BG65066B1 - CD19xCD3 SPECIFIC POLYPEPTIDES AND USE THEREOF - Google Patents

Abstract

Described are novel single-chain malfunctional polypeptides comprising at least two binding sites specific for the CD19 and CD3 antigen, respectively. Further provided are polypeptides, wherein the above-described polypeptide comprises at least one further domain, preferably of pre-determined function. Furthermore, polynucleotides encoding said polypeptides as well as to vectors comprising said polynucleotides and host cells transformed therewith and their use in the production of said polypeptides are described. In addition, compositions, preferably pharmaceutical and diagonostic compositions are provided comprising any of the afore-described polypeptides, polynucleotides or vectors. Described is also the use of the afore-mentioned polypeptides, polynucleotides and vectors for the preparation of pharmaceutical compositions for immunotherapy, preferably against B-cell malignancies such as non-Hodgkin lymphoma.

Description

Technical field

The present invention relates to novel single-stranded multifunctional polypeptides comprising at least two binding sites specific for the CD19 and CD3 antigens, respectively. Polypeptides are also provided, the polypeptide described below comprising at least one additional domain, preferably with predetermined functions. In addition, the invention also relates to polynucleotides encoding these polypeptides, as well as vectors that include said polynucleotides and host cells transformed with said polynucleotides, and their use in the production of said polypeptides. In addition, compositions, preferably pharmaceutical and diagnostic compositions including any of the polypeptides, polynucleotides and vectors described above, are also provided for the preparation of pharmaceutical compositions for immunotherapy, preferably against B-cell malignancies such as non-Hodgkin lymphoma.

A number of documents are cited in the text of the present invention. Each of the documents cited herein (including manufacturer's descriptions, instructions, etc.) are incorporated herein by reference; nevertheless, none of the documents cited is considered to be the true level of the present invention.

BACKGROUND OF THE INVENTION

Despite the importance of medicine, studies on B-cell-mediated diseases, such as non-Hodgkin's lymphoma, have resulted in only a small amount of data used in the clinic, and conventional approaches to treat such diseases remain annoying and unpleasant, and / or there is a high risk from the recurrence of the disease. For example, although high-dose chemotherapy as a primary treatment for severe non-Hodgkin lymphoma may not improve survival, approximately 50% of patients still die from the disease [2 - 4]. In addition, mild non-Hodgkin's lymphoma - similar chronic lymphatic leukemia and cell lymphoma are still incurable. This stimulates the search for alternative strategies such as immunotherapy. Antibodies directed against cell surface molecules defined by a CD antigen represent the only opportunity for the development of therapeutic agents.

Expression of some CD antigens is highly restricted to specific lympho-hematopoietic cell lines and over the past few years, antibodies directed against lymphoid-specific antigens have been used to develop treatments that are effective either in vitro or in animal models [513]. In this regard, CD19 has proven to be an extremely useful target. CD 19 is expressed throughout the B line from pro B cell to mature B cell, does not change, is uniformly expressed in all lymphoma cells and is absent from stem cells [8,14]. An interesting modification is the administration of a bispecific antibody with one specificity for CD19 and the other for the CD3 antigen on T cells. However, the bispecific antibodies provided in this way suffer from low T-cell cytotoxicity and lack of costimulatory agents in order to present satisfactory biological activity.

Therefore, a technical problem emphasizing the present invention is to provide tools and methods useful in treating B-cell-mediated diseases as various forms of non-Hodgkin lymphoma. The solution to such a technical problem is achieved by providing the embodiments described in the claims.

Accordingly, the present invention relates to a single-stranded multifunctional polypeptide comprising:

(a) one first domain comprising an immunoglobulin chain binding site or an antibody specifically recognizing the CD19 antigen; and (b) a second domain comprising an immunoglobulin chain binding site or an antibody specifically recognizing the CD3 antigen.

The terms "first domain" and "second domain", in accordance with the present invention, mean that one binding site is directed against rap B cell marker CD 19, which is uniformly expressed in the majority of malignant B cells and the other the binding site is directed against the CD3 antigen of human T cells.

The term "binding site" as used in accordance with the present invention refers to a domain that includes a three-dimensional structure capable of specifically binding to an epitope such as native antibodies without scFv fragments or one of their respective immunoglobulin chains, preferably the V _H chain . Thus, said domain may include the V _H and / or V _L domain of an antibody or immunoglobulin chain, preferably at least the V _H domain. On the other hand, said binding sites contained in the polypeptide of the invention may include at least one complementary determinant region (CDR) of an antibody or immunoglobulin chain recognizing CD19 and CD3 antigens respectively. In view of this, it should be noted that the domains of the binding sites present in the polypeptide of the invention may originate not only from antibodies but also from other CD 19 or CD3 binding proteins, such as naturally occurring surface proteins. receptors or ligands. According to the invention, said binding site is included in a domain.

The term "multifunctional polypeptide" as used herein refers to a polypeptide comprising at least two amino acid sequences originating from different sources, i.e. from two different molecules, optionally originating from different species, wherein at least two of these sources characterize the site of the connection. Accordingly, said binding sites characterize the functions or at least some functions of said multifunctional peptide. Such polypeptides include, for example, bispecific (bsc) single-chain antibodies.

The term "single-stranded" as used in accordance with the present invention means that said first and second domains of the polypeptide are covalently linked, preferably in the form of a collinear amino acid sequence encoded by a nucleic acid molecule. CD 19 marks an antigen that is expressed in the B lineage, both in pro B cells and in mature B cells, does not change, is uniformly expressed in all lymphoma cells and is absent from stem cells [8,14].

CD3 indicates an antigen that is expressed on T cells as part of the multimolecular T-cell receptor complex and which consists of three different chains of Coepsilon, CoDelta and CDraMa. The accumulation of CD3 on T cells, for example through immobilized antiCD3 antibodies, results in T-cell activation similar to T cell receptor binding but regardless of its clone-specificity. In fact, most anti-CD3 antibodies recognize COepsilon chains.

Antibodies that specifically recognize the CD19 or CD3 antigen have been described in the prior art, for example [24,25 and 43], respectively, and can be regenerated by conventional methods known in the art.

Non-single-stranded non-single-stranded CD19 x CD3 antibodies that re-direct T-cell cytotoxicity to lymphoma cells in an MHC-independent manner have already been shown to be effective in vitro [5, 6, 9-11, 13,43] in animals models [7,28], as in some pilot clinical trials [12,29, 30]. So far, these antibodies have been constructed by hybrid-hybridoma techniques, by covalent binding of monoclonal antibodies [31] or by a diabody approach [43]. In-depth clinical studies have been conducted due to the fact that these antibodies have low biological activity, so higher doses need to be administered and this administration of antibodies alone does not have a beneficial therapeutic effect. Furthermore, access to clinical material is restricted.

Without being bound by any particular theory, it is believed that by using a bispecific antibody-like format, as defined above, the polypeptides thus generated, such as bispecific CD 19 x CD3 antibodies, are typically capable of destroying CD19-positive target cells by collection of cytotoxic T lymphocytes without any need for T cell pre- and / or co-stimulation. This is in sharp contrast to all known bispecific CD19 x CD3 antibodies produced according to other molecular formats and is generally independent of the specific features of the CD19 or CD3 antibody used in the construction, for example of the bispecific single chain antibody. Independence from T-cell pre- and / or co-stimulation can significantly contribute to the extremely high cytotoxicity mediated by the polypeptide of the invention, as explained by the specific bispecific CD 19 xCD3 antibody described in the embodiments.

Another advantageous feature of the polypeptide of the invention is that, because of its small, relatively compact structure, it is easy to produce and purify, thus overcoming problems of low yield, the occurrence of a product-defined disease, or labor-intensive processes of purification [15-19] reported for CD19 x CD3 specific antibodies produced by hybrid-hybridoma, by chemical coupling or by renaturation (bacterial inclusion bodies). In the following, the utility and unexpected effects of the polypeptide of the invention will be contemplated in a non-limiting manner in light of the appended claims, including some of the preferred embodiments of the invention set forth below, illustrating the broad scope of the present invention.

In accordance with the present invention, a eukaryotic expression system is being developed that is developed for the production of recombinant bispecific single-chain antibodies [1] in order to generate recombinantly bispecific CD 19 x CD3 antibody through the expression of CHO cells. The fully functional antibody is substantially purified from the culture supernatant by its C-terminal histidine tag on a Ni-NTA chromatographic column. The specific binding to CD19 and CD3 is demonstrated by FACS analysis. The resulting bscCD19 X CD3 (bispecific single-stranded CD 19 x CD3) molecule of the invention exhibits some unexpected properties:

- induces high lymphoma targeting Cellular cytotoxicity in vitro and in vivo. Even at very low concentrations of 10-100 pg / ml and low values of E (effector): T (target) ratio of 5: 1 and 2.5: 1, significant specific lymphoma cell line lysis is observed. In addition, 3 micro g to 10 micro g bscCD 19 X CD3 molecules of the invention on voluntary use show a clear and significant improvement in medical status. Compared to the previously published CD 19 X CD3 antibodies produced by hybrid hybrid techniques or by diabody approach (which also represent a different format) that exhibit cytotoxic activity within a few nanograms / ml or even micro g / ml, bscCD19 X CD3 the antibody of the invention appeared to be much more effective [5-7, 27, 43] as documented, for example, in the accompanying embodiments 4, 5 and 7.

- Even low concentrations of bscCD 19 X CD3 of the invention are capable of inducing rapid cytotoxicity directed against lymphoma (after 4 h) at low E: T ratios without the need for any prior T-cell stimulation. In contrast, conventionally CD 19 X CD3 bispecific antibody [5-7,27] does not exhibit cytotoxic activity under these conditions (namely, without pre-T cell stimulation, low E: T ratio) even at high concentrations up to 3,000 ng / ml. Although induction of cytotoxic activity without prior stimulation has also been reported, in the case of another conventional CD 19 X CD3 antibody, this effect is only achieved at high concentrations and high E: T ratio (100 ng / ml, 27: 1) [ 9] compared to the bscCD 19 X CD3 of the invention (100 pg / ml, 2.7: 1). The cytotoxic effect of this antibody is also observed only after one day of pre-stimulation with the specific antibody itself, wherein the bscCD 19 X CD3 of the invention induces lymphoma-directed cytotoxicity after four hours. To the best of the inventors of the invention, such rapid and specific cytotoxic activity of T cells, at such low concentrations and E: T ratios, have not been observed for other bispecific antibodies that have been used so far. However, anti-p185HE1 <2 / anti-CD3 bispecific F (ab) ₂ antibody has been shown to induce cytotoxic activity at similar concentrations as bscCD19 X CD3 of the invention, which requires 24 h pre-stimulation with IL-2 [32]. Therefore, the bscCD1 9 X CD3 antibody of the invention exhibits unique cytotoxic properties that distinguish this molecule from other bispecific antibodies that have already been described.

bscCD19 X CD3 of the invention mediates cytotoxic effects that are antigen specific, as demonstrated by the following facts:

- this antibody is unable to lyse plasmacytoma cell lines NC1 and L363, which are cell lines from B lines that do not express the CD19 antigen; and

- cytotoxicity against lymphoma cells could be blocked by the parent anti-CD19 antibody HD37 (HD37 antibody is derived from HD37 hybridoma [22]).

Blocking the perforin synthetic pathway by calcium deprivation via EGTA completely blocks the cytotoxicity mediated by bscCD 19 X CD3, suggesting that specific lysis is more a T-cell-mediated effect than a direct effect of the antibody itself.

Taking all this into consideration, the bscCD 19XCD3 antibody constructed according to the general findings of the invention exceeds the CD19XCD3 bispecific antibodies described so far, given its significantly higher biological activity as well as its rapid and easy production, in this way, sufficient quantities of high quality clinical products are obtained.

Therefore, the bscCD 19XCD3 molecules of the invention are expected to be suitable candidates to demonstrate the therapeutic advantage of bispecific antibodies in the treatment of Cell-mediated diseases such as non-Hodgkin lymphoma in clinical trials.

In a preferred embodiment of the polypeptide of the invention, said domains are linked via a polypeptide linker. Said linker is located between said first and said second domain, wherein said polypeptide linker preferably comprises multiple hydrophilic amino acids with peptide bonds, and binds the N-terminal end of said first domain and the C terminal end of said second domain.

In another preferred embodiment of the invention, said first and / or second domain of the polypeptide described above resembles or corresponds to the V _H and V _L region of a naturally occurring antibody. The antibody that provides the binding site for the polypeptide of the invention may be, for example, a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a humanized antibody, a bispecific antibody, a synthetic antibody, an antibody fragment such as Fab, Fv or scFv fragments, and the like. or chemically modified derivatives of any of these substances. Monoclonal antibodies can be prepared, for example, by techniques as originally described by Kohler and Milstein, Nature 256 (1975), 495, and Galfreq Meth. Enzymol. 73 (1981), 3, which include the fusion of murine myeloma cells to mammalian spleen cells immunized with modifications developed in the prior art. In addition, antibodies or fragments thereof for the abovementioned antigens may be obtained using methods described in, for example, Harlow and Lane "Antibodies, A Labiratory Manual", CHS Press, Cold Sping Harbor, 1988. Antibodies may be are obtained from different species, including humans. When derivatives of said antibodies are obtained by the phage display technique, surface plasmon resonance, as used in the BIAcore system, can be used to increase the efficiency of phage antibodies that bind to an epitope of a CD 19 or CD3 antigen (Schier, Human Antibodies Hybridomas 7 (1996), 97-105; Malmborg, J. Immunol. Methods 183 (1995), 7-13), The production of chimeric antibodies is described, for example, in WO 1989/009622. Methods for producing humanized antibodies are described, for example, in EP-A1 0 239 400 and WO 1990/007861. Another source of antibodies for use according to the present invention are the so-called xenogeneic antibodies. The general principle for the production of xenogenic antibodies, such as human antibodies in mice, is described in, for example, WO 1991/010741, WO 1994/002602, WO 1996/034096 and WO 1996/033735.

Antibodies for use according to the present invention or their corresponding immunoglobulin chains can be further modified using conventional techniques well known in the art, for example, using amino acid deletions, insertions, substitutions, additions and / or recombinations and / or whatever and any other modifications known in the art, whether single or combined. Methods for introducing such modifications into the DNA sequence emphasizing the amino acid sequence of an immunoglobulin chain are well known in the art; see, for example, Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (1989) Ν. Y. These modifications are preferably carried out at the nucleotide level.

In another preferred embodiment of the invention, at least one of the domains mentioned in the polypeptides described above is a single-stranded fragment of the variable region of the antibody.

As is well known, Fv, the minimal antibody fragment that contains the complete antigen recognition and binding site, consists of a heavy and one light chain variable domain dimer (V _H and V _L ) in a non-covalent association. In this configuration, this corresponds to the CDRs detected in the native three complementary determinant regions (CDRs) of each variable domain to define a single antigen binding site of the surface of the V _H -V _L dimer Collectively, the six CDRs confer antigen-binding specificity on the antibody. The framework (FRs) limiting CDRs has a tertiary structure that is essentially conserved in native immunoglobulins of species as diverse as human and mouse. These FRs serve to keep CDRs in their proper orientation. Constant domains are not required for binding functions, but may help stabilize the V _H V _L interaction. Even a single variable domain (or half of Fv comprising only three CDRs specific to one antigen) has the ability to recognize and bind the antigen, although usually at a lower affinity than one whole binding site (Painter, Bochem. 11 (1972 ), 1327-1337). Therefore, said domain of the polypeptide binding site of the invention may be a pair of V _H -V _L , V _H -V _H or V _L -V _L domains, whether from one or different immunoglobulins. The order of the V _H and V _L domains in the polypeptide chain is not decisive for the present invention, the order of the above domains can be reversed, usually without losing any function. However, it is important that the V _H and V _L domains are arranged so that the antigen binding site can be folded properly.

In one preferred embodiment of the polypeptide of the invention, said domains are arranged in the order V _L CD19V _H CD19- V _H CD3-V _L CD3, wherein "V _L " and "V _H " denote the light and heavy chains of the variable domain of specific anti-CD 19 and antiCD3 antibodies.

As discussed above, said binding sites are preferably linked via a flexible linker, preferably via a polypeptide linker located between said domains, said polypeptide linker comprising multiple, hydrophilic, peptide-linked amino acids of sufficient length to span The C-terminal end and one of said domains comprising the binding sites and the N-terminal end of the other of said domains including said binding sites when the polypeptide of the invention it undergoes a conformation suitable for bonding when in aqueous solution. Preferably said polypeptide linker comprises a plurality of glycine, alanine and / or serine residues. Preferably, said polypeptide linker includes multiple sequences of amino acid sequence. Typically, the polypeptide linker includes 10 to 15 amino acids, although polypeptide linkers over 15 amino acids may also work well. In a preferred embodiment of the invention, said polypeptide linker comprises 1 to 5 amino acid residues.

In a highly preferred embodiment of the present invention, said polylinker in the polypeptide of the invention comprises 5 amino acids. As can be seen from the accompanying embodiments, said polypeptide linker has the advantage of including the Gly Gly Gly Gly Gly Ser amino acid sequence.

In another preferred embodiment of the invention, said first domain of the polypeptide of the invention comprises at least one CDR of the V _H and V _L regions comprising the amino acid sequence encoded by the DNA sequence shown in Fig. 8 from nucleotides 82 to 414 (V _L ) and from nucleotides 460 to 831 (V _H ) and / or said second domain includes at least one CDR, preferably two, more preferably 3 CDRs from the V _H and V _L regions comprising the amino acid sequence encoded by the DNA sequence shown in Figure 8 from nucleotides 847 to 12 03 (V _H ) and from nucleotides 1258 to 1575 (V _L ), optionally in combination with a framework region that appears together with the indicated CDRs in the parent antibodies. The CDRs contained in the variable regions shown in Figure 8 can be determined, for example, by Kabat, "Sequences of Proteins of Immunological Interest" (US Department of Helth and Human Services, third edition, 1983; fourth edition, 1987; fifth edition, 1990 ). One of skill in the art will appreciate that the binding site or at least one CDR derived therefrom can be used in constructing the polypeptide of the invention. Preferably, said polypeptide comprises the amino acid sequence encoded by the DNA sequence shown in Figure 8 from nucleotides 82 to 1575. One skilled in the art will appreciate that the binding sites of the polypeptide of the invention can be constructed according to methods known in the art. for example, as described in EP-A1 0 451 216 and EP-A1 0549581.

The domains of the polypeptide binding sites of the invention preferably have a specificity at least substantially identical to the binding specificity of, for example, an antibody or immunoglobulin chain from which they originate. Such domain binding sites may have a binding affinity of 10 ⁵ M ¹ , preferably not higher than 10 ⁷ M ¹ , for the CD3 antigen and preferably up to 10 ¹⁰ M-1 or more for the CD 19 antigen.

In a preferred embodiment of the polypeptide of the invention (a) said first domain binding site has an affinity of at least about ⁷ M, preferably at least about ⁹ M, and more preferably 10 M;

and / or (b) said second domain binding site has an affinity of at least approximately ΙΟ ⁷ M, preferably less than approximately 10 ^-6 M and even more preferably in the order of ΙΟ ′ ⁵ M.

According to preferred embodiments mentioned above, it is advantageous if the CD19 antigen recognition site has high affinity in order to capture target cells that need to be destroyed with high efficiency. On the other hand, the binding affinity of the binding site recognizing the CD3 antigen must be in the order of those of the natural CD3 receptors or that which is usually detected by the interaction of the T cell receptor with its ligand, which is the MHC peptide complex on the surface of the target cell. In another preferred embodiment of the invention, the peptide described above is a bispecific single-chain antibody.

The present invention also relates to a polypeptide comprising at least one further domain, said domains being linked by covalent or non-covalent bonds.

The binding may be based on genetic fusion according to methods known in the art and described above, or may be accomplished by, for example, chemical crosslinking as described in WO 1994 / 004686. The additional domain present in the polypeptide of the invention may preferably be linked via a flexible linker, more useful polypeptide linker for one of the domains of the binding site, said polypeptide linker comprising multiple, hydrophilic, peptide-linked amino acids of sufficient length to occupy oyanieto between the C-terminal end of one of said domains and Nterminalniya end of the other of said domains when said polypeptide undergoes a conformation suitable for binding when it is in aqueous solution. Preferably said polypeptide linker is a polypeptide linker as indicated in the above described embodiments. The polypeptide of the invention may further include a cleavage linker or cleavage site for proteinases such as enterokinase; see attached examples.

In addition, said additional domain may have a predefined specificity or function. For example, the literature refers to a host according to the concept of targeting bioactive substances such as drugs, toxins and enzymes, to a specific point in the body to destroy or localize the malignant cells or to induce a localized effect of the drug or enzyme. This effect has been suggested to be achieved by conjugating the bioactive substance to monoclonal antibodies (see, e.g., Y. Oxford University Press; and Ghose, J. Natl. Cancer Inst. 61 (1978), 657-676).

It is also understood in this context that the polypeptides of the invention can be further modified by conventional methods known in the art. This allows the construction of chimeric proteins comprising the polypeptide of the invention and other functional amino acid sequences, e.g., nuclear localization signals, transactivating domains, DNA-binding domains, hormone-binding domains, tag proteins (GST, GFP, h-myc peptide, FLA Of the peptide) that may be derived from heterologous proteins. As described in the accompanying embodiments, the polypeptide of the invention preferably includes a FLAG tag of approximately eight amino acids in length; see Figure 8.

The polypeptides of the invention can be used therapeutically in patients suffering from B-cell disorders such as B-cell lymphoma, B-cell-derived chronic lymphatic leukemia (B-CLL) and / or having a cell-related autoimmune disease, such as myasthenia gravis, Morbus Bazedow, Hashimoto thyreoiditis, or Goodpasture syndrome. Such therapy can be carried out by, for example, administering the polypeptides of the invention. Such administration may utilize unlabeled as well as labeled polypeptides.

The polypeptides of the invention, for example, can be administered labeled with a therapeutic agent. These agents may be linked either directly or indirectly to the antibodies or antigens of the invention. An example of indirect coupling is by using a spacer part. These spacer portions, in turn, may be insoluble or soluble (Diener, Science 231 (1986), 148) and may be selected to allow the release of the drug from the antigen at the designated site. Examples of therapeutic agents that can bind to the immunotherapy polypeptides of the invention are drugs, radioisotopes, pectins and toxins. Drugs that can be conjugated to the polypeptides of the invention include compounds that are classically referred to as drugs, such as mitomycin C, daunorubicin, and vinblastine.

When using radioisotope conjugated polypeptides of the invention, for example, in immunotherapy, some isotopes may be more preferred than others according to such factors as leukocyte distribution as well as stability and emission. According to the autoimmune response, some emitters may be more preferred than others. In general, radioisotopes emitting alpha and beta particles are preferred in immunotherapy. Low energy high alpha emitters such as ²¹² Bi are preferred. Examples of radioisotopes that can bind to the polypeptides of the invention for therapeutic purposes are ¹²⁵ I, ¹³¹ I, ⁹⁰ Y, ⁶⁷ Cu, ²¹² Bi, ²¹² At, ²¹¹ Pb, ⁴⁷ Sc, ¹⁰⁹ Pd and ¹⁸⁸ Re.

Pectins are proteins, usually isolated from plant material, that bind to specific sugar moieties. Many lectins are also capable of agglutinating cells and stimulating lymphocytes. However, ricin is a toxic lectin used in immunotherapy. This is accomplished by binding the alpha-peptide chain of the ricin responsible for toxicity to the polypeptide to allow site-specific delivery of the toxic effect.

Toxins are poisonous substances produced by plants, animals, or microorganisms that are often lethal in sufficient dosage. Diphtheria toxin is a substance produced by Corynebacterium diphtheria that can be used therapeutically. This toxin is composed of alpha and beta subunits that can be separated under appropriate conditions. The toxic A component can bind to the polypeptide of the invention and can be used for site-specific delivery of interacting B cells and T cells that are brought close by binding to the polypeptide of the invention.

Other therapeutic agents, such as those described above, can bind to the polypeptide of the invention, as well as the corresponding ex vivo and in vivo therapeutic protocols are known or can be readily established by those skilled in the art. Where appropriate, one skilled in the art may use the polypeptide of the invention described above encoding any of the polypeptides or vectors described above instead of the protein material itself.

It will therefore be appreciated by those skilled in the art that the polypeptide of the invention can be used to construct other polypeptides of desired specificity and biological function. The polypeptides of the invention are expected to play an important therapeutic and research role, particularly in the field of medicine, for example in the development of new approaches to the treatment of B-cell disorders, such as some cancers or autoimmune diseases, or as an interesting tool for analysis and modulating the corresponding cellular signal transduction pathway.

In another preferred embodiment of the invention, this at least one other domain comprises a molecule selected from the group consisting of effector molecules having conflation suitable for biological activity, amino acid sequences capable of secreting a single ion, and amino acid sequences capable of selective binding to a solid support or to a pre-selected antigen.

Preferably this other domain includes an enzyme, toxin, receptor, binding site, biosynthetic antibody binding site, growth factor, cell differentiation factor, lymphokine, cytokine, hormone, easily detectable particle, antimetabolite, radioactive atom or antigen. Said antigen may be, for example, a tumor antigen, a viral antigen, a microbial antigen, an allergen, an autoantigen, a virus, a microorganism, a polypeptide, a peptide, or multiple tumor cells.

In addition, said ion-capable sequence is preferably selected from calmodulin, metallothionein, their functional fragments, or an amino acid sequence rich in at least one glutamic acid, aspartate, lysine and arginine.

In addition, said polypeptide sequence capable of selectively binding to a solid support may be a positive or negatively charged amino acid sequence, cystine-containing amino acid sequence, avidin, streptavidin, functional fragment of Staphylococcus protein A, GST, His-tag, His-tag -tag or Lex A. As described in the accompanying embodiments, the polypeptide of the invention, explained by a single-stranded antibody, is expressed by an N-terminal FLAG tag and / or a C-terminal His-tag, which allows for easier purification and detection. The FLAG tag used in the example includes 8 amino acids (see Figure 8) and thus is preferably used according to the present invention. However, FLAG-tag including abbreviated versions of FLAG are used in the accompanying embodiments, with the Asp-Tyr-Lys-Asp amino acid sequence also being appropriate.

The effector molecules and amino acid sequences described above may be present in a proforma, which is either active or not, and which can be removed when, for example, they enter a known cellular environment.

In a particularly preferred embodiment of the invention, said receptor is a costimulatory surface molecule important for T-cell activation or including an epitope binding site or hormone binding site.

In another particularly preferred embodiment of the invention, said costimulatory surface molecule is CD80 (B71) or CD86 (B7-2).

In another preferred embodiment, the present invention relates to polynucleotides which, upon expression, encode the polypeptides described above. Said polynucleotides may be fused to suitable expression control sequences known in the art to provide proper transcription and translation of polypeptides.

Said polynucleotides may be, for example, DNA, cDNA, RNA, or synthetically produced DNA or RNA, or a recombinantly produced chimeric nucleic acid molecule comprising any of these polynucleotides, either alone or in combination. Preferably, said polynucleotide is part of a vector. Such vectors may include other genes, such as marker genes, that allow selection of this vector in a suitable host cell and under suitable conditions. Preferably, the polynucleotide of the invention is linked to an expression-controlling sequence allowing expression in prokaryotic or eukaryotic cells. The expression of said polynucleotide involves transcription of the polynucleotide into capable of translating mRNA. The regulatory elements providing expression in eukaryotic cells, preferably mammalian cells, are known to those skilled in the art. These typically include regulatory sequences providing for transcription initiation and, if desired, poly-A signals, providing transcription breakdown and transcript stabilization. Additional regulatory elements may include transcription enhancers as well as translation enhancers and / or a naturally associated or heterologous promoter region. Possible regulatory elements allowing expression in host prokaryotic cells include, for example, PL, lac, trp or tac promoter from E. coli, and examples of regulatory elements allowing expression in eukaryotic cells are the AOX1 or GAL1 promoter in yeast or CMV-, SV40-, RSV promoter (Rous sarcoma virus), CMV enhancer, SV-40 enhancer, or globulin intron in mammalian cells or other organisms. In addition to the elements responsible for initiating transcription, such regulatory elements may also include transcriptional termination signals, such as the SV40-poly-A site or tk-poly-Asite, downstream of the polynucleotide. Furthermore, according to the expression system used, leader sequences targeting the polypeptide to the cell space or secreting it into the environment well known in the art can be added to the coding sequence of the polynucleotide of the invention; see also, for example, embodiments of the invention. The leader sequence (s) are assembled in an appropriate phase with translation, initiation, and fading sequences, and preferably a leader sequence capable of directing the translation of the secreted protein, or a portion thereof, to the periplasmic space or extracellular environment. Optionally, the heterologous sequence may encode a fusion protein comprising an N-terminal identification peptide conferring the desired characteristics, for example, stabilization or simplified purification of the expressed recombinant product; look above. In this context, suitable expression vectors are well known in the art, OkayamaBerg cDNA expression vector pcDV 1 (Pharmacia), pCDM8, pRc / CMV, pcDNA1, pcDNA3 (Invitrogene), or pSPORT1 (GIBCO BRL).

Preferably, the expression control sequences are eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells, but control sequences for prokaryotic cells may also be used. Once the vector has already been incorporated into the appropriate host, the host is maintained under conditions suitable for a high level of expression of the nucleotide sequences, and may optionally be followed by collection and purification of the polypeptide of the invention; see, for example, the accompanying embodiments.

As described above, the polypeptide of the invention can be used alone or as part of a vector for expression of the polypeptide of the invention in cells, for example in gene therapy or diagnosis of diseases associated with B-cell disorders. Polynucleotides or vectors containing the DNA sequence (s) encoding any of the polypeptides described above are introduced into the cell, which in turn produces the polypeptide of interest. Gene therapy based on the introduction of therapeutic genes into cells by ex vivo or in vivo techniques is one of the most important applications of gene transfer. Suitable vectors, methods or systems for delivering genes for ex vivo or in vivo gene therapy have been described in the literature and are well known to those skilled in the art; see, for example, Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Really. 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813; Verma, Nature 389 (1994), 239; Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Really. 77 (1995), 1077-1086; Onodera, Blood 91 (1998), 30-36; Verma, Gene Ther. 5 (1998), 692-699; Nabel, Ann.

N. Y. Acad. Sci. 811 (1997), 289-292; Verzeletti, Hum. Gene Ther. 9 (1998), 2243-51; Wang, Nature Medicine 2 (1996), 714-716; WO 1994/029469; WO 1997/000957, US 5,580,859; US 5,589,466; or Schaper, Current Opinion in Biotechnology 7 (1996), 635-640; cited literature reference. The polynucleotides and vectors of the invention can be designed for direct introduction into the cell by liposomes or by viral vectors (e.g., adenovirus, retroverus). Preferably, said cell is a microbial cell line, embryonic cell, or egg cell, or derivatives thereof, preferably said cell is a stem cell. An example of an embryonic stem cell may be a stem cell as described in Nagy, Proc. Natl. Acad. Sci. USA 90 (1993), 8424-8428.

As described above, the present invention relates to vectors, certain plasmids, cosmids, viruses and bacteriophages conventionally used in genetic engineering, which include a polynucleotide encoding the polypeptide of the invention. Preferably said vector is an expression vector and / or a gene transfer vector or a target vector. Expression vectors derived from viruses, such as retroviruses, vaccine viruses, adeno-associated viruses, herpes virus or bovine papilloma virus, can be used to deliver polynucleotides or vectors of the invention in target cell populations. Methods well known to one of skill in the art may be used to construct recombinant vectors; see, for example, the techniques described in Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N. Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N. Y. (1989). Alternatively, the polynucleotides and vectors of the invention can be reconstituted into liposomes for delivery into target cells. The vectors containing the polynucleotides of the invention can be transferred to a host cell by well-known methods that vary according to the cell type of the host. For example, calcium chloride transfection is widely used for prokaryotic cells, while treatment with calcium phosphate or electroporation can be used for other host cells; see for example Sambrook above. Once expressed, the polypeptides of the invention can be purified according to standard state-of-the-art procedures, including ammonium sulfate precipitation, affinity column chromatography, gel electrophoresis, and the like; see Scopes, “Protein Purification,” Springer-Verlag, N. Y. (1982). Substantially pure polypeptides with approximately 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity are most preferred for pharmaceutical use. Once purified partially or to the desired homogeneity, the polypeptides can be used therapeutically (including extracorporeally) or for the development and refinement of studies.

In another embodiment, the invention relates to a cell comprising the polypeptide or vector described above. Preferably, said cell is an eukaryotic, preferably mammalian cell, if therapeutic use of the polypeptide is contemplated. Yeast, as well as less preferred prokaryotic cells, such as bacterial cells, may also serve, in particular, if the polypeptide produced is used as a diagnostic agent.

The polynucleotide or vector of the invention that is present in the host cell may either be integrated into the genome of the host cell or may be maintained extrachromosomally.

The term "prokaryotic" is intended to include all bacteria that can be transformed with DNA or RNA molecules to express the polypeptide of the invention. Host prokaryotic cells may include Gram negative as well as Gram positive bacteria such as E. coli, S. typhimurium, Serratia marcescens and Bacillus subtilis. The term "eukaryotic" is understood to include cells from yeast, higher plants, insects and preferably mammals. According to the host used in the recombinant production procedure, the polypeptides of the present invention may be glycosylated or not glycosylated. The polypeptides of the invention may also include an initial methionine amino acid residue. A polynucleotide encoding a polypeptide of the invention can be used to transform or transfect the host using techniques well known to those skilled in the art. Particularly preferred is the use of a plasmid or virus comprising the coding sequence of the polypeptide of the invention and a genetically fused N-terminal FLAG-tag and / or C-terminal His-tag. Preferably, the length of this FLAG tag is approximately 4 to 8 amino acids, more preferably 8 amino acids. Methods for the preparation of fusion, operatively linked genes and their expression in, for example, mammalian and bacterial cells are well known in the art (Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, Ν. Y, 1989). The genetic structures and methods described therein can be used to express the polypeptide of the invention in eukaryotic or prokaryotic hosts. In general, expression vectors containing promoter sequences that facilitate transcription efficiency of the inserted polynucleotide are used according to the host. Typically, the expression vector contains a single origin of replication, a promoter and a terminator, as well as specific genes that are capable of conferring phenotypic selection on the transformed cells. In addition, transgenic animals, preferably mammals containing cells of the invention can be used in the large-scale production of the polypeptide of the invention.

In another embodiment, the present invention relates to a method for the preparation of the above, comprising culturing cells of the invention under conditions suitable for the expression of the polypeptide and isolating the polypeptide from the cells or from the culture medium.

The transformed host can be grown in a fermenter and cultured according to techniques known in the art to achieve optimal cell growth. The polypeptide of the invention can then be isolated from the culture medium, cell lysate, or cell membrane fractions. Isolation and purification of, for example, microbially expressed polypeptides of the invention may be by any conventional means, such as separation by preparative chromatography and immunological separation, such as those requiring the use of monoclonal or polyclonal antibodies directed against, for example, a tag of the polypeptide of the invention or as described in the embodiments of the invention.

Accordingly, the present invention enables the recombinant production of polypeptides comprising a binding site having affinity and epitope specificity for the CD19 and CD3 antigen, and optionally another functional domain. As is apparent from the above, the invention provides a large family of polypeptides containing such binding sites for use in any therapeutic or diagnostic approach. It will be understood by one of ordinary skill in the art that the polypeptides of the invention may further be coupled to other particles as described above, for example, drugs targeting and depicting applications. Such binding can be carried out chemically after expression of the polypeptides at the attachment site or the binding product can be constructed in the polypeptide of the invention at the DNA level. The DNAs are then expressed in a suitable host system, and the expressed proteins are harvested and renatured as needed. As described above, binding sites preferably originate from the variable region of antibodies. In this regard, hybridoma technology enables the production of antibody-secreting cell lines for virtually any desired substance that produces an immune response. It can then be obtained from the cytoplasm of the hybridoma RNA encoding the light and heavy chains of the immunoglobulin. The 5 'end region of the mRNA can be used to produce cDNA to be used in the method of the present invention. The DNA encoding the polypeptides of the invention can then be expressed in cells, preferably mammalian cells.

According to the host cell, renaturation techniques may be needed to achieve the correct conformation. If necessary, spot replacement search can be performed in DNA to optimize binding using conventional cassette mutagenesis or other protein design methodologies, as described herein. The preparation of the polypeptides of the invention may also depend on the known amino acid sequence (or corresponding DNA or RNA sequence) of bioactive proteins, such as enzymes, toxins, growth factors, cell differentiation factors, receptors, antimetabolites, hormones or various cytokines or lymphocytes. Such sequences are known in the literature and are available through computerized databases. For example, the polypeptide of the invention may be designed to consist of a single-stranded Fv fragment and the extracellular portion of the human co-stimulatory protein CD80 (B7-1) linked via a (Gly4Ser 1) 1 linker. The CD80 co-stimulating protein belongs to the Ig superfamily. It is a highly glycosylated protein of 262 amino acids. A more detailed description is published by Freeman, J. Immunol. 143 (1989), 2714-2722. Stable expression can be effected in, for example, DHFR deficient CHO cells, as described by Kaufmann, Methods Enzymol. 185 (1990), 537566. The protein can then be purified by its His-tag attached to the C-terminus using a HaNi-NTA-column (Mack, Proc. Natl. Acad. Sci. USA 92 (1995), 7021 -7025).

Furthermore, the present invention provides compositions comprising the aforementioned polypeptide, polynucleotide or vector of the present invention.

Preferably, the present invention relates to compositions that are pharmaceutical compositions comprising the aforementioned polypeptide, polynucleotide (s) or vector (s) of the present invention.

The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline, water, emulsions, such as oil-water emulsions, various types of wetting agents, sterile solutions, and the like. Compositions comprising such carriers can be formulated into pharmaceutical form by well-known conventional methods. These pharmaceutical compositions may be administered to the subject in an appropriate dose. The administration of suitable compositions can be accomplished by a variety of routes, for example intravenously, intraperitoneally, subcutaneously, intramuscularly, topically or intradermally. The dosage regimen will be determined by your doctor and clinical factors. As is well known in the medical literature, dosages for each patient depend on many factors, including patient height, body surface area, age, particular compound to be administered, sex, time and route of administration, general health status and other medicines that are competitively administered. In general, the regimen for regular administration of the pharmaceutical composition should be in the range of 1 micro g to 10 mg units per day. If the regimen is continuous infusion, it should be in the range of 1 micro g to 10 mg units per kilogram body weight per minute, respectively. However, a more preferred dose for continuous infusion should be in the range of 0.01 micro g to 10 mg units per kilogram body weight per hour. Particularly preferred doses are as indicated below. Progression through periodic evaluation can be monitored. The dose will vary, but the preferred dose for intravenous administration of DNA is from about 10 ⁶ to 10 ¹² copies of the DNA molecule. The composition of the invention may be administered topically or systematically. Typically, administration is parenteral, e.g., intravenously; DNA can also be applied directly to the target site, for example, by biological delivery to an internal or external target site or by a catheter to a site in an artery. Preparation for parenteral administration involves sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer or fixed oils. Intravenous vehicles include fluid and nutritional supplements, electrolyte supplements (such as those based on Ringer's dextrose), and more. similar. Preservatives and other additives such as antimicrobials, antioxidants, chelating agents and inert gases, etc., may also be present. similar. In addition, the pharmaceutical composition of the present invention may include protein carriers such as serum albumin or immunoglobulin, preferably of human origin. It is further contemplated that the pharmaceutical composition of the invention may include a biologically active agent, according to the desired use of the pharmaceutical composition. Such agents may be drugs acting on the gastrointestinal system, drugs acting as cytostatics, drugs preventing increased uric acid in the blood, and / or agents such as T-cell co-stimulating molecules or cytokines known in the art of the technique.

The present invention provides that the various polynucleotides and vectors of the present invention are administered either alone or in any combination, using standard vectors and / or gene delivery systems, and optionally together with a pharmaceutically acceptable carrier or excipient. After administration, said polynucleotides and vectors can be stably integrated into the genome of the subject.

On the other hand, viral vectors that are specific to some cells or tissues and continue to exist in said cells may be used. Suitable pharmaceutically acceptable carriers or excipients are known in the art. The pharmaceutical compositions prepared according to the present invention can be used to prevent or treat or delay over time various types of diseases that are associated with B-cell-associated immunodeficiency and malignancies.

It is also possible to use the pharmaceutical composition according to the invention which includes a polynucleotide or vector of the invention for gene therapy. Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, naked DNA, and viral vectors such as herpes virus, retroviruses, adeno-associated viruses, among others. Delivery of nucleic acids to a specific site in the body for gene therapy can also be achieved using a biological delivery system, such as that described by Williams (Proc. Natl. Acad. Sci. USA 88 (1991), 2726-2729). Other methods of nucleic acid delivery include particle-mediated gene transfer, such as those described in Verma, Gene Ther. 15 (1998), 692699. It should be understood that introduced polynucleotides or vectors express the gene product after introduction into said cell and preferably remain with this status during the half-life of said cell. For example, a cell line can be designed, according to methods well known to those skilled in the art, to stably express the polynucleotide under the control of appropriate regulatory sequences. Instead of using vectors that contain the viral origin of replication, the host cells can be transformed with the polynucleotide of the invention and a selection marker, or from the same or different plasmids. After the introduction of the above DNA, the engineered cells can be allowed to sprout for 1 -2 days in enriched medium, after which selective medium is included. The selection marker in the recombinant plasmid confers resistance to the selection and allows the selection of cells that have a stably integrated plasmid in their chromosomes and sprout in the form of an outbreak, which in turn can be cloned and develop into a cell line. Such engineered cell lines are also extremely useful in screening methods for detecting compounds involved, for example in B-cell / T-cell interactions.

A large number of breeding systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, Cell 11 (1977), 223), hypoxanthine-guanine phosphoribosyl transferase (Szybalska, Proc. Natl. Acad. Sci. USA 48 (1962), 2026), and adenine phosphoribosyl transferase (Lowy, Cell 22 (1980), 817) in tk ', hgprt or aprt cells, respectively. Also, resistance to antimetabolites may be used as a basis for the selection of dhfr that confers resistance to methotrexate (Wigler, Proc. Natl. Acad. Sci. USA 77 (1980), 3567; O'Hare, Proc. Natl. Acad Sci. USA 78 (1981), 1527), gpt, which confers resistance to mycophenolic acid (Mulligan, Proc. Natl. Acad. Sci. USA 78 (1981), 2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, J. Mol. Biol. 150 (1981), 1); hygro that confers hygromycin resistance (Santerre, Gene 30 (1984), 147); or puromycin (pat, puromycin N-acetyl transferase). Additional selection genes have been described, for example, trpB, which enables cells to use indole instead of tryptophan, hisD, which allows cells to use histinol instead of histidine (Hartman, Proc. Natl. Acad. Sci. USA 85 (1988), 8047 ); and ODC (ornithine decarboxylase), which confers resistance to ornithine decarboxylase inhibitor, 2- (difluoromethyl) -Ornithine, DFMO (McCologue, 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.).

In another embodiment, the present invention relates to diagnostic compositions comprising any of the peptides, polynucleotides or vectors of the invention described above and, if desired, suitable determination agents.

The polypeptides of the invention are also suitable for use in immunoassays in which they can be used in the liquid phase or coupled to a solid phase carrier. Examples of immunoassays that can use the polypeptides of the present invention are competitive and incompetent direct or indirect immunoassays. Examples of such immunoassays are radioimmunoassay (RIA), sandwich (immunometric assay) and Western blot assay. The polypeptides of the present invention can be linked to many different carriers and used to isolate cells specifically linked to said polypeptides. Examples of well known carriers include glass, polystyrene polyvinyl chloride, polypropylene polyethylene polycarbonate, dextran, nylon, amylose, natural and modified celluloses, colloidal metals, polyacrylamides, agarose and magnetite. The nature of the carrier may be either soluble or insoluble for the purposes of the invention.

There are many different markers and marking methods known to those skilled in the art. Examples of such type of markers that can be used in the present invention include enzymes, radioisotopes, colloidal metals, fluorescent compounds, chemiluminescent compounds and bioluminescent compounds; see also the embodiments discussed above.

The present invention also relates to the use of the polypeptides, polynucleotides and vectors of the present invention described above for the preparation of a pharmaceutical composition for the treatment of B-cell malignancies, B-cell-mediated autoimmune diseases or depletion of Cells.

Recent clinical studies to redirect the cytotoxic activity of human T cells through bispecific antibodies have shown promising results in the treatment of refractory Hodgkin's disease [33], breast and ovarian cancer [34-37], and malignant glioma [38]. Considering the facts

- that bsc antibodies, due to their low molecular weight, facilitate tumor entry (as shown for Fab or Fv fragments) [39]; and

- bsc antibodies are believed to reduce the dose-dependent and dose-limiting toxicity caused by the systemic release of cytokines mediated by Fc portions of a conventional bispecific antibody; and

- that an intact monoclonal antibody (directed against CD20) leads to tumor repression in advanced stages of HaNHL [41,42], it is expected and has actually been shown that the polypeptides of the invention are interesting molecules that contribute to further therapeutic improvement.

Therefore, in a preferred embodiment, the pharmaceutical composition of the invention is used to treat non-Hodgkin lymphoma.

The dose limits for administering the polypeptides, polynucleotides, and vectors of the invention are wide enough to produce the desired effect in which the symptoms of B-cell-mediated disease are improved. The dose should not be so large as to cause major adverse effects, such as adverse reactions, anaphylactic reactions and the like. Typically, the dosage will vary according to the age, condition, sex and spread of the disease in the patient and can be determined by one of ordinary skill in the art. The dose may be determined by the individual physician during any contraindications. It is envisaged that the dose range will be at 0.01 micro g to 10 mg of the polypeptide of the invention. An extremely preferred dose is 0.1 microg to 1 mg, a preferred dose is 1 to 100 microg and an even more preferred dose is 3 to 10 microg (claim 7).

The invention also relates to a method for identifying compounds for activating or co-stimulating T cells or for identifying inhibitors of T cell activation and stimulation, including

a) culturing CD19 positive cells (preferably B cells) and T cells in the presence of the polypeptide of the invention and, if desired, in the presence of a component capable of providing a signal that can be readily responded to by T cell activation with a compound, which will be screened under conditions allowing the compound to interact with the cells; and

b) determining the presence or absence of a signal generated by the interaction of the compound with the cells.

This embodiment is extremely useful for testing the ability of compounds as co-stimulating molecules. In this method CD 19 positive cells / B cells provide a primary signal for T cell activation, thus avoiding the clonotypic T cell receptor. It can then be determined according to the invention which of the test compounds still needs to actually activate the T cells. In this method of the invention, CD 19 positive cells / B cells function as stimulating cells binding bispecific molecules that bind to CD3 complexes on the surface of the same T cells. The biological methods for conducting the cultivation, determination and, if desired, testing are clear to the person skilled in the art.

The term "compound" in the method of the invention includes a signal substance or a plurality of substances that may or may not be identical. Said compound (s) may be included, for example, in samples, for example, cell extracts of, for example, plants, animals or microorganisms. In addition, said compounds may be known in the art, but have not yet been known for their ability to inhibit T-cell activation or have not been known for their utility as a T-cell co-stimulating factor. Multiple compounds may, for example, be added to the culture medium or injected into the cell. If a sample containing the compound is identified by the method of the invention, then it is possible to either isolate the compound from the original sample identified as containing the compound in question, or subsequently the original sample can be separated, for example, if it consists of many different compounds, such that reduce the number of different compounds for the sample and repeat the method with the subdivisions of the original sample. It can then be determined whether said sample or compound exhibits the necessary properties by methods known in the art, such as those described herein and in the appended claims. Depending on the complexity of the samples, the steps described above can be performed several times, preferably while the sample identified according to the method of the invention includes only a limited number of or only one substance. Preferably said sample includes substances having similar chemical and / or physical properties, and more preferably said substances are identical. The methods of the invention can be readily conducted and designed by one of ordinary skill in the art, for example, according to other cell-based experiments described in the prior art or using and modifying methods as described in the accompanying embodiments . In addition, one of skill in the art will readily recognize which other compounds and / or cells can be used to carry out the methods of the invention, for example, interleukins or enzymes that, if necessary, convert any compound into a precursor, which in turn stimulates or suppresses T cell activation. Such adaptation of the method of the invention is within the ability of one of ordinary skill in the art and can be accomplished without undue experimentation.

Compounds that can be used according to the method of the present invention include peptides, proteins, nucleic acids, antibodies, small organic compounds, ligands, peptidomimetics, PNAs and the like. These compounds may also be functional derivatives or analogues of known T-cell activators or inhibitors. Methods for the preparation of chemical derivatives and analogues are well known to those skilled in the art and are described, for example, in Beilstein, Handbook of Organic Chemistry, Springer edition New York Inc., 175 Fifth Avenue, New York, Ν. Y. 10010 U. S. A. and Organic Synthesis, Wiley, New York, USA. In addition, said derivatives and analogs can be tested for their effect according to methods known in the art or as described, for example, in the accompanying embodiments. In addition, peptidomimetics and / or computer-aided or T-cell activation inhibitors may be used, for example, according to the methods described below. Custom computer programs can be used to identify the interaction sites of a putative inhibitor and the antigen of the invention by computer searching for complementary structural motifs (Fassina, Immunomethods 5 (1994), 114-120). Other adapted computer programs for computer-aided design of proteins and peptides are described in the prior art, for example, in Berry, Biochem. Soc. Trans. 22 (1994), 1033-1036; Wodak, Ann. Ν. Y. Acad. Sci. 501 (1987), 1-13; Pabo, Biochemistry 25 (1986), 5987-5991. The results obtained from the above-described computer analyzes can be used in combination with the method of the invention, for example to optimize known T-cell activators or inhibitors. Suitable peptidomimetics can also be identified by the synthesis of peptidomimetic combination libraries by successive chemical modifications and testing of the compounds obtained, for example, according to the method described herein and related embodiments. Methods for generating and using peptidomimetic combination libraries have been described in the prior art, for example, in Ostresh, Methods in Enzymology 267 (1996), 220-234 and Dorner, Bioorg. Med. Chem. 4 (1996), 709-715. In addition, three-dimensional and / or crystallographic structures of B cell / T cell interaction inhibitors or activators can be used to design peptidomimetic T cell activation inhibitors or activators to be tested in the method of the invention (Rose, Biochemistry 35 (1996), 1293312944; Rutenber, Bioorg. Med. Chem. 4 (1996), 1545-1558).

In general, the invention provides methods for identifying compounds that are capable of modulating the B-cell / T-cell immune response.

Compounds found to activate the B cell / T cell mediated response can be used to treat cancer and related diseases. In addition, it may be possible to specifically inhibit viral diseases, thereby preventing viral infection and its spread. Compounds identified as suppressors of T-cell activation or stimulation may be used in organ transplantation to avoid transplant rejection; look above.

Compounds identified or prepared according to the method of the present invention are expected to be very useful in diagnosis, and in particular for therapeutic use. In yet another embodiment, the invention relates to a method of producing a pharmaceutical composition comprising converting the identified compound of step (b) into pharmaceutical form to the methods of the invention described above in a pharmaceutically acceptable form. It is further appreciated that said component can be modified by peptidomimetics. Methods for generating and using peptidomimetic combinatorial libraries are known in the art, for example, Ostresh, Methods in Enzymology 267 (1996), 210-234, Domer, Bioorg. Med. Chem. 4 (1996), 709-715, Beeley, Trends Biotechnol. 12 (1994), 213-216, or al-Obeidi, Mol. Biotech. 9 (1998), 205-223.

The therapeutically useful compounds identified according to the method of the invention may be administered to a patient by any suitable method for the particular compound, e.g., orally, intravenously, parenterally, transdermally, transmucosally or surgically or by implantation (e.g., as the compound is in the form solid or semi-solid biocompatible and resorptive matrix) at or near the point where the effect of the compound is desired. The therapeutic doses are suitably determined by one of ordinary skill in the art, see above.

Additionally, the present invention provides a method of treating B-cell malignancies, B-cell-mediated autoimmune diseases or depletion of the Cells and / or a method for delaying a pathological condition caused by B-cell disorders, comprising administering a polypeptide, polynucleotide or vector of the invention in a mammalian cell affected by said malignancies and / or pathological condition. It is also preferred that said mammal be a human.

These and other embodiments are described and included in the description and embodiments of the present invention. Other literature relating to any of the antibodies, methods, uses and compounds used according to the present invention can be found in public libraries and databases, using, for example, electronic devices. For example, the public Medline database, available online at http://www.ncbi.nlm.nih.gov/ PubMed / medline.html, may be used. Other databases and addresses such as http://www.ncbi.nlm.nih.gov/. http: // www.infobiogen.fr/,http://www.fmi.ch/biology/ research tools.html. http://www.tigr.org/ are known to those of skill in the art and can also be obtained by using, for example, http://www.lycos.com. A review of patent information in biotechnology and an evaluation of relevant sources useful for retrospective search and up-to-date information are provided by Berks, TIBTECH 12 (1994), 352-364.

Description of the attached figures

Figure 1. SDS-PAGE: Coomassie staining of the purified bscCD19xCD3 fragment with different amounts of protein. The molecular weight (kDa) of the marker is indicated on the left;

Figure 2. FACS analysis with bscCD19xCD3 (200 micro g / ml) on various CD19-No3Hive B-cell lines (BJAB, SKW6.4, Blin-1, Daudi, Raji), on CD19-negative B-cell line BL60 and on CD3-positive Jurkat cells and primary human PBMCs. Dashed lines are an indication of negative controls;

Figure 3. Cytotoxicity of bscCD 19xCD3 in a ⁵¹ Cr release assay with unstimulated human PBMCs and various B cell lines. Effector: Target cell ratio 10: 1; incubation time 4 h. Standard deviation for all 7% attempts at 3 replicates;

Figure 4. Cytotoxicity assay for chromium release with unstimulated primary human PBLs against plasmacytoma cell lines L363 and NC1 and Daudi E: T ratio 20: 1 ratio; incubation time 8 h;

Figure 5. Inhibition of cytotoxicity of bscCD 19xCD3 by parental antiCD 19 antibody HD37 assay for chromium release; incubation time 8 h; E: T ratio 20: 1; concentration of bscCD19xCD3 1 ng / ml;

Figure 6. Cytotoxicity assay with unstimulated PBMCs against Daudi cells after addition of increasing amounts of EGTA, E: T ratio 10: 1, incubation time 4 h;

Figure 7. Cytotoxicity of bscCD19xCD3 in a ⁵¹ Cr release assay with unstimulated human PBMCs and Blin-Ι as target cells at different E: T ratios; incubation time 4 h; concentration of conventional bispecific antibody 3 micro g / ml; Habsc 17-lAxCD3 concentration 100 ng / ml; E: T ratios as indicated;

Figure 8. DNA and protein sequence of a bscCD19xCD3 antibody (variant containing FLAG tag). The numbers indicate the nucleotide (nt) positions, the corresponding amino acids are indicated after the nucleotide sequence. The DNA encoding sequence for the bispecific antibody begins at position 1 and ends at position 1593. The first six nt (positions -10 to -5) and the last six nt (positions 1596 to 1601) contain the EcoRI and Sail restriction enzyme cleavage sites, respectively. Nucleotides 1 to 57 specify the leader sequence; nucleotides 82 to 414 and 460 to 831 encode V _L CD19 and V _H CD19, respectively; nucleotides 847 to 1203 and 1258 to 1575 encode V _H CD3 and V _L CD3, respectively; and nucleotides 1576 to 1593 encode His-tag.

Figure 9. Depletion of primary (malignant) CD19 ⁺ B cells by collection of autologous primary T lymphocytes by bscCD 19xCD3.

A) Start (t = 0): η = 3 χ 10 ⁶ PBL / well were seeded in 24 well tissue culture dishes in a volume of 1 ml RPMI 1640 medium each, with 10% FCS added to each. The initial percentage of CD19 ⁺ B cells as well as that of CD4 ⁺ - and CD8 ⁺ T cells is indicated.

B-G) Relative counting of B- and CD4 ⁺ - and CD8 ⁺ T-cells after t ~ 5 days incubation at 37 ° C / 5% CO ₂ in the absence of (B-C) or in the presence (DG) of bscCD 19xCD3 (concentrations as indicated) with or without 60 U / ml IL-2. Negative controls containing either a bispecific single-stranded antibody (17-1 AxCD3) with no clear cell specificity for the target or no bispecific antibody at all (C).

Figure 10. Purification steps for bscCD 19xCD3;

Figure 11. SDS-PAGE analysis for the purity of bscCD 19xCD3 is shown. Colored Coomassie-blue SDS 4-12% polyacrylamide gel gradient. Lanes 1 and 6, molecule size markers; lane 2, cell culture supernatant; lane 3, active fraction of cation exchange chromatography; lane 4; active fractions of cobalt chelate affinity chromatography; lane 5, active gel filtration fraction. Equal amounts of protein (2 micro g) of cell culture supernatant and different column fractions were analyzed. The size in kDa of molecular weight standards is indicated on the right. The arrow indicates the position of bscCD 19xCD3;

Figure 12. Cation exchange chromatography on bscCD1 9xCD3. Protein concentration was measured by absorption at 280 nm (mAU, left). The protein elution profile is shown in a continuous line. The NaCl gradient step profile is shown by a continuous straight line (% B, right) and the fractions collected are indicated by broken lines. BscCD 19xCD3 were determined in fraction F6;

Figure 13. Affinity chromatography with bscCD 19xCD3 cobalt chelate. Protein concentration was measured by absorption at 280 nm (mAU, left). The protein elution profile is shown in a continuous line. The imidazole gradient is indicated by a continuous straight line (% B, right) and the collected fractions are indicated by a broken continuous line. BscCD19xCD3 was detected in fraction F7;

Figure 14. Gel filtration of antiCD19xaHTH-CD3. Protein concentration was measured by absorption at 280 nm (mAU, left). The protein elution profile is shown in a continuous line. The broken lines indicate the fractions collected. BscCDl9xCD3 is detected in F7 fractions corresponding to a molecular size of approximately 60 kDa;

Figure 15. Blood levels of gamma-glutamyl transferase (GGT) in response to treatment with bscCD 19xCD3. GGT levels are determined by a standard clinical biochemical method and expressed as unit / I. The time axis shows the days (d) after the first administration of the drug begins, starting from zero, hours (h) following the individual drug addition. The arrows indicate the time at which the drug is administered.

Figure 16. Ultrasound measurements from the spleen of patient AB.

A: Determination of spleen size on April 12, 1999, prior to cbscCD19xCD3 therapy. The figure shows an enlarged spleen (size 146 mm x 69.2 mm) due to infiltration of malignant B cells.

C: Determination of spleen size on April 16, 1999 after treatment with 3 micro g on April 14, followed by 10 micro g on April 15. The photograph shows a shrinkage of the spleen to a size of 132 mm x 58.9 mm caused by systemic treatment with bscCD 19xCD3. The discrepancies between the unit dimensions of the size values given in Table 1 are explained by the different spatial plans in determining the size of the organ by ultrasound. Both dimensions are marked with (+) and (x);

Figure 17. Enumeration of leukocytes in the blood in response to treatment with bscCD 19xCD3. The leukocyte count is given in gigas / liter. The time axis shows the days (d) after the first administration of the drug begins, starting from zero, hours (h) following the individual drug addition. Arrows indicate the time at which the drug is administered;

Figure 18. Blood levels of C-reactive protein (CRP) in response to treatment with bscCD 19xCD3. CRP levels were determined by a standard clinical biochemical method and expressed as mg / dl. The time axis shows the days (d) after the first administration of the drug begins, starting from zero, hours (h) following the individual drug addition. Arrows indicate the time at which the drug is administered;

Figure 19. Blood levels of tumor necrosis factor-alpha (TNF) in response to treatment with bscCD 19xCD3. TNF levels were determined by ELISA and expressed in ng / ml. The time axis shows days (d) after the first administration of the drug begins, starting from zero, hours (h) following individual drug addition. Arrows indicate the time at which the drug is administered;

Figure 20. Blood levels of interleukin6 (IL-6) in response to treatment with bscCD 19xCD3. IL-6 levels were determined by ELISA and expressed in pg / ml. The time axis shows the days (d) after the first administration of the drug begins, starting from zero, hours (h) following the individual drug addition. Arrows indicate the time at which the drug is administered;

Figure 21. Blood levels of interleukin8 (IL-8) in response to treatment with bscCD 19xCD3. IL-8 levels were determined by ELISA and expressed in pg / ml. The time axis shows the days (d) after the first administration of the drug begins, starting from zero, hours (h) following the individual drug addition. Arrows indicate the time at which the drug is administered;

Figure 22. Blood levels of soluble interleukin-2 receptor alpha chain (IL-2R) in response to treatment with bscCD 19xCD3. IL-2R levels were determined by ELISA and expressed in units / ml. The time axis shows the days (d) after the first administration of the drug begins, starting from zero, hours (h) following the individual drug addition. The arrows indicate the time at which the drug is administered.

The invention is described using the following biological examples, which are illustrative and do not limit its scope.

Examples of carrying out the invention

Example 1. Cloning of variable (V) immunoglobulin domains

Domains of V light chain (VL) and V heavy chain (VH) of HD37 hybridomas [22] are cloned according to standard PCR methods [23]. CDNA synthesis was carried out with oligo dT primers and Taq polymerase.

List of primers

5'Ll:

GAAGCACGCGTAGATATCKTGMTSACCCAAWCTCCA [SEQ ID NO: 1]

3'K:

GAAGATGGATCCAGCGGCCGCAGCATCAGC [SEQ ID NO: 2]

5Ή1:

CAGCCGGCCATGGCGCAGGTSCAGCTGCAGSAG [SEQ ID NO: 3]

3'G:

ACCAGGGGCCAGTGGATAGACAAGCTTGGGTGTCGTTTT [SEQ ID NO: 4] 5'VLB5RRV:

AGGTGTACACTCCATATCCAGCTGACCCAGTCTCCA [SEQ ID NO: 5]

3'VLGS15:

GGAGCCGCCGCCGCCAGAACCACCACCTTTGATCTCGAGCTTGGTCCC [SEQ ID NO: 6] 5′VHGS15:

GGCGGCGGCGGCTCCGGTGGTGGTGGTTCTCAGGTSMARCTGCAGSAGTCWGG [SEQ ID NO: 7]

3'VHBspEl:

AATCCGGAGGAGACGGTGACCGTGGTCCCTIGGCCCCAG [SEQ ID NO: 8]

For the amplification of V domains by PCR, primers 5'L1 and 3'K limiting the V _L domain, and 5'H1 and 3'O for the heavy chain based on primers described by Dubel et al. [24].

The cDNA of the anti-POP scFv fragment was kindly provided by A. Traunecker [25].

Example 2. Construction of bispecific single-stranded fragments and expression in eukaryotes

For the preparation of the anti-CD19 scFv fragment, the respective VL- and VH-regions cloned into individual plasmid vectors serve as matrices for VL- and VH-specific PCR using pairs of oligonucleotide primers 5'VLB5RRV / 3'VLGS15 and 5 'VHGS15 / 3'VHBspEI, respectively. In this way, overlapping complementary sequences are introduced into the PCR products, which combine to form the coding sequence of 15 amino acids (Gly ₄ Serj) _3- BHHKep during subsequent fusion-PCR. This amplification step is carried out with the primer pair 5'VLB5RRV / 3'VHBspEI and the resulting fusion product (or more specifically the anti-CD19 scFv fragment) is cleaved by EcoRV and BspEI restriction enzymes, thereby cloning into KS- a vector (Stratagene) containing either an (EcoRI / Sall-cloned) coding sequence of an anti-171 A / anti-CIZ bispecific single-stranded antibody with an N-terminal FLAG tag [1] or that of the modified version without FLAG / epitope (21) , thereby replacing anti-17-1 A- with antiC019 specificity and protecting the 5-amino acid (O ^ BegD-linker linking the C-terminal α I-SSZ scFv-fragment, respectively. Then, a DNA fragment, encoding both versions of the anti-CDl 9 / anti-SSZ bispecific single chain antibody with the arrangement of the domains VLcDis-VHcDis-VHcoj-VLcDa ^subcloned EcoRI / Sall into the described expression vector pEF-DHRF [1], respectively, The resulting plasmid DNAs were transfected into CHF-deficient DHFR cells by electroporation: Selection, gene amplification and protein production were performed as described [1]. The following examples illustrate the results obtained with the FLAG-containing version of bscCD19xCD3.

Purification of bscCD19xCD3 from the supernatant of transfected CHO cells yields 4 mg / Ι culture supernatant. bsc-Ab was purified by its C-terminal histidine tail by affinity chromatography on a Ni-NTA column as described [1]. bsc-Ab was eluted from the Ni-NTA column as a separate peak at a concentration of 200 mM imidazole.

SDS-Page was performed according to Laemmli [26] with a 12% gel followed by Coomassie brilliant blue R250 staining to analyze the purification of bsc-Ab. The results of the SDS-PAGE analysis (Fig. 1) show the expected size of bscAb (60 kDa).

Example 3. Binding properties of bscAbCD19xCD3

The binding properties of bsc-Ab to CD3 and CD 19 are shown by flow cytometric analysis of CD3-positive Jurkat cells, human PBMCs and a number of different cell lines of CD19-positive B cell lymphoma, including Blin I, SKW6.4, Daudi, B JAB and Raji. C019-positive B cells of Daudi, Raji, B JAB (Burkitt lymphoma), SKW6.4 (human EBV transformed B cells) and Blin1 (pre B cell line) were used in flow cytometric analysis and chromium release assay. Jurkat is a CD3-positive T cell line; BL60 and plasmacytoma cell lines NC1 and L363 are negative for both surface molecules, CD3 and CD 19. The cell lines are cultured in complete RPMI 1640 (Biochrom) medium with 10% FCS (GIBCO).

χ 10 ⁶ cells were washed with PBS, resuspended in 200 micro 1 PBS with 10% Vemimmun (Centeon, Marburg, Germany) and 0.1% NaN ₃ and incubated for 30 min at 4 ° C. After the centrifugation step (100 x g, 5 min), the cells were incubated in 50 micro 1 bscCD19xCD3 (200 micro g / ml in PBS with 10% Venimmun and 0.1% NaN ₃ ) for 30 min at 4 ° C. The cells were washed twice with PBS. A FITC-conjugated His-tag antibody (Dianova) was used to detect bsc-Ab. Irrelevant bsc-Ab 17-lAxCD3, obtained from the same expression system as bscCD19xCD3, or the His-tag antibody alone, serve as negative controls. Flow cytometry was performed with a Becton Dickinson FACScan. No binding was found on BL60s that did not express either CD 19 or CD3 (Fig. 2).

Example 4. Cytotoxic activity of bscAbCD19xCD3 against C019-positive lymphoma cells

The bscCD19xCD3 antibody was shown to be highly cytotoxic to several lymphoma cell lines in a ⁵¹ Cr release assay (Figure 3). Human peripheral blood mononuclear cells (PBMCs) were isolated from fresh wound skin as effector cells from arbitrary donors using Lymphoprep ™ (Nycomed) gradient centrifugation at 100 x g centrifugation steps to remove platelets. C019-positive B cells were depleted using Dynabeads® M-450 CD19 (Dynal). Depleted cell populations were analyzed by flow cytometry (Becton Dickinson) showing 99% depletion of CD19-positive cells. PBMCs were incubated overnight at 37 ° C, 5% CO ₂ CO-positive B cell lines (Raji, Blin I, Daudi, BJAB, SKW6.4) were used as target cells.

Cytotoxicity was measured in a standard chromium release assay in fertilized 96-well plates (Nunc) using RPMI 1640 complete medium (Biochrom) with 10% FCS (GIBCO).

Unstimulated PBMCs were added in amounts of 80 microl medium to each well containing 20 micro 1 bsc-Ab at various concentrations. Then, 100 micro 1 of ⁵¹ Target cells (1 × 10 ⁴ ) were added, the plates were centrifuged for 3 min at 100 x g and incubated for 4 h at 37 ° C, 5% CO ₂ . After an additional spin step, 50 micro 1 supernatants were removed and examined for the release of ⁵¹ Cr in a gamma counter (TopCount, Canberra Packard).

Spontaneous release was measured by incubation of target cells without effector cells or antibodies, with maximum release determined by incubation of target cells with 10% TritonX-100. Incubation of target cells with bscAb without effector cells does not result in measurable lysis. The percentage specific lysis was calculated by nonspecific release in (%) = [(cpm, experimental release) (cpm, spontaneous release)] / [(cpm, maximal release) - (cpm, spontaneous release)] x 100. All tests were performed in triplicate. The SD at triplicate for all experiments was below 6%. To mimic in vivo conditions, unstimulated PBMCs from healthy donors are used as effector cells. Rapid induction of cytotoxicity can be observed for up to 4 h without any protocol for pre-stimulation of T cells. As a control, the bsc-antibody has different tumor specificity (bsc 171AxCD3), but generated through the same system as the bscCD19xCD3 antibody exhibits lysis activity slightly above the mean background. Furthermore, no cytotoxic activity could be observed using plasmacytoma cell line NC1 and L363, which did not express CD19 as target cells (Figure 4). In competitive studies with increasing amounts of C019-specific parent monoclonal antibody HD37, the cytotoxic activity of bscCD19xCD3 could be almost completely blocked (Figure 5). These controls indicate that the bscCD 19xCO3-mediated cytotoxic effects are antigen specific. To obtain more information about the molecular mechanisms of how the bscCD19xCD3 antibody kills CD19positive target cells, an attempt was made to block bscCD 19xCO3-mediated cytotoxicity by EGTA. As shown in Figure 6, the cytotoxic activity of bscCD 19xCD3 can be completely blocked by EGTA, which means that specific lysis is more of a T-cell mediated effect (most likely via the perforin synthetic pathway) rather than a direct effect (e.g. apoptosis inducing antibody) of the antibody itself.

When unstimulated T cells are used, even at antibody concentrations below 1 ng / ml, a significant cytotoxic effect against Blin-Ι cells can be observed (Figure 7). Even at relatively low E: T ratios [5: 1; 2.5: 1] and at very high antibody concentrations of 10-100 pg / ml, the bscCD 19xCD3 antibody can rapidly induce specific cytotoxic activity of unstimulated T cells (Figure 7) . In contrast, a conventional CD19xCD3 antibody generated by a hybrid hybridoma technique [5-7, 27] showed no significant cytotoxic activity under these conditions, even at concentrations up to 3000 ng / ml (Figure 7). The conventional bispecific antibody needs additional T-cell prestimulation and high antibody concentrations of approximately 100 ng / ml to induce specific T-cell cytotoxicity (not shown), which is in accordance with the literature [5-7,27 ].

Example 5. Exhaustion of primary (malignant) B cells with autologous T cells by cytotoxic activity of bscCD 19xCD3

In order to determine the cytotoxic activity of bscCD 19xCD3 on primary malignant B cells, peripheral blood mononuclear cells (PBMCs) of a patient suffering from B-CLL (B cell derivative of chronic lymphatic leukemia) were isolated by Ficoll density gradient. These cells were sequentially cultured in the presence or absence of bscCD 19xCD3 for 5 days at 37 ° C / 5% CO ₂ in RPMI 1640 medium supplemented with 10% FCS and, optionally, 60 U / ml IL-2. Current cytometric analysis showed that peripheral blood (PBL) lymphocytes of this particular NHL (Non-Hodgkin lymphoma) -patient (who was then systematically treated with bscCD 19xCD3; see Example 7) contained 92.6% C019-positive B- cells (= target cells) and 7.4% CD3-positive T lymphocytes (= effector cells) at a CD4 / CD8 T-cell ratio of 2.6: 4.8. Most of these CD19-positive cells are composed of malignant cells. 3x10 ⁶ PBL / ml per well were sown in a volume of 1 ml for each in 24-well tissue culture dishes. For negative controls, culture medium supplemented with IL-2 and culture medium supplemented with IL-2 with the irrelevant bispecific single-stranded antibody bscl7-lAxCD3 (1) at a concentration of 0.5 micro g / ml. As shown in Figure 9, no depletion of CD19-bearing cells was detected under these conditions after 5 days of incubation. However, when bscCD 19xCD3 was added at concentrations of 0.5 micro g / ml or 0.05 micro g / ml (whether in the presence or absence of IL-2) almost all C019-positive B cells were killed. The culture cells at this time consist mainly of T lymphocytes with a CD4 / CD8 T cell ratio of approximately 1: 2 to 1: 3. This demonstrates the exceptional cytotoxicity of bscCD 19xCD3 to CD 19positive B cells, provided that the total depletion of primary B cells by autologous T cells can be induced by concentrations of only 50 ng / ml at an extremely unfavorable initial effector cell ratio targets below 1:10, even without IL2 or other supplemental T-cell stimulation.

Example 6. Purification of bscCD 19xCD3 for therapeutic use

BscCD19xCD3 was obtained from Chinese hamster ovary (CHO) cells stably transfected with an expression vector (pEFDHFR; see Example 2) encoding bscCD19xCD3 and, further, hexahistidine and the FLAG tag. Cells were grown in serum-free medium (Rencyte) in a hollow fiberglass reactor (Unisyn). Five thousand milliliters of cell culture supernatants were collected and sterile filtered through

0.2 micro m filter (AcroCap; Pall Gelman).

BscCD19xCD3 was detected and quantified by Western blotting using murine anti-FLAG IgG (Sigma) and alkaline phosphatase (Sigma) conjugated murine IgG. Detection was performed by chemiluminescence using a BCIP / NBT system (Devitron). Protein concentrations were determined by Bradford assay (Biorad) using bovine IgG (Biorad) as a protein standard. The purity of the column fractions was examined by reducing sodium dodecyl sulfate (SDS) Bis / Tris 4-12% gradient polyacrylamide gel electrophoresis (PAGE) using a MOPS buffer system (Novex).

Purification of bscCD 19xCD3 to homogeneity requires cation exchange chromatography, cobalt chelate affinity chromatography and, as a last step, gel filtration. These purification steps are carried out using standard protocols (see above). A flow chart of the purification method is shown in Figure 10.

Cation exchange chromatography: Cell culture supernatant of CHO cells was mixed with two volumes of C buffer (30 mM morpholinoethane sulfonic acid [MES], 20 mM NaCB, 3 mM EDTA, 0.3 mM benzamidine hydrochloride, pH 5.5) and passed through 70 ml- SP Sepharose Fast Flow cation exchange column (Pharmacia) at a flow rate of 20 ml / min. The column was equilibrated with buffer A (20 mM MES, 20 mM NaCe, pH 5.8). After washing with 5 volumes of column A with buffer A, bscCD 19xCD3 was eluted with a step gradient of 45% buffer B (20 mM MES, 1 M NaCB, pH 5.8) in buffer A. The eluate received 0.045 volumes 1 M Tris / HCl, pH 8.5 containing 47 mM imidazole then subjected to sterile filtration (0.2 µm; AcroCap). A typical elution profile of cation exchange chromatography is shown in Figure 12. BscCD 19xCD3 is contained in fraction 6.

Cobalt chelate affinity purification: The eluate from the cation exchange column was passed at a flow rate of 2.5 ml / min through 10 mlChelating Sepharose Fast Flow column (Pharmacia) equilibrated in AO buffer (50 mM Na ₂ HPO ₄ , 400 mM NaCl, pH 8.0). The column was pre-equilibrated with a solution of 0.1 M cobalt chloride. After washing with 33 volumes of column with buffer AO, buffer A (50 mM Na ₂ HPO ₄ , 400 mM NaCl, 2 mM imidazole, pH 6.4) and a gradient of ΟΙ 2% buffer B (50 mM NaHPO, 400 mM NaCl, 500 mM imidazole, pH 6.4) in buffer A, bscCD 19xCD3 was eluted in one step with 30 ml of 100% buffer B. The eluate was sterile filtered, followed by approximately 10-fold concentration in a MacroSep device (Pall Gelman; 10 kD cut-off ). A typical elution profile for cobalt chelate affinity chromatography is shown in Figure 13. BscCD19xCD3 is found in fraction No. 7.

Gel filtration: The concentrated eluate from the affinity column with cobalt chelate was passed at a flow rate of 0.75 ml / min through a 124 ml-High Load Superdex 200 column (Pharmacia; prep grade) equilibrated with phosphate buffered saline (Gibco). bscCD19xCD3 was eluted in a fraction with a molecule size corresponding to approximately 55 kDa (Figure 14, fraction No. 7). To the gel filtration fraction containing bscCD 19xCD3 was added 5% human serum albumin (Behring), followed by sterile filtration through a 0.1 micrometer filter (Millex; Millipore).

The abundance of bscCD 19xCD3 in cell culture supernatant and the various active fractions of the column, as analyzed by SDS-PAGE, are shown in Figure 11. bscCD 19xCD3 is the major open protein in cell culture supernatant (lane 2). High-purity anti-CD 19hanth-POPs used in human therapy did not show detectable impurities (Figure 11, lane 5).

Example 7. Clinical use of bscCD 19xCD3 in a patient with B-cell lymphoma

In voluntary use, a patient (AB, woman, born 1937) suffering from B-cell-derived chronic lymphatic leukemia (BCLL) is treated with a bispecific single-stranded bscCD 19xCD3 antibody.

Patient history and distribution:

The patient was diagnosed with B-CLL in 1992. During the initial diagnosis, the disease had affected areas of different lymph nodes and spleen; moreover, hemolytic anemia of autoimmune origin was observed as well as immunoglobulin deficiency. The patient has well-controlled struma nodosa and a normal thyroid condition by treatment with carbimazole 2.5 mg / d.

The patient received multiple cycles of chemotherapy with chlorambucil and prednisone from 1992 to 1994. Following the progression of the disease, treatment was changed to cyclophosphamide, dexorubicin, vincristine and prednisone (CHOP, 8 cycles) and remission was achieved for more than one year. At the next relapse, the patient received a further 6 cycles of CHOP, followed by chlorambucil and prednisone and a single dose of chlorambucil alone, which did not lead to any improvement in the disease. In December 1998, a spleen irradiation was performed to control the progression of splenomegaly in the patient. The patient undergoes severe bone marrow reduction with numerous infectious complications. Its anemia and thrombocytopenia require frequent red blood cell transfusions and platelet replacement.

Due to the advanced stage of the disease and the affected bone marrow function, more aggressive and higher doses of chemotherapy are not recommended for the patient. Treatment with antiCD20 antibody retuximab is not recommended because the efficacy of retuximab in B-CLL is not well understood so far.

FACS analysis showed that 95% of the patient's peripheral blood cells were CD19 positive cells, while 77% of the cells expressed the CD20 antigen. Incubation of peripheral blood cells of a patient with bscCD1 9xCD3 showed marked depletion of CD 19-positive B cells (see Example 5). For this reason, treating physicians have decided to treat the patient with the new bscCD 19xCD3 voluntarily. The patient was informed in detail of the novelty of the compound and of the potential risks and benefits of such treatment. She fully understood the explanations and gave written consent for voluntary use.

Description of clinical application:

Prior to initiation of treatment, the patient underwent a clinical examination and advanced diagnostic procedures to check the severity of the disease and to exclude any other risk factors. The patient is in good clinical condition with anemia, with thrombocytopenia and weight loss, but without any involvement of the cardiovascular system or any complications preventing the use of bscCD 19xCD3. The patient complains of a migraine headache the night before the first day of treatment. For the administration of HabscCD19xCD3, the patient is admitted to a hospital under enhanced surveillance to ensure prompt treatment for any emergencies that may arise. To prevent any acute cytokine reactions and complications of tumor lysis, the patient is prophylactically administered IV doses of 2 mg clemastine (Tavegil®) and 200 mg cimetidine (Tagamet®), as well as 300 mg allopurinol and 20 mg of omeprazole (Antra®).

Alkalisation and heparinization are performed during the treatment and the subsequent period. In addition, the patient received any necessary symptomatic treatment.

Blood samples were taken before and during drug administration to monitor biochemical, hematologic and immunological parameters.

1 applying bscCD 19xCD3 (April 14th. 1999):

The patient received a first dose of 3 micro g bscCD 19xCD3 as a 20-minute infusion in isotonic phosphate buffer containing 5% human serum albumin (HSA). The patient has no side effects during the infusion. Approximately 1 hour after the infusion, the patient experiences cold for about five minutes, followed by sweating, a slight drop in blood pressure of about 10 mm Hg, and a slight increase in body temperature (+ 0.5 ° C) for about a few hours. In addition, her headache is slightly exacerbated. The patient is treated with another 2 mg Tavegil® and 200 mg Tagamet®, 250 mg prednisolone (SoluDecortin®) and 50 mg pethidine (Dolantin®). All symptoms disappear without leaving any consequences for the next day.

^2nd implementation of bscCD19xCD3 (15 April 1999)

A second dose of 10 µg bscCD 19xCD3 was given one day later under the same conditions. About one hour after the infusion, the patient experienced severe cold, fever (39.2 ° C), slight increase in breathing and a fall in blood. The patient was treated with 2 mg Tavegil, 200 mg Tagamet and 300 mg Solu-Decortin and 15 mg pyritramide (Dipidolor®). To stabilize her cardiovascular function, the patient receives a dopamine infusion. After this treatment, the symptoms decrease significantly. However, the patient is transferred to the cardiology ward overnight to ensure constant monitoring of vital signs and prompt intervention if necessary. The patient is brought to a regular hospital room the next morning without any other complications.

Over the next three days, the patient continued to have a subfebrile temperature (about 37.2 ° C) and developed a minor pleural effusion one day after the second dose (April 16, 1999) and a slight swelling of the lower extremities (April 18, 1999). Cardiovascular function remains stable and laboratory studies show no significant changes in safety, except for an increase in gamaglutamyl transferase after the second dose of bscCD 19xCD3 (Figure 15).

Because bscCD19xCD3 is tolerated by the patient and side effects can be controlled by symptomatic treatment, administration of the new bscCD 19xCD3 will continue in that patient.

Clinical and immunological efficacy of bscCD 19xCD3:

Clinical results:

Ultrasound examination of the spleen and five abdominal axillary lymph nodes was performed one day before and four days after the second dose of bscCD 19xCD3. Already one day after the 10 micro g dose (April 16, 1999), the lymph nodes as well as the spleen show a contraction of about 20% compared to baseline values. This observation was confirmed at the second ultrasound examination on 19 April 1999. The spleen weight decreased to 350 g (from 1630 g baseline to 1280 g on 19 April 1999) (Table 1; Figure 16).

Hematological results:

The white blood cell count, which includes most malignant B cells, decreased during the course of treatment and subsequent days (Table 2; Figure 17). C-reactive protein (CRP) is an acute-phase reaction protein that reflects the activation and effect of inflammatory processes. It decreased markedly after administration of 10 micro g bscCD 19xCD3, followed by a continuous decrease over the next three days of observation (Table 2; Figure 18).

Immunological results

Serum cytokine levels, reflecting the acute immunological response to administration of the compound, are measured before and at different intervals after administration of the new compound. Serum cytokine and soluble IL-2 receptor levels were measured by quantitative ELISA according to the manufacturer's instructions.

Tumor necrosis factor TNF-alpha increased significantly in a dose-dependent manner during the first hour after administration of bscCD 19xCD3 (Figure 19).

Interleukin 6 (IL-6) and interleukin 8 (IL8) also show significant increases in a dose-dependent manner. Their maximum levels are observed 2 to 4 hours after administration of bscCD19xCD3 (Figures 20, 21). All cytokines returned to baseline within a few hours.

The soluble IL-2 receptor has already been raised to a baseline, which can be explained by the mass of malignant B cells expressing the IL-2 receptor. Following administration of the new bscCD 19xCD3, an increase in soluble IL-2 receptor was observed, indicating activation of effector cells (Figure 22).

Conclusions:

The new bscCD 19-CD3 is reliably administered to a patient suffering from refractory B-CLL. The tolerance of bscCD 19xCD3 at a dose of 3 microg and 10 microg is acceptable and can be well controlled through proliferation measurements and symptomatic treatment.

The new bscCD 19xCD3 causes the previously enlarged spleen and lymph nodes of the patient to contract, as shown in the ultrasound image. Because enlargement of the spleen and lymph nodes of the patient is caused by infiltration of malignant B cells, the contraction reflects the destruction of 5 malignant B cells as a result of administration of bscCD19xCD3.

In stark contrast to any other bispecific CD19xCD3 antibody known in the art, the bispecific CD19xCD3 antibody of the invention (bscCD19xCD3) exhibits clinical activity in B-cell non-Hodgkin lymphoma as measured by lymphoid contraction, treated with malignant B cells. Advantageously, bscCD19xCD3 has been shown to be clinically effective at surprisingly low doses well tolerated after systemic administration. Therefore, the clinical action of bscCD1 9xCD3 confirms its exceptional cytotoxic activity as determined in vitro.

The size of the sodium abdominal lymph nodes, one on the left and one on the right axillary lymph node and the spleen are determined and measured ultrasonically using a Toshiba SSA100 device. The dimensions are given in three dimensions and in mm. The weight of the spleen is calculated by its size and by the ultrasonic density.

TABLE 1:

Effect of bscCD19xCD3 on lymph node size and spleen in a patient with B-cell lymphoma cn σ>

co cn

Ε ε Well Well Well EE Ε Well Well Well Well 00 CD HG co co χφ • m- X T " t ^- see X— No X X X X X 00 CXI ο ο see see co V " ΓΊΠ co co co see see X X X X X X ID About CO see co G'- Fr. see CD CXI xt XT hf co co CXI

cn E E E cn cr> E E E co co CM - 4— No CM is; X X X s ο o co X— c co co co 03 X X X CD CM co co X " hf hf xf

E E E E Yu E XT co V " X X CM CM X X o CM CM co X cd o and ΧΦ χφ co co co co co CM No

cn cn σ>

Εζ

X CL 1 = <6

CM

E E E E E E E E xT 00 l · - co 4- CM r— X X X X cn CM co CM hf co co CM X X X X χφ co co co Yu Yu xr CO., LTD

E E E cn co co X X co ΧΦ hf CM X X o CD about co K co co CM

tK x X X (0 X m c; ex co d> X s X co 2 X o s m ID p < X m X CO., LTD X co cx 1— a s X c; co 5; X fi «=; m

TABLE 2: Blood levels of selection markers in response to treatment with bscCD19xCD3.

April 14, 1999 April 15, 1999 April 16, 1999 April 17, 1999 April 18, 1999 April 19, 1999 Units GGT I / O 22 24 (in the morning) (evening) 124 (6am) 107 (12.00 h) 96 89 87 LDH il 618 536 (in the morning) 773 (evening) 548 697 551 539 Leukocytes Gpt / I 46,8 43.3 (in the morning) 22.3 (Evening) 36,9 37,0 28,3 36,6 Lymphocytes % 85 58,8 (in the morning) 82,0 (evening) 60.9 64,4 65,5 88 CRP mg / dl <0.4 1.0 (morning) 0.7 (evening) 5.2 2.5 2.0 0.7

Blood levels of gamma-glutamyl transferase (GGT), lactate dehydrogenase (LDH) and C-reactive protein (CRP) are determined by standard clinical biochemical methods and expressed in units / ml (GGT), units / 1 5 (LDH) and mg / dl (CRP). The leukocyte count is expressed as Giga points / l and the lymphocyte count is represented as a percentage of total leukocytes. Baseline values on 14 April 1999, prior to treatment, are given in the first column. The response of 3 micro g bscCD 19xCD3 on 15 April 1999 (which was annexed on 14 April) is shown in the second column. The response of the second treatment with 10 micro g of the compound on the same day is shown in the third column. Blood levels of selection markers in the fourth day following drug treatment are given in the last columns.

LIST OF SEQUENCES (1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: DOERKEN, Bernd (B) STREET: Lyckallee 47 (C) CITY: Berlin (D) STATE: POPE (E) COUNTRY: Germany (F) POSTAL CODE (ZIP): 14055 (A) NAME: RIETHMUELLER, Bernd (B) STREET: Finauer Str. 12 (C) CITY: Munich (D) STATE: POPE (E) COUNTRY: Germany (F) ZIP CODE (ZIP): 80805 (ii) TITLE OF THE INVENTION:

CD 19 X CD3 SPECIFIC POLYPEPTIDES AND THEIR USE (iii) NUMBER OF SEQUENCES: 10 (iv) COMPUTER FORMAT:

(A) ENVIRONMENT: Flops (B) COMPUTER: IBM PC Compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentin Release # 1.0, Version # 1.30 (EPO) (2) SEQ ID Information NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) CHAIN: single (D) TOPOLOGY: linear (ii) MOLECULES TYPE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

GAAGCACGCG TAGATATCKT GMTSACCCAA WCTCCA 36 (2) SEQ ID NO: 2:

(i) HA SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) CHAIN: single (D) TOPOLOGY: linear (ii) MOLECULES TYPE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2

GAAGATGGAT CCAGCGGCCG CAGCATCAGC 30 (2) SEQ ID NO: 3:

(i) HA SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) CHAIN: single (D) TOPOLOGY: linear (ii) MOLECULES TYPE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

CAGCCGGCCA TGGCGCAGGT SCAGCTGCAG SAG 33 (2) SEQ ID NO: 4:

(i) HA SEQUENCE CHARACTERISTICS:

(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) CHAIN: single (D) TOPOLOGY: linear (ii) MOLECULES TYPE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

ACCAGGGGCC AGTGGATAGA CAAGCTTGGG TGTCGTTTT 39 (2) SEQ ID NO: 5:

(i) HA SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) CHAIN: single (D) TOPOLOGY: linear (ii) MOLECULES TYPE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

AGGTGTACAC CCATATSS A GCTG ACCCAG TCTCCA 36 (2) SEQ ID NO: 6:

(i) HA SEQUENCE CHARACTERISTICS:

(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) ERPITY: single (D) TOPOLOGY: linear (ii) MOLECULES TYPE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ IDNO: 6:

GGAGCCGCCGCCGCCAGAAC CACCACCTTTGATCTCGAGCTTGGTCCC 48 (2) SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) ERPITY: single (D) TOPOLOGY: linear (ii) MOLECULES TYPE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO: Ί:

GGCGGCGGCG GCTCCGGTGG TGGTGGTTCT CAGGTACTGC AGAGTCGG 48 (2) SEQ ID NO: 8:

(i) HA SEQUENCE CHARACTERISTICS:

(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) CHAIN: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleogide" HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

AATCCGGAGG AGACGGTGAC CGTGGTCCCTTGGCCCCAG 39 (2) SEQ ID NO: 9:

(i) HA SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1611 base pairs (B) TYPE: nucleic acid (C) CHAIN: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICS: NO (ix) PROPERTIES

(A) NAME / KEY: CDS (B) LOCATION: 11..1603 (xi) SEQUENCE DESCRIPTION: SEQ ID: 9:

Claims (28)

Claims A single-stranded multifunctional polypeptide comprising (a) a first domain comprising an immunoglobulin chain or antibody binding site specifically recognizing the CD19 antigen; and (b) a second domain comprising an immunoglobulin chain or antibody binding site specifically recognizing CD3 antigen in human T cells, characterized in that said domains are arranged in the following order V _L CD19V _H CD1 9-V _h CD3- In _l CD3. A polypeptide according to claim 1, characterized in that said two domains are linked by a polypeptide linker. A polypeptide according to claim 1 or 2, characterized in that the first and / or second domains resemble or correspond to the V _H and V _L regions of a naturally occurring antibody. A polypeptide according to any one of claims 1 to 3, characterized in that said antibody is a monoclonal antibody, a synthetic antibody or a humanized antibody. A polypeptide according to any one of claims 1 to 4, characterized in that at least one of said domains is a single-stranded fragment of the variable region of the antibody. A polypeptide according to any one of claims 2 to 5, characterized in that said polypeptide linker contains a plurality of glycine, alanine and / or serine residues. A polypeptide according to any one of claims 2 to 6, characterized in that said polypeptide linker comprises multiple consecutive copies of an amino acid sequence. A polypeptide according to any one of claims 2 to 7, characterized in that said polypeptide linker contains from 1 to 5 amino acid residues. A polypeptide according to any one of claims 2 to 8, characterized in that said polypeptide linker comprises the amino acid sequences: Gly Gly Gly Gly Ser. A polypeptide according to any one of claims 1 to 9, characterized in that said first domain contains at least one CDR of the V _H and V _L regions comprising the amino acid sequence encoded by the DNA sequence shown in Figure 8 from nucleotides 82 to 414 (V _L ) and nucleotide 460 to 831 (V _H ) and / or when said domain contains at least one CDR of V _H and V _L region comprising the amino acid sequence encoded by the DNA sequence shown in Figure 8 from nucleotides 847 to 1203 (V _H ) and nucleotides 1258 to 1575 (VJ. A polypeptide according to any one of claims 1 to 10, characterized in that (a) said first domain binding site has an affinity of at least about ^-7 M; and / or (b) said second domain binding site has an affinity of at least approximately 10- ⁷ M. A polypeptide according to any one of claims 1 to 11, characterized in that it is a bispecific single-stranded antibody. A polypeptide according to any one of claims 1 to 12, characterized in that it contains at least one other domain. A polypeptide according to claim 13, characterized in that said other domain is linked by covalent or non-covalent bonds. A polypeptide according to claim 13 or 14, characterized in that at least one other domain comprises an effector molecule with a composition suitable for biological activity, capable of releasing one ion or selectively binding to a solid carrier or to a pre-selected determinant. A polynucleotide which, upon expression, encodes a polypeptide according to any one of claims 1 to 15. A vector comprising a polynucleotide according to claim 16. A cell transfected with the polynucleotide of claim 16 or the vector of claim 17. A method for producing a polynucleotide according to any one of claims 1 to 15, characterized in that the cells according to claim 18 are cultured and the said polypeptide is isolated from the culture. A composition comprising a polypeptide according to any one of claims 1 to 15, a polynucleotide of claim 16 or a vector of claim 17. 21. The composition of claim 20, wherein it is a pharmaceutical composition, optionally including a pharmaceutically acceptable carrier. The composition according to claim 20, characterized in that it is a diagnostic composition, optionally including suitable means of determination. Use of the polypeptide according to any of claims 1 to 15, the polynucleotide of claim 16 or the vector of claim 17 for the preparation of a pharmaceutical composition for the treatment of B-cell malignancies, cell-mediated autoimmune diseases or B-cell depletion. Use according to claim 23, wherein said B-cell malignancy is B-cell lymphoma, non-Hodgkin lymphoma, or B-cell chronic lymphatic leukemia (B-CLL). Use according to claim 23, characterized in that said B-cell mediated autoimmune diseases are Myasthenia Gravis, Morbus Bazedov, Hashimoto thyroiditis or Goodpastur syndrome. Use of a polynucleotide according to claims 1 to 15, a polynucleotide according to claim 16, or a vector of claim 17 for the preparation of a pharmaceutical composition for delaying pathological conditions caused by Cellular disorders. Use of a polynucleotide according to claim 16 or a vector of claim 17 for the preparation of gene therapy compositions. 28. A method for identifying activators or inhibitors of T-cell activation or stimulation, comprising: (a) culturing T cells and CD19 positive cells, preferably B cells, in the presence of a polypeptide according to any one of claims 1 to 15 and, optionally, in the presence of a component capable of providing a signal that can is detected, in response to T-cell activation with a compound to be screened, under conditions under which T-cell activation is allowed, and (b) detecting the presence or absence of a signal generated by the interaction of the compound with the cells.