgcgtcttcgactgcctgaactgggtcgagaacatgcgggtgtcgatg gatgcgattgccgaggagaacaagctctgcgaggcggcgatctgctacaccggcgatatcctcaattccgcccg cccgaaatacgacctgaaatactataccgaccttgccgtcgaactcgagaaggccggcgcccatatcatcgcag tcaaggatatggcgggtctgttgaagccggcggcggcgaaggtgctgttcaaggcgctgcgcgaagcgaccgg cctgccgatccacttccacacgcatgacacttcgggcatcgcggccgcgaccgtccttgccgcggtcgaagccg gtgtcgatgccgtcgatgcggcgatggatgcgctttccggcaatacctcgcagccttgtctcggctcgatcgtcgag gcgctctccggctccgagcgcgatccgggcctcgatccggaatggattcgccgtatctcgttctattgggaagcggt gcgcaaccagtatgccgccttcgaaagcgacctcaaggggccggcctcggaagtctatctgcatgaaatgccgg gcggccagttcaccaatctcaaggagcaggcccgctcgctcggtctcgagacccgctggcatcaggtggcgca ggcctatgccgacgccaaccagatgttcggcgatatcgtcaaggtgacgccctcctccaaggtggtcggcgacat ggcgctg atgatggtgtcccaggatctgacggtcgccgacgtcgtcagccccgagcgcgaagtctccttccccga atcggtggtgtcgatgctgaagggcgatctcggccagccgccgccgggatggccggcagcacttcagaaaaag gcactgaagggcgaaaagccctatacggtgcgtcccggctcgctgctgaaggaagccgatctcgatgccgagc gcaaggtcatcgagacgaagctggagcgcgaggtcagcgacttcgaatttgcctcctatctgatgtatccgaaggt cttcaccgactttgcgctcgcctccgatacctatggcccggtctcggtgctgccgacgcctgcctatttctacgggctg gccgacggcgaggagctgtttgccgatatcgaacgaggcaagacgctcgtcatcgtcaatcaggcaatgagcg ccaccgacagccagggcatggtcaccgtcttcttcgaactcaacggccagccgcgccgcatcaaggtgccgga ccgggcccatggggcgacgggtgcggccgtgcgccgcaaggccgagcccggtaatggtgctcatgtcggtgcg ccgatgcccggcgtcatcagccgcgtcttcgcctcatccggccaagccgtcagcgccggtgatgtgctcgtctcca tcgaagcgatgaagatggaaacggcgatccatgcggaaaaggatggaacggttgccgaaattctcgtcaaggc cggcgatcagattgatgccaaggacctgcttgtcgtctacgccgcttga

Sequence No. 19 (stha) [142] atgccacattcctacgattacgatgccatagtaataggttccggccccggcggcgaaggcgctgcaatg ggcctggttaagcaaggtgcgcgcgtcgcagttatcgagcgttatcaaaatgttggcggcggttgcacccactggg gcaccatcccgtcgaaagctctccgtcacgccgtcagccgcattatagaatttaatcaaaacccactttacagcga ccattcccgactgctccgctcttcttttgccgatatccttaaccatgccgataacgtgattaatcaacaaacgcgcatg cgtcagggattttacgaacgtaatcactgtgaaatattgcagggaaacgctcgctttgttgacgagcatacgttggc gctggattgcccggacggcagcgttgaaacactaaccgctgaaaaatttgttattgcctgcggctctcgtccatatc

Petition 870170048524, of 7/12/2017, p. 41/55

38/38 atccaacagatgttgatttcacccatccacgcatttacgacagcgactcaattctcagcatgcaccacgaaccgcg ccatgtacttatctatggtgctggagtgatcggctgtgaatatgcgtcgatcttccgcggtatggatgtaaaagtggat ctgatcaacacccgcgatcgcctgctggcatttctcgatcaagagatgtcagattctctctcctatcacttctggaaca gtggcgtagtgattcgtcacaacgaagagtacgagaagatcgaaggctgtgacgatggtgtgatcatgcatctga agtcgggtaaaaaactgaaagctgactgcctgctctatgccaacggtcgcaccggtaataccgattcgctggcgtt acagaacattgggctagaaactgacagccgcggacagctgaaggtcaacagcatgtatcagaccgcacagcc acacgtttacgcggtgggcgacgtgattggttatccgagcctggcgtcggcggcctatgaccaggggcgcattgc cgcgcaggcgctggtaaaaggcgaagccaccgcacatctgattgaagatatccctaccggtatttacaccatccc ggaaatcagctctgtgggcaaaaccgaacagcagctgaccgcaatgaaagtgccatatgaagtgggccgcgc ccagtttaaacatctggcacgcgcacaaatcgtcggcatgaacgtgggcacgctgaaaattttgttccatcgggaa acaaaagagattctgggtattcactgctttggcgagcgcgctgccgaaattattcatatcggtcaggcgattatgga acagaaaggtggcggcaacactattgagtacttcgtcaacaccacctttaactacccgacgatggcggaagcct atcgggtagctgcgttaaacggtttaaaccgcctgttttaa

Sequence No. 20 (ydhU) [143] atgaacccgtcgcaacatgctgaacagtttcagagccagttagcgaactatgtgccacagttcactcccg aattttggccggtgtggttgatcattgccggagtattgctggttgggatgtggttggtgctggggctgcatgccttgcttc gtgctcgtggcgtgaagaaatcagccaccgatcatggtgagaagatttatctttacagcaaagcggtcagattatg gcactggtcgaatgcgttactctttgtattgttgctggccagtgggctgataaatcactttgcgatggtgggcgcaact gcggttaaaagtctggttgcggtgcatgaagtttgcggatttttgttactggcatgctggctcggctttgtgctgatcaat gccgttggggataatggtcaccactatcgcattcgtcgtcaggggtggctggaacgagcggcaaaacaaacgcg attttatttgtttggcattatgcagggggaagaacatcctttcccggcaacaacccagtctaaatttaatcccttacagc aggtcgcctatgttggtgtcatgtatggattgctgccgttgttactattgacggggctgctgtgtctctatccgcaagccg tgggagatgtgtttcctggcgtaagatactggttattgcagacacattttgctctggcatttataagcctcttttttatcttcg cup gtcatctttatctttgcaccacggggcgtacgccacacgaaacctttaaaagcatggtcgatggctatcaccggcac

Petition 870170048524, of 7/12/2017, p. 42/55

1/6

Claims (30)

1. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS characterized by being a fermentative process for the bacterial production of amino acids, more specifically the amino acid L-methionine, through fermentative techniques and use of water glycerin from biodiesel production. 2. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claim 1 characterized by the fact that it involves applying genetic engineering to obtain a bacterial strain that is superproductive and excretory of methionine. 3. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claim 2 characterized by having the deletion of the metJ gene, generating the strain NB1701, which codes for the transcription factor that suppresses the expression of the metA, metB, metC and metL genes, essential for the production of L-methionine. 4. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM BIOFUEL PRODUCTION WASTE according to claim 2 and 3 characterized by having the metA gene, resulting in the strain NB1702, which is downregulated by methionine and S-adenosylmethionine, so that a mutated metA ^fd isoform is overexpressed avoiding negative regulation. 5. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 4 characterized by having the deleted metI gene of the strain NB1702, which codes for an importer of L-methionine, from so the strain generated with this mutation is unable to transport methionine from the medium Petition 870170048524, of 7/12/2017, p. 43/55 2/6 extracellular to the cytosol, differing from the cited patents, resulting in strain NB1703. 6. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 5 characterized by having the lysA gene deleted from the strain 1703 resulting in strain NB1704, the lysA gene codes for the protein diaminopimelate decarboxylase, involved in the last stage of the L-lysine production pathway. 7. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 6 characterized by having deleted the strain 1704 the pta gene, which codes for the enzyme phosphate acetyltransferase, associated with the acetate production pathway using acetyl-CoA as a precursor, resulting in the strain named NB1705. 8. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 7 characterized by having deleted from the 1705 strain the ackA gene that codes for the enzyme acetate kinase, associated with the production pathway acetate using acetyl phosphate as a precursor, resulting in strain NB1706. 9. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 8 characterized by having deleted from the 1706 strain the arcA gene which codes for the transcription factor which, together with arcB, acts as a global negative regulator of the citric acid cycle, suppressing it under conditions of anaerobia or microoxygenation, resulting in strain NB1707. 10. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 9 characterized by having deleted from the 1707 strain the arcB gene that allows the NB1708 strain to be able to maintain the cycle of the Petition 870170048524, of 7/12/2017, p. 44/55 3/6 functional citric acid under limited oxygenation conditions, keeping the metabolic flow constant for the production of L-methionine. 11. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 10 characterized by having deleted from the 1708 strain the ptsG gene that codes for the IIBC component of the specific enzyme PTS glucose, enzyme this involved in the process of assimilation of glucose as a carbon source, resulting in strain NB1709. 12. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 11 characterized by having inserted into the genome of the strain 1709 the construction by the constitutive synthetic promoter J23118 containing the glpF gene, glycerol transporter for the intracellular medium, together with the glpK ^fd gene, which promotes glycerol phosphorylation, forming glycerol-3 phosphate, resulting in strain NB1710. 13. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 12 characterized by having inserted into the genome of the strain 1710 the construction by the constitutive synthetic promoter J23118 containing the pntA and pntB genes, which convert NADP + and NADH into NADPH and NAD +, respectively, were inserted into the genome together with the sthA gene, which converts NAD + and NADPH into NADH and NADP +, resulting in strain NB1711. 14. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 13 characterized by having inserted into the genome of the strain 1711 the construction by the constitutive synthetic promoter J23118 containing the glyA gene, to increase its expression causing the transfer of a methyl group to the tetrahydrofolate molecule; that together with the aspC gene, which codes for aspartate aminotransferase protein and promotes the formation of oxaloacetate from aspartate; resulting in strain NB1712. Petition 870170048524, of 7/12/2017, p. 45/55 4/6 15. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 14 characterized by having inserted into the genome of the strain 1712 the construction by the constitutive synthetic promoter J23118 of the yjeH gene, described as an exporter of L-methionine for the extracellular medium, as well as the pyc gene, of Rizhobium etli, which codes for the pyruvate carboxylase enzyme, promoting the formation of oxaloacetate directly from pyruvate ; resulting in strain NB1713. 16. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 15 characterized by having inserted into the genome of the strain 1713 the construction by the constitutive synthetic promoter J23118 of the ftsA and ftsZ genes, involved in the formation of the ring structure responsible for maintaining the cell division process even when there is a signal to stop proliferation caused mainly by cell-cell contact; resulting in strain NB1714. 17. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 16 characterized by having inserted in the genome of strain NB1714 the construction by the constitutive synthetic promoter J23118 which encodes the metK * gene methionine adenosyltransferase enzyme with reduced activity; thus resulting in strain NB1715. 18. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 15 characterized by having inserted in the genome of strain NB1713 the construction by the synthetic promoter constitutive J23118 the gene cysE, containing a mutation which encodes the serine acetyltransferase enzyme; as well as the metH gene encoding the methionine synthase enzyme; resulting in strain NB1716. 19. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to Petition 870170048524, of 7/12/2017, p. 46/55 5/6 with claims 2 to 18, characterized in that it deleted the thrB gene from the NB1716 strain, which encodes the enzyme homoserine kinase, which consumes Lhomoserin as a precursor for the synthesis of threonine; as well as the insertion of the metK * gene that encodes the methionine adenosyltransferase enzyme with reduced activity; thus resulting in strain NB1717. 20. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 19 characterized in that the ftsA, ftsZ and metH genes were inserted in the genome of the NB1717 strain. , resulting in strain NB1718. 21. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 2 to 20 characterized by having inserted the metK gene into the genome of the NB1718 strain, resulting in the metK gene. NB1719. 22. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS characterized by being a fermentative process that uses at least one of the strains characterized in claims 3 to 21. 23. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claim 22 characterized by having a downstream process that results in a product with high purity. 24. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 22 and 23 characterized by having a final product with high purity in liquid form. 25. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 22 and 23 characterized by having a final product with high purity in solid form. Petition 870170048524, of 7/12/2017, p. 47/55 6/6 26. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claim 22 characterized by using residual glycerinated water from the biodiesel process as a carbon source. 27. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claim 22 characterized by using as a carbon source residues from the production of ethanol from sugarcane. 28. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claim 22 characterized by using as a carbon source residues from the production of ethanol from corn. 29. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 22, 26, 27 and 28 characterized by using as a carbon source mixture of at least two of the mentioned carbon sources. 30. FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONIN FROM WASTE FROM THE PRODUCTION OF BIOFUELS according to claims 22, 26, 27 and 28 characterized by using as a carbon source mixture of the three mentioned carbon sources. Petition 870170048524, of 7/12/2017, p. 48/55 1/1 FERMENTATIVE PROCESS FOR THE PRODUCTION OF L-METHIONINE A FROM BIOFUEL PRODUCTION WASTE