BE1028802A1 - DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE THE INTESTINAL MICROBIOTA OF PIGLETS AT WEANING TIME - Google Patents

DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE THE INTESTINAL MICROBIOTA OF PIGLETS AT WEANING TIME Download PDF

Info

Publication number
BE1028802A1
BE1028802A1 BE20205828A BE202005828A BE1028802A1 BE 1028802 A1 BE1028802 A1 BE 1028802A1 BE 20205828 A BE20205828 A BE 20205828A BE 202005828 A BE202005828 A BE 202005828A BE 1028802 A1 BE1028802 A1 BE 1028802A1
Authority
BE
Belgium
Prior art keywords
prebiotic
probiotic
composition according
animal
fermentation
Prior art date
Application number
BE20205828A
Other languages
French (fr)
Other versions
BE1028802B1 (en
Inventor
Van Lidth De Jeude Jehan Lienart
Elisa Martinez
Philippe Thonart
Nadia Everaert
Véronique Delcenserie
Sureda Ester Arevalo
Ahmed Sabri
Original Assignee
Le Centre Wallon De Rech Agronomiques
Aveve Biochem
Artechno Sa
Vesale Pharmaceutica
Univ Liege
Dumoulin Sa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Le Centre Wallon De Rech Agronomiques, Aveve Biochem, Artechno Sa, Vesale Pharmaceutica, Univ Liege, Dumoulin Sa filed Critical Le Centre Wallon De Rech Agronomiques
Priority to BE20205828A priority Critical patent/BE1028802B1/en
Priority to PCT/EP2021/081889 priority patent/WO2022101511A1/en
Priority to EP21815428.4A priority patent/EP4243626A1/en
Priority to CA3198168A priority patent/CA3198168A1/en
Publication of BE1028802A1 publication Critical patent/BE1028802A1/en
Application granted granted Critical
Publication of BE1028802B1 publication Critical patent/BE1028802B1/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K10/00Animal feeding-stuffs
    • A23K10/10Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A23K10/18Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions of live microorganisms
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/163Sugars; Polysaccharides
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K50/00Feeding-stuffs specially adapted for particular animals
    • A23K50/30Feeding-stuffs specially adapted for particular animals for swines
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K50/00Feeding-stuffs specially adapted for particular animals
    • A23K50/60Feeding-stuffs specially adapted for particular animals for weanlings
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135Bacteria or derivatives thereof, e.g. probiotics
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/20Reducing nutritive value; Dietetic products with reduced nutritive value
    • A23L33/21Addition of substantially indigestible substances, e.g. dietary fibres
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/40Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/702Oligosaccharides, i.e. having three to five saccharide radicals attached to each other by glycosidic linkages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/716Glucans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/733Fructosans, e.g. inulin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/742Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/745Bifidobacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Polymers & Plastics (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Animal Husbandry (AREA)
  • Nutrition Science (AREA)
  • Birds (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Physiology (AREA)
  • Pediatric Medicine (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Composition symbiotique administrable à l’animal, en particulier au mammifère, en particulier au porc, en particulier de l’animal en gestation et au nouveau-né, en particulier à la truie en gestation ou non et au porcelet comprenant au moins un probiotique et au moins un prébiotique pour le traitement ou la prévention de la dysbiose, caractérisée en ce que ledit au moins un probiotique et ledit au moins un prébiotique sont choisis de telle manière qu’ils génèrent ensemble un environnement anti-inflammatoire dans l’intestin dudit animal.Symbiotic composition which can be administered to animals, in particular to mammals, in particular to pigs, in particular to pregnant animals and to newborns, in particular to sows, whether or not pregnant, and to piglets, comprising at least one probiotic and at least one prebiotic for the treatment or prevention of dysbiosis, characterized in that said at least one probiotic and said at least one prebiotic are chosen such that they together generate an anti-inflammatory environment in the intestine of said animal .

Description

DÉVELOPPEMENT D'UNE COMPOSITION SYMBIOTIQUE COMME UN ADDITIF D'ALIMENTATION POUR LES PORCELETS OU LES TRUIES GESTANTES POUR MODULERDEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE

LE MICROBIOTE INTESTINAL DES PORCELETS AU TEMPS DU SEVRAGE La présente invention se rapporte à une composition symbiotique administrable à l'animal, en particulier au mammifère, en particulier au porc, de préférence à l'animal en gestation et au nouveau- né, en particulier à la truie en gestation ou non et au porcelet comprenant au moins un probiotique et au moins un prébiotique pour le traitement ou la prévention de la dysbiose intestinale, ladite composition étant administrée dans le but d'améliorer les conditions de santé du nouveau- né.THE INTESTINAL MICROBIOTA OF PIGLETS DURING WEANING The present invention relates to a symbiotic composition which can be administered to animals, in particular to mammals, in particular to pigs, preferably to pregnant animals and to newborns, in particular to pregnant or non-pregnant sows and to piglets comprising at least one probiotic and at least one prebiotic for the treatment or prevention of intestinal dysbiosis, said composition being administered for the purpose of improving the health conditions of the newborn.

La dysbiose intestinale est un déséquiliore du microbiote intestinal pouvant générer une prolifération de pathogènes (par ex E. coli) provoquant la diarrhée. Le microbiote est, quant à lui, défini comme l'ensemble des microorganismes présents dans un milieu déterminé (définition de l'office québécois de la langue française, 2008). Ce milieu determine est appelé microbiome. Le déséquiliore du microbiote intestinal se traduit par une réduction de la diversité des populations bactériennes et par un excès des bactéries pathogènes du microbiote. A l'inverse un microbiote équilioré dans la répartition des espèces de microorganismes qui le composent est dit en eubiose.Intestinal dysbiosis is an imbalance of the intestinal microbiota that can generate an overgrowth of pathogens (eg E. coli) causing diarrhea. The microbiota is defined as all the microorganisms present in a given environment (definition from the Quebec office of the French language, 2008). This determined environment is called the microbiome. The imbalance of the intestinal microbiota results in a reduction in the diversity of bacterial populations and an excess of pathogenic bacteria in the microbiota. Conversely, a microbiota balanced in the distribution of the species of microorganisms that compose it is said to be in eubiosis.

Le secteur de la production de viande grandit rapidement dans le monde, la production de porc augmente de manière régulière et représente l'un des plus gros consommateurs d'antibiotiques dans la production animale.The meat production sector is growing rapidly in the world, pork production is increasing steadily and represents one of the largest consumers of antibiotics in animal production.

Dans les fermes porcines, le sevrage (interruption de l'allaitement et changement vers une alimentation sèche) est une période associée à Un risque pour les jeunes animaux. Une problématique récurrente lors du sevrage des animaux est le risque accru de diarrnées résultant de la transition abrupte de régime alimentaire. Cette transition abrupte peut engendrer une dysbiose intestinale.On pig farms, weaning (stopping breastfeeding and switching to dry feed) is a period associated with a risk for young animals. A recurring problem when weaning animals is the increased risk of diarrhea resulting from the abrupt transition of diet. This abrupt transition can lead to intestinal dysbiosis.

Les diarrhées peuvent entraîner une perte de poids, voire la mort du nouveau-né dans des cas graves. Le traitement de routine ainsi que les procédures de prophylaxie appliquées pour la diarrnée détectée juste après la naissance du porcelet sont souvent peu efficaces.Diarrhea can lead to weight loss, even death of the newborn in severe cases. Routine treatment as well as prophylactic procedures applied for diarrhea detected just after the birth of the piglet are often not very effective.

Cette période de transition génère par ailleurs chez l'animal, en particulier chez le porcelet, un stress significatif au niveau comportemental, nutritionnel et environnemental, responsable d'une forte réduction dans la consommation de nourriture.This transition period also generates in the animal, in particular in the piglet, a significant stress at the behavioral, nutritional and environmental level, responsible for a strong reduction in food consumption.

Il est donc crucial de maîtriser ce risque de diarrhées car elles occasionnent une perte considérable pour les éleveurs puisqu'elles sont souvent associées à un taux de mortalité élevé, une perte de poids, un retard de croissance, et des coûts liés aux traitements.It is therefore crucial to control this risk of diarrhea because it causes a considerable loss for breeders since it is often associated with a high mortality rate, weight loss, stunted growth, and treatment-related costs.

Actuellement ce risque de diarrhées est maîtrisé par l'ajout d'additifs minéraux bactériostatiques (ZnO, CuSOQ4) dans le régime des porcelets sevrés mais, au-delà de la résistance déjà observée à ces composés, la pratique d'ajout d'additifs minéraux bactériostatiques mène à des problèmes environnementaux (contamination des eaux par les minéraux lessivés et contenus dans les effluents d'élevage).Currently this risk of diarrhea is controlled by the addition of bacteriostatic mineral additives (ZnO, CuSOQ4) in the diet of weaned piglets but, beyond the resistance already observed to these compounds, the practice of adding mineral additives bacteriostatic leads to environmental problems (contamination of water by leached minerals contained in livestock effluents).

L’ajout d'antibiotiques thérapeutiques dans la nourriture des animaux autour du sevrage est également une pratique courante. Ce traitement reste problématique car il induit la résistance des bactéries aux antibiotiques. Chez les animaux d'élevage, une utilisation aveugle d'antibiotiques peut également favoriser la dysbiose intestinale. De plus, sachant que la résistance aux antibiotiques augmente de plus en plus et en particulier chez les animaux d'élevage, la commission européenne a interdit depuis le Ier janvier 2006 l'utilisation des antibiotiques comme facteurs de croissance dans les aliments pour animaux.Adding therapeutic antibiotics to animal feed around weaning is also common practice. This treatment remains problematic because it induces the resistance of bacteria to antibiotics. In farm animals, indiscriminate use of antibiotics can also promote intestinal dysbiosis. Moreover, knowing that resistance to antibiotics is increasing more and more, particularly in farm animals, the European Commission has since January 1, 2006 banned the use of antibiotics as growth promoters in animal feed.

Compte tenu de la croissance de la démographie mondiale et de la demande croissante de viande dans le monde, il est donc crucial de trouver des solutions alternatives à l'usage des antibiotiques et des additifs minéraux pour réduire l'incidence et la sévérité des problèmes digestifs chez les animaux sevrés et, de manière plus générale, pour soutenir une croissance durable de l'industrie de la viande.Given the growth of global demography and the growing demand for meat in the world, it is therefore crucial to find alternative solutions to the use of antibiotics and mineral additives to reduce the incidence and severity of digestive problems. in weaned animals and, more generally, to support the sustainable growth of the meat industry.

AU vu de ce qui précède, des solutions alternatives aux antibiotiques et minéraux bactériostatiques ont été développées impliquant une utilisation optimale de probiotiques en combinaison ou non avec des prébiotiques.In view of the above, alternative solutions to antibiotics and bacteriostatic minerals have been developed involving optimal use of probiotics in combination or not with prebiotics.

D'une manière générale, une combinaison d'au moins un probiotique avec au moins un prébiotique est appelée un symbiotique, lorsque le prébiotique agit comme substrat en synergie avec le probiotique pour procurer un effet positif sur la santé, en particulier sur la digestion.Generally, a combination of at least one probiotic with at least one prebiotic is called a synbiotic, when the prebiotic acts as a substrate in synergy with the probiotic to provide a positive effect on health, in particular on digestion.

La digestion des protéines, des sucres et des graisses chez les individus monogastriques, et en particulier chez les porcs et la volaille, repose d'abord sur une digestion s'effectuant au niveau de l'estomac qui constitue un environnement acide entraînant une dénaturation des macromolécules pour former un digesta.The digestion of proteins, sugars and fats in monogastric individuals, and in particular in pigs and poultry, is based first on digestion taking place in the stomach, which constitutes an acid environment leading to denaturation of the macromolecules to form a digesta.

Le digesta arrive ensuite dans l'intestin et y subi encore une hydrolyse par action du suc pancréatique qui contient plusieurs protéases et par action des aminopeptidases et des dipeptidases intestinales.The digesta then arrives in the intestine and again undergoes hydrolysis there by the action of pancreatic juice which contains several proteases and by the action of aminopeptidases and intestinal dipeptidases.

L'absorption des produits de ces hydrolyses a lieu dans la partie supérieure de l'intestin grêle et tous les produits non digérés dans l'intestin grêle gagnent le gros intestin où ils sont soumis à l'action des microorganismes (microbiote intestinal) en entraînant une fermentation.The absorption of the products of these hydrolyses takes place in the upper part of the small intestine and all the undigested products in the small intestine reach the large intestine where they are subjected to the action of microorganisms (intestinal microbiota) resulting in a fermentation.

Il existe de nombreuses publications qui confirment le rôle indispensable du microbiote intestinal sur la santé des animaux (et des humains). Le microbiote intestinal interagit aussi de manière permanente avec le système immunitaire présent dans la paroi intestinale. Certaines études ont aussi démontré la capacité des probiotiques et/ou des prébiotiques à rééquilibrer le microbiote intestinal et leur utilité sur la santé intestinale par effets généralement directs et à court-terme.There are many publications that confirm the indispensable role of the intestinal microbiota on the health of animals (and humans). The intestinal microbiota also interacts permanently with the immune system present in the intestinal wall. Some studies have also demonstrated the ability of probiotics and/or prebiotics to rebalance the intestinal microbiota and their usefulness on intestinal health through generally direct and short-term effects.

L'Organisation mondiale de la Santé (OMS) et l'Organisation des Nations unies pour l'alimentation et l'agriculture (FAO) ont définis les probiotiques comme étant des « micro-organismes vivants qui, lorsqu'ils sont ingérés en quantité suffisante, exercent des effets positifs sur Ia santé, au-delà des effets nutritionnels traditionnels ». || existe des définitions plus lorges qui ne font pas référence à l'alimentation, et où le mot « ingérés » peut être remplacé par « administrés ».The World Health Organization (WHO) and the Food and Agriculture Organization of the United Nations (FAO) have defined probiotics as "living microorganisms which, when ingested in sufficient quantity , exert positive effects on health, beyond the traditional nutritional effects”. || there are longer definitions which do not refer to food, and where the word "ingested" can be replaced by "administered".

Bien que ies gens pensent souvent aux bactéries et autres micro-organismes comme des « germes » nocifs, beaucoup sont en fait Utiles. Certaines bactéries aident à digérer les aliments, à détruire les cellules pathogènes ou à produire des vitamines. Beaucoup de micro- organismes dans les produits problotigues sont les mêmes que ou similaires aux micro-organismes qui Vivent naturellement, de manière endogène, dans notre corps.Although people often think of bacteria and other microorganisms as harmful "germs", many are actually helpful. Some bacteria help digest food, destroy pathogenic cells or produce vitamins. Many of the microorganisms in the problotigues products are the same or similar to the microorganisms that live naturally, endogenously, in our bodies.

Sans être exhaustif, les probiotiques comprennent différents microorganismes comme les bactéries Bacillus coagulans, Bacillus subtilis, Bifidobacterium animalis lactis, Lactobacillus rhamnosus, Bacillus licheniformis, Lactobacillus plantarum, Bifidobacterium thermophilum, Clostridium butyricum, Enterococcus faecium, Bifidobacterium crudilactis, Bifidobacterium mongoliense, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus salivarius, Lactobacillus helveticus, Lactobacillus crispatus, Lactobacillus pontis, Lactobacillus johnsoni, Bifidobacterium infantis, Bifidobacterium longum, Collinsella tTanakaei, Pediococcus acidilacticiici, Faecalibacterium prausniizi, 5 Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus. Les bactéries probiotiques les plus courantes étant celles du genre lactobacilus et Bifidobacierium. Les probiotiques comprennent également des levures comme Saccharomyces boulordii_ (Sanders M.E. « Probiotics, strains matter», Functional foods & nutraceuticais IO magazine, 2007, 36-41}.Without being exhaustive, probiotics include various microorganisms such as bacteria Bacillus coagulans, Bacillus subtilis, Bifidobacterium animalis lactis, Lactobacillus rhamnosus, Bacillus licheniformis, Lactobacillus plantarum, Bifidobacterium thermophilum, Clostridium butyricum, Enterococcus faecium, Bifidobacterium crudilactis, Bifidobacterium mongoliense, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus salivarius, Lactobacillus helveticus, Lactobacillus crispatus, Lactobacillus pontis, Lactobacillus johnsoni, Bifidobacterium infantis, Bifidobacterium longum, Collinsella tTanakaei, Pediococcus acidilacticiici, Faecalibacterium prausniizi, 5 Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticustipes. The most common probiotic bacteria are those of the Lactobacilus and Bifidobacierium genus. Probiotics also include yeasts like Saccharomyces boulordii_ (Sanders M.E. "Probiotics, strains matter", Functional foods & nutraceuticals IO magazine, 2007, 36-41}.

Les prébiotiques, quant à eux, sont des substrats utilisés de manière sélective par les micro-organismes de l'hôte qui stimulent sélectiivement la croissance ou l'activité de micro-organismes souhdaitabies (Expert consensus document: The International Scientific Association for Probiotics and Prebiotics (ISAFP} consensus statement on the definition and scope of prebiotics, Nature Reviews (Gastroenterology & Hepatoiogy, 2017, 14, 491-502, https://doi.org/10.1038/nrgastro.201 7.75).Prebiotics, on the other hand, are substrates used selectively by host microorganisms that selectively stimulate the growth or activity of desirable microorganisms (Expert consensus document: The International Scientific Association for Probiotics and Prebiotics (ISAFP} consensus statement on the definition and scope of prebiotics, Nature Reviews (Gastroenterology & Hepatoiogy, 2017, 14, 491-502, https://doi.org/10.1038/nrgastro.201 7.75).

Sans être exhaustif, les prébiotiques comprennent entre autres l'inuline, le beta-glucane, le 2'-Fucosyllactose (2FL), des oligosaccharides comme les galactooligosaccharides (GOS), fructooligosaccharides (FOS), mannanoligosaccharide (MOS), xylooligosaccharide (XOS), acide gras polyinsaturés (polyunsaturated fatty acid: PUFA), acide linoléique conjugué (ALC).Without being exhaustive, prebiotics include, among others, inulin, beta-glucan, 2'-Fucosyllactose (2FL), oligosaccharides such as galactooligosaccharides (GOS), fructooligosaccharides (FOS), mannanoligosaccharide (MOS), xylooligosaccharide (XOS) , polyunsaturated fatty acid (PUFA), conjugated linoleic acid (CLA).

Une formulation combinant au moins un probiotique en association avec au moins un prébiotique pour prévenir et traiter les infections bactériennes pouvant mener à la diarrhée, augmenter le poids de l'animal et promouvoir la croissance est connue du document WO2014049023. Le document WO2014049023 décrit des produits et compositions pouvant être bénéfiques en élevage. Lesdits produits et compositions qui y sont décrites comprennent des microorganismes, tels que des bactéries, en particulier des bactéries probiotiques. Les souches, ainsi que les compositions les comprenant, peuvent être administrées à des animaux, de préférence à des animaux d'élevage, tels que les porcs. L'administration peut avoir lieu dans les premiers jours de vie. Selon ce document, l'administration des produits ou des compositions favorise la croissance animale et la prise de poids de l'animal. Les infections bactériennes peuvent également être prévenues ou traitées par lesdits composés ou compositions.A formulation combining at least one probiotic in combination with at least one prebiotic to prevent and treat bacterial infections that can lead to diarrhea, increase the weight of the animal and promote growth is known from document WO2014049023. The document WO2014049023 describes products and compositions which can be beneficial in breeding. Said products and compositions described therein comprise microorganisms, such as bacteria, in particular probiotic bacteria. The strains, as well as the compositions comprising them, can be administered to animals, preferably to farm animals, such as pigs. The administration can take place in the first days of life. According to this document, the administration of the products or compositions promotes animal growth and the weight gain of the animal. Bacterial infections can also be prevented or treated by said compounds or compositions.

Le document WO2018002671 divulgue une composition pour le traitement et/ou la nutrition de volailles telles que des poulets de chair comprenant (1) un probiotique commensal choisi parmi Bifidobacterium animalis, Collinsella Tanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilacticiici, Lactobacillus pontis, Faecalibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, Butyricicoccus, Lactobacillus johnsoni et Ruminococcus sp.; et (ii) un prébiotigue. Ce document divulgue également l'utilisation d'une telle composition pour le traitement des maladies entériques chez les volailles, telles que l'entérite nécrotique.Document WO2018002671 discloses a composition for the treatment and/or nutrition of poultry such as broilers comprising (1) a commensal probiotic chosen from Bifidobacterium animalis, Collinsella Tanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilacticiici, Lactobacillus pontis , Faecalibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, Butyricicoccus, Lactobacillus johnsoni and Ruminococcus sp.; and (ii) a prebiotic. This document also discloses the use of such a composition for the treatment of enteric diseases in poultry, such as necrotic enteritis.

Le document WO20061334/72A1 concerne un additif alimentaire et/ou additif pour l'eau potable animale ou humaine favorisant la santé ou la croissance de probiotiques. Ce document concerne en outre une utilisation de l'additif alimentaire humain et animal et/ou de l'eau potable, notamment pour la prévention de l'effet néfaste d'un certain nombre de germes indésirables dans le système digestif des animaux et/ou des oiseaux domestiques.The document WO20061334/72A1 relates to a food additive and/or additive for animal or human drinking water promoting the health or the growth of probiotics. This document also relates to a use of the human and animal food additive and/or drinking water, in particular for the prevention of the harmful effect of a certain number of undesirable germs in the digestive system of animals and/or domestic birds.

Finalement, le document WO2017156548A1 concerne certains aliments comprenant un composant nutrittonnel fermentescible et un composant probiotique, où le composant probiotique est sélectionné, sur la base de critères génétiques et/ou métaboliques, pour métaboliser spécifiquement tout monomère de sucre libre (Free Sugar Monomers (FSM)) ou tout acide aminé libre (Free Amino Acids (FAA)) ou peptide qui s'accumulent dans l'intestin grêle et le gros intestin en raison de la composante nutritonnelle fermentescible, qui, sans cette métabolisation seraient fermentés et métabolisés par des bactéries moins adaptées / opportunistes, créant des efflorescences de bactéries intestinales délétères et déplaçant le microbiome vers un potentiel état de dysbiose.Finally, the document WO2017156548A1 relates to certain foods comprising a fermentable nutritional component and a probiotic component, where the probiotic component is selected, on the basis of genetic and/or metabolic criteria, to specifically metabolize any free sugar monomer (Free Sugar Monomers (FSM )) or any free amino acid (Free Amino Acids (FAA)) or peptide which accumulate in the small and large intestines due to the fermentable nutrient component, which without this metabolization would be fermented and metabolized by bacteria less adaptive/opportunistic, creating blooms of deleterious gut bacteria and shifting the microbiome to a potential state of dysbiosis.

Malheureusement, les formulations connues sont essentiellement utilisées comme agent thérapeutique de dysbiose ou de déséquiliore du microbiome chez l'animal d'élevage. Les effets démontrés in vivo par ces formulations restent très généraux comme la prise de poids ou le pourcentage de mortalité de l'animal. De nombreux probiotiques sont décrits en association avec n'importe quel prébiotique dans des bouts bien divers.Unfortunately, the known formulations are essentially used as a therapeutic agent for dysbiosis or imbalance of the microbiome in farm animals. The effects demonstrated in vivo by these formulations remain very general, such as weight gain or the percentage of animal mortality. Many probiotics are described in combination with any prebiotic in a variety of ways.

En outre, selon Barba-Vidal et col. Animal, 2018, 12, 2489-2498, DOI: 10.1017/S1751731118000873, il existe un manque criant de reproductibilité au niveau des expérimentations montrant l'effet bénéfique des probiotiques.Furthermore, according to Barba-Vidal et al. Animal, 2018, 12, 2489-2498, DOI: 10.1017/S1751731118000873, there is a glaring lack of reproducibility in experiments showing the beneficial effect of probiotics.

La présente invention vise donc à procurer une formulation symbiotique qui a un effet qui se maintient dans le temps en agissant spécifiquement sur la modulation du microbiote de manière précoce, favorisant ainsi une eubiose intestinale de manière fiable.The present invention therefore aims to provide a symbiotic formulation which has an effect which is maintained over time by acting specifically on the modulation of the microbiota in an early manner, thus promoting intestinal eubiosis in a reliable manner.

En effet, selon la présente invention, une composition symbiotique d'au moins un prébiotique et d'au moins un probiotique aurait non seulement un effet thérapeutique mais également un impact prophylactique sur la modulation du microbiote de l'hôte pour une action à plus long terme. Il est en effet décrit par Nauta et col. AM. J. Clin. Nutr. 2013, 98 :5865-935, DOI: 10.3945/cjon.112.039644 que la modulation du microbiote grâce à une alimentation adaptée durant la gestation et juste après la naissance peut en effet favoriser la digestion, l'homéostasie métabolique et le développement immunologique.Indeed, according to the present invention, a symbiotic composition of at least one prebiotic and at least one probiotic would not only have a therapeutic effect but also a prophylactic impact on the modulation of the host microbiota for a longer-lasting action. term. It is indeed described by Nauta et al. AM. J. Clin. Nutr. 2013, 98:5865-935, DOI: 10.3945/cjon.112.039644 that modulating the microbiota through an appropriate diet during gestation and just after birth can indeed promote digestion, metabolic homeostasis and immunological development.

Les interventions à la fin de la gestation de la truie et/ou dès la naissance du porcelet devraient permettre par le principe de la programmation précoce d'influencer de manière optimale et durable le bon développement du microbiote du nouveau-né. Par conséquent, les effets positifs pour Ia santé de l'animal ne seraient pas observés seulement en début de vie et durant les 3-4 semaines après le sevrage mais ils resteraient aussi observables au long de la vie adulte.Interventions at the end of the sow's gestation and/or from the birth of the piglet should allow, by the principle of early programming, to influence in an optimal and lasting way the good development of the microbiota of the newborn. Consequently, the positive effects for the animal's health would not only be observed at the start of life and during the 3-4 weeks after weaning, but they would also remain observable throughout adult life.

La première colonisation intestinale du porcelet par le microbiote maternel au moment de la mise bas est cruciale pour l'établissement d'un microbiote intestinal favorable du nouveau-né, mais la composition du microbiote peut être influencée par de nombreux facteurs tels que des antibiotiques, la nourriture, l'environnement, les agents infectieux, etc.The first intestinal colonization of the piglet by the maternal microbiota at the time of farrowing is crucial for the establishment of a favorable intestinal microbiota of the newborn, but the composition of the microbiota can be influenced by many factors such as antibiotics, food, environment, infectious agents, etc.

La présente invention entend donc pallier les inconvénients précités en procurant une composition telle qu’'indiquée précédemment caractérisée en ce que ledit au Moins Un probiotique et ledit au moins Un prébiotique sont choisis de telle manière qu'ils génèrent ensemble un environnement anti-inflammatoire dans l'estomac et/ou l'intestin dudit animal, en particulier du mammifère, en particulier du porc, de préférence de l'animal en gestation et du nouveau-né, en particulier de la truie en gestation ou non et du porcelet, dans le but d'améliorer les conditions de santé du nouveau-né.The present invention therefore intends to overcome the aforementioned drawbacks by providing a composition as indicated above, characterized in that said at least one probiotic and said at least one prebiotic are chosen in such a way that they together generate an anti-inflammatory environment in the stomach and/or the intestine of the said animal, in particular of the mammal, in particular of the pig, preferably of the animal in gestation and of the newborn, in particular of the sow in gestation or not and of the piglet, in the aim of improving the health conditions of the newborn.

Selon la présente invention, il a en effet été mis en évidence qu'il était possible de mettre à disposition une formulation symbiotique qui génère de manière démontrée et reproductible Un environnement anti- inflammatoire dans le système digestif, tant de l'animal en gestation que plus tard du nouveau-né, lequel se maintient dans le temps pour protéger l'animal contre des dysbioses ultérieures.According to the present invention, it has in fact been demonstrated that it is possible to provide a symbiotic formulation which generates in a demonstrated and reproducible manner an anti-inflammatory environment in the digestive system, both of the animal in gestation and later in the newborn, which is maintained over time to protect the animal against subsequent dysbiosis.

La formulation symbiotique selon la présente invention permettant de moduler le microbiote du fœtus dans un animal en gestation ou du nouveau-né permettra d'avoir un effet prophylactique maximal et assurera une croissance et un développement optimal de l'animal.The symbiotic formulation according to the present invention making it possible to modulate the microbiota of the fetus in a pregnant or newborn animal will make it possible to have a maximum prophylactic effect and will ensure optimal growth and development of the animal.

En effet, la formulation selon la présente invention favorise une flore intestinale saine qui protège ainsi l'animal qui l'ingère, en particulier lorsque celle-ci est ingérée par la femelle en gestation par la génération démontrée et reproductible d'un environnement anti- inflammatoire dans l'estomac et/ou l'intestin, et ce de manière systématique.Indeed, the formulation according to the present invention promotes a healthy intestinal flora which thus protects the animal which ingests it, in particular when the latter is ingested by the pregnant female by the demonstrated and reproducible generation of an anti- inflammation in the stomach and/or the intestine, and this in a systematic way.

En effet, il est crucial d'analyser l'impact des probiotiques à travers 3 critères importants : la concentration en cellules viables, l'effet bénéfique sur la croissance de l'hôte et l'effet bénéfique sur le fonctionnement du tube digestif grâce notamment à un impact anti- inflammatoire (Markowiak P. et Slizewska K., Gut Pathog. 2018, 10, 21, doi: 10.1186/s13099).Indeed, it is crucial to analyze the impact of probiotics through 3 important criteria: the concentration of viable cells, the beneficial effect on the growth of the host and the beneficial effect on the functioning of the digestive tract thanks in particular with an anti-inflammatory impact (Markowiak P. and Slizewska K., Gut Pathog. 2018, 10, 21, doi: 10.1186/s13099).

La formulation symbiotique selon la présente invention procure une solution efficace contre la dysbiose et le problème de diarrhée survenant lors du sevrage, dont le probiotique et le prébiotique sont choisis spécifiquement non pas uniquement sur la viabilité cellulaire, mais pour leurs effets associés sur la viabilité cellulaire et sur la réponse anti-inflammatoire du microbiote de l'hôte.The symbiotic formulation according to the present invention provides an effective solution against dysbiosis and the problem of diarrhea occurring during weaning, of which the probiotic and the prebiotic are chosen specifically not only on cell viability, but for their associated effects on cell viability. and on the anti-inflammatory response of the host microbiota.

| a en effet été démontré selon la présente invention que la formulation symbiotique contenant un probiotique et un prébiotique produit une diminution de la production d'IL-8 en test in vitro, et une augmentation des acides gras à courtes chaînes « Short Chain Fatty Acids, SCFAs » ainsi qu’une amélioration de la diversité et de la quantité des populations bactériennes endogènes comme les Lactobacillus et les Bifidobacteria ainsi que les bactéries intervenant dans les voies métaboliques de production du butyrate ou d'autres acides gras à chaines courtes. Le probiotique et le prébiotique, ensemble, forment un microbiote intestinal équillioré, conduisant de cette manière à la génération ensemble d'un environnement anti-inflammatoire dans le système digestif de l'animal, en particulier du mammifère, en particulier du porc, de préférence de l'animal en gestation et du nouveau-né, en particulier de la truie en gestation ou non et du porcelet.| has in fact been demonstrated according to the present invention that the symbiotic formulation containing a probiotic and a prebiotic produces a reduction in the production of IL-8 in an in vitro test, and an increase in short chain fatty acids "Short Chain Fatty Acids, SCFAs” as well as an improvement in the diversity and quantity of endogenous bacterial populations such as Lactobacillus and Bifidobacteria as well as bacteria involved in the metabolic pathways for the production of butyrate or other short-chain fatty acids. The probiotic and the prebiotic together form an enhanced gut microbiota, thereby leading to the generation together of an anti-inflammatory environment in the digestive system of the animal, especially the mammal, especially the pig, preferably of the animal in gestation and the newborn, in particular of the sow, whether pregnant or not, and of the piglet.

En effet, ces indicateurs sont importants car il a été montré qu'un environnement inflammatoire du tractus gasitrointestinal peut générer une dysbiose intestinale (Zeng et col., Mucosal Immunol., 2017, 10,18-26, doi: 10.1038/mi.2016.75). II a également été montré que les « Short Chain Fatty Acids, SCFA » peuvent avoir additionnellement un effet bénéfique de régulateurs immunologiques sur l'environnement gastro- intestinal (Parada Venegas et col. Frontiers in Immunology, 2019, 10, doi:10.3389/fimmu.2019.00277). Les SCFAs sont des acides gras à courtes chaînes, produits par le processus de fermentation dans le colon. L'acétate, le propionate et le butyrate sont les trois principaux SCFAs. Le butyrate est particulièrement important pour le bon fonctionnement du colon car il est la source d'énergie principale des colonocytes (cellules épithéliales du colon). Les SCFAs peuvent également réduire la réponse pro-inflammatoire des cellules épithéliales de l'intestin (Iraporda C. et col., Immunology, 2015 10:1161-1169. https://doi.org/10.1016/j.imbio.2015.06.004).Indeed, these indicators are important because it has been shown that an inflammatory environment of the gastrointestinal tract can generate intestinal dysbiosis (Zeng et al., Mucosal Immunol., 2017, 10,18-26, doi: 10.1038/mi.2016.75 ). It has also been shown that “Short Chain Fatty Acids, SCFA” may additionally have a beneficial effect of immunological regulators on the gastrointestinal environment (Parada Venegas et al. Frontiers in Immunology, 2019, 10, doi:10.3389/fimmu .2019.00277). SCFAs are short chain fatty acids produced by the fermentation process in the colon. Acetate, propionate and butyrate are the three main SCFAs. Butyrate is particularly important for the proper functioning of the colon because it is the main source of energy for colonocytes (colon epithelial cells). SCFAs can also reduce the pro-inflammatory response of gut epithelial cells (Iraporda C. et al., Immunology, 2015 10:1161-1169. https://doi.org/10.1016/j.imbio.2015.06. 004).

Administrée à l'animal, en particulier au mammifère, en particulier au porc, de préférence à l'animal en gestation, et au nouveau- né, en particulier à la truie en gestation ou non et au porcelet, la formulation symbiotique selon la présente invention favorise l'établissement d'un microbiote intestinal équilioré de manière très précoce, protégeant l'animal, le mammifère, le porc ou l’animal en gestation ou encore le nouveau-né, plus particulièrement la truie en gestation ou le porcelet de manière soutenue dans le temps contre la dysbiose par le probiotique et le prébiotique qu'elle contient, lesquels génèrent ensemble Un environnement anti-inflammatoire.Administered to the animal, in particular to the mammal, in particular to the pig, preferably to the pregnant animal, and to the newborn, in particular to the pregnant or non-pregnant sow and to the piglet, the symbiotic formulation according to the present invention promotes the establishment of a balanced intestinal microbiota very early, protecting the animal, the mammal, the pig or the animal in gestation or even the newborn, more particularly the sow in gestation or the piglet in a sustained over time against dysbiosis by the probiotic and prebiotic it contains, which together generate an anti-inflammatory environment.

Dans une forme de réalisation préférentielle de la présente invention, ledit probiotique est choisi dans le groupe des bactéries Bifidobacterium thermophilum, Enterococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis.In a preferred embodiment of the present invention, said probiotic is chosen from the group of bacteria Bifidobacterium thermophilum, Enterococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis.

Selon la présente invention, Bifidobacterium thermophilum provient de la Belgian Coordinated Collections of Microorganisms (BCCM/LMG Gent) répertoriée sous le numéro 18892, Enterococcus faecium (LMG S-28935), Bifidobacterium animalis lactis est une souche déposée à la Belgian Coordinated Collections of Microorganisms (BCCM/LMG Gent) ayant le numéro de dépôt LMG P-28149, Clostridium butyricum (LMG1217), Bifidobacterium crudilactis est une souche déposée à la Collection Nationale de Cultures de Micro-organismes (CNCM, Institut Pasteur) ayant le numéro de dépôt (CNCM |-3342) dans le cadre du document WO2006122850.According to the present invention, Bifidobacterium thermophilum comes from the Belgian Coordinated Collections of Microorganisms (BCCM/LMG Gent) listed under number 18892, Enterococcus faecium (LMG S-28935), Bifidobacterium animalis lactis is a strain deposited at the Belgian Coordinated Collections of Microorganisms (BCCM/LMG Gent) having the deposit number LMG P-28149, Clostridium butyricum (LMG1217), Bifidobacterium crudilactis is a strain deposited at the National Collection of Microorganism Cultures (CNCM, Institut Pasteur) having the deposit number ( CNCM |-3342) in the context of document WO2006122850.

Dans une forme particulière de la présente invention, ledit prébiotique est choisi dans le groupe comprenant l'inuline, le B-glucane, 2'Fucosyllactose, GOS/FOS, l'amidon résistant.In a particular form of the present invention, said prebiotic is chosen from the group comprising inulin, B-glucan, 2′ Fucosyllactose, GOS/FOS, resistant starch.

De préférence, selon l'invention, ladite composition symbiotique est caractérisée en ce que ledit au moins un probiotique et ledit au moins un prébiotique génèrent ensemble une augmentation des concentrations en populations bactériennes endogènes favorables au microbiote intestinal telles que les Lactobacillus et les Bifidobacteria. Avantageusement, cette augmentation des concentrations en populations bactériennes génère un meilleur équiliore du microbiote intestinal de l'hôte diminuant le risque de dysbiose intestinal. Avantageusement, selon l'invention, ladite composition symbiotique est caractérisée, de préférence, en ce que ledit au moins un probiotique et ledit au moins un prébiotique génèrent ensemble une réduction de la concentration d'IL8 d'au moins 10% formant ledit environnement anti-inflammatoire. Dans le cadre de la présente invention, la concentration d'IL-8 a été mesurée grâce à des tests in vitro sur des cellules IPEC_J2 en présence du jus de fermentation (contenant ou non la composition symbiotique à tester).Preferably, according to the invention, said symbiotic composition is characterized in that said at least one probiotic and said at least one prebiotic together generate an increase in the concentrations of endogenous bacterial populations favorable to the intestinal microbiota, such as Lactobacillus and Bifidobacteria. Advantageously, this increase in bacterial population concentrations generates a better balance of the host's intestinal microbiota, reducing the risk of intestinal dysbiosis. Advantageously, according to the invention, said symbiotic composition is characterized, preferably, in that said at least one probiotic and said at least one prebiotic together generate a reduction in the concentration of IL8 of at least 10% forming said anti-inflammatory environment. -inflammatory. In the context of the present invention, the concentration of IL-8 was measured using in vitro tests on IPEC_J2 cells in the presence of the fermentation juice (containing or not containing the symbiotic composition to be tested).

Avaniageusement, selon l'invention, ladite composition symbiotique est caractérisée, de préférence, en ce que ledit au moins un probiotique et ledit au moins un prébiotique génèrent ensemble une stabilisation ou une augmentation de la sécrétion d'acides gras à courte chaîne (SCFA's) par le microbiote intestinal. Les SCFAs ont en effet un rôle bénéfique multiple au niveau de l'intestin : le butyrate, notamment, a un rôle régulateur dans le transport de fluide transépithélial. II améliore également l'état oxydatif et l'inhibition de inflammation de la muqueuse de l'intestin, il renforce la barrière de défense épithéliale, il module la sensibilité viscérale et la mobilité instestinale (Canani, R.B. et col. World J.Advantageously, according to the invention, said symbiotic composition is preferably characterized in that said at least one probiotic and said at least one prebiotic together generate a stabilization or an increase in the secretion of short-chain fatty acids (SCFA's) by the gut microbiota. SCFAs have a multiple beneficial role in the intestine: butyrate, in particular, has a regulatory role in the transport of transepithelial fluid. It also improves the oxidative state and the inhibition of inflammation of the intestinal mucosa, it reinforces the epithelial defense barrier, it modulates visceral sensitivity and intestinal mobility (Canani, R.B. et al. World J.

Gastroenterol., 2011, 17 : 1519-1528, doi: 10.3748/wjg.v17.i12.1519).Gastroenterol., 2011, 17: 1519-1528, doi: 10.3748/wjg.v17.i12.1519).

De préférence, selon l'invention, lesdits SCFAs sont choisis parmi le butyrate, le propionate, l'acétate, le lactate ou leurs combinaisons.Preferably, according to the invention, said SCFAs are chosen from butyrate, propionate, acetate, lactate or combinations thereof.

Dans le cadre de la présente invention, la production desdits SCFAs est mesurée grâce au modèle in vitro fermentation statique détaillé plus en détails ci-après.In the context of the present invention, the production of said SCFAs is measured using the in vitro static fermentation model detailed in more detail below.

De préférence, selon l'invention, Ia composition symbiotique est caractérisée en ce que ledit au moins un probiotique et ledit au moins un prébiotique est choisi dans le groupe constitué de Bifidobacterium thermophilum et inuline, de Bifidobacterium crudilactis et beta-glucanes, de Bifidobacterium animalis lactis et 2'fucosyllactose, de Clostridium butyricum ei GOS/FOS, Enterococcus faecium et beta-glucanes et leur mélange.Preferably, according to the invention, the symbiotic composition is characterized in that said at least one probiotic and said at least one prebiotic is chosen from the group consisting of Bifidobacterium thermophilum and inulin, Bifidobacterium crudilactis and beta-glucans, Bifidobacterium animalis lactis and 2'fucosyllactose, Clostridium butyricum and GOS/FOS, Enterococcus faecium and beta-glucans and their mixture.

En effet, selon la présente invention, une composition symbiotique comprenant Bifidobacterium thermophilum et inuline ou comprenant Bifidobacterium crudilactis et beta-glucanes, ou comprenant Bifidobacterium animalis lactis et 2'fucosyllactose ou comprenant Clostridium butyricum et GOS/FOS ou encore comprenant Enterococcus faecium et beta-glucanes a montré une capacité synergique à créer un environnement anti-inflammatoire, en réduisant la présence d'IL-8, en augmentant la production d'acide gras à courtes chaînes et en favorisant la croissance des populations bactérienne favorables au microbiote.Indeed, according to the present invention, a symbiotic composition comprising Bifidobacterium thermophilum and inulin or comprising Bifidobacterium crudilactis and beta-glucans, or comprising Bifidobacterium animalis lactis and 2'fucosyllactose or comprising Clostridium butyricum and GOS/FOS or also comprising Enterococcus faecium and beta- glucans showed a synergistic ability to create an anti-inflammatory environment, by reducing the presence of IL-8, increasing the production of short-chain fatty acids and promoting the growth of bacterial populations favorable to the microbiota.

Avantageusement, selon l'invention, la composition symbiotique peut contenir plus de 1 probiotique, par exemple 2 probiotiques, ou par exemple 3 probiotiques, ou par exemple 4 probiotiques ou par exemple 5 probiotiques. Selon l'invention, la composition symbiotique poura également contenir plus de 1 prébiotique, par exemple 2 prébiotiques, ou par exemple 3 prébiotiques, ou par exemple 4 prébiotiques. Une composition symbiotique pouvant contenir une combinaison de plusieurs probiotiques et de plusieurs prébiotiques permet d'optimiser l'environnement anti-inflammatoire et d'améliorer la production des indicateurs de croissance du microbiote tels que les SCFASs.Advantageously, according to the invention, the synbiotic composition can contain more than 1 probiotic, for example 2 probiotics, or for example 3 probiotics, or for example 4 probiotics or for example 5 probiotics. According to the invention, the symbiotic composition may also contain more than 1 prebiotic, for example 2 prebiotics, or for example 3 prebiotics, or for example 4 prebiotics. A symbiotic composition that may contain a combination of several probiotics and several prebiotics optimizes the anti-inflammatory environment and improves the production of microbiota growth indicators such as SCFASs.

Avaniageusement, selon l'invention, la composition symbiotique contient au moins 1 excipient conventionnel, et se présente sous forme liquide ou solide.Advantageously, according to the invention, the symbiotic composition contains at least 1 conventional excipient, and is in liquid or solid form.

La forme solide peut-être une poudre, une poudre dans une gélule, un granulé ou un comprimé ou une autre forme quelconque.The solid form can be a powder, a powder in a capsule, a granule or a tablet or any other form.

D'autres formes de réalisation de la composition symbiotique suivant l'invention sont indiquées dans les revendications annexées.Other embodiments of the symbiotic composition according to the invention are indicated in the appended claims.

La présente invention se rapporte également à un complément alimentaire administrable à l'animal, en particulier au mammifère, en particulier au porc, de préférence à l'animal en gestation et au nouveau-né, en particulier à la truie en gestation ou non et au porcelet pour le traitement préventif et/ou curatif de la dysbiose intestinale.The present invention also relates to a food supplement which can be administered to animals, in particular to mammals, in particular to pigs, preferably to pregnant animals and to newborns, in particular to pregnant sows or not and in piglets for the preventive and/or curative treatment of intestinal dysbiosis.

Ledit complément alimentaire, comprenant ladite composition, peut être sous forme liquide par exemple dans une base lactée ou huileuse ou sous forme solide comme une poudre, une poudre dans une gélule, un granulé ou un comprimé ou une autre forme quelconque.Said food supplement, comprising said composition, can be in liquid form, for example in a milky or oily base, or in solid form such as a powder, a powder in a capsule, a granule or a tablet or any other form whatsoever.

D'autres formes de réalisation du complément alimentaire suivant l'invention sont indiquées dans les revendications annexées.Other embodiments of the food supplement according to the invention are indicated in the appended claims.

La présente invention se rapporte en outre à un aliment complet ou complémentaire pour animaux d'élevage comprenant ladite composition, ledit aliment étant sous forme de farine et/ou de granulés et/ou d'alimentations lactées et/ou toutes autres formes de conditionnement alimentaire.The present invention also relates to a complete or complementary feed for farm animals comprising said composition, said feed being in the form of flour and/or granules and/or milk feeds and/or any other forms of food packaging. .

D'autres formes de réalisation de l'aliment complet ou complémentaire pour animaux d'élevage suivant l'invention sont indiquées dans les revendications annexées La présente invention se rapporte de plus à un aliment pour nouveau-né animal comprenant ladite composition selon la présente invention et une base lactée compatible avec l'alimentation du nouveau-né.Other embodiments of the complete or complementary food for livestock according to the invention are indicated in the appended claims The present invention also relates to a food for newborn animals comprising the said composition according to the present invention and a milk base compatible with newborn feeding.

D'autres formes de réalisation de l'aliment pour nouveau-né animal suivant l'invention sont indiquées dans les revendications annexées.Other embodiments of the food for newborn animals according to the invention are indicated in the appended claims.

La présente invention se rapporte enfin à une utilisation de ladite composition pour le traitement préventif et/ou curatif de la dysbiose intestinale de animal, en particulier du mammifère, en particulier du porc, de préférence de l'animal en gestation et du nouveau-né, en particulier de la truie en gestation ou non et du porcelet, comprenant au moins une administration de ladite composition à raison d'une quantité de préblotique comprise entre O1 et 1000 d/jour/animal, préférentiellement entre 05 et 100 gfouvonmal, de manière avantageuse entre | et 25 g/lour/animat, d'une quantité de probiotique comprise entre 1.00E+05 et 1.00E+015 CFU/jour/animal, préférentiellement entre 1.00E+06 et 1.00E+013 CFU/jour/animal, de manière avantageuse entre 1.00E+07 et 1.00E+011 CFU/jour/animal et au moins une administration d'une ration alimentaire quotidienne, ledit probiotique et ledit prébiotique de la composition étant administrés de manière simultanée, séparée ou échelonnée dans le temps.The present invention finally relates to a use of said composition for the preventive and/or curative treatment of intestinal dysbiosis in animals, in particular mammals, in particular pigs, preferably pregnant animals and newborns. , in particular pregnant sows or not and piglets, comprising at least one administration of said composition at the rate of a quantity of preblotic of between 01 and 1000 d/day/animal, preferably between 05 and 100 gfouvonmal, so advantageous between | and 25 g/hour/animal, of a quantity of probiotic comprised between 1.00E+05 and 1.00E+015 CFU/day/animal, preferably between 1.00E+06 and 1.00E+013 CFU/day/animal, so as advantageous between 1.00E+07 and 1.00E+011 CFU/day/animal and at least one administration of a daily food ration, said probiotic and said prebiotic of the composition being administered simultaneously, separately or staggered over time.

D'autres formes d'Utilisation de ladite composition suivant l'invention sont indiquées dans les revendications annexées.Other forms of use of said composition according to the invention are indicated in the appended claims.

D'autres caractéristiques, détails et avantages de l'invention ressortiront de la description donnée ci-après, à titre non limitatif et en faisant référence aux dessins et aux exemples. La figure 1 montre le schéma du dispositif expérimental du système BabySPIME (Dufourny S. et col. Journal of Microbiological Methods, 2019, 167: 105735. https://doi.org/10.1016/j.mimet.2019). Compartiment 1 : Estomac/duodenum/jejunum, compartiment 2 : iléon, compartiment 3: colon ascendant. A: Alimentation, B: probiotique, C: prébiotique.Other characteristics, details and advantages of the invention will become apparent from the description given below, on a non-limiting basis and with reference to the drawings and the examples. Figure 1 shows the schematic of the experimental device of the BabySPIME system (Dufourny S. et al. Journal of Microbiological Methods, 2019, 167: 105735. https://doi.org/10.1016/j.mimet.2019). Compartment 1: Stomach/duodenum/jejunum, compartment 2: ileum, compartment 3: ascending colon. A: Food, B: probiotic, C: prebiotic.

La figure 2 illustre le niveau de production d'IL-8 (pg/MI) par des cellules IPEC-J2. Les cellules IPEC-J2 ont été mise en contact d'un jus de fermentation venant d'une fermentation avec uniquement un prébiotique, GOS/FOS (GF) ou Inuline (Inu) ou 2'FL (2FL) ou beta-glucane (BG) ou amidon résistant (RS), ou bien provenant d'une fermentation pendant laquelle une composition combinant un prébiotique et un probiotique selon l'invention a été testée. Les résultats montrent la moyenne du niveau de production d’IL-8 +/- l'écart-type. La ligne horizontale correspond au niveau d'IL-8 dans la condition contrôle (blanc- mucine). La signification statistique a été analysée par un test ANOVA unidirectionnel avec une comparaison multiple de type Dunnett de chaque prébiotique et symbiotique par rapport à la condition contrôle (indiqué par *), et entre les combinaisons symbiotiques et le prébiotique seul (indiqué par #). Lorsque p < 0.05: *, # ; lorsque p < 0.01 : **, ## ; lorsque p < 0.001 : ***, ### ; et lorsque p < 0.0001 : ****, #H###. BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis, BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.Figure 2 illustrates the level of IL-8 production (pg/MI) by IPEC-J2 cells. The IPEC-J2 cells were brought into contact with a fermentation juice coming from a fermentation with only a prebiotic, GOS/FOS (GF) or Inulin (Inu) or 2'FL (2FL) or beta-glucan (BG ) or resistant starch (RS), or else originating from a fermentation during which a composition combining a prebiotic and a probiotic according to the invention was tested. The results show the mean of the level of IL-8 production +/- the standard deviation. The horizontal line corresponds to the level of IL-8 in the control condition (blank-mucin). Statistical significance was analyzed by a one-way ANOVA test with a Dunnett-type multiple comparison of each prebiotic and symbiotic against the control condition (indicated by *), and between the symbiotic combinations and the prebiotic alone (indicated by #). When p < 0.05: *, #; when p < 0.01: **, ##; when p < 0.001: ***, ###; and when p < 0.0001: ****, #H###. BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis, BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.

La figure 3 montre une série temporelle indiquant l'accumulation de la production de gaz dans une fermentation in vitro en lot (fermentation statiques in vitro) d'un prébiotique seul ou en combinaison avec un probiotique (symbiotique). La fermentation in vitro en lot de la combinaison symbiotique se réalise avec 10E7 CFU/ml de probiotique et 0.1g de prébiotique (même quantité dans la condition où le prébiotique est présent seul), en présence d'un inoculat de 3% en fécès. Les résultats indiquent Ia Moyenne (ml/g de substrat) +/- l'écart type de 3 réplicats expérimentaux. Pour les prébiotiques, GF : GOS/FOS, Inu : inuline, 2FL:2'FL, BG : beta-glucane, amidon résistant : RS. Pour les probiotiques, BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.Figure 3 shows a time series indicating the accumulation of gas production in a batch in vitro fermentation (in vitro static fermentation) of a prebiotic alone or in combination with a probiotic (symbiotic). The in vitro batch fermentation of the symbiotic combination is carried out with 10E7 CFU/ml of probiotic and 0.1 g of prebiotic (same quantity in the condition where the prebiotic is present alone), in the presence of an inoculate of 3% in faeces. The results indicate the Mean (ml/g of substrate) +/- the standard deviation of 3 experimental replicates. For prebiotics, GF: GOS/FOS, Inu: inulin, 2FL:2'FL, BG: beta-glucan, resistant starch: RS. For probiotics, BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.

La figure 4 montre l'abondance relative de groupes de bactéries bénéfiques pour l'eubiose intestinale à 24h après le démarrage de la fermentation in vitro en lot (fermentation statiques in vitro) en présence du prébiotique seul ou en présence de combinaisons symbiotiques (prébiotique + probiotique). Les groupes de bactéries bénéfiques sélectionnés comprennent les bifidobacteria, les lactobacilli, les clostridium cluster IV, les clostridium cluster XIVa et le gène butyry!- CoA:acetyl-CoA transférase. La méthode de mesure par qPCR 2A(-AACT) a été utilisée pour établir l'abondance relative, les mesures ont été normalisées par rapport aux bactéries totales et un mélange d'échantillons d'ADN de tous les extraits a été utilisé comme calibrateur. La fermentation in vitro, en fermenteur individuel, des combinaisons symbiotiques a été effectuée à 10E7 CFU/ml de probiotique et de 0.1 g de prébiotique (même quantité pour la condition avec le prébiotique seul), en présence de 3% d'un inoculat de fécès. Les résultats indiquent la moyenne (ml/g de substrat) +/- l'écart type de 3 réplicats expérimentaux.Figure 4 shows the relative abundance of groups of bacteria beneficial for intestinal eubiosis at 24 hours after the start of the batch in vitro fermentation (in vitro static fermentation) in the presence of the prebiotic alone or in the presence of symbiotic combinations (prebiotic + probiotic). Beneficial bacteria groups selected include bifidobacteria, lactobacilli, clostridium cluster IV, clostridium cluster XIVa, and the gene butyryl-CoA:acetyl-CoA transferase. The 2A(-AACT) qPCR measurement method was used to establish relative abundance, measurements were normalized to total bacteria, and a mixture of DNA samples from all extracts was used as calibrator. The in vitro fermentation, in an individual fermenter, of the symbiotic combinations was carried out at 10E7 CFU/ml of probiotic and 0.1 g of prebiotic (same quantity for the condition with the prebiotic alone), in the presence of 3% of an inoculate of faeces. The results indicate the mean (ml/g of substrate) +/- the standard deviation of 3 experimental replicates.

La signifiance statistique a été analysée par un test ANOVA unidirectionnel avec une comparaison multiple de type Dunnett et où * correspond à p < 0.05, ** à p < 0.01, *** à p < 0.01, et **** à p < 0.0001. Pour les prébiotiques, GF : GOS/FOS, Inu : inuline, 2FL : 2'FL, BG : beta-glucane, amidon résistant : RS. Pour les probiotiques, BCO : Bacillus coagulans, BT : Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis, BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.The statistical significance was analyzed by a one-way ANOVA test with a Dunnett type multiple comparison and where * corresponds to p < 0.05, ** to p < 0.01, *** to p < 0.01, and **** to p < 0.0001. For prebiotics, GF: GOS/FOS, Inu: inulin, 2FL: 2'FL, BG: beta-glucan, resistant starch: RS. For probiotics, BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis, BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.

La figure 5 montre la capacité du probiotique à survivre et à s'établir dans une communauté microbiale complexe. La figure 5 montre l'abondance relative de chaque probiotique par rapport aux bactéries totales à 12h, 24h et 48h après le démarage de la fermentation pour différentes compositions symbiotiques. L'abondance relative de chaque probiotigue est normalisée par rapport à la quantité relative de probiotique obtenu dans l'échantillon où juste le probiotique a été ajouté. Pour les prébiotiques, GoF : GOS/FOS, Inu : inuline, 2FL : 2'FL, BG : beta- glucane, amidon résistant: RS. Pour les probiotiques, BCO : Bacillus coagulans, BT : Bifidobacterium thermophilum, CB : Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, LP: Lactobacillus plantarum.Figure 5 shows the ability of the probiotic to survive and establish in a complex microbial community. Figure 5 shows the relative abundance of each probiotic compared to the total bacteria at 12 h, 24 h and 48 h after the start of the fermentation for different symbiotic compositions. The relative abundance of each probiotic is normalized to the relative amount of probiotic obtained in the sample where just the probiotic was added. For prebiotics, GoF: GOS/FOS, Inu: inulin, 2FL: 2'FL, BG: beta-glucan, resistant starch: RS. For probiotics, BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, LP: Lactobacillus plantarum.

La figure 6 montre l'évolution de la population bactérienne entre la fin de la période de stabilisation et la fin de la semaine de traitement: Les résultats sont montrés avec les compositions symbiotiques suivantes Enterococcus faecium (EF) + beta-glucane (BG); Bifidobacterium thermophilum (BT) + inuline (Inu); Clostridium butyricum (CB) + GOS/FOS (G/F); Bifidobacterium animalis lactis (BAL) + 2’FL (2FL); Bifidobacterium crudilactis (BC) + beta-glucane (BG); et la condition contrôle. Les résultats sont des rapport d'expression génique par rapport aux bactéries totales.FIG. 6 shows the evolution of the bacterial population between the end of the stabilization period and the end of the week of treatment: The results are shown with the following symbiotic compositions Enterococcus faecium (EF)+beta-glucan (BG); Bifidobacterium thermophilum (BT) + inulin (Inu); Clostridium butyricum (CB) + GOS/FOS (G/F); Bifidobacterium animalis lactis (BAL) + 2'FL (2FL); Bifidobacterium crudilactis (BC) + beta-glucan (BG); and the control condition. Results are ratios of gene expression to total bacteria.

Comme indiqué précédemment, la présente invention se rapporte à une formulation symbiotique comprenant au moins un prébiotique et au moins Un probiotique.As indicated previously, the present invention relates to a symbiotic formulation comprising at least one prebiotic and at least one probiotic.

De préférence, ledit probiotique est choisi dans le groupe des micro-organismes comprenant Bifidobacterium i$hermophilum, Enferococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis.Preferably, said probiotic is chosen from the group of microorganisms comprising Bifidobacterium i$hermophilum, Enferococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis.

Dans une forme particulière de la présente invention, ledit prébiotique est choisi dans le groupe comprenant l'inuline, le B-glucane, 2'Fucosyllactose, GOS/FOS, l'amidon résistant. | a en effet été démontré selon la présente invention que la formulation symbiotique contenant un probiotique et un prébiotique produit une diminution de la production d'IL-8 en test in vitro, et une augmentation des «Short Chain Fatty Acids, SCFAs» ainsi qu'une amélioration de la diversité et de la quantité des populations bactériennes endogènes comme les Lactobacillus, les bifidobactéries, les Clostridium clusters IV et XIVa ainsi que les bactéries intervenant dans les voies métaboliques de production du butyrate, formant un microbiote intestinal équilioré, conduisant de cette manière à la génération ensemble d'un environnement anti-inflammatoire dans le système digestif de l’animal, en particulier du mammifère, en particulier du porc, de préférence de l'animal en gestation et du nouveau-né, en particulier de la truie en gestation ou non et du porcelet.In a particular form of the present invention, said prebiotic is chosen from the group comprising inulin, B-glucan, 2′ Fucosyllactose, GOS/FOS, resistant starch. | has in fact been demonstrated according to the present invention that the symbiotic formulation containing a probiotic and a prebiotic produces a decrease in the production of IL-8 in an in vitro test, and an increase in "Short Chain Fatty Acids, SCFAs" as well as an improvement in the diversity and quantity of endogenous bacterial populations such as Lactobacillus, bifidobacteria, Clostridium clusters IV and XIVa as well as bacteria involved in the metabolic pathways of butyrate production, forming an improved intestinal microbiota, leading in this way to the joint generation of an anti-inflammatory environment in the digestive system of the animal, in particular of the mammal, in particular of the pig, preferably of the pregnant animal and of the newborn, in particular of the sow in pregnancy or not and of the piglet.

Administrée à l'animal en gestation ou au nouveau-né, plus particulièrement à la truie en gestation ou au porcelet, la formulation symbiotique selon la présente invention favorise l'établissement d'un microbiote intestinal équilioré de manière très précoce, protégeant l'animal en gestation ou encore le nouveau-né, plus particulièrement la tuie en gestation ou le porcelet de manière soutenue dans le temps contre la dysbiose par le probiotique et le prébiotique qu'elle contient, lesquels génèrent ensemble un environnement anti-inflammatoire.Administered to the pregnant animal or to the newborn, more particularly to the pregnant sow or to the piglet, the symbiotic formulation according to the present invention promotes the establishment of a balanced intestinal microbiota very early, protecting the animal in gestation or even the newborn, more particularly the sow in gestation or the piglet in a sustained manner against dysbiosis by the probiotic and the prebiotic which it contains, which together generate an anti-inflammatory environment.

De préférence, selon l'invention, ladite composition symbiotique est caractérisée en ce que ledit au moins Un probiotique et ledit au moins un prébiotique génèrent ensemble une augmentation des concentrations en populations bactériennes endogènes favorables au microbiote intestinal telles que les Lactobacillus et les Bifidobacteria.Preferably, according to the invention, said symbiotic composition is characterized in that said at least one probiotic and said at least one prebiotic together generate an increase in the concentrations of endogenous bacterial populations favorable to the intestinal microbiota, such as Lactobacillus and Bifidobacteria.

Avantageusement, cette augmentation des concentrations en populations bactériennes génère un meilleur équiliore du microbiote intestinal de l'hôte diminuant le risque de dysbiose intestinal.Advantageously, this increase in bacterial population concentrations generates a better balance of the host's intestinal microbiota, reducing the risk of intestinal dysbiosis.

Avantageusement, selon l'invention, ladite composition symbiotique est caractérisée, de préférence, en ce que ledit au moins un probiotique et ledit au moins un prébiotique génèrent ensemble une réduction de la concentration d’IL-8 d'au moins 10% formant ledit environnement antiinflammatoire.Advantageously, according to the invention, said symbiotic composition is preferably characterized in that said at least one probiotic and said at least one prebiotic together generate a reduction in the concentration of IL-8 of at least 10% forming said anti-inflammatory environment.

Dans le cadre de la présente invention, la concentration d'IL-8 a été mesurée grâce à des tests in vitro sur des cellules IPEC-J2 en présence du jus de fermentation (contenant ou non la composition symbiotique à tester). Avantageusement, selon l'invention, ladite composition symbiotique est caractérisée, de préférence, en ce que ledit au moins un probiotique et ledit au moins un prébiotique génèrent ensemble une stabilisation ou une augmentation de la sécrétion d'acides gras à courte chaîne (SCFA's) par le microbiote intestinal, lesdits SCFAs, produits lors du processus de fermentation du microbiote, sont Un indicateur de l'équiliore et dela croissance du microbiote.In the context of the present invention, the concentration of IL-8 was measured by means of in vitro tests on IPEC-J2 cells in the presence of the fermentation juice (containing or not containing the symbiotic composition to be tested). Advantageously, according to the invention, said symbiotic composition is characterized, preferably, in that said at least one probiotic and said at least one prebiotic together generate a stabilization or an increase in the secretion of short-chain fatty acids (SCFA's) by the intestinal microbiota, said SCFAs, produced during the fermentation process of the microbiota, are an indicator of the balance and growth of the microbiota.

Les SCFAs comme le butyrate a en effet un rôle bénéfique multiole au niveau de l'intestin comme son rôle régulateur dans le transport de fluide transépithélial.SCFAs like butyrate indeed have a multiole beneficial role in the intestine as its regulatory role in the transport of transepithelial fluid.

Il améliore également l'état oxydatif et inflammation de la muqueuse de l'intestin, il renforce la barrière de défense épithéliale, il module la sensibilité viscérale et la mobilité intestinale (Canani, R.B. et col. World J. Gastroenterol., 2011, 17: 1519-1528, doi: 10.3/48/wjg.v17.112.1519). De préférence, selon l'invention, lesdits SCFAs sont choisis parmi le butyrate, le propionate, l'acétate, le lactate ou leurs combinaisons.It also improves the oxidative state and inflammation of the intestinal mucosa, it strengthens the epithelial defense barrier, it modulates visceral sensitivity and intestinal mobility (Canani, R.B. et al. World J. Gastroenterol., 2011, 17 : 1519-1528, doi: 10.3/48/wjg.v17.112.1519). Preferably, according to the invention, said SCFAs are chosen from butyrate, propionate, acetate, lactate or combinations thereof.

Dans le cadre de la présente invention, la production desdits SCFAs est mesurée grâce au modèle de fermentation statiques in vitro.In the context of the present invention, the production of said SCFAs is measured using the in vitro static fermentation model.

De préférence, selon l'invention, la composition symbiotique est caractérisée en ce que ledit au moins un probiotique et ledit au moins un prébiotique est choisi dans le groupe constitué de Bifidobacterium thermophilum et inuline, de Bifidobacterium crudilactis et beta-glucanes, de Bifidobacterium animalis lactis et 2'fucosyllactose, de Clostridium butyricum ei GOS/FOS, Enterococcus faecium et beta-glucanes et leur mélange.Preferably, according to the invention, the symbiotic composition is characterized in that said at least one probiotic and said at least one prebiotic is chosen from the group consisting of Bifidobacterium thermophilum and inulin, Bifidobacterium crudilactis and beta-glucans, Bifidobacterium animalis lactis and 2'fucosyllactose, Clostridium butyricum and GOS/FOS, Enterococcus faecium and beta-glucans and their mixture.

Avaniageusement, selon l'invention, la composition symbiotique peut contenir plus de 1 probiotique, par exemple 2 probiotiques, ou par exemple 3 probiotiques, ou par exemple 4 probiotiques ou par exemple 5 probiotiques. Selon l'invention, la composition symbiotique pourra également contenir plus de 1 prébiotique, par exemple 2 prébiotiques, ou par exemple 3 prébiotiques, ou par exemple 4 prébiotiques. Une composition symbiotique pouvant contenir une combinaison de plusieurs probiotiques et de plusieurs prébiotiques permet d'optimiser l'environnement anti-inflammatoire et d'améliorer la production des indicateurs de croissance du microbiote tels que les SCFASs.Advantageously, according to the invention, the symbiotic composition can contain more than 1 probiotic, for example 2 probiotics, or for example 3 probiotics, or for example 4 probiotics or for example 5 probiotics. According to the invention, the symbiotic composition may also contain more than 1 prebiotic, for example 2 prebiotics, or for example 3 prebiotics, or for example 4 prebiotics. A symbiotic composition that may contain a combination of several probiotics and several prebiotics optimizes the anti-inflammatory environment and improves the production of microbiota growth indicators such as SCFASs.

Fermentation statique in vitro: La capacité de fermentation des différentes combinaisons symbiotiques a été testée dans un modèle statique de fermentation in vitro, suivant le protocole décrit par Bindelle et col. Journal of Animal Science 2010, 87, 583-93. nttps://doiorg/10.252//10s.2007-0717 et par Tran et col. FEMS Microbiology Ecology 2016, 92, 1-13. hips fgolorg/id.1093/femsec{iv145. En résumé, la fermentation in vitro aété réalisée dans des flacons contenant 15 ml d'une solution contenant 3% de matières fécales de porcelet en pré-sevrage; trois supports de microcosmes préalablement immergés dans de la gélose à la mucine; 100 mg de prébiotique et 1E07 CFU / ml de probiotique. Les flacons scellés ont été incubés à 39 ° C sous agitation pendant 48 h dans un bain-marie. Trois répétitions ont été réalisées par condition de test.In vitro static fermentation: The fermentation capacity of the different symbiotic combinations was tested in a static in vitro fermentation model, following the protocol described by Bindelle et al. Journal of Animal Science 2010, 87, 583-93. nttps://doiorg/10.252//10s.2007-0717 and by Tran et al. FEMS Microbiology Ecology 2016, 92, 1-13. hips fgolorg/id.1093/femsec{iv145. In summary, in vitro fermentation was carried out in flasks containing 15 ml of a solution containing 3% pre-weaning piglet faeces; three microcosm carriers previously immersed in mucin agar; 100 mg of prebiotic and 1E07 CFU/ml of probiotic. Sealed vials were incubated at 39°C with shaking for 48 h in a water bath. Three replicates were performed per test condition.

Production de gaz: La pression du gaz a été mesurée 2, 5, 8, 12, 16, 20, 24 et 48h après le début de la fermentation pour la détermination de la cinétique de fermentation en utilisant le modèle mathématique monophasique de Groot et col. Animal Feed Science and Technology 1996, 64, 77-89. https://doi.org/10.1016/S0377-8401(96)01012-7. Plusieurs paramètres ont été calculés avec ce modèle: A (volume de gaz maximal, ml/g substrat), B (temps pour atteindre A/2, h), C comme constante déterminant la pente du point d'inflexion du profil, Rmax (taux de fermentation maximum, ml/g de subsirat/heure) et Tmax (temps pour atteindre Rmax).Gas production: The gas pressure was measured 2, 5, 8, 12, 16, 20, 24 and 48h after the start of fermentation for the determination of fermentation kinetics using the monophasic mathematical model of Groot et al. . Animal Feed Science and Technology 1996, 64, 77-89. https://doi.org/10.1016/S0377-8401(96)01012-7. Several parameters were calculated with this model: A (maximum gas volume, ml/g substrate), B (time to reach A/2, h), C as constant determining the slope of the inflection point of the profile, Rmax ( maximum fermentation rate, ml/g of subsirat/hour) and Tmax (time to reach Rmax).

Acides gras à chaîne courte: Lactate et les acides gras à chaîne courte (SCFA) ont été dosés dans le jus de fermentation obtenu après 24h par HPLC isocratique. La courbe standard utilisée contenait de l'acétate, du propionate, du butyrate ainsi que des acides gras à chaîne ramifiée (BCFA): isobutyrate, valérate et isovalérate.Short-chain fatty acids: Lactate and short-chain fatty acids (SCFA) were measured in the fermentation juice obtained after 24 hours by isocratic HPLC. The standard curve used contained acetate, propionate, butyrate as well as branched chain fatty acids (BCFA): isobutyrate, valerate and isovalerate.

La mesure de SCFA a ensuite été calculée en tenant compte de la production basale dans les flacons témoins-mucine contenant les supports de microcosme avec de la mucine. Les valeurs sont données en mmol par g de substrat et comparées aux mesures dans le jus de fermentation ne contenant que le prébiotique correspondant.The SCFA measurement was then calculated taking into account the basal production in the control-mucin flasks containing the microcosm carriers with mucin. The values are given in mmol per g of substrate and compared to the measurements in the fermentation juice containing only the corresponding prebiotic.

Détermination des modifications du microbiote par qPCR lors d'un essai en modèle de fermentation statique in vitro en présence de différentes compositions symbiotiques.Determination of microbiota modifications by qPCR during an in vitro static fermentation model test in the presence of different symbiotic compositions.

Pour chaque essai dans le système de fermentation statique in vitro, l'analyse des modifications du microbiote intestinal a été réalisée par qPCR sur des échantillons prélevés après 24 heures de fermentation.For each test in the in vitro static fermentation system, the analysis of changes in the intestinal microbiota was carried out by qPCR on samples taken after 24 hours of fermentation.

Les séquences des amorces sens et des amorces anti-sens utilisées pour mesurer l'expression par qPCR des gènes cibles correspondant aux populations bactériennes bénéfiques pour Ia communauté microbienne de l'intestin sont indiquées dans le Tableau 1 ci-dessous.The sequences of the forward primers and the antisense primers used to measure the expression by qPCR of the target genes corresponding to the bacterial populations beneficial for the microbial community of the intestine are indicated in Table 1 below.

Tableau 1.- Séquences des amorces sens (F) et anti-sens (R) pour mesurer par qPCR des gènes cibles correspondant aux populations bactériennes bénéfiques pour la communauté microbienne de l'intestin. Population Séquence des amorces 5'—3' bactérienne/gèn | Gènes cibles q x . > Référence . des genes cibles es ciblesTable 1.- Sequences of sense (F) and antisense (R) primers to measure by qPCR target genes corresponding to bacterial populations beneficial to the microbial community of the intestine. Population Sequence of bacterial 5'—3' primers/gen | Target genes q x . > Reference . target genes targets

CGTGCCAGCCGCGGTAATAC Bactéries totales GGGITGCGCTCGITGCGGGA | Amit-Romach Unibac-R et col. (2004)CGTGCCAGCCGCGGTAATAC Total Bacteria GGGITGCGCTCGITGCGGGA | Amit-Romach Unibac-R et al. (2004)

CTTAACCCAACCTTAACCCAAC

CATCCAGTGCAAACCTAAGA Lactobacillus Wang et col. GATCCGCTTGCCTTCGC (1996) GGGTGGTAATGCCGGAT - Bifidobacterium Langendijk et Bif662-R CCACCGTTACACCGGGAA col. (1995) Clostridium Sg-Clept-F | GCACAAGCAGTGGAG Matsuki et cluster IV Sg-Clept-R | CTTCCTCCGTTTTGTCAA col. (2004) Clostridium AAATGACGGTACCTGACTA Matsuki et cluster XIVa CTTTGAGTTTCATTCTTGCG col. (2002) Butyryl- TGGACAGAAAGGTIGCGGA CoA:acetate- Uerlings et GTGTGTACGCCCAGATCCT col. (2019) COA transférase Les bactéries totales sont ciblées à l'aide des amorces décrites dans Amit- Romach E. et col. Poult Sci 2004, 83, 1093-1098, doi: 10.3382/ps/pey394. Les bactéries faisant partie du groupe lactobacillus sont ciblées à l'aide des amorces décrites dans Wang R.F. et col. Appl Environ Microbiol 1996, 62, 1242-1247, doi: 10.1128/AEM.62.4.1242-1247.1996.CATCCAGTGCAAACCTAAGA Lactobacillus Wang et al. GATCCGCTTGCCTTCGC (1996) GGGTGGTAATGCCGGAT - Bifidobacterium Langendijk and Bif662-R CCACCGTTACACCGGGAA col. (1995) Clostridium Sg-Clept-F | GCACAAGCAGTGGAG Matsuki and cluster IV Sg-Clept-R | CTTCCTCCGTTTTGTCAA col. (2004) Clostridium AAATGACGGTACCTGACTA Matsuki and cluster XIVa CTTTGAGTTTCATTCTTGCG col. (2002) Butyryl-TGGACAGAAAGGTIGCGGA CoA:acetate-Uerlings and GTTGTACGCCCAGATCCT col. (2019) COA transferase Total bacteria are targeted using the primers described in Amit-Romach E. et al. Poult Sci 2004, 83, 1093-1098, doi: 10.3382/ps/pey394. Bacteria belonging to the lactobacillus group are targeted using the primers described in Wang R.F. et al. Appl Environ Microbiol 1996, 62, 1242-1247, doi: 10.1128/AEM.62.4.1242-1247.1996.

Les bactéries faisant partie du groupe bifidobacterium sont ciblées à l'aide des amorces décrites dans Langendijk P.S. et col. Appl Environ Microbiol 1995, 61, 3069-3075, doi: 10.1128/AEM.61.8.3069-The bacteria belonging to the bifidobacterium group are targeted using the primers described in Langendijk P.S. et al. Appl Environ Microbiol 1995, 61, 3069-3075, doi: 10.1128/AEM.61.8.3069-

3075.1995.3075.1995.

Les bactéries faisant partie du groupe clostridium cluster IV sont ciblées à l’aide des amorces décrites dans Matsuki T. et col. ApplBacteria belonging to the clostridium cluster IV group are targeted using the primers described in Matsuki T. et al. Appl

Environ Microbiol 2004, 70, 7220-7228, doi: 10.1128/AEM.70.12.7220-Environ Microbiol 2004, 70, 7220-7228, doi:10.1128/AEM.70.12.7220-

7228.2004. Les bactéries faisant partie du groupe clostridium cluster XIVa sont ciblées à l'aide des amorces décrites dans Matsuki T. et col. Appl Environ Microbiol 2002, 68, 5445-5451, doi: 10.1128/gem.68.11.5445-7228.2004. Bacteria forming part of the clostridium cluster XIVa group are targeted using the primers described in Matsuki T. et al. Appl Environ Microbiol 2002, 68, 5445-5451, doi:10.1128/gem.68.11.5445-

5451.2002. La Butyri-CoA:acetate-CoA transférase est ciblée à l'aide des amorces décrites dans Uerlings J. et col. J Sci Food Agric 2019, 99, 5720-5733, doi: 10.1002/jsfa.9837.5451.2002. Butyri-CoA:acetate-CoA transferase is targeted using the primers described in Uerlings J. et al. J Sci Food Agric 2019, 99, 5720-5733, doi: 10.1002/jsfa.9837.

Détermination de la capacité des probiotiques de survivre et de s’établir dans un écosystème microbien complexe par qPCR lors d’un essai en modèle de fermentation statique in vitro en présence de différentes compositions symbiotiques.Determination of the ability of probiotics to survive and establish themselves in a complex microbial ecosystem by qPCR during an in vitro static fermentation model assay in the presence of different symbiotic compositions.

Pour chaque essai dans le modèle de fermentation statique in vitro, l'analyse et suivi de la présence de chaque probiotique dans le jus de fermentation a été réalisée par qPCR sur des échantillons prélevés à 12, 24 et 48 heures après le début de la fermentation. Les séquences des amorces sens et des amorces anti-sens ufilisées pour mesurer par RT- qPCR l'abondance relative des probiotiques sont indiquées dans le Tableau 2 ci-dessous.For each test in the in vitro static fermentation model, the analysis and monitoring of the presence of each probiotic in the fermentation juice was carried out by qPCR on samples taken 12, 24 and 48 hours after the start of fermentation. . The sequences of the forward primers and the antisense primers used to measure the relative abundance of the probiotics by RT-qPCR are indicated in Table 2 below.

Tableau 2.- Séquences des amorces sens (F) et anti-sens (R) pour mesurer par qPCR l'abondance relative des probiotiques. ee a Bifidobacterium CCCTIT CCA CGG GTC CC Veiga et col animalis lactis IOR | AAG GGA AAC CGT GTC TCC AC (2010) GCATGGAGGAAAAAG- GAA Bacillus coagulans Hidaka et col. IOR CCCGGCAACAGAGITITA (2010) Bifidobacterium TTG CIT GCG GGT GAG AGT Mathys et thermophilum IOR CGC CAA CAA GCT GAT AGG AC | col. (2008) Clostridium ATGGGTTAGGCAAGCAGAAA Cremones et butyricum LR GCTGGATCTGCCTTCTCATC col. (2012) Enterococus GAA ACG ACG GTG TCA TCA Loquasto et faecium LR; TCC ATT TTG TCG TTA TCT G col. (2013)Table 2.- Sequences of forward (F) and antisense (R) primers for measuring the relative abundance of probiotics by qPCR. ee a Bifidobacterium CCCTIT CCA CGG GTC CC Veiga et col animalis lactis IOR | AAG GGA AAC CGT GTC TCC AC (2010) GCATGGAGGAAAAAG-GAA Bacillus coagulans Hidaka et al. IOR CCCGGCAACAGAGITITA (2010) Bifidobacterium TTG CIT GCG GGT GAG AGT Mathys and thermophilum IOR CGC CAA CAA GCT GAT AGG AC | collar. (2008) Clostridium ATGGGTTAGGCAAGCAGAAA Cremones et butyricum LR GCTGGATCTGCCTTCTCATC col. (2012) Enterococus GAA ACG ACG GTG TCA TCA Loquasto and faecium LR; TCC ATT TTG TCG TTA TCT G col. (2013)

TGG ATC ACC TCC TTT CTA AGG Lactobacillus F AAT Haarman et plantarum OR | TGTTCT CGG TTT CAT TAT GAA col. (2005)TGG ATC ACC TCC TTT CTA AGG Lactobacillus F AAT Haarman and plantarum OR | TGTTCT CGG TTT CAT TAT GAA col. (2005)

AAA ATA Bifidobacterium TGACCGACGAGATCACCTAT Cette crudilactis (rpoB) IOR | ACCATCTGACGTGGAGAGA invention Bifidobacterium CCATCGAGCTTCGTCCTTT Cette crudilactis (rpIB) IOR | GCCTTACCGAGCTGAAGATT invention Références bibliographiques du Tableau 2: Veiga, P. et col. 2010. Proceedings of the National Academy of Sciences of The United States of America 2010, 107: 1813237, https://doi.org/10.1073/pnas.101 1737107.AAA ATA Bifidobacterium TGACCGACGAGATCACCTAT This crudilactis (rpoB) IOR | ACCATCTGACGTGGAGAGA invention Bifidobacterium CCATCGAGCTTCGTCCTTT This crudilactis (rpIB) IOR | GCCTTACCGAGCTGAAGATT invention Bibliographic references in Table 2: Veiga, P. et al. 2010. Proceedings of the National Academy of Sciences of The United States of America 2010, 107: 1813237, https://doi.org/10.1073/pnas.101 1737107.

Hidaka T. et col. Water Research 2010, 44, 2554-62, https://doi.org/10.1016/j.watres.2010.01.007.Hidaka T. et al. Water Research 2010, 44, 2554-62, https://doi.org/10.1016/j.watres.2010.01.007.

Mathys S. et col. BMC Microbiology 2008, 8, 179, https://doi.org/10.1186/1471-2180-8-179. Cremonesi P. et col. Journal of Dairy Research 2012, 79,318-23, https://doi.org/10.1017/S002202991200026X.Mathys S. et al. BMC Microbiology 2008, 8, 179, https://doi.org/10.1186/1471-2180-8-179. Cremonesi P. et al. Journal of Dairy Research 2012, 79,318-23, https://doi.org/10.1017/S002202991200026X.

Loquasto J.R. et col. Applied and Environmental Microbiology 2013, 79, 6903-10, https://doi.org/10.1128/AEM.01777-13. Haarman M. et col. Applied and Environmental Microbiology 2005, 71, 2318-24, hitps://doi.0rg/10.1128/AEM.71.5.2318.Loquasto J.R. et al. Applied and Environmental Microbiology 2013, 79, 6903-10, https://doi.org/10.1128/AEM.01777-13. Haarman M. et al. Applied and Environmental Microbiology 2005, 71, 2318-24, hitps://doi.0rg/10.1128/AEM.71.5.2318.

Détermination de la réponse immunitaire causée par incubation du jus de fermentation obtenu lors d’un essai en modèle de fermentation statique in vitro en présence de différentes compositions symbiotiques.Determination of the immune response caused by incubation of the fermentation juice obtained during an in vitro static fermentation model test in the presence of different symbiotic compositions.

Dans la cadre de la présente invention, la lignée IPEC-J2 (entérocytes intestinaux isolés du jéjunum d'un porcelet nouvellement né et non allaité (ou alimenté avec une formulation lactée) et appartenant à une lignée cellulaire ni transformée ni tumorigène) a été incubée dans le jus de fermentation produit par Ia combinaison symbiotique à tester ou contenant uniquement le prébiotique en question pendant 24h. A la suite de cette période d'incubation, la réponse immunitaire est évaluée par la production de cytokines induites (IL-8, IL-6, IL-1b) et TNF-alpha. Préalablement, la cytotoxicité des jus de fermentation sur les cellules IPEC-J2 a été évaluée car pour pouvoir observer une réponse immunitaire, il est important que la lignée cellulaire reste viable. Pour chaque combinaison sélectionnée, l'effet des différentes concentrations en jus de fermentation, préalablement filtré à 0.8 um, sur la viabilité des cellules IPEC-J2 a été mesurée par le test MTT (sel de tétrazolium MTT : bromure de 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium), qui est un test colorimétrique de numérotation des cellules viables. Le contact des cellules IPEC-J2 a été ensuite réalisé avec un taux d'inoculation du jus de fermentation de 0.8% (V/V).In the context of the present invention, the IPEC-J2 line (intestinal enterocytes isolated from the jejunum of a newly born and non-breastfed piglet (or fed with a milk formulation) and belonging to a cell line neither transformed nor tumorigenic) was incubated in the fermentation juice produced by the symbiotic combination to be tested or containing only the prebiotic in question for 24 hours. Following this incubation period, the immune response is evaluated by the production of induced cytokines (IL-8, IL-6, IL-1b) and TNF-alpha. Previously, the cytotoxicity of the fermentation juices on the IPEC-J2 cells was evaluated because in order to be able to observe an immune response, it is important that the cell line remains viable. For each combination selected, the effect of the different concentrations of fermentation juice, previously filtered at 0.8 um, on the viability of the IPEC-J2 cells was measured by the MTT test (MTT tetrazolium salt: 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium), which is a colorimetric test for counting viable cells. The contact of the IPEC-J2 cells was then carried out with an inoculation rate of the fermentation juice of 0.8% (V/V).

Mesure de la concentration d'IL-8: Dans le cadre de la présente invention, la concentration d'IL- 8 a été mesurée grâce à des tests in vitro sur des cellules IPEC-J2 en présence du jus de fermentation (contenant ou non la composition symbiotique à tester) (voir Figure 2). Pour réaliser le test, un essai a été réalisé en comparant les concentrations de IL-8 (les autres marqueurs IL-6, IL-1 et TNF-alpha n’ont pas été détectés) produites en présence du jus de fermentation dans différentes conditions: témoin-mucine (ligne horizontale de la Figure 2), prébiotiques seules (conditions GOS/FOS (GF), 2FL,Inuline (Inu), amidon résistant (RS) et B-glucane (BG)), et symbiotiques (les autres conditions de la Figure 2). Cet essai indique que si le niveau de IL-8 est plus faible en présence du jus de fermentation contenant la composition prébiotique ou symbiotique comparé au jus de fermentation témoin-mucine, cela montre un effet anti-inflammatoire de la présence du pré- ou symbiotique. En plus, si le niveau de IL-8 est plus faible en présence du jus de fermentation contenant la composition symbiotique comparé au jus de fermentation contenant uniquement le prébiotique, cela montre que la combinaison spécifique dudit au moins un probiotique avec ledit au moins un prébiotique possède un effet anti-inflammatoire supplémentaire par rapport au prébiotique seul. La viabilité cellulaire des symbiotiques (résultats du test MTT) a été prise en compte pour ajuster les concentrations d'IL-8. Le niveau d'expression d'IL-8 est déterminé par ELISA (Porcine IL-8/CXCL8 DuoSet ELISA kit DY535: R&D Systems).Measurement of the concentration of IL-8: In the context of the present invention, the concentration of IL-8 was measured thanks to in vitro tests on IPEC-J2 cells in the presence of the fermentation juice (containing or not the symbiotic composition to be tested) (see Figure 2). To carry out the test, a test was carried out comparing the concentrations of IL-8 (the other markers IL-6, IL-1 and TNF-alpha were not detected) produced in the presence of the fermentation juice under different conditions : control-mucin (horizontal line in Figure 2), prebiotics alone (GOS/FOS (GF), 2FL, Inulin (Inu), resistant starch (RS) and B-glucan (BG) conditions), and symbiotic (other conditions in Figure 2). This test indicates that if the level of IL-8 is lower in the presence of the fermentation juice containing the prebiotic or symbiotic composition compared to the control fermentation juice-mucin, this shows an anti-inflammatory effect of the presence of the pre- or symbiotic . In addition, if the level of IL-8 is lower in the presence of the fermentation juice containing the symbiotic composition compared to the fermentation juice containing only the prebiotic, this shows that the specific combination of said at least one probiotic with said at least one prebiotic has an additional anti-inflammatory effect compared to the prebiotic alone. The cell viability of the synbiotics (results of the MTT test) was taken into account to adjust the concentrations of IL-8. The level of expression of IL-8 is determined by ELISA (Porcine IL-8/CXCL8 DuoSet ELISA kit DY535: R&D Systems).

Modèle BabySPIME : Le modèle BabySPIME est un modèle scientifiquement validé (Dufourny S. et col. Journal of Microbiological Methods, 2019, 167: 105735. https://doi.org/10.1016/j.mimet.2019) qui simule la dynamique et les conditions physiologiques d'un tractus gastrointestinal complet chez le porcelet dans un environnement in vitro (équipement dérivé du modèleBabySPIME model: The BabySPIME model is a scientifically validated model (Dufourny S. et al. Journal of Microbiological Methods, 2019, 167: 105735. https://doi.org/10.1016/j.mimet.2019) which simulates the dynamics and the physiological conditions of a complete gastrointestinal tract in piglets in an in vitro environment (equipment derived from the model

SHIME de ProDigest Bvba, Gent, Belgium). Le modèle comprend 2 fois 3 réacteurs qui simulent de manière séquentielle l'estomac (condition acide et digestion par la pepsine), Viléon (processus de digestion enzymatique) et le côlon proximal (processus de fermentation par le microbiote) (voir Figure 1). Ce système permet d'obtenir des communautés microbiennes complexes et stables dont la fonction et la structure sont fortement similaires aux communautés microbiennes retrouvées dans les différentes régions de l'intestin.SHIME from ProDigest Bvba, Gent, Belgium). The model includes 2 x 3 reactors that sequentially simulate the stomach (acid condition and pepsin digestion), Viléon (enzymatic digestion process) and the proximal colon (microbiota fermentation process) (see Figure 1). This system makes it possible to obtain complex and stable microbial communities whose function and structure are highly similar to the microbial communities found in the different regions of the intestine.

Des pompes péristaltiques permettent le transfert du milieu de culture, du jus pancréatique, de la bile, de l'acide (HCI 0.5M), de la base (NaOH 0.5M) et des liquides de fermentation d'un réacteur à l'autre au cours d'un cycle complet. En pratique, le réacteur 1 simule les fonctions de l’estomac, du duodenum et du jejunum, le réacteur 2 simule les fonctions de l'îleum, le réacteur 3 simule les fonctions du colon proximal.Peristaltic pumps allow the transfer of culture medium, pancreatic juice, bile, acid (0.5M HCl), base (0.5M NaOH) and fermentation liquids from one reactor to another during a complete cycle. In practice, reactor 1 simulates the functions of the stomach, duodenum and jejunum, reactor 2 simulates the functions of the ileum, reactor 3 simulates the functions of the proximal colon.

Un essai complet dans le système babySPIME dure 3 semaines : 2 semaines de stabilisation du microbiote simule la phase de lactation suivie par une semaine de traitement avec la composition symbiotique. Une solution de 108 CFU/ml a été préparée pour inoculer une dose finale de 107 CFU/ml de contenu intestinal. La dose de prébiotique estde2g de prébiotique/jour pour atteindre une concentration de 1% de l'alimentation.A complete trial in the babySPIME system lasts 3 weeks: 2 weeks of stabilization of the microbiota simulates the lactation phase followed by a week of treatment with the symbiotic composition. A solution of 108 CFU/ml was prepared to inoculate a final dose of 107 CFU/ml of intestinal contents. The dose of prebiotic is 2g of prebiotic/day to reach a concentration of 1% of the diet.

Les matières fécales de 6 porcelets âgé de 27 jours en allaitement et n'ayant pas subi de traitement antibiotique ont été utilisées pour préparer l'inoculat de l'étude. Les matières fécales ont été prélevées directement des porceleïs et maintenues sur glace dans des conditions anaérobies. Pour chaque essai, l'inoculat a été préparé et homogénéisé pendant 10 minutes en ajoutant les matières fécales de chaque porcelet à une solution tampon de phosphate en anaérobie. Après une filtration macroscopique pour éliminer les particules encore en suspension, le filtrat a été injecté de manière simultanée dans les réacteurs 2 et 3. Avant l'inoculation, ces deux réacteurs ont été remplis avec un milieu de culture non-acidifié et le pH a été ajusté de manière automatique dans chaque réacteur de manière à simuler au mieux les conditions physiologiques.The faeces of 6 suckling 27-day-old piglets that had not undergone antibiotic treatment were used to prepare the inoculum for the study. Faeces were collected directly from piglets and kept on ice under anaerobic conditions. For each trial, the inoculum was prepared and homogenized for 10 minutes by adding the faeces of each piglet to an anaerobic phosphate buffer solution. After macroscopic filtration to eliminate the particles still in suspension, the filtrate was injected simultaneously into reactors 2 and 3. Before inoculation, these two reactors were filled with a non-acidified culture medium and the pH was automatically adjusted in each reactor so as to best simulate the physiological conditions.

Le milieu de culture a été préparé et validé préalablement. Les bouteilles de milieu ont été stockées à 4°C et le pH a été ajusté à 3.0 avant l'utilisation dans le premier réacteur. Une solution mimant le jus pancréatique contenant du bicarbonate de sodium (2.5 g/L, VWR Chemicals, Radnol, Pennsylvania, USA), de la pancréatine (0.99/L, ProDigest) et Oxgall (4.0 g/L) a été ajouté au milieu.The culture medium was prepared and validated beforehand. Bottles of medium were stored at 4°C and the pH was adjusted to 3.0 before use in the first reactor. A solution mimicking pancreatic juice containing sodium bicarbonate (2.5 g/L, VWR Chemicals, Radnol, Pennsylvania, USA), pancreatin (0.99/L, ProDigest) and Oxgall (4.0 g/L) was added to the medium .

Le cycle d'alimentation est planifié 3 fois par jour basé sur un temps total de rétention de 14h. Au cours de chaque cycle, le milieu de culture, maintenu à 4°C, passe dans le réacteur 1 pendant 1h30. Ensuite, le jus pancréatique/oxgall (60mI), aussi maintenu à 4°C, a été ajouté dans le même réacteur pour pendant Ih. Après ce temps, et de manière simultanée, le contenu du réacteurs 1, 2 et 3 a été transvasé respectivement dans les réacteurs 2, 3 et dans un conteneur biologique de déchet.The feeding cycle is scheduled 3 times per day based on a total retention time of 14h. During each cycle, the culture medium, maintained at 4° C., passes through reactor 1 for 1 hour 30 minutes. Then pancreatic juice/oxgall (60mI), also maintained at 4°C, was added to the same reactor for 1h. After this time, and simultaneously, the contents of reactors 1, 2 and 3 were transferred respectively to reactors 2, 3 and to a biological waste container.

Les conditions anaérobiques de tous les réacteurs sont maintenues grâce à un flux d'azote (N2) une fois par jour pendant 10 minutes au niveau des réacteurs. Le contenu des réacteurs est agité de manière continue (300 rpm) et maintenu à 39.5°C. Le pH des réacteurs 2 et 3 est contrôlé en continu afin de stabiliser le pH de l'iléum et du colon proximal.The anaerobic conditions of all the reactors are maintained thanks to a flow of nitrogen (N2) once a day for 10 minutes at the level of the reactors. The contents of the reactors are stirred continuously (300 rpm) and maintained at 39.5°C. The pH of reactors 2 and 3 is continuously monitored in order to stabilize the pH of the ileum and the proximal colon.

Des prélèvements ont été collectés dans le système babySPIME durant la phase de stabilisation, avant le traitement avec les formulations symbiotiques et en fin de traitement avec le symbiotique.Samples were collected in the babySPIME system during the stabilization phase, before the treatment with the symbiotic formulations and at the end of the treatment with the symbiotic.

Pour chaque essai dans le système babySPIME, l'analyse des modifications du microbiote intestinal a été réalisée par qPCR sur des échantillons prélevés en fin de phase de stabilisation et à la fin d'une semaine de traitement par une composition symbiotique. Les séquences des amorces sens et des amorces anti-sens ufilisées pour mesurer par qPCR l'expression des gènes cibles correspondant aux populations bactériennes bénéfiques pour la communauté microbienne de l'intestin sont indiquées dans le Tableau 1 mentionné plus haut.For each trial in the babySPIME system, the analysis of changes in the intestinal microbiota was carried out by qPCR on samples taken at the end of the stabilization phase and at the end of one week of treatment with a symbiotic composition. The sequences of the sense primers and of the antisense primers used to measure by qPCR the expression of the target genes corresponding to the bacterial populations beneficial for the microbial community of the intestine are indicated in Table 1 mentioned above.

Trois répétitions sur le modèle SHIME ont été réalisées pour chacune des combinaisons symbiotiques.Three repetitions on the SHIME model were carried out for each of the symbiotic combinations.

Exemples.- Exemple 1 : La capacité de fermentation de la composition symbiotique par modélisation de la production de gaz et la production de lactate et SCFA dans un modèle de fermentation statique in vitro Les courbes de la fermentation des pré- ou symbiotiques sont montrées dans la figure 3. Dans toutes les conditions de la Figure 3, il y a une augmentation de la capacité de fermentation mesurée par l'augmentation de la production de gaz. Dans toutes les conditions de la figure 3, cette production de gaz est plus importante en présence d'une composition symbiotigue par rapport à la présence du prébiotique seul.Examples.- Example 1: The fermentation capacity of the symbiotic composition by modeling the production of gas and the production of lactate and SCFA in an in vitro static fermentation model The fermentation curves of the pre- or symbiotics are shown in the Figure 3. Under all conditions in Figure 3, there is an increase in fermentation capacity measured by the increase in gas production. Under all the conditions of FIG. 3, this gas production is greater in the presence of a symbiotic composition compared with the presence of the prebiotic alone.

Les paramètres issus de la modélisation de la production de goz pendant la fermentation statique des symbiotiques sont comparés par rapport aux paramètres des prébiotiques seules (tableau 3).The parameters resulting from the modeling of the production of goz during the static fermentation of the symbiotics are compared with the parameters of the prebiotics alone (Table 3).

Os [SP | es NT | am | vo | zm | max Pr | EN | EN TND > EE 12/19 2 SG al RING G GO [ER |E | DISS CS DD |G | Ps, | CS = [3] (S[X[X[R) ass sa (81281 (AJ 00 © olglea|/s) |109/0/5 SS SS 2159/16/90 = | VIV [VIV 717Bones [SP | are NT | am | you | zm | max Pr | IN | EN TND > EE 12/19 2 SG al RING G GO [ER |E | DISS CS DD |G | ps, | CS = [3] (S[X[X[R) ass sa (81281 (AJ 00 © olglea|/s) |109/0/5 SS SS 2159/16/90 = | VIV [VIV 717

GR == 3 n= a LA |P PO | Dn SA | WE | Pen | € ND | : Fu ü 3 — 5 ABA RSS Sa SS = Er = Klei (60/60/60 lere] ||| | eee ||| ||| 7/0 = = JIA DO GO SSSR [Sil [ES OO TND SIP 2 E [za FASO (SE SSS1E1TS [EEE (É ESS Ÿ Els en ||| ES C = > u 2 aa | <tr] |D = = = oe a SF NS me OS | LOS m | | Hs |t | CA 5 = 3 |In JS] (SN | OS SS INS LO D = MINE] TEA 15 SE AIG Ef alé c|'o1Gd|S| |19/9/0 Do SS oo © x 2 = q du 5 allelen allen als Gun] L 2 E pi A ee EE EN — Z & © © |OJs|HSOJS|=- en |] ale OST | ed fe = à 0 DIT Tal RST AS (On (ASS A = À 1815 Ss | [SE [0 [IM SE SA TE [= S œ EISIN [gls] | ||] ea SS & © SIE (BISSL (SES SS SES DS CO 5 = = - Tolles] === me es fes Nas © © mm NZ [SE] ISIS 6 | rer 218 || 6 | ER = 5 5 Dias (DE SO Ss DIÄT ps | |slAls/|sl| esse (88 (58 AR = 0 > 5 21919 ei Oo S|1S15|9 co + 2 CC = © à ellela ele [el © DIN RS TG SC CSS SG [SS] [||| ë € 5 Us (glglol|slg|sl|s/slg|/s\s|e See 19/9/1510 ; ; U <a © ; I ea ea EEE als = € , DD [m | Ps [ON] PS JE DE | A || Ps | PS | | m [m DM] L "5 U N pus | a | a | m | | a | | A | |E | pas | ps | es es | ess | | ens ES || | CN ren Ten are [a en | en AIR ie © Ss 5 le) 82585 8858| 88 BE 885 g 0 5 | 15 \(S[58/8 8528 sa (98 388° v ËL = là S|S|G|S| (9 3 16 o/g ö|el N 2 5 © FIV VIV Oo Dz 5 on aloe ale ala le 5506 cg © © 18 IS SEES (NE RSS S NR A Ù = E [He |S|6oJ0|6/606/0/S/0/0|SJ= ||| |||] cs ù DÛ 2 IEEE OST L © + | Zl Ins] TE SN TE TRE ESS ES | = 0 D le (ST (01510 ||| [us || | || INT [|| | D + = m co | m | rr | rr # 2 eu 55=—5 Re FT = 15 =|5= 2 à 2 Dn D a SR || PO fe © | S|IS/9|S = >> 10 5 [is | 65 | 60 SIDE De © PS a IS à € + (PF D/s ee [A| UE 1818 Cm DSG n © € sElé BSG 5 oo Sa SS olgers = a Ÿ 128 U 8 # 153 ; = he N ) = A [er = en SR = SE 5 2 = 180097 NSS SE Ze ZINN Sn WISS = A Lu 5 + m. m | | CN _ — | Co dd | = | = Lt ts = = = QC de ol PF |L X em | DO | CH | 60 | On | 0 || es | 50 | SP [A =} | NO | Pe 9 SZ = ELISA ST GS SE SA JS SG [Aa (ANS [SR 5 5 © 5888 EFÉSEFHEZEESE SNS KRISE 1 N a em m | Ha He Ps : 2 Se dz FÉO [TS (SA |||] [SN TS [|| [es X 5 € X a 4 © E 2 > > _ dc D 3 g 2 X, Ce = E _ “ vo T 3 5 CO SS 6 = EE MD , blu lis & aD (7 > 2 © 19151818 Ne 12 RO SIE 2 € Se OT DOSE ED [a|n ; N c & 3 OK ae 30a 05 ZED 7 4 A | Re | 7 | LS | hl er = br | 55 SE © u. b 2 DS |5/0/60/&|6/5/5/E|53/5/€ [Om aeGR == 3 n= a LA |P PO | Dn SA | WE | pen | € n/a | : Fu ü 3 — 5 ABA RSS Sa SS = Er = Klei (60/60/60 lere] ||| | eee ||| ||| 7/0 = = JIA DO GO SSSR [Sil [ES OO TND SIP 2 E [za FASO (SE SSS1E1TS [EEE (É ESS Ÿ Els en ||| ES C = > u 2 aa | <tr] |D = = = oe a SF NS me OS | LOS m | | Hs |t | CA 5 = 3 |In JS] (SN | OS SS INS LO D = MINE] TEA 15 SE AIG Ef alé c|'o1Gd|S| |19/9/0 Do SS oo © x 2 = q du 5 allelen allen als Gun] L 2 E pi A ee EE EN — Z & © © |OJs|HSOJS|=- en |] ale OST | ed fe = à 0 DIT Tal RST AS (On (ASS A = À 1815 Ss | [SE [ 0 [IM SE SA TE [= S œ EISIN [gls] | ||] ea SS & © SIE (BISSL (SES SS SES DS CO 5 = = - Tolles] === me es fes Nas © © mm NZ [SE ] ISIS 6 | rer 218 || 6 | ER = 5 5 Dias (DE SO Ss DIÄT ps | |slAls/|sl| esse (88 (58 AR = 0 > 5 21919 ei Oo S|1S15|9 co + 2 CC = © to ellela ele [el © DIN RS TG SC CSS SG [SS] [||| ë € 5 Us (glglol|slg|sl|s/slg|/s\s|e See 19/9/1510; ; U < a © ; I ea ea EEE als = €, DD [m | Ps [ON] PS I DE | A || Ps | PS | | m [m DM] L "5 U N pus | a | a | m | | a | | A | | E | not | ps | es es | ess | | set ES || | CN ren Ten are [a en | in AIR ie © Ss 5 le) 82585 8858| 88 BE 885g 0 5 | 15 \(S[58/8 8528 sa (98 388° v ËL = there S|S|G|S| (9 3 16 o/g ö|el N 2 5 © FIV VIV Oo Dz 5 on aloe ale ala le 5506 cg © © 18 IS SEES (NE RSS S NR A Ù = E [He |S|6oJ0|6/606/0/S/0/0|SJ= ||| |||] cs ù DÛ 2 IEEE OST L © + | Zl Ins] TE SN TE TRE ESS ES |= 0 D le (ST (01510 ||| [us || | || INT [|| | D += m co | m | rr | rr # 2 eu 55=—5 Re FT = 15 =|5= 2 to 2 Dn D a SR || PO fe © | S|IS/9|S = >> 10 5 [is | 65 | 60 SIDE De © PS a IS à € + (PF D/s ee [A| UE 1818 Cm DSG n © € sElé BSG 5 oo Sa SS olgers = a Ÿ 128 U 8 # 153 ; = he N ) = A [er = en SR = SE 5 2 = 180097 NSS SE Ze ZINN Sn WISS = A Lu 5 + m.m | | CN _ — | Co dd | = | = Lt ts == = QC de ol PF |L X em | DO | CH | 60 | On | 0 || es | 50 | SP [A=} | NO | Pe 9 SZ = ELISA ST GS SE SA JS SG [Aa (ANS [SR 5 5 © 5888 EFÉSEFHEZEESE SNS KRISE 1 N a em m | Ha He Ps: 2 Se dz FÉO [TS (SA |||] [SN TS [|| [es X 5 € X a 4 © E 2 > > _ dc D 3 g 2 X, Ce = E _ “ vo T 3 5 CO SS 6 = EE MD , blu lis & aD (7 > 2 © 19151818 Ne 12 RO SIE 2 € Se OT DOSE ED [a| not ; N c & 3 OK ae 30a 05 ZED 7 4 A | Re | 7 | LS | hl er = br | 55 SE © u. b 2 DS |5/0/60/&|6/5/5/E|53/5/€ [Om ae

La cinétique de production de gaz et les paramètres du modèle incluent : A: la production maximale de gaz ; B: le temps pour avoir 50% de la production maximale de gaz; C: la pente ; D: le taux maximal de production de gaz (Rmax) ; le temps à Rmax (Tmax). La fermentation statique des combinaisons symbiotiques a été réalisée à 10E7 CFU/ml de probiotique et 0.1 g de prébiotique (même quantité de prébiotique utilisée dans la condition où le prébiotique est seul) en présence de 3% d'un inoculat de fécès. Les résultats indiquent Ia moyenne +/- l'écart-type de 3 réplicats expérimentaux. Les p-valeurs ont été obtenues par une analyse statistique ANOVA unidirectionnel avec un test de comparaison multiple de type Dunnett. La significativité statistique est considérée lorsque p < 0.05.Gas production kinetics and model parameters include: A: maximum gas production; B: the time to have 50% of the maximum gas production; C: the slope; D: the maximum rate of gas production (Rmax); the time at Rmax (Tmax). The static fermentation of the symbiotic combinations was carried out at 10E7 CFU/ml of probiotic and 0.1 g of prebiotic (same quantity of prebiotic used in the condition where the prebiotic is alone) in the presence of 3% of a faeces inoculate. The results indicate the mean +/- standard deviation of 3 experimental replicates. The p-values were obtained by a one-way ANOVA statistical analysis with a Dunnett type multiple comparison test. Statistical significance is considered when p < 0.05.

Les SCFAs dans le jus de fermentation après 24h de fermentation sont montrés dans le tableau 4. Il n'y avait pas de production delactate après 24h de fermentation.The SCFAs in the fermentation juice after 24 h of fermentation are shown in Table 4. There was no delactate production after 24 h of fermentation.

ç T a |g POP TE = ce a le > | a mee > 0 > IS 5 ES pm = Ex s|s|es Bas : mey = x © 5 —|5 © — | © SS Ver de == TS = | © len | = Ss NE EE = = 5 a = | 8 = 238 S RE al ee BE2020 = : “le > =| AE pers DZ 8 S SE © Alle So Se PORTES /5828 Af «x <} pe DISS sr OR “te il y DB . u a les + = Sy = SISI vo; us el u ey en = Sa es e= = & EN a 2 LJ 2 [2 es DIS Jes) «> & 1e =} 58 &|S - Æ De = LS re a | SS Be © Alm — ca Ss DS © « 5 = 5 ERE SIE 8 215 SS D + Lei 5 6 | ca pa Cu] er a ij ch wl Een) = a] | x m es = S 21e mn = lus | X | © À, = | ele 5 = % je] se 16 m = ISIS “Is — LB “Ja 0 = 3 IT on u D es ad Ch E © Ù > = 18 SG) = 19 u De ij ! 5 Deal f en u D © à 5 ce ca Le le y #2 [3 | |3 #25 5 SE € ES © == = ISIS “| 18/88 + > 133 ol U L a 8 S SIS Ca ès olen mal ol Ÿ + co E EE SI | S/S] > ess | Ch 3 = E z 5 So Ÿ 2 | = en îles ch D © Re ti & Se SS = = ç >> oi mi O + a nd 1|— = vn ns ws Fa = 3 12e wo 7 al als 3 8° & 8888 SS SS 5e LJ S REESE ES |Een DR = € sale? SIE] ® | Ss oo € ti mo | € ea Ps d wa cd Da i 5 A Jo ed | cs | 05 DD = En, te we à = U SEHE = SHE ju Do | TL N u er OS = e= dou EN en SI 513 Ca] Ss 2 319 ASS 5 | e= SS De S SIE = " 5 0 = 15 "pe | + 21 & op Æ == le ö Os es SS XS - © a Va ASS LS © Sl € ASS Go = = les Fe : co se SI “0 5 = 5 5|e|s|s _ S/A. = SSS js 5 5 Sa 5 18/8182 58 5 1218 x Js S SS zZ ze - IT: © A LE 2 + D S je D 3 = = me [em cles 5 5 > = = sm Eu D 4 Ss = Oo _ e À © 7 AR 3 ea SC en =| 2 we 2 a 5 8 SS SISIS 2 => 5 Mo me U = 5 = e v SS lm 7 > SS CH € == ei 07 <a a io} { ml S mo 7 Se ele = =| IN Di = cé D 2 Ps ee va 55 „| SS € o = © = 181, N Y = | | 5 = 21316 |E | wije) Se ‚2 | Ja ESSEN: S/S ls DE S| © LA oo SIT ox Je Sl a Ss no > = = ni |t | ej es & 15 = © Lan) == > D “tf wle cz es ons CR | a ms B] in =| © IE DI 15 <=. pee em Ss | ee De LA es >= = Or wle ca op > vale ce 505 = SS CSSS SS 5 SS ; = 5 aa Al cri (| Ô oO > = e= 2 ih CO & 5 19 SS SE ca ci “es 8 EL uE = cr | Ald) S Les | er se = A © 5 La ti > a LA | zn Sl a | + AEN 5 es | so Ta DE ca |“ © SBS |: == m © = S 88/85 a 9 zò 2 [XS 5| [SII X 8 S/S 5 || SS ESE 2/8 SNE 3 RS a 316 # & = | à $ So SI LA ca > pe © |In : 5 0 = Ds 0 |= es D Le 152 = + Da I [ab] = 2 = | … 8 122 =) & on [ar s|5|S SIN - = 152 © 2 ca 8 & = | EIS = > = SS | 1 | c5 & © > a © Le) De SEE == UN les ET 1 = 5 5 | © 5 olens ci = = © Lj Ç on € = D pe ISI “Ig = © = ce 3 8 ‘: £ |= 2 1€ ZE SS us = AS SSS == 5 © = E zl © € EE dje 4 SS SS 855 = à $ G Ze) SS Dal = 15 Al E S/S 5/8 = D > > eo se 8 FE m | © CN Eh © Oo > à # ! en mm a] où | Fn KISS Ie & DIS TIR D Ald c loi SES 17 co os cs 7 ; = a A 5 Lt) y ip SS Pa to ca 12 5 Ps es = “a TY A & = |4 © IS IS js ce Is © 3 = 18 ps os es EL © 6 Du = 19/2 5 18 = SS S = x & = = N Al + 5 es | + e d ve „En a es a ei D ps A D = CHA Ps D | = Re 6A | À _ 510 q Ÿ = + A les co da zp | == + © 5 y >E u Im wi OS x | = eN A| EE æ = Gi = N 3 oe re lei |E ps | es a = ea |= 3 N AS © |S ÿ| © SEQIS EIL [8 sel as SIS os | AS Ca a | HD a | & SS © 1e | NE ES AS A + 3 N = 13/5 DISS ne SS Ss AN |A >| % lez 51519 mln | © p 4 ál © ale 5 | EN > al us Ma = Lu = 3 Dn le zr où tra ele N m | ee 22 5] a | Se X | Ds fen) = | SIE LS U: A Pos Pr | Om ep | es a es co SM Os CO © = Ss Si : = le EE ey 3 Ss & IE Se IE 5e. il SS SIE SE Ss à ml © SS 5 ÿ | ; ; | Eil ej “é X 2 ea SIE 43 ; © U JG SS = 5 Ds Se fs EN | De iO N || 5 la en MS = Ne 5 G gE an = 5 | Ss > |e = 180 = © LE : a ci 5 2 | EL _g aile cd Ie Ge = = Lu OR 36/9 SS] IE El A) $ SS x Je G È A a (D te eh CH EN Da EN! cle + BN = en + ea | ka Mar als ® 2 & BIS = Lu Li. = x Aa Cs "7 LÉ) OÖ. #20 #73 = USE ae 211 En FF lS & pas | a |A = DA EIN La] ‚ N us | a = ES > Ge | ks € ES 28 >| 3 9 © ò K|Ö | © GI © ° 292880 | a ET au, D ar | Aid EEç T a |g POP TE = ce a le > | a mee > 0 > IS 5 ES pm = Ex s|s|es Bottom: mey = x © 5 —|5 © — | © SS Ver of == TS = | © len | = Ss NE EE = = 5 a = | 8 = 238 S RE al ee BE2020 = : “the > =| AE pers DZ 8 S SE © Alle So Se PORTES /5828 Af “x <} pe DISS sr OR “te il y DB . u has the + = Sy = SISI vo; us el u ey en = Sa es e= = & EN a 2 LJ 2 [2 es DIS Jes) «> & 1e =} 58 &|S - Æ De = LS re a | SS Be © Alm — ca Ss DS © « 5 = 5 ERE SIE 8 215 SS D + Lei 5 6 | ca pa Cu] er a ij ch wl Een) = a] | x m es = S 21st min = read | X | © To, = | ele 5 = % je] se 16 m = ISIS “Is — LB “Ja 0 = 3 IT on u D es ad Ch E © Ù > = 18 SG) = 19 u De ij ! 5 Deal f en u D © à 5 ce ca Le le y #2 [3 | |3 #25 5 SE € ES © == = ISIS “| 18/88 + > 133 ol U L a 8 S SIS Caès olen mal ol Ÿ + co E EE SI | S/S] > ess | Ch 3 = E z 5 So Ÿ 2 | = en isles ch D © Re ti & Se SS = = ç >> oi mi O + a nd 1|— = vn ns ws Fa = 3 12th wo 7 al als 3 8° & 8888 SS SS 5th LJ S REESE ES | Een DR = € dirty? SIE] ® | Ss oo € ti mo | € ea Ps d wa cd Da i 5 A Jo ed | cs | 05 DD = En, te we à = U SEHE = SHE ju Do | TL N u er OS = e= dou EN en SI 513 Ca] Ss 2 319 ASS 5 | e= SS From S SIE = " 5 0 = 15 "pe | + 21 & op Æ == le ö Os es SS XS - © a Va ASS LS © Sl € ASS Go = = les Fe : co se SI “0 5 = 5 5|e|s|s _ S/A. = SSS js 5 5 Sa 5 18/8182 58 5 1218 x Js S SS zZ ze - IT: © A LE 2 + D S i D 3 = = me [em cles 5 5 > = = sm Eu D 4 Ss = Oo _ e À © 7 AR 3 ea SC en =| 2 we 2 a 5 8 SS SISIS 2 => 5 Mo me U = 5 = e v SS lm 7 > SS CH € == ei 07 <a a io} { ml S mo 7 Se ele = =| IN Di = cé D 2 Ps ee va 55 „| SS € o = © = 181, N Y = | | 5 = 21316 |E | wije) Se‚2 | Ja ESSEN: S/S ls DE S| © LA oo SIT ox Je Sl a Ss no > = = ni |t | ej es & 15 = © Lan) == > D “tf wle cz es ons CR | a ms B] in =| © IE DI 15 <=. pee em Ss | ee De LA es >= = Or wle ca op > vale ce 505 = SS CSSS SS 5 SS; = 5 aa Al cri (| Ô oO >= e= 2 ih CO & 5 19 SS SE ca ci “es 8 EL uE = cr | Ald) S Les | er se = A © 5 La ti > a LA | zn Sla | + AEN 5 th | so Ta DE ca |“ © SBS |: == m © = S 88/85 a 9 zò 2 [XS 5| [SII X 8 S/S 5 || SS ESE 2/8 SNE 3 RS a 316 # & = | à $ So SI LA ca > pe © |In : 5 0 = Ds 0 |= es D Le 152 = + Da I [ab] = 2 = | … 8 122 =) & on [ar s|5|S SIN - = 152 © 2 ca 8 & = | EIS = > = SS | 1 | c5 & © > a © The) Of SEE == A the AND 1 = 5 5 | © 5 olens ci = = © Lj Ç on € = D pe ISI “Ig = © = ce 3 8 ': £ |= 2 1€ ZE SS us = AS SSS == 5 © = E zl © € EE dje 4 SS SS 855 = à $ G Ze) SS Dal = 15 Al E S/S 5/8 = D > > eo se 8 FE m | © CN Eh © Oo > to #! in mm a] where | Fn KISS Ie & DIS TIR D Ald c SES law 17 co os cs 7; = a A 5 Lt) y ip SS Pa to ca 12 5 Ps es = “a TY A & = |4 © IS IS js ce Is © 3 = 18 ps os es EL © 6 Du = 19/2 5 18 = SS S = x & = = N Al + 5 es | + e d ve „En a es a ei D ps A D = CHA Ps D | = Re 6A | À _ 510 q Ÿ = + A les co da zp | == + © 5 y >E u Im wi OS x | = in A| EE æ = Gi = N 3 oe re lei |E ps | es a = ea |= 3 N AS © |S ÿ| © SEQIS EIL [8 sel as SIS os | AS Ca a | HD has | & SS © 1st | NE ES AS A + 3 N = 13/5 DISS ne SS Ss AN |A >| % lez 51519 mln | © p 4 to © ale 5 | EN > al us Ma = Lu = 3 Dn the zr where tra ele N m | ee 22 5] a | Se X | Dsfen) = | SIE LS U: A Pos Pr | Om ep | es a es co SM Os CO © = Ss Si: = le EE ey 3 Ss & IE Se IE 5e. he SS SIE SE Ss to ml © SS 5 ÿ | ; ; | Eil ej “é X 2 ea SIE 43; © U JG SS = 5 Ds Se fs EN | From iO N || 5 la in MS = Ne 5 G gE an = 5 | Ss > |e = 180 = © LE: a ci 5 2 | EL _g wing cd Ie Ge = = Lu OR 36/9 SS] IE El A) $ SS x Je G È A a (D te eh CH EN Da EN! cle + BN = en + ea | ka Mar als ® 2 & BIS = Lu Li. = x Aa Cs "7 LÉ) OÖ. #20 #73 = USE ae 211 En FF lS & pas | a |A = DA EIN La] ‚ N us | a = ES > Ge | ks € ES 28 >| 3 9 © ò K|Ö | © GI © ° 292880 | a ET au, D ar | Aid EE

La fermentation statique des combinaisons symbiotiques a été réalisée à 10E7 CFU/ml de probiotique et 0,1 g de prébiotique (même quantité de prébiotique utilisée dans la condition où le prébiotique est seul) en présence de 3% d'un inoculat de fécès.The static fermentation of the symbiotic combinations was carried out at 10E7 CFU/ml of probiotic and 0.1 g of prebiotic (same quantity of prebiotic used in the condition where the prebiotic is alone) in the presence of 3% of a faeces inoculate.

Les résultats indiquent la moyemne +/- l'écart-type de 3 réplicats expérimentaux.Results indicate the mean +/- standard deviation of 3 experimental replicates.

Les p-valeurs ont été obtenues par une analyse statistique ANOVA unidirectionnel avec un test de comparaison multiple de type Dunnett.The p-values were obtained by a one-way ANOVA statistical analysis with a Dunnett type multiple comparison test.

Lorsque p <005:*;p< 0,01 :**;p<0,001 : *** > p < 0,0007 : ****, Example 2 : Détermination des modifications du microbiote par gPCR lors d'un essai en modèle de fermentation statique in vitro en présence de différentes compositions symbiotiques L’abondance relative des bactéries bénéfiques après 24h de fermentation sont présentés dans la figure 4. La méthode de delta-delta CT a été utilsée pour exprimer les bactéries cibles par rapport aux bactéries totales.When p <005:*;p< 0.01:**;p<0.001: *** > p < 0.0007: ****, Example 2: Determination of changes in microbiota by gPCR during an assay in in vitro static fermentation model in the presence of different symbiotic compositions The relative abundance of beneficial bacteria after 24 hours of fermentation are presented in Figure 4. The delta-delta CT method was used to express the target bacteria compared to the bacteria total.

Les résultats des symbiotiques sont comparés par rapport aux prébiotiques seuls.The results of the synbiotics are compared with the prebiotics alone.

Comme l'indique la figure 4, plusieurs compositions symbiotiques, comme BT-GF, CB-GF, BCO-GF, BCU-2FL, BMO-2FL, BAL-2FL, BAL-Inu, BT-Inu, CB-RS, BCU-RS, BAL-BG, LP-BG, ou BCU- BG, permettent d'augmenter de manière significative l'abondance relative des bactéries bénéfiques à 24h de fermentation.As shown in Figure 4, several symbiotic compositions, such as BT-GF, CB-GF, BCO-GF, BCU-2FL, BMO-2FL, BAL-2FL, BAL-Inu, BT-Inu, CB-RS, BCU -RS, BAL-BG, LP-BG, or BCU-BG, make it possible to significantly increase the relative abundance of beneficial bacteria at 24 hours of fermentation.

Exemple 3 : Détermination de la capacité des probiotiques de survivre et de s'établir pendant la fermentation La figure 5 montre la présence des probiotiques dans le jus de fermentation après 12, 24 et 48h de fermentation.Example 3: Determination of the ability of probiotics to survive and establish themselves during fermentation Figure 5 shows the presence of probiotics in the fermentation juice after 12, 24 and 48 hours of fermentation.

Des compositions symbiotiques, comme BT-Inu, permettent une bon établissement et une bonne capacité de survie du probiotique.Symbiotic compositions, such as BT-Inu, allow good establishment and survivability of the probiotic.

Exemple 4 : Détermination de l'effet immunomodulateur de la composition symbiotique par quantification de la production d'IL-8 et NO par des cellules IPEC-J2.Example 4: Determination of the immunomodulatory effect of the symbiotic composition by quantification of the production of IL-8 and NO by IPEC-J2 cells.

La production d'IL-8 dans les cellules IPEC-J2 a été mesurée porun'est ELISA.IL-8 production in IPEC-J2 cells was measured by ELISA.

Après 24h d'incubation, la réponse immunitaire a été évaluée en mesurant la production d’IL-8 dans le mileu de culture cellulaire. Les cellules IPEC-J2 ont été iIncubées avec 0,8 % (V/V) de jus de fermentation préalablement stérilisé par filtration. De plus, le taux de survie des cellules IPEC-J2 est supérieur ou égal à 70% dans toutes les conditions testées de jus de fermentation.After 24 h of incubation, the immune response was evaluated by measuring the production of IL-8 in the cell culture medium. The IPEC-J2 cells were incubated with 0.8% (V/V) of fermentation juice previously sterilized by filtration. Moreover, the survival rate of IPEC-J2 cells is greater than or equal to 70% in all the tested conditions of fermentation juice.

Pour déterminer l'impact de la composition symbiotique contenue dans le jus de fermentation sur la production d'IL-8, le taux de production d’IL-8 a été mesuré dans une condition contrôle où le jus de fermentation contient un inoculat de fèces, de lo mucine (témoin- mucine), mais en absence de problotiques, de prébiotiques ou de symbiotiques. Dans cette condition conirôle, un niveau de base d'expression d'IL-8 est de 932 pg/ml! (représenté par la ligne horizontale à la figure 2}. Les pré- et symbiotiques ont été comparé par rapport au témoin-mucine. En plus les symbiotiques ont été comparé par rapport au prébiotique pour estimer l'effet additionnel de probiotique. Le tableau 5 montre les p-vaieurs de ces comparaisons, et la figure 2 montre les concentrations d'IL8.To determine the impact of the symbiotic composition contained in the fermentation juice on the production of IL-8, the production rate of IL-8 was measured in a control condition where the fermentation juice contains an inoculate of faeces , of lo mucin (control-mucin), but in the absence of problotics, prebiotics or symbiotics. In this controlled condition, a basal level of IL-8 expression is 932 pg/ml! (represented by the horizontal line in Figure 2}. The pre- and synbiotics were compared against the control-mucin. In addition the synbiotics were compared against the prebiotic to estimate the additional probiotic effect. Table 5 shows the p-values of these comparisons, and Figure 2 shows the concentrations of IL8.

Tableau 5.- Production d'IL-8 par les cellules IPEC-J2 dans le surnageant après 24h d'incubation avec 0,8% de jus de fermentation préalablement stérilisé par filtration produit par la composition symbiotique ou le prébiotique seul.Table 5.- Production of IL-8 by the IPEC-J2 cells in the supernatant after 24 hours of incubation with 0.8% of fermentation juice previously sterilized by filtration produced by the symbiotic composition or the prebiotic alone.

IL-8 (pg/ml) moyenne | ET (vs (vs blanc- prébiotique) mucine) GOS/FOS (GF) 10940 | 40,5 | | 0042 BCO-GF 897,3 0,0041 0,9207 BT-GF 1089,4 0,9999 0,0497 CB-GF 849,5 0,0006 0,3954 EF-GF 927,5 0,0138 0,9997 10412 |526| | 02193 BAL-2FL 581,3 <0,0001 <0,0001 BCU-2FL 570,8 <0,0001 <0,0001 BMO-2FL 715,1 <0,0001 0,0037 INULINE (Inu) 11164 | 409 | | 0028 BAL-Inu 1177,7 112,6 0,4075 0,004 1025,9 0,1816 0,3398 Amidon résistant (RS) | 753,3 | 509| | 0,0086 BCU-RS 1150,3 <0,0001 0,003 CB-RS 1195,6 <0,0001 0,0007 B-GLUCANE 8317 |405| | 01916 BAL-BG 393,6 <0,0001 <0,0001 BCU-BG 413,2 <0,0001 <0,0001 EF-BG 1128,9 <0,0001 0,0066 LP-BG 775,7 106,0 0,5405 0,0232 9371 [nos] | Les valeurs sont corrigées en fonction de la viabilité cellulaire. Les résultats sont des moyennes avec leurs écart-types. Les comparaisons sont réalisées entre les compositions symbiotiques et le prébiotique seul. Les significativités statistiques sont analysées par une ANOVA unidirectionnel avec un test de comparaison multiple de type Dunnett.IL-8 (pg/ml) mean | ET (vs (vs white- prebiotic) mucin) GOS/FOS (GF) 10940 | 40.5 | | 0042 BCO-GF 897.3 0.0041 0.9207 BT-GF 1089.4 0.9999 0.0497 CB-GF 849.5 0.0006 0.3954 EF-GF 927.5 0.0138 0.9997 10412 |526| | 02193 BAL-2FL 581.3 <0.0001 <0.0001 BCU-2FL 570.8 <0.0001 <0.0001 BMO-2FL 715.1 <0.0001 0.0037 INULIN (Inu) 11164 | 409 | | 0028 BAL-Inu 1177.7 112.6 0.4075 0.004 1025.9 0.1816 0.3398 Resistant starch (RS) | 753.3 | 509| | 0.0086 BCU-RS 1150.3 <0.0001 0.003 CB-RS 1195.6 <0.0001 0.0007 B-GLUCANE 8317 |405| | 01916 BAL-BG 393.6 <0.0001 <0.0001 BCU-BG 413.2 <0.0001 <0.0001 EF-BG 1128.9 <0.0001 0.0066 LP-BG 775.7 106, 0 0.5405 0.0232 9371 [nos] | Values are corrected for cell viability. The results are means with their standard deviations. The comparisons are made between the symbiotic compositions and the prebiotic alone. The statistical significances are analyzed by a one-way ANOVA with a Dunnett type multiple comparison test.

Lorsque p<0,05 : * ; p<0,01 : ** ; p<0,001 : *** ; p<O,0001 : ****,When p<0.05: *; p<0.01: **; p<0.001: ***; p<0.0001: ****,

Exemple 5 : Détermination des modifications du microbiote par qPCR lors d'un essai en modèle baby SPIME en présence de différentes compositions symbiotiques.Example 5: Determination of the modifications of the microbiota by qPCR during a test in the baby SPIME model in the presence of different symbiotic compositions.

Les résultats globaux obtenus sur le système baby SPIME sont présentés dans la figure 6 et le tableau 6.The overall results obtained on the baby SPIME system are presented in Figure 6 and Table 6.

Tableau 6.- Synthèse de la régulation à la hausse ou à la baisse de groupes bactériens d'intérêt suite au traitement symbiotique dans le système SHIME après une semaine de traitement avec les différents symbiotiques.Table 6.- Summary of the up-regulation or down-regulation of bacterial groups of interest following symbiotic treatment in the SHIME system after one week of treatment with the different symbiotics.

Test Lactobacillus | Bifidobacterium | Cluster | Cluster XIV | Acetyl Wilcoxon IV CoA Control Baisse Tendance à la Stable Stable Stable SHIME p<0,01 baisse 0,05<p<0,1 EF + BG Stable Tendance à la Baisse Stable Hausse baisse p= p<0,05 0,05<p<0,1 0,01 BT + INU Stable Tendance à la | Hausse Baisse Stable hausse p<0,05 (p = 0,05) 0,05<p<0,1 CB + Baisse Stable Stable Stable Hausse GOS/FOS p<0,01 p<0,01 BAL + 2FL Baisse Hausse Stable Stable Stable p<0,01 p<0,05 BCU + BG Baisse Tendance à la | Hausse | Tendance | Stable p<0,01 hausse p<0,05 | à la baisse 0,05<p<0,1 0,05<p<0,1 Nous retrouvons soit une diminution de la population bactérienne, soit une augmentation de la population bactérienne ou soit une stabilisation de la population bactérienne. Le test statistique réalisé est un test de Wilcoxon.Lactobacillus test | bifidobacterium | cluster | Cluster XIV | Acetyl Wilcoxon IV CoA Control Decreasing Trending Stable Stable Stable SHIME p<0.01 decreasing 0.05<p<0.1 EF + BG Stable Decreasing trend Stable Increasing decreasing p= p<0.05 0.05< p<0.1 0.01 BT + INU Stable Trend towards | Increase Decrease Stable increase p<0.05 (p = 0.05) 0.05<p<0.1 CB + Decrease Stable Stable Stable Increase GOS/FOS p<0.01 p<0.01 BAL + 2FL Decrease Increase Stable Stable Stable p<0.01 p<0.05 BCU + BG Decrease Trend | Rise | Trend | Stable p<0.01 increase p<0.05 | downwards 0.05<p<0.1 0.05<p<0.1 We find either a decrease in the bacterial population, an increase in the bacterial population or a stabilization of the bacterial population. The statistical test performed is a Wilcoxon test.

Exemple 6: Composition symbiotique Cl comprenant au moins Clostridium butyricum et au moins GOS/FOS contre la dysbiose intestinale.Example 6: Symbiotic composition C1 comprising at least Clostridium butyricum and at least GOS/FOS against intestinal dysbiosis.

On a préparé la composition Cl en ajoutant 1E07 CFU/ml Clostridium butyricum et 0,1 g de GOS/FOS.Composition C1 was prepared by adding 1E07 CFU/ml Clostridium butyricum and 0.1 g GOS/FOS.

Plus particulièrement, au niveau du prébiotique, 0,19 de GOS/FOS a été ajouté dans chaque flacon de fermentation contenant 15ml de jus de fermentation.More particularly, at the level of the prebiotic, 0.19 of GOS/FOS was added in each fermentation bottle containing 15ml of fermentation juice.

Pour le mélange GOS/FOS, le prébiotique consiste en une solution liquide homogène de 80% (p/p) de GOS et 20% (p/p) de FOS.For the GOS/FOS mixture, the prebiotic consists of a homogeneous liquid solution of 80% (w/w) GOS and 20% (w/w) FOS.

AU niveau du probiotique, une poudre lyophilisée de bactérie a été pré-mixé dans une solution tampon à une concentration de 1,5E08 CFU/ml (solution stock). Avant d'être ajouté au flacon de fermentation, la solution pré-mixée de probiotique a subi un processus de revivification consistant en une incubation de 30 min, à 37°C sous agitation.At the level of the probiotic, a freeze-dried powder of bacteria was pre-mixed in a buffer solution at a concentration of 1.5E08 CFU/ml (stock solution). Before being added to the fermentation flask, the pre-mixed probiotic solution underwent a revivification process consisting of a 30 min incubation at 37°C with shaking.

Ensuite, 1 ml de la solution pré-mixée (solution stock) a été ajouté au flacon menant à une concentration finale en probiotique de 1E07 CFU/ml dans le flacon.Then 1ml of the pre-mixed solution (stock solution) was added to the vial leading to a final probiotic concentration of 1E07 CFU/ml in the vial.

La composition symbiotique comprenant au moins Clostridium butyricum et au moins GOS/FOS contre la dysbiose intestinale a montré un effet favorable sur la fermentation, en augmentant la valeur A (production maximale de gaz) par rapport au prébiotique seul (voir condition CB-GoF du Tableau 3, et en augmentant les concentrations de SCFAs totales et butyrate après 24 heures de fermentation statique in vitro (voir condition CB-GoF du Tableau 4). En plus, l'abondance relative des Bifidobacteria et Lactobacill a augmenté en comparaison avec le prébiotique seul (voir condition CB-GF de la Figure 4). Le probiotique Clostridium butyricum était encore présent dans le jus de fermentation après 48h de fermentation.The symbiotic composition comprising at least Clostridium butyricum and at least GOS/FOS against intestinal dysbiosis showed a favorable effect on fermentation, by increasing the A value (maximum gas production) compared to the prebiotic alone (see CB-GoF condition of the Table 3, and by increasing the concentrations of total SCFAs and butyrate after 24 hours of static fermentation in vitro (see CB-GoF condition of Table 4) In addition, the relative abundance of Bifidobacteria and Lactobacill increased in comparison with the prebiotic alone (see CB-GF condition in Figure 4) The probiotic Clostridium butyricum was still present in the fermentation juice after 48 hours of fermentation.

Un effet anti-inflammatoire est montré in vitro sur des cellules IPEC-J2 générant une diminution de la production d'IL-8 par rapport au GOS/FOS seul, tandis que la concentration d'IL-8 n'était pas différent par rapport au témoin-mucine (voir condition CB-GF de la Figure 2). De plus, la composition symbiotique Cl montre une amélioration du microbiote dans le modèle SHIME en augmentant les populations bactériennes impliquées dans les voies métaboliques de production de butyrate.An anti-inflammatory effect is shown in vitro on IPEC-J2 cells generating a decrease in IL-8 production compared to GOS/FOS alone, while the concentration of IL-8 was not different compared to to control-mucin (see CB-GF condition of Figure 2). Moreover, the Cl symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations involved in the metabolic pathways of butyrate production.

L'augmentation de ces populations bactériennes a été analysée par qPCR (voir condition CB + G/F de la Figure 6 et Tableau 6 présentés plus haut). Les séquences des amorces sens et des amorces antisens utilisées pour mesurer par qPCR l'abondance relative des populations bactériennes bénéfiques pour la communauté microbienne de l'intestin sont indiquées dans le Tableau 1. Exemple 7: Composition symbiotique C2 comprenant au moins Bifidobacterium thermophilum et au moins l'inuline contre la dysbiose intestinale.The increase in these bacterial populations was analyzed by qPCR (see condition CB+G/F of FIG. 6 and Table 6 presented above). The sequences of the sense primers and the antisense primers used to measure by qPCR the relative abundance of the bacterial populations beneficial to the microbial community of the intestine are indicated in Table 1. Example 7: Symbiotic composition C2 comprising at least Bifidobacterium thermophilum and at least less inulin against intestinal dysbiosis.

On a préparé la composition C2 en ajoutant 1E07 CFU/ml de Bifidobacterium thermophilum et 0,1 g d'inuline.Composition C2 was prepared by adding 1E07 CFU/ml of Bifidobacterium thermophilum and 0.1 g of inulin.

Plus particulièrement, au niveau du prébiotique, 0,1g d'inuline a été ajouté dans chaque flacon de fermentation contenant 15ml de jus de fermentation.More specifically, at the prebiotic level, 0.1g of inulin was added to each fermentation bottle containing 15ml of fermentation juice.

Au niveau du probiotigue Bifidobacterium thermophilum, une poudre lyophilisée de bactérie a été pré-mixé dans une solution tampon à une concentration de 1,5E08 CFU/ml (solution stock). Avant d'être ajouté au flacon de fermentation, la solution pré- mixée de probiotique a subi un processus de revivification consistant en uneincubation de 30 min, à 37°C sous agitation.At the level of the probiotic Bifidobacterium thermophilum, a freeze-dried powder of bacteria was pre-mixed in a buffer solution at a concentration of 1.5E08 CFU/ml (stock solution). Before being added to the fermentation flask, the pre-mixed probiotic solution underwent a revivification process consisting of a 30 min incubation at 37°C with shaking.

Ensuite, 1 ml de la solution pré-mixée (solution stock) a été ajouté au flacon menant à une concentration finale en probiotique de 1E07 CFU/ml dans le flacon.Then 1ml of the pre-mixed solution (stock solution) was added to the vial leading to a final probiotic concentration of 1E07 CFU/ml in the vial.

La composition symbiotique C2 comprenant Bifidobacterium thermophilum (BT) et de l'inuline (Inu) contre la dysbiose intestinale a montré un effet bénéfique sur la fermentation, démontré par une augmentation de la valeur A (production maximale de gaz), une diminution de la valeur B (le temps pour atteindre 50% de la production maximale de gaz), une augmentation de la vitesse de fermentation (Rmax), et une diminution du temps pour atteindre la quantité maximale de gaz produite (Tmax) par rapport à l'inuline seule (voir condition BT-Inu du Tableau 3). En plus, une augmentation de la concentration de butyrate et l'abondance relative des bifidobactéries dans le jus de fermentation après 24h est démontré (voir condition BT-Inu de la Figure 4), Bifidobacterium thermophilum était bien présent jusqu'à la fin de la fermentation. Un effet anti-inflammatoire in vitro sur des cellules IPEC-J2 générant une diminution de la production d'IL-8 par rapport à l’inuline seule (pas de différence entre le symbiotique et le témoin-mucine) selon le protocole décrit à l'exemple 1 (voir condition BT-Inu de la Figure 2).The C2 symbiotic composition comprising Bifidobacterium thermophilum (BT) and inulin (Inu) against intestinal dysbiosis showed a beneficial effect on fermentation, demonstrated by an increase in A value (maximal gas production), a decrease in B value (the time to reach 50% of maximum gas production), an increase in fermentation rate (Rmax), and a decrease in time to reach the maximum amount of gas produced (Tmax) compared to inulin alone (see BT-Inu condition in Table 3). In addition, an increase in the concentration of butyrate and the relative abundance of bifidobacteria in the fermentation juice after 24 hours is demonstrated (see BT-Inu condition in Figure 4), Bifidobacterium thermophilum was indeed present until the end of the fermentation. An in vitro anti-inflammatory effect on IPEC-J2 cells generating a decrease in IL-8 production compared to inulin alone (no difference between the synbiotic and the control-mucin) according to the protocol described at l Example 1 (see BT-Inu condition in Figure 2).

De plus, la composition symbiotique C2 montre une amélioration du microbiote dans le modèle SHIME en augmentant les populations bactériennes impliquées dans les voies métaboliques de production de butyrate et montrant une tendance à l'augmentation des bifidobactéries. L'augmentation de ces populations bactériennes a été mesurée par qPCR (voir condition BT + INU de la Figure 6 et Tableau 6). Les séquences des amorces sens et des amorces anti-sens utilisées pour mesurer par qPCR l'abondance relative des populations bactériennes bénéfiques pour la communauté microbienne de l'intestin sont indiquées dans le Tableau 1.In addition, the C2 symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations involved in the metabolic pathways of butyrate production and showing a tendency towards the increase of bifidobacteria. The increase in these bacterial populations was measured by qPCR (see BT + INU condition of Figure 6 and Table 6). The sequences of forward primers and reverse primers used to measure by qPCR the relative abundance of beneficial bacterial populations for the gut microbial community are shown in Table 1.

Exemple 8: Composition symbiotique C3 comprenant au moins Bifidobacterium animalis lactis et au moins 2'FL contre la dysbiose intestinale.Example 8: C3 symbiotic composition comprising at least Bifidobacterium animalis lactis and at least 2'FL against intestinal dysbiosis.

On a préparé la composition C3 en ajoutant 1E07 CFU/ml de Bifidobacterium animalis lactis et 0,1 g de 2'FL.Composition C3 was prepared by adding 1E07 CFU/ml of Bifidobacterium animalis lactis and 0.1 g of 2'FL.

Plus particulièrement, au niveau du prébiotique, 0,1g de 2'FL a été ajouté dans chaque flacon de fermentation contenant 15ml de jus de fermentation.More specifically, at the level of the prebiotic, 0.1g of 2'FL was added to each fermentation flask containing 15ml of fermentation juice.

AU niveau du probiotique Bifidobacterium animalis lactis, une poudre lyophilisée de bactérie a été pré-mixé dans une solution tampon à une concentration de 1,5E08 CFU/ml (solution stock). Avant d'être ajouté au flacon de fermentation, la solution pré-mixée de probiotique a subi un processus de revivification consistant en une incubation de 30 min, à 37°C sous agitation.At the level of the probiotic Bifidobacterium animalis lactis, a freeze-dried powder of bacteria was pre-mixed in a buffer solution at a concentration of 1.5E08 CFU/ml (stock solution). Before being added to the fermentation flask, the pre-mixed probiotic solution underwent a revivification process consisting of a 30 min incubation at 37°C with shaking.

Ensuite, 1 ml de la solution pré-mixée (solution stock) a été ajouté au flacon menant à une concentration finale en probiotique de 1E07 CFU/ml dans le flacon.Then 1ml of the pre-mixed solution (stock solution) was added to the vial leading to a final probiotic concentration of 1E07 CFU/ml in the vial.

La composition symbiotique C3 contre la dysbiose intestinale a montré un effet bénéfique sur la fermentation, démontré par une augmentation de la valeur A (production maximale de gaz), une diminution de la valeur B (le temps pour atteindre 50% de la production maximale de gaz), une augmentation de la vitesse de fermentation (Rmax), et une diminution du temps pour atteindre la quantité maximale de gaz produite (Tmax) par rapport à 2'FL seule (voir condition Bal-2FL du Tableau 3). En plus, une augmentation de la concentration de butyrate (voir condition BAL-2FL du Tableau 4) et l'abondance relative des Clostridium clusters IV dans le jus de fermentation après 24h est démontré (voir condition BAL-2FL de la Figure 4), Bifidobacterium animalis lactis était bien présent jusqu'à la fin de la fermentation.The C3 symbiotic composition against intestinal dysbiosis showed a beneficial effect on fermentation, demonstrated by an increase in the A value (maximum gas production), a decrease in the B value (the time to reach 50% of the maximum production of gas), an increase in the fermentation rate (Rmax), and a decrease in the time to reach the maximum quantity of gas produced (Tmax) compared to 2'FL alone (see Bal-2FL condition of Table 3). In addition, an increase in the butyrate concentration (see BAL-2FL condition in Table 4) and the relative abundance of Clostridium clusters IV in the fermentation juice after 24 hours is demonstrated (see BAL-2FL condition in Figure 4), Bifidobacterium animalis lactis was present until the end of fermentation.

Un effet anti-inflammatoire in vitro sur des cellules IPEC-J2 générant une diminution de la production d'IL-8 (voir condition BAL-2FL de la Figure 2) par rapport à 2'FL seul et par rapport au témoin-mucine selon le protocole de l'exemple 1. De plus, la composition symbiotique C3 montre une amélioration du microbiote dans le modèle SHIME en augmentant les populations bactériennes de bifidobactéries. L'augmentation de ces populations bactériennes a été mesurée par qPCR (voir condition BAL + 2FL de la Figure 6 et Tableau 6). Les séquences des amorces sens et des amorces anti-sens utilisées pour mesurer par qPCR l'abondance relative des populations bactériennes bénéfiques pour la communauté microbienne de l'intestin sont indiquées dans le Tableau 1.An anti-inflammatory effect in vitro on IPEC-J2 cells generating a decrease in the production of IL-8 (see BAL-2FL condition in Figure 2) compared to 2'FL alone and compared to the control-mucin according to the protocol of example 1. In addition, the C3 symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations of bifidobacteria. The increase in these bacterial populations was measured by qPCR (see BAL + 2FL condition of Figure 6 and Table 6). The sequences of forward primers and reverse primers used to measure by qPCR the relative abundance of beneficial bacterial populations for the gut microbial community are shown in Table 1.

Exemple 9: Composition symbiotique CA comprenant Bifidobacterium crudilactis et du beta-glucane contre la dysbiose intestinale.Example 9: CA symbiotic composition comprising Bifidobacterium crudilactis and beta-glucan against intestinal dysbiosis.

On a préparé la composition C4 en ajoutant 1E07 CFU/ml de Bifidobacterium crudilactis et 0,1 g de beta-glucane.Composition C4 was prepared by adding 1E07 CFU/ml of Bifidobacterium crudilactis and 0.1 g of beta-glucan.

Plus particulièrement, au niveau du prébiotique, 0,1g de beta-glucane a été ajouté dans chaque flacon de fermentation contenant 15ml de jus de fermeniation. Au niveau du probiotique Bifidobacterium animalis lactis, une poudre lyophilisée de bactérie a été pré-mixé dans une solution tampon à une concentration de 1,5E08 CFU/ml (solution stock). Avant d'être ajouté au flacon de fermentation, la solution pré-mixée de probiotique a subi un processus de revivification consistant en une incubation de 30 min, à 37°C sous agitation. Ensuite, 1 mlde la solution pré-mixée (solution stock) a été ajouté au flacon menant à une concentration finale en probiotique de 1E07 CFU/ml dans le flacon.More specifically, at the level of the prebiotic, 0.1g of beta-glucan was added to each fermentation bottle containing 15ml of fermentation juice. With regard to the probiotic Bifidobacterium animalis lactis, a freeze-dried powder of bacteria was pre-mixed in a buffer solution at a concentration of 1.5E08 CFU/ml (stock solution). Before being added to the fermentation flask, the pre-mixed probiotic solution underwent a revivification process consisting of a 30 min incubation at 37°C with shaking. Then 1ml of the pre-mixed solution (stock solution) was added to the vial leading to a final probiotic concentration of 1E07 CFU/ml in the vial.

La composition symbiotique C4 comprenant Bifidobacterium crudilactis et du beta-glucane contre la dysbiose intestinale a montré un effet bénéfique sur Ia fermentation, démontré par une augmentation de la valeur A (production maximale de gaz) et une augmentation de la vitesse de fermentation (Rmax) par rapport au beta-glucane seul (voir condition BCU-BG du Tableau 3). En plus, après 24h de fermentation, une augmentation de la concentration des SCFAs totales et de butyrate (voir condition BCU-BG du Tableau 4) et l'abondance relative des Clostridium clusters XIVa dans le jus de fermentation est démontré (voir condition BCU- BG de la Figure 4). Un effet anti-inflammatoire est démontré in vitro sur des cellules IPEC-J2 générant une diminution de la production d'IL-8 par rapport au beta-glucane seule et par rapport au témoin-mucine selon le protocole décrit à l'exemple 1 (voir condition BCU-BG de la Figure 2).The C4 symbiotic composition comprising Bifidobacterium crudilactis and beta-glucan against intestinal dysbiosis showed a beneficial effect on fermentation, demonstrated by an increase in the A value (maximum gas production) and an increase in the fermentation rate (Rmax) compared to beta-glucan alone (see BCU-BG condition in Table 3). In addition, after 24 hours of fermentation, an increase in the concentration of total SCFAs and butyrate (see BCU-BG condition of Table 4) and the relative abundance of Clostridium clusters XIVa in the fermentation juice is demonstrated (see BCU-BG condition). BG of Figure 4). An anti-inflammatory effect is demonstrated in vitro on IPEC-J2 cells generating a decrease in the production of IL-8 compared to beta-glucan alone and compared to the control-mucin according to the protocol described in example 1 ( see BCU-BG condition of Figure 2).

De plus, la composition symbiotique CA montre une amélioration du microbiote dans le modèle SHIME en augmentant les populations bactériennes impliquées dans les voies métaboliques de production de butyrate et montrant une tendance à l'augmentation des bifidolbactéries. L'augmentation de ces populations bactériennes a été mesurée par qPCR (voir condition BC + BG de la Figure 6 et Tableau 6). Les séquences des amorces sens et des amorces anti-sens utilisées pour mesurer par qPCR l'abondance relative des populations bactériennes bénéfiques pour la communauté microbienne de l'intestin sont indiquées dans le Tableau 1.In addition, the CA symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations involved in the metabolic pathways of butyrate production and showing a tendency towards the increase of bifidolbacteria. The increase in these bacterial populations was measured by qPCR (see BC + BG condition of Figure 6 and Table 6). The sequences of forward primers and reverse primers used to measure by qPCR the relative abundance of beneficial bacterial populations for the gut microbial community are shown in Table 1.

Exemple 10: Composition symbiotique C5 comprenant Enterococcus faecium et du beta-glucane contre la dysbiose intestinale.Example 10: C5 symbiotic composition comprising Enterococcus faecium and beta-glucan against intestinal dysbiosis.

La composition symbiotique C5 contre la dysbiose intestinale a montré un effet bénéfique sur la fermentation, démontré par une augmentation de la valeur A (production maximale de gaz) et une augmentation de la vitesse de fermentation (Rmax) par rapport au beta- glucane seul (voir condition EF-BG du Tableau 3). En plus, après 24h de fermentation, une augmentation de la concentration des SCFAs totales et de butyrate dans le jus de fermentation est démontré (voir condition EF-BG du Tableau 4).The C5 symbiotic composition against intestinal dysbiosis showed a beneficial effect on fermentation, demonstrated by an increase in the A value (maximum gas production) and an increase in the rate of fermentation (Rmax) compared to beta-glucan alone ( see condition EF-BG in Table 3). In addition, after 24 hours of fermentation, an increase in the concentration of total SCFAs and butyrate in the fermentation juice is demonstrated (see EF-BG condition in Table 4).

De plus, la composition symbiotique C5 montre une amélioration du microbiote dans le modèle SHIME en augmentant les populations bactériennes impliquées dans les voies métaboliques de production de butyrate mais pas des bifidobactéries. L'augmentation de ces populations bactériennes a été mesurée par qPCR (voir condition EF + BG de la Figure 6 et Tableau 6). Les séquences des amorces sens et des amorces anti-sens utilisées pour mesurer par qPCR l'abondance relative des populations bactériennes bénéfiques pour la communauté microbienne de l'intestin sont indiquées dans le Tableau 1.Moreover, the C5 symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations involved in the metabolic pathways of butyrate production but not bifidobacteria. The increase in these bacterial populations was measured by qPCR (see EF + BG condition of Figure 6 and Table 6). The sequences of forward primers and reverse primers used to measure by qPCR the relative abundance of beneficial bacterial populations for the gut microbial community are shown in Table 1.

Exemple 11 : Composition symbiotique SYN 3 comprenant E. faecium, C. butyricum, du beta-glucane et de l'inuline contre la dysbiose intestinale et doses administrées in vivo à la truie avant mise bas et après mise bas.Example 11 Synbiotic composition SYN 3 comprising E. faecium, C. butyricum, beta-glucan and inulin against intestinal dysbiosis and doses administered in vivo to the sow before farrowing and after farrowing.

Pour les probiotiques, la quantité administrée est indiquée en CFU/truie/jour, tandis que pour les prébiotiques, la quantité administrée est indiquée en g/truie/jour (voir Tableau 7).For probiotics, the amount administered is indicated in CFU/sow/day, while for prebiotics the amount administered is indicated in g/sow/day (see Table 7).

L'administration in vivo de la composition symbiotique a été réalisée à 4 stades de développement différents : avant mise bas, une semaine après mise bas, 2 semaines après mise bas et 3 semaines après mise bas.The in vivo administration of the symbiotic composition was carried out at 4 different stages of development: before farrowing, one week after farrowing, 2 weeks after farrowing and 3 weeks after farrowing.

Tableau 7.- Composition symbiotique SYN3 comprenant E. faecium, C. butyricum, du beta-glucane et de l'inuline et quantité de chaque probiotique et prébiotique administrée par jour à 4 stades de développement. SYN3 E. faecium C. butyricum | Beta-glucane | Inuline G80-G107 EE lee le Le bas, MB) 1,60E+09 1,60E+09 1,60 9,60Table 7.- SYN3 symbiotic composition comprising E. faecium, C. butyricum, beta-glucan and inulin and quantity of each probiotic and prebiotic administered per day at 4 stages of development. SYN3 E. faecium C. butyricum | Beta-glucan | Inulin G80-G107 EE lee Le le bas, MB) 1.60E+09 1.60E+09 1.60 9.60

MB : mise-bas ; G : jour de gestation Les 4 stades de développement sont G80-G107 (entre 80 jours et 107 jours de gestation, avant mise bas), 1 semaine après mise bas, 2 semaines après mise base et 3 semaines après mise bas.MB: farrowing; G: day of gestation The 4 stages of development are G80-G107 (between 80 days and 107 days of gestation, before parturition), 1 week after parturition, 2 weeks after parturition and 3 weeks after parturition.

Exemple 12 : Composition symbiotique SYN 4 comprenant E. faecium, B. animalis lactis, B. crudilactis, du beta-glucane et de l'inuline contre la dysbiose intestinale et doses administrées in vivo à la truie avant mise bas et après mise bas.Example 12 Synbiotic composition SYN 4 comprising E. faecium, B. animalis lactis, B. crudilactis, beta-glucan and inulin against intestinal dysbiosis and doses administered in vivo to the sow before farrowing and after farrowing.

Pour les probiotiques, la quantité administrée est indiquée en CFU/truie/jour, tandis que pour les prébiotiques, la quantité administrée est indiquée en g/truie/jour (voir Tableau 8). L'administration in vivo de la composition symbiotique a été réalisée à 4 stades de développement différents : G80-G107 (entre 80 et 107 jours de gestation, avant mise bas, MB), une semaine après mise bas, 2 semaines après mise bas et 3 semaines après mise bas.For probiotics, the amount administered is indicated in CFU/sow/day, while for prebiotics the amount administered is indicated in g/sow/day (see Table 8). The in vivo administration of the symbiotic composition was carried out at 4 different stages of development: G80-G107 (between 80 and 107 days of gestation, before parturition, MB), one week after parturition, 2 weeks after parturition and 3 weeks after farrowing.

Tableau 8.- Composition symbiotique SYNA comprenant E. faecium, B. animalis lactis, B. crudilactis, du beta-glucane et de l’inuline et quantité de chaque probiotique et prébiotique administrée par jour à 4 stades de développement. | Probiotique Prébiotique E. B. animalis | Beta SYN4 faecium lactis B. crudilactis glucane Inuline (CFU/truie | (CFU/truie/jo (CFU/frvie/jo (g/truie/jo (a/frvie/] Esse G80-G107 (avant Wr a rs ie fire Le he MB) 1,07E+09 1,07E+09 1,07E+09 1,60 9,60 MB: mise-bas ; G : jour de gestation Exemple 13: Composition symbiotique contre la dysbiose intestinale et doses administrées in vivo au porcelet Dans un essai in vivo (première expérience), le symbiotique 1 est composé de Clostridium butyricum et GOS/FOS et le symbiotique 2 est composé de B. animalis lactis et 2'FL (voir Tableaux 9 et 10 ci-dessous). Les quantités distribuées aux porcelets, avec un pistolet d'administration sont indiquées dans le tableau 9. De manière contrôlée, les porcelets ont ingéré une quantité déterminée de symbiotique, qui a augmenté avec l’âge.Table 8.- SYNA symbiotic composition comprising E. faecium, B. animalis lactis, B. crudilactis, beta-glucan and inulin and quantity of each probiotic and prebiotic administered per day at 4 stages of development. | Probiotic Prebiotic E. B. animalis | Beta SYN4 faecium lactis B. crudilactis glucan Inulin (CFU/sow | (CFU/sow/jo (CFU/frvie/jo (g/sow/jo (a/frvie/] Esse G80-G107 (before Wr a rs ie fire Le he MB) 1.07E+09 1.07E+09 1.07E+09 1.60 9.60 MB: farrowing; G: day of gestation Example 13: Symbiotic composition against intestinal dysbiosis and doses administered in vivo at piglet In an in vivo test (first experiment), Symbiotic 1 is composed of Clostridium butyricum and GOS/FOS and Symbiotic 2 is composed of B. animalis lactis and 2'FL (see Tables 9 and 10 below). The quantities distributed to the piglets with an administration pistol are indicated in Table 9. In a controlled manner, the piglets ingested a determined quantity of symbiotic, which increased with age.

Dans un autre essai in vivo (deuxième expérience), les mêmes symbiotiques ont été testés. Cette fois, le symbiotique est distribué aux porcelets par le pistolet d'administration à la naissance et au jour 4-5, et ensuite dans le lait de remplacement et l'aiment ‘creep feed’In another in vivo test (second experiment), the same symbiotics were tested. This time, the synbiotic is delivered to piglets through the feed gun at birth and day 4-5, and then in milk replacer and the likes 'creep feed'

(alimentation sous la truie) distribué Uniquement aux porcelets (pas aux truies). Les quantités des symbiotiques distribués aux porcelets sont indiquées dans le tableau 10. Il est bien entendu que la présente invention n'est en aucune façon limitée aux formes de réalisations décrites ci-dessus et que bien des modifications peuvent y être apportées sans sortir du cadre des revendications annexées.(feed below the sow) distributed Only to piglets (not to sows). The amounts of the symbiotics distributed to the piglets are indicated in Table 10. It is understood that the present invention is in no way limited to the embodiments described above and that many modifications can be made thereto without departing from the scope of the appended claims.

je 5 5 = = = = >| = a | & sl | &| 2 = SS 83 Zes EEE Is ES à 12 DIG d © | © | lass — — |G 2 D + iD au DD A L IS ut ee 6185| 2 Q D t FTP Ù D = = = Ox = = ü UO |t Ol U IS 5 aòl les S |8 UE ë 2 2 5 x Ss zz 8/5288 3| & 528 = 3 D = m7 oh = a Le) ee =| + xt + ’ Dj MW > N ex LL € 1213191151 05i 5 5 ==== >| = a | & sl | &| 2 = SS 83 Zes EEE Is ES at 12 DIG d © | © | lass — — |G 2 D + iD au DD A L IS ut ee 6185| 2 Q D t FTP Ù D = = = Ox = = ü UO |t Ol U IS 5 aòl les S |8 UE ë 2 2 5 x Ss zz 8/5288 3| & 528 = 3 D = m7 oh = a Le) ee =| + xt + ’ Dj MW > N ex LL € 1213191151 05

U © s + 2 ; = | = £& >| = 5 | 312 <a Le) SD BS = D ë 5 S © 2 [vo a + Lo CN => ax == 2 ES == Jo ll 5 m 2 Pans = = es 1 = REES le Zu 2 957 #5 Zee © sd J - Im 1 = L + 5 SS ETET S je 288 = cs Ie G ä : cn — O = A Sa AIR D = + => = © D AH S a 2 à zl 8 5 sj à 28 m oO 5 — 2 © U LA LL 14 u _ OL pn 4e qd 3 N = = 2 5 381 68 5 5 5 «| ls 9 CL Go © 5 |e = 2 £ D 3 25 | Ù ] = vx is Ms Ss u w © ou Pin, ms = ae = 5 5 5 à la ë [Too ld] 2 5 2 308 3885 E88030-5 ZUEEß = U 3 SE 8 256) 5 | 918 So = cn “1-2 5 SS) 8 =| 015 D 5 =) © = à & à Ad EN I Sl uw x à à = 2 ZIS 2 A — Ö a 2 =U © s + 2; = | = £& >| = 5 | 312 <a Le) SD BS = D ë 5 S © 2 [vo a + Lo CN => ax == 2 ES == Jo ll 5 m 2 Pans = = es 1 = REES le Zu 2 957 #5 Zee © sd J - Im 1 = L + 5 SS ETET S i 288 = cs Ie G ä : cn — O = A Sa AIR D = + => = © D AH S a 2 to zl 8 5 sj to 28 m oO 5 — 2 © U LA LL 14 u _ OL pn 4th qd 3 N = = 2 5 381 68 5 5 5 “| ls 9 CL GB © 5 |e = £2 D 3 25 | Ù ] = vx is Ms Ss u w © or Pin, ms = ae = 5 5 5 à la ë [Too ld] 2 5 2 308 3885 E88030-5 ZUEEß = U 3 SE 8 256) 5 | 918 So = cn “1-2 5 SS) 8 =| 015 D 5 =) © = à & à Ad EN I Sl uw x à à = 2 ZIS 2 A — Ö a 2 =

LG > 3 = 5 ss A N x + = N = = As SIS 2 au oc 5 = = 5 5 315 =} us = das En oc 2 w = © ls EE de ES 5 D = _ = IR SIE Ee € ee 9 2 © = 1 612 ©) WJ OO FT |A = r DIE DO so — OP OS Dm D 14 D LJ SS | LL 2 2 - “| à 0 Do Old GI5 05 am D bd 5 _ 9 ee à 7 2/5 519 © & , > Ä G| | 515 QE es > = = — = “Te 2 cs LL #5 ai + = =. ST J 0 © a EG — GA Q © Ka N : = | = a 5 a] = > es N | 3 id 2 Re a 2m SD] ec £ SS So 5 TT SS 8 ae HS à a SIA 585 © LD Elu L SEPT = € 11° = x Eos [eee | SE SF DC = 5 18-2028 5 929 292 5 dju DD a MD ‘ 5 = 5 “à = = U A 0 a = 5 DO à Gr © hm Ci IS] 5 SS 5 > © 2 > 7 Ee 4 >| = "EL Ee D LL LL o = = + = U oO D ® - Lel © Le] ee AD es \ = = © — x SON OF ana u œ D © © > Si o pu © nr = © © 5 < = 8 à 5 © y2 || EU SE = =” € y = 5 SE RE 712 TD |E a] u = Du SRE OR an = 5 U = Di © GT + 18 Sd © + d 2 DID] — | © 5 E à à pu = 2 = ©, = In Ö 2 AS SE| = a JE ov 2 5 ta 6 SS El gla |? 5 CL © . D A © Be IT I Es LA Sd RN id a | ER 2 à see A 10 co SC © © S | æ@ = 1È6 35 en US © © (2 SD God 7 | Ol |82 à a ea . + A ÀLG > 3 = 5 ss A N x + = N = = As SIS 2 au oc 5 = = 5 5 315 =} us = das En oc 2 w = © ls EE de ES 5 D = _ = IR SIE Ee € ee 9 2 © = 1 612 ©) WJ OO FT |A = r DIE DO so — OP OS Dm D 14 D LJ SS | LL 2 2 - “| to 0 Do Old GI5 05 am D bd 5 _ 9 ee to 7 2/5 519 © & , > Ä G| | 515 QE es >== —= “Te 2 cs LL #5 ai +==. ST J 0 © a EG — GA Q © Ka N : = | = a 5 a] => es N | 3 id 2 Re a 2m SD] ec £ SS So 5 TT SS 8 ae HS a a SIA 585 © LD Elu L SEPT = € 11° = x Eos [eee | SE SF DC = 5 18-2028 5 929 292 5 dju DD a MD ‘ 5 = 5 “à = = U A 0 a = 5 DO à Gr © hm Ci IS] 5 SS 5 > © 2 > 7 Ee 4 >| = "EL Ee D LL LL o = = + = U oO D ® - Lel © Le] ee AD es \ = = © — x SON OF ana u œ D © © > Si o pu © nr = © © 5 < = 8 to 5 © y2 || EU SE = =” € y = 5 SE RE 712 TD |E a] u = Du SRE OR an = 5 U = Di © GT + 18 Sd © + d 2 DID] — | © 5 E à à pu = 2 = ©, = In Ö 2 AS SE|= a JE ov 2 5 ta 6 SS El gla |? 5 CL © .D A © Be IT I Es LA Sd RN id a |ER 2 à see A 10 co SC © © S | æ@ = 1È6 35 en US © © (2 SD God 7 | Ol |82 à a ea . + A À

© 2 = BE202 = D 0/5828 in À = d = #| 5 dr &, MID 8 | = 2 Ps As ds > al F9 212 D >| 3 m 51 T = | © al alë «| S S as =) L| 4 Ezi 5 3 = E ls) © | ® = ZIET = Q = = |] 2 © 5 1%1% 5 = | © & U D || = © sa 6 5 | X y oO = SER als 58/82 5| #8 A DIS | = &| 5 8 SIS d 2/8 di GC | = = ON , 2 [UN © Ô = ò 2 Bl = | $ 5 | S 2 A 5 © 0 = A + . © 5 © | Ta = bee We] D < SM di 4/8 = th LJ 2 a - a] pas . A = en SS © <1 Ol” N 7 D D = N D bi > 5 AR _ + & Elo El = > SN SS ie à 5 | 2 = | 8 5 © 0195/19/15 = ä 2/2 5 = BV SE y qi on = RT = = 3 _ . = AIG 8 5 | S 5 | L >| = = | 7 = HSM] SE 512215 S = | 2 a ES 0 | dù 8 01% | À 5 2 | D SS 8 Sl Woz © | © dln = in | CS D CC > OO ci ï Mh © A 2 OS sl Ë&| ES 8618 = | 8 à © © D 5 2555 5 5 3353 8 58/2 a | | ‘ =|3| 83 a SI AS = > Le a SN rad DIE ANG 5 © = — 51312 > SL 3 ojos = EI D | ® U + > 2 [en] 5 3 3,5 388 PS D : a ; = = © ZE ISI: EE 3.5 | 3 © EEE. “Je 5 5 IH > SA QC à DI à aa == CD EN So 2 o ze ea Q = D s © A DD - Fr = = Si & Gls CS» 0 ES „© = vl & N a = Q ä Öl | OS ORG 2 Cr] =, A © Ie Sl 8 SIA 5 Sf £ 5115 à Ö £ sé 5185899138 8 = © ASIEN 5 _ à 5 = & © 5 3 x= 55 5 co 8 sel #8 3/8253 x 2 © ale © Silos = | 5 2 5 = | = = + 35/25 5 | 7 © | © = 31 B 3 5 #-à 8 58 2|2 5| 8 85 # * 4 Se À da > 5 9 = #2 35/2 2|8| 8 OR € = CR - im , 5 © ES S/I & à SI Eg 5 Ù) £ œ, =12/2/5 812313 8 =| 58 8 © 8 „5 $ 8838 5/2 3 D © = Ch Ss 8 © > co » oo € © = E 5 = «I _ Ln ae = _ = 2 = qu Oo Zä 5 E 2) # 2 _ D ë |#| 8° NERE-E SI. + x 5 BK m5 El E/S ST D u 42 SO ID Sos S| (8) = Q { Sos SS“ SE Ee È S | € T LE ® ES | = 1 2 Tj © #8 [3/3 € A = © > U G & m Q 2 ES RS je = ul E| = x SE SIE N à Lui a GJ & & se] CA nù LJ EE ge N % U = LA Bu Eg 2 BE sf: Èe L2 2 fj oo |Z 2 oO.© 2 = BE202 = D 0/5828 in À = d = #| 5 dr &, MID 8 | = 2 Ps As ds > al F9 212 D >| 3m 51 T = | © al alë | S S as =) L| 4 Ezi 5 3 = E ls) © | ® = ZIET = Q = = |] 2 © 5 1%1% 5 = | © & U D || = © her 6 5 | X y oO = SER als 58/82 5| #8 A DIS | = &| 5 8 SIS d 2/8 di GC | = = ON , 2 [A © Ô = ò 2 Bl = | $5 | S 2 A 5 © 0 = A + . © 5 © | Ta = bee We] D < SM di 4/8 = th LJ 2 a - a] not . A = en SS © <1 Ol” N 7 D D = N D bi > 5 AR _ + & Elo El = > SN SS ie à 5 | 2 = | 8 5 © 0195/19/15 = ä 2/2 5 = BV SE y qi on = RT = = 3 _ . = AIG 8 5 | S5 | L >| = = | 7 = HSM] SE 512215 S = | 2 to ES 0 | owing 8 01% | To 5 2 | D SS 8 Sl Woz © | © dln=in | CS D CC > OO ci ï Mh © A 2 OS sl Ë&| ES 8618 = | 8 to © © D 5 2555 5 5 3353 8 58/2 a | | ‘ =|3| 83 a SI AS = > Le a SN rad DIE ANG 5 © = — 51312 > SL 3 ojos = EI D | ® U + > 2 [in] 5 3 3.5 388 PS D: a; = = © ZE ISI: EE 3.5 | 3 © EEE. “Je 5 5 IH > SA QC à DI à aa == CD EN So 2 o ze ea Q = D s © A DD - Fr = = Si & Gls CS» 0 ES „© = vl & N a = Q ä Öl | OS ORG 2 Cr]=, A © Ie Sl 8 SIA 5 Sf £5115 à Ö£ sé 5185899138 8 = © ASIEN 5 _ à 5 = & © 5 3 x= 55 5 co 8 sel #8 3/8253 x 2 © ale © Silos = | 5 2 5 = | = = + 35/25 5 | 7 © | © = 31 B 3 5 #-to 8 58 2|2 5| 8 85 # * 4 Se To da > 5 9 = #2 35/2 2|8| 8 OR € = CR - im , 5 © ES S/I & à SI Eg 5 Ù) £ œ, =12/2/5 812313 8 =| 58 8 © 8 „5 $ 8838 5/2 3 D © = Ch Ss 8 © > co » oo € © = E 5 = «I _ Ln ae = _ = 2 = qu Oo Zä 5 E 2) # 2 _ D л |#| 8° NERE-E SI. + x 5 BK m5 El I/O ST D u 42 SO ID Sos S| (8) = Q { Sos SS“ SE Ee È S | € T LE ® ES | = 1 2 Tj © #8 [3/3 € A = © > U G & m Q 2 ES RS i = ul E| = x SE SIE N à Lui a GJ & & se] CA nù LJ EE ge N % U = LA Bu Eg 2 BE sf: Èe L2 2 fj oo |Z 2 oO.

GR ; = GA | 0 SEA |15 NEO = LL.GR; = GA | 0 SEA |15 NEO = LL.

D 9 Lu & SS AN aD 9 Lu & SS AN a

Claims (15)

«Revendications »"Claims" 1. Composition symbiotique administrable à l'animal, en particulier au mammifère, en particulier au porc, en particulier de l'animal en gestation et au nouveau-né, en particulier à la truie en gestation ou non et au porcelet comprenant au moins Un probiotique et au moins un prébiotique pour le traitement ou la prévention de la dysbiose, caractérisée en ce que ledit au moins Un probiotique et ledit au moins Un prébiotique sont choisis de telle manière qu’ils génèrent ensemble un environnement antiinflammatoire dans l'intestin dudit animal, en particulier du mammifère, en particulier du porc, de préférence de l'animal en gestation et au nouveau-né, en particulier à la truie en gesiation ou non et au porcelet.1. Symbiotic composition that can be administered to animals, in particular to mammals, in particular to pigs, in particular to pregnant animals and to newborns, in particular to pregnant sows or not and to piglets comprising at least one probiotic and at least one prebiotic for the treatment or prevention of dysbiosis, characterized in that said at least one probiotic and said at least one prebiotic are chosen such that they together generate an anti-inflammatory environment in the intestine of said animal , in particular mammals, in particular pigs, preferably pregnant animals and newborns, in particular pregnant sows or not and piglets. 2. Composition selon la revendication 1, dans lequel ledit probiotique est choisi dans le groupe des micro-organismes comprenant Bifidobacterium Tthermophilum, Enterococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis.2. Composition according to Claim 1, in which the said probiotic is chosen from the group of microorganisms comprising Bifidobacterium Tthermophilum, Enterococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis. 3. Composition selon la revendication 1 ou 2, dans laquelle ledit prébiotique est choisi dans le groupe comprenant l'inuline, le B-glucane, 2'Fucosyllactose, GOS/FOS {galactoligosaccharide, fructoligosaccharide), l'amidon résistant.3. Composition according to Claim 1 or 2, in which the said prebiotic is chosen from the group comprising inulin, B-glucan, 2′ Fucosyllactose, GOS/FOS (galactoligosaccharide, fructoligosaccharide), resistant starch. 4. Composition selon [lune des revendications précédentes 1 à 3, caractérisée en ce que ledit au moins un probiotique et ledit au moins un prébiotique génèrent ensemble une augmentation des concentrations en populations bactériennes endogènes favorables au microbiote intestinal telles que les lactobacillus, et les bifidobacteria.4. Composition according to [one of the preceding claims 1 to 3, characterized in that said at least one probiotic and said at least one prebiotic together generate an increase in the concentrations of endogenous bacterial populations favorable to the intestinal microbiota such as lactobacillus, and bifidobacteria . 5. Composition selon [lune des revendications précédentes 1 à 4, caractérisée en ce que ledit au moins Un probiotique et ledit au moins Un prébiotique génèrent ensemble une réduction de la concentration d'IL-8 d'au moins 10 %, formant ledit environnement anti- inflammatoire.5. Composition according to [one of the preceding claims 1 to 4, characterized in that said at least one probiotic and said at least one prebiotic together generate a reduction in the concentration of IL-8 of at least 10%, forming said environment anti-inflammatory. 6. Composition selon [lune des revendications précédentes 1 à 5, caractérisée en ce que ledit au moins un probiotique et ledit au moins un prébiotique génèrent ensemble une stabilisation ou une augmentation de la sécrétion d'acides gras à courte chaîne (SCFA's) par le microbiote intestinal, lesdits SCFAs, produits lors du processus de fermentation du microbiote, sont un indicateur de l'équiliore et de la croissance du microbiote.6. Composition according to [one of the preceding claims 1 to 5, characterized in that said at least one probiotic and said at least one prebiotic together generate a stabilization or an increase in the secretion of short-chain fatty acids (SCFA's) by the intestinal microbiota, said SCFAs, produced during the fermentation process of the microbiota, are an indicator of the balance and growth of the microbiota. 7. Composition selon la revendication 6, dans laquelle lesdits SCFAs sont choisis parmi le butyrate, le propionate, l'acétate, le lactate ou leurs combinaisons.7. Composition according to Claim 6, in which the said SCFAs are chosen from butyrate, propionate, acetate, lactate or combinations thereof. 8. Composition selon l’une quelconque des revendications précédentes, dans laquelle ledit au moins un probiotique et ledit au moins un prébiotique est choisi dans le groupe constitué de Bifidobacterium t£hermophilum et inuline, de Bifidobacterium crudilactis et beta-glucanes, de Bifidobacterium animalis lactis et 2’fucosyllactose, de Clostridium butyricum ei GOS/FOS, Enterococcus faecium et beta- glucanes et leur mélange.8. Composition according to any one of the preceding claims, in which the said at least one probiotic and the said at least one prebiotic is chosen from the group consisting of Bifidobacterium thermophilum and inulin, Bifidobacterium crudilactis and beta-glucans, Bifidobacterium animalis lactis and 2'fucosyllactose, Clostridium butyricum and GOS/FOS, Enterococcus faecium and beta-glucans and their mixture. 9. Composition selon l’une quelconque des revendications précédentes, contenant plus de 1 probiotique, par exemple 2 probiotiques, ou par exemple 3 probiotiques, ou par exemple 4 probiotiques ou par exemple 5 probiotiques.9. Composition according to any one of the preceding claims, containing more than 1 probiotic, for example 2 probiotics, or for example 3 probiotics, or for example 4 probiotics or for example 5 probiotics. 10. Composition selon l’une quelconque des revendications précédentes, contenant plus de 1 prébiotique, par exemple 2 prébiotiques, ou par exemple 3 prébiotiques, ou par exemple 4 prébiotiques.10. Composition according to any one of the preceding claims, containing more than 1 prebiotic, for example 2 prebiotics, or for example 3 prebiotics, or for example 4 prebiotics. 11. Composition selon l'une quelconque des revendications précédentes, contenant au moins un excipient conventionnel, sous forme liquide ou solide.11. Composition according to any one of the preceding claims, containing at least one conventional excipient, in liquid or solid form. 12. Complément alimentaire pour le traitement préventif et/ou curatif de la dysbiose, comprenant ladite composition selon l'une quelconque des revendications 1 à 11.12. Food supplement for the preventive and / or curative treatment of dysbiosis, comprising said composition according to any one of claims 1 to 11. 13. Aliment complet ou complémentaire pour animaux d'élevage comprenant ladite composition selon l'une quelconque des revendications 1 à 11, ledit aliment étant sous forme de farine et/ou de granulés et/ou d'alimentations lactées et/ou toutes autres formes de conditionnement alimentaire.13. Complete or complementary feed for farm animals comprising said composition according to any one of claims 1 to 11, said feed being in the form of flour and/or granules and/or milk feeds and/or any other forms of food conditioning. 14. Aliment pour nouveau-né animal comprenant ladite composition selon l'une quelconque des revendications 1 à 11 et une base lactée compatible avec l'alimentation du nouveau-né.14. Food for newborn animals comprising said composition according to any one of claims 1 to 11 and a milk base compatible with the diet of the newborn. 15. Utilisation dune composition selon l’une des revendications 1 à 11, pour le traitement préventif et/ou curatif de la dysbiose, comprenant au moins une administration de ladite composition selon l'une des revendications } à 11 à raison d'une quantité de prébiotique comprise entre 0,1 et 1000 g/iour/animal, préférentiellement entre 0,5 et 100 g/jour/animal, de manière avantageuse entre 1 et 25 g/our/animatl, d'une quantité de probiotique comprise entre 1,00E+05 et 1,00E+015 CFU/jour/animal, préférentiellement entre 1,00E+06 et 1,00E+013 CFU/jour/animal, de manière avantageuse entre 1,00E+07 et 1,00E+011 CFU/jour/animal et au moins une administration d'une ration alimentaire quotidienne, ledit probiotique et ledit prébiotique de la composition selon l'une des revendications 1 à 11 étant administrée de manière simultanée, séparée ou échelonnée dans le temps.15. Use of a composition according to one of claims 1 to 11, for the preventive and / or curative treatment of dysbiosis, comprising at least one administration of said composition according to one of claims } to 11 in an amount of prebiotic comprised between 0.1 and 1000 g/day/animal, preferentially between 0.5 and 100 g/day/animal, advantageously between 1 and 25 g/day/animal, of a quantity of probiotic comprised between 1 .00E+05 and 1.00E+015 CFU/day/animal, preferably between 1.00E+06 and 1.00E+013 CFU/day/animal, advantageously between 1.00E+07 and 1.00E+011 CFU/day/animal and at least one administration of a daily food ration, said probiotic and said prebiotic of the composition according to one of Claims 1 to 11 being administered simultaneously, separately or staggered over time.
BE20205828A 2020-11-16 2020-11-16 DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE THE INTESTINAL MICROBIOTA OF PIGLETS AT WEANING TIME BE1028802B1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
BE20205828A BE1028802B1 (en) 2020-11-16 2020-11-16 DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE THE INTESTINAL MICROBIOTA OF PIGLETS AT WEANING TIME
PCT/EP2021/081889 WO2022101511A1 (en) 2020-11-16 2021-11-16 Symbiotic composition as feed additive for piglets or sows and the use thereof
EP21815428.4A EP4243626A1 (en) 2020-11-16 2021-11-16 Symbiotic composition as feed additive for piglets or sows and the use thereof
CA3198168A CA3198168A1 (en) 2020-11-16 2021-11-16 Symbiotic composition as feed additive for piglets or sows and the use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
BE20205828A BE1028802B1 (en) 2020-11-16 2020-11-16 DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE THE INTESTINAL MICROBIOTA OF PIGLETS AT WEANING TIME

Publications (2)

Publication Number Publication Date
BE1028802A1 true BE1028802A1 (en) 2022-06-10
BE1028802B1 BE1028802B1 (en) 2022-06-14

Family

ID=73543940

Family Applications (1)

Application Number Title Priority Date Filing Date
BE20205828A BE1028802B1 (en) 2020-11-16 2020-11-16 DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE THE INTESTINAL MICROBIOTA OF PIGLETS AT WEANING TIME

Country Status (4)

Country Link
EP (1) EP4243626A1 (en)
BE (1) BE1028802B1 (en)
CA (1) CA3198168A1 (en)
WO (1) WO2022101511A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117625444A (en) * 2023-11-10 2024-03-01 宁夏大学 Probiotic for calves and application thereof
CN118000349B (en) * 2024-03-05 2024-09-20 武汉家家乐饲料股份有限公司 Fermented feed for promoting appetite of piglets and preparation method thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006122850A1 (en) 2005-05-16 2006-11-23 Universite De Liege Probiotic bifidobacterial species
WO2006133472A1 (en) 2005-06-14 2006-12-21 Erber Aktiengesellschaft Probiotic health or fitness promoting human or animal foodstuff and/or drinking water additive and use thereof
WO2014049023A1 (en) 2012-09-25 2014-04-03 Aquilon Cyl Sanidad Animal Probiotic and prebiotic compositions
WO2017156548A1 (en) 2016-03-11 2017-09-14 Evolve Biosystems Inc. Food compositions for weaning
WO2018002671A1 (en) 2016-06-30 2018-01-04 Dairy Crest Limited Composition for treatment and/or nutrition of poultry

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2008E (en) 1903-11-24 Ocedes Lavanchy-Maison) Air compression pump for any application (casing system)
AT413191B (en) * 2002-10-11 2005-12-15 Erber Ag FEED AND / OR DRINKING WATER SUPPLEMENT FOR ANIMALS
EP2459203B1 (en) * 2009-07-30 2018-10-31 DuPont Nutrition Biosciences ApS Lactic acid bacteria and bifidobacteria for treating endotoxemia
US20150305385A1 (en) * 2014-04-25 2015-10-29 Mead Johnson Nutrition Company Pediatric nutritional composition with human milk oligosaccahrides, prebiotics and probiotics
MX2019000715A (en) * 2016-08-04 2019-06-20 Nestec Sa Nutritional compositions and infant formulas comprising a mix of oligosaccharides and optionally bifidobacterium lactis for preventing, treating or reducing the severity of non-rotavirus-associated diarrhoea.
CN108323641A (en) * 2018-02-07 2018-07-27 上海宠幸宠物用品有限公司 A kind of health food and preparation method thereof for improving pet dog cat function of intestinal canal
EP3911170A2 (en) * 2019-01-18 2021-11-24 Mars Incorporated Methods and compositions for treating intestinal dysbiosis
FR3093427B1 (en) * 2019-03-05 2021-03-05 Mativa Tech COMPOSITION FOR USE IN THE PREVENTION AND / OR TREATMENT OF DYSBIOSIS

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006122850A1 (en) 2005-05-16 2006-11-23 Universite De Liege Probiotic bifidobacterial species
WO2006133472A1 (en) 2005-06-14 2006-12-21 Erber Aktiengesellschaft Probiotic health or fitness promoting human or animal foodstuff and/or drinking water additive and use thereof
WO2014049023A1 (en) 2012-09-25 2014-04-03 Aquilon Cyl Sanidad Animal Probiotic and prebiotic compositions
WO2017156548A1 (en) 2016-03-11 2017-09-14 Evolve Biosystems Inc. Food compositions for weaning
WO2018002671A1 (en) 2016-06-30 2018-01-04 Dairy Crest Limited Composition for treatment and/or nutrition of poultry

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
"The International Scientific Association for Probiotics and Prebiotics (ISAPP) consensus statement on the définition and scope of prebiotics", NATURE REVIEWS GASTROENTEROLOGY & HEPATOLOGY, vol. 14, 2017, pages 491 - 502, Retrieved from the Internet <URL:https://doi.org/10.1038/nrgastro.2017.75>
AMIT-ROMACH E, POULT SCI, vol. 83, 2004, pages 1093 - 1098
BARBA-VIDAL, ANIMAL, vol. 12, 2018, pages 2489 - 2498
BINDELLE, JOURNAL OF ANIMAL SCIENCE, vol. 87, 2010, pages 583 - 93, Retrieved from the Internet <URL:https://doi.orq/10.2527/ias.2007-0717>
CANANI, R.B., WORLD J. GASTROENTEROL., vol. 17, 2011, pages 1519 - 1528
CREMONESI P, JOURNAL OF DAIRY RESEARCH, vol. 79, 2012, pages 318 - 23, Retrieved from the Internet <URL:https://doi.org/10.1017/S002202991200026X>
DUFOURNY S, JOURNAL OF MICROBIOLOGICAL METHODS, vol. 167, 2019, pages 105735, Retrieved from the Internet <URL:https://doi.org/10.1016/j.mimet.2019>
GROOT, ANIMAL FEED SCIENCE AND TECHNOLOGY, vol. 64, 1996, pages 77 - 89, Retrieved from the Internet <URL:https://doi.org/10.1016/S0377-8401(96)01012-7>
HAARMAN M, APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 71, 2005, pages 2318 - 24, Retrieved from the Internet <URL:https://doi.org/10.1128/AEM.71.5.2318>
HIDAKA T., WATER RESEARCH, vol. 44, 2010, pages 2554 - 62, Retrieved from the Internet <URL:https://doi.org/10.1016/j.watres.2010.01.007>
IRAPORDA C, IMMUNOLOGY, vol. 10, 2015, pages 1161 - 1169, Retrieved from the Internet <URL:https://doi.org/10.1016/j.imbio.2015.06.004>
LANGENDIJK P.S., APPL ENVIRON MICROBIOL, vol. 61, 1995, pages 3069 - 3075
LOQUASTO J.R., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 79, 2013, pages 6903 - 10, Retrieved from the Internet <URL:https://doi.org/10.1128/AEM.01777-13>
MARKOWIAK P.SLIZEWSKA K., GUT PATHOG, vol. 10, 2018, pages 21
MATHYS S, BMC MICROBIOLOGY, vol. 8, 2008, pages 179, Retrieved from the Internet <URL:https://doi.org/10.1186/1471-2180-8-179>
MATSUKI T, APPL ENVIRON MICROBIOL, vol. 68, 2002, pages 5445 - 5451
MATSUKI T, APPL ENVIRON MICROBIOL, vol. 70, 2004, pages 7220 - 7228
NAUTA, AM. J. CLIN. NUTR., vol. 98, 2013, pages 586 - 93
PARADA VENEGAS, FRONTIERS IN IMMUNOLOGY, vol. 10, 2019
SANDERS M.E.: "Probiotics, strains motter", FUNCTIONAL FOODS & NUTRACEUTICALS MAGAZINE, 2007, pages 36 - 41
TRAN, FEMS MICROBIOLOGY ECOLOGY, vol. 92, 2016, pages 1 - 13, Retrieved from the Internet <URL:https://doi.org/10.1093/femsec/fiv165>
UERLINGS J, J SCI FOOD AGRIC, vol. 99, 2019, pages 5720 - 5733
VEIGA, P., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 107, 2010, pages 18132 - 37, Retrieved from the Internet <URL:https://doi.org/10.1073/pnas.1011737107>
WANG R.F., APPL ENVIRON MICROBIOL, vol. 62, 1996, pages 1242 - 1247
ZENG, MUCOSAL IMMUNOL., vol. 10, 2017, pages 18 - 26

Also Published As

Publication number Publication date
CA3198168A1 (en) 2022-05-19
BE1028802B1 (en) 2022-06-14
EP4243626A1 (en) 2023-09-20
WO2022101511A1 (en) 2022-05-19

Similar Documents

Publication Publication Date Title
US20240123000A1 (en) Treatment of clostridium difficile infection
US10555980B2 (en) Treatment of Clostridium difficile infection
AU2016344770B2 (en) Faecalibacterium prausnitzii and Desulfovibrio piger for use in the treatment or prevention of diabetes and bowel diseases
KR20180127972A (en) Use of microbial communities for human and animal health
EP3937958A1 (en) &lt;smallcaps/&gt;? ? ?christensenellaceae? ? ? ? ?bacterium of thefamily for the prevention and/or treatment of chronic inflammatory diseases and/or inflammatory gastrointestinal diseases and/or cancers
BE1028802B1 (en) DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE THE INTESTINAL MICROBIOTA OF PIGLETS AT WEANING TIME
CA2709850A1 (en) Composition for human and/or animal nutrition, uses thereof and yeasts
EP2306846A2 (en) Composition of soluble indigestible fibre and of microalgae used in the well-being field
US11141442B2 (en) Tributyrin compositions and methods therefor
CN116782771A (en) Compositions and related methods for supporting companion animals having gastrointestinal disorders
WO2022018373A1 (en) Combination of lactobacillus strains and use thereof in animal health
EP2919592B1 (en) Use of branched maltodextrins for the intestinal well-being of infants
Burel et al. The effect of the feed on the host-microflora interactions in poultry: an overview
Hino et al. Ameliorating effects of short-chain inulin-like fructans on the healing stage of trinitrobenzene sulfonic acid-induced colitis in rats
FR3114106A1 (en) Bacterial strain belonging to the genus Christensenella and compositions
Vila Effects of dietary fiber on swine intestinal epithelial and immune response
Ferrandis Vila Effects of dietary fiber on swine intestinal epithelial and immune response
Pelpolage Health functionality of agricultural products and agricultural by-products
WO2023036957A1 (en) Use of faecalibacterium to treat a respiratory viral infection
Van der Westhuizen The potential of neokestose as a prebiotic for broiler chickens

Legal Events

Date Code Title Description
FG Patent granted

Effective date: 20220614