BE1028802A1 - DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE THE INTESTINAL MICROBIOTA OF PIGLETS AT WEANING TIME - Google Patents

Abstract

Symbiotic composition which can be administered to animals, in particular to mammals, in particular to pigs, in particular to pregnant animals and to newborns, in particular to sows, whether or not pregnant, and to piglets, comprising at least one probiotic and at least one prebiotic for the treatment or prevention of dysbiosis, characterized in that said at least one probiotic and said at least one prebiotic are chosen such that they together generate an anti-inflammatory environment in the intestine of said animal .

Description

DEVELOPMENT OF A SYMBIOTIC COMPOSITION AS A FEED ADDITIVE FOR PIGLETS OR PREGNANT SOWS TO MODULATE

THE INTESTINAL MICROBIOTA OF PIGLETS DURING WEANING The present invention relates to a symbiotic composition which can be administered to animals, in particular to mammals, in particular to pigs, preferably to pregnant animals and to newborns, in particular to pregnant or non-pregnant sows and to piglets comprising at least one probiotic and at least one prebiotic for the treatment or prevention of intestinal dysbiosis, said composition being administered for the purpose of improving the health conditions of the newborn.

Intestinal dysbiosis is an imbalance of the intestinal microbiota that can generate an overgrowth of pathogens (eg E. coli) causing diarrhea. The microbiota is defined as all the microorganisms present in a given environment (definition from the Quebec office of the French language, 2008). This determined environment is called the microbiome. The imbalance of the intestinal microbiota results in a reduction in the diversity of bacterial populations and an excess of pathogenic bacteria in the microbiota. Conversely, a microbiota balanced in the distribution of the species of microorganisms that compose it is said to be in eubiosis.

The meat production sector is growing rapidly in the world, pork production is increasing steadily and represents one of the largest consumers of antibiotics in animal production.

On pig farms, weaning (stopping breastfeeding and switching to dry feed) is a period associated with a risk for young animals. A recurring problem when weaning animals is the increased risk of diarrhea resulting from the abrupt transition of diet. This abrupt transition can lead to intestinal dysbiosis.

Diarrhea can lead to weight loss, even death of the newborn in severe cases. Routine treatment as well as prophylactic procedures applied for diarrhea detected just after the birth of the piglet are often not very effective.

This transition period also generates in the animal, in particular in the piglet, a significant stress at the behavioral, nutritional and environmental level, responsible for a strong reduction in food consumption.

It is therefore crucial to control this risk of diarrhea because it causes a considerable loss for breeders since it is often associated with a high mortality rate, weight loss, stunted growth, and treatment-related costs.

Currently this risk of diarrhea is controlled by the addition of bacteriostatic mineral additives (ZnO, CuSOQ4) in the diet of weaned piglets but, beyond the resistance already observed to these compounds, the practice of adding mineral additives bacteriostatic leads to environmental problems (contamination of water by leached minerals contained in livestock effluents).

Adding therapeutic antibiotics to animal feed around weaning is also common practice. This treatment remains problematic because it induces the resistance of bacteria to antibiotics. In farm animals, indiscriminate use of antibiotics can also promote intestinal dysbiosis. Moreover, knowing that resistance to antibiotics is increasing more and more, particularly in farm animals, the European Commission has since January 1, 2006 banned the use of antibiotics as growth promoters in animal feed.

Given the growth of global demography and the growing demand for meat in the world, it is therefore crucial to find alternative solutions to the use of antibiotics and mineral additives to reduce the incidence and severity of digestive problems. in weaned animals and, more generally, to support the sustainable growth of the meat industry.

In view of the above, alternative solutions to antibiotics and bacteriostatic minerals have been developed involving optimal use of probiotics in combination or not with prebiotics.

Generally, a combination of at least one probiotic with at least one prebiotic is called a synbiotic, when the prebiotic acts as a substrate in synergy with the probiotic to provide a positive effect on health, in particular on digestion.

The digestion of proteins, sugars and fats in monogastric individuals, and in particular in pigs and poultry, is based first on digestion taking place in the stomach, which constitutes an acid environment leading to denaturation of the macromolecules to form a digesta.

The digesta then arrives in the intestine and again undergoes hydrolysis there by the action of pancreatic juice which contains several proteases and by the action of aminopeptidases and intestinal dipeptidases.

The absorption of the products of these hydrolyses takes place in the upper part of the small intestine and all the undigested products in the small intestine reach the large intestine where they are subjected to the action of microorganisms (intestinal microbiota) resulting in a fermentation.

There are many publications that confirm the indispensable role of the intestinal microbiota on the health of animals (and humans). The intestinal microbiota also interacts permanently with the immune system present in the intestinal wall. Some studies have also demonstrated the ability of probiotics and/or prebiotics to rebalance the intestinal microbiota and their usefulness on intestinal health through generally direct and short-term effects.

The World Health Organization (WHO) and the Food and Agriculture Organization of the United Nations (FAO) have defined probiotics as "living microorganisms which, when ingested in sufficient quantity , exert positive effects on health, beyond the traditional nutritional effects”. || there are longer definitions which do not refer to food, and where the word "ingested" can be replaced by "administered".

Although people often think of bacteria and other microorganisms as harmful "germs", many are actually helpful. Some bacteria help digest food, destroy pathogenic cells or produce vitamins. Many of the microorganisms in the problotigues products are the same or similar to the microorganisms that live naturally, endogenously, in our bodies.

Without being exhaustive, probiotics include various microorganisms such as bacteria Bacillus coagulans, Bacillus subtilis, Bifidobacterium animalis lactis, Lactobacillus rhamnosus, Bacillus licheniformis, Lactobacillus plantarum, Bifidobacterium thermophilum, Clostridium butyricum, Enterococcus faecium, Bifidobacterium crudilactis, Bifidobacterium mongoliense, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus salivarius, Lactobacillus helveticus, Lactobacillus crispatus, Lactobacillus pontis, Lactobacillus johnsoni, Bifidobacterium infantis, Bifidobacterium longum, Collinsella tTanakaei, Pediococcus acidilacticiici, Faecalibacterium prausniizi, 5 Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticustipes. The most common probiotic bacteria are those of the Lactobacilus and Bifidobacierium genus. Probiotics also include yeasts like Saccharomyces boulordii_ (Sanders M.E. "Probiotics, strains matter", Functional foods & nutraceuticals IO magazine, 2007, 36-41}.

Prebiotics, on the other hand, are substrates used selectively by host microorganisms that selectively stimulate the growth or activity of desirable microorganisms (Expert consensus document: The International Scientific Association for Probiotics and Prebiotics (ISAFP} consensus statement on the definition and scope of prebiotics, Nature Reviews (Gastroenterology & Hepatoiogy, 2017, 14, 491-502, https://doi.org/10.1038/nrgastro.201 7.75).

Without being exhaustive, prebiotics include, among others, inulin, beta-glucan, 2'-Fucosyllactose (2FL), oligosaccharides such as galactooligosaccharides (GOS), fructooligosaccharides (FOS), mannanoligosaccharide (MOS), xylooligosaccharide (XOS) , polyunsaturated fatty acid (PUFA), conjugated linoleic acid (CLA).

A formulation combining at least one probiotic in combination with at least one prebiotic to prevent and treat bacterial infections that can lead to diarrhea, increase the weight of the animal and promote growth is known from document WO2014049023. The document WO2014049023 describes products and compositions which can be beneficial in breeding. Said products and compositions described therein comprise microorganisms, such as bacteria, in particular probiotic bacteria. The strains, as well as the compositions comprising them, can be administered to animals, preferably to farm animals, such as pigs. The administration can take place in the first days of life. According to this document, the administration of the products or compositions promotes animal growth and the weight gain of the animal. Bacterial infections can also be prevented or treated by said compounds or compositions.

Document WO2018002671 discloses a composition for the treatment and/or nutrition of poultry such as broilers comprising (1) a commensal probiotic chosen from Bifidobacterium animalis, Collinsella Tanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilacticiici, Lactobacillus pontis , Faecalibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, Butyricicoccus, Lactobacillus johnsoni and Ruminococcus sp.; and (ii) a prebiotic. This document also discloses the use of such a composition for the treatment of enteric diseases in poultry, such as necrotic enteritis.

The document WO20061334/72A1 relates to a food additive and/or additive for animal or human drinking water promoting the health or the growth of probiotics. This document also relates to a use of the human and animal food additive and/or drinking water, in particular for the prevention of the harmful effect of a certain number of undesirable germs in the digestive system of animals and/or domestic birds.

Finally, the document WO2017156548A1 relates to certain foods comprising a fermentable nutritional component and a probiotic component, where the probiotic component is selected, on the basis of genetic and/or metabolic criteria, to specifically metabolize any free sugar monomer (Free Sugar Monomers (FSM )) or any free amino acid (Free Amino Acids (FAA)) or peptide which accumulate in the small and large intestines due to the fermentable nutrient component, which without this metabolization would be fermented and metabolized by bacteria less adaptive/opportunistic, creating blooms of deleterious gut bacteria and shifting the microbiome to a potential state of dysbiosis.

Unfortunately, the known formulations are essentially used as a therapeutic agent for dysbiosis or imbalance of the microbiome in farm animals. The effects demonstrated in vivo by these formulations remain very general, such as weight gain or the percentage of animal mortality. Many probiotics are described in combination with any prebiotic in a variety of ways.

Furthermore, according to Barba-Vidal et al. Animal, 2018, 12, 2489-2498, DOI: 10.1017/S1751731118000873, there is a glaring lack of reproducibility in experiments showing the beneficial effect of probiotics.

The present invention therefore aims to provide a symbiotic formulation which has an effect which is maintained over time by acting specifically on the modulation of the microbiota in an early manner, thus promoting intestinal eubiosis in a reliable manner.

Indeed, according to the present invention, a symbiotic composition of at least one prebiotic and at least one probiotic would not only have a therapeutic effect but also a prophylactic impact on the modulation of the host microbiota for a longer-lasting action. term. It is indeed described by Nauta et al. AM. J. Clin. Nutr. 2013, 98:5865-935, DOI: 10.3945/cjon.112.039644 that modulating the microbiota through an appropriate diet during gestation and just after birth can indeed promote digestion, metabolic homeostasis and immunological development.

Interventions at the end of the sow's gestation and/or from the birth of the piglet should allow, by the principle of early programming, to influence in an optimal and lasting way the good development of the microbiota of the newborn. Consequently, the positive effects for the animal's health would not only be observed at the start of life and during the 3-4 weeks after weaning, but they would also remain observable throughout adult life.

The first intestinal colonization of the piglet by the maternal microbiota at the time of farrowing is crucial for the establishment of a favorable intestinal microbiota of the newborn, but the composition of the microbiota can be influenced by many factors such as antibiotics, food, environment, infectious agents, etc.

The present invention therefore intends to overcome the aforementioned drawbacks by providing a composition as indicated above, characterized in that said at least one probiotic and said at least one prebiotic are chosen in such a way that they together generate an anti-inflammatory environment in the stomach and/or the intestine of the said animal, in particular of the mammal, in particular of the pig, preferably of the animal in gestation and of the newborn, in particular of the sow in gestation or not and of the piglet, in the aim of improving the health conditions of the newborn.

According to the present invention, it has in fact been demonstrated that it is possible to provide a symbiotic formulation which generates in a demonstrated and reproducible manner an anti-inflammatory environment in the digestive system, both of the animal in gestation and later in the newborn, which is maintained over time to protect the animal against subsequent dysbiosis.

The symbiotic formulation according to the present invention making it possible to modulate the microbiota of the fetus in a pregnant or newborn animal will make it possible to have a maximum prophylactic effect and will ensure optimal growth and development of the animal.

Indeed, the formulation according to the present invention promotes a healthy intestinal flora which thus protects the animal which ingests it, in particular when the latter is ingested by the pregnant female by the demonstrated and reproducible generation of an anti- inflammation in the stomach and/or the intestine, and this in a systematic way.

Indeed, it is crucial to analyze the impact of probiotics through 3 important criteria: the concentration of viable cells, the beneficial effect on the growth of the host and the beneficial effect on the functioning of the digestive tract thanks in particular with an anti-inflammatory impact (Markowiak P. and Slizewska K., Gut Pathog. 2018, 10, 21, doi: 10.1186/s13099).

The symbiotic formulation according to the present invention provides an effective solution against dysbiosis and the problem of diarrhea occurring during weaning, of which the probiotic and the prebiotic are chosen specifically not only on cell viability, but for their associated effects on cell viability. and on the anti-inflammatory response of the host microbiota.

| has in fact been demonstrated according to the present invention that the symbiotic formulation containing a probiotic and a prebiotic produces a reduction in the production of IL-8 in an in vitro test, and an increase in short chain fatty acids "Short Chain Fatty Acids, SCFAs” as well as an improvement in the diversity and quantity of endogenous bacterial populations such as Lactobacillus and Bifidobacteria as well as bacteria involved in the metabolic pathways for the production of butyrate or other short-chain fatty acids. The probiotic and the prebiotic together form an enhanced gut microbiota, thereby leading to the generation together of an anti-inflammatory environment in the digestive system of the animal, especially the mammal, especially the pig, preferably of the animal in gestation and the newborn, in particular of the sow, whether pregnant or not, and of the piglet.

Indeed, these indicators are important because it has been shown that an inflammatory environment of the gastrointestinal tract can generate intestinal dysbiosis (Zeng et al., Mucosal Immunol., 2017, 10,18-26, doi: 10.1038/mi.2016.75 ). It has also been shown that “Short Chain Fatty Acids, SCFA” may additionally have a beneficial effect of immunological regulators on the gastrointestinal environment (Parada Venegas et al. Frontiers in Immunology, 2019, 10, doi:10.3389/fimmu .2019.00277). SCFAs are short chain fatty acids produced by the fermentation process in the colon. Acetate, propionate and butyrate are the three main SCFAs. Butyrate is particularly important for the proper functioning of the colon because it is the main source of energy for colonocytes (colon epithelial cells). SCFAs can also reduce the pro-inflammatory response of gut epithelial cells (Iraporda C. et al., Immunology, 2015 10:1161-1169. https://doi.org/10.1016/j.imbio.2015.06. 004).

Administered to the animal, in particular to the mammal, in particular to the pig, preferably to the pregnant animal, and to the newborn, in particular to the pregnant or non-pregnant sow and to the piglet, the symbiotic formulation according to the present invention promotes the establishment of a balanced intestinal microbiota very early, protecting the animal, the mammal, the pig or the animal in gestation or even the newborn, more particularly the sow in gestation or the piglet in a sustained over time against dysbiosis by the probiotic and prebiotic it contains, which together generate an anti-inflammatory environment.

In a preferred embodiment of the present invention, said probiotic is chosen from the group of bacteria Bifidobacterium thermophilum, Enterococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis.

According to the present invention, Bifidobacterium thermophilum comes from the Belgian Coordinated Collections of Microorganisms (BCCM/LMG Gent) listed under number 18892, Enterococcus faecium (LMG S-28935), Bifidobacterium animalis lactis is a strain deposited at the Belgian Coordinated Collections of Microorganisms (BCCM/LMG Gent) having the deposit number LMG P-28149, Clostridium butyricum (LMG1217), Bifidobacterium crudilactis is a strain deposited at the National Collection of Microorganism Cultures (CNCM, Institut Pasteur) having the deposit number ( CNCM |-3342) in the context of document WO2006122850.

In a particular form of the present invention, said prebiotic is chosen from the group comprising inulin, B-glucan, 2′ Fucosyllactose, GOS/FOS, resistant starch.

Preferably, according to the invention, said symbiotic composition is characterized in that said at least one probiotic and said at least one prebiotic together generate an increase in the concentrations of endogenous bacterial populations favorable to the intestinal microbiota, such as Lactobacillus and Bifidobacteria. Advantageously, this increase in bacterial population concentrations generates a better balance of the host's intestinal microbiota, reducing the risk of intestinal dysbiosis. Advantageously, according to the invention, said symbiotic composition is characterized, preferably, in that said at least one probiotic and said at least one prebiotic together generate a reduction in the concentration of IL8 of at least 10% forming said anti-inflammatory environment. -inflammatory. In the context of the present invention, the concentration of IL-8 was measured using in vitro tests on IPEC_J2 cells in the presence of the fermentation juice (containing or not containing the symbiotic composition to be tested).

Advantageously, according to the invention, said symbiotic composition is preferably characterized in that said at least one probiotic and said at least one prebiotic together generate a stabilization or an increase in the secretion of short-chain fatty acids (SCFA's) by the gut microbiota. SCFAs have a multiple beneficial role in the intestine: butyrate, in particular, has a regulatory role in the transport of transepithelial fluid. It also improves the oxidative state and the inhibition of inflammation of the intestinal mucosa, it reinforces the epithelial defense barrier, it modulates visceral sensitivity and intestinal mobility (Canani, R.B. et al. World J.

Gastroenterol., 2011, 17: 1519-1528, doi: 10.3748/wjg.v17.i12.1519).

Preferably, according to the invention, said SCFAs are chosen from butyrate, propionate, acetate, lactate or combinations thereof.

In the context of the present invention, the production of said SCFAs is measured using the in vitro static fermentation model detailed in more detail below.

Preferably, according to the invention, the symbiotic composition is characterized in that said at least one probiotic and said at least one prebiotic is chosen from the group consisting of Bifidobacterium thermophilum and inulin, Bifidobacterium crudilactis and beta-glucans, Bifidobacterium animalis lactis and 2'fucosyllactose, Clostridium butyricum and GOS/FOS, Enterococcus faecium and beta-glucans and their mixture.

Indeed, according to the present invention, a symbiotic composition comprising Bifidobacterium thermophilum and inulin or comprising Bifidobacterium crudilactis and beta-glucans, or comprising Bifidobacterium animalis lactis and 2'fucosyllactose or comprising Clostridium butyricum and GOS/FOS or also comprising Enterococcus faecium and beta- glucans showed a synergistic ability to create an anti-inflammatory environment, by reducing the presence of IL-8, increasing the production of short-chain fatty acids and promoting the growth of bacterial populations favorable to the microbiota.

Advantageously, according to the invention, the synbiotic composition can contain more than 1 probiotic, for example 2 probiotics, or for example 3 probiotics, or for example 4 probiotics or for example 5 probiotics. According to the invention, the symbiotic composition may also contain more than 1 prebiotic, for example 2 prebiotics, or for example 3 prebiotics, or for example 4 prebiotics. A symbiotic composition that may contain a combination of several probiotics and several prebiotics optimizes the anti-inflammatory environment and improves the production of microbiota growth indicators such as SCFASs.

Advantageously, according to the invention, the symbiotic composition contains at least 1 conventional excipient, and is in liquid or solid form.

The solid form can be a powder, a powder in a capsule, a granule or a tablet or any other form.

Other embodiments of the symbiotic composition according to the invention are indicated in the appended claims.

The present invention also relates to a food supplement which can be administered to animals, in particular to mammals, in particular to pigs, preferably to pregnant animals and to newborns, in particular to pregnant sows or not and in piglets for the preventive and/or curative treatment of intestinal dysbiosis.

Said food supplement, comprising said composition, can be in liquid form, for example in a milky or oily base, or in solid form such as a powder, a powder in a capsule, a granule or a tablet or any other form whatsoever.

Other embodiments of the food supplement according to the invention are indicated in the appended claims.

The present invention also relates to a complete or complementary feed for farm animals comprising said composition, said feed being in the form of flour and/or granules and/or milk feeds and/or any other forms of food packaging. .

Other embodiments of the complete or complementary food for livestock according to the invention are indicated in the appended claims The present invention also relates to a food for newborn animals comprising the said composition according to the present invention and a milk base compatible with newborn feeding.

Other embodiments of the food for newborn animals according to the invention are indicated in the appended claims.

The present invention finally relates to a use of said composition for the preventive and/or curative treatment of intestinal dysbiosis in animals, in particular mammals, in particular pigs, preferably pregnant animals and newborns. , in particular pregnant sows or not and piglets, comprising at least one administration of said composition at the rate of a quantity of preblotic of between 01 and 1000 d/day/animal, preferably between 05 and 100 gfouvonmal, so advantageous between | and 25 g/hour/animal, of a quantity of probiotic comprised between 1.00E+05 and 1.00E+015 CFU/day/animal, preferably between 1.00E+06 and 1.00E+013 CFU/day/animal, so as advantageous between 1.00E+07 and 1.00E+011 CFU/day/animal and at least one administration of a daily food ration, said probiotic and said prebiotic of the composition being administered simultaneously, separately or staggered over time.

Other forms of use of said composition according to the invention are indicated in the appended claims.

Other characteristics, details and advantages of the invention will become apparent from the description given below, on a non-limiting basis and with reference to the drawings and the examples. Figure 1 shows the schematic of the experimental device of the BabySPIME system (Dufourny S. et al. Journal of Microbiological Methods, 2019, 167: 105735. https://doi.org/10.1016/j.mimet.2019). Compartment 1: Stomach/duodenum/jejunum, compartment 2: ileum, compartment 3: ascending colon. A: Food, B: probiotic, C: prebiotic.

Figure 2 illustrates the level of IL-8 production (pg/MI) by IPEC-J2 cells. The IPEC-J2 cells were brought into contact with a fermentation juice coming from a fermentation with only a prebiotic, GOS/FOS (GF) or Inulin (Inu) or 2'FL (2FL) or beta-glucan (BG ) or resistant starch (RS), or else originating from a fermentation during which a composition combining a prebiotic and a probiotic according to the invention was tested. The results show the mean of the level of IL-8 production +/- the standard deviation. The horizontal line corresponds to the level of IL-8 in the control condition (blank-mucin). Statistical significance was analyzed by a one-way ANOVA test with a Dunnett-type multiple comparison of each prebiotic and symbiotic against the control condition (indicated by *), and between the symbiotic combinations and the prebiotic alone (indicated by #). When p < 0.05: *, #; when p < 0.01: **, ##; when p < 0.001: ***, ###; and when p < 0.0001: ****, #H###. BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis, BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.

Figure 3 shows a time series indicating the accumulation of gas production in a batch in vitro fermentation (in vitro static fermentation) of a prebiotic alone or in combination with a probiotic (symbiotic). The in vitro batch fermentation of the symbiotic combination is carried out with 10E7 CFU/ml of probiotic and 0.1 g of prebiotic (same quantity in the condition where the prebiotic is present alone), in the presence of an inoculate of 3% in faeces. The results indicate the Mean (ml/g of substrate) +/- the standard deviation of 3 experimental replicates. For prebiotics, GF: GOS/FOS, Inu: inulin, 2FL:2'FL, BG: beta-glucan, resistant starch: RS. For probiotics, BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.

Figure 4 shows the relative abundance of groups of bacteria beneficial for intestinal eubiosis at 24 hours after the start of the batch in vitro fermentation (in vitro static fermentation) in the presence of the prebiotic alone or in the presence of symbiotic combinations (prebiotic + probiotic). Beneficial bacteria groups selected include bifidobacteria, lactobacilli, clostridium cluster IV, clostridium cluster XIVa, and the gene butyryl-CoA:acetyl-CoA transferase. The 2A(-AACT) qPCR measurement method was used to establish relative abundance, measurements were normalized to total bacteria, and a mixture of DNA samples from all extracts was used as calibrator. The in vitro fermentation, in an individual fermenter, of the symbiotic combinations was carried out at 10E7 CFU/ml of probiotic and 0.1 g of prebiotic (same quantity for the condition with the prebiotic alone), in the presence of 3% of an inoculate of faeces. The results indicate the mean (ml/g of substrate) +/- the standard deviation of 3 experimental replicates.

The statistical significance was analyzed by a one-way ANOVA test with a Dunnett type multiple comparison and where * corresponds to p < 0.05, ** to p < 0.01, *** to p < 0.01, and **** to p < 0.0001. For prebiotics, GF: GOS/FOS, Inu: inulin, 2FL: 2'FL, BG: beta-glucan, resistant starch: RS. For probiotics, BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, BCU: Bifidobacterium crudilactis, BMO: Bifidobacterium mongoliense, LP: Lactobacillus plantarum.

Figure 5 shows the ability of the probiotic to survive and establish in a complex microbial community. Figure 5 shows the relative abundance of each probiotic compared to the total bacteria at 12 h, 24 h and 48 h after the start of the fermentation for different symbiotic compositions. The relative abundance of each probiotic is normalized to the relative amount of probiotic obtained in the sample where just the probiotic was added. For prebiotics, GoF: GOS/FOS, Inu: inulin, 2FL: 2'FL, BG: beta-glucan, resistant starch: RS. For probiotics, BCO: Bacillus coagulans, BT: Bifidobacterium thermophilum, CB: Clostridium butyricum, EF: Enterococcus faecium, BAL: Bifidobacterium animalis lactis, LP: Lactobacillus plantarum.

FIG. 6 shows the evolution of the bacterial population between the end of the stabilization period and the end of the week of treatment: The results are shown with the following symbiotic compositions Enterococcus faecium (EF)+beta-glucan (BG); Bifidobacterium thermophilum (BT) + inulin (Inu); Clostridium butyricum (CB) + GOS/FOS (G/F); Bifidobacterium animalis lactis (BAL) + 2'FL (2FL); Bifidobacterium crudilactis (BC) + beta-glucan (BG); and the control condition. Results are ratios of gene expression to total bacteria.

As indicated previously, the present invention relates to a symbiotic formulation comprising at least one prebiotic and at least one probiotic.

Preferably, said probiotic is chosen from the group of microorganisms comprising Bifidobacterium i$hermophilum, Enferococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis.

In a particular form of the present invention, said prebiotic is chosen from the group comprising inulin, B-glucan, 2′ Fucosyllactose, GOS/FOS, resistant starch. | has in fact been demonstrated according to the present invention that the symbiotic formulation containing a probiotic and a prebiotic produces a decrease in the production of IL-8 in an in vitro test, and an increase in "Short Chain Fatty Acids, SCFAs" as well as an improvement in the diversity and quantity of endogenous bacterial populations such as Lactobacillus, bifidobacteria, Clostridium clusters IV and XIVa as well as bacteria involved in the metabolic pathways of butyrate production, forming an improved intestinal microbiota, leading in this way to the joint generation of an anti-inflammatory environment in the digestive system of the animal, in particular of the mammal, in particular of the pig, preferably of the pregnant animal and of the newborn, in particular of the sow in pregnancy or not and of the piglet.

Administered to the pregnant animal or to the newborn, more particularly to the pregnant sow or to the piglet, the symbiotic formulation according to the present invention promotes the establishment of a balanced intestinal microbiota very early, protecting the animal in gestation or even the newborn, more particularly the sow in gestation or the piglet in a sustained manner against dysbiosis by the probiotic and the prebiotic which it contains, which together generate an anti-inflammatory environment.

Preferably, according to the invention, said symbiotic composition is characterized in that said at least one probiotic and said at least one prebiotic together generate an increase in the concentrations of endogenous bacterial populations favorable to the intestinal microbiota, such as Lactobacillus and Bifidobacteria.

Advantageously, this increase in bacterial population concentrations generates a better balance of the host's intestinal microbiota, reducing the risk of intestinal dysbiosis.

Advantageously, according to the invention, said symbiotic composition is preferably characterized in that said at least one probiotic and said at least one prebiotic together generate a reduction in the concentration of IL-8 of at least 10% forming said anti-inflammatory environment.

In the context of the present invention, the concentration of IL-8 was measured by means of in vitro tests on IPEC-J2 cells in the presence of the fermentation juice (containing or not containing the symbiotic composition to be tested). Advantageously, according to the invention, said symbiotic composition is characterized, preferably, in that said at least one probiotic and said at least one prebiotic together generate a stabilization or an increase in the secretion of short-chain fatty acids (SCFA's) by the intestinal microbiota, said SCFAs, produced during the fermentation process of the microbiota, are an indicator of the balance and growth of the microbiota.

SCFAs like butyrate indeed have a multiole beneficial role in the intestine as its regulatory role in the transport of transepithelial fluid.

It also improves the oxidative state and inflammation of the intestinal mucosa, it strengthens the epithelial defense barrier, it modulates visceral sensitivity and intestinal mobility (Canani, R.B. et al. World J. Gastroenterol., 2011, 17 : 1519-1528, doi: 10.3/48/wjg.v17.112.1519). Preferably, according to the invention, said SCFAs are chosen from butyrate, propionate, acetate, lactate or combinations thereof.

In the context of the present invention, the production of said SCFAs is measured using the in vitro static fermentation model.

Preferably, according to the invention, the symbiotic composition is characterized in that said at least one probiotic and said at least one prebiotic is chosen from the group consisting of Bifidobacterium thermophilum and inulin, Bifidobacterium crudilactis and beta-glucans, Bifidobacterium animalis lactis and 2'fucosyllactose, Clostridium butyricum and GOS/FOS, Enterococcus faecium and beta-glucans and their mixture.

Advantageously, according to the invention, the symbiotic composition can contain more than 1 probiotic, for example 2 probiotics, or for example 3 probiotics, or for example 4 probiotics or for example 5 probiotics. According to the invention, the symbiotic composition may also contain more than 1 prebiotic, for example 2 prebiotics, or for example 3 prebiotics, or for example 4 prebiotics. A symbiotic composition that may contain a combination of several probiotics and several prebiotics optimizes the anti-inflammatory environment and improves the production of microbiota growth indicators such as SCFASs.

In vitro static fermentation: The fermentation capacity of the different symbiotic combinations was tested in a static in vitro fermentation model, following the protocol described by Bindelle et al. Journal of Animal Science 2010, 87, 583-93. nttps://doiorg/10.252//10s.2007-0717 and by Tran et al. FEMS Microbiology Ecology 2016, 92, 1-13. hips fgolorg/id.1093/femsec{iv145. In summary, in vitro fermentation was carried out in flasks containing 15 ml of a solution containing 3% pre-weaning piglet faeces; three microcosm carriers previously immersed in mucin agar; 100 mg of prebiotic and 1E07 CFU/ml of probiotic. Sealed vials were incubated at 39°C with shaking for 48 h in a water bath. Three replicates were performed per test condition.

Gas production: The gas pressure was measured 2, 5, 8, 12, 16, 20, 24 and 48h after the start of fermentation for the determination of fermentation kinetics using the monophasic mathematical model of Groot et al. . Animal Feed Science and Technology 1996, 64, 77-89. https://doi.org/10.1016/S0377-8401(96)01012-7. Several parameters were calculated with this model: A (maximum gas volume, ml/g substrate), B (time to reach A/2, h), C as constant determining the slope of the inflection point of the profile, Rmax ( maximum fermentation rate, ml/g of subsirat/hour) and Tmax (time to reach Rmax).

Short-chain fatty acids: Lactate and short-chain fatty acids (SCFA) were measured in the fermentation juice obtained after 24 hours by isocratic HPLC. The standard curve used contained acetate, propionate, butyrate as well as branched chain fatty acids (BCFA): isobutyrate, valerate and isovalerate.

The SCFA measurement was then calculated taking into account the basal production in the control-mucin flasks containing the microcosm carriers with mucin. The values are given in mmol per g of substrate and compared to the measurements in the fermentation juice containing only the corresponding prebiotic.

Determination of microbiota modifications by qPCR during an in vitro static fermentation model test in the presence of different symbiotic compositions.

For each test in the in vitro static fermentation system, the analysis of changes in the intestinal microbiota was carried out by qPCR on samples taken after 24 hours of fermentation.

The sequences of the forward primers and the antisense primers used to measure the expression by qPCR of the target genes corresponding to the bacterial populations beneficial for the microbial community of the intestine are indicated in Table 1 below.

Table 1.- Sequences of sense (F) and antisense (R) primers to measure by qPCR target genes corresponding to bacterial populations beneficial to the microbial community of the intestine. Population Sequence of bacterial 5'—3' primers/gen | Target genes q x . > Reference . target genes targets

CGTGCCAGCCGCGGTAATAC Total Bacteria GGGITGCGCTCGITGCGGGA | Amit-Romach Unibac-R et al. (2004)

CTTAACCCAAC

CATCCAGTGCAAACCTAAGA Lactobacillus Wang et al. GATCCGCTTGCCTTCGC (1996) GGGTGGTAATGCCGGAT - Bifidobacterium Langendijk and Bif662-R CCACCGTTACACCGGGAA col. (1995) Clostridium Sg-Clept-F | GCACAAGCAGTGGAG Matsuki and cluster IV Sg-Clept-R | CTTCCTCCGTTTTGTCAA col. (2004) Clostridium AAATGACGGTACCTGACTA Matsuki and cluster XIVa CTTTGAGTTTCATTCTTGCG col. (2002) Butyryl-TGGACAGAAAGGTIGCGGA CoA:acetate-Uerlings and GTTGTACGCCCAGATCCT col. (2019) COA transferase Total bacteria are targeted using the primers described in Amit-Romach E. et al. Poult Sci 2004, 83, 1093-1098, doi: 10.3382/ps/pey394. Bacteria belonging to the lactobacillus group are targeted using the primers described in Wang R.F. et al. Appl Environ Microbiol 1996, 62, 1242-1247, doi: 10.1128/AEM.62.4.1242-1247.1996.

The bacteria belonging to the bifidobacterium group are targeted using the primers described in Langendijk P.S. et al. Appl Environ Microbiol 1995, 61, 3069-3075, doi: 10.1128/AEM.61.8.3069-

3075.1995.

Bacteria belonging to the clostridium cluster IV group are targeted using the primers described in Matsuki T. et al. Appl

Environ Microbiol 2004, 70, 7220-7228, doi:10.1128/AEM.70.12.7220-

7228.2004. Bacteria forming part of the clostridium cluster XIVa group are targeted using the primers described in Matsuki T. et al. Appl Environ Microbiol 2002, 68, 5445-5451, doi:10.1128/gem.68.11.5445-

5451.2002. Butyri-CoA:acetate-CoA transferase is targeted using the primers described in Uerlings J. et al. J Sci Food Agric 2019, 99, 5720-5733, doi: 10.1002/jsfa.9837.

Determination of the ability of probiotics to survive and establish themselves in a complex microbial ecosystem by qPCR during an in vitro static fermentation model assay in the presence of different symbiotic compositions.

For each test in the in vitro static fermentation model, the analysis and monitoring of the presence of each probiotic in the fermentation juice was carried out by qPCR on samples taken 12, 24 and 48 hours after the start of fermentation. . The sequences of the forward primers and the antisense primers used to measure the relative abundance of the probiotics by RT-qPCR are indicated in Table 2 below.

Table 2.- Sequences of forward (F) and antisense (R) primers for measuring the relative abundance of probiotics by qPCR. ee a Bifidobacterium CCCTIT CCA CGG GTC CC Veiga et col animalis lactis IOR | AAG GGA AAC CGT GTC TCC AC (2010) GCATGGAGGAAAAAG-GAA Bacillus coagulans Hidaka et al. IOR CCCGGCAACAGAGITITA (2010) Bifidobacterium TTG CIT GCG GGT GAG AGT Mathys and thermophilum IOR CGC CAA CAA GCT GAT AGG AC | collar. (2008) Clostridium ATGGGTTAGGCAAGCAGAAA Cremones et butyricum LR GCTGGATCTGCCTTCTCATC col. (2012) Enterococus GAA ACG ACG GTG TCA TCA Loquasto and faecium LR; TCC ATT TTG TCG TTA TCT G col. (2013)

TGG ATC ACC TCC TTT CTA AGG Lactobacillus F AAT Haarman and plantarum OR | TGTTCT CGG TTT CAT TAT GAA col. (2005)

AAA ATA Bifidobacterium TGACCGACGAGATCACCTAT This crudilactis (rpoB) IOR | ACCATCTGACGTGGAGAGA invention Bifidobacterium CCATCGAGCTTCGTCCTTT This crudilactis (rpIB) IOR | GCCTTACCGAGCTGAAGATT invention Bibliographic references in Table 2: Veiga, P. et al. 2010. Proceedings of the National Academy of Sciences of The United States of America 2010, 107: 1813237, https://doi.org/10.1073/pnas.101 1737107.

Hidaka T. et al. Water Research 2010, 44, 2554-62, https://doi.org/10.1016/j.watres.2010.01.007.

Mathys S. et al. BMC Microbiology 2008, 8, 179, https://doi.org/10.1186/1471-2180-8-179. Cremonesi P. et al. Journal of Dairy Research 2012, 79,318-23, https://doi.org/10.1017/S002202991200026X.

Loquasto J.R. et al. Applied and Environmental Microbiology 2013, 79, 6903-10, https://doi.org/10.1128/AEM.01777-13. Haarman M. et al. Applied and Environmental Microbiology 2005, 71, 2318-24, hitps://doi.0rg/10.1128/AEM.71.5.2318.

Determination of the immune response caused by incubation of the fermentation juice obtained during an in vitro static fermentation model test in the presence of different symbiotic compositions.

In the context of the present invention, the IPEC-J2 line (intestinal enterocytes isolated from the jejunum of a newly born and non-breastfed piglet (or fed with a milk formulation) and belonging to a cell line neither transformed nor tumorigenic) was incubated in the fermentation juice produced by the symbiotic combination to be tested or containing only the prebiotic in question for 24 hours. Following this incubation period, the immune response is evaluated by the production of induced cytokines (IL-8, IL-6, IL-1b) and TNF-alpha. Previously, the cytotoxicity of the fermentation juices on the IPEC-J2 cells was evaluated because in order to be able to observe an immune response, it is important that the cell line remains viable. For each combination selected, the effect of the different concentrations of fermentation juice, previously filtered at 0.8 um, on the viability of the IPEC-J2 cells was measured by the MTT test (MTT tetrazolium salt: 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium), which is a colorimetric test for counting viable cells. The contact of the IPEC-J2 cells was then carried out with an inoculation rate of the fermentation juice of 0.8% (V/V).

Measurement of the concentration of IL-8: In the context of the present invention, the concentration of IL-8 was measured thanks to in vitro tests on IPEC-J2 cells in the presence of the fermentation juice (containing or not the symbiotic composition to be tested) (see Figure 2). To carry out the test, a test was carried out comparing the concentrations of IL-8 (the other markers IL-6, IL-1 and TNF-alpha were not detected) produced in the presence of the fermentation juice under different conditions : control-mucin (horizontal line in Figure 2), prebiotics alone (GOS/FOS (GF), 2FL, Inulin (Inu), resistant starch (RS) and B-glucan (BG) conditions), and symbiotic (other conditions in Figure 2). This test indicates that if the level of IL-8 is lower in the presence of the fermentation juice containing the prebiotic or symbiotic composition compared to the control fermentation juice-mucin, this shows an anti-inflammatory effect of the presence of the pre- or symbiotic . In addition, if the level of IL-8 is lower in the presence of the fermentation juice containing the symbiotic composition compared to the fermentation juice containing only the prebiotic, this shows that the specific combination of said at least one probiotic with said at least one prebiotic has an additional anti-inflammatory effect compared to the prebiotic alone. The cell viability of the synbiotics (results of the MTT test) was taken into account to adjust the concentrations of IL-8. The level of expression of IL-8 is determined by ELISA (Porcine IL-8/CXCL8 DuoSet ELISA kit DY535: R&D Systems).

BabySPIME model: The BabySPIME model is a scientifically validated model (Dufourny S. et al. Journal of Microbiological Methods, 2019, 167: 105735. https://doi.org/10.1016/j.mimet.2019) which simulates the dynamics and the physiological conditions of a complete gastrointestinal tract in piglets in an in vitro environment (equipment derived from the model

SHIME from ProDigest Bvba, Gent, Belgium). The model includes 2 x 3 reactors that sequentially simulate the stomach (acid condition and pepsin digestion), Viléon (enzymatic digestion process) and the proximal colon (microbiota fermentation process) (see Figure 1). This system makes it possible to obtain complex and stable microbial communities whose function and structure are highly similar to the microbial communities found in the different regions of the intestine.

Peristaltic pumps allow the transfer of culture medium, pancreatic juice, bile, acid (0.5M HCl), base (0.5M NaOH) and fermentation liquids from one reactor to another during a complete cycle. In practice, reactor 1 simulates the functions of the stomach, duodenum and jejunum, reactor 2 simulates the functions of the ileum, reactor 3 simulates the functions of the proximal colon.

A complete trial in the babySPIME system lasts 3 weeks: 2 weeks of stabilization of the microbiota simulates the lactation phase followed by a week of treatment with the symbiotic composition. A solution of 108 CFU/ml was prepared to inoculate a final dose of 107 CFU/ml of intestinal contents. The dose of prebiotic is 2g of prebiotic/day to reach a concentration of 1% of the diet.

The faeces of 6 suckling 27-day-old piglets that had not undergone antibiotic treatment were used to prepare the inoculum for the study. Faeces were collected directly from piglets and kept on ice under anaerobic conditions. For each trial, the inoculum was prepared and homogenized for 10 minutes by adding the faeces of each piglet to an anaerobic phosphate buffer solution. After macroscopic filtration to eliminate the particles still in suspension, the filtrate was injected simultaneously into reactors 2 and 3. Before inoculation, these two reactors were filled with a non-acidified culture medium and the pH was automatically adjusted in each reactor so as to best simulate the physiological conditions.

The culture medium was prepared and validated beforehand. Bottles of medium were stored at 4°C and the pH was adjusted to 3.0 before use in the first reactor. A solution mimicking pancreatic juice containing sodium bicarbonate (2.5 g/L, VWR Chemicals, Radnol, Pennsylvania, USA), pancreatin (0.99/L, ProDigest) and Oxgall (4.0 g/L) was added to the medium .

The feeding cycle is scheduled 3 times per day based on a total retention time of 14h. During each cycle, the culture medium, maintained at 4° C., passes through reactor 1 for 1 hour 30 minutes. Then pancreatic juice/oxgall (60mI), also maintained at 4°C, was added to the same reactor for 1h. After this time, and simultaneously, the contents of reactors 1, 2 and 3 were transferred respectively to reactors 2, 3 and to a biological waste container.

The anaerobic conditions of all the reactors are maintained thanks to a flow of nitrogen (N2) once a day for 10 minutes at the level of the reactors. The contents of the reactors are stirred continuously (300 rpm) and maintained at 39.5°C. The pH of reactors 2 and 3 is continuously monitored in order to stabilize the pH of the ileum and the proximal colon.

Samples were collected in the babySPIME system during the stabilization phase, before the treatment with the symbiotic formulations and at the end of the treatment with the symbiotic.

For each trial in the babySPIME system, the analysis of changes in the intestinal microbiota was carried out by qPCR on samples taken at the end of the stabilization phase and at the end of one week of treatment with a symbiotic composition. The sequences of the sense primers and of the antisense primers used to measure by qPCR the expression of the target genes corresponding to the bacterial populations beneficial for the microbial community of the intestine are indicated in Table 1 mentioned above.

Three repetitions on the SHIME model were carried out for each of the symbiotic combinations.

Examples.- Example 1: The fermentation capacity of the symbiotic composition by modeling the production of gas and the production of lactate and SCFA in an in vitro static fermentation model The fermentation curves of the pre- or symbiotics are shown in the Figure 3. Under all conditions in Figure 3, there is an increase in fermentation capacity measured by the increase in gas production. Under all the conditions of FIG. 3, this gas production is greater in the presence of a symbiotic composition compared with the presence of the prebiotic alone.

The parameters resulting from the modeling of the production of goz during the static fermentation of the symbiotics are compared with the parameters of the prebiotics alone (Table 3).

Bones [SP | are NT | am | you | zm | max Pr | IN | EN TND > EE 12/19 2 SG al RING G GO [ER |E | DISS CS DD |G | ps, | CS = [3] (S[X[X[R) ass sa (81281 (AJ 00 © olglea|/s) |109/0/5 SS SS 2159/16/90 = | VIV [VIV 717

GR == 3 n= a LA |P PO | Dn SA | WE | pen | € n/a | : Fu ü 3 — 5 ABA RSS Sa SS = Er = Klei (60/60/60 lere] ||| | eee ||| ||| 7/0 = = JIA DO GO SSSR [Sil [ES OO TND SIP 2 E [za FASO (SE SSS1E1TS [EEE (É ESS Ÿ Els en ||| ES C = > u 2 aa | <tr] |D = = = oe a SF NS me OS | LOS m | | Hs |t | CA 5 = 3 |In JS] (SN | OS SS INS LO D = MINE] TEA 15 SE AIG Ef alé c|'o1Gd|S| |19/9/0 Do SS oo © x 2 = q du 5 allelen allen als Gun] L 2 E pi A ee EE EN — Z & © © |OJs|HSOJS|=- en |] ale OST | ed fe = à 0 DIT Tal RST AS (On (ASS A = À 1815 Ss | [SE [ 0 [IM SE SA TE [= S œ EISIN [gls] | ||] ea SS & © SIE (BISSL (SES SS SES DS CO 5 = = - Tolles] === me es fes Nas © © mm NZ [SE ] ISIS 6 | rer 218 || 6 | ER = 5 5 Dias (DE SO Ss DIÄT ps | |slAls/|sl| esse (88 (58 AR = 0 > 5 21919 ei Oo S|1S15|9 co + 2 CC = © to ellela ele [el © DIN RS TG SC CSS SG [SS] [||| ë € 5 Us (glglol|slg|sl|s/slg|/s\s|e See 19/9/1510; ; U < a © ; I ea ea EEE als = €, DD [m | Ps [ON] PS I DE | A || Ps | PS | | m [m DM] L "5 U N pus | a | a | m | | a | | A | | E | not | ps | es es | ess | | set ES || | CN ren Ten are [a en | in AIR ie © Ss 5 le) 82585 8858| 88 BE 885g 0 5 | 15 \(S[58/8 8528 sa (98 388° v ËL = there S|S|G|S| (9 3 16 o/g ö|el N 2 5 © FIV VIV Oo Dz 5 on aloe ale ala le 5506 cg © © 18 IS SEES (NE RSS S NR A Ù = E [He |S|6oJ0|6/606/0/S/0/0|SJ= ||| |||] cs ù DÛ 2 IEEE OST L © + | Zl Ins] TE SN TE TRE ESS ES |= 0 D le (ST (01510 ||| [us || | || INT [|| | D += m co | m | rr | rr # 2 eu 55=—5 Re FT = 15 =|5= 2 to 2 Dn D a SR || PO fe © | S|IS/9|S = >> 10 5 [is | 65 | 60 SIDE De © PS a IS à € + (PF D/s ee [A| UE 1818 Cm DSG n © € sElé BSG 5 oo Sa SS olgers = a Ÿ 128 U 8 # 153 ; = he N ) = A [er = en SR = SE 5 2 = 180097 NSS SE Ze ZINN Sn WISS = A Lu 5 + m.m | | CN _ — | Co dd | = | = Lt ts == = QC de ol PF |L X em | DO | CH | 60 | On | 0 || es | 50 | SP [A=} | NO | Pe 9 SZ = ELISA ST GS SE SA JS SG [Aa (ANS [SR 5 5 © 5888 EFÉSEFHEZEESE SNS KRISE 1 N a em m | Ha He Ps: 2 Se dz FÉO [TS (SA |||] [SN TS [|| [es X 5 € X a 4 © E 2 > > _ dc D 3 g 2 X, Ce = E _ “ vo T 3 5 CO SS 6 = EE MD , blu lis & aD (7 > 2 © 19151818 Ne 12 RO SIE 2 € Se OT DOSE ED [a| not ; N c & 3 OK ae 30a 05 ZED 7 4 A | Re | 7 | LS | hl er = br | 55 SE © u. b 2 DS |5/0/60/&|6/5/5/E|53/5/€ [Om ae

Gas production kinetics and model parameters include: A: maximum gas production; B: the time to have 50% of the maximum gas production; C: the slope; D: the maximum rate of gas production (Rmax); the time at Rmax (Tmax). The static fermentation of the symbiotic combinations was carried out at 10E7 CFU/ml of probiotic and 0.1 g of prebiotic (same quantity of prebiotic used in the condition where the prebiotic is alone) in the presence of 3% of a faeces inoculate. The results indicate the mean +/- standard deviation of 3 experimental replicates. The p-values were obtained by a one-way ANOVA statistical analysis with a Dunnett type multiple comparison test. Statistical significance is considered when p < 0.05.

The SCFAs in the fermentation juice after 24 h of fermentation are shown in Table 4. There was no delactate production after 24 h of fermentation.

ç T a |g POP TE = ce a le > | a mee > 0 > IS 5 ES pm = Ex s|s|es Bottom: mey = x © 5 —|5 © — | © SS Ver of == TS = | © len | = Ss NE EE = = 5 a = | 8 = 238 S RE al ee BE2020 = : “the > =| AE pers DZ 8 S SE © Alle So Se PORTES /5828 Af “x <} pe DISS sr OR “te il y DB . u has the + = Sy = SISI vo; us el u ey en = Sa es e= = & EN a 2 LJ 2 [2 es DIS Jes) «> & 1e =} 58 &|S - Æ De = LS re a | SS Be © Alm — ca Ss DS © « 5 = 5 ERE SIE 8 215 SS D + Lei 5 6 | ca pa Cu] er a ij ch wl Een) = a] | x m es = S 21st min = read | X | © To, = | ele 5 = % je] se 16 m = ISIS “Is — LB “Ja 0 = 3 IT on u D es ad Ch E © Ù > = 18 SG) = 19 u De ij ! 5 Deal f en u D © à 5 ce ca Le le y #2 [3 | |3 #25 5 SE € ES © == = ISIS “| 18/88 + > 133 ol U L a 8 S SIS Caès olen mal ol Ÿ + co E EE SI | S/S] > ess | Ch 3 = E z 5 So Ÿ 2 | = en isles ch D © Re ti & Se SS = = ç >> oi mi O + a nd 1|— = vn ns ws Fa = 3 12th wo 7 al als 3 8° & 8888 SS SS 5th LJ S REESE ES | Een DR = € dirty? SIE] ® | Ss oo € ti mo | € ea Ps d wa cd Da i 5 A Jo ed | cs | 05 DD = En, te we à = U SEHE = SHE ju Do | TL N u er OS = e= dou EN en SI 513 Ca] Ss 2 319 ASS 5 | e= SS From S SIE = " 5 0 = 15 "pe | + 21 & op Æ == le ö Os es SS XS - © a Va ASS LS © Sl € ASS Go = = les Fe : co se SI “0 5 = 5 5|e|s|s _ S/A. = SSS js 5 5 Sa 5 18/8182 58 5 1218 x Js S SS zZ ze - IT: © A LE 2 + D S i D 3 = = me [em cles 5 5 > = = sm Eu D 4 Ss = Oo _ e À © 7 AR 3 ea SC en =| 2 we 2 a 5 8 SS SISIS 2 => 5 Mo me U = 5 = e v SS lm 7 > SS CH € == ei 07 <a a io} { ml S mo 7 Se ele = =| IN Di = cé D 2 Ps ee va 55 „| SS € o = © = 181, N Y = | | 5 = 21316 |E | wije) Se‚2 | Ja ESSEN: S/S ls DE S| © LA oo SIT ox Je Sl a Ss no > = = ni |t | ej es & 15 = © Lan) == > D “tf wle cz es ons CR | a ms B] in =| © IE DI 15 <=. pee em Ss | ee De LA es >= = Or wle ca op > vale ce 505 = SS CSSS SS 5 SS; = 5 aa Al cri (| Ô oO >= e= 2 ih CO & 5 19 SS SE ca ci “es 8 EL uE = cr | Ald) S Les | er se = A © 5 La ti > a LA | zn Sla | + AEN 5 th | so Ta DE ca |“ © SBS |: == m © = S 88/85 a 9 zò 2 [XS 5| [SII X 8 S/S 5 || SS ESE 2/8 SNE 3 RS a 316 # & = | à $ So SI LA ca > pe © |In : 5 0 = Ds 0 |= es D Le 152 = + Da I [ab] = 2 = | … 8 122 =) & on [ar s|5|S SIN - = 152 © 2 ca 8 & = | EIS = > = SS | 1 | c5 & © > a © The) Of SEE == A the AND 1 = 5 5 | © 5 olens ci = = © Lj Ç on € = D pe ISI “Ig = © = ce 3 8 ': £ |= 2 1€ ZE SS us = AS SSS == 5 © = E zl © € EE dje 4 SS SS 855 = à $ G Ze) SS Dal = 15 Al E S/S 5/8 = D > > eo se 8 FE m | © CN Eh © Oo > to #! in mm a] where | Fn KISS Ie & DIS TIR D Ald c SES law 17 co os cs 7; = a A 5 Lt) y ip SS Pa to ca 12 5 Ps es = “a TY A & = |4 © IS IS js ce Is © 3 = 18 ps os es EL © 6 Du = 19/2 5 18 = SS S = x & = = N Al + 5 es | + e d ve „En a es a ei D ps A D = CHA Ps D | = Re 6A | À _ 510 q Ÿ = + A les co da zp | == + © 5 y >E u Im wi OS x | = in A| EE æ = Gi = N 3 oe re lei |E ps | es a = ea |= 3 N AS © |S ÿ| © SEQIS EIL [8 sel as SIS os | AS Ca a | HD has | & SS © 1st | NE ES AS A + 3 N = 13/5 DISS ne SS Ss AN |A >| % lez 51519 mln | © p 4 to © ale 5 | EN > al us Ma = Lu = 3 Dn the zr where tra ele N m | ee 22 5] a | Se X | Dsfen) = | SIE LS U: A Pos Pr | Om ep | es a es co SM Os CO © = Ss Si: = le EE ey 3 Ss & IE Se IE 5e. he SS SIE SE Ss to ml © SS 5 ÿ | ; ; | Eil ej “é X 2 ea SIE 43; © U JG SS = 5 Ds Se fs EN | From iO N || 5 la in MS = Ne 5 G gE an = 5 | Ss > |e = 180 = © LE: a ci 5 2 | EL _g wing cd Ie Ge = = Lu OR 36/9 SS] IE El A) $ SS x Je G È A a (D te eh CH EN Da EN! cle + BN = en + ea | ka Mar als ® 2 & BIS = Lu Li. = x Aa Cs "7 LÉ) OÖ. #20 #73 = USE ae 211 En FF lS & pas | a |A = DA EIN La] ‚ N us | a = ES > Ge | ks € ES 28 >| 3 9 © ò K|Ö | © GI © ° 292880 | a ET au, D ar | Aid EE

The static fermentation of the symbiotic combinations was carried out at 10E7 CFU/ml of probiotic and 0.1 g of prebiotic (same quantity of prebiotic used in the condition where the prebiotic is alone) in the presence of 3% of a faeces inoculate.

Results indicate the mean +/- standard deviation of 3 experimental replicates.

The p-values were obtained by a one-way ANOVA statistical analysis with a Dunnett type multiple comparison test.

When p <005:*;p< 0.01:**;p<0.001: *** > p < 0.0007: ****, Example 2: Determination of changes in microbiota by gPCR during an assay in in vitro static fermentation model in the presence of different symbiotic compositions The relative abundance of beneficial bacteria after 24 hours of fermentation are presented in Figure 4. The delta-delta CT method was used to express the target bacteria compared to the bacteria total.

The results of the synbiotics are compared with the prebiotics alone.

As shown in Figure 4, several symbiotic compositions, such as BT-GF, CB-GF, BCO-GF, BCU-2FL, BMO-2FL, BAL-2FL, BAL-Inu, BT-Inu, CB-RS, BCU -RS, BAL-BG, LP-BG, or BCU-BG, make it possible to significantly increase the relative abundance of beneficial bacteria at 24 hours of fermentation.

Example 3: Determination of the ability of probiotics to survive and establish themselves during fermentation Figure 5 shows the presence of probiotics in the fermentation juice after 12, 24 and 48 hours of fermentation.

Symbiotic compositions, such as BT-Inu, allow good establishment and survivability of the probiotic.

Example 4: Determination of the immunomodulatory effect of the symbiotic composition by quantification of the production of IL-8 and NO by IPEC-J2 cells.

IL-8 production in IPEC-J2 cells was measured by ELISA.

After 24 h of incubation, the immune response was evaluated by measuring the production of IL-8 in the cell culture medium. The IPEC-J2 cells were incubated with 0.8% (V/V) of fermentation juice previously sterilized by filtration. Moreover, the survival rate of IPEC-J2 cells is greater than or equal to 70% in all the tested conditions of fermentation juice.

To determine the impact of the symbiotic composition contained in the fermentation juice on the production of IL-8, the production rate of IL-8 was measured in a control condition where the fermentation juice contains an inoculate of faeces , of lo mucin (control-mucin), but in the absence of problotics, prebiotics or symbiotics. In this controlled condition, a basal level of IL-8 expression is 932 pg/ml! (represented by the horizontal line in Figure 2}. The pre- and synbiotics were compared against the control-mucin. In addition the synbiotics were compared against the prebiotic to estimate the additional probiotic effect. Table 5 shows the p-values of these comparisons, and Figure 2 shows the concentrations of IL8.

Table 5.- Production of IL-8 by the IPEC-J2 cells in the supernatant after 24 hours of incubation with 0.8% of fermentation juice previously sterilized by filtration produced by the symbiotic composition or the prebiotic alone.

IL-8 (pg/ml) mean | ET (vs (vs white- prebiotic) mucin) GOS/FOS (GF) 10940 | 40.5 | | 0042 BCO-GF 897.3 0.0041 0.9207 BT-GF 1089.4 0.9999 0.0497 CB-GF 849.5 0.0006 0.3954 EF-GF 927.5 0.0138 0.9997 10412 |526| | 02193 BAL-2FL 581.3 <0.0001 <0.0001 BCU-2FL 570.8 <0.0001 <0.0001 BMO-2FL 715.1 <0.0001 0.0037 INULIN (Inu) 11164 | 409 | | 0028 BAL-Inu 1177.7 112.6 0.4075 0.004 1025.9 0.1816 0.3398 Resistant starch (RS) | 753.3 | 509| | 0.0086 BCU-RS 1150.3 <0.0001 0.003 CB-RS 1195.6 <0.0001 0.0007 B-GLUCANE 8317 |405| | 01916 BAL-BG 393.6 <0.0001 <0.0001 BCU-BG 413.2 <0.0001 <0.0001 EF-BG 1128.9 <0.0001 0.0066 LP-BG 775.7 106, 0 0.5405 0.0232 9371 [nos] | Values are corrected for cell viability. The results are means with their standard deviations. The comparisons are made between the symbiotic compositions and the prebiotic alone. The statistical significances are analyzed by a one-way ANOVA with a Dunnett type multiple comparison test.

When p<0.05: *; p<0.01: **; p<0.001: ***; p<0.0001: ****,

Example 5: Determination of the modifications of the microbiota by qPCR during a test in the baby SPIME model in the presence of different symbiotic compositions.

The overall results obtained on the baby SPIME system are presented in Figure 6 and Table 6.

Table 6.- Summary of the up-regulation or down-regulation of bacterial groups of interest following symbiotic treatment in the SHIME system after one week of treatment with the different symbiotics.

Lactobacillus test | bifidobacterium | cluster | Cluster XIV | Acetyl Wilcoxon IV CoA Control Decreasing Trending Stable Stable Stable SHIME p<0.01 decreasing 0.05<p<0.1 EF + BG Stable Decreasing trend Stable Increasing decreasing p= p<0.05 0.05< p<0.1 0.01 BT + INU Stable Trend towards | Increase Decrease Stable increase p<0.05 (p = 0.05) 0.05<p<0.1 CB + Decrease Stable Stable Stable Increase GOS/FOS p<0.01 p<0.01 BAL + 2FL Decrease Increase Stable Stable Stable p<0.01 p<0.05 BCU + BG Decrease Trend | Rise | Trend | Stable p<0.01 increase p<0.05 | downwards 0.05<p<0.1 0.05<p<0.1 We find either a decrease in the bacterial population, an increase in the bacterial population or a stabilization of the bacterial population. The statistical test performed is a Wilcoxon test.

Example 6: Symbiotic composition C1 comprising at least Clostridium butyricum and at least GOS/FOS against intestinal dysbiosis.

Composition C1 was prepared by adding 1E07 CFU/ml Clostridium butyricum and 0.1 g GOS/FOS.

More particularly, at the level of the prebiotic, 0.19 of GOS/FOS was added in each fermentation bottle containing 15ml of fermentation juice.

For the GOS/FOS mixture, the prebiotic consists of a homogeneous liquid solution of 80% (w/w) GOS and 20% (w/w) FOS.

At the level of the probiotic, a freeze-dried powder of bacteria was pre-mixed in a buffer solution at a concentration of 1.5E08 CFU/ml (stock solution). Before being added to the fermentation flask, the pre-mixed probiotic solution underwent a revivification process consisting of a 30 min incubation at 37°C with shaking.

Then 1ml of the pre-mixed solution (stock solution) was added to the vial leading to a final probiotic concentration of 1E07 CFU/ml in the vial.

The symbiotic composition comprising at least Clostridium butyricum and at least GOS/FOS against intestinal dysbiosis showed a favorable effect on fermentation, by increasing the A value (maximum gas production) compared to the prebiotic alone (see CB-GoF condition of the Table 3, and by increasing the concentrations of total SCFAs and butyrate after 24 hours of static fermentation in vitro (see CB-GoF condition of Table 4) In addition, the relative abundance of Bifidobacteria and Lactobacill increased in comparison with the prebiotic alone (see CB-GF condition in Figure 4) The probiotic Clostridium butyricum was still present in the fermentation juice after 48 hours of fermentation.

An anti-inflammatory effect is shown in vitro on IPEC-J2 cells generating a decrease in IL-8 production compared to GOS/FOS alone, while the concentration of IL-8 was not different compared to to control-mucin (see CB-GF condition of Figure 2). Moreover, the Cl symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations involved in the metabolic pathways of butyrate production.

The increase in these bacterial populations was analyzed by qPCR (see condition CB+G/F of FIG. 6 and Table 6 presented above). The sequences of the sense primers and the antisense primers used to measure by qPCR the relative abundance of the bacterial populations beneficial to the microbial community of the intestine are indicated in Table 1. Example 7: Symbiotic composition C2 comprising at least Bifidobacterium thermophilum and at least less inulin against intestinal dysbiosis.

Composition C2 was prepared by adding 1E07 CFU/ml of Bifidobacterium thermophilum and 0.1 g of inulin.

More specifically, at the prebiotic level, 0.1g of inulin was added to each fermentation bottle containing 15ml of fermentation juice.

At the level of the probiotic Bifidobacterium thermophilum, a freeze-dried powder of bacteria was pre-mixed in a buffer solution at a concentration of 1.5E08 CFU/ml (stock solution). Before being added to the fermentation flask, the pre-mixed probiotic solution underwent a revivification process consisting of a 30 min incubation at 37°C with shaking.

Then 1ml of the pre-mixed solution (stock solution) was added to the vial leading to a final probiotic concentration of 1E07 CFU/ml in the vial.

The C2 symbiotic composition comprising Bifidobacterium thermophilum (BT) and inulin (Inu) against intestinal dysbiosis showed a beneficial effect on fermentation, demonstrated by an increase in A value (maximal gas production), a decrease in B value (the time to reach 50% of maximum gas production), an increase in fermentation rate (Rmax), and a decrease in time to reach the maximum amount of gas produced (Tmax) compared to inulin alone (see BT-Inu condition in Table 3). In addition, an increase in the concentration of butyrate and the relative abundance of bifidobacteria in the fermentation juice after 24 hours is demonstrated (see BT-Inu condition in Figure 4), Bifidobacterium thermophilum was indeed present until the end of the fermentation. An in vitro anti-inflammatory effect on IPEC-J2 cells generating a decrease in IL-8 production compared to inulin alone (no difference between the synbiotic and the control-mucin) according to the protocol described at l Example 1 (see BT-Inu condition in Figure 2).

In addition, the C2 symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations involved in the metabolic pathways of butyrate production and showing a tendency towards the increase of bifidobacteria. The increase in these bacterial populations was measured by qPCR (see BT + INU condition of Figure 6 and Table 6). The sequences of forward primers and reverse primers used to measure by qPCR the relative abundance of beneficial bacterial populations for the gut microbial community are shown in Table 1.

Example 8: C3 symbiotic composition comprising at least Bifidobacterium animalis lactis and at least 2'FL against intestinal dysbiosis.

Composition C3 was prepared by adding 1E07 CFU/ml of Bifidobacterium animalis lactis and 0.1 g of 2'FL.

More specifically, at the level of the prebiotic, 0.1g of 2'FL was added to each fermentation flask containing 15ml of fermentation juice.

At the level of the probiotic Bifidobacterium animalis lactis, a freeze-dried powder of bacteria was pre-mixed in a buffer solution at a concentration of 1.5E08 CFU/ml (stock solution). Before being added to the fermentation flask, the pre-mixed probiotic solution underwent a revivification process consisting of a 30 min incubation at 37°C with shaking.

Then 1ml of the pre-mixed solution (stock solution) was added to the vial leading to a final probiotic concentration of 1E07 CFU/ml in the vial.

The C3 symbiotic composition against intestinal dysbiosis showed a beneficial effect on fermentation, demonstrated by an increase in the A value (maximum gas production), a decrease in the B value (the time to reach 50% of the maximum production of gas), an increase in the fermentation rate (Rmax), and a decrease in the time to reach the maximum quantity of gas produced (Tmax) compared to 2'FL alone (see Bal-2FL condition of Table 3). In addition, an increase in the butyrate concentration (see BAL-2FL condition in Table 4) and the relative abundance of Clostridium clusters IV in the fermentation juice after 24 hours is demonstrated (see BAL-2FL condition in Figure 4), Bifidobacterium animalis lactis was present until the end of fermentation.

An anti-inflammatory effect in vitro on IPEC-J2 cells generating a decrease in the production of IL-8 (see BAL-2FL condition in Figure 2) compared to 2'FL alone and compared to the control-mucin according to the protocol of example 1. In addition, the C3 symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations of bifidobacteria. The increase in these bacterial populations was measured by qPCR (see BAL + 2FL condition of Figure 6 and Table 6). The sequences of forward primers and reverse primers used to measure by qPCR the relative abundance of beneficial bacterial populations for the gut microbial community are shown in Table 1.

Example 9: CA symbiotic composition comprising Bifidobacterium crudilactis and beta-glucan against intestinal dysbiosis.

Composition C4 was prepared by adding 1E07 CFU/ml of Bifidobacterium crudilactis and 0.1 g of beta-glucan.

More specifically, at the level of the prebiotic, 0.1g of beta-glucan was added to each fermentation bottle containing 15ml of fermentation juice. With regard to the probiotic Bifidobacterium animalis lactis, a freeze-dried powder of bacteria was pre-mixed in a buffer solution at a concentration of 1.5E08 CFU/ml (stock solution). Before being added to the fermentation flask, the pre-mixed probiotic solution underwent a revivification process consisting of a 30 min incubation at 37°C with shaking. Then 1ml of the pre-mixed solution (stock solution) was added to the vial leading to a final probiotic concentration of 1E07 CFU/ml in the vial.

The C4 symbiotic composition comprising Bifidobacterium crudilactis and beta-glucan against intestinal dysbiosis showed a beneficial effect on fermentation, demonstrated by an increase in the A value (maximum gas production) and an increase in the fermentation rate (Rmax) compared to beta-glucan alone (see BCU-BG condition in Table 3). In addition, after 24 hours of fermentation, an increase in the concentration of total SCFAs and butyrate (see BCU-BG condition of Table 4) and the relative abundance of Clostridium clusters XIVa in the fermentation juice is demonstrated (see BCU-BG condition). BG of Figure 4). An anti-inflammatory effect is demonstrated in vitro on IPEC-J2 cells generating a decrease in the production of IL-8 compared to beta-glucan alone and compared to the control-mucin according to the protocol described in example 1 ( see BCU-BG condition of Figure 2).

In addition, the CA symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations involved in the metabolic pathways of butyrate production and showing a tendency towards the increase of bifidolbacteria. The increase in these bacterial populations was measured by qPCR (see BC + BG condition of Figure 6 and Table 6). The sequences of forward primers and reverse primers used to measure by qPCR the relative abundance of beneficial bacterial populations for the gut microbial community are shown in Table 1.

Example 10: C5 symbiotic composition comprising Enterococcus faecium and beta-glucan against intestinal dysbiosis.

The C5 symbiotic composition against intestinal dysbiosis showed a beneficial effect on fermentation, demonstrated by an increase in the A value (maximum gas production) and an increase in the rate of fermentation (Rmax) compared to beta-glucan alone ( see condition EF-BG in Table 3). In addition, after 24 hours of fermentation, an increase in the concentration of total SCFAs and butyrate in the fermentation juice is demonstrated (see EF-BG condition in Table 4).

Moreover, the C5 symbiotic composition shows an improvement of the microbiota in the SHIME model by increasing the bacterial populations involved in the metabolic pathways of butyrate production but not bifidobacteria. The increase in these bacterial populations was measured by qPCR (see EF + BG condition of Figure 6 and Table 6). The sequences of forward primers and reverse primers used to measure by qPCR the relative abundance of beneficial bacterial populations for the gut microbial community are shown in Table 1.

Example 11 Synbiotic composition SYN 3 comprising E. faecium, C. butyricum, beta-glucan and inulin against intestinal dysbiosis and doses administered in vivo to the sow before farrowing and after farrowing.

For probiotics, the amount administered is indicated in CFU/sow/day, while for prebiotics the amount administered is indicated in g/sow/day (see Table 7).

The in vivo administration of the symbiotic composition was carried out at 4 different stages of development: before farrowing, one week after farrowing, 2 weeks after farrowing and 3 weeks after farrowing.

Table 7.- SYN3 symbiotic composition comprising E. faecium, C. butyricum, beta-glucan and inulin and quantity of each probiotic and prebiotic administered per day at 4 stages of development. SYN3 E. faecium C. butyricum | Beta-glucan | Inulin G80-G107 EE lee Le le bas, MB) 1.60E+09 1.60E+09 1.60 9.60

MB: farrowing; G: day of gestation The 4 stages of development are G80-G107 (between 80 days and 107 days of gestation, before parturition), 1 week after parturition, 2 weeks after parturition and 3 weeks after parturition.

Example 12 Synbiotic composition SYN 4 comprising E. faecium, B. animalis lactis, B. crudilactis, beta-glucan and inulin against intestinal dysbiosis and doses administered in vivo to the sow before farrowing and after farrowing.

For probiotics, the amount administered is indicated in CFU/sow/day, while for prebiotics the amount administered is indicated in g/sow/day (see Table 8). The in vivo administration of the symbiotic composition was carried out at 4 different stages of development: G80-G107 (between 80 and 107 days of gestation, before parturition, MB), one week after parturition, 2 weeks after parturition and 3 weeks after farrowing.

Table 8.- SYNA symbiotic composition comprising E. faecium, B. animalis lactis, B. crudilactis, beta-glucan and inulin and quantity of each probiotic and prebiotic administered per day at 4 stages of development. | Probiotic Prebiotic E. B. animalis | Beta SYN4 faecium lactis B. crudilactis glucan Inulin (CFU/sow | (CFU/sow/jo (CFU/frvie/jo (g/sow/jo (a/frvie/] Esse G80-G107 (before Wr a rs ie fire Le he MB) 1.07E+09 1.07E+09 1.07E+09 1.60 9.60 MB: farrowing; G: day of gestation Example 13: Symbiotic composition against intestinal dysbiosis and doses administered in vivo at piglet In an in vivo test (first experiment), Symbiotic 1 is composed of Clostridium butyricum and GOS/FOS and Symbiotic 2 is composed of B. animalis lactis and 2'FL (see Tables 9 and 10 below). The quantities distributed to the piglets with an administration pistol are indicated in Table 9. In a controlled manner, the piglets ingested a determined quantity of symbiotic, which increased with age.

In another in vivo test (second experiment), the same symbiotics were tested. This time, the synbiotic is delivered to piglets through the feed gun at birth and day 4-5, and then in milk replacer and the likes 'creep feed'

(feed below the sow) distributed Only to piglets (not to sows). The amounts of the symbiotics distributed to the piglets are indicated in Table 10. It is understood that the present invention is in no way limited to the embodiments described above and that many modifications can be made thereto without departing from the scope of the appended claims.

i 5 5 ==== >| = a | & sl | &| 2 = SS 83 Zes EEE Is ES at 12 DIG d © | © | lass — — |G 2 D + iD au DD A L IS ut ee 6185| 2 Q D t FTP Ù D = = = Ox = = ü UO |t Ol U IS 5 aòl les S |8 UE ë 2 2 5 x Ss zz 8/5288 3| & 528 = 3 D = m7 oh = a Le) ee =| + xt + ’ Dj MW > N ex LL € 1213191151 05

U © s + 2; = | = £& >| = 5 | 312 <a Le) SD BS = D ë 5 S © 2 [vo a + Lo CN => ax == 2 ES == Jo ll 5 m 2 Pans = = es 1 = REES le Zu 2 957 #5 Zee © sd J - Im 1 = L + 5 SS ETET S i 288 = cs Ie G ä : cn — O = A Sa AIR D = + => = © D AH S a 2 to zl 8 5 sj to 28 m oO 5 — 2 © U LA LL 14 u _ OL pn 4th qd 3 N = = 2 5 381 68 5 5 5 “| ls 9 CL GB © 5 |e = £2 D 3 25 | Ù ] = vx is Ms Ss u w © or Pin, ms = ae = 5 5 5 à la ë [Too ld] 2 5 2 308 3885 E88030-5 ZUEEß = U 3 SE 8 256) 5 | 918 So = cn “1-2 5 SS) 8 =| 015 D 5 =) © = à & à Ad EN I Sl uw x à à = 2 ZIS 2 A — Ö a 2 =

LG > 3 = 5 ss A N x + = N = = As SIS 2 au oc 5 = = 5 5 315 =} us = das En oc 2 w = © ls EE de ES 5 D = _ = IR SIE Ee € ee 9 2 © = 1 612 ©) WJ OO FT |A = r DIE DO so — OP OS Dm D 14 D LJ SS | LL 2 2 - “| to 0 Do Old GI5 05 am D bd 5 _ 9 ee to 7 2/5 519 © & , > Ä G| | 515 QE es >== —= “Te 2 cs LL #5 ai +==. ST J 0 © a EG — GA Q © Ka N : = | = a 5 a] => es N | 3 id 2 Re a 2m SD] ec £ SS So 5 TT SS 8 ae HS a a SIA 585 © LD Elu L SEPT = € 11° = x Eos [eee | SE SF DC = 5 18-2028 5 929 292 5 dju DD a MD ‘ 5 = 5 “à = = U A 0 a = 5 DO à Gr © hm Ci IS] 5 SS 5 > © 2 > 7 Ee 4 >| = "EL Ee D LL LL o = = + = U oO D ® - Lel © Le] ee AD es \ = = © — x SON OF ana u œ D © © > Si o pu © nr = © © 5 < = 8 to 5 © y2 || EU SE = =” € y = 5 SE RE 712 TD |E a] u = Du SRE OR an = 5 U = Di © GT + 18 Sd © + d 2 DID] — | © 5 E à à pu = 2 = ©, = In Ö 2 AS SE|= a JE ov 2 5 ta 6 SS El gla |? 5 CL © .D A © Be IT I Es LA Sd RN id a |ER 2 à see A 10 co SC © © S | æ@ = 1È6 35 en US © © (2 SD God 7 | Ol |82 à a ea . + A À

© 2 = BE202 = D 0/5828 in À = d = #| 5 dr &, MID 8 | = 2 Ps As ds > al F9 212 D >| 3m 51 T = | © al alë | S S as =) L| 4 Ezi 5 3 = E ls) © | ® = ZIET = Q = = |] 2 © 5 1%1% 5 = | © & U D || = © her 6 5 | X y oO = SER als 58/82 5| #8 A DIS | = &| 5 8 SIS d 2/8 di GC | = = ON , 2 [A © Ô = ò 2 Bl = | $5 | S 2 A 5 © 0 = A + . © 5 © | Ta = bee We] D < SM di 4/8 = th LJ 2 a - a] not . A = en SS © <1 Ol” N 7 D D = N D bi > 5 AR _ + & Elo El = > SN SS ie à 5 | 2 = | 8 5 © 0195/19/15 = ä 2/2 5 = BV SE y qi on = RT = = 3 _ . = AIG 8 5 | S5 | L >| = = | 7 = HSM] SE 512215 S = | 2 to ES 0 | owing 8 01% | To 5 2 | D SS 8 Sl Woz © | © dln=in | CS D CC > OO ci ï Mh © A 2 OS sl Ë&| ES 8618 = | 8 to © © D 5 2555 5 5 3353 8 58/2 a | | ‘ =|3| 83 a SI AS = > Le a SN rad DIE ANG 5 © = — 51312 > SL 3 ojos = EI D | ® U + > 2 [in] 5 3 3.5 388 PS D: a; = = © ZE ISI: EE 3.5 | 3 © EEE. “Je 5 5 IH > SA QC à DI à aa == CD EN So 2 o ze ea Q = D s © A DD - Fr = = Si & Gls CS» 0 ES „© = vl & N a = Q ä Öl | OS ORG 2 Cr]=, A © Ie Sl 8 SIA 5 Sf £5115 à Ö£ sé 5185899138 8 = © ASIEN 5 _ à 5 = & © 5 3 x= 55 5 co 8 sel #8 3/8253 x 2 © ale © Silos = | 5 2 5 = | = = + 35/25 5 | 7 © | © = 31 B 3 5 #-to 8 58 2|2 5| 8 85 # * 4 Se To da > 5 9 = #2 35/2 2|8| 8 OR € = CR - im , 5 © ES S/I & à SI Eg 5 Ù) £ œ, =12/2/5 812313 8 =| 58 8 © 8 „5 $ 8838 5/2 3 D © = Ch Ss 8 © > co » oo € © = E 5 = «I _ Ln ae = _ = 2 = qu Oo Zä 5 E 2) # 2 _ D л |#| 8° NERE-E SI. + x 5 BK m5 El I/O ST D u 42 SO ID Sos S| (8) = Q { Sos SS“ SE Ee È S | € T LE ® ES | = 1 2 Tj © #8 [3/3 € A = © > U G & m Q 2 ES RS i = ul E| = x SE SIE N à Lui a GJ & & se] CA nù LJ EE ge N % U = LA Bu Eg 2 BE sf: Èe L2 2 fj oo |Z 2 oO.

GR; = GA | 0 SEA |15 NEO = LL.

D 9 Lu & SS AN a

Claims (15)

"Claims" 1. Symbiotic composition that can be administered to animals, in particular to mammals, in particular to pigs, in particular to pregnant animals and to newborns, in particular to pregnant sows or not and to piglets comprising at least one probiotic and at least one prebiotic for the treatment or prevention of dysbiosis, characterized in that said at least one probiotic and said at least one prebiotic are chosen such that they together generate an anti-inflammatory environment in the intestine of said animal , in particular mammals, in particular pigs, preferably pregnant animals and newborns, in particular pregnant sows or not and piglets. 2. Composition according to Claim 1, in which the said probiotic is chosen from the group of microorganisms comprising Bifidobacterium Tthermophilum, Enterococcus faecium, Bifidobacterium animalis lactis, Clostridium butyricum, Bifidobacterium crudilactis. 3. Composition according to Claim 1 or 2, in which the said prebiotic is chosen from the group comprising inulin, B-glucan, 2′ Fucosyllactose, GOS/FOS (galactoligosaccharide, fructoligosaccharide), resistant starch. 4. Composition according to [one of the preceding claims 1 to 3, characterized in that said at least one probiotic and said at least one prebiotic together generate an increase in the concentrations of endogenous bacterial populations favorable to the intestinal microbiota such as lactobacillus, and bifidobacteria . 5. Composition according to [one of the preceding claims 1 to 4, characterized in that said at least one probiotic and said at least one prebiotic together generate a reduction in the concentration of IL-8 of at least 10%, forming said environment anti-inflammatory. 6. Composition according to [one of the preceding claims 1 to 5, characterized in that said at least one probiotic and said at least one prebiotic together generate a stabilization or an increase in the secretion of short-chain fatty acids (SCFA's) by the intestinal microbiota, said SCFAs, produced during the fermentation process of the microbiota, are an indicator of the balance and growth of the microbiota. 7. Composition according to Claim 6, in which the said SCFAs are chosen from butyrate, propionate, acetate, lactate or combinations thereof. 8. Composition according to any one of the preceding claims, in which the said at least one probiotic and the said at least one prebiotic is chosen from the group consisting of Bifidobacterium thermophilum and inulin, Bifidobacterium crudilactis and beta-glucans, Bifidobacterium animalis lactis and 2'fucosyllactose, Clostridium butyricum and GOS/FOS, Enterococcus faecium and beta-glucans and their mixture. 9. Composition according to any one of the preceding claims, containing more than 1 probiotic, for example 2 probiotics, or for example 3 probiotics, or for example 4 probiotics or for example 5 probiotics. 10. Composition according to any one of the preceding claims, containing more than 1 prebiotic, for example 2 prebiotics, or for example 3 prebiotics, or for example 4 prebiotics. 11. Composition according to any one of the preceding claims, containing at least one conventional excipient, in liquid or solid form. 12. Food supplement for the preventive and / or curative treatment of dysbiosis, comprising said composition according to any one of claims 1 to 11. 13. Complete or complementary feed for farm animals comprising said composition according to any one of claims 1 to 11, said feed being in the form of flour and/or granules and/or milk feeds and/or any other forms of food conditioning. 14. Food for newborn animals comprising said composition according to any one of claims 1 to 11 and a milk base compatible with the diet of the newborn. 15. Use of a composition according to one of claims 1 to 11, for the preventive and / or curative treatment of dysbiosis, comprising at least one administration of said composition according to one of claims } to 11 in an amount of prebiotic comprised between 0.1 and 1000 g/day/animal, preferentially between 0.5 and 100 g/day/animal, advantageously between 1 and 25 g/day/animal, of a quantity of probiotic comprised between 1 .00E+05 and 1.00E+015 CFU/day/animal, preferably between 1.00E+06 and 1.00E+013 CFU/day/animal, advantageously between 1.00E+07 and 1.00E+011 CFU/day/animal and at least one administration of a daily food ration, said probiotic and said prebiotic of the composition according to one of Claims 1 to 11 being administered simultaneously, separately or staggered over time.