AU782109B2 - Repressible sterility of animals - Google Patents

Description

WO 01/48224 PCT/AU00/01596 REPRESSIBLE STERILITY OF ANIMALS Field of the Invention This application is concerned with the control of animal reproduction, and especially with preventing the spread of feral and/or genetically modified animals. In particular, the present invention relates to constructs and methods that allow animals to be bred in captivity, but renders them infertile in the wild, by allowing reversible control over fertility and reproduction.

Background of the Invention Feral animals are one of the world's major environmental problems. Goats, cats, rabbits and carp are only the more prominent of hundreds of species traded internationally for recreation or agriculture that have escaped into the wild and formed destructive populations.

Terrestrial, freshwater and marine ecosystems are all conspicuously degraded by these species, to the extent that public concern over feral animals has become a major issue for industries seeking to introduce new species in order to compete on world markets.

A good recent example is the Pacific oyster.

Despite the promise of new jobs in coastal communities and an industry that is worth $50-75 million annually, recent applications to expand the geographic area for Pacific oyster mariculture facilities in Australia and the United States have been rejected indefinitely until the problem of feral oysters can be overcome. Even plans to expand the size of the industry in areas where farming already occurs are being blocked for the same reason, following very public and often acrimonious debate between industry and conservation-minded elements of the community. Attempts to solve the problem using current techniques such as triploidy and sterile hybrids have not been successful.

Neither technique can guarantee a zero risk of producing feral populations, and both also suffer major technical WO 01/48224 PCT/AU00/01596 2 difficulties. In the case of oysters, for example, animals sterilised via chemical or genetic manipulation of ploidy do not produce significant amounts of roe, which substantially reduces their market value. Moreover, these animals still produce a small number of viable gametes. So the debate continues to focus on whether degraded beaches are an acceptable price for new industries and jobs.

Hundreds of species of exotic animals are shipped internationally each day, mainly for recreational purposes.

Inevitably, either accidentally and/or through intentional release, some animals will escape, and establish feral populations. Sterilisation prior to importation of such exotics would prevent the establishment of feral populations and remove the risk-of forming new problem pest species. A generic means of sterilisation that prevents development of these feral populations would have huge economic and environmental benefits.

More recently, the containment of genetically modified animals has caused concern. For example, Salmon containing genes for enhanced production of growth hormones' have been produced in Europe, New Zealand and North America. Concern has been expressed about the impact of these fish as "super-competitors", should they escape and form feral populations. Similar concerns have been expressed about other genetic improvements that deliberately or accidentally enhance competitiveness. This concern has now grown to a point where there is pressure to ban such modified organisms in toto. However, given their economic significance, it may be preferable to have effective biological controls in place which enable these organisms to be contained within a specific locality. A sterile feral construct inserted into the genetically enhanced stock would prevent development of viable feral populations, as well as preventing integration of enhanced genes into populations of wild con-specifics.

Accordingly, some of the major benefits that a sterile feral construct would offer include: WO 01/48224 PCT/AU00/01596 -3i. Provision of a fail-safe system for preventing the establishment of feral populations of exotic species.

This could fundamentally change the risk of importing these species, and would reduce public antagonism to farming of those that have the potential to be environmentally destructive.

2. Protection of investments in breeding stocks, for example those developed by extensive selective breeding programs. Currently, the commercial advantages from improved stock can be lost when .live, reproductively capable animals are marketed (eg oysters, prawns, and sheep). Repressible sterility can be used as a "lock and key" process whereby improved stock could only breed when provided the correct combination of repressers (and optionally inducers) in exactly the right sequence.

3. Production of animals for intentional release that are guaranteed to be sterile. Release of such sterile animals has been used as a control mechanism for certain highly fecund pest species, eg. insects. Repressible sterility technology makes it possible to apply similar approaches to other, existing pest species, for which there are currentlyno "sterile male" equivalents.

4. Provision of an effective containment mechanism Sfor genetically modified organisms. Repressible sterility provides just such a security system for future applications of molecular engineering in animal production, yet enables safe propagation of these individuals using conventional rearing facilities. Linking a genetically engineered process (faster growth, longer spawning seasons, etc.) to a repressible sterility construct ensures that genetic enhancements of exotic or native species do not enter wild populations.

One method of containing genetically-modified organisms, namely, plants, is the so-called "terminator gene" or Technology Protection System (TPS). This approach was developed by Delta and Pine Land Company who jointly owns the rights for this invention with USDA-ARS, WO 01/48224 PCT/AU00/01596 4 as disclosed in US patent number 5,723,765, which is incorporated herein by reference. Essentially, the method stops the seeds of certain plants from germinating, and utilizes: 1. A transiently-active promoter operably linked to a first (toxic, hence lethal).gene, but separated by a blocking sequence which prevents the lethal gene expression; 2. A second gene, encoding a recombinase which, upon expression, excises the blocker sequence; and 3. A third gene, encoding-a tetracyclinecontrollable blocker of the recombinase.

Unless the seeds of the plants are transformed with all three genes, and receive the tetracycline at a precise point, the recombinase is expressed, resulting in the blocker sequence being excised, and the toxic gene being expressed.

While this method may function well in plants, it would not function in many animal species. Few recombinases have been identified that will function in animals (and vertebrates in particular) and those that have been identified Cre and Flp recombinase) function in only a limited number of species. Moreover, the use of a toxic substance in animals may be unacceptable, particularly for those likely.to be consumed. Further, the system requires a number of complex steps, which are not readily achieved, and once the blocker sequence has been :excised it is virtually impossible to reverse the control process.

Accordingly, there is still a need to provide methods of preventing the escape of exotic and/or genetically modified animals.

We have now developed such a method. We have designed certain genetic constructs that allow animals to be bred in captivity, but render them reproductively nonviable or infertile in the wild. Moreover, these constructs provide reversible control over fertility and WO 01/48224 PCT/AU00/01596 5 reproduction, and are applicable to a wide variety of animal species.

Summary of the Invention In its most general aspect, the invention disclosed herein provides a nucleic acid construct which may be inserted into the genome of any target organism.

The construct can use any promoter/gene combinations, provided that they satisfy the criteria of being activated only during embryonic development and/or gametogenesis, and being crucial for completion of embryogenic development and/or gametogenesis.

One type of construct, which is designed to function in a variety of target species, comprises: a) a native-promoter of.a crucial gene; b) a blocking DNA sequence (blocker) contoured for and designed to abrogate the crucial gene's function or to cause its mis-expression; and c) a genetic switch to regulate controlled expression/repression of the blocker/gene knockout.

In captivity, expression of the blocker can be repressed in the presence of a trigger molecule, supplied via the diet or in soluble form, so that fertilisation occurs and embryos complete.development. In the wild, where the trigger molecule is unavailable, the blocker remains active and the critical gene is disrupted,.leading to early death of invasive progeny.

Accordingly, in a.first aspect, the present invention provides a construct.for disrupting gametogenesis or embryogenesis in.animals, comprising: a) a first nucleic acid molecule, which is activated in a defined spatio-temporal pattern, and which is operably linked to b) a second nucleic acid molecule, which encodes a transactivating protein; and c) a third nucleic acid molecule, which is operably linked to a fourth nucleic acid molecule, WO 01/48224 PCT/AU00/01596 6 wherein activation of said first nucleic acid molecule controls the expression of the second nucleic acid molecule, which in turn activates the third nucleic acid molecule, which effects the expression of the fourth nucleic acid molecule which encodes a blocker molecule which disrupts gametogenesis .or embryogenesis in the animal. Either or both the first and fourth nucleic acid molecules are transiently activated or transiently affect development in a defined spatio-temporal pattern.

Each of the first, second, third and fourth nucleic acids may be genomic DNA, cDNA, RNA, or a.hybrid molecule thereof. It will be clearly'understood that the term nucleic acid molecule encompasses a full-length molecule, or a biologically active fragment thereof.

.Preferably the first nucleic acid molecule is a DNA molecule encoding a promoter region. More preferably the promoter is activated only during embryonic development and/or gametogenesis, and is crucial for completion of embryogenic development and/or gametogenesis. Most preferably this DNA molecule has the nucleotide sequence shown in SEQ ID NO:1, SEQ. ID NO:8 SEQ ID NO:60. A sample of SEQ ID NO.1 DNA was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and :accorded the accession number MM99/09098. A sample of SEQ ID NO.8 DNA was deposited at the Australian Government Analytical Laboratories on and accorded the accession number A sample of SEQ ID.NO.60 DNA was deposited at the Australian Government Analytical Laboratorieson 23 December 1999, and accorded the accession number NM99/09106.

Preferably the second nucleic acid molecule is a cDNA molecule encoding the tetracycline-responsive transcriptional activator protein (tTA), as defined herein, having a nucleotide sequence of SEQ ID NO:2. A sample of SEQ ID NO.2 cDNA was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number MM99/09099.

WO 01/48224 PCT/AU00/01596 7 Preferably the third nucleic acid molecule is DNA molecule encoding a repressible promoter. More preferably the promoter consists of the tet responsive element (TRE) which is coupled to and tightly regulates a minimal promoter region. Most preferably this comprises the tet responsive element (TRE) and the Pmincv as shown in SEQ ID NO:3. A sample of SEQ ID NO.3 DNA was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number MM99/09100.

Preferably the fourth nucleic acid molecule encodes a blocker molecule selected from the group.

consisting of antisense RNA, double-stranded RNA (dsRNA), sense RNA and ribozyme. More preferably the molecule is dsRNA or sense RNA.that when mis-expressed disrupts development in a defined spatio-temporal pattern. Most preferably this RNA molecule is encoded by the nucleotide sequence shown in SEQ ID NO:13, SEQ ID NO:62, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID:61. A sample of SEQ ID NO.13 DNA.

was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number MM99/09100. A sample of SEQ ID NO:62 DNA was deposited at the Australian Government Analytical Laboratories .on and accorded the accession number A sample of SEQ ID N0.23 DNA was.deposited.at the Australian Government Analytical Laboratories .on 22 December 1999, and accorded the accession number NM99/09101. A sample of SEQ ID N0.24 DNA was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number NM99/09102. A sample of SEQ ID NO.61 DNA was deposited at the Australian Government Analytical Laboratories on 23 December 1999, and accorded the accession number NM99/09107.

In a second aspect, the present invention provides a nucleic acid molecule, which encodes a promoter and is transiently activated in a defined spatio-temporal WO 01/48224 PCT/AU00/01596 8 pattern. More preferably, the promoter is active only during a narrow window during embryogenesis or larval development. Most preferably the nucleic acid is a promoter having a.nucleotide sequence as shown in SEQ ID NO:1, SEQ ID NO:8 and SEQ ID In a third aspect, the present invention provides a nucleic acid molecule, which encodes a promoter having: a) .a nucleotide sequence as shown in SEQ ID NO:1, SEQ ID NO:8 and SEQ ID NO:60; or b) a biologically active.fragment of the sequence in or c) a nucleic acidmolecule which has at least sequence homology to the sequence in a) or or d) a nucleic acid molecule which is capable of hybridizing to the sequence in a) or b) under stringent conditions.

In a fourth aspect, the present invention provides a nucleic acid molecule that encodes the coding region of a gene including: a) a nucleotide sequence selected from the group consisting of SEQ ID NO:63, SEQ ID NO:23, SEQ ID NO:24 and SEQ ID NO 61 or b) a biologically active fragment of any one of the sequences in or c) a nucleic acid molecule which has at least sequence homology with any one of the sequences disclosed in a) or or d) a nucleic acid molecule that is capable of binding to any one of the sequences disclosed in a) or b) under stringent conditions.

A sample of SEQ ID NO.63 DNA was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number MM99/09100. A sample of SEQ ID N0.23 DNA was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number NM99/09101. A sample of SEQ ID N0.24 DNA was deposited at WO 01/48224 PCT/AU00/01596 9 the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number NM99/09102. A sample of SEQ ID NO.61 DNA was deposited at the Australian Government Analytical Laboratories on 23 December 1999, and accorded the accession number NM99/09107.

In a fifth aspect, the present invention provides a nucleic acid molecule which encodes a blocker molecule wherein the blocker molecule is capable of disrupting gametogenesis or embryogenesis in an animal.

Preferably the blocker molecule is selected from the group consisting of antisense RNA, dsRNA, sense RNA and ribozyme. More preferably the molecule is dsRNA or sense RNA that when mis-expressed disrupts development in a defined spatio-temporal pattern. Most preferably the blocker molecule is encoded, or partially encoded, by a sequence selected from the group consisting of SEQ ID NO:13, SEQ ID NO:62, SEQ ID NO:23 and SEQ ID NO:61. A sample of SEQ ID NO.13 DNA was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number MM99/09100. A sample of SEQ' ID NO.62 DNA was deposited at the Australian Government Analytical Laboratories on and accorded the accession number .A sample of SEQ ID NO..61 DNA was deposited at the Australian Government Analytical Laboratories on 23 December 1999, .and .accorded the accession number NM99/09107.

In an sixth aspect, the present invention provides.a construct for disrupting gametogenesis or embryogenesis in animals, comprising: a) a first.nucleic acid molecule, which is transiently activated in a defined spatio-temporal pattern, and which is operably linked to b) a second nucleic acid molecule, which encodes a blocker molecule wherein activation of said first nucleic acid molecule controls the expression of the second nucleic acid which WO 01/48224 PCT/AU00/01596 10 disrupts gametogenesis or embryogenesis in the animal.

In a seventh aspect, the present invention provides a method of preventing embryogenesis in animals comprising the steps of: 1) stably transforming an animal cell with a construct according to the invention; and 2) implanting the cell into a host organism, whereby a whole animal develops from the implanted cell.

Preferably, the stable transformation is effected by-microinjection, transfection or infection, wherein the construct stably integrates into the genome by homologous recombination.

In an eighth aspect, the present invention provides a transgenic animal stably transformed with a .construct according to the invention.

Preferably the host organism is of the same genus as the transformed cell. More preferably the host organism is any;animal, including vertebrates and invertebrates.

Most preferably the host organism is selected from the group consisting of fish, mammals, amphibians, and mollusc..

Fish include; but are not limited to, zebrafish, European carp, salmon, tilapia and trout. Mammals include; but are not limited to, cats, dogs, donkeys, camels, rabbits, rats, and mice. Molluscs include; but are not limited to, Pacific oysters, zebra mussels,.striped mussels, abalone, pearl oysters, and scallops.

Modified and variant forms of the constructs may be produced in vitro, by means of chemical or enzymatic treatment, or in vivo by means of recombinant DNA technology. Such constructs may differ from those disclosed, for example, by virtue of one or more nucleotide substitutions, deletions or insertions, but substantially retain a biological activity of the construct or nucleic acid molecule of this invention.

Brief Description of the Figures: Figure 1 shows the plasmid map of WO 01/48224 PCT/AU00/01596 11 Figure 2 shows the plasmid map of pZBMP2(1.4)- EGFP. The transcriptional unit consists of the modified EGFP coding sequences (Cormac et al., 1996), under the regulation of a 1,414 bp zBMP2 promoter.

Figure 3 shows zBMP2 promoter-driven EGFP expression in zebrafish embryo at 9.5h pi. Right, lateroventral view, anterior to right. Panel A shows a typical zebrafish embryo showing EGFP expression predominantly in the anterio-ventral region. Panel B shows a light micrograph of the embryo on left. PO, polster.

Figure 4 shows EGFP expression in 9.5hpi old zebrafish embryo. Lateral views, with dorsal to top and anterior to left. Panel A shows EGFP expression driven by zBMP2 promoter. Panel B shows a light micrograph of the embryo on left. PO,.polster; TB, tail bud.

Figure 5 shows anterior region of a zebrafish embryo, showing EGFP expression driven by zpBMP2 at 24-h pi. Panel A shows the left, dorso-lateral view. EGFP expression is seen in domains of native zBMP2 expression.

Panel B shows light micrograph of the embryo on left.

Left, lateral view. PE, posterior margin of eye; OV, otic vesicle; FB, pectoral fin bud.

Figure 6 shows the plasmid map of pSMAD5-EGFP. A sample of pSMADS-EGFP was deposited at the Australian Government Analytical Laboratories on and accorded the accession number The zebrafish promoter drives expression of the EGFP.

Figure 7 shows a shield stage zebrafish embryo, showing ubiquitous expression of EGFP (panel A) driven by zebrafish smad5 promoter Panel B represents the light micrograph of the embryo on left.

Figure 8 shows middle section of a typical 24hpi zebrafish embryo injected with pSMAd5-EGFP. The EGFP expression is predominantly restricted to ventral tissues.

D, dorsal; V, ventral.

Figure 9 shows dorsalized phenotypes of zebrafish, resulting from zBMP2 antisense and dsRNA (B) WO 01/48224 PCT/AU00/01596 12 injections. Developments of ventral structures are perturbed in both instances.

Figure 10 shows the ventralized chordino phenotypes of zebrafish resulting from zBMP2 sense transcript injections. Enlarged blood island (A and B, arrow) and multiplicated ventral margin of tail fin (C, arrow).

Figure 11 shows the plasmid map of the antisense EGFP fusion construct, pzBMP2-As-EGFP. A sample of pzBMP2- As-EGFP was deposited at the Australian Government Analytical Laboratories on 22 December 1999, and accorded the accession number MM99/09102.

Figure 12 shows the plasmid map of pzBMP2-dsRNA.

The zBMP2 promoter drives the expression of about 800 bp of zBMP2 cDNA, designed to fold back.on itself as a dsRNA.

Figure 13 shows the plasmid map of pzBMP2-Tet- Off. This construct was engineered to drive expression of tTA under the regulation of zBMP2 promoter.

Figure 14 shows the plasmid map of the complete sterile feral construct, pSF1. The zBMP2 promoter drives the expression of tTA, which in turn activates the expression of EGFP and the zBMP2 double stranded RNA blocker, in the absence of doxycycline.

Figure 15 shows a.plasmid map of zebrafish Sterile feral Construct pSF2. 'This.:construct is identical to pSF1, except that CMV promoter drives the tTA. -A sample of pSF2 was deposited at the Australian Government Analytical Laboratories on and accorded the accession number Figure 16 shows a plasmid map of zebrafish Sterile feral Construct pSF3. This construct is identical to pSF2, except that the zebrafish smad5 promoter drives the tTA. A sample of pSF3 was deposited at the Australian Government Analytical Laboratories on and accorded the accession number Figure 17 shows a plasmid map of zebrafish Sterile feral Construct pSF4. This construct is identical WO 01/48224 PCT/AU00/01596 13 to pSF3, except that the zBMP2 double stranded RNA blocker is replaced by zBMP2 sense cDNA. A sample of pSF4 was deposited at the Australian Government Analytical Laboratories on and accorded the accession number Figure 18 show 24-hpi zebrafish embryos following the injection of pSF4. Panel A, two-zebrafish embryos with enlarged blood islands (arrow), typical of ventralized mutations. Panel B, close up view of 24 hpi zebrafish embryo tail, with enlarged blood island (arrow).

Panel C, EGFP micrograph of embryo in panel B, showing close association of EGFP expression.and ventralization (arrow).

Figure 19 shows the amino acid alignments of closely related HOXCG1 and HOXCG3 genes in various animals.

Figure 20 shows typical control D-hinge larvae with a single velum and a larvae exhibiting the multiple velum phenotype as a consequence of blocking expression of Hox CG1 with double stranded HOXG1 RNA.

Figure 21 shows the plasmid map of the double stranded blocking construct for oyster Hox gene, pBiT(dHSP)-RFP-oHoxDS/BH. A sample of pBiT(dHSP)-RFP- SoHoxDS/BH was deposited at the Australian Government Analytical Laboratories on and accorded the accession number Figure 22 shows the amino. acid alignments of closely related goosecoid genes in various animals Figure 23 shows the mechanisms of action of regulatory elements of the mouse goosecoid gene promoter .region.

Figure 24 shows the plasmid map of the mouse goosecoid promoter driving expression of the enhanced green fluorescent protein reporter (pSFM 1) Figure 25 shows the plasmid map of the tetracycline transactivated TRE driving expression of the mouse goosecoid cDNA (pSFM 2).

Figure 26 shows the mouse goosecoid promoter driving expression of mouse goosecoid cDNA fused to the red WO 01/48224 PCT/AU00/01596 14 fluorescent protein reporter (pSFM 6).

Figure 27 shows the plasmid map of the mouse goosecoid promoter driving expression of the tetracycline transactivator tTA protein (pSFM 7).

Figure 28 shows the plasmid map of the mouse goosecoid promoter driving expression of the luciferase+ protein reporter (pSFM Figure 29 shows the plasmid map of the promoterless luciferase+ protein reporter (pSFM 21).

Figure 30 shows the plasmid.map of the CMV promoter driving expression of the luciferase+ protein.

reporter (pSFM 23).

Figure 31 shows the plasmid map of the tetracycline transactivated TRE driving expression of the enhanced'.green fluorescent.protein reporter (pSFM 24).

Figure 32 shows the plasmid map of.the tetracycline transactivated TRE driving expression of the luciferase+ protein reporter (pSFM Figure 33 shows an agarose gel demonstrating the -presence of mouse goosecoid mRNA expression in P19 cells as.

detected by RT-PCR amplification of mRNA using goosecoid- :specific primers. Lane 1: PCR product from P19 cells using goosecoid primers; Lane..2: PCR product from Ifg of pSFM 2 as a.positive-:goosecoid:control; Lane 3: PCR product from P19 cells with GAPDH primers; Lane4::.:DNA MW.;marker Figure 34 shows the plasmid-map of.the tetracycline transactivated TRE driving expression of the mouse goosecoid dsRNA blocker construct (pSFM SFigure 35 shows the plasmid map of the CMV promoter driving expression of the mouse goosecoid antisense RNA blocker construct (pSFM 8).

Figure 36 shows the plasmid map of the tetracycline transactivated TRE driving expression of the mouse goosecoid antisense blocker construct (pSFM A sample of pSFM 9 was deposited at the Australian Government Analytical Laboratories on 23 December 99 and accorded the accession number NM99/09107.

WO 01/48224 PCT/AU00/01596 15 Figure 37 shows the cellular locations of CMV promoter-driven expression of red fluorescent protein in P19-SFM 7 cells CMV promoter-driven expression of red fluorescent protein fused to the mouse goosecoid protein and TRE tetracycline responsive enhanced green fluorescent protein expression in cells co-transfected with CMV promoter-driven expression of red fluorescent protein fused to the mouse goosecoid protein Detailed Description of the Invention The practice of the present .invention employs, unless otherwise indicated, conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are well known to the skilled .worker, and are explained fully in the literature.

See, "DNA Cloning: A Practical Approach," Volumes I and II Glover, ed., 1985); "Oligonucleotide Synthesis" Gait, ed., 1984); "Nucleic Acid Hybridization" Hames S.J. Higgins, eds., 1985); "Transcription and Translation" Hames S.J. Higgins,.

eds., 1984); "Animal Cell Culture" Freshney, ed., 1986); "Immobilized Cells and Enzymes" (IRL Press, 1986); B. Perbal, "A:Practical Guide to Molecular Cloning" (1984), and Sambrook, et al., "Molecular.Cloning: a Laboratory Manual" 12 th edition (1989).

'Definitions The description that follows makes use of a number of terms .used in recombinant DNA technology. In order to provide a clear and consistent understanding of the specification and claims, including the scope given such terms, the following definitions are provided.

A "nucleic acid molecule" or "polynucleic acid molecule" refers herein to deoxyribonucleic acid and ribonucleic acid in all their forms, single and double-stranded DNA, cDNA, mRNA, and the like.

A "double-stranded DNA molecule" refers to the WO 01/48224 PCT/AU00/01596 16 polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its normal, double-stranded helix.

This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus this term includes doublestranded.DNA found, inter alia, in linear DNA molecules restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction-along .the nontranscribed strand of DNA (i.e.,.the strand having a sequence homologous to the mRNA).

A DNA sequence "corresponds" to an amino acid sequence if .translation of the DNA sequence in accordance with the genetic code yields the amino acid sequence the DNA sequence "encodes" the amino acid sequence).

One DNA sequence "corresponds" to another DNA sequence if the two sequences encode the same amino acid sequence.

Two DNA sequences are "substantially similar" when at least about 85%, preferably at least about 90%, and most preferably at least about 95%, of the nucleotides match over. the defined length of.the DNA sequences.

Sequences that are substantially similar--can be identified in a Southern hybridization experiment.,- for.example under stringent conditions as defined for that particular system.

Defining appropriate hybridization conditions is within the skill of the art. See.e.g., Sambrook et al., "Molecular Cloning: a Laboratory Manual" 12 th edition (1989), vols. I, II and III. Nucleic Acid Hybridization. However, ordinarily, "stringent conditions" for hybridization or annealing of nucleic acid molecules are those that employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate (SDS) at 50 0 C, or employ during hybridization a denaturing agent such as WO 01/48224 PCT/AU00/01596 17 formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% mM sodium phosphate buffer at pH with 750 mM NaCI, 75 mM.sodium citrate at 42 0

C.

Another example is use of 50% formamide, 5 X SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 0.1% sodium pyrophosphate, 5 X Denhardt's solution, sonicated salmon sperm DNA (50 gg/mL), 0.1% SDS, and 10% dextran sulfate at 42 0 C, with washes at 42 0 C in 0.2 X SSC and 0.1% SDS.

A "heterologous" region or domain of a DNA construct is an identifiable .segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous region is a construct where the coding sequence itself is not found in nature a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene).

Allelic variations or naturally occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

A "gene" includes all the DNA sequences associated with the promoter and coding region and noncoding region such as introns and 5' and 3' non-coding sequences and enhancer elements.

A "coding region" is an in-frame sequence of codons from the start codon, normally ATG, to the stop codon TAA, and which may or may not include introns.

A "coding sequence" is an in-frame sequence of codons that correspond to or encode a protein or peptide sequence. Two coding sequences correspond to each other if the sequences or their complementary sequences encode the same amino acid sequences. A coding sequence in association with appropriate regulatory sequences may be WO 01/48224 PCT/AU00/01596 18 transcribed and translated into a polypeptide in vivo. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.

A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3'direction) coding sequence. A coding sequence is "under the control" of the promoter sequence in a cell when RNA polymerase which binds the promoter sequence transcribes the coding sequence into mRNA, which is then in turn translated into the protein encoded by the coding sequence.

For the purposes of the present invention, the promoter sequence is bounded at its 3' terminus by the translation start codon of a coding sequence, and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease Sl), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes, .prokaryotic promoters contain Shine-Delgarno sequences in addition to the -10 and -35 consensus sequences.

A cell has been "transformed" by-exogenous DNA when such exogenous DNA has been introduced inside the cell wall. Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell. In prokaryotes and yeast, for example, the exogenous DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the exogenous DNA is inherited by daughter cells through chromosome replication.

This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous

DNA.

WO 01/48224 PCT/AU00/01596 19 "Integration" of the DNA may be effected using non-homologous recombination following mass transfer of DNA into the cells using microinjection, biolistics, electroporation or.lipofection. Alternative methods such as homologous recombination, and or restriction enzyme mediated integration (REMI) or transposons are also encompassed, and may be considered to be improved integration methods.

A "clone" is a population of cells derived from a single cell or common ancestor by mitosis.

"Cell," "host cell," "cell'line," and "cell culture" are used interchangeably herewith.and. all. such terms should be understood to include progeny. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations. .Thus the .words "transformants".and "transformed cells" include the primary subject cell and cultures derived therefrom, without regard for the number of times the cultures have been passaged. It should also be understood that all progeny.might not be precisely identical in DNA content, due to deliberate or inadvertent mutations.

Vectors are used to introduce a foreign substance, such as DNA, RNA or protein, into an organism.

Typical vectors include recombinant viruses (for DNA) and liposomes (for protein). "DNA cloning vector" is an autonomously replicating DNA molecule,. such -as plasmid, phage or cosmid. Typically the DNA cloning vector comprises one or a small number of restriction endonuclease recognition sites, at which such DNA sequences may be cut in a determinable fashion without loss of an essential biological function of the vector, and into which a DNA fragment may be spliced in order to bring about its replication and cloning. The cloning vector may also comprise a marker suitable for use in the identification of cells transformed with the cloning vector.

An "expression vector" is similar to a DNA cloning vector, but contains regulatory sequences which are WO 01/48224 PCT/AU00/01596 20 able to direct protein synthesis by an appropriate host cell. This usually means a promoter to bind RNA polymerase and initiate transcription of mRNA, as well as ribosome binding sites and initiation signals to direct translation of the mRNA into a polypeptide. Incorporation of a DNA sequence into an expression vector at the proper site and in correct reading frame, followed by transformation of an appropriate host cell by the vector, enables the production of mRNA corresponding to the DNA sequence, and usually of a protein encoded by the DNA sequence.

"Plasmids" are DNA molecules.that are capable of replicating within a host.cell, .either:extrachromosomally or as part of the host cell chromosome(s), and are designated by a lower case preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are commercially available, are publicly available on an unrestricted basis, or can be constructed from such available plasmids by methods disclosed herein and/or in accordance with published procedures. In certain instances, as will be apparent to the ordinarily skilled worker, other plasmids known in the art may be used interchangeably with plasmids described herein.

"Control sequences" refers to DNA sequences necessary for the expression of an operably linked nucleotide coding sequence in.aparticular host cell. The control sequences suitable.for:.expression .in prokaryotes, for example, include origins .of replication, promoters, ribosome binding sites, and transcription termination sites. The control sequences that are suitable for expression in eukaryotes, for example, include origins of replication, promoters, ribosome binding sites, polyadenylation signals, and enhancers.

An "exogenous" element is one that is foreign to the host cell, or is homologous to the host cell but in a position within the host cell in which the element is ordinarily not found.

"Digestion" of DNA refers to the catalytic WO 01/48224 PCT/AU00/01596 21 cleavage of DNA with an enzyme that acts only at certain locations in the DNA. Such enzymes are called restriction enzymes or restriction endonucleases, and the sites within DNA where such enzymes cleave are called restriction sites.

If there are multiple restriction sites within the DNA, digestion will produce two or more linearized DNA fragments (restriction fragments). The various restriction enzymes used herein are commercially available, and their reaction conditions, cofactors, and other requirements as established by the enzyme manufacturers are used.

Restriction enzymes are commonly designated by abbreviations composed of a capital letter-followed by other letters representing the microorganism from which each restriction enzyme originally was obtained and then a number.designating the particular enzyme. In general, about 1 pg of DNA is digested with about 1-2 units of enzyme in about 20 .1 of buffer solution. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer, and/or are well known in the art.

"Recovery" or "isolation" of a given fragment of DNA from a restriction digest typically is accomplished by.

.separating the digestion .products, which are referred to.as "restriction fragments," on a polyacrylamide or agarose gel by electrophoresis, identifying:the fragment.of interest on the basis of its mobility relative to.that of.marker DNA fragments of known molecular weight, excising the portion of the gel that. contains the desired fragment, and separating the DNA from the gel, for example by electroelution.

"Ligation" refers to the process of forming phosphodiester bonds between two double-stranded DNA fragments. Unless otherwise specified, ligation is accomplished using known buffers and conditions with units of T4 DNA ligase per 0.5 ig of approximately equimolar amounts of the DNA fragments to be ligated.

"Oligonucleotides" are short-length, single- or WO 01/48224 PCT/AU00/01596 22 double-stranded polydeoxynucleotides that are chemically synthesized by known methods (involving, for example, triester, phosphoramidite, or phosphonate chemistry), such as described by Engels et al., Agnew. Chem. Int. Ed. Engl.

28:716-734 (1989). They are then purified, for example, by polyacrylamide gel electrophoresis.

"Polymerase chain reaction," or "PCR," as used herein generally refers to a method .for amplification of a desired nucleotide sequence in vitro, as described in U.S.

Patent No. 4,683,195. In general, the PCR method involves repeated cycles of primer extension synthesis, using two oligonucleotide primers capable of hybridizing preferentially to a template nucleic acid. Typically, the primers used in the PCR method will be complementary to .nucleotide sequences within .the template at both ends of or flanking the nucleotide sequence to be amplified, although.

primers complementary to the nucleotide sequence to be amplified also may be used. See Wang et al., in PCR Protocols, pp.70-75 (Academic Press, 1990); Ochman et al., in PCR Protocols, pp. 219-227; Triglia, et al., Nuc. Acids Res. 16:8186 (1988).

"PCR cloning" refers to the use of the PCR method to amplify a specific desired nucleotide sequence that is present amongst the nucleic acids from.a suitable cell or tissue .source, including:..total -genomic DNA-.and cDNA transcribed from total cellular.RNA. See Frohman et al., Proc. Nat. Acad. Sci. USA 85:8998-9002 (1988); Saiki et al., Science 239:487-492 (1988); Mullis et Meth.

Enzymol. 155:335-350 (1987).

"zBMP2 promoter" refers to a promoter encoded by the nucleotide sequence set forth in SEQ ID NO.:1. "zSMAD promoter" refers to a promoter encoded by the nucleotide sequence set forth in SEQ ID NO.:8. "goosecoid promoter" refers to a promoter encoded by the nucleotide sequence set forth in SEQ ID NO.:60. "Blocker molecule" refers to either antisense RNA, dsRNA, sense RNA or DNA that preferably encodes BMP2, GSC, HoxCG1 or HoxCG3 and includes the WO 01/48224 PCT/AU00/01596 23 sequences shown in SEQ ID NO:13, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:61. However, it will be appreciated by those skilled in the art that any nucleic acid molecule capable of disrupting gametogenesis or embryogenesis is encompassed. Accordingly, the terms "blocker molecule RNA" and."blocker molecule DNA" as used herein are interchangeable depending upon whether it is a species of RNA or DNA, that is being addressed. "HoxCG" refers to genes HoxCG1 and HoxCG3 isolated from Pacific oyster encoded by the nucleotide sequences set forth in SEQ ID NO.:23 and SEQ ID NO:24, respectively. Sequence variants of zBMP2 promoter,. SMAD promoter, goosecoid promoter and HoxCG blocker molecules may be made synthetically, for example, by site-directed or PCR mutagenesis, or. may exist naturally, as in the case of allelic forms and other naturally occurring variants of the nucleotide sequences set forth in SEQ ID NO.:1, SEQ ID NO:8, SEQ ID NO:60, SEQ ID NO:23, and SEQ ID NO:24, respectively, that may occur in fish and other animal species.

zBMP2 promoter, SMAD promoter, goosecoid promoter HoxCG, and blocker molecule nucleotide sequence variants are included within the scope of the invention, provided .that they are functionally active. As used herein, ."functionally active" and ".functional activity" with reference to zBMP2 promoter, SMAD promoter, goosecoid promoter and HoxCG means that the zBMP2 promoter, SMAD promoter, goosecoid promoter and HoxCG variants are able to function in a similar way to naturally occurring zBMP2 promoter, SMAD promoter,.goosecoid promoter and HoxCG.

With reference to the blocker molecule "functionally active" and "functional activity" means that the blocker molecule variants are capable of disrupting gametogenesis or embyrogenesis in an animal. Therefore, zBMP2 promoter, SMAD promoter, goosecoid promoter HoxCG and blocker molecule nucleotide sequence variants generally will share at least about 75%, preferably greater than 80% and more WO 01/48224 PCT/AU00/01596 24 preferably greater than 90%, sequence identity with the nucleotide sequences set forth in SEQ ID NO.:1, SEQ ID NO:8, SEQ ID NO:60, SEQ ID NO:23, and SEQ ID NO:24 respectively, after aligning the sequences to provide for maximum homology, as determined, for example, by the Fitch et al., Proc. Nat. Acad. Sci. USA 80:1382-1386 (1983), version of the algorithm described by Needleman et al., J.

Mol. Biol. 48:443-453 (1970).

Nucleotide sequence variants of zBMP2 promoter, SMAD promoter, goosecoid promoter HoxCG and blocker molecule are prepared by-introducing appropriate nucleotide changes into zBMP2 promoter, .SMAD.promoter, goosecoid promoter, HoxCG and blocker molecule DNA, or by in vitro synthesis. Such variants include deletions from, or insertions or substitutions of, nucleotides within the zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule nucleotide sequences set forth in SEQ ID NO.:1, SEQ ID NO:8, SEQ ID NO: 60, SEQ ID NO:23, and SEQ ID NO:24. Any combination of deletion, insertion, and substitution may be made to arrive at a nucleotide sequence variant of zBMP2 promoter, SMAD promoter, goosecoid promoter HoxCG or blocker molecule provided that such variants possess the desired characteristics described herein. Changes.that are made in the nucleotide sequence set forth in SEQ ID SEQ ID NO:8, SEQ ID NO:60, SEQ ID NO:23, and SEQ ID NO:24, respectively, -t.o arrive at nucleotide sequence variants of zBMP2 promoter, SMAD promoter, goosecoid promoter and HoxCG blocker molecules also may result in further modifications of the zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule upon their activation in host cells.

There are two principal variables in the construction of nucleotide sequence variants of zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG and blocker molecule nucleic acid: the location of the mutation site and the nature of the mutation. These are variants from the nucleotide sequences set forth in SEQ ID NO.:1, WO 01/48224 PCT/AU00/01596 25 SEQ ID NO:8, SEQ ID NO 60, SEQ ID NO:23, and SEQ ID NO:24 and may represent naturally occurring allelic forms of zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG and blocker molecule or predetermined mutant forms of zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG and blocker molecule made by mutating zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule DNA, either to arrive at an allele or a variant not found in nature. In general, the location and nature of the mutation chosen will depend upon the zBMP2 promoter, SMAD promoter, goosecoid promoter, -HoxCG or blocker molecule characteristic to be modified.

Nucleotide sequence deletions generally range from about 1 to 30 nucleotides, more preferably about 1 to 10 nucleotides, and are typically contiguous.

Nucleotide sequence insertions include fusions ranging in length from one nucleotide to hundreds of nucleotides, as well as intrasequence insertions of single or multiple nucleotides. Intrasequence insertions insertions made within the nucleotide sequences set forth in SEQ ID NO.:1, SEQ ID NO:8, SEQ ID NO:60, SEQ ID NO:23, and SEQ ID NO:24) may range generally from about 1 to nucleotides, more preferably 1 to 5, most preferably 1 to 3.

The.third group of.variants are those in which nucleotides in the nucleotide sequences. set..forth in SEQ ID NO.:1, SEQ ID NO:8, SEQ ID'NO:60,'SEQ ID'NO:23, and SEQ ID NO:24 have been substituted with other nucleotides.

Preferably one to four, more preferably one to three, even more.preferably one to two, and most preferably only one nucleotide has been removed and a different nucleotide inserted in its place. The sites of greatest interest for making such substitutions are those sites that are likely to be important to the functional activity of the zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule.

zBMP2 promoter, SMAD promoter, goosecoid WO 01/48224 PCT/AU00/01596 26 promoter, HoxCG and blocker molecule DNA is-obtained from cDNA or genomic DNA libraries, or by in vitro synthesis.

Identification of zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule DNA within a cDNA or a genomic DNA library, or in some other mixture of various DNAs, .is conveniently accomplished by the use of an oligonucleotide hybridization probe labelled with a detectable moiety, such as a radioisotope. See Keller et DNA Probes, pp.149-213 (Stockton Press, 1989). To .identify.DNA encoding zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule DNA, the nucleotide sequence of the hybridization probe.is preferably selected so that the hybridization probe is capable of hybridizing preferentially to DNA encoding homologues of the equivalent zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule DNA in other species, or variants or derivatives thereof as described herein, under the hybridization conditions chosen. Another method for obtaining zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule is chemical synthesis using one of the methods described, for example, by Engels et al., Agnew. Chem. Int. Ed. Engl. 28:716-734 (1989).

If the entire nucleotide coding.sequence for zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule is not obtained in a single cDNA, genomic DNA, or other DNA, as determined, for example, by DNA :sequencing or restriction endonuclease analysis, then appropriate DNA fragments restriction fragments or PCR amplification products) may be recovered from several DNA's, and covalently joined to one another to construct the entire coding sequence. The preferred means of covalently joining DNA fragments is by ligation using a DNA ligase enzyme, such as T4 DNA ligase.

"Isolated" zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule nucleic acid is zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG WO 01/48224 PCT/AU00/01596 27 or blocker molecule nucleic acid that is identified and separated from (or otherwise substantially free from), contaminant nucleic acid encoding other polypeptides. The isolated zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule can be incorporated into a plasmid or expression vector, or can be labeled for probe purposes, using a label as described further herein in the discussion of assays and nucleic acid hybridization methods.

It will be appreciated that if the desired result of the present invention is sterilized-adult feral animals then the blocker molecules.maybe .expressed in vitro, isolated, purified, and then delivered to specific organisms. The mode of delivery may be any known procedure .including injection and ingestion. Moreover, constructs of the present invention which are capable of expressing blocker molecules may also be delivered to adult feral animals by viral vectors like adenovirus. Isolated zBMP2 promoter, SMAD promoter and goosecoid promoter nucleic acid is also used to control.the expression of other desired genes or blocker molecules in vivo. Indeed, the zBMP2 promoter, SMAD promoter and goosecoid promoter may be used in any vector, or construct where the expression of.a gene, cDNA, or coding sequence is desirably controlled to be at a particular spatio-temporal-point-.during.-embyrogenesis. It will be appreciated that while the:zBMP2 promoter and SMAD promoter are particularly useful in controlling the .expression of nucleic acids.in fish, they are equally useful in other.organisms. In various embodiments of the invention, host cells are transformed or transfected with recombinant DNA molecules comprising an isolated zBMP2 promoter or SMAD promoter DNA or goosecoid promoter operably linked to a desired nucleic acid molecule, wherein the expression of the desired molecule is directly or indirectly under the control of the zBMP2 promoter or SMAD promoter or goosecoid promoter.

Isolated HoxCG nucleic acid is also used to WO 01/48224 PCT/AU00/01596 28 produce HoxCG by recombinant DNA and recombinant cell culture methods. In various embodiments of the invention, host cells are transformed or transfected with recombinant DNA molecules comprising an isolated HoxCG DNA, to obtain expression of the HoxCG DNA and thus the production of HoxCG in large quantities. DNA encoding amino acid sequence variants of HoxCG is prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants of HoxCG), or preparation by site-directed or oligonucleotidemediated mutagenesis, PCR mutagenesis, and cassette mutagenesis of DNA encoding a variant or a non-variant form of HoxCG.

Site-directed mutagenesis is a preferred method for preparing substitution, deletion, and insertion variants of HoxCG DNA, or other DNA such as the zBMP2 promoter, SMAD promoter, and blocker molecule DNA. This technique is well known in the art; see Zoller et al., Meth. Enz. 100:4668-500 (1983.); Zoller, et al., Meth. Enz.

154:329-350 (1987); Carter, Meth. Enz. 154:382-403 (1987); Horwitz et al., Meth. Enz. 185:599-611 (1990), and has been used to produce amino acid sequence variants of trypsin and T4 lysozyme, which variants have certain desired functional properties. Perry et al..,-Science 226:555-557 (1984); Craik et al., Science 228:291-297 (1985).

Briefly, in carrying out site-directed mutagenesis .of zBMP2.promoter, SMAD promoter, goosecoid promoter, HoxCG and blocker molecule DNA, the zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG and blocker molecule DNA is altered by first hybridizing an oligonucleotide encoding the desired mutation to a single strand of zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG and blocker molecule DNA. After hybridization, a DNA polymerase is used to synthesize an entire second strand, using the hybridized oligonucleotide as a primer, and using the single strand of zBMP2 promoter, WO 01/48224 PCT/AU00/01596 29 SMAD promoter, goosecoid promoter, HoxCG and blocker molecule DNA as a template. Thus the oligonucleotide encoding the desired mutation is incorporated into the resulting double-stranded DNA.

Oligonucleotides for use as hybridization probes or primers may be prepared by.any suitable.method, such.as purification of a naturally occurring DNA or in vitro synthesis. For example, oligonucleotides.are readily synthesized using various techniques in such as those described by Narang.et al., Meth. Enzymol.. 68:90-98 (1979); Brown et al., Meth. Enzymol. 68:109-151 (1979.); Caruther et al., Meth. Enzymol. 154:287-313 (1985). The general approach to selecting a suitable hybridization probe or primer is well known. Keller et al., DNA Probes, pp.11-18 (Stockton Press, 1989). Typically, the hybridization probe or primer will contain 10-25 or more nucleotides, and will include at least 5 nucleotides on either side of the sequence encoding the desired mutation so as to ensure that the oligonucleotide will hybridize preferentially to the single-stranded DNA template molecule.

Multiple mutations are introduced into HoxCG DNA to produce amino acid sequence variants of HoxCG comprising several or a combination of insertions, deletions, or substitutions of amino acid residues as compared to the amino acid sequences set:forth in Figure 720. .If the sites to be mutated are located close together, the.mutations may be introduced simultaneously using a single oligonucleotide that encodes all of the desired mutations. If, however, the sites to be. mutated are located some distance from each other (separated by more than about ten nucleotides), it is more difficult to generate a.single oligonucleotide that encodes all of the desired changes. Instead, one of two alternative methods may be employed.

In the first method, a separate oligonucleotide is generated for each desired mutation. The oligonucleotides are then simultaneously annealed to the single-stranded template DNA, and the second strand of DNA WO 01/48224 PCT/AU00/01596 30 that is synthesized from the template will encode all of the desired amino acid substitutions.

The alternative method involves two or more rounds of mutagenesis to produce the desired mutant. The first round is as described for introducing a single mutation: a single strand.of a previously prepared-HoxCG DNA is used as a template, an oligonucleotide encoding the first desired mutation is annealed to this template, and a heteroduplex DNA.molecule is then generated. The second round of mutagenesis utilizes the mutated DNA produced in the first round of mutagenesis as the template. Thus this template already contains .oneor. more mutations. The oligonucleotide encoding the additional desired amino acid substitution(s) is then annealed to this template, and the resulting strand of DNA now encodes mutations from both the first and second rounds of mutagenesis. This resultant DNA can be:used as a template in a third round of mutagenesis, and so on.

PCR mutagenesis is also suitable for making nucleotide sequence variants of zBMP2 promoter, SMAD promoter,.goosecoid promoter, HoxCG and blocker molecule.

Higuchi, in PCR Protocols, pp.177-183 (Academic Press, 1990); Vallette et al., Nuc. Acids Res. 17:723-733 (1989).

Briefly, when small amounts of template.DNA are used.as starting material in a.PCR;-.primers that differ slightly in sequence from the corresponding region in .a template DNA can be used to generate relatively large quantities of a specific DNA fragment that.differs from the template sequence only at the positions.where the primers differ from the template.. For introduction of a mutation into a plasmid DNA, for example, one of the primers is designed to overlap the position of the mutation and to contain the mutation; the sequence of the other primer must be identical to a nucleotide sequence within the opposite strand of the plasmid DNA, but this sequence can be located anywhere along the plasmid DNA. It is preferred, however, that the sequence of the second primer is located within WO 01/48224 PCT/AU00/01596 31 200 nucleotides from that of the first, such that in the end the entire amplified region of DNA bounded by the primers can be easily sequenced. PCR amplification using a primer pair like the one just described results in a population of DNA fragments that differ at the position of the mutation specified by the primer, and possibly at other positions, as template copying is somewhat error-prone.

See Wagner et al., in PCR Topics, pp.69-71 (Springer- Verlag, 1991).

If the ratio of template to product amplified DNA is extremely low, the majority of-product DNA fragments incorporate the desired mutation:(s). .This product DNA is used to replace the corresponding region in the plasmid that served as PCR template using standard recombinant DNA methods. Mutations at separate positions can be introduced simultaneously by either using a mutant second primer, or performing a second PCR with different mutant primers and ligating the two resulting PCR fragments simultaneously to the plasmid fragment in a three (or more)-part ligation.

Another method for preparing variants, cassette mutagenesis, is based on the technique described by Wells et al., Gene, 34:315-323 (1985). The starting material is the plasmid (or other vector) comprising the zBMP2 Spromoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule DNA to be.mutated. The.codon(s) in the zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG or blocker molecule DNA to be mutated are identified.- There -must be'a unique restriction endonuclease site on each side of the identified mutation site(s). If no such restriction sites exist, they may be generated using the abovedescribed oligonucleotide- mediated mutagenesis method to introduce them at appropriate locations in the zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG and blocker molecule DNA. The plasmid DNA is cut at these sites to linearize it. A double-stranded oligonucleotide encoding the sequence of the DNA between the restriction sites but containing the desired mutation(s) is synthesized WO 01/48224 PCT/AU00/01596 32 using standard procedures, wherein the two strands of the oligonucleotide are synthesized separately and then hybridized together using standard techniques. This double-stranded oligonucleotide is referred to as the cassette. This cassette is designed to have 5' and 3' ends that are compatible with the ends of.the linearized plasmid, such that it can be directly ligated to the plasmid. This plasmid now contains the mutated zBMP2 .promoter, SMAD promoter, goosecoid promoter, HoxCG, or blocker molecule DNA sequence.

zBMP2 promoter, .SMAD promoter, goosecoid promoter, HoxCG, and blocker molecule DNA, whether cDNA or genomic DNA or a product of in vitro synthesis, is ligated into a replicable vector for further cloning or for expression. "Vectors" are plasmids and other DNA's that are capable of replicating autonomously within a host cell, and as .such, are useful for performing two functions in conjunction with compatible host cells (a vector-host system). One function is to facilitate the cloning of the nucleic acid that encodes the zBMP2 promoter, SMAD promoter, goosecoid promoter, HoxCG, and blocker molecule, to produce usable quantities of the nucleic acid.

The other. function is to direct .the..expression of.HoxCG.

One or both of.these functions are performed by the vectorhost system. The vectors :will. contain different components depending upon the function they are toperform as well as the host cell with which they are to-be used for cloning or expression.

To produce HoxCG, an expression vector will contain nucleic acid that encodes HoxCG as described above.

The HoxCG of this invention may be expressed directly in recombinant cell culture, or as a fusion with a heterologous polypeptide, preferably a signal sequence or other polypeptide having a specific cleavage site at the junction between the heterologous polypeptide and the HoxCG.

In one example of recombinant host cell WO 01/48224 PCT/AU00/01596 33 expression, cells are transfected with an expression vector comprising HoxCG DNA and the HoxCG encoded thereby is recovered from the culture medium in which the recombinant host cells are grown. But the expression vectors and methods disclosed herein are suitable for use over a wide range.of prokaryotic and eukaryotic organisms.

Prokaryotes may be used for the initial cloning of DNA's and the construction of the vectors useful in the invention. However, prokaryotes may also be used for expression of mRNA or protein encoded by HoxCG.

Polypeptides that are produced in-prokaryotic host cells typically will be non-glycosylated.

Plasmid or viral vectors containing replication origins and other control sequences that are derived from species compatible with the host cell are used in connection with prokaryotic host cells, for cloning or expression of an isolated DNA. For example, E. coli typically is transformed using pBR322 a plasmid derived from an E. coli species. Bolivar et al., Gene 2:95-113 (1987). PBR322 contains genes for ampicillin and tetracycline resistance so that cells transformed by the plasmid can easily be identified or selected. For it to serve as an expression vector, the.pBR322 plasmid, or other plasmid or viral vector,-must also contain, or be modified to contain, a promoter that functions in.the host. cell to provide messenger RNA (mRNA) transcripts of a::'DNA inserted downstream of the promoter. Rangagwala et al., Bio/Technology 9:477-479 (1991).

In addition to prokaryotes, eukaryotic microbes, such as yeast, may also be used as hosts for the cloning or expression of DNA's useful in the invention. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used eukaryotic microorganism. Plasmids useful for cloning or expression in yeast cells of a desired DNA are well known, as are various promoters that function in yeast cells to produce mRNA transcripts.

Furthermore, cells derived from multicellular WO 01/48224 PCT/AU00/01596 34 organisms also may be used as hosts for the cloning or expression of DNA's useful in the invention. Mammalian cells are most commonly used, and the procedures for maintaining or propagating such cells in vitro, which procedures are commonly referred to as tissue culture, are -well known. Kruse Patterson, eds., Tissue Culture (Academic Press, 1977). Examples of useful mammalian cells are human cell lines such as 293, HeLa, and WI-38, monkey cell lines such as COS-7 and VERO, and hamster cell lines such as BHK-21 and CHO, all of which are publicly available from the American Type Culture Collection (ATCC), Rockville, Maryland 20852.USA.

Expression vectors, unlike cloning vectors, should contain a promoter that is recognized by the host organism and is.operably linked to the HoxCG nucleic acid.

Promoters are untranslated sequences that are located upstream from the start codon of a gene and that control transcription of the gene (that is, the synthesis of mRNA)i.

Promoters typically fall into two classes, inducible and constitutive. Inducible promoters are promoters that initiate high level transcription of the DNA under their control in response to some change in culture conditions, for.:example, the presence or absence of a nutrient or a change in temperature.

A-large number.of .promoters .are.known, that may be operably linked.to HoxCG DNA.to achieve.:expression of HoxCG in a host cell. This is not to say that the promoter associated with naturally occurring HoxCG DNA is not usable. However, heterologous promoters generally will result in greater transcription and higher yields of expressed HoxCG.

Promoters suitable for use with prokaryotic hosts include the P-lactamase and lactose promoters, Goeddel et al., Nature 281:544-548 (1979), tryptophan (trp) promoter, Goeddel et al., Nuc. Acids Res. 8:4057-4074 (1980), and hybrid promoters such as the tac promoter, deBoer et al., Proc. Natl. Acad. Sci. USA 80:21-25 (1983). However, other WO 01/48224 PCT/AU00/01596 35 known bacterial promoters are suitable. Their nucleotide sequences have been published, Siebenlist et al., Cell 20:269-281 (1980), thereby enabling a skilled worker operably to ligate them to DNA encoding HoxCG using linkers or adaptors to supply any required restriction sites. See Wu et al., Meth. Enz. 152:343-349 (1987).

Suitable promoters for use with yeast hosts include the promoters for 3-phosphoglycerate kinase, Hitzeman et al., J. Biol. Chem. 255:12073-12080 (1980); Kingsman et al., Meth. Enz. 185:329-341 (1990), or other glycolytic enzymes such as enolase, glyceraldehyde-3phosphate dehydrogenase,.hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, .triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Dodson et al., Nuc. Acids res. 10:2625-2637 (1982); Emr, Meth. Enz. 185:231-279 (1990).

Expression vectors useful in mammalian cells typically include a promoter derived from a virus. For example, promoters derived from polyoma virus, adenovirus, cytomegalovirus (CMV), and simian virus 40 (SV40) are commonly used. Further, it is also possible, and often desirable, to utilize promoter or other control sequences associated with a naturally occurring DNA that encodes HoxCG, provided that such pontrol..sequences are functional in the particular host cell used for recombinant DNA expression. In particular, in the present invention it may be desirable to utilize the zBMP2 promoter or SMAD promoter or goosecoid.promoter such that a spatio-temporal expression of the HoxCG occurs.

Other control sequences that are desirable in an expression vector in addition to a promoter are a ribosomebinding site, and in the case of an expression vector used with eukaryotic host cells, an enhancer. Enhancers are cis-acting elements of DNA, usually about from 10-300 bp, that act on a promoter to increase the level of transcription. Many enhancer sequences are now known from WO 01/48224 PCT/AU00/01596 36 mammalian genes (for example, the genes for globin, elastase, albumin, a-fetoprotein and insulin). Typically, however, the enhancer used will be one from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. See Kriegler, Meth. Enz. 185:512-527 (1990).

Expression vectors may also contain sequences necessary for the termination of transcription and for stabilizing the messenger RNA (mRNA). Balbas et al., Meth.

Enz. 185:14-37 (1990); Levinson, Meth. Enz. 185:485-511 (1990). In the case of expression vectors used with eukaryotic host.:cells, such transcription termination sequences may be obtained from the untranslated regions of eukaryotic or viral DNA's or cDNAs. These regions contain polyadenylation sites as well as transcription termination sites. Birnsteil et al., Cell 41:349-359 (1985).

In general, control sequences are DNA sequences necessary for the expression.of an operably linked coding sequence in a particular host cell. "Expression" refers to transcription and/or translation. "Operably linked" refers to the covalent joining of two or more DNA sequences, by means of enzymatic ligation or otherwise, -in a configuration relative to one another such that the normal .function of thesequences can be performed. For example, DNA for a pre-sequence or secretory leader is :operably linked to DNA for..a.polypeptide.if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading frame.

WO 01/48224 PCT/AU00/01596 37 Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used, in conjunction with standard recombinant DNA methods.

Expression and cloning vectors also will contain a sequence that enables .the vector to replicate in one or more selected host cells. Generally, in cloning vectors this sequence is one that enables the vector to replicate independently of the host chromosome(s), and includes origins of replication or.autonomously replicating sequences. Such sequences-.are well.known for a variety of bacteria, yeast, .and viruses.. The origin of.replication from the plasmid pBR322 is suitable for-most gram-negative bacteria, the 2. plasmid origin is suitable for yeast, and various.viral origins (for example, from SV40, polyoma, or adenovirus) are useful for cloning vectors in mammalian cells. Most expression vectors are "shuttle" vectors, i.e., they are capable of replication in at least one class of organisms but can be transfected into another organism for expression. For example, a vector may be cloned in E. coliand then the same vector is transfected into yeast or mammalian cells for expression even though it is not capable of replicating independently of the host cell chromosome.

The expression vector may also include .an amplifiable gene, such'as that comprising the :coding sequence for dihydrofolate reductase (DHFR). Cells .containing an expression vector that includes a DHFR gene may be cultured in the presence of methotrexate, a competitive antagonist of DHFR. This leads to the synthesis of multiple copies of the DHFR gene and, concomitantly, multiple copies of other DNA sequences comprising the expression vector, Ringold et al., J. Mol.

Apl. Genet. 1:165-175 (1981), such as a DNA sequence encoding HoxCG. In that manner, the level of HoxCG produced by the cells may be increased.

DHFR protein encoded by the expression vector WO 01/48224 PCT/AU00/01596 38 also may be used as a selectable marker of successful transfection. For example, if the host cell prior to transformation is lacking in DHFR activity, successful transformation by an expression vector comprising DNA sequences encoding HoxCG and DHFR protein can be determined by cell growth in medium containing methotrexate. Also, mammalian cells transformed by an expression vector comprising DNA sequences encoding HoxCG, DHFR protein, and aminoglycoside 3' phosphotransferase (APH) can be determined by cell growth in medium containing an aminoglycoside antibiotic such as kanamycin or neomycin.

Because eukaryotic cells do not normally express an endogenous APH activity, genes encoding APH protein, commonly referred to as neor genes, may be used as dominant selectable markers in a wide range of eukaryotic host cells, by which cells transfected by the vector can easily be identified or selected. Jiminez et al., Nature, 287:869-871 (1980); Colbere-Garapin et al., J. Mol. Biol.

150:1-14 (1981); Okayama Berg, Mol. Cell. Biol., 3:280- 289 (1983).

Many other selectable markers are known that may be used for identifying and isolating recombinant host cells that express HoxCG. For example, a suitable selection marker for use in yeast is the trpl gene present in the yeast plasmid YRp7. Stinchcomb et al., Nature 282:39-43 (1979); Kingsman et al., Gene 7:141-152 (1979); Tschemper et al., Gene 10:157-166 (1980). The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 (available from the American Type Culture Collection, Rockville, Maryland 20852 USA). Jones, Genetics 85:12 (1977). The presence of the trpl lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan. Similarly, Leu2-deficient yeast strains (ATCC Nos. 20622 or 38626) are complemented by known plasmids bearing the Leu2 gene.

WO 01/48224 PCT/AU00/01596 39 Particularly useful in the invention are expression vectors that provide for the transient expression in mammalian cells of DNA encoding HoxCG. In general, transient expression involves the use of an expression vector that is able to efficiently replicate in a host cell, such that the host cell accumulates many copies of the expression vector and, in turn, synthesizes high levels of a desired polypeptide encoded by the expression vector. Transient expression systems, comprising a suitable expression vector .and a host cell, allow for the convenient positive identification of polypeptides encoded by cloned DNA's, .as well as for the rapid screening of such polypeptides for desired biological or physiological properties. Yang et al., Cell 47:3-10 (1986); Wong et al., Science 228:810-815 (1985); Lee et al., Proc. Nat Acad. Sci. USA 82:4360-4364 (1985). Thus, transient expression systems are particularly useful in the invention for expressing DNA's encoding amino acid sequence variants of HoxCG, to identify those variants which are functionally active.

Since it is often difficult to predict in advance the characteristics of an amino acid sequence variant of HoxCG, it will be appreciated that some screening of such variants will be needed to identify those that are functionally active. Such screening may be performed in vitro, using routine assays for receptor binding, or assays for cell proliferation, cell differentiation or cell viability, or using immunoassays with monoclonal antibodies that selectively bind to HoxCG that effect the functionally active HoxCG, such as a monoclonal antibody that selectively binds to the active site or receptor binding site of HoxCG.

As used herein, the terms "transformation" and "transfection" refer to the process of introducing a desired nucleic acid, such a plasmid or an expression vector, into a host cell. Various methods of transformation and transfection are available, depending on WO 01/48224 PCT/AU00/01596 40 the nature of the host cell. In the case of E. coli cells, the most common methods involve treating the cells with aqueous solutions of calcium chloride and other salts.

In the case of mammalian cells, the most common methods are transfection mediated by either calcium phosphate or DEAEdextran, or electroporation. Sambrook et al., eds., Molecular Cloning, pp. 1.74-1.84 and 16.30-16.55 (Cold Spring Harbor Laboratory Press, 1989). Following transformation or transfection, the desired nucleic acid may integrate into the host cell genome, or may exist as an extrachromosomal element.

Host cells that are transformed or transfected with the above-described plasmids and expression vectors are cultured in conventional nutrient media modified as is appropriate for inducing.promoters or selecting for drug resistance or some other selectable marker or phenotype.

The culture conditions, such as temperature, pH, and the like, suitably are those previously used for culturing the host cell used for cloning or expression, as the case may be, and will be apparent to those skilled in the art.

Suitable host cells for cloning or expressing the vectors herein are prokaryotes, yeasts, and higher eukaryotes, including insect, oysters, lower vertebrate, and mammalian host cells. Suitable prokaryotes include eubacteria, such as Gram-negative or Gram-positive organisms, for example, E. coli, Bacillus species such as B. subtilis, Pseudomonas species such as P. aeruginosa, Salmonella typhimurium, or Serratia marcescans.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable hosts for zBMP2, HoxCG and blocker molecule-encoding vectors.

Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe, Beach and Nurse, Nature 290:140-142 (1981), Pichia pastoris, Cregg et al., WO 01/48224 PCT/AU00/01596 41 Bio/Technology 5:479-485 (1987); Sreekrishna, et al., Biochemistry 28:4117-4125 (1989), Neurospora crassa, Case, et al., Proc. Natl. Acad. Sci. USA 76:5259-5263 (1979), and Aspergillus hosts such as A. nidulans, Ballance et al., Biochem. Biophys. Res. Commun. 112:284-289 (1983); Tilburn et al., Gene 26:205-221 (1983); Yelton et al., Proc. Natl.

Acad. Sci. USA 81:1470-1474 (1984), and A. niger, Kelly et al., EMBO J. 4:475-479 (1985).

Suitable host cells for the expression of HoxCG also are derived from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is useable, whether from vertebrate or invertebrate culture. It will be appreciated, however, that because of the species-, tissue-, and cell-specificity of glycosylation, Rademacher et al., Ann. Rev. Biochem.

57:785-838 (1988), the extent or pattern of glycosylation of HoxCG in a foreign host cell typically will differ from that of HoxCG obtained from a cell in which it is naturally expressed.

Examples of invertebrate cells include insect and plant cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori host cells have been identified. Luckow et al., Bio/Technology 6:47-55 (1988); Miller et al., in Genetic Engineering, vol. 8, pp.277-279 (Plenum Publishing, 1986); Maeda et al., Nature 315:592-594 (1985).

Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can be utilized as hosts. Typically, plant cells are transfected by incubation with certain strains of the bacterium Agrobacterium tumefaciens. During incubation of the plant cells with A. tumefaciens, the DNA is transferred into cells, such that they become transfected, and will, under WO 01/48224 PCT/AU00/01596 42 appropriate conditions, express the introduced DNA. In addition, regulatory and signal sequences compatible with plant cells are available, such as the nopaline synthase promoter and polyadenylation signal sequences, and the ribulose biphosphate carboxylase promoter. Depicker et al., J. Mol. Appl. Gen. 1:561-573 (1982). Herrera-Estrella et al., Nature 310:115-120 (1984). In addition, DNA segments isolated from the upstream region of the T-DNA 780 gene are capable of activating or increasing transcription levels of plant-expressible genes in recombinant DNAcontaining plant tissue. European .Pat. Pub...No. EP 321,196 (published June 21, 1989).

However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue .culture) has become a routine procedure in recent years. Kruse Patterson, eds., Tissue Culture (Academic Press, 1973). Examples of useful mammalian host cells are the monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line 293 (or 293 cells subcloned for growth in suspension culture), Graham et al.,: J. Gen Virol. 36:59-72 (1977); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells (including DHFR-deficient CHO cells, Urlaub et al., Proc. Natl. Acad.

Sci. USA 77:421.6-4220 (1980); mouse sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980); monkey kidney cells (CV1, ATCC CCL 70); African green monkey:kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).

Construction of suitable vectors containing the nucleotide sequence encoding HoxCG and appropriate control sequences employs standard recombinant DNA methods. DNA is WO 01/48224 PCT/AU00/01596 43 cleaved into fragments, tailored, and ligated together in the form desired to generate the vectors required.

For analysis to confirm correct sequences in the vectors constructed, the vectors are analyzed by restriction digestion (to confirm the presence in the vector of predicted restriction endonuclease) and/or by sequencing by the dideoxy chain termination method of Sanger et al., Proc. Nat. Acad. Sci. USA 72:3918-3921 (1979).

The mammalian host cells used to produce the HoxCG of this invention may be cultured in a variety of media. Commercially available media such as Ham's (Sigma), Minimal Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are suitable for culturing the host cells. In addition, any of the media described in Ham, et al., Meth.

Enz. 58:44-93 (1979); Barnes et al., Anal. Biochem.

102:255-270 (1980); Bottenstein et al., Meth. Enz. 58:94- 109 (1979); U.S. Pat. Nos. 4,560,655; 4,657,866; 4,767,704; or 4,927,762; or in PCT Pat. Pub. Nos. WO 90/03430 (published April 5, 1990), may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics, trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The host cells referred to in this disclosure WO 01/48224 PCT/AU00/01596 44 encompass cells in culture in vitro as well as cells that are within a host animal, for example, as a result of transplantation or implantation.

It is further contemplated that the HoxCG of this invention may be produced by homologous recombination, for example, as described in PCT Pat. Pub. No. WO 91/06667 (published May 16, 1991). Briefly, this method involves transforming cells containing an endogenous gene encoding HoxCG with a homologous DNA, which homologous DNA comprises an amplifiable gene, such as DHFR, and at least one flanking sequence, having a length of at least about 150 base pairs, which is homologous with a nucleotide sequence in the cell genome that is within or in proximity to the gene encoding HoxCG. The transformation is carried out under conditions such that the homologous DNA integrates into the cell genome by recombination. Cells having integrated the homologous DNA then are subjected to conditions which select for amplification of the amplifiable gene, whereby the HoxCG gene amplified concomitantly. The resulting cells then are screened for production of desired amounts of HoxCG. Flanking sequences that are in proximity to a gene encoding HoxCG are readily 7 identified, for example, by the method of genomic walking, using as a starting point the HoxCG nucleotide sequence set forth in SEQ ID NO.:23 and.SEQ ID NO.:24. See Spoerel et al., Meth. Enz. 152:598-603 (1987).

Gene amplification and/or gene expression may be measured in a sample directly, for example, by conventional Southern blotting to quantitate DNA, or Northern blotting to quantitate mRNA, using an appropriately labeled oligonucleotide hybridization probe, based on the sequences provided herein. Various labels may be employed, most commonly radioisotopes, particularly 32p. However, other techniques may also be employed, such as using biotinmodified nucleotides for introduction into a polynucleotide. The biotin then serves as the site for binding to avidin or antibodies, which may be labeled with WO 01/48224 PCT/AU00/01596 45 a wide variety of labels, such as radioisotopes, fluorophores, chromophores, or the like. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn.may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.

Gene expression, alternatively, may be measured by immunological methods, :such.as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of the gene product, HoxCG. With immunohistochemical staining techniques, a cell sample.is prepared, typically by dehydration and fixation, followed by reaction with labeled antibodies specific for the gene product coupled, where the labels are usually visually detectable, such as enzymatic labels, fluorescent labels, luminescent labels, and the like. A particularly sensitive staining technique suitable for use in the present invention is described by Hsu et al., Am. J. Clin. Path., 75:734-738 (1980). Antibodies useful.for.immunohistochemical staining and/or assay of sample .fluids may be either monoclonal or polyclonal.

Conveniently, the antibodies may be prepared against a synthetic peptide based on .the DNA sequences provided herein.

Throughout the description and claims of this .specification,.the word "comprise" and variations of the word, such as "comprising" and "comprises", means "including but not limited to" and is not intended to exclude other additives, components, integers or steps.

The invention will now be further described by way of reference only to the following non-limiting examples. It should be understood, however, that the examples following are illustrative only, and should not be taken in any way as a restriction on the generality of the WO 01/48224 PCT/AU00/01596 46 invention described above. Amino acid sequences referred to herein are given in standard single letter code.

Example 1 Isolation of Stage-specific Promoters for a Sterile Feral Construct In order to identify a good candidate promoter and/or gene for the proposed construct, the applicant examined a number of animals, both vertebrate and invertebrate. The applicant finally decided on the wellstudied model for fish, the zebrafish .(Brachydanio rerio).

This fish model was chosen as it is reasonably.well characterized, and the fish are.small and relatively easily breed and reared. Moreover, the zebrafish has a high degree of nucleotide and amino acid sequence homology to most other fish species studied, and as will be shown later, a reasonably high degree of sequence homology with other non-fish species. This degree of similarity can permit the identification of genes in other species by comparison with those of zebrafish. Accordingly, it was considered, that this model was most appropriate for locating and testing a promoter which may function across all species. At least it was a useful model for testing the broad "sterile feral construct" concept.

The applicant examined mutant screens in zebrafish for a target gene that was essential.-for a short period in larval development, but which had-no adult functions. The applicant focused on 6 mutations that cause .dorso-ventral patterning defects .(Mullins et al 1996), and in particular on the swirl mutant, which exhibits severe dorsalization and the complete lack of ventral structures such as blood and pronephros. Swirl encodes the zebrafish homologue of BMP2 and was named zBMP2 (Kishimoto et al., 1997). In zebrafish the dorsalised swirl mutant phenotype is rescued by injection of zBMP2 mRNA at the single cell stage (Kishimoto et al., 1997), which indicates that the gene is essential only during early larval development and plays no maternal role. BMPs (Bone Morphogenetic Proteins) WO 01/48224 PCT/AU00/01596 47 are a subfamily of the larger transforming growth factor beta (TGF-P) superfamily of signalling molecules that play a central role in establishing the early animal body plan and in.organogenesis (Hogan, 1996).

The cDNA for the zBMP2 gene was obtained from M.

Hammerschmidt (Max Plank Institute, Frieburg) as a 1,732 bp fragment subcloned into a plasmid designated pzBMP2b. This plasmid was transformed into XL-1 blue strain of E. coli :according to the instructions of the supplier (Stratagene).

A resulting positive clone carrying the plasmid was grown according to standard protocols, and the cDNA from the bacterial culture was isolated by standard procedures.

After digestion with EcoRI, a 422 bp fragment spanning the untranslated region was isolated and labelled with 32

P.

This was then used as a probe for a zebrafish genomic library.

The zebrafish genomic BAC library was purchased in the form of arrayed filter sets, from Genome Systems Inc (GSI), and screened using the labelled probe by standard hybridization techniques as described previously. Five positive clones (BMP-BAC5, BMP-BAC10, BMP-BAC15, BMP-BAC17, and BMP-BAC21) were then purchased from Genome Systems Inc (GSI). Preliminary sequencing of all five positive BAC clones using primers specific of the 5'-untranslated region of the cDNA revealed that ;the clones-were identical to each other and to the region of the BMP2 cDNA. Two of the BAC clones (BMP-BAC5 and BMP-BAC10) were subcloned as HindIII fragments into pGEM-7ZF(+) by standard procedures. We obtained 6,915 bp of sequence from these clones which represented from -3879 to +3035bp relative to the translation start site. The coding sequence obtained was identical to the zebrafish zBMP2 cDNA sequence previously described by Nikido et al. (1997) and Lee et al. (1998).

This suggested that BAC 5 and 10, and perhaps the remaining three BAC clones, contained authentic zebrafish BMP2 genomic DNA. However, based on the genomic sequences we obtained, the previously designated start site, at 376 bp WO 01/48224 PCT/AU00/01596 48 in the cDNA (Lee et al., 1998), lies in the second exon and the first exon is untranslated.

Further definition and isolation of the zBMP2 promoter was accomplished by sequencing these HindIII subclones to isolate candidate fragments which resided of the sequence homologous to the cDNA coding for zBMP2 gene. One of these subclones had a 5,901bp insert that was positive for zBMP2 gene. Figure 1 shows the resultant plasmid pBAC5/H11. The insert was also found to include a 1,414bp region that was 5' of the presumptive start codon of zBMP2, and which was considered to be a possible location of the zBMP2 promoter. A 1,414 bp fragment was excised from pBAC5/Hll with SmaI/EcoRI and subcloned into the multiple cloning site of pBluescript-II-SK. This fragment contained the putative zBMP2 promoter from about bp 5' of the first splice site. A SacI-KpnI fragment was then excised from this plasmid and directionally cloned into pGEM-EGFP containing the modified GFP reporter gene (GM2, see Cormack et al., 1996) resulting in the construct pzBMP2(1.4)-EGFP as shown in Figure 2.

We considered that the control of expression of zBMP2 gene likely resided in this SacI-KpnI fragment, and would be useful in controlling the "Sterile-Feral" construct. However, we are sure that any promoter with an appropriate spatial-temporal pattern could be used in the final "Sterile-Feral" construct. The construct pzBMP2(1.4)-EGFP was inserted into zebrafish embryos to test whether it followed a similar spatial-temporal expression pattern as reported for the zBMP2 promoter.

This construct and all subsequent constructs were prepared using the following procedures and introduced into the developing embryos by microinjection.

All the DNA preparations were appropriately linearized and gel purified (Qiaquick Gel Extraction Kit) before injection. Needles were made from borosilicate glass capillaries with filaments (GC100TF-15, Clark Electromedical instruments) using a P-80PC micropipette WO 01/48224 PCT/AU00/01596 49 puller (Sutter Instrument The needle was backfilled with purified DNA diluted to 100ng/gl in 1X injection buffer (10X; 50mM Tris; 5mM EDTA;1M KC1, pH7.2) using a hand pulled pipette. Injections were carried out on a dissection microscope fitted with two, 3-dimensional .Narshige MN-151 micromanipulators. Embryos were held in place during injection by a hydraulically (mineral oil) driven holding pipette. Injection of DNA solution was facilitated pneumatically using a 3-way foot operated plunge valve (Festo Engineering), connected between the injection needle holder and nitrogen tank. Injection was performed on one-cell.stage :embryos, unless .specifically indicated otherwise. Injected embryos were incubated and reared as described above.

Post-injection, early-stage embryos were examined under UV illumination in a Zeiss microscope equipped with standard fluorescent isothiocynate (FITC) filter set, while later-stage embryos were anaesthetized in embryo medium containing 0.125%, 2-phenoxyethanol (Sigma P-1126), before: examination. Photomicrographs of embryos expressing EGFP were obtained for analysis.

Table 1 summarises the injection trials. The percentage of embryos expressing EGFP at 10h post injection varied from batch to batch, ranging from 0% to 42.7%.

Expression was detectable as early as dorsal shield stage (6h pi) in most of.the expressing embryos. At pi, the majority of the.expressing embryos had expression that was limited to anterior ventral regions (Figure 3a); however, 3 embryos expressed EGFP all along the ventral margin (Figure 4a). The patchiness is typical of the mosaic expression expected in founder transgenic animals. Nonetheless, expression domains extended from polster region (Figure 3a;PO) anteriorly to the region of future tail bud, posteriorly (Figure 3a;TB).

WO 01/48224 WO 0148224PCT/AUOO/015%6 Table 1 50 Results of EGFP expression in embryos injected with pzBmp2(l.4)-EGFP at about 9.5-10h Post Injection Batch 1 2 3 4 Number observed 28 21 20 28 Total No.

with Expression 0 .3 2 12 Number with Anterioventral expression 0 2 No. with entire ventral domain 0 2 2 WO 01/48224 PCT/AU00/01596 51 At about 24h pi, expression was predominantly in the ventral domains (Figure 5a), mimicking the native zBMP2 expression in the region of the developing eye, otic vesicle, and pectoral fin bud. Abolition of tail bud expression at 24h pi suggests that the cloned promoter may lack regulatory elements responsible for maintenance of BMP2 expression at this stage. No EGFP expression was detected by 48h pi, suggesting that the zBMP2 gene is not required this late in development.

The zBMP2 promoter sequence is shown in SEQ ID NO: 1.

Example 2 Isolation of Second Promoter for Sterile Feral Construct As the applicant was concerned about the potential shortcomings/delays of the BMP2 promoter in combination with a tet-responsive (tetOff) element to effectively block its own native transcripts, an early acting, but temporally restricted promoter sharing spatial domains with that of BMP2 was considered preferable. One such candidate was the zebrafish SMAD5. Similar to BMP2, mutation in the zebrafish SMAD5 results in a dorsalized mutation designated somitabun (sbn) and the dorsalised mutant phenotype has been shown to be rescued by injection of SMAD5 mRNA at the single cell:stage (Hild..et al., 1999).

This indicated that the gene.is.essential only.:during early larval development. It has also been implied that the acts as a transducer of BMP2 signalling with potential upstream and downstream functions. The functional association between the BMP2 and SMAD5 suggested that the two genes share the same spatial expression domains. Further the maternal expression of SMAD5 and also the relative early onset of zygotic SMAD5 expression ensure that the cells are competent to process BMP2 signalling (Hild et al., 1999; Dick et al., 1999). Therefore, we considered that by employing a SMAD5 promoter to drive the expression of a BMP2 blocker would alleviate some of the WO 01/48224 PCT/AU00/01596 52 potential temporal delays associated with employing the BMP2 promoter.

The cDNA for the SMAD5 gene was amplified from zebrafish shield stage cDNA using following primers SMADul: 5'-TGCAGGTGGACTTTGGATCCG-3' SEQ. ID. NO.:4 SMADL1: 5'-GCCTAAAGGCAACAGATGCTA-3' SEQ. ID. The primers were designed based on the published zebrafish SMAD5 cDNA sequences (Hild et al., 1999). The amplified 2285 bp product was cloned into pGem-T-Easy vector as per the cloning instructions-of the.manufacturer (Promega, Madison USA) and confirmed by sequencing. A resulting positive clone carrying the plasmid was grown according to standard protocols, and the cDNA from the bacterial culture was isolated by standard procedures. A 366 bp fragment spanning the 5' untranslated region was isolated and labelled with 2"P. This was then used as a probe for a zebrafish genomic library.

Four positive clones (SMAD-BAC1, SMAD-BAC8, SMAD- BAC13, and SMAD-BAC 17) were then purchased from GSI.

Preliminary sequencing of all four positive BAC clones using primers specific of the 5'-untranslated region of the cDNA revealed that the clones were identical to each other and to the region of the BMP2 cDNA. One of the BAC clones (SMAD-BAC51) was subcloned.as.-HindIII fragments into pGEM- 7ZF(+) by standard procedures. We obtained a positive subclone of about 8 KB (psBACl/H12), that contained 1,005 bp of putative promoter sequence 5' of the start codon.

The coding sequence obtained was identical to the zebrafish cDNA sequence previously described by Hild et al.

(1999).

A 1,005 bp putative promoter fragment was then amplified from psBAC1/H12 with the following primers M13 forward: 5'-GTAAAACGACGGCCAGT SEQ ID NO:6 SMAD L2: 5'-TAGTGCTGGGCTGCACCAG SEQ ID NO:7 WO 01/48224 PCT/AU00/01596 53 The amplified fragment was ligated into pGEM- Teasy vector and the orientation and sequence confirmed The promoter was again excised as SmaI/EcoRI fragment, blunt ended and ligated into the SmaI linearized pGEM-EGFP. A positive clone, pSMAD5-EGFP (Figure 6) in the correct orientation was selected and tested in vivo in zebrafish embryos.

Injection trials of pSMAD5-EGFP into the zebrafish embryo resulted in expression of the EGFP as early as 4 hp. The expression pattern was ubiquitous initially as late as shield stage (Figure then predominantly restricting to ventral tissues at about 24 hpi (Figure The experimental evidence suggested that the zygotic expression of SMAD5 was activated marginally ahead of zBMP2. Although preliminary, our promoter analysis experiments suggested that the SMAD5 promoter was indeed activated slightly ahead of bmp2 promoter (data not shown). No EGFP expression was detected by 48hpi, suggesting.that the SMAD5 gene was not required this late in development.

The zebrafish SMAD5 promoter sequence is shown in SEQ ID NO; 8.

Example 3 Zebrafish Model Breeding and rearing protocols for zebrafish generally follow Westerfield (1995). Stock was obtained from a local pet store; however, it would be appreciated by those skilled in the art that zebrafish could equally be obtained from laboratories around the world Institute of Neuroscience, eugene, Oregon, USA) and maintained at 27-28 0 C in an in-house re-circulatory flowthrough system. Embryos were obtained by natural matings, transferred into Embryo Medium (Westerfield, 1995), and incubated in a bench top incubator at 26-27 0 C until 3-4 days old. They were then transferred into nursery tanks maintained at 27-28 0 C, and reared on finely ground WO 01/48224 PCT/AU00/01596 54 commercial fish flakes (Tetramin), and live Artemia.

After approximately 3 months, the fish were transferred into standard fish tanks alongside the adult fish. The adult fish were.fed daily with flakes and occasionally supplemented with either freshly hatched or frozen Artemia.

Example 4 Blocking Expression of zBMP2 The applicant tested three options for blocking expression of the candidate genes: mis/over-expression of sense (see below), antisense (Izant and Weintraub .1984) and double stranded RNA (dsRNA). (Guo and Kemphues, 1995). The latter appears to be more-potent than antisense at inducing interference in C. elegans (Fire et al., 1998) and has been employed to silence native and reporter genes in plants (Waterhouse et al., 1998). To develop and optimise the blocking component of.the "sterile feral" construct, the applicant assayed sense, antisense, and dsRNA of zBMP2 by injection in zebrafish embryos. Results indicated that both antisense and dsRNA block gene expression, whereas sense strand injection resulted in over-expression.

Capped full-length sense and antisense zBMP2 RNA transcripts were generated by linearizing the plasmid pzBMP2b, whereas the truncated versions of just the or the.3'-regions were generated by appropriately linearised pzBMP2-ApaI or pzBMP2-BstXI, .respectively. .All in vitro transcriptions were carried out..using T3/T7,mMESSAGE mMACHINE TM (Ambion), as appropriate. dsRNA was prepared by annealing sense and antisense RNA in RNAase free injection buffer at 37C for 5 minutes for the truncated and minutes for the full-length transcripts. Annealing of respective sense and antisense strands as dsRNA was confirmed by running a sample on a non-denaturing agarose gel. About 3-5 picolitres of RNA solutions, ranging between 100-250ng/pl, were injected into 1-2 cell stage embryos as described above in Example 1. In the case of 2cell stage injections, both the cells were injected.

In embryos injected with full-length antisense or WO 01/48224 PCT/AU00/01596 55 dsRNA of zBMP2, the proportion of normal embryos was significantly reduced and some weakly dorsalised embryos resembling zebrafish swirl mutant were seen (Figure 9a&b).

Sense injections resulted in mild ventralization of the embryos, which in some cases resembled the zebrafish chordino mutant phenotype (Figure 10). Chordino is the dorsally expressing zebrafish homologue of chordin, known to interact antagonistically with BMPs (in this case swirl) in a dose dependent manner (Kishimoto et al., 1997).

To obtain molecular data to support hypothesised interference of the dsRNA on expression of zBMP2, the applicant injected truncated forms of zBMP2 dsRNA, so as to use the uninjected portion as probe to detect and quantify the native transcript levels in the injected embryos. The percentage of deformed embryos in groups injected with 3'zBMP2 and 5'-zBMP2 dsRNA was 43.4% and 40.2%, as compared to 9.2% and 2.4% in the corresponding controls (Table 2).

WO 01/48224 WO 0148224PCT/AUOO/01596 56 Table 2 Results of Truncated zBMP2 dsRNA Into One-Cell Stage Embryos Inj ection Transcript Injected 3' z.BKP2 Control -zBMP Control Conc. ng/g~l Number injected Number survivors Number deformed* 150 0 250 0 123 66 88 53 83 (67.5) 54 (81.8) 67 (76.1) 42 (79.2) 36 (43.4) (9.2) 27 (40.2) 1 (2.4) *Results in parenthesis indicate percentages WO 01/48224 PCT/AU00/01596 57 Example 5 Combined Promoter and Blocker DNA Construct On confirming the ability of in vitro transcribed BMP2 antisense and double stranded transcripts to disrupt larval development, DNA constructs capable of expressing the antisense and double stranded transcripts in vivo were developed and tested.

A 711 bp ApaI fragment of the zBMP2 cDNA was excised from the plasmid pzBMP2b and inserted into the Apal linearized pzBMP2(1.4)-EGFP resulting in the pzBMP2As-EGFP (Figure 11). Antisense orientation of zBMP2 fragment in pzBMP2AS-EGFP was confirmed both by restriction analysis and sequencing. The pzBMP2As-EGFP was a.fusion construct capable of co-expressing BMP2 antisense and EGFP. Coexpression of EGFP.with the BMP2 antisense provided an easily detectable marker to distinguish the mutant embryos emanating from antisense interference and those potentially resulting from spontaneous or background mutations.

pzBMP2AS-EGFP was linearized with NotI for injection into the embryos.

For the double stranded knockout, four segments of the zBMP2 gene were arranged to express double stranded mRNA in vivo (Figure 12). The first section comprised the.

1,414 bp "HindIII-EcoRI" promoter region retained in the pGEM 7zf(+) vector backbone, obtained by excising the EcoRI-SacI coding region of the: zBMP2 from .subclone. The second segment was .a 510bp .fragment of the zBMP2 cDNA from sequence 301-810 in the published cDNA sequence (Lee et al., .1998). This fragment was amplified using the following primers: zfEx l-3.EcoF Forward Primer 5'-ACCCCGAATTCATGAGGAACTTAGGA-3' SEQ ID NO:9 zfExl-3.SalR Reverse Primer 5'-ATCAGCTCGTCGACAGGAATGGAGGTAAG-3' SEQ ID WO 01/48224 PCT/AU00/01596 58 *The amplified product generated had an EcoRI site on the 5'-end and a Sall site on the 3'-end for ease of cloning. The third section was a 286bp fragment of cDNA (bases 307-592) which was amplified using the following primers: Bexli.PstF 2 Forward Primer 5'-ACACCTGCAGATGAGGAACTTAGGAGACGAC-3' SEQ ID NO:11 Bexli.SalR Reverse Primer 5'-TACTGAGGGTCGACTGCCGATTTGCT-3' SEQ ID NO:12 These primers generated a PstI site on the 5' end and Sall site on the 3' end for cloning. When ligated to the second fragment, the third segment formed an inverted repeat of the 5' end of the cDNA (bases 307 through 592).

The final segment was a PstI-SacI fragment containing a poly A tail.section, excised from the pGT2-ns-GM2f construct that was kindly donated by Dr. Shou Lin, Institute..of Molecular. Medicine .and Genetics, Medical College of Georgia. The DNA sequence for the double stranded BMP2 construct is given as.SEQ ID NO:13.

Results of the BMP2 antisense-EGFP fusion construct injection are presented in the Table 3.

WO 01/48224 WO 0148224PCT/AUOO/01596 Table 3 59 Results of NotIT linearized pzBMP2-As--EGFP Injection into the one-Cell Zebrafish Embryos Batch Conc.

gig/m1 Number injected Number Survivors Number deformed* Number with EGFP expression 1. 100 0 2 100 0 3 100 0 48 36 40 29 (72.5) 36 16 (44.4) 16 9 (56.2) 20 12 23 15 (65.2) parenthesis indicate 1 (2.7) .0 6 (37.5) 0 4 (33 .3) 0 (31.3) 0 3 0 *Figures in percentages.

WO 01/48224 PCT/AUOO/01596 60 The number of deformed individuals in the injected groups ranged from 0% to 37.5%. The majority of the deformed individuals (83.3% and 75% in batches 1 and 2, respectively) expressed EGFP, indicating that the antisense was effective in disrupting the larval development. None of the individuals in the control.group and non-deformed individuals in the injected group had EGFP expression.

Results of the zBMP2-double stranded construct are given in Table 4.

WO 01/48224 PCT/AU00/01596 61 Table 4 Cell Results of pzBMP2-ds Injection into 1-4 Stage Zebrafish Embryos- Batch Treatment Number Conc. (p.g/ml Treated Number of mortality Injected Control Uninjected control dsRNA injected Uninjected control dsRNA injected 37 4 (10.8) 123 143 51 24 (20.5) 20 (14.3) 11 (17.1) Number Deformed 0 1 21 (14.7) 0 22 (45.7) 100 100 47 7 (16.5) Figures in parenthesis indicate percentages.

denotes a deformed control fish that had deformities that.

did not resemble the swirl mutants.

WO 01/48224 PCT/AU00/01596 62 Of 211 control embryos (mock-injected with buffer only or permitted to develop normally), only one embryo was deformed. The deformity did not resemble the swirl mutant. In the two dsDNA treatment groups, 14.7% and 45.7% of the embryos expressed the swirl mutation.

Example 6 The Repressible Element The proof-of-concept used a commercially available repressible element as the externally keyed genetic switch or Tet-responsive PhM'*-i promoter. PhcwV-1 contains the Tet-responsive .element (TRE) which consists of seven copies of the 42 bp.tet .operator .sequence (tetO).

This element is just upstream of the minimal CMV promoter (PmincMv), which lacks the enhancer that is part of the complete CMV promoter. Therefore, PhcMv.-i is silent in the absence of binding of transactivator protein (tTA) to the tetO. The tetracycline-sensitive element is described by Gossen and Bujard (1992; tet-off), Gossen et al. (1995; Tet-on), and Kistner et al. (1996). In the tetracyclineregulated system (Tet-Off system) developed by Hermann Bujard, addition of tetracycline (Tc) or doxycycline Dox; a: Tc derivative) prevents the binding of a tTA, to the Tetresponsive element. This then blocks..gene expression from the:TRE until the drug is removed. A complementary system has also been developed (Tet-On.system)_ In the Tet-On system, addition of doxycycline.allows the binding of a reverse transactivater, rtTA, to the tetO promoter, leading to gene expression from the TRE. Gene expression continues from the TRE until removal of the drug. A tetracycline responsive element has the advantage of ease of administering. Tetracycline is a routinely used antibiotic in fish and shellfish culture (see Stoffregan et al., 1996), readily traverses cutaneous membranes while retaining its biological activity, and can be administered by whole organism immersion. Use of the Tet-On/Off controllable expression systems is covered by US Patent number 5,464,758, assigned to BASF Aktiengesellschaft.

WO 01/48224 PCT/AU00/01596 63 The applicant first tested the functionality of the Tet-off system in zebrafish cell cultures. The cell culture was established using ZF4 cells as previously described (Driever and Rangini, 1993). Cells were transfected with the DNAs using Effectene liposomes (Qiagen) according to the manufacturer's instructions.

Cells were initially transfected with pTet-Off and placed under neomycin selection for 1 month. Neomycin-resistant cells were then transfected with pTRE-EGFP, and the selection plasmid pTK-Hyg,.and placed under hygromycin selection for two weeks. 'EGFP expression was determined by examining and counting cells. with obvious fluorescence and by examination of cell lysates using a fluorometer. Cells were grown in medium with or without doxycycline (0.2 gg/ml) for 72 h prior to assessment of gene expression, or were rinsed of doxycycline and assessed for reporter gene expression 72 h after removal of doxycycline.

In the absence of doxycycline, EGFP fluorescence was detected in a small percentage (approximately of cells (Table WO 01/48224 WO 0148224PCT/AUOO/01596 64 Table Trans fection Treatment None pTet-Off pTRE-EGFP pTet-Off pTRE-

EGFP

pTet-Off pTRE- EGFP Dox (72 h) pTet-Off pTRE- EGFP removal of Dox (72 h) cells expressing EGFP expression in EGFP cell lysates 0 0 0 ±12 .0 ±9 86 ±11 5.9 1.2 0.2 1 2.6 9 5±3 49 ±6 Values represent the average and standard errors for 3 separate transfection experiments, each containing 4 replicates.

WO 01/48224 PCT/AU00/01596 65 The low percentage of cells expressing the reporter gene presumably reflects the efficiency of simultaneously transfecting the cells with two plasmids (pTRE-EGFP and pTK-Hyg). When doxycycline was added, EGFP gene expression dropped substantially, to approximately 3% of expression levels seen in cells not exposed to doxycycline. Interestingly, washing the cells and removing as much of the doxycycline as possible could reverse the repression of reporter gene expression. Fluorometric assays of cell lysates performed using a BMG FluoStar showed similar results to cell counts, with repression of the EGFP fluorescence being:repressed in the.presence of doxycycline. The reversal of the repression following removal of doxycycline appeared greater in these assays, most likely because the fluorometer could detect low levels of fluorescence not detected by microscopic examination.

Next the applicant tested the tet-off system in whole zebrafish embryos. The Tet-On TM and Tet-offT M gene expression system and the Tet responsive bidirectional vectors pBI and pBI-EGFP were purchased from a commercial source (Clontech). The pzBMP2-Tet-Off construct (Figure 13) was engineered by excising PminCMV promoter as SpeI and EcoRI fragment from pTet-Off and replacing.it with the 1,414 bp zBMP2 promoter as XbaI/EcoRI, from pzBMP2-(1.4), by directional cloning. .The pzBMP2-Tet-Off and.pBI constructs were linearised with SacI and PuvII, respectively and column purified using a PCR purification column (Qiagen). Eluted DNA .were quantified and mixed in equimolar ratio to yield a final concentration of about 150ng/pl in injection buffer. Injections were carried out using one-cell stage embryos as described in Example 1.

Of the 84 embryos co-injected, EGFP expression was detectable in 7 individuals at about 24h pi. A low percentage of transformed embryos is typical of coinjection experiments. The spatial pattern of EGFP expression (along the anterio-ventral regions) is similar to that we previously observed when EGFP was directly under WO 01/48224 PCT/AU00/01596 66 the regulation of zBMP2 promoter.

Example 7 Complete Zebrafish Sterile Feral Construct A single tet responsive double stranded RNA blocker construct under the regulation of zBMP2 promoter, pBIT(Bmp2)-Bmp2ds (Figure 14), was built using pBI-EGFP as the backbone. The bidirectional tet responsive construct with.EGFP as a marker was chosen to provide a visible marker. First, the SV40 PolyA was excised from the vector pBI-EGFP .(Clontech, PT3146-5) following digestion with AatII and SalI. The resulting.fragment.was blunt ended with T4 DNA polymerase and religated to form pBi(.-SV), an intermediate plasmid.

This.was then cut with HindIII and used in a subsequent ligation with a HindIII fragment containing the BMP2 promoter, which was obtained from BMP-tetOff plasmid (SEQ IDNO:2, NM99/09099). The resulting plasmid, called pBi*tTA was then cut with with PvuII, dephosphorylated, and.

added to a ligation reaction containing a second fragment (blunt ended with T4 DNA polymerase), which contained the a 510bp fragment of the zBMP2 cDNA from sequence 301-810 in the published cDNA sequence (Lee et al., 1998) and was obtained by digesting dsRNA(BMP2) (SEQ ID NO:13, NM99/09100) with EcoRI and HindIII followed by gel purification. This ligation reaction produced :the construct pSFl. The pBIT(*Bmp2)-bmp2ds :construct is shown in Figure 14 and SEQ ID NO: 14 and here through refereed to as pSFl.

Similarly pBIT(Cmv)-BMP2ds (pSF2), a zbmp2 double stranded RNA blocker construct in which the tet-Off (tTA) is under the regulation of CMV promoter, was built as follows. Commercially purchased pTet-Off construct was digested with HindII, XhoI and SapI. A 2250 bp XhoI/HindIII fragment containing CMV promoter, tTA and PolyA and a 2000 bp SapI/XhoI fragment containing vector backbone were gel purified. Meanwhile the pBIT(bmp)-bmp2ds was digested with HindIII/SapI and a 3,459 bp fragment WO 01/48224 PCT/AU00/01596 67 containing EGFP and double stranded bmp2 RNA, with Pglobin poly A was gel purified. Finally the three fragments were ligated directionally to yield the pBIT(CMV)-bmp2ds (pSF2, Figure 15, SEQ ID NO:15) construct.

The applicant constructed two more candidate sterile feral constructs, with tTA driven by the zebrafish promoter: one used BMP2 double stranded RNA as developmental blocker [pBIT(smad)-BMP2ds] and another used zBMP2 sense, to be mis-expressed, as a blocker [pBIT(smad)- .BMP2sense). An intermediate construct, pSmadTet-Off, was built by excising the CMVminl.promoter as Xbal-and Spel fragmet from pTet-Off and replacing it with a 965 bp zebrafish SMAD5 promoter.

Subsequently, pBIT(smad)-BMP2ds (pSF3, Figure 16, SEQ ID NO:16) was made by excising CMV promoter as a XhoI/SphI fragment from pBIT(CMV)-bmp2ds and replacing it with XhoI/SphI SMAD5 promoter fragment from pSmadTet-Off.

The construct was confirmed by restriction analysis and sequencing. The construct was renamed pSF3.

The pBIT(smad)-BMP2sense(pSF4, Figure 17; SEQ ID NO:17) was constructed as follows. Firstly a 1,440 bp zebrafish BMP2 cDNA was excised as EcoRI and XhoI fragment from pzBMP2b, blunt ended and ligated into PvuII linearized pBI-EGFP. The sense orientation of the bmp2 cDNA in the bi-directional vector was confirmed by restriction analysis and-sequencing. A resulting.clone (pBI-bmp2-Sense) in the correct orientation was prepared.for further use. The .double stranded RNA blocker in the pBIT(smad)-bmp2ds (pSF3) was excised as EagI/MluI fragment and replaced with EagI/MluI fragment from pBI-bmp2-Sense construct. The resulting pBIT(smad)-bmp2-Sense construct (pSF4, Figure 17 and SEQ ID NO:17) was confirmed by restriction analysis and sequencing.

Table 6 summarises the pooled results of three different batches of pSFl construct injections into zebrafish embryos.

WO 01/48224 PCT/AU00/01596 68 Table 6 Results of pSF1 (100ng/l) injections into the zebrafish embryo.

Treatment Total No No. No.

dead dead Live Shpi 24hpi SF1 166 65 11 90 No. Glow No. Non Glow Deformed Normal Deformed Normal 2 Injected Buffer Control (54.2) (2.2) 143 56 17 70 0 34 0 (37.7) 0 0 52 (57.7) 0 (48.9) WO 01/48224 PCT/AU00/01596 69 Although about 40% of the embryos had EGFP expression, only 2.2% had the associated deformity resembling the dorsalized swirl mutation. This is in stark contrast to 14-40% swirl like deformities the applicant observed by injection of a double stranded RNA construct (pzBMP2-ds) that was driven directly by the BMP2 promoter. The lack of correlation between the deformity and EGFP expression may be attributed to several reasons, including the delay associated with the indirect expression of the blocker by the BMP2 promoter mediated via the expression of tTA.

Table 7 summarises the results of pSF2 injected into the embryos of zebrafish.

WO 01/48224 'h'00148224PCT/AUOO/01596 70 Table 7 Results of injecting pSF2 (10Qng/J.) into the embryos of zebrafish.

Treatment Total SF2 fox No Dox Control Dox No Dox No dead 44 28 23 13 No.

dead 2 4hpi 30 53 14 1s No.- Live 101 (57.7) 102 (55.7) 81 (68.6) 76 (71.0) No. Glow Deformed 3 (2.9) 11 (10.7) 0 0 Normal 8 (7.9) 49 (48.0) 0 0 No. Non Glow Deformed Normal 6 84 (83.1) 2 (39.2) 0 0 0 WO 01/48224 PCT/AU00/01596 71 CMV, a ubiquitously active promoter, drives the pSF2. In all these sets of experiments, about half the injected and control fish were immersed in a solution of 150 ppm doxycycline (dox) to evaluate the efficiency of repression. The data were pooled from 3 separate sets of injections.

Following pSF2 injection and repression, the proportion of embryos expressing EGFP in the dox treated group was much lower from that of untreated group (11% vs These results confirm Example 6 that the applicant has achieved temporal control of genes under.the regulation of tet responsive promoter in zebrafish.

However, as in case of pSF1, there was no correlation between the embryos expressing EGFP and those with a dorsalized deformity. Although the CMV is a ubiquitously expressing promoter, the applicant hypothesized that the mosaic distribution of injected construct may have precluded consistent expression in the BMP2 expression domains.

The results from injection and repression of pSF3, in which the tTA is driven by zebrafish promoter are presented in Table 8.

0 Table 8. Results of the repression experiment following injection of pSF3 and pSF2 constructs (100ng/gl) in the zebrafish embryos. Numbers in parenthesis are percentages.

Treatment pSF3 No Dox Dox 125 ppm Control No Dox Dox 150 ppm pSF2 No Dox Dox 150 ppm Total Dead Dead HPI 24 HPI 60 9 13 Live 38 (63.3) 14 27 (51.9) 0 56 (65.8) 20 42 (48.8) 6 41 (70.6) 14 26 (44.8) Deformed 15 (39.4) 5 (18.5) Glow Normal 11 (28.9) 5 (18.5) Total 26 (68.4) 10 (37.0) No Glow Deformed Normal 0 12 (31.5) 1 16 (59.25) 5 (8.9) 0 2 (4.8) 9 (34.6) 51 (91.0) 42 (100) 15 (36.5) 14 (53.8) Total 12 (31.5) 17 (62.9) 56 (100) 42 (100) 17 (41.4) 23 (88.4) 8 (19.5) 1 (3.8) 16 (39.0) 2 (7.6) 24 (58.5) 3 (11.5) 0r 0, 0 WO 01/48224 PCT/AU00/01596 73 The applicant included pSF2 injections in this set of experiments as positive controls for repression.

Repression of embryos injected with pSF3 were carried out in rearing medium containing 125ppm dox, unlike the 150 ppm employed for pSF2 injected groups. This was because in preliminary experiments the applicant encountered higher mortality associated with 150 ppm dox and pSF3 injected embryos (data not shown).

As for pSF2, treatment with dox reduced substantially the percentage of surviving embryos exhibiting EGFP expression and swirl-like deformies, confirming repression. Unlike the'pSF2 construct, there was a clear association between.EGFP expression and a dorsalizied mutation, the two co-expressing in close to of the embryos surviving past 24hpi. This confirms that the SMAD5 promoter effectively expressed the BMP2 double-stranded blocker, causing developmental arrest in un-repressed embryos. The applicant hypothesize that the increased efficiency of SMAD5 promoter in the complete Sterile Feral Construct over that of BMP2 promoter results from its potential early zygotic activation, ensuring the transcription of blocker molecules much before expression of the native BMP2 transcripts. Since the smad5 is known to be expressed maternally (Hild et al., 1999), it is likely to function even more effectively in permanently transformed lines The applicant also :built and .tested a Sterile Feral Construct for zebrafish using mis-expression of the BMP2 gene as the blocker sequence (pSF4). As predicted, injection of pSF4 resulted in overexpression of BMP2, resulting in fish with ventralizied mutations (Figure 18A-C, arrow. Majority of the deformed fish co-expressed EGFP and in some instances the EGFP expression was closely associated with the ventralized tissue (Figure 18C). As summarized in Table 9, the large majority of the EGFP expressing embryos also had ventralized phenotypes as shown in Figure 18A-C.

Table 9 WO 01/48224 PCT/AU043/01596 74 Results of pSF4 injection (lO0ng/gil) into zebrafish embryos Treatment Total No.

No. Dead 5HPI 24HPI No Live No Glowing Deformed Normal PSF4 Injected Control 234 104 37 93 (44.4) 8) (39.7) 118 46 10 68 33 (35.4) 31 (33.3) No. non-Glowing Deformed -Normal 7 22 (23.6) 3 (95.5) WO 01/48224 PCT/AU00/01596 75 Example 8 Transfection of Pacific Oysters Mature oysters (Crassostrea gigas) were obtained from local hatcheries in Tasmania and New South Wales, and held in artificial seawater at 100C until required. Eggs were collected from 2-3 females by stripping the gonads and were pooled, rinsed on a 20 pm mesh, and left to condition in artificial sea water for 2 h. Sperm were stripped from male gonads, diluted to approximately 10,000 gametes/pl, and used immediately for electroporation-mediated nucleic acid delivery. Plasmid DNA (50 pg/ml) or double-stranded RNA (dsRNA; 1 ug/ml) was delivered into 1 x 106 sperm using a BioRad Gene Pulser II electroporator in 0.2 cm gap electroporation cuvettes. Sperm were subjected to a single electroporation pulse (50 V, 100% modulation, 10 kHz, 12.5 msec) and immediately mixed with 5000 oocytes.

Fertilized embryos and developing larvae were reared at 0 C in artificial seawater containing 0.1 pg/ml chloramphenicol. Surviving larvae were counted after 24 h development. For experiments in which the Drosophila melanogaster heat shock promoter was used to drive expression of the delivered genes, a 1 h heat shock at 37 0 C was provided either at 2 h or 18 h post fertilization, and development was then permitted to proceed at 20 0

C.

The applicant developed and tested transfection techniques for Pacific oyster eggs and larvae using genes encoding enhanced green fluorescent protein (EGFP, Clontech), glucuronidase (GUS), and red fluorescent protein (RFP, Clontech). Efficacy of electroporation as a transfection method of oyster sperm, using EGFP as a reporter gene was tested. Two different constructs, containing the EGFP gene under the control of either the CMV or Drosophila heat shock (Hsp) promoter were delivered into sperm using electroporation, and EGFP fluorescence was monitored using microscopy and fluorometric assays. Oyster embryos and larvae displayed a moderate level of autofluorescence that obscured WO 01/48224 PCT/AU00/01596 76 detection of low levels of EGFP. Consequently, it was seldom possible to visually distinguish transfectants from non-transfectants when the EGFP gene was under the control of the CMV promoter using the construct pBiT(CMV)-EGFP (SEQ ID NO:18) as compared to EGFP expression levels observed using pBiT(dHSP)-EGFP (SEQ ID NO:19) following heat shock. However, EGFP and RFP were .easily detected when expressed under the control of the D. melanogaster heat shock promoter, using constructs pBiT(dHSP)-EGFP (SEQ ID NO:19) and pBiT(dHSP)-RFPoHoxDS/BH (SEQ ID NO:20) respectively. By visual inspection, it was estimated that. approximately of the surviving trochophore larvae were transfected (Table WO 01/48224 WO 0148224PCT/AUOO/01596 77 Table Electroporation applied Genetic construct Promoter/ Reporter CMV/ EGFP

CMV/EGFP

Hsp/ EGFP Hsp/ EGFP Hsp/ EGFP Heat shock %larvae with

EGFP

fluorescence 1 0±0.2 0±0.2 1 ±0.5 5± 3 4±1 24 ±10 61 15

EGFP

fluorescenc: e relative to controls 1 ±0.2 1±0.2 1±0.3 1.5 0.2 1.2 0.3 2.4 0.7 14.3 1.1 1 Larvae seen in with EGFP fluorescence visibly non-transfected controls greater than that The values represent the means and standard errors for three separate experiments.

WO 01/48224 PCT/AU00/01596 78 To quantitatively assess EGFP and RFP fluorescence, larvae were homogenized in homogenization buffer (50 mM sodium phosphate, pH 7.0, 10 mM EDTA, 0.1% Triton X-100, 0.1% Sarkosyl, 10 mM mercaptoethanol), and protein extracts were measured for fluorescence using a BMG FLUOstar fluorometer.

Transfection efficiencies were also assessed in a second set of experiments that examined delivery of pHSP-GUS construct (SEQ ID NO:21). The pHSP-GUS construct was made in a two step fashion. First, the D.

melanogaster heat shock promoter and terminator were isolated from the pCaSpeR-hs plasmid (Thummel .and Pirrotta, 1992, Drosophila Information Service 71: 150) by PCR using the two primers: Dmhsp Forward Primer 5'-GAATTCCTAGAATCCCAAAACAAACTGG-3' SEQ ID NO:31 Dmhst Reverse Primer 5'-GGATCCTGACCGTCCATCGCAATAAAATGAGCC-3' SEQ ID NO:32 The resulting amplicon was cloned into the Ttailed vector pGEM-T-Easy (Promega) according to the manufacturer's directions to produce the plasmid. The second step involved excision of the. gene encoding the P-glucuronidase gene (gus) from the plasmid pBacPak8-GUS (Clontech) using the restriction endonucleases NcoI and EcoRI. The ends of the 1.8 kb gus fragment were then converted to blunt ends using the Klenow fragment of E.

coli DNA polymerase. The pGEMhsp70 plasmid was then linearized at the polylinker site between the promoter and terminator sequences using BglII and the ends were converted to blunt ends using the Klenow fragment. The 1.8 kb gus gene fragment was finally ligated into the blunt-end BglII site to produce the pHSP-GUS plasmid (SEQ ID NO:21). The pHSP-GUS construct expresses GUS under the WO 01/48224 PCT/AUDO/01596 79 control of the D. melanogaster heat shock promoter (Table 11).

WO 01/48224 PCT/AU00/01596 80 Table 11 Efficacy of electroporation as a transfection method of oyster sperm, using GUS as a reporter gene.

Genetic construct Electroporation Promoter/ reporter gene

CMV/GUS

CMV/GUS

Hsp/GUS Hsp/GUS Hsp/GUS Heat shock survival none 100±4 none 95±5 none .93±5 none 92 ±6 yes 92+5 none 91±6 yes 90+4

GUS

activity' 4.2 0.3 4.3.±0.3 4.4 0.4 6.7 ±0.8 4.5 0.5 10.5 ±0.5 83.2 5.4

GUS

activity relative to controls 1.6 1.1 19.8 1GUS activity expressed as fluorescence units/Jg protein.

Values represent the mean and standard error for three separate spawning experiments, each with three replicates.

WO 01/48224 PCT/AU00/01596 81 GUS activity in these experiments was measured using a fluorometric assay as previously described (Jefferson, R A 1987).

Fluorometric assays of larval extracts confirmed that electroporation of sperm could deliver foreign.DNA into oyster embryos (Tables 10 and 11). In the absence of electroporation, little or no reporter gene expression was detected in transfected larvae. With electroporation, clear differences were observed in the relative strengths of the two different gene promoters tested. Expression of the reporter genes.was approximately 1.6 times higher using the heat shock promoter, even in the absence of heat shock, compared to expression levels observed using the CMV promoter. With heat shock, reporter gene expression increased another 6- 8 fold.

Example 9 The Repressible Element in Oysters Tet-OffT control of EGPP expression was first assessed in oyster heart primary cell culture, using culturing methods previously described (Mol. Marine Biol.

Biotech. 5:.167-174). Oyster cells were first transfected with the pTet-Off plasmid (Clontech, Genbank ACC# U89929), using Effectene liposomes (Qiagen), and placed under neomycin selection for 2 weeks. The.cells were then co-transfected with.-the pBTIEGFP reporter gene plasmid (Clontech #PT3146-5).and the' selection plasmid pTK-Hyg (Clontech, GenBank Accession U40398). 'Dually transfected cells were then treated with 1 Jg/ml doxycycline and EGFP expression was assessed 72 h later.

Doxycycline was then removed from the medium, cells were washed in PBS, and incubated for a further 96 h to determine if EGFP expression had changed. It can be seen from Table 12 that a small percentage of cells were observed to express EGFP in the absence of doxycycline.

WO 01/48224 PCT/AUOO/01596 82 Table 12 Tet-Off TMControl of EGFP Expression in Oyster Cell Culture Transfection and doxycycline (Dox) Treatment None pTet-Off pBI-EGFP pTet-Off pBI-EGFP (no Dox) pTet-Off pBI-EGFP Dox for 72 h) pTet-Off pBI-EGFP Dox for 72 h, followed by removal of Dox for 96 h) cells expressing

EGFP

0 0 0 2.2 ±0.4 0 0.5 ±0.2 WO 01/48224 PCT/AU00/01596 83 The low double transfection rates are.

presumably due to most cells acquiring the pTK-Hyg plasmid without acquiring the pBI-EGFP plasmid. Addition of doxycycline to the medium resulted in complete repression of the EGFP reporter gene expression. When the doxycycline was removed, the level of reporter gene expression increased after 96 h, indicating that the repression is reversible.

The results in Table 12 indicated that gene expression in oyster cells can be regulated using the Tet-OffT system, and hence similar experiments were conducted in oyster larvae.

Oyster embryos were transfected-with the pBiT(HSP)-EGFP plasmid (SEQ ID NO:19), which encodes the tetracycline (or doxycycline)-controlled transactivator (tTA= Tet-Off") under control of a heat shock promoter, and contains the EGFP reporter gene under the control of the tetracycline (doxycycline) response element (TRE).

The construct pBiT(HSP)-EGFP (SEQ ID NO:19) was prepared as follows. Four fragments were prepared and ligated together to create the construct. The first, was obtained by digesting pHSP70-1MCS (SEQ ID NO:22) with XhoI and XbaI followed excision and gel purification of the appropriate XhoI/XbaI fragment containing the Drosophila HSP70 promoter. The second was obtained by digesting pTet-Off (Genbank ACC#.:U89929) with..XbaI::and HindIII and gel purifying the appropriate fragment.

containing the tet-responsive .transcriptional activator (tTA) and SV40 poly adenylation signal. The third fragment was obtained by digesting pBI-EGFP (Clontech, PT3146-5) with HindII and SapI and gel purifying the appropriate fragment containing the TRE and CMVmin bidrectional promoter and multiple cloning site. The fourth fragment was obtained by digesting pTet-Off (Genbank ACC# U89929) with XhoI and SapI and gel purifying the appropriate fragment containing the vector backbone and ampicilin resistance gene.

The construct expresses the tet-responsive WO 01/48224 PCT/AU00/01596 84 transcriptional activator (tTA) from the Drosophila promoter (PHSP70) which in turn activates expression of EGFP under control of the tetracyclineresponse element, or TRE. Oyster sperm were transfected with the construct using electroporation, and oocytes were fertilized and allowed to develop for 24 hours in the presence or absence of 5 g/Al doxycycline. In the absence of doxycycline, EGFP was expressed in transfected oyster larvae, and when doxycycline was added, the EGFP expression levels dropped to levels equal to that of nontransfected embryos (Table 13). The results from the tissue culture and embryo transfections indicate 'that transgene expression in oysters-can be effectively controlled using the Tet-Off

T

system.

WO 01/48224 PCT/AU00/01596 85 Table 13 Regulation of EGFP Expression Using Doxycycline in Oyster Larvae Transfected with pBiT(HSP)-EGFP (SEQ ID NO.19) Fluorescence (FU/tlg protein) Treatment Regime Non-transformed control -Dox, heat shock -Dox, heat shock +Dox, heat shock Total fluorescence (incl.

autofluorescence) 320 21) Corrected for autofluorescence 0. 21) 426 24) 1025 (±78) 215 27) 106 24) 705 (±78) 0 (±27) Values represent the mean and standard deviation for two separate spawning experiments, each with three replicates.

WO 01/48224 PCT/AU00/01596 86 EXAMPLE 10 Blocking Expression of a Developmental Gene in Oysters The applicant has identified conserved gene functions which are crucial to larval development in oysters and characterised two suitable candidate sequences as targets for antisense or dsRNA knockout.

Disrupting this gene function is then lethal to the animal (larvae) because transcription factors are prevented from binding and initiating cascades of gene activity required for morphogenesis (body construction).

The applicant chose to target the DNA.binding ability of a class of transcription factors known as "Helix-loop- Helix" factors that bind DNA during the development of animal body plans (reviewed by Stein et al., 1996; and also see de Rosa, 1999). The applicant isolated two partial gene sequences comprising this crucial and highly conserved DNA binding sequence from a Pacific oyster cDNA library (HoxCgl and HoxCg3; SEQ ID NOS.: 23 and 24, respectively). Alignments of the sequence of this evolutionary conserved class of genes and phylogenetic analysis have revealed that this sequence is indeed a HOX gene and is previously undescribed in oysters (Figure 19).

The applicant identified two oligonucleotide sequences that are candidates for antisense larval pesticides. An oyster specific antisense: 5'-GAGATCGTTCAGTCAGCG-3' SEQ ID and a broader spectrum antisense 3' SEQ ID NO:26 wherein represents the base guanine or cytosine.

These sequences are potentially capable of truncating vital gene products, and hence preventing their function in vivo.

WO 01/48224 PCT/AU00/01596 87 The applicant synthesized and tested antisense and double stranded blockers for the gus gene from Escherichia coli, Hox CG1 (SEQ ID NO:23), and Hox CG3 (SEQ ID NO:24). RNA was prepared by in vitro synthesis for these three different genes or gene fragments: the 1.8 kb open reading frame of the gus gene from E. coli; the 129 bp fragment of oyster gene Hox Cgl (SEQ ID NO:23, AGAL ref# NM99/09101); and the 129 bp fragment of the .oyster gene HoxCG3 (SEQ ID NO:24, AGAL Ref#NM99/09102).

The DNA fragments were each cloned into pBluescript the vectors .were linearized with either HindIII or PstI, and T3 or T7 RNA polymerase (Promega) .was used to generate sense or antisense RNAs, respectively using a commercially available in vitro transcription kit (Promega, Madison Wisconsin). The resulting samples were then digested with DNase I for 15 minutes at 37 0 C. To produce double stranded RNA (dsRNA), equimolar amounts of the sense and antisense RNAs were mixed and heated to 0 C and allowed to cool slowly to room temperature thus forming dsRNA. The RNA was extracted with phenol/chloroform and then chloroform, precipitated with ethanol, and resuspended in 10 mM Tris-HCl, pH 9.

Formation of dsRNA was confirmed by.resolving the annealed and non-annealed RNAs on a 1% agarose gel in TEE mM Tris-borate, 2 mM EDTA, pH The in vitro transcribed.dsRNAs,:plus sense, and antisense RNAs for the GUS,..HoxCG1 and HoxCG3 genes were delivered into oyster sperm by electroporation using a set of conditions previously found to be optimal for delivery of a reporter gene construct Transfections for the control treatments were carried out in RNA free sea water. Delivery of sense and antisense RNAs had no or only a small effect on the number of individuals that developed, relative to the non-treated controls (Table 14).

WO 01/48224 PCT/AU00/01596 88 Table 14 Effect on Early Larval Development of Oyster Transfected with In Vitro Transcribed Sense antisense and double-stranded (DS) RNAs of three different gene sequences, GUS, HoxCG1, HoxCG3 RNA delivered into sperm control GUS (DS) HoxCG1 (S) HoxCG1 (AS) HoxCG1- (DS) HoxCG3 (S) HoxCG3 (AS) HoxCG3 (DS) survivors at 24 h development' 100 3 94 5 91±5 85 9 71±7 92 ±4 87±6 79 ±7 arrested development 2 5±1 .7 3 9+4 17±5 79 8±4 15 3 23 Percentage of embryos that developed into trochophores, relative to non-treated controls 2 Includes all individuals (embryos and larvae) that failed to develop to the D-hinge larval stage WO 01/48224 PCT/AU00/01596 89 Transfection with dsRNA for the GUS gene had no obvious effect on development, but transfection with dsRNAs specific to the HoxCG genes resulted in increased numbers of individuals showing arrested early larval development. The dsRNA specific to the HoxCG1 gene was the most effective dsRNA, with almost 80% of individuals failing to develop beyond the trochophore stage of larval development (Table 14).

Screening for mutant phenotypes in the resulting larvae revealed severe developmental mutants especially in the treatments containing dsRNA for both gene constructs, but not the.RNA-free -controls '(Figure Table 14). Fatal embryonic distortions due to the double stranded blocker of HoxCG1 can be broadly classified as defects in the anterior/posterior axis formation including associated structures (such as the velum) and for HoxCG3 as defects in velum and body perhaps premature velum release.

To test whether dsRNA could reduce expression of a gene in oyster cells, primary cell cultures were first transfected with the pHSP-GUS plasmid (SEQ ID NO:21). After two days of growth, the dsRNA specific to the gus gene was delivered into these cells by transfection using Effectene liposomes (Qiagen). After 72 h, the level of GUS activity was measured. The cells transfected with the dsRNA showed a 76% reduction in the reporter gene activity compared. to similarly .aged gustransfected cells (Table WO 01/48224 WO 0148224PCT/AUDO/01596 90 Table Reduced GUS Transgene Expression in Oyster Cells Transfected with In Vitro Transcribed dsRNA GUS Gene Expression (pmol MU produced/min) No dsRNA added %.decrease in gene expression dsRNA added 42 13 1± 10 4 WO 01/48224 PCT/AU00/01596 91 In vivo expression of dsRNA was achieved by transfecting oyster larvae with the pBiT(dHSP)-RFP-oHoxDS/BH plasmid (Figure 21; SEQ ID which contains the heat inducible promoter from D. melanogaster driving the expression of a hairpin RNA molecule specific to the HoxCG1 gene. The construct was prepared as follows. SEQ ID NO:23(AGAL ref NM99/09101) was used as a template to generate a PCR fragment using the following primers: CG1.1.Sal.for Forward primer: 5'-ATGGATGTCGACTCAGACGCTGGAG-3' SEQ ID.NO.:27 And CG1.1.Pst.rev Reverse primer: 5'-GATTCACTAGTCAATTCCTGCAGTT-3' SEQ ID NO:28 This fragment was then cloned into the pCR®2.1-TOPO (Invitrogen) .cloning vector. Two separate fragments, an EcoRI/EcoRI and a SalI/PstI, both containing the HoxCG1.1 (SEQ ID NO:23), were digested out of this construct for use in further ligations. The latter fragment (SalI/PstI) was inserted into-the dsRNA(.MP2) construct (AGAL ref# NM99/09100) which.had been digested with SalI and PstI to remove the inverted BMP2 sequence. This intermediate construct was then digested with EcoRI and Spel to produce a fragment containing both the a 510bp fragment of the zBMP2 cDNA from sequence 301-810 in the published cDNA sequence (Lee et al., 1998) and the Hox CG1.1 (SEQ ID NO:23) fragment. This EcoRI/Spel fragment and the EcoRI/EcoRI fragment containing HoxCG1.1 were then combined into a ligation reaction with pHSP70-1MCS (SEQ ID NO:22, containing the Drosophila heat shock promoter dHSP70 and its poly adenylation signal) digested with EcoRI and XbaI, to produce pHSP-oHoxDS/BH (SEQ ID WO 01/48224 PCT/AU00/01596 92 NO:29). This latter construct uses the Drosophila heat shock promoter to drive expression of an mRNA consisting of an inverted section of the HoxCG1.1 followed by a section of BMP2 cDNA in sense orientation followed by a segment of the HoxCG1.1 fragment in sense orientation followed by the poly adenalation signal of the Drosophila heat shock promoter.

Oyster sperm were transfected with the DNA using electroporation, and oocytes were fertilized and larvae allowed to develop for 96 hours. Embryos were heat shocked for one hour at 3 hours post fertilization to induce transcription of the dsRNAs. Even without heat shock, approximately a third:of the larvae failed to develop beyond the trochophore larval .stage, and died within a few days (Table 16).

WO 01/48224 WO 0148224PCT/AUOO/01596 93 Table 16 Arrested Development of Oyster Embryos Transfected with pHSP-oHoxDS/BH plasmid (SEQ ID NO:29) arrested development no heat shock with heat shock non-transfected phsp-GUS pHS P- oHoxDS /BH 5±1 6±2 33±9 4±1 8±3.

67±16 WO 01/48224 PCT/AU00/01596 94 With heat shock, over 65% of the larvae failed to develop. Since all larvae are not transfected by the electroporation procedure, it is likely that those individuals that developed normally were not transfected with the genetic construct. Non-transfected oyster embryos and embryos transfected with a plasmid expressing .dsRNA for the GUS gene showed no obvious reduction in survivorship (Table 16).

Example 10 Complete Sterile Feral Construct for Oysters Two different plasmids were prepared that .used Tet-OffTM to control the in vivo expression of dsRNAs specific to developmental genes. The first, pBiT(CMV)-EGFP-zfBMP(DS), (SEQ ID NO:30), was designed to express the reporter gene EGFP as well as dsRNA specific to the zebrafish BMP2 gene in the absence of tetracycline or doxycycline- The construct was prepared as follows: An intermediate constuct was first engineered using three separate fragments. The first was an XhoI/HindIII fragment that was obtained by digesting pTet-Off (Genbank ACC# U89929) with XhoI and HindIII and gel purifying the appropriate fragment containing the.CMV promoter, tet-responsive transcriptional activator (tTA), and SV40 poly adenylation signal. .The .second fragment was obtained by digesting pBI-EGFP (CLONTECH) with HindIII and SapI and gel purifying the appropriate fragment containing the TRE and CMVmin bidrectional promoter and multiple cloning site (MCS). The third fragment was obtained by digesting pTet-Off (Genbank ACC# U89929) with XhoI and SapI and gel purifying the appropriate fragment containing the vector backbone and ampicilin resistance gene. These three fragments were ligated together to form the intermediate construct pBiT(CMV)-EGFP (SEQ ID NO:18). A fourth fragment, obtained by digesting Seq.ID#4 (dsRNA(BMP2), AGAL Ref# NM99/09100) with EcoRI and HindIII and gel purifying the WO 01/48224 PCT/AU00/01596 95 appropriate fragment containing a 510bp segment of the zBMP2 cDNA from sequence 301-810 and the inverted 286bp segment of the cDNA (Bases307-592) of the published zebrafish BMP2 cDNA sequence (Lee et al., 1998). This EcoRI/HindIII fragment was then blunt ended with T4 DNA polymerase and ligated into the unique PvuII site of the MCS of pBiT(CMV)-EGFP to form the construct pBiT(CMV)-EGFP-zfBMP(DS) (SEQ ID NO:30). This construct expresses the tet-responsive transcriptional activator (tTA) from the strong immediate early promoter of cytomegalovirus (Pcm). The tTA functions to drive gene expression via the tetracycline-response element, or TRE.

In the absence of tetracyline or doxycyline both.EGFP and the blocker gene (double stranded BMP2 mRNA, cloned into the MCS) are expressed.

Sperm were transfected with either pBiT(dHSP)- EGFP (SEQ ID NO:19) or pBiT(CMV)-EGFP-zfBMP(DS) DNA, (SEQ ID NO:30), oocytes were fertilized, and allowed to develop for 24 hours in the presence or absence of gg/(jl doxycycline. Embryos transfected with the pBiT(dHSP)-EGFP DNA were not heat shocked so that EGFP expression would be similar in both transfections. When oyster embryos were transfected with this construct, lower hatch rates and poorer larval survival rates than those of non-transfected controls were observed (Table 17).

WO 01/48224 PCT/AUOO/01596 96 Table 17 Tet-Off~m Control of EGFP and dsRNA-zfBMP Expression in Oyster Embryos Construct injected Non-trans fected pBiT(d{SP) -EGFP pBiT(CMV) -EGFPzfBMP (DS) %survival (relative to control) Dox Dox 100 +5 100+ 3 77 +6 95+ 3 71 +8 92+ 4 EGFP (FTJ4Lg protein) Dox Dox 0+ 10 0 +11 31 +8 0+ 8 20 11 0 9 WO 01/48224 PCT/AU00/01596 97 When doxycycline was added to the water, this trend was reversed. Most of this arrested development however, may be caused by expression of EGFP, as similar levels of arrested development were observed when embryos were transfected with the pBiT(dHSP)-EGFP plasmid (without exposure to heat shock), and normal developmental rates were restored when doxycycline was added to the water. It cannot be excluded however, that the zebrafish dsRNA has caused some small degree of developmental arrest in the oysters, as the BMP2 may have an as yet unidentified orthologue with enough sequence identity to zfBMP2 to be affected by this: .dsRNA molecule.

The second Sterile Feral Construct tested for oysters, expresses the tTA under the Drosophila HSP. The tTA then drives expression of red fluorescent protein and double stranded oyster Hox via the TRE. Three separate fragments were ligated together to form this construct.

The first fragment was obtained by digestion of pBiT(dHSP)-EGFP, (Seq ID NO:19), with HindIII and NheI followed by gel purification of the appropriate fragment containing the Drosophila HSP promoter. The second fragment was obtained by digesting pBiT(dHSP)-EGFP with NotI and MluI followed by gel purification of the appropriate fragment containing the TRE. The third fragment was obtained by digesting pHSP-oHoxDS/BH with MluI and SpeI and gel purifying :the.appropriate fragment containing the 510bp fragment of the:zBMP2 cDNA from sequence 301-810 in the published cDNA sequence (Lee et 1998). The fourth fragment was obtained by firstly subcloning into pGEM3zf a KpnI/XbaI fragment containing the coding region of red fluorescent protein (RFP) that was excised from pDsRedl-Nl .(Clontech, PT3405-5) vector.

The resulting plasmid was then subjected to digestion with HindIII and PspOMI and the appropriate fragment containing the coding region of RFP was then gel purified from this reaction. This HindIII/PspOMI fragment was combined with the NheI/HindIII, Notl/MluI, and Mlul/SpeI fragments to form the second sterile feral oyster WO 01/48224 PCT/AUOO/01596 98 construct pBiT(dHSP)-RFP-oHoxDS/BH (SEQ ID NO:20; Figure 21).

Sperm were transfected with the plasmid, oocytes were fertilized, and allowed to develop for 72 hours in the presence or absence of 5 gg/pl doxycycline.

When oyster embryos were transfected with the second repressible sterile feral construct, a considerable percentage failed to develop beyond the trochophore stage of larval development and subsequently died before reaching the D-hinge stage (Table 18).

WO 01/48224 PCT/AUOO/01596 99 Table 18 Reversible Arrested Oyster Larval Development Following Transfection. with the Tetracycline-Responsive Plasmid.

phsp-BiT-RFP/dsRNA-HoxCG1 Construct used for transfection.

Non transfected phsp- GUS pCD4V-RFP phsp-BiT-dsRNA- HoxCGl /RFP arrested development No doxycycline With doxycycline *0±5 3 5±3 3 5±2 4 ±3 67±8 9±4 WO 01/48224 PCT/AU00/01596 100 Addition of doxycycline to the water virtually prevented the developmental arrest, and most embryos developed properly to the D-hinge larval stage, relative to the non-treated controls.

RFP expression was not easily detected by microscopy in embryos transfected with the RFP gene under the control of either a heat shock or a CMV promoter. A small amount of RFP was detected using fluorometric measurements of larvae transfected with the pCMV-RFP construct, but little RFP could be detected in larvae transfected with the repressible anti-development construct (results not shown). As many of the embryos transfected with this latter construct fail to develop, the lack of RFP expression is not surprising. Attempts to detect RFP in early and late staged embryos were unsuccessful, using either RFP-expressing construct.

Example 11 Development of a Repressibly Sterile Mouse Development of the sterile feral construct for mice parallels that detailed above for zebrafish, and involves identification of a suitable target gene and associated promoter, engineering these into a construct with the Tet On/Off repressible system, and then testing, in this case in cell lines, prior to production of a transgenic mouse.model for the sterile-feral concept.

There are many genes.known to have adverse effects on fertilisation, development.or reproduction in mice. These genes can be readily identified through literature and database searches (Medline, mouse knock out database, Genbank etc.). These candidate genes fall mainly into the category of genes that are required for specific developmental processes during embryogenesis.

Furthermore, genes that are involved in stages of fertilisation and implantation are also potential candidate genes for this fertility control technology.

Developmental stages identified as potential sterile feral construct targets are classified under one of the following general areas: fertilisation, WO 01/48224 PCT/AU00/01596 101 preimplantation, post implantation (until neurulation) and organogenesis stages. The latter stages include factors such as those associated with the specification of male and female reproductive organs (Cunha et al., 1976). Proteins involved in these stages may have different roles such as morphogens, master genes, growth factors or receptors.

Genes associated with fertilisation include such factors as protein receptors or ligands required for successful fertilisation. Preimplantation genes that can be manipulated to control their gene expression and so achieve controllable fertility are .also covered by this patent and include genes encoding proteins. such as growth factors, signaling molecules and their receptors.

The homeobox gene goosecoid is one of the first genes to be transcribed in the organizer region of the mouse at the onset of gastrulation and RNA transcripts first appear in the dorsal mesoderm of the late blastula (Blumberg et al., 1991). The goosecoid gene is also highly conserved among different species (Figure 22).

During mouse embryogenesis, expression of the goosecoid gene takes place in two different phases. In the first phase of expression, goosecoid gene expression can be detected in the organizer between 6.4 to 6.7 days (Blum et al., 1992) and in the second phase it is detected during organogenesis from 10.5 day onwards:(Gaunt.et al., 1993) and expressed in some parts of.head, the:;limbs and the ventrolateral body wall. The homozygous knockout mutation of goosecoid in the mouse leads to defects late in development of the embryos. In particular, null homozygous goosecoid embryos are born with numerous developmental defects and die within 24 hours of birth (Rivera-Perez et al., 1995). The observed phenotype is in accordance with late expression of goosecoid in normal embryos, and it has been proposed that the lack of an earlier phenotype is due to functional compensation by other orthologous genes such as gsc2.

At the promoter level, molecular studies have WO 01/48224 PCT/AU00/01596 102 demonstrated that expression of goosecoid in Xenopus is mediated by the combined effects of two regions of the promoter, the distal element (DE) and the proximal element The DE responds directly to dorsal mesoderm inducing signals such as activin and Vgl (members of the TGF-9 super family), whereas the PE responds indirectly to wnt signaling (McKendry et al., 1998). Sequence comparison among different species shows that these proximal and distal elements are conserved among different species and there may be a common mechanism for its.activation (Blum et al., 1992). It was proposed that the DE responds.:directly.to.:mesoderm inducing signals such as activin, whereas the PE.responds indirectly to Wnt signaling (Laurent and Cho, 1999) (Figure 23).

Studies involving the goosecoid promoter in mouse and other species have shown that the promoter region carrying these two elements are adequate for reporter gene activity studies. These two elements are generally located within 500 bp from the transcriptional start site.

The goosecoid gene, in the form of sterile feral constructs, can be used to demonstrate how a developmentally active gene can be manipulated to maintain its temporal and spatial.gene specification under repressible promoter elements.

Example 12 Cloning the Goosecoid-Gene Promoter The goosecoid promoter was amplified by PCR using BALB/c genomic DNA. Primers were designed from Mus musculus goosecoid homeobox gene, promoter sequence, of the Genbank accession number Y13151.

The primers were as follows: Forward Primer 5'-GGAGACAGGCAGTCCCGGTAGATC-3' SEQ ID NO:33 WO 01/48224 PCT/AU00/01596 103 Reverse Primer 5'-TGGGAATTGTCCCACTCTCTGCTC-3' SEQ ID NO:34 The PCR conditions were as follows: x 3min, 72°C x Imin (hotstart), 58 0 C x 1min, 72 0 C x Imin for 1 cycle. Then 95 0 C x 45sec, 58 0 C x 1min, 72 0 C x imin for 28 cycles. The reaction was completed by incubating the reaction at 72C x 10min and 25 0 C x The PCR product for the goosecoid promoter was ligated into pGEM-T-Easy cloning vector (Promega Cat A1360).

Example 13 Selection and Construction .of Reporter Plasmids for Testing Promoter Function Reporter genes for promoter expression in mammals are available in two forms. Firstly reporter genes can be used to determine location of expression of a gene product. Examples of such commercially available reporters include the Enhanced Green Fluorescent Protein (EGFP) and Red Fluorescent Protein (RFP). Alternatively, other reporter genes can be used to quantitate relative levels of expression and include firefly luciferase (LUC+) modified for optimal expression in mammalian systems. The reporter genes EGFP and LUC+ were selected for use in testing sterile feral constructs based on the goosecoid promoter in the mouse.

pSFM 1: goosecoid promoter, expressing .enhanced green fluorescent protein (Figure 24; SEQ ID 35). The goosecoid promoter produced by PCR and cloned into pGEM- T-Easy (see above) was subcloned into the pEGFP-1 vector (Clontech Cat. 6086-1) by digestion with EcoRl and cloned into the EcoRl site of the MCS of pEGFP-1. The orientation of the goosecoid promoter was confirmed by both restriction enzyme mapping and sequencing.

pSFM 2: goosecoid cDNA in pTRE (Figure 25; SEQ ID 36). A goosecoid cDNA equivalent was prepared from a goosecoid genomic DNA clone. The goosecoid DNA clone was prepared by PCR using BALB/c mouse genomic DNA. Primers WO 01/48224 PCT/AU00/01596 104 were designed from the published sequence of goosecoid (Genbank Accession M85271). The goosecoid gene coding region is comprised of 3 exons. PCR primers were designed to produce each of the exons individually and were cloned into bacterial plasmid vectors using standard molecular biology techniques. The cDNA for goosecoid was then reconstructed by tandemly ligating the individual exons together to form a new clone. The exons can also be joined in other orientations to encode for various combinations of dsRNA or antisense of the goosecoid RNA.

The Primers used were designed from the entire coding region of the genomic DNA ('Sequence.-locations referred to goosecoid Genbank Accession Number M85271) and were: Design of PCR primers to amplify goosecoid exons 1,2,3. exon 1 (bp 296-650); exon 2 (bp 1159-1418); exon 3 (bp 1765-1920): Exon 1 forward (bp 296-316) 5'-GGTTAAGCTTATGCCCGCCAGCATGTTCAGC-3' SEQ ID NO:37 Exon 1 reverse (bp 631-650) 5'-GCGGGGCCCTCGTAGCCTGGGGGCGTCGGGACGCAG-3' SEQ ID NO:38 Exon 2 forward (bp 1165-1183) 5'-CGAGGGCCCCGGTTCTGTACT-3' SEQ ID NO:39 Exon 2 reverse (bp 1398-1418) 5'-TTTGAGCTCCACCTTCTCCTCCCGAAG-3' SEQ ID Exon 3 forward (bp 1765-1785) 5'-GTCTGGTTTAAGAACCGCCGA-3' SEQ ID NO:41 Exon 3 reverse (bp 1900-1920 WO 01/48224 PCT/AU00/01596 105 5'-GGAATTCTCAGCTGTCCGAGTCCAAATC-3' SEQ ID NO:42 Three exons were amplified by PCR using the above primers and the following conditions; 0 C x 2min, 40 0 C x 30sec, 72 0 C x 45sec for 1 cycle. Then 0 C x 30sec, 40°C x 30sec, 72 0 C x 45sec for 30 cycles.

The reaction was stopped by incubation at 72C x and 25 0 C x Goosecoid exon 1-3 PCR products were cloned into Promega (Cat A1360) pGEM-T-Easy.cloning vectors.

These clones were named pME 1, pME.2 and pME 3 for exon 1-3 in pGem-T-Easy respectively.

The strategy for producing the equivalent clone for the complete goosecoid cDNA coding region was as follows: pME 2 was cut with ApaI and religated, to remove the EcoRl site. Pfu polymerase PCR of clone pME 3 was undertaken using the primers and conditions for exon 3 as described above. This generated a blunt-ended fragment which was then digested with EcoRI. Following religation of pME2 (see step 1 above) with EcoIcRl.

Ligated together pME2 from and digested PCR product from to produce pME 4.

Cut pME 1 with HindII and then.partial .digest with Apal (band size 370 bp, ::external Apal .site) Cut pME 4 with ApaI, followed by EcoRl Cut pBluescript SK- with HindIII followed by EcoRI Ligated above with pME 4 product and pME 1 product to produce the complete goosecoid cDNA coding region. This clone was confirmed by sequencing and designated pCMH142 (SEQ ID 43) pSFM 6: Goosecoid promoter expressing goosecoid cDNA fused to red fluorescent protein (Figure 26). A 0.9 kb PCR fragment containing the full coding sequence of mouse goosecoid was amplified from pCMH142 using two PCR primers: WO 01/48224 PCT/AU00/01596 106 gsc F4 5'-TTAAGCTTGCCACCATGCCCGCCAGCATGT-3' SEQ ID 44 gsc R4 5'-TTGGATCCGCGCTGTCCGAGTCCAAATC-3' SEQ ID These primers produced a goosecoid-containing fragment where the TGA stop codon was replaced with an alanine codon. The PCR primers were also used to introduce a HindIII site upstream of the ATG start codon and a BamHI site downstream of the alanine codon. This fragment was restricted with HindIII and BamHI and then inserted into the plasmid pDSRedl-N1 (Clontech 6921-1) cut with.HindIII and BamHI in order to generate.pSFM 6 (SEQ ID ,46) pSFM 7: Mouse.goosecoid promoter expressing the tetracycline transactivator protein tTA (Figure 27). SEQ ID 47 The goosecoid tetracycline dependent transactivator plasmid was constructed by replacing EGFP of pSFM 1 with the 1008 bp coding region region (Genbank accession U89930 bp 774-1781) of the tet-responsive transcriptional activator (tTA) from the pTET-OFF plasmid (Clontech, Cat K1620-A). The tTA coding region was amplified by PCR using Pfu polymerase, restricted by Agel and EcoRl and cloned into pSFM 1 to produce pSFM 7.

pSFM 20: goosecoid promoter expressing luciferase+ protein (Figure 28). SEQ -D::48 A 0.7 kb (NotI end-filled with Klenow +.BamHI) fragment coding for green fluorescent protein region from pSFM1 was replaced.with 1.6 kb (Xbal end filled with Klenow enzyme BamHI) luciferase+ coding fragment derived from pXP1-G (Promega E1751).

.pSFM 21: Promoterless luciferase+ (Figure 29).

SEQ ID 49 A 1.6 kb luciferase coding EcoRI fragment was deleted from pSFM pSFM 23: pCMV promoter expressing luciferase+ (Figure 30). SEQ ID WO 01/48224 PCT/AU00/01596 107 A 1.6 kb (SacI StuI) luciferase+ coding fragment of pSFM 20 was cloned into pEGFP-N1 (Clontech 6085-1) cut with SacI StuI.

pSFM 24: Equivalent to the tet-responsive enhanced green fluorescent protein expression vector pTRE-EGFP (Clontech 6241-1)(Figure 31) SEQ ID 51 pSFM 25.: Tet-responsive expression vector pTREluciferase+ (Figure 32). SEQ ID 52 A 0.77kb SalI XbaI EGFP containing fragment of pSFM 24 was replaced by a 1.7kb SalI XbaI luciferase+ containing fragment derived from pXPl-G (Promega).

Example 14 Selection of Mammalian Cell Lines Mouse goosecoid was selected to demonstrate whether a developmental gene can be tightly regulated in the form of sterile feral constructs in mammalian cell lines. Most of the mainpulations using sterile feral :constructs based on goosecoid were therefore carried out in the mouse embryo cell lines P19 teratocarcinoma since it has been shown previously that the mouse goosecoid gene product is constitutively expressed in P19 teratocarcinoma cell lines. NIH/3T3 cells (in which goosecoid gene expression.is absent) were used as controls.

In addition goosecoid reporter .cons.tructs were tested in.non-transformed mouse:primary embryonic fibroblasts. .These cells display monolayered, anchorage dependent and.contact inhibited growth in tissue culture.

Using transient transfection with reporter and other plasmid constructs (reporters and blockers) the observed effects on these plasmids is expected to reflect the anticipated effect in the whole organism.

Chromatin structure surrounding the inserted gene is also likely affect the pattern of regulation of gene expression and so the choice of stable cell lines for gene expression is essential. For example, it is known that transfected DNA does not display the same WO 01/48224 PCT/AU00/01596 108 accessibility to transcriptional factors as chromosomal DNA (Archer et al., 1992). Another important factor to consider is that the goosecoid promoter contains only 1.1 kb upstream to the transcription start site leading to potential restriction of access by nuclear and other transcriptional factors by surrounding DNA sequences and chromatin structure.

All cell lines were obtained from American Type Culture Collection unless otherwise stated. These are P19 teratocarcinoma cells (ATCC number CRL-1825) and NIH/3T3 cells (ATCC number CRL-1658).

For transient transfection.assays, .P19 cells were cultured on gelatinized dishes.in DMEM supplemented with 10% fetal bovine serum. Cells (0.3 million per well in 6-well cluster plates) were transfected with reporter plasmid using transfection reagent 'Geneporter' from Gene Therapy Systems according manufacturer's recommendation.

Stably integrated P19 clones were obtained by using BioRad Gene Pulser II electroporation system. 30 pg DNA electroporated into 10 million cells under following conditions 960 gF and 0.16 kV in a 0.4 cm cuvette (0.4 kV/cm). The next day normal media were replaced with appropriate selection media (300 gg/ml G418) Reverse transcriptase polymerase chain reaction (RT-PCR) was used to confirm that .the -goos.ecoid.gene. is actively expressed in P19 cell lines with thegoosecoid specific primers exon 2 forward (SEQ ID 39).and exon 3 reverse (SEQ ID 42):

RT-PCR

cDNA was synthesized in a 50 p.1 reaction using 100 ng of poly(A) RNA extracted from various tissues and cell lines. The RNA was heated with a mixture of random 6 base pair and oligo(dT) primers for 5 min at 650C. and cooled to room temperature for 10 min. Reverse transcription was performed at 37 0 C. for 1 h after adding WO 01/48224 PCT/AU00/01596 109 10xRT buffer (Promega), 20 U RNase inhibitor (Promega), 2 pLi of 0.1mM dNTPs and 50 U MMLV reverse transcriptase. The cDNA mixture was then heated for 5 min at 90 0 C and stored at -20 0 C until needed.

RT-PCR was conducted using 2.l of cDNA in a final reaction using goosecoid specific primers (Figure 33). By comparison, RT-PCR amplification on NIH/3T3 cells gave negative results for goosecoid. In both cells, RT-PCR of a general housekeeping gene GADPH gave positive.bands. In addition GFP expression from P19 cells containing the reporter plasmid pSFM 1 stably integrated was unaffected by repeated passaging or freezing and thawing.

In order to measure the activity of the goosecoid gene, a cell culture system was developed that responds to tetracycline repression and permits the measurement of gene activity using both fluorescence reporters.

Fluorescent and transmitted light images were acquired using a CCD camera with a microscope.

Fluorescence filter sets had an excitation wavelength of 480 nm, dichroic cut-on filter at 505 nM and an emission filters at 535 nM and 605 nM. The luminescence assays were conducted by using a dark 96 well plate was done by Victor2 from Wallac or by Topcount NXT from Canberra Packard.

P19 cells were transiently transfected in 6 well plates with pSFM 20 (goosecoid promoter-luciferase), pSFM 21 (promoterless .luciferase) and pSFM 23 (CMV promoter-luciferase) using Gene Porter. Cells were harvested at various times post-tranfection and assayed for luciferase activity using a Promega kit (Cat. E1501) in a Top Count NXT luminometer.

Table 19 shows the luciferase activities of promoter reporter constructs shown in counts per second (cps) of transiently transfected in P19 cells.

WO 01/48224 PCT/AUOO/01596 110 Table 19 Hours 24 48 72 pSFM 21 254 604 252 pSFM 23 78778 145403 49936 pSFM2O 1263 3707 1692 WO 01/48224 PCT/AU00/01596 111 Maximum luciferase activity was observed 48 hours post-transfection for all plasmids. Luciferase activity from the goosecoid promoter construct (pSFM was 6 fold higher compared to the promoterless construct (pSFM 21). CMV driven luciferase activity (pSFM 23) was 200-300 fold higher than for the promoterless luciferase (pSFM 21). Therefore 48 hours post transformation was selected for.optimal detection of luciferase expression.

Selection of a P19 cell line stably integrated with a goosecoid-dependent TET-OFF transactivator P19 cells were .electroporated with pSFM 7 (Goosecoid promoter-TET/OFF) linearised with ApaLI and selected for stable integration.

Table 20 showes the luciferase activities of pSFM 25 (TRE luciferase+) .shown in counts per second (cps) of transiently transfected in P19-pSFM 7 cells.

WO 01/48224 WOOI/8224PCT/AUOO/01596 112 Table pSFM 25 Clone number without doxycycline, 9 582529 12 417268 29 616604 pSFM with doxycycline 54858 4396 48260 19548 8013 272888 703470 WO 01/48224 PCT/AU00/01596 113 From 100 clones, one clone (46) was selected which demonstrated the highest luciferase activity when transiently transfected with the reporter plasmid pSFM (TRE-luciferase+). Addition of doxycycline at lpg/ml reduced.luciferase activity from pSFM 25 in this clone by fold. This clone, containing stably integrated pSFM 7 was therefore designated P19-pSFM 7 and used for further testing.

Reporter plasmids pSFM 20 (goosecoid promoter luciferase+), pSFM 21 (promoterless luciferase+), pSFM 23 (CMV promoter luciferase+) and pSFM 25 (TRE luciferase+) were transiently transfected into either P19 or P19-pSFM 7 (Goosecoid TET/OFF) cells to test the effectiveness of the TET-OFF genetic switch driven by goosecoid promoter.

Table 21 shows the luciferase activities of transient transfection of reporter plasmids in P19 and P19-pSFM 7 cell lines.

WO 01/48224 PCT/AUOO/01596 114 Table 21 Plasmids P19-pSFM pSFM 20 pSFM 21 pSFM 23 pSFM 25 Average 365 60 16031 368 7 cells Fold 6 1 267 6 P19 cells Average Fold 610 121 1 44491 367 183 WO 01/48224 PCT/AU00/01596 115 P19-pSFM 7 but not the P19 cells show a 6 fold increase in luciferase+ reporter activity when transfected with pSFM 25 compared to the promoterless plasmid pSFM 21. This increase is comparable to the increase seen when the cells are transfected with plasmids containing the luciferase driven by the goosecoid promoter (pSFM 20). Therefore the P19-pSFM 7 cell line can be used to drive .expression through pTRE plasmids.to the same level as plasmids driving expression .from the goosecoid promoter directly.

Example 15 Construction and Testing;:of -Blocker Plasmids Antisense and double stranded blockers specific for goosecoid were constructed.

pSFM 5: Tet-responsive expression vector pTREgoosecoid double strand RNA (Figure 34). SEQ ID 57 was derived from pSFM 2 and pSFM 9. A 0.48kb PstI BamHI fragment of pSFM 9 was inserted into a 3.9kb PstI partial BamHI fragment of pSFM 2 to produce pSFM pSFM 8: pCMV promoter expressing goosecoid antisense RNA .(Figure 35). SEQ ID 58 A 0.8kb EcoRI KpnI fragment of pSFM 9 containing the goosecoid cDNA was inserted into pdsRED-Nl (Clontech 6921-1) cut with KpnI; .EcoRl. This..clone was then cut with SmaI HpaI to remove the RFP ;and religated to produce pSFM 8.

pSFM 9: Tet-responsive expression vector pTREgoosecoid antisense RNA (Figure 36). SEQ ID 59 A 0.78kb HindIII Klenow end-filled EcoRI fragment of pCMH142 was cloned into pTRE cut with BamHI end-filled with Klenow EcoRI.

The first stage for testing blocker constructs is to set up an appropriate cell system to detect expression of reporter constructs. Initially, either pdsRED-N1 (CMV promoter RFP), pSFM 6 (CMV promoter goosecoid cDNA fused to RFP) or pSFM 24 (TRE EGFP) were WO 01/48224 PCT/AU00/01596 116 transfected into P19-pSFM 7 cells to test the expression patterns of the EGFP, RFP and goosecoid-fused to RFP proteins (Figure 37). These tests show that RFP is expressed in the cytoplasm when driven from a CMV promoter (Figure 37,B). When goosecoid is fused to RFP and driven from a CMV promoter however, the RFP signal is now detected in the nucleus (Figure 37C,D), whereas the EGFP is expressed in the cytoplasm of the same cells when expressed through the TRE promoter (Figure 37D). This shows therefore, that goosecoid is efficiently transferred to the nucleus when fused to the reporter gene RFP and that this system can be used to.test cotransfected blocker plasmids.against goosecoid. In these cases, RFP expression fused to goosecid in the nucleus is expected to be inhibited in the presence of an appropriate blocker.

In order to assess various.antisense and dsRNA blockers, pSFM 6 (CMV promoter goosecoid fused to RFP) was transiently cotransfected into the P19-pSFM 7 (Goosecoid promoter TET/OFF) cells along with either pSFM (TRE promoter dsRNA goosecoid), pSFM 8 (CMV promoter antisense goosecoid), pSFM 9 (TRE promoter antisense goosecoid) or pSFM 24 (TRE promoter.EGFP). In these cases, significant difference could not be detected between the various treatments in either the intensity or number of cells expressing RFP in-the nucleus.

There are several potential reasons ,for the absence of RNA blocker effects. First, antisense and .dsRNA blockers-may not be expressed at levels.high enough to effectively interfere with the target mRNA molecules.

Secondly, there may be cellular mechanisms in mammals that recognize and interfere with such constructs.

Thirdly, the RNA inhibitory molecules may not be able to access and block the RNA target.

The goosecoid gene, in the form of sterile feral constructs, was tested in mammalian cells to demonstrate whether plasmids DNA coding for SF blockers have effect any effect on blocking goosecoid expression.

WO 01/48224 PCT/AU00/01596 117 We have demonstrated the methods for producing stably integrated cell lines and the testing of blocker constructs based on goosecoid dsRNA and goosecoid antisense. Our results suggest that post-transcriptional silencing through double strand RNA is unlikely to be very effective in mice. We therefore conclude that either the system described here is insufficiently sensitive to detect RNA interference using the current blockers or that these inhibitors are relatively ineffective in the P19.mammalian cell line. Nevertheless, small effects in cell culture can translate into severe phenotypic abnormality when introduced into mice.

By contrast, over-expression and mis-expression of genes leading to developmental abnormalities has been demonstrated in mice (Zwijsen et al., 1999; Goodrich et al., 1999). It can be reasonably expected therefore that sterile feral blockers.that cause over-expression or misexpression of developmental genes through at tetracycline repressible system will succeed. However, sense constructs cannot be easily tested using reporter systems. It is necessary to stably introduce such constructs into embryonic stem (ES) cells and produce transgenic mice to evaluate the extent to which development can be disrupted.

Example 16 Production of Transgenic.Mice..using the goosecoid Promoter By using the goosecoid gene promoter (or similar) to drive expression of known proteins critical to early embryogenesis a transgenic mouse can be made.

Candidate sense blockers for expression from the goosecoid promoter are gene products that are critical for development in the mouse and are also normally expressed in the embryo during gastrulation at the same time as the goosecoid gene product. Two other proteins, Chordin and Noggin, are known to expressed within the same embryonic region at times and locations similar to that of goosecoid (Bachiller et al., 2000). In WO 01/48224 PCT/AU00/01596 118 particular, Chordin is expressed in the same region as goosecoid at embryonic stage TS 11 in the primitive streak and node.

Double knock-out mice for Chordin and Noggin have been produced and these show severe phenotypic defects in the prosenchephalon. Both of these proteins are therefore essential for successful development in the mouse. These two genes are antagonisers of another gene product, BMP-4, which is expressed in the region adjacent to the primitive streak. Together, these three gene products contribute to the anterior/posterior structural features of the developing mice. .Therefore, misexpression of BMP-4 using the goosecoid promoter, within the primitive streak, where Noggin and Chordal are expressed, will interefere with the balance between these gene products and be expected to produce a phenotype that will match the double knock-out for Chordin and Noggin.

Many other developmental genes, particularly those involved with early embryogenesis could be misexpressed in a similar manner.

The following process can be used to generate a transgenic mouse line expressing repressible developmentally regulated blockers. Gene targeting in mice is regularly achieved using two different methods.

One is.by oocyte injection and the other is through gene insertion into embryonic stem.cells. The.,embryonic stem cell method is the most preferred..for. manipulations using the goosecoid gene since this gene is usually activated following removal of leukemic inhibitory factor (a factor used to maintain the cells in undifferentiated state) from the culture medium (Savatier et al., 1996).' Testing for effectiveness of reversible blockers on goosecoid expression in cell cuture can therefore be tested in embryonic stem cells before being transferred into mouse but not in system using directly injected oocytes.

The manipulations and production of repressibly steile transgenic mice is readily achievable to those practiced in the art (Hogan et al., 1994). This involves WO 01/48224 PCT/AU00/01596 119 the following steps: Transfection, stable integration and selection of embryonic stem cells with a sterile feral construct consisting of the goosecoid promoter driving expression of tTA (Tet-Off) such as pSFM 7 (SEQ ID NO:48).

Transfection, stable integration and selection of the teracycine dependent effector construct consisting of the TRE (Tet-reponsive promoter) driving expression of one of the following: goosecoid antisense or dsRNA in constructs such as pSFM 9 (SEQ ID NO:59) and pSFM 5 (SEQ ID NO:57) or the cDNA for genes essential for development in the embryo around the time..of primitive streak formation (such as BMP-4).

Conclusions One type of "sterile feral" construct encompassed by the present invention consists of three components, a developmental or constitutive promoter, a gene blocker sequence, and a repressible promoter from Clontech 's commercially available Tet-Off system. The developmental or constitutive promoter functions to drive expression of Tet-Off represser protein (tTA, Clontech

TM

which binds to the tet responsive element (TRE-CMVmin, Clontech) that in turn drives expression of the gene blocker sequence. Expression of the blocker DNA sequence results in production of either, anti-sense:.or -double stranded mRNA to ultimately knock-out .function -of the target gene or mis-expression of a sense sequence, that causes distorted development and embryo death. .Correct function of the sterile feral construct requires that functions of both the developmental promoter and the target gene are confined to either oogenesis or embryogenesis. This can be achieved optimally by using a stage-specific promoter, though it can also be achieved through use of a developmental blocker who's effects are also spatio-temporally confined to early embryogenesis.

Repression of the blocker sequence function is accomplished through exposure to tetracyline which WO 01/48224 PCT/AUOO/01596 120 prevents the binding of the tTA to the TRE-CMVmin.

WO 01/48224 PCT/AU00/01596 121 References Archer, T. P. Lefebvre, et al. (1992).

Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation [published erratum appears in Science 1992 Apr 10;256(5054):161].

Science 255(5051): 1573-6.

Ausubel, Brent, Kingston, R.E., Moore, Sridman, Smith J.A. and Struhl, K.

(Eds.; 1996). Current protocols in molecular biology.

John Wiley and Sons Inc, USA. Vol 1-3.

Bachiller, J. Klingensmith, et al. (2000).

The organizer factors Chordin and .Noggin are required for mouse forebrain development. Nature 403(6770): 658-61.

Blum, S. J. Gaunt, et al. (1992).

Gastrulation in the mouse: the role of the homeobox gene goosecoid. Cell 69(7): 1097-106.

Blumberg, C. V. Wright, et al. (1991).

Organizer-specific homeobox genes in Xenopus laevis embryos. Science 253(5016): 194-6.

Cormack BP, Valdivia RH, Falkow S (1996)FACSoptimised mutants of the green fluorescent protein (GFP).

Gene 173:33-38.

Cunha,.G. R. (1976). Stromal induction and specification of morphogenesis and cytodifferentiation of the epithelia of the Mullerian ducts and urogenital sinus during development of the uterus and vagina in mice.. J Exp Zool 196(3): 361-70.

Dale, Howes,G., Price, B.M.J. and 'Smith (1992) Bone morphogenetic protein 4: a ventralizing factor in early Xenopus development. Development 115:573- 585 DeRobertis, E.M.and Sasai, Y (1996). A common plan for dorsoventral patterning in bilateria. Nature 380:37-40.

Dick et al (1999). Smadl and Smad5 have distinct roles during dorsoventral patterning of the zebrafish embryo.

Developmental Dynamics 216:285-298.

Driever et al (1996). A genetic screen for mutations affecting embryogenesis in zebrafish.

WO 01/48224 PCT/AU00/01596 122 Development. 123:37-46 Driever, W. and Rangini, Z. (1993).

Characterization of a cell line derived from zebrafish (Bracydanio rerio) embryos. In Vitro (Cell. Dev. Biol.

29A: 749-754.

factor encoded by the short gastrulation gene. Genes Dev 8:2602-2616.

Ferguson, E.L. and Anderson, K.V. (1992).

Decapentaplegic acts as a morphogen to organize dorsalventral pattern in the Drosophila embryo.Cell 71:451- 461.

Fire, Xu, Montogomery Kostas, S.A. Driver, S.E. and Mello Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature.391:806-811.

Francois, Solloway, O'Neill, J.W., Emery, J. and Bier, E. (1994) Dorsal-ventral patterning of the Drosophila embryo depends on a putative negative growth Gaunt, S. M. Blum, et al. (1993).

Expression of the mouse goosecoid gene during midembryogenesis may mark mesenchymal cell lineages in the developing head, limbs and body wall. Development 117(2): 769-78.

Goodrich, L. D. Jung, et al. (1999).

Overexpression of ptcl inhibi:ts.induction of :Shh target genes and prevents normal patterning'.in the-neural tube.

Dev Biol 211(2): 323-34.

Gossen, M. Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline responsive promoters. Proc. Natl. Acad. Sci. USA 89:5547- 5551.

Gossen, Freundlieb, Bender, Muller, Hillen, W. Bujard, H. (1995) Transcriptional activation by tetracycline in mammalian cells. Science 268:1766-1769.

Hafter et al (1996). The identification of genes with unique and essential functions in the WO 01/48224 PCT/AU00/01596 123 development of the zebrafish, Danio rerio. Development.

123:1-36.

Hammerschmidt, Serbedzija, N. and McMahon, A.P.(1996) genetic analysis of dorsoventral pattern formation in the zebrafish: requirement of a BMP-like ventralizing activity and its dorsal represser. Genes Dev. 10:2452-2461.

Hild et al (1999). The snad5 mutation somitabun blocks Bmp2b signalling during early dorsoventral patterning of the zebrafish embryo. Development 126: 2149-2159.

Hogan, R. Beddington, et al., Eds. (1994).

Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press.

Holley, Jackson, Sasai, Lu, B., De Robertis, Hoffmann, and Ferguson, E.L.

(1995) A conserved system for dorsal-ventral patterning in insects and Animals involving sog and chordin. Nature 376: 249-253 Izant JG, Weintraub H (1984). Inhibition of thymidine kinase gene expression by anti-sense RNA: a molecular approach to genetic analysis. Cell 36:1007- 1015.

Jefferson, R. A. (1987). Assaying chimeric genes in plants: The GUS gene fusion system. Plant Mol.

Biol. Rep. 5: 387-405.

Jones, Dale,..L., Hogan, Wright C.V.E. and Smith, J.C. (1996). Bone morphogenetic protein- 4 (BMP4) acts during gastrula stages to cause ventralization of Xenopus embryos. Development 122:1545- 1554.

Kishimoto, Lee, Zon, L., .Hammerschmidt, M. and Schulte-Merker, S. (1997). The molecular nature of zebrafish swirl BMP2 function is essential during early dorsoventral patterning.

Development. 124:4457-4466.

Kistner A, Gossen M, Zimmermann F, Jerecic J, Ullmer C, Lubbert H, and Bujard H. (1996) Doxycyclinemediated quantitative and tissue-specific control of gene WO 01/48224 PCT/AU00/01596 124 expression in transgenic mice. Proc Natl Acad Sci U S A 93:10933-10938.

Laurent, M. N. and K. W. Cho (1999). Bone morphogenetic protein antagonism of Spemann's organizer is independent of Wnt signaling. Dev Biol 206(2): 157-62.

Lemaire,. P. and Yasuo H. (1998). Developmental signalling: a careful balancing act. Curr Biol.8:228-231 McKendry, R. M. Harland, et al. (1998).

Activin-induced factors maintain goosecoid transcription :through a paired homeodomain binding site. Dev Biol 204(1): 172-86.

mechanisms of dorsal-ventral patterning. Development 121:4319-4328 Mishihina, Susuki, Ueno. N. and Behringer, R.R. (1995). BMPr encodes a type I bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis. Genes and Dev.

9:3027-3037.

Miya, Morita, Suzuki, Ueno, N. and Satoh, N. (1997). Functional analysis of an ascidian homologue of Animal BMP-2/BMP-4 suggests its role in Piccolo, Sasai,Y., Lu, B. and DeRobertis, E.M. (1996). A possible molecular mechanism for Spemann organizer function: Inhibition of ventral signals by direct binding of Chordin to BMP-4. Cell 85:589-598.

Rivera-Perez, J. .M..Mallo, .'et al. .(1995).

Goosecoid is not an essential .component of the.mouse gastrula organizer but is required :for craniofacial and rib development. Development 121(9): 3005-12.

Sambrook, Fritsch, E.F. and Maniatis, T.(eds.; 1989). Molecular Cloning A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press. Vol 1-3.

Savatier, H. Lapillonne, et al. (1996).

Withdrawal of differentiation inhibitory activity/leukemia inhibitory factor up-regulates D-type cyclins and cyclin-dependent kinase inhibitors in mouse embryonic stem cells. Oncogene 12(2): 309-22.

Schmidt, Francois, Bier, E.and WO 01/48224 PCT/AU00/01596 125 Kimelman, D. (1995). Drosophila short gastrulation induces an ectopic axis in Xenopus: evidence for conserved Schulte-Merker, Lee, McMahon A.P. and Hammerschmidt, M.(1997). The zebrafish organizer requires chordino. Nature 387:862-863.

Stoffregen, Bowser, P.R. and Babish J.G.

(1996). Antibacterial chaemotherapeutants for finfish aquaculture: A synopsis of laboratory and field efficacy and .saftey studies. J. aquatic animal health. 8:181-207.

Suzuki Y, Yandell MD, Roy PJ, Krishna S, Savage-Dunn C, Ross RM, Padgett..RW,.Wood WB (1999).. A BMP homolog acts as a dose-dependent regulator of body size and male tail patterning in Caenorhabditis elegans.

Development 126(2): 241-250 the inhibition of neural fate specification.Development.124:5149-5159 Tjian R, Maniatis T (1994). Transcriptional activation: a complex puzzle with few easy pieces. Cell 8:77:5-8.

Waterhouse, Graham, M.W. and Wang, M-B.

(1998). Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Proc. Natl. Acad. Sci. 95:13959-13964.

Westerfield M. (1995). The zebrafish book: University of Oregon Press.

Zwijsen, M. J. :Goumans.,.et al. (1999).

Ectopic expression of the transforming growth-factor beta type II receptor disrupts mesoderm organisation during mouse gastrulation. Dev Dyn 214(2): 141-51.

EDITORIAL NOTE APPLICATION NUMBER 23322/01 The following sequence listing pages 1 69 are part of the description. The claims pages follow on pages 126 130.

WO 01/48224 WOOI/8224PCT/AUOO/01596 SEQUENCE LISTING <110> CSIRO Division of Marine Research <120> REPRESSIBLE STERILITY OF ANIMALS <130> CSIRO Marine Research <140> PCT/AUOO/0 <141> 2000-12-22 <150> PQ4884 <151> 1999-12-24 <160> 63 <170> Patentln Ver. 2.1 <210> 1 <211> 1710 <212> DNA <213> Zebrafish <400> 1 acatagtgtt atatacat La gatagtctaa aaagatcaaa tatatttgtg caaaa taac t atatatatat atatatatat ctacagggac tttctgttta aaaaacttgt aaaatcat tt acatcaac tt ttagctttat aataaaagaa ttttaaaacg aacgttaaca ccttataaat ttaaatttag tctcgttcaa ggaaat tcgg agcgcggcat gctccaatca cacggaaaac catcatatat gataagtzcag gttagtacac attcatatat catatacatt tatgattata atatatatat atatatatat tagagatgta acggaaagca tattttctag gggaaatatt taaattttat agctatggca tattcggct t t ttaaagaca tttacccttc actgaaaaaa gatt tgttta attactaaca tccatccgcg cattgtgaca atggcacaga ttctgctgac aagtacaccc tactgaagcc tcaaatttat gtatattgtt agactagtca gtataaaatt atatatatat atatccctca aagtcagaat gattttttta ccgaaataaa aaaaaaagaa ttatttatct caaca tgtca tatacaagtc acacattgca actataaatt tactcaaata accatacttc tgtttacata cgcgcagagt tcatcagaca cgcggcgcgt cacaagtttt t ttgaaaatc aaatctgaag gtaagggaaa tatatatgta gtattaaagc tgtacacgca atatatatat agatattttt tattagcccc agcagacct t acaaataaga cacaatttca tttggtaact tgttgtagct taaaatagtt ataacaaatc actatacatg caaatgtaga agtctcaatt ggataataca gtgggcatgt acaaaaagcc gctgcacgca tgatttcttt tctcaattca ctaatctaag atattaggta tataggaagc caaatctgga aatttgtaag atatatatat tattattgtt cttgtatatt gaaatggctt ctttctccct aaggggcac t acgacgacaa acat tgt ccc ttacataaaa aattaaatga attttaaaca taatttaaat gtattgcgta taaaatatgc tcaaacgctt ttgcgctcgc gagatgagtc aaaacaaaaa tattttgtgc aaaataacat aaaaatgtaa tttacaatat gctaatttaa t taagcaaat atatatatat atttttgtta ttccccccca ttaaaaaatt tgctctgata aataattctg gagatgtaat agaataagta tgttagatca aacctaaaat gaagatatat tagtgcgcat tacattacat cccatgcagg gaa tggagag gcagcgaagc tccaaacagc caaaaaatga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 WO 01/48224 WO 0148224PCT/AUOO/01596 caaatccagg attgtgcgat ctcgcgctgt cacttttggg attgctgctg tctttgacct gagcgctcgc gcacttcatt agagtttagt agagtctagt ctgaagtgtt gcacaagtat gaacaagaag aggcgacttg agctgcgacg actctctgtc gtgggataaa aaaatcgctt gtggattaaa acacgaattc atgaggaact tagaagacga cgggaacgca gaccggccac agcgcttcct cctccggtaa cgcattcaat 1500 1560 1620 1680 1710 <210> 2 <211> 1481 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Tetracycline-responsive transcriptional activator protein nucleotide sequence <400> 2 atgtctagat ggaa tcgaag c tgtattggc gataggcacc aataacgc ta tcagatacac tgccaacaag actttaggtt cctactactg ggtgcagagc cttaaatgtg accatcgagg gctccgcgcc accgatgtca gccgacgcgc ggatttaccc gagcagatgt aaaatgcttt caataaacaa gtgggaggtt tgcaagcctc catgagcaga gtcaacaggc atgtcccctg <210> 3 <211> 447 <212> DNA tagataaaag gtttaacaac atgtaaaaaa atactcactt aaagttttag ggcc tacaga gtttttcact gcgtattgga atagtatgcc cagccttctt aaagtgggtc gcctgctcga tgtcctttct gcctggggga tagacgattt cccacgactc ttaccgatgc ataagataca atttgtgaaa gttaacaaca ttttaaagca gtcgtc tggc gcgcccgccg ggtaaccggc gcggacggga taaagtgatt ccgtaaactc taagcgggct ttgccc ttta atgtgcttta aaaacagtat agagaacgcg agatcaagag gccattatta attcggcctt cgcgtacagc tctcccggac ccccgcggga cgagc tccac cgatctggac cgccccctac ccttggaatt ttgatgagtt tttgtgatgc acaattgcat agtaaaacct cggaccacgc ccgaggcaag ctcttcatcg agtatcagct aacagcgcat gcccagaagc ttgctcgacg aaaggggaaa ctaagtcatc gaaactctcg t tatatgcac catcaagtcg egacaagcta gaattgatca cgcgcgcgta gacgacgccc cacacgcgca ttagacggcg atgttggggg ggcgctctgg gacgagtacg tggacaaacc tattgcttta tcattttatg ctacaaatgt tatctgtgca actcgggcgg ggaatgcgcg cgaccaagc t tagagctgct ttggtgtaga ccttagccat gctggcaaga gcaatggagc aaaatcaatt tcagcgctgt ctaaagaaga tcgaattatt tatgcggatt cgaaaaacaa ccgaagaggc gac tgtcgac ,aggacgtggc acggggattc atatggccga gtgggtaggg acaactagaa tttgtaacca tttcaggttc ggtatggctg aggtccccgg cgccctgccc cgaccttcag taatgaggtc gcagcctaca tgagatgtta ttttttacgc aaaagtacat agccttttta ggggcatttt aagggaaaca tgatcaccaa.

agaaaaacaa ttacgggtct ggggctggcg ggcccccccg gatggcgc at cccgggtccg cttcgagttt ggcgcgagga tgcagtgaaa ttataagctg agggggaggt attatgatcc acgcgcgc tc gtcccaccag catcgccggc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1481 WO 01/48224 WO 0148224PCT/A UOOIO 1596 <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Tet responsive element <400> 3 ctcgagttta ccactcccta tatcagtgat-agagaaaagt gtgaaagtcg agtttaccac actccctatc agtgatagag.

agaaaagtga aagtcgagtt ctcggtaccc gggtcgagta agtgaaccgt cagatcgcct ccgggaccga tccagcctcc tcagtgatag gaaagtcgag tccctatcag aaaagtgaaa taccactccc ggcgtgtacg ggagacgcca cggcccc agaaaagtga tttaccactc tgatagagaa gtcgagttta tatcagtgat gtgggaggcc tccacgctgt aagtcgagtt cctatcagtg aagtgaaagt ccactcccta agagaaaagt tatataagca tttgacctcc taccactccc atagagaaaa cgagtttacc tcagtgatag gaaagtcgag gagctcgttt atagaagaca <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:SMADul forward primer <400> 4 tgcaggtgga ctttggatcc g <210> <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:SMADLl reverse primer <400> gcctaaaggc aacagatgct a <210> 6 <211> 17 <212> DNA <213> Artificial Sequence WO 01/48224 WO 0148224PCT/AUOO/01596 <220> <223> Description of Artificial Sequence:M13 forward primer <400> 6 gtaaaacgac ggccagt <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of primer <400> 7 tagtgctggg ctgcaccag <210> 8 <211> 1006 <212> DNA <213> Zebrafish <220> <221> promoter <222> (1)..(1006) Artificial Sequence:SMAD L2 reverse <400> 8 aagcttactt cttcatggaa t aa tcaccc t gtttctctct gaaatttaaa ttcagtttac tgtagaaata tttcagggtt gaaaatctat tccaaactga ggtgtcagtc tgcctggttg tagttgtgac gcagctgcgt tcccccctcc ggccgaggac gtatatttag tgagttaaac ttgccttaat cttttatcta ggagttgtgc ccacactgaa tagaactttt aacataaatt aatattttaa tcaactccct aatcaatttc tctgaccaca tgtgtttcca ccagttcctc cctgctttCC ccccctgaca gc tccagat t gttctcc tgg gaaggaatat gtttggccag ttggtaaagt atcgatggat ctaaactgaa atgttaagct gaattaaatt ttngcac tca gaatttgctt tctctttttt accaatatct gccttgattc ccccggcttc acttcctgtc tacacaaaca tggcttcctg accctcgcaa ttcaacggaa cttgtttttt cttatatatt aggagaaatg- gttgtgccca tttgtttctc ttgctcttca c ttc aac tc t gctttaacac catttgttaa cagaattttt tcataattaa tttttttatc ggcatggatt ctcaattgcc actgcaggcc cttggtcctg cacacataat gtgcagccca tacgctggct gtgtttggac aaaaactgga aatctacatt tttaaggaaa aaaaatgaat tagattatgc tgcaggtgga agtttataaa ctttacgcta ttcctgagcc caaggctaag catcttcctg gcacta actagtatat taggtcattt actgagcctg tgcttggttt ttttagttgt ctgacacagt gtaaaagcgc tttggtgnaa taaaatattg atgttttatt ctttgagtcc atctcctaac attctcgcag ccaagtacca cctgtccact gcacactgct 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1006 WO 01/48224 WO 0148224PCT/AUOO/01596 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:zfEx 1-3.EcoF Forward Primer <400> 9 accccgaatt catgaggaac ttagga 26 <210> <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:zfExl-3.Sa1R Reverse Primer <400> atcagctcgt cgacaggaat ggaggtaag 29 <210> 11 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Bexli.PstF 2 Forward Primer <400> 11 acacctgcag atgaggaact taggagacga c 31 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Bexli.Sa1R WO 01/48224 WO 0148224PCT/AUOO/01596 Reverse Primer <400> 12 tactgagggt cgactgccga ttztgct <210> 13 <211> 1126 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Blocker Molecule <400> 13 gaattcatga cggaactgac gtgttgctgg tcggggagac ttgctcaata cagtacatgc ccgaggagca agttttcatc cagtttttct tcgc ttcaat agttcgctcc gagtccaacg cacggcgacc gtcgtctcct gacatgataa tgctttattt aaacaagtta gaggtttttt gatcagatcc ggaacttagg tgatcatggt gaggtgccgt acacaccgga tgttcggatt tggacttgta ctatgggaaa acgaagaggc tcaaccttac ccgaacatat ggtgtgtgtc gcacctccca atgatcagtc aagttcctca gatacattga gtgaaatttg acnacaacaa aaagcaagta actagttcta agacgacggg cgccgtggtc tggactcatt gcgaac egat gaagcgaaaa ttatatgcac.

acatgtagaa tttcgaggca ctccattcct tgagcaagcg tccccgaatc gcaacacc tg agttccggag tctgcagcaa tgagt ttgga tgatgctatt ttgcattcat aaacctctnc gagcggccgc.

aacgcagacc ggccacagcg .cttcctcctc cgcgctctca cccgagatcg acaaacttcc cccaccccaa tctgaaaacg agggcagcca ctgtccagcc gtcgactgcc tagctcaaac actgtatttc accgagcaac gaggaagcgc ttggatatca caaaccncan gctttatttg cggtgctgtt accgacggaa tgaacgagtt gcaaatcggc atgacccgaa gcagagcaaa tgaaaggaaa gatttgcttg tcgttcagga cgtcggtcga agcaccgtga tgtggccggt agcttatcga ctagaatgca taaccattat.

gctcggtcag atacagtgat tgagctacgc agtggtccct cattcggcgc cacgatacga aacaacgcag gggtgggttt agtttgtatc tc tcgggaat gagcgcggac ctgcgttCCC tgatgatcca gtgaaaaaaa aagctgcaat ggaggtgtgg tgatcctcta 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1126 tttatgtttc. aggttcagng aaatgtggta tggctgatta caccgcggtg gagctc <210> 14 <211> 8282 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:pBIT(Bmp2)-bmp2ds construct refereed to as pSF1.

<400> 14 WO 01/48224 WO 0148224PCT/AUOO/01596 actagttcta tgtcttctat aaacgagctc aaagtcgagt ccctatcagt aaagtgaaag accactccct tagagaaaag ctatataagc ttttgacctc cggtacccgg -gaccggccac ctcacggtgc atcgaccgac ttcc tgaacg ccaagcaaat aacgatgacc gccagcagag agcctgaaag tgccgatttg aaactcgttc caacagcacc gcgctgtggc atcaagctct gtgagtttgg ggagggggca ggaccctcat .aatttttaaa ttttcaaggc ataattaaat ,cttattggta tgatatacac aaccatgttc ctgtctcatc gtggctggtg aaaaattatg.

tttattttca gggagggcaa gccatatgct gccccctgct tatattttgt actagccaga atgaactcga gcgctcttcc ggtatcagct aaagaacatg gagcggccgc ggaggtcaaa tgcttatata ttaccactcc gatagagaaa tcgagtttac atcagtgata tgaaagtcga agagctcgtt catagaagac ggatcctcta agcgcttcct tgttgctcgg ggaaatacag agtttgagct cggcagtggt cgaacattcg caaacacgat gaaaaacaac cttggggtgg aggaagt ttg tcgatctcgg gtgagagcgc cggtctgcgt gacgcgtgct ggacccttga aagttttcag gataattttg tttcattttc, ttcactttcg aatcagggta gataaggtag gaaacaac ta tgt ttgagat atgccttctt att ttggcaa tggccaatgc gggacatcat ttgcaatagt atcatttaaa ggc tgczcatg gtccattcct tttgtgttat tttttcctcc ctgcattaat gcttcctcgc cactcaaagg tgagcaaaag ctgcaggaat acagcgtgga ggtcgagttt ctatcagtga agtgaaagtc cactccctat gagaaaagtg gctcggtacc tagtgaaccg accgggaccg gtcagaattc cc tccggaac tcaggtgttg tgattcgggg acgcttgctc ccc tcagtac gcgcccgagg acgaagtttt gcagcagttt gttttcgctt tatcagttcg gaatgagtcc ggaccacggc tcccgtcgtc agcgcggcct ttgttctttc ggtgttgttt tttctttcac tgtaactttt tttatttgtc attatattgt aatatttctg catcctggta gaggataaaa ctttttccta agaattcact cc tggc tcac gaagcccctt gtgtgggaat acatcagaat aacaaaggtg tattccatag ttttttcttt tctcctgact gaatcggcca tcactgactc cggtaatacg gccagcaaaa tcggggcCgC tggcgtctcc accactccct tagagaaaag gagtttacca cagtgataga aaagtcgagt cgggtcgagt tcagatcgcc atccagcctc atgaggaact tgactgatca ctgggaggtg agacacacac aatatgttcg atgctggact agcactatggcatcacgaag ttcttcaacc caatccgaac ctccggtgtg aacggcacc t gaccatgatc tcctaagt tc cgacgatatc tttttcgcta agaatgggaa tttctactct ttcgttaaac agattgtaag acttcagcac catataaatt atcatcctgc tactctgagt cagctcctgg cctcaggtgcaaataccact gagcatc tga tttttgtgtc gagtatttgg gctataaaga aaaagcc ttg aacaicccta actcccagtc acgcgcgggg gctgcgctcg gttatccaca ggccaggaac ggaggc tgga aggcgatctg atcagtgata tgaaagtcga ctccctatca gaaaagtgaa ttaccactcc aggcgtgtac tggagacgcc cgcggccccg taggagacga tggtcgccgt ccgttggact cggagcgaac gattgaagcg tgtattatat gaaaacatgt aggctttcga ttacctccat atattgagca tgtctccccg cccagcaaca agtcagttcc ctcatctgca tctagactga ttgaaaaatt gatgtccctt gttgacaa~c tttagcttgc tac tt tctct agttttagag ctggctggcg ctttctcttt -ccaaaccggg -gcaacgtgc t aggctgccta gagatctttt cttctgggta tctcactcgg tttagagttt ggtcatcagt acttgaggtt aaattttcct atagctgtcc agaggcggtt gtcgttCggC gaatcagggg cgtaaaaagg tcggtcccgg acggttcact gagaaaagtg gtttaccact gtgatagaga agtcgagttt ctatcagtga ggtgggaggc atccacgctg aattcgagct cgggaacgca ggtccgcgct cattcccgag tgatacaaac aaaacccacc gcactctgaa agaaagggca ggcactgtcc tcctgtcgac agcgtagctc aatcactgta cctgaccgag ggaggaggaa gcaattggat gaacttcagg catgttatat gtatcaccat attgtctcct atttgtaacg aatcactttt .aacaattgtt tggaaatatt atggttacaa cccctctgct ggttgttgtg tcagaaggtg tccctctgcc ataaaggaaa aaggacatat ggcaacatat atatgaaaca agattttttt tacatgtttt ctcttctctt tgcgtattgg tgcggcgagc atiaacgcagg ccgcgttgct 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 WO 01/48224 WO 0148224PCT/AUDO/01596 ggcgtttttc gaggtggcga cgtgcgctct gggaagcgtg tcgctccaag cggtaactat cac tggtaac gtggcctaac agttaccttc cggtggtttttcctttgatc tttggtcatg ttttaaatca cagtgaggca cgtcgtgtag .accgcgagac ggccgagcgc ccgggaagct tacaggcatc acgatcaagg tcctccgatc -actgcataat ctcaaccaag aatacgggat ttcttcgggg cactcgtgca aaaaacagga ac tca tact c cggatacata .ccgaaaagtg agtcagtatt aaatttgtac tatatatata cctcaagata .agaattatta ttttaagcag ataaaacaaa aagaacacaa tatcttttgg tgtcatgttg aagtctaaaa ttgcaataac aaattactat aaatacaaat acttcagtct acataggata agagtgtggg cataggctcc aacccgacag cctgttccga gcgctttctc ctgggctgtg Cgtc ttgagt aggattagca tacggctaca ggaaaaagag t ttgtttgca ttttctacgg agattatcaa atctaaagta cctatctcag ataactacga ccacgctcac agaagtggtc agagtaagta gtggtgtcac cgagttacat gttgtcagaa tctcttactg tcattctgag aataccgcgc cgaaaac tc t cccaactgat aggcaaaatg ttcctttttc tttgaatgta ccacctgcga aaagccaaat acgcaaattt tatatatata ttttttatta gcccccttgt accttgaaat taagactttc tttcaaaggg taactacgac tagctacatt tagttttaca aaatcaatta acatgatttt gtagataatt caattgtatt atacataaaa catgttcaaa gcccccctga gactataaag ccctgccgct aatgctcacg tgcacgaacc ccaacccggt gagcgaggta c tagaaggac ttggtagctc agcagcagat.

ggtctgacgc aaagga tct t tatatgagta.

cgatctgtct tacgggaggg cggctccaga ctgcaacttt gttcgccagt gctcgtcgtt gatcccccat gtaagttggc tcatgccatc aatagtgtat cacatagcag caaggatctt cttcagcatc ccgcaaaaaa aatattattg tttagaaaaa caagctttac ctggagctaa gtaagttaag tatatatata ttgttatttt atattttccc ggcttttaaa tcccttgc tc gcactaataa gacaagagat gtcccagaat taaaatgtta aatgaaacct aaacagaaga taaattagtg gcgtatacat tatgccccat cgcttgaatg cgagcatcac ataccaggcg taccggatac ctgtaggtat ccccgttcag aagacacgac tgtaggcggt agtatttggt ttgatccggc -tacgcgcaga .tcagtggaac cacctagatc aacttggtct atttcgttca cttaccatct tttatcagca aaaaatcgac tttccccctg ctgtccgcct ctcagttcgg cccgaccgct ttatcgccac gctacagagt atctgcgctc aaacaaacca .aaaaaaggat gaaaactcac cttttaaatt gacagttacc tccatagttg ggccccagtg -ataaaccagc atccgcctcc *atccagtcta taatagtttg cgcaacgttg tggtatggct .tcattcagct gttgtgcaaa cgcagtgtta cgtaagatgc gcggcgaccg aact ttaaaa accgctgttg ttttactttc gggaataagg aagcatttat taaacaaata aatat tatat tttaacaaaa caaatatata tatatatata tgttactaca ccccatttct *aaat taaaaa tgataaaaat ttctgacatc gtaatttagc aagtaaataa gatcatttta aaaataacgt tatatcctta cgcatttaaa tacattctcg gcaggggaaa gagagagcgc aaagcggtta tcactcatgg ttttctgtga agttgctctt gtgctcatca agatccagtt accagcgttt gcgacacgga caggg ttatt ggggttccgc ttgtgcatat taacttatga tatatatata tatatatata gggactagag gtttaacgga cttgttattt catttgggaa aactttaaat tttatagcta aagaatat tc aaacgtttaa taacatttac taaatactga tttaggattt ttcaaattac ttcggtccat ggcatcattg gc tcaagtca gaagctccct ttctcccttc tgtaggtcgt gcgccttatc tggcagcagc tcttgaagtg tgctgaagcc ccgctggtag c tcaagaaga gt taagggat aaaaatgaag aatgcttaat cctgactccc .ctgcaatgat cagccggaag ttaattgttg ttgc cat tgc cc gg ttc cca gctccttcgg ttatggcagc ctggtgagta gcccggcgtc ttggaaaacg cgatgtaacc ctgggtgagc aatgttgaat gtctcatgag gcacatttcc acattagact ttatagtata tatatatata tatatatatc .atgtaaagtc aagcagattt tc tagccgaa atat taaaaa tttatttatt tggcacaaca ggctttatac agacaacaca ccttcactat aaaaatactc gtttaaccat taacatgttt ccgcgcgcgc tgacatcatc 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3.780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 agacaacaaa aagccttgcg ctcgcgcagc gaagcgctcc aatcaatggc acagacgcgg 5760 WO 01/48224 WO 0148224PCT/AUOO/01596 cgcgtgctgc acgcagagat gtttttgatt tctttaaaac gctgtcactt ttgggattgc ttagtagagt ctagtctgaa cgacgactct ctgtcgtggg tctagattag ataaaagtaa atcgaaggtt taacaacccg tattggcatg taaaaaataa aggcaccata ctcacttttg aacgctaaaa gttttagatg .ggtacacggc .ctacagaaaa caacaaggtt tttcactaga ttaggttgcg tattggaaga actactgata gtatgccgcc gcagagccag ccttcttatt aaatgtgaaa gtgggtccgc atcgagggcc tgctcgatct ccgcgcctgt cctttctccc gatgticagcc tgggggacga gacgcgctag acgatttcga tttacccccc acgactccgc cagatgttta ccgatgccct agacatgata agatacattg atgctttatt tgtgaaattt taaacaagtt aacaacaaca ggaggttttt taaagcaagt aagcctcgtc gtctggccgg gagcagagcg cccgccgccg *aacaggcggt'aaccggcctc tcccctggcg gacgggaagt agctcgtcca tgccgagagt tcgcgcttct cgttggggtc ggcagcagca cggggccgtc acgctgccgt cctcgatgtt *ttgtcggcca tgatatagac .atgttgccgt cctccttgaaccctcgaact tcacctcggc cgctcctgga cgtagccttc tcggggtagc ggctgaagca ggcacgggca gcttgccggt tcgccctcgc cc tcgccgga accaggatgg gcaccacccc cc gagtc tccaa aaaaacaaaa tgctgtcttt gtgttgcaca ataaaaaaat agtgattaac taaactcgcc gcgggctttg ccctttagaa tgctttacta acagtatgaa gaatgcatta tcaagagcat attattacga cggccttgaa gtacagccgc ccgga~cgac cgcgggacac gctccactta tctggacatg cccctacggc tggaattgac atgagtttgg gtgatgctat attgcattca aaaacctcta accacgctat aggcaagact ttcatcggga atcagctcga gatcccggcg tttgctcagg gccgatgggg gtggcggatc gttgtggctg gtcgatgccc gcgggttttg gggcatggcg ctgcacgccg ggtgcagatg cacgctgaac ggtgaacagc acagccacgg aaaacttctg aatgacaaat ccaggattgt gacctgagcg ctcgcgcact agtatgaaca agaagaggcg cgcttgtgga ttaaaacacg agcgcattag agctgcttaa cagaagctag gtgtagagca ctcgacgcct tagccattga ggggaaagct ggcaagattt agtcatcgcg atggagcaaa .actctcgaaa atcaattagc tatgcactca gcgctgtggg caagtcgcta aagaagaaag caagctatcg aattatttga ttgatcatat'.gcggattaga gcgcgtacga .aaaacaatta gacgcccccg aagaggcggg acgcgcagac tgtcgacggc gacggcgagg acgtggcgat ttgggggacg gggattcccc gctctggata tggccgactt gagtacggtg ggtagggggc acaaaccaca actagaatgc tgctttattt gtaaccatta ttttatgttt caggttcagg caaatgtggt atggctgatt ctgtgcaagg tccccggacg cgggcggcgc cctgcccgtc atgcgcgcga ccttcagcat ccaagcttga tatcgaattc gcggtcacga actccagcag gcggactggg tgctcaggta gtgttctgct ggtagtggtc ttga-agttca .ccttgatgcc ttgtagttgt actccagctt, .ttcagctcga tgcggttcac tagttgccgt cgtccttgaa gacttgaaga agtcgtgctg taggtcaggg tggtcacgag aacttcaggg tcagcttgcc ttgtggccgt ttacgtcgcc tcctcgccct tgctcaccat ctgaccacaa gcgatctcgc tcattagagt acttgagctg aattcatatg tgaggtcgga gcctacattg gatgttagat tttacgtaat agtacattta 'ctttttatgc gcattttact ggaaacacct tcaccaaggt aaaacaactt cgggtctacc gctggcggct ccccccgacc ggcgcatgcc gggtccggga cgagtttgag gcgaggatcc agtgaaaaaa taagctgcaa gggaggtgtg atgatcctgc cgcgctccat ccaccaggtc cgccggcatg ttacttgtac gaccatgtga gtggttgtcg ggcgagctgc gttcttctgc gtgccccagg cagggtgtcg gaagatggtg cttcatgtgg ggtgggccag gtaggtggca gtccagc tcg ccgcggggat 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 67-80 6840 6900 6960 7020 7080 7140 7200 7260 7320 7380 7440 7500 7560 7620 7680 7740 7800 7860 7920 7980 8040 8100 8160 8220 8280 8282 <210> <211> 7713 <212> DNA WO 01/48224 WO 014S224PCT/AUOO/01596 <213> Artificial Sequence <220> <223> Description of Artific ial Sequence:pBIT(CMV)-bip2ds referred to as pSF2 <400> ctcgaggagc ttggcccatt gcatacgttg ggctcatgtc caacattacc gccatgttga tcaattacgg .ggtcatltagt .tcatagccca gtaaatggcc cgctaaactggacgtcaatg tttcctactt tggcagtaca cccattgacg cgtaacaact ataagcagag gacctccata gattagataa aaggtttaac ggca tgtaaa accatactca ctaaaagttt cacggcc tac aaggttt ttc gttgcgtatt ctgatagtat agccagcctt *gtgaaagtgg agggcctgct .gcctgtcctt .tcagcctggg cgctagacga ccccccacga tgtttaccga atgataagat.

tttatttgtg caagttaaca gttttttaaa ctcgtcgtct agagcgcccg ggcggtaacc ctggcggacg cgtccatgcc gcttctcgtt gcagcacggg .cgcctggctg tagtaacgcc cccacttggc acggtaaatg ggcagtacat tcaatgggcg tcaatgggag ccgccccatt ctcgtttagt gaagacaccg aagtaaagtg adcccgtaaa aaataagcgg cttttgccct tagatgtgct agaaaaacag actagagaat ggaagatcaa gcc gccatta cttattcggc gtccgcgtac.

c ga tctcccg tctccccgcg ggacgagctc tttcgatctg ctccgccccc tgcccttgga acattgatga aaatttgtga.

acaacaattg gcaagtaaaa ggccggacca ccgccgaggc ggcctcttca ggaagtatca gagagtgatc ggggtctttg gcCgtcgccg accgcccaac aatagggact agtacatcaa gcccgcctgg ctacgtatta tggatagcgg t ttgtt ttgg gacgcaaatg gaaccgtcag.

ggaccgatcc attaacagcg ctcgcccaga gctttgctcg ttagaagggg ttactaagtc tatgaaactc gcattatatg gagcatcaag ttacgacaag cttgaattga agccgcgcgc gacgacgacg ggacacacgc cacttagacg gacatgttgg tacggcgctc attgacgagt ,gtttggacaa tgc tattgct cattcatttt cctctacaaa cgc tatctgt aagactcggg tcgggaatgc gctcgaccaa ccggcggcgg ctcagggcgg atgggggtgt tatccatatc cattgattat tatatggagt gacccccgcc ttccattgac gtgtatcata cattatgccc gtcatcgcta tttgactcac caccaaaatc ggcggtaggc atcgcctgga agcctccgcg cattagagct agctaggtgt acgccttagc aaagc tggca atcgcgatgg tcgaaaatca cactcagcgc tcgctaaaga ctatcgaatt tcatatgcgg.

gtacgaaaaa cccccgaaga gcagactgtc gcgaggacgt gggacgggga tggatatggc acggtgggta accacaacta ttatttgtaa atgtttcagg tgtggtatgg gcaaggtccc cggcgccctg gcgcgacctt gcttgatatc tcacgaactc actgggtgct tctgctggta ataatatgta tgac tagtta -tccgcgt tac cattgacgtc gtcaatgggt tgccaagtac agtacatgac ttaccatggt ggggatttcc aacgggactt gtgtacggtg gacgccatcc gccccgaatt gcttaatgag agagcagcc t cattgagatg agat tt tt ta agcaaaagta attagccttt tgtggggcat agaaagggaa atttgatcac attagaaaaa caattacggg ggcggggctg gacggccccc :ggcgatggcg ttccccgggt cgacttcgag gggggcgcga gaatgcagtg ccattataag ttcaggggga ctgattatga cggacgcgcg cccgtcccac cagcatcgcc gaattcttac cagcaggac caggtagtgg gtggtcggcg catttatatt ttaatagtaa ataacttacg aataatgacg ggagtattta gccccctatt cttatgggac gatgcggttt aagtctccac ggaggtctat acgctgtttt catatgtcta gtcggaatcg acattgtatt ttagataggc cgtaataacg catttaggta ttatgccaac tttactttag acacctacta caaggtgcag caacttaaat tctaccatcg *gcggctccgc ccgaccgatg catgccgacg tttgagcaga ggatccagac aaaaaaatgc ctgcaataaa ggtgtgggag tcctgcaagc c tccatgagc caggtcaaca ggcatgtccc ttgtacagct atgtgatcgc ttgtcgggca agctgcacgc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 WO 01/48224 WO 0148224PCT/AUOO/01596 tgccgtcctc gatgttgtgg cggccatgat atagacgttg tgccgtcctc cttgaagtcg cgaacttcac ctcggcgcgg cctggacgta gccttcgggc ggtagcggct gaagcactgc cgggcagctt gccggtggtg cctcgccctc gccggacacg ggatgggcac caccccggtg tagttctaga .gcggccgcct tcttctatgg aggtcaaaac acgagctctg cttatatagg agtcgagttt accactccct ctatcagtga tagagaaaag agtgaaagtc gagtttacca cactccctat cagtgataga gagaaaagtg aaagtcgagc atataagcag agctcgttta ttgacctcca tagaagacac gtacccgggg atcctctagt ccggccacag cgcttcctcc cacggtgctg ttgctcggtc cgaccgacgg aaatacagtg cctgaacgag tttgagctac aagcaaatcg gcagtggtcc cgatgacccg aacattcggc cagcagagca aacacgatac cctgaaagga aaaacaacgc ccgatttgct tggggtgggt actcgttcag gaagtttgta tccgtcggtc gatcticggga acagcaccgt gagagcgcgg gctgtggccg gtctgcgttc caagctctga cgcgtgctag gagtttgggg acccttgatt agggggcaaa .gttttcaggg accctcatga taatttftgtt tattttcttt tcattttctg tttttaaatt-cactttcgtt ttcaaggcaa tcagggtaat aattaaatga taaggtagaa tattggtaga aacaactaca atatacactg tttgagatga ccatgttcat gccttcttct gtctcatcat tttggcaaag ggctggtgtg gccaatgccc aaattatggg gacatcatga tattttcatt gcaatagtgt cggatct tga tggctgttgt atgcccttca gtcttgtagt atggcggact acgccgtagg cagatgaact ctgaacttgt aacagctcct gcaggaattc agcgtggatg tcgagtttac atcagtgata tgaaagtcga ctccctatca gaaaagtgaa tcggtacccg gtgaaccgtc cgggaccgat cagaattcat tccggaactg aggtgttgct attcggggag gcttgctcaa ctcagtacat gcccgaggag gaagttttca agcagttttt tttcgcttca tcagttcgct atgagtccaa accacggcga ccgtcgtctc cgcggcctcg gttctttctt tgttgtttag tctttcactt taactttttt tatttgtcag tatattgtac tatttctgca tcctggtaat ggataaaata ttttcctaca aattcactcc tggctcacaa agccccttga gtgggaattt agttcacctt agttgtactc gctcgatgcg tgccgtcgtc tgaagaagtc tcagggtggt tcagggtcag ggccgtttac cgcccttgct ggggccgcgg gcgtc tccag cactccctat gagaaaagtg gtttaccact gtgatagaga agtcgagttt ggtcgagtag agatcgcctg ccagcctccg gag'gaactta actgatcatg gggaggtgcc acacacaccg tatgttcgga gctggacttg cactatggga tcacgaagag cttcaacctt atccgaacat ccggtgtgtg cggcacctc ccatgatcag ctaagttcct.

acgatatctc tttcgctatt aatgggaaga tctactctgt cgttaaactt attgtaagta ttcagcacag tataaattct catcctgcct c tc tgag tc c gctcctgggc tcaggtgcag ataccactga gcatctgact tttgtgtctc gatgccgttc cagcttgtgc gttcaccagg c ttgaagaag gtgctgcttc cacgagggtg cttgccgtag gtcgccgtcc caccatccgc aggctggatc gcgatctgac cagtgataga aaagtcgagt ccctatcagt aaagtgaaag accactccct gcgtgtacgggagacgccat cggccccgaa ggagacgacg gtcgccgtgg gttggactca gag cgaac tg ttgaagcgaa tattatatgc aaacatgtag gctttcgagg acctccattc attgagcaag tc tcc ccgaa cagcaacacc .tcagt tccgg .catctgcagc tagac tgaga gaaaaat tca tgtcccttgt tgacaaccat tagcttgcat ctttctctaa ttttagagaa ggc tggcgtg ttctctttat aaaccgggcc aacgtgctgg gctgcctatc gatct tt ttc tctgggtaat tcactcggaa ttctgcttgt cccaggatgt gtgtcgccct atggtgcgct atgtggtcgg ggccagggca gtggcatcgc agctcgacca ggggatccac ggtcccggtg ggttcactaa gaaaagtgaa ttaccactcc gatagagaaa ,tcgagtttac atcagtgata tgggaggcc t ccacgctgtt ttcgagctcg ggaacgcaga tccgcgctct ttcccgagat atacaaactt aacccacccc actc tgaaaa aaagggcagc cactgtccag ctgtcgactg cgtagctcaa tcactgtatt tgaccgagca aggaggaagc aat tggatat acttcagggt tgttatatgg atcaccatgg tgtctcctct ttgtaacgaa tcactttttt caattgttat gaaatattct ggttacaatg cc tctgc taa ttgttgtgct agaaggtggt cctctgccaa aaaggaaatt ggacatatgg 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 WO 01/48224 WO 0148224PCT/AUOO/01596 gagggcaaat catatgctgg cccctgctgt tattttgttt tagccagatt ggagatccct tgggcgCtct agcggtatca aggaaagaac -gctggcgttt .tcagaggtgg cctcgtgcgc *ttcgggaagc *cgttcgctcc atccggtaac agccactggt gtggtggcct gccagttacc tagcggtggt aga tcc tt tg gattttggtc aagttttaaa.

aatcagtgag ccccgtcgtg gataccgcga aagggccgag *ttgccgggaa .tgctacaggc ccaacgatca cggtcctccg agcactgcat *gtactcaacc .gtcaatacgg acgttcttcg acccactcgt agcaaaaaca aatactcata gagcggatac catttaaaac ctgccatgaa ccattcctta tgtgttattt tttcctcctc cgactgcatt tccgcttcct gctcactcaa atgtgagcaa ttccataggc cgaaacccga tctcctgttC gtggcgcttt aagctgggct tatcgtcttg aacaggatta aactacggct ttcggaaaaa ttttttgttt atcttttcta, at gaga ttat tc aa tctaaa gcacctatct tagataacta gacccacgct cgcagaagtg gctagagtaa atcgtggtgt aggcgagtta atcgttgtca aattctctta aagtcattct gataataccg gggcgaaaac gcacccaact .ggaaggcaaa ctcttccttt atatttgaat atcagaatga caaaggtggc ttccatagaa ttttctttaa tcctgactac aatgaatcgg cgctcactga aggcggtaat aaggccagca tccgcccccc caggactata c gacc ctgcc ctcaatgctc gtgtgcacga agtccaaccc gcagagcgag acac tagaag gagttggtag gcaagcagca cggggtctga caaaaaggat gtatatatga cagcgatc tg cgatacggga caccggctcc gtcctgcaac gtagttcgcc cacgctcgtc catgatcccc gaagtaagtt ctgtcatgcc gagaatagtg cgccacatag tctcaaggat gatcttcagc atgccgcaaa ttcaatatta -gtatttagaa gtatttggtt tataaagagg aagccttgac catccctaaa tcccagtcat ccaacgcgcg ctcgctgcgC acggttatcc aaaggccagg tgacgagcat aagataccag gcttaccgga acgctgtagg accccccgtt.

ggtaagacac gtatgtaggc gacagtattt ctcttgatcc gat tacgcgc cgctcagtgg cttcacctag gtaaacttgg tctatttcgt gggcttacca agatttatca tttatccgcc agttaatagt gtt tggtatg catgttgtgc ggccgcagtg atccgtaaga tagagtttgg tcatcag tat ttgaggttag attttcctta agctgtccct gggagaggcg tcggtcgttc acagaatcag aaccg taaaa cacaaaaatc gcgtttcccc tacctgtccg tatctcagtt cagcccgacc caacatatgc atgaaacagc atttttttta catgttttac cttctcttat gtttgcgtat ggctgcggCg gggataacgc aggccgcgtt gacgctcaag c tggaagctc cctttctccc cggtgtaggt gctgcgcctt .gacttatcgc .cactggcagc ggtgctacag agttcttgaa ggtatctgcg .ctctgctgaa ggcaaacaaa agaaaaaaag aacgaaaact atccttttaa tctgacagtt tcatccatag tctggcccca gcaataaacc tccatccagt ttgcgcaacg gcttcattca aaaaaagcgg ttatcactca tgcttttctg c caccgctgg gatctcaaga cacgt taagg attaaaaatg accaatgctt ttgcctgact gtgctgcaat agccagccgg ctattaattg ttgttgccat gctccggttc ttagctcctt tggttatggC tgactggtga cttgcccggC tca-ttggaaa gttcgatgta tttctgggtg ggaaatgttg attgtctcat cgcgcacatt taa cc tataa 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 7020 7080 7140 7200 7260 7.320 7380 7440 7500 7560 7620 7680 7713 tatgcggcga ccgagttgct.

cagaacttta. aaagtgctca cttaccgctg ttgagatcca atcttttact ttcaccagcg aaagggaata agggcgacac ttgaagcatt tatcagggtt aaataaacaa ataggggttc aaccattatt atcatgacat tca tccccgaaaa gtgccacctg. acgtctaaga aaataggcgt atcacgaggc cctttcgtct <210> <211> <212> <213> <220> 16 7998

DNA

Artificial Sequence WO 01/48224 ~'/O01/4224PCT/AUO0101596 <223> Description of Artificial Sequence:pB3IT(smad2)-BMPp2ds construct refereed to as pSF3 <400> 16 ctcgaggagc ggctcatgtc aatgagttaa c t ttgcct ta ctcttttatc gtggagttgt aaccacactg 'actagaactt taaacataaa ttaatatttt attcaactcc gaaatcaatt tctctgacca tgtgtgtttC acccagttcc gtcc tgct tt ccccccctga acgctccaga aagtgattaa gtaaactcgc agcgggcttt gccctttaga gtgct ttact aacagtatga agaatgcatt atc aagagca cat tattacg tcggcc ttga cgtacagccg tcccggacga ccgcgggaca agctccactt atctggacat ccccctacgg t tggaat tga gatgagtttg tgtgatgcta aattgcattc taaaacctct gaccacgcta gaggcaagac cttcatcggg tatcagctcg ttggcccatt caacattacc acgaaggaat atgtttggcc tattggtaaa gcatcgatgg aactaaactg ttatgttaag ttgaat taaa aattngcact ctgaatttgc tctctctttt caaccaatat cagccttgat tcccccggct ccacttcctg catacacaaa tttggcttcc cagcgcatta ccagaagcta gctcgacgcc aggggaaagc aagtcatcgc atatgcactc tcaagtcgct acaagctatc, attgatcata cgcgcgtacg cgacgccccc cacgcgcaga agacggcgag gttgggggac cgctctggat cgagtacggt gacaaaccac ttgctttatt attttatgtt acaaatgtgg tctgtgcaag tcgggcggcg aatgcgcgcg accaagcttg gcatacgttg gccatgttga atcttgtttt agaggagaaa gttttgtttc atttgctctt aacttcaact c tgc t ttaac ttcatttgtt cacagaattt tt tcataatt ttttttttta ctggcatgga tcctcaattg tcactgcagg tccttggtcc cacacacata tggtgcagcc gagctgctta ggtgtagagc ttagccattg tggcaagatt gatggagcaa aatcaattag agcgctgtgg aaagaagaaa gaattatttg tgcggattag aaaaacaatt *gaagaggcgg ctgtcgacgg gacgtggcga ggggattccc atggccgact gggtaggggg aactagaatg tgtaaccatt tcaggttcag tatggctgat gtccccggac ccctgcccgt accttcagca atatcgaatt tatccatatc cattgat tat ttcttatata tggttgtgcc tctacgctgg cagtgtttgg c taaaaactg acaatctaca aatttaagga ttaaaaatga aatagattat tctgcaggtg ttagtttata ccctttacgc ccttcctgag tgcaaggcta atcatcttcc c agcac taa t atgaggtcgg agcctacatt agatgttaga ttttacgtaa aagtacattt cctttttatg ggcattttac gggaaacacc atcaccaagg' aaaaacaac t acgggtctac ggctggcggc cc cccccgac tggcgcatgc cgggtccggg tcgagtt tga cgcgaggatc cagtgaaaaa ataagctgca ggggaggtgt tatgatcctg gcgcgctcca cccaccaggt tcgccggcat cttacttgta ataatatgta tgactagtat tttaggtcat caac tgagcc cttgcttggt acttttagtt gactgacaca ttgtaaaagc aatttggtgn .attaaaatat.

gcatgtttta gactttgagt aaatctccta taattctcgc ccccaagtac agcctgtcca tggcacactg cactagatta aatcgaaggt gtattggcat taggcaccat taacgctaaa aggtacacgg ccaacaaggt tttaggttgc tactactgat tgcagagc ca .taaatgtgaa catcgagggc tccgcgcctg cgatgtcagc cgacgcgc ta atttaccccc gcagatgttt cagacatgat aatgctttat ataaacaagt gggaggtttt caagcctcgt tgagcagagc caacaggcgg gtcccctggC cagctcgtcc atcttcatgg tttaatcacc tggtttctct tttggtactt gtgaaattta gtttcagttt gctgtagaaa aatttcaggg tggaaaatct .tttccaaact :ccggtgtcag actgcctggt agtagt tgtg cagcagctgc cttcccccct ctggccgagg gataaaagta ttaacaaccc gtaaaaaata actcactttt agttttagat cctacagaaa ttttcactag gtattggaag agtatgccgc gccttcttat agtgggtccg ctgctcgatc tcctttctcc ctgggggacg gacgatttcg cacgactccg accgatgccc aagatacatt ttgtgaaatt taacaacaac ttaaagcaag cgtctggccg gcc cgccgcc taaccggcct ggacgggaag atgccgagag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1 800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 WO 01/48224 ~VO 0148224PCT/AUOO/01596 tga tcc cggc citttgctcag cgccgatggg tgtggcggat cgttgtggct agtcgatgcc qcgcgggtctt cgggcatggc *ac tgcacgcc tggtgcagat acacgctgaa cggtgaacag cgcctgcagg aaaacagcgt ataggtcgag tccctatcag aaaagtgaaa taccactccc a tagagaaaa cgagctcggt gtttagtgaa gacaccggga c tagtcagaa cctcctccgg cggtcaggtg cagtgattcg gctacgcttg ggtccctcag tcggcgcccg *gatacgaagt aacgcagcag ttgtatcagt cgggaatgag -cgcggaccac cgttcccgtc gctagcgcgg tgattgttct cagggtgttg t tgtttc tt t ttctgtaact tcgtttattt gtaattatat tagaatattt ctacatcctg gatgaggata cttctttttc caaagaattc ggcggtcacg ggcggactgg ggtgttctgc cttgaagttc gttgtagttg cttcagctcg gtagttgccg ggacttgaag gtaggtcagg gaacttcagg cttgtggccg ctcctcgccc aattcggggc ggatggcgtc tttaccactc tgatagagaa gtcgagttta tatcagtgat gtgaaagtcg acccgggtcg ccgtcagatc cc gatc cagc ttcatgagga aactgactga ttgctgggag gggagacaca ctcaatatgt tacatgctgg aggagcacta tttttcttca cttcaatccg tcgctccggt tccaacggca ggcgaccatg gtctcctaag cctcgacgat ttctttttcg tttagaatgg cactttctac tttttcgtta gtcagattgt tgtacttcag ctgcatataa gtaatcatcc aaatactctg ctacagctcc actcctcagg aactccagca gtgctcaggt tggtagtggt accttgatgc tactccagct atgcggttca tcgtccttga aagtcgtgct gtggtcacga gtcagcttgc tttacgtcgc.

ttgc tcacca cgcggaggct tccaggcgat cctatcagtg aagtgaaagt ccactcccta.

agagaaaagt agtttaccac agtaggcgtg gcctggagac ctccgcggcc acttaggaga tcatggtcgc gtgccgt tgg caccggagcg tcggattgaa acttgtatta tgggaaaaca aagaggcttt.

accttacctc aacatattga gtgtgtctcc cc tcccagca atcagtcagt ttcctcatct atctctagac ctattgaaaa gaagatgtcc tctgttgaca aac tttagct aagtactttc cacagtttta attctggctg tgcctttctc agtccaaacc tgggcaacgt tgcaggctgc ggaccatgtg atcgcgcttc tcgttggggt agtggttgtc gggcagcagc acggggccgt cggcgagctg cacgctgccg tcctcgatgt cgttcttctg cttgtcggcc atgatataga tgtgccccag gatgttgccg tcctccttga ccagggtgtc gccctcgaac ttcacctcgg agaagatggt gcgctcctgg acgtagcctt gcttcatgtg gtcggggtag cggctgaagc gggtgggcca gggcacgggc agcttgccgg cgtaggtggc atcgccctcg ccctcgccgg cgtccagctc gaccaggatg ggcaccaccc tccgcgggga tccactagtt ctagagcggc ggatcggtcc cggtgtcttc tatggaggtc ctgacggttc actaaacgag ctctgcttat atagagaaaa gtgaaagtcg agtttaccac cgagtttacc actccctatc .agtgatagag tcagtgatag. agaaaagtga aag-tcgagtt gaaagtcgag tttaccactc cctatcagtg tccctatcag tgatagagaa aagtgaaagt tacggtggga ggcctatata agcagagctc gccatccacg ctgttttgac ctccatagaa ccgaattcga gctcggtacc cggggatcct cgacgggaac gcagaccggc cacagcgctt cgtggtccgc gctctcacgg tgctgttgct actcattccc gagatcgacc gacggaaata aactgataca aacttcctga acgagtttga gcgaaaaccc accccaagca aatcggcagt tatgcactct gaaaacgatg acccgaacat tgtagaaagg. gcagccagca gagcaaacac cgaggcactg tccagcctga aaggaaaaac cattcctgtc gactgccgat ttgcttgggg gcaagcgtag .ctcaaactc.ttcaggaagt ccgaatcact gtatttccgt cggtcgatct acacctgacc *gagcaacagc accgtgagag tccggaggag. gaagcgctgt ggccggtctg gcagcaattg gatatcaagc tctgacgcgt tgagaacttc agggtgagtt tggggaccct attcatgtta tatggagggg gcaaagtttt cttgtatcac catggaccct catgataatt accattgtct cctcttattt tcttttcatt tgcatttgta acgaattttt aaattcactt tctaatcact tttttttcaa ggcaatcagg gagaacaatt gttataatta aatgataagg gcgtggaaat attcttattg gtagaaacaa tttatggtta caatgatata cactgtttga gggcccctct gctaaccatg ttcatgcctt gctggttgtt gtgctgtctc atcattttgg ctatcagaag gtggtggctg gtgtggccaa 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 WO 01/48224 WO 0148224PCTIAUOO/01596 tgccctggct catgaagccc agtgtqtggg aaaacatcag atgaacaaag ccttattcca tatttttttc tcctctcctg gcat taatga ttcctcgctc *ctcaaaggcg agcaaaaggc *taggctccgc *cccgacagga tgt tccgacc gctttctcaa gggctgtgtg tcttgagtcc gattagcaga .cggctacact aaaaagagtt *tgtttgcaag ttctacgggg attatcaaaa ctaaagtata tatctcagcg aactacgata acgctcaccg aagtggtcct agtaagtagt *ggtgtcacgc agt tacatga *tgtcagaagt tcttactgtc *attctgagaa -taccgcgcca **aaaactctca .caa ctga tc t gcaaaatgcc cctttttcaa tgaatgtatt acctgacgtc gaggcccttt cacaaatacc actgagatct ttttccctct cttgagcatc tgacttctgg gtaataaagg aattttttgt gtctctcact cggaaggaca aatgagtatt tggtttagag tttggcaaca gtggctataa agaggtcatc agtatatgaa tagaaaagcc ttgacttgag gttagatttt tttaacatcc ctaaaatttt ccttacatgt actactccca gtcatagctg tccctcttct atcggccaac gcgcggggag aggcggtttg actgactcgc tgcgctcggt cgttcggctg gtaatacggt .atccacaga atcaggggat cagcaaaagg ccaggaaccg taaaaaggcc ccccctgacg agcatcacaa aaatcgacgc ctataaagat accaggcgtt tccccctgga ctgccgctta ccggatacct gtccgccttt tgctcacgct gtaggtatct cagttcggtg cacgaacccc ccgttcagcc cgaccgctgc aacccggtaa gacacgactt atcgccactg gcgaggtatg taggcggtgc tacagagttc agaaggacag tatttggtat ctgcgctctg ggtagctctt gatccggcaa acaaaccacc cagcagatta cgcgcagaaa aaaaggatct tctgacgctc agtggaacga aaactcacgt aggatcttca cctagatcct tttaaattaa tatgagtaaa cttggtctga cagttaccaa atctgtctat ttcgttcatc catagttgcc cgggagggct taccatctgg ccccagtgct *gctccagatt tatcagcaat aaaccagcca gcaactttat ccgcctccat ccagtctatt tcgccagtta atagtttgcg caacgttgtt tcgtcgtttg gtatggcttc attcagctcc tcccccatgt tgtgcaaaaa agcggttagc aagttggccg cagtgttatc actcatggtt.atgccatccg taagatgctt ttctgtgact.

-tagtgtatgc ggcgaccgag ttgctcttgc catagcagaa ctttaaaagt gctcatcatt aggatcttac cgctgttgag atccagttcg tcagcatctt. ttactttcac .cagcgtttct gcaaaaaagg .gaataagggc gacacggaaa tattattgaa gcatttatca gggttattgt tagaaaaata aacaaatagg ggttccgcgc taagaaacca ttattatcat gacattaacc cgtcttca gccaaaaatt aaatttattt tatgggaggg tatgccatat acagccccct ttttatattt tttactagcc cttatggaga cgtat tgggc cggcgagcgg aacgcaggaa gcgttgc tgg tcaagtcaga agc tccctc g .:ctcccttcgg taggtcgttc :gccttatccg gcagcagcca ttgaagtggt ctgaagccag gctggtagcg caagaagatc taagggattt aaatgaagtt tgct taatca tgactccccg gcaatgatac gccggaaggg aattgttgcc gccattgcta ggttcccaac tccttcggtc atggcagcac .ggtgagtact ccggcgtcaa ggaaaacgtt atgtaaccca gggtgagcaa tgttgaatac ctcatgagcg acatttCccc tataaaaata atggggacat tcattgcaat caaatcattt gctggctgcc gctgtccatt tgttttgtgt agatttttcc tccctcgact gc t ctt c cgc tatcagctca agaacatgtg cgtttttcca ggtggcgaaa tgcgctctcc ,gaagcgtggc gctccaagct gtaactatcg ctggtaacag ggcc taacta ttaccttcgg gtggtttttt ctttgatctt tggtcatgag ttaaatcaat gtgaggcacc tcgtgtdgat cgcgagaccc ccgagcgcag gggaagctag caggcatcgt ga tcaaggcg ctccgatcgt tgcataattc caaccadgtc tacgggataa cttcggggcg ctcgtgcacc aaacaggaag tcatactctt gatacatatt gaaaagtgcc ggcgtatcac 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 7020 7080 7140 7200 7260 7320 7.3 B0 7440 7500 7560 7620 7680 7740 7800 7860 7920 7980 7998 <210> 17 <211> 8611 <212> DNA WO 01/48224 WO 0148224PCT/AUOO/01596 <213> Artificial Sequence <220> <223> Description of Artificial Sequence-pBITsmad2) -BMP2sense construct refereed to as pSF4.

<400> 17 ctcgaggagc .ttggcccatt gcatacgttg tatccatatc ataatatgta catttatatt, ggctcatgtc aatgagttaa ctttgcctta ctcttttatc gtggagttgt aaccacac tg actagaactt taaacataaa ttaatatttt attcaactcc gaaatcaatt tctctgacca tgtgtgtttc acccagttcc gtcctgcttt.

ccccccctga acgctccaga *aagtgattaa *gtaaactcgc agcgggcttt gccctttaga gtgctttact aacagtatga *agaatgcatt atcaagagca -cattattacg tcggccttga, cgtacagccg *tcccggacga.

ccgcgggaca agctccactt a tctggacat ccccctacgg ttggaattga gatgagtttg tgtgatgcta aattgcattc taaaacctct gaccacgcta caacattacc acgaaggaat atgtttggcc tattggtaaa.

gcatcgatgg aactaaactg ttatgttaag ttgaattaaa aattngcact ctgaatttgc tctctctttt caaccaatat cagccttgat tcccccggct.

ccacttcctg catacacaaa tttggcttcc cagcgcatta ccagaagcta gctcgacgcc aggggaaagc aagtcatcgc aactctcgaa atatgcactc tcaagtcgct.

acaagctatcattgatcata cgcgcgtacg cgacgccccc cacgcgcaga agacggcgag g'ttgggggac cgctctggat cgagtacggt gacaaaccac ttgctttatt attttatgtt acaaatgtgg tctgtgcaag gccatgttga atcttgtttt agaggagaaa gttttgtttc atttgctctt aacttcaact ctgctttaac .ttcatttgtt cacagaattt tttcataatt ttttttttta ctggcatgga tcctcaattg tcactgcagg tcc ttggtcc cacacacata tggtgcagcc *gagctgc tta ggtgtagagc ttagccattg tggcaagatt gatggagcaa aatcaattag agcgctgtgg aaagaagaaa gaattatttg tgcggattag aaaaacaatt gaagaggcgg ctgtcgacgg gacgtggcga ggggattccc atggccgact gggtaggggg aactagaatg tgtaaccatt.

tcaggttcag tatggctgat gtccccggac cattgattat.

ttcttatata tgg-ttgtgcc tctacgctgg cagtgtt tgg ctaaaaactg ac aa tctac a.

aatttaagga t taaaaatga aatagattat tctgcaggtg ttagtttata ccctttacgc ccttcctgag tgcaaggcta atcatcttcc cagcactaat atgaggtcgg agcctacatt agatgttaga ttttacgtaa aagtacattt cctttttatg.

ggcattt tac gggaaacaccatcaccaagg: aaaaacaact.

acgggtc tac ggctggcggc cccccccgac tggcgcatgc cgggtccggg tcgagtttga.

cgcgaggatc cagtgaaaaa.

ataagctgca.

ggggaggtgt tatgatcctg gcgcgctcca.

tgactagtat tttaggtcat caactgagcc cttgcttggt, acttttagtt -gactgacaca ttgtaaaagc -aatttggtgn attaaaatat.

gcatgtttta.

gactttgagt aaatctccta taattctcgc ccccaagtac agcctgtcca tggcacactg cactagatta aatcgaaggt gtattggcat taggcaccat taacgctaaa aggtacacgg ccaacaaggt tttaggttgc atcttcatgg tttaatcacc tggtttctct tttggtactt.

gtgaaattta gtttcagttt *.gctgtagaaa aatttcaggg tggaaaatct tttccaaact ccggtgtcag actgcctggt agtagttgtg cagcagctgc cttcccccct.

c tggccgagg ga taaaagta ttaacaaccc gtaaaaaata.

ac tcacttt t agttttagat cc tacagaaa .ttttcactag gtattggaag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 tactactgat...agtatgccgc 1560 tgcagagcca.*gccttcttat 1620 taaatgtgaa.

catcgagggc tccgcgcctg cgatgtcagc cgacgcgcta.

atttaccccc gcagatgttt cagac atga t aatgctttat ataaacaagt gggaggtttt caagcctcgt tgagcagagc agtgggtccg ctgctcgatc tcctttctcc c tgggggacg gacgatttcg cacgactccg accgatgccc aagatacat t ttgtgaaatt taacaacaac ttaaagcaag cgtctggccg gcccgccgcc 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 WO 01/48224 WO 0148224PCT/AUOO/01 596 gaggcaagac cttcatcggg tatcagctcg tgatcccggc ctttgctcag cgccgatggg tgtggcggat cgttgtggct agtcgatgcc cgcgggtctt cgggcatggc actgcacgcc tggtgcagat acacgctgaa cggtgaacag cgcctgcagg aaaacagcgt ataggtcgag tccctatcag aaaagtgaaa taccactccc -atagagaaaa cgagctcggt gtttagtgaa gacaccggga ctagtcagaa cctcctccgg cggtcaggtg cagtgattcg .gCtacgcttg ggtccctcag L.cggcgcccg gatacgaagt aacgcagcag ggagctgcgc ;.:aattaacattacttctggac.

ttcagctgtg gctccatcct gagggtcagt ggtaacctac gcaggctcga acatgctctc aggctatcat c tccaccaac agcctgttgc gaaggtcatt acaatctCc tcgggcggcg aatgcgcgcg accaagcttg ggcggtcacg ggcggactgg ggtgttctgc cttgaagttc gttgtagttg cttcagctcg gtagt tgccg ggacttgaag gtaggtcagg gaacttcagg cttgtggccg ctcctcgccc aattcggggc ggatggcgtc tttaccactc tgatagagaa.

gtcgagttta tatcagtgat gtgaaagtcg acccgggtcg ccgtcagatc ccgatccagc ttcatgagga aactgactga ttgc tgggag gggagacaca ctcaatatgt tacatgctgg aggagcac ta tttcatcacg tttttcttca attttcaggg tacgaggtgt acccgtctgg gcacgctggg aaggagtcag, cgttcccttc agccatgacg cgagggcaaa tatgtggact gctttctact catgccattg atcccgacgg cttaaaaact caatgaagac ccctgcccgt acc ttcagca atatcgaatt aactccagca gtgctcaggt tggtagtggt accttgatgc tactccagct atgcggttca tcgtccttga aagtcgtgct gtggtcacga gtcagcttgc tttacgtcgc t tgctcacca cgcggaggct tccaggcgat cc tatcagtg aagtgaaagt ccactcccta agagaaaagt agtttaccac agtaggcgtg gcc tggagac c tccgcggcc acttaggaga tcatggtcgc gtgccgttgg caccggagcg tcggattgaa acttgtatta tgggaaaaca aagaggcttt accttacctc ac caagt tc t tcaggccagc tgcaggactc cccgcgaatc aagtatccga acgcggatga gtcaaggcac agccgaggag tcagtgatgt gccatggcga tccagacgct agc tcagccc accaggacat ttttatttat cccaccaggt tcgccggcat c ttacttgta ggaccatgtg agtggttgtc cggcgagctg cgttcttctg tgtgccccag ccagggtgtc agaagatggt gcttcatgtg gggtgggcca cgtaggtggc cgtccagctc tccgcgggga ggatcggtcc ctgacggttc.

atagagaaaa cgagtttacc tcagtgatag gaaagtcgag tccctatcag tacggtggga gccatccacg ccgaattcga cgacgggaac cgtggtccgc actcattccc aactgataca gcgaaaaccc tatgcac tc t tgtagaaagg cgaggcactg cattcctggc.

cggagatgcc tttggccccc tcacacgcgc ccagcacaac ggaggctgag ggactcgtgg agccgtcttg aaagcaccac cggctggaac gtgtccgttc ggtgaac tcg tatctcactg ggtggtggag acaaaagagc caacaggcgg gtcccc tggc cagctcgtcc atcgcgcttc gggcagcagc cacgctgccg cttgtcggcc gatgt tgccg gccctcgaac gcgctcctgg gtcggggtag gggcacgggc atcgccctcg gaccaggatg taaccggcct ggacgggaag atgccgagag tcgttggggt acggggccgt tcc tcgatgt atgatataga tcctccttga ttcacctcgg acgtagcctt cggctgaagc agcttgccgg ccctcgccgg ggcaccaccc tccactagtt 'ctagagcggc cggtgtcttc tatggaggtc' actaaacgag ctctgcttat gtgaaagtcg actccctatc agaaaagtga tttaccactc tgatagagaa ggcctatata ctgttttgac gctcggtacc gcagaccggc gctctcacgg gagatcgacc aacttcctga accccaagca gaaaacgatg gcagccagca tccagcctga -gaggagc tga.

agtacgagtg tccaaagagc tgggaaagct cacgggctcc agcaaccgga gcacaagccc cattcgaacc cagcgctcga gagtggatcg cctctgccgg gtcaactcca ctgtacctgg ggctgtgggt gagctatttg agtttaccac agtgatagag aagtcgagtt cctatcagtg aagtgaaagt agcagagctc ctccatagaa cggggatcct cacagcgc tt tgctgttgct gacggaaata acgagtttga aatcggcagt acccgaacat ,gagcaadcac aaggaaaaac tctccgctgc gcttccacag ctctaaccag tcgacgtggg ttgtagaggt ggaagcacgt gacctctgct gagaaaagcg ac tgtaggcg tggcaccgcc accatctaaa acat tccc aa acgagtacga gccgatgaga gaggaagaaa 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 WO 01/48224 WO 0148224PCT/AUOO/01596 agaaatatat tcgac Lgacg gtttggggac ggggcaaagt cctcatgata ttttcttttc tttaaattca caaggcaatc ttaaatgata ttggtagaaa atacactgtt atgttcatgc ctcatcattt ctggtgtggc attatgggga ttttcattgc gggcaaatca tatgctggct cctgctgtcc ttttgttttg gccagatttt agatccctcg ggcgctcttc cggtatcagc gaaagaacat tggcgttttt agaggtggcg tcgtgcgctc cgggaagcgt ttcgctccaa ccggtaacta ccac tggtaa ggtggcctaa cagttacctt gcggtggttt atcctttgat ttttggtcat gttttaaatc tcagtgaggc ccgtcgtgta taccgcgaga gggccgagcg gccgggaagc ctacaggcat aacgatcaag gtcctccgat cactgcataa actcaaccaa atgaatatat cgtgctagcg ccttgattgt tttcagggtg attttgtttc attttctgta ctttcgttta agggtaatta aggtagaata caactacatc tgagatgagg cttcttcttt tggcaaagaa caatgccctg catcatgaag aatagtgtgt tttaaaacat gccatgaaca attccttatt tgttattttt tcctcctctc actgcattaa cgcttcctcg tcactcaaag gtgagcaaaa ccataggctc aaacccgaca tcctgttccg ggcgctttct gctgggctgt tcgtcttgag caggattagc ctacggctac cggaaaaaga ttttgtttgc cttttctacg gagattatca aatctaaagt acctatc tca gataactacg cccacgctca cagaagtggt tagagtaagt cgtggtgtca gcgagttaca cgttgtcaga ttctcttact gtcattctga ttatgttgaa cggcc tcgac tctttctttt ttgtttagaa tttcactttc acttttttcg tttgtcagat tattgtactt tttctgcata ctggtaatca ataaaatact ttcctacagc ttcactcctc gctcacaaat ccccttgagc gggaattttt cagaatgagt aaggtggcta ccatagaaaa ttctttaaca ctgactactc tgaatcggcc ctcactgact gcggtaatac ggccagcaaa cgcccccctg ggactataaa accctgccgc caatgctcac gtgcacgaac tcc aac ccgg agagcgaggt actagaagga gttggtagct aagcagcaga gggtc tgacg aaaaggatct ata tat gagt gcgatc tgtc atacgggagg ccggc tccag cctgcaactt agttcgccag cgc tcgtcgt tgatccccca agtaagttgg gtcatgccat gaatagtgta tgaacaaaac gatatctcta tcgctattga tgggaagatg tactctgttg ttaaacttta tgtaagtact cagcacagtt taaattctgg tcctgccttt ctgagtccaa tcctgggcaa aggtgcaggc accactgaga atctgacttc tgtgtctctc atttggttta taaagaggtc gccttgactt t ccc taaaat ccagtcatag aacgcgcggg cgctgcgctc ggttatccac aggccaggaa acgagcatca gataccaggc ttaccggata gc tgtaggta cccccgttca taagacacga atgtaggcgg cagtatttgg cttgatccgg ttacgcgcag c tcagtggaa tcacctagat aaac ttggtc tatttcgttc gcttaccatc atttatcagc tatccgcctc ttaatagttt ttggtatggc tgttgtgcaa ccgcagtgtt ccgtaagatg tgcggcgacc aaaaaaaaaa gac tgagaac aaaattcatg tcccttgtat acaaccat tg gcttgcattt ttctctaatc ttagagaaca ctggcgtgga ctctttatgg acc gggc ccc cgtgctggt t tgcctatcag tctttttccc tgggtaataa actcggaagg.

gagtttggca.

atcagtatat gaggttagat tttccttaca ctgtccctct gagaggcggt ggtcgttcgg agaatcaggg ccgtaaaaag caaaaatcga gtttccccct cctgtccgcc tctcagttcg gcccgaccgc cttatcgcca tgctacagag tatctgcgct caaacaaacc.

aaaaaaagga cgaaaactca ccttttaaat tgacagt tac atccatagtt tggccccagt aataaaccag catccagtc t gcgcaacgtt ttcattcagc aaaagcggtt atcactcatg cttttctgtg gagttgctct aaaaaaaaac ttcagggtga ttatatggag caccatggac tctcctctta gtaacgaatt actttttttt attgttataa aatattctta ttacaatgat tctgctaacc gttgtgctgt aaggtggtgg tctgccaaaa aggaaattta acatatggga -acatatgcca gaaacagccc tttttttata tgttttacta tctcttatgg ttgcgtattg ctgcggcgag gataacgcag gccgcgttgc cgctcaagtc ggaagctccc tttctccctt gtgtaggtcg tgcgccttat ctggcagcag .ttcttgaagt ctgc tgaagc accgctggta tctcaagaag cgttaaggga taaaaatgaa caatgcttaa gcctgactcc gctgcaatga ccagccggaa attaattgtt gttgccattg tccggttccc agctccttcg gttatggcag actggtgagt tgcccggcgt 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 7020 7080 7140 7200 7260 7320 7380 7440 7500 7560 7620 7680 7740 7800 7860 7920 7980 8040 8100 8160 WO 01/48224 WO 0148224PCT/AUOO/01 596 caa tacggga gttc ttcggg ccactcgtgc caaaaacagg tactcatact gcggatacat cccgaaaagt ataggcgtat taataccgcg gcgaaaactc acccaactga aaggcaaaat cttccttttt atttgaatgt gccacctgac cacgaggccc ccacatagca tcaaggatct tcttcagcat gccgcaaaaa caatattatt.

atttagaaaa.

gtctaagaaa tttcgtcttC gaactttaaa taccgctgtt cttttacttt agggaataag gaagcattta ataaacaaat ccattattat a agtgc tca tc gagatccagt caccagcgtt ggcgacacgg tcagggt tat aggggttccg catgacatta attggaaaac tcgatgtaac tctgggtgag aaatgttgaa tgtctcatga cgcacatttc acctataaaa 8220 8280 8340 8400 8460 8520 8580 8611 <210> 18 <211> 6890 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:pBIT(CMV2)-EGFP <400> 18 *ctcgaggagc.

ggctcatgtc .tcaattacgg gtaaa tggcc tatgttccca cgctaaactg gacgtcaatg tttcctactt tggcagtaca cccattgacg *cgtaacaact ataagcagag .gacc tccata gattagataa aaggtttaac ggcatgtaaa accatac tca ctaaaagttt cacggcctac aaggtttttc gttgcgtatt ctgatagtat agccagcctt gtgaaagtgg agggcctgct gcctgtcctt tcagcctggg cgctagacga ccccccacga ttggcccatt caacattacc ggtcattagt cgcctggctg tagtaacgc c cccacttggc acggtaaatg ggcagtacat tcaatgggcg tcaatgggag ccgccccat t ctcgtttagt gaagacaccg aagtaaagtg aacccgtaaa aaataagcgg cttttgccct tagatgtgct agaaaaacag actagagaat ggaagatcaa gccgccat ta cttattcggc gtccgcgtac cgatctcccg tctccccgcg ggacgagctc tttcgatctg c tccgccccc gcatacgttg gocca tgt tga tcatagccca accgcccaac aatagggact agtacatcaa gcccgcctgg ctacgtatta tggatagcgg tttgttttgg gacgcaaatg gaaccgtcag ggaccgatcc attaacagcg ctcgcccaga gctttgctcg ttagaagggg ttactaagtc tatgaaactc gcattatatg gagcatcaag ttacgacaag cttgaattga agccgcgcgc gacgacgacg ggacacacgc cacttagacg gacatgttgg tacggcgctc tatccatatc cattgattat tatatggagt gacccccgcc ttccattgac gtgtatcata cattatgccc gtcatcgcta tttgactcac caccaaaatc ggcggtaggc atcgcctgga agcctccgcg.

cattagagc t agctaggtgt acgccttagc aaagctggca atcgcgatgg tcgaaaatca cactcagcgc tcgctaaaga ctatcgaatt tcatatgcgg gtacgaaaaa cccccgaaga gcagactgtc gcgaggacgt gggacgggga tggatatggc ataatatgta tgactagtta tccgcgttac cattgacgtc gtcaatgggt tgccaagtac agtacatgac ttaccatggt ggggatttcc aacgggac tt gtgtacggtg gacgccatcc catttatatt ttaatagtaa ataacttacg aataatgacg ggagtattta gccccctatt cttatgggac gatgcggttt aagtctccac tccaaaatgt ggaggtctat acgctgtttt gccccgaatt .catatgtcta 780 .gcttaatgag :gtcggaatcg 840 .agagcagcct ~acattgtatt 900 cattgagatg agatttttta agcaaaagta attagccttt tgtggggcat agaaagggaa atttgatcac attagaaaaa caattacggg ggcggggctg gacggccccc ggcgatggcg ttccccgggt cgacttcgag ttagataggc cgtaataacg catttaggta ttatgccaac tttactttag acacctacta caaggtgcag caacttaaat tctaccatcg gcggctccgc ccgaccgatg catgccgacg ccgggattta tttgagcaga 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 WO 01/48224 WO 0148224PCT/AUOO/01596 tgtttaccga tgcccttgga attgacgagt acggtgggta gggggcgcga atgataagat acattgatga gtttggacaa accacaacta gaatgcagtg tttatttgtg aaatttgtga tgctattgct ttatttgtaa ccattaxtaag caagttaaca acaacaattg cattcatttt atgtttcagg ttcaggggga gttttttaaa gcaagtaaaa cctctacaaa tg-tggtatgg ctgattatga ctcgtcgtct ggccggacca cgctatctgt gcaaggtccc cggacgcgcg agagcgcccg ccgccgaggc aagactcggg cggcgccctg cccgtcccac ggcggtaacc ggcctcttca tcgggaatgc gcgcgacctt cagcatcgcc ctggcggacg ggaagtatca gctcgaccaa gcttgatatc gaattcttac .cgtccatgcc gagagtgatc-ccggcggcgg tcacgaactc cagcaggacc.

gcttctcgtt'-ggggtctttg-ctcagggcgg'actgggtgct caggtagtgg gcagcacggg gccgtcgccg atgggggtgt tctgctggta gtggtcggcg tgccgtcctc gatgttgtgg cggatcttga agttcacctt gatgccgttc cggccatgat atagacgttg tggctgttgt agttgtactc cagcttgtgc tgccgtcctc cttgaagtcg atgcccttca gctcgatgcg .gttcaccagg cgaacttcac ctcggcgcgg gtcttgtagt tgccgtcgtc..cttgaagaag cctggacgta gccttcgggc atggcggact tgaagaagtc. gtgctgcttc ggtagcggct gaagcactgc acgccgtagg tcagggtggt cacgagggtg cgggcagctt gccggtggtg cagatgaact tcagggtcag cttgccgtag cctcgccctc gccggacacg ctgaacttgt ggccgtttac gtcgccgtcc ggatgggcac caccccggtg aacagctcct cgcccttgct caccatccgc tagttctaga gcggccgcct gcaggaattc ggggccgcgg aggctggatc tcttctatgg aggtcaaaac agcgtggatg gcgtctccag gcgatctgac acgagctctg cttatatagg tcgagtttac cactccctat cagtgataga agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag cactccctat cagtgataga gaaaagtgaa agtcgagttt accactccct gagaaaagtg aaagtcgagc tcggtacccg ggtcgagtag-gcgtgtacgg atataagcag agctcgttta-gtgaaccgtc agatcgcctg gagacgccat ttgacctcca tagaagacac cgggaccgat ccagcctccg cggccccgaa gtacccgggg atcctctagt cagctgacgc gtgctagcgc-: ggcctcgacg *actgagaact tcagggtgag tttggggacc cttgattgtt-ctttctttttaaattcatgt tatatggagg gggcaaagtt ttcagggtgt tgtttagaat cccttgtatc accatggacc.ctcatgataa ttttgtttct ttcactttct *caaccattgt ctcctcttat tttcttttca ttttctgtaa cttttttcgt cttgcatttg taacgaattt ttaaattcac tttcgtttat ttgtcagatt tctctaatca-cttttttttc aaggcaatca gggtaattat attgtacttc tagagaacaa ttgttataat taaatgataa ggtagaatat ttctgcatat tggcgtggaa atattcttat tggtagaaac aactacatcc tggtaatcat tctttatggt tacaatgata tacactgttt gagatgagga taaaatactc ccgggcccct ctgctaacca tgttcatgcc ttcttctttt tcctacagct gtgctggttg ttgtgctgtc tcatcatttt ggcaaagaat tcactcctca gcctatcaga aggtggtggc tggtgtggcc aatgccctgg ctcacaaata ctttttccct ctgccaaaaa ttatggggac atcatgaagc cccttgagca gggtaataaa ggaaatttat tttcattgca atagtgtgtg ggaatttttt ctcggaagga catatgggag ggcaaatcat ttaaaacatc agaatgagta agtttggcaa catatgccat atgctggctg ccatgaacaa aggtggctat ggatccagac aaaaaaatgc ctgcaataaa ggtgtgggag tcctgcaagc ctccatgagc caggtcaaca ggcatgtccc ttgtacagct atgtgatcgc ttgtcgggca agctgcacgc ttctgcttgt cccaggatgt .gtgtcgccct atggtgcgct atgtggtcgg ggccagggca gtggcatcgc agctcgacca ggggatccac ggtCccggtg ggttcactaa gaaaagtgaa ttaccactcc gatagagaaa tcgagtttac atcagtgata tgggaggcct ccacgctgtt ttcgagctcg .*atatctctag cgc tattgaa .gggaagatgt actctgttga taaactttag gtaagtactt .agcacagttt aaattctggc cctgcctttc tgagtccaaa cctgggcaac ggtgcaggc t ccactgagat tctgacttct gtgtctctca tttggtttag aaagaggtca 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 WO 01/48224 WO 0148224PCT/AUOO/01 596 tcagtatatg aggttagatt ttcettacat tgtccctctt agaggcggtt gtcgttcggc gaatcagggg cgtaaaaagg aaaaatcgac tttccccctg -ctgtccgcct ctcagttcgg cccgaccgcL.

.ttatcgccac gctacagagt atctgcgctc aaacaaacca aaaaaaggat gaaaactcac cttttaaatt gacagttacc tccatagttg ggccccagtg ataaaccagc atccagtcta cgcaacgttg t cattcagct' aaagcggtta tcactcatgg ttt.Lctgtga agLtgctcLL gtgctcatca *agatccagtt accagcgttt gcgacacgga cagggttatt ggggttccgc aaacagcccc LLLtttatat gttttactag ctcttatgga tgcgtattgg tgcggcgagc ataacgcagg ccgcgt LgcL, gc Lcaag tca gaagctccct t Lctccc L*Lc tgtaggtcgt.

gcgcct La c Lggcagcagc tcttgaagtg tgctgaagcc ccgctggtag c Lcaagaaga gttaagggat aaaaatgaag aatgcttaat.

cctgactccc c Lgcaatgat cagccggaag ttaattgttg ttgccattgc ccggttc cca gctcct Lcgg ttatggcagc ctggtgagta gcccggcgtc ttggaaaacg cgatgtaacc c tgggtgagc aatgttgaat, gtctcatgag gcacatttcc ctgctgtcca tttgttttgt ccagattttt gatccctcga gcgctcttc ggtatcagct aaagaacatg ggcgtttttc gaggtggcga cgtgcgctct gggaagcgtg tcgctccaag cggtaactat cac Lggtaac gtggcctaac agttaccttc cggtggtttt Lcc tttgatc Lttggtcatg ttttaaatca cagtgaggca cgtcgtgtag accgcgagac ggccgagcgc ccgggaagc t tacaggcatc acgatcaagg tc c ccgatc actgcataat ctcaaccaag aatacgggat ttcttcgggg cac tcgtgca aaaaacagga ac tcatactc cggatacata ccgaaaagtg ttccLtattc gttaLttttLt cctcctctcc ctgcattaat gCttcctcgc cactcaaagg tgagcaaaag c a aggc tcc aacccgacag cctgttccga gcgctttctc ctgggctgtg cgtcttgagt aggattagca catagaaaag Lctttaacat tgactactcc gaatcggcca tcactgac Lc cggtaatacg gccagcaaaa gcccccctga gac tataaag ccctgccgct aatgctcacg tgcacgaacc ccaacccggt.

gagcgaggta tacggctaca ctagaaggac ggaaaaagag. ttggtagctc tttgtttgca .agcagcagat ccL Lgact Lg ccctaaaatt cagtcatagc acgcgcgggg gctgcgctcg gttatccaca.

ggccaggaac cgagcatcac ataccaggcg taccggatac ctgtaggtaL ccccgLtcag aagacacgac tgtaggcggt.

-agtatLtggt ttgatccggc tacgcgcaga.

tcagtggaac cacctagatc aacLtggtct, attcgttca.

cttaccatct tttatcagca atccgcc Lcc taatagtttg tggtatggct.

gttgtgcaaa cgcagtgtta cgtaagatgc gcggcgaccg aactLtaaaa tLtctacgg agattatcaa atctaaagta cctatctcag ataactacga ccacgctcac agaagtggtc agagtaagta gtggtgtcac cgagttacat gttgtcagaa tctcttactg LcaLtctgag aataccgcgc ggtctgacgc aaaggatcLL tatatgagta cgatc LgtcL Lacgggaggg c ggc Lccaga ctgcaacttt.

gttcgccagL gctcgtcgtt gatcccccaL gtaagttggc Lcaigccatc aatagtgtaL cacatagcag 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 .5520 5580 .564 0 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 -6600 6660 6720 6780 6840 6890 cgaaaactct.-caaggatcLL accgctgttg cccaactgaL cLtcagcatc Ltttactttc aggcaaaatg ccgcaaaaaa- gggaataagg LtccLLLttc aatattattg aagcaLLtat tttgaatgta Lttagaaaaa taaacaaata ccacctgacg Lctaagaaac cattaLtatc atgacattaa cctataaaaa Ltaggcgtatc acgaggcccL LtcgtcLtca <210> 19 <211> 6624 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: pBITdHSP2) -EGFP WO 01/48224 ~VO 0148224PCT/AUOO/O1 596 <400> 19 c tcgagcggc agtgaattgt tctttttggg catactgctc gtataaatag acgtcgctaa cagtaaagtg gcaac tac tg gaat Lgggaa ttaacagcgc tcgcccagaa ctttgctcga tagaagggga tac taagtca atgaaactct cattatatgc agcatcaagt tacgacaagc ttgaattgat gccgcgcgcg *acgacgacgc gacacacgcg acttagacgg acatgttggg acggcgctct ttgacgagta tttggacaaa attcatttta ctctacaaat gctatctgtg agac tcgggc cgggaatgcg *ctcgaccaag cggcggcggt *tcagggcgga tgggggtgtt ggatcttgaa ggctgttgta tgcccttcag tcttgtagtt tggcggactt cgccgtaggt agatgaactt tgaacttg tg acagctcctc caggaattcg cgccagtgtg aatacgactc tctctccctc tcgttggttc ag'gcgcttcg gcgaaagcta caagttaaag aaatctgcca ttcgttaaca.

attagagctg gctaggtgta cgccttagcc aagctggcaa tcgcgatgga cgaaaatcaa actcagcgct cgctaaagaa tatcgaatta catatgcgga tacgaaaaac ccccgaagag cagactgtcg cgaggacgtg ggacggggat ggatatggcc cggtgggtag ccacaactag tatttgtaac tgtttcaggt gtggtatggc caaggtcccc ggcgccctgc cgcgaccttc cttgatatcg cacgaactcc ctgggtgctc *ctgctggtag.

gttcaccttg gttgtactcc ctcgatgcgg gccgtcgtcc gaagaagtcg cagggtggtc cagggtcagc gccgtttacg gcccttgctc gggccgcgga atggatatct actatagggc tctgcactaa gagagagcgc tctacggagc agcaaataaa tgaatcaatt agaagtaatt gatctgcggc cttaatgagg gagcagccta attgagatgt gattttttac gcaaaagtac ttagcctttt gtggggcatt gaaagggaaa tttgatcacc ttagaaaaac aattacgggt gcggggctgg acggcccccc gcgatggcgc tccccgggtc gacttcgagt ggggcgcgag aatgcagtga cattataagc tcagggggag tgattatgat ggacgcgcgc ccgtcccacc agcatcgccg aattcttact agcaggacca aggtagtggt tggtcggcga.

.atgccgttct agcttgtgcc ttcaccaggg ttgaagaaga tgctgcttca acgagggtgg ttgccgtagg tcgccgtcca accatccgcg ggc tggatcg gcagaattcg ccctttgtaa aacgacggcc gaattggccg ttattcgtta ttctctcttt tgctctctca ctctgtcaca cagtaaacgg gcctcgaatg ttcgcgaaaa gagcgccgga gacaattcaa ttcaaacaag caaagtgaac caagcgcagc tgaacaagct aaacaatctg aaaagtaacc agcaaccaag taaatcaact attgaataca agaagagaac tctgaatagg cgcggtctag attagataaa agtaaagtga tcggaatcga aggtttaaca acccgtaaac cattgtattg gcatgtaaaa aataagcggg tagataggca ccatactcac ttttgccctt gtaataacgc taaaagtttt agatgtgctt atttaggtac *acggcctaca gaaaaacagt tatgccaaca .aggtttttca ctagagaatg ttactttagg ttgcgtattg gaagatcaag cacctactac tgatagtatg ccgccattat aaggtgcaga gccagccttc ttattcggcc aacttaaatg tgaaagtggg tccgcgtaca ctaccatcga gggcctgctc gatctcccgg cggctccgcg cctgtccttt ctccccgcgg cgaccgatgt cagcctgggg gacgagctcc atgccgacgc gctagacgat ttcgatctgg cgggatttac cccccacgac tccgccccct ttgagcagat gtttaccgat gcccttggaa gatccagaca tgataagata cattgatgag aaaaaatgct ttatttgtga aatttgtgat tgcaataaac aagttaacaa caacaattgc gtgtgggagg ttttttaaag caagtaaaac cctgcaagcc tcgtcgtctg gccggaccac tccatgagca gagcgcccgc *cgccgaggca aggtcaacag gcggtaaccg .gcctcttcat gcatgtcccc tggcggacgg *gaagtatcag tgtacagctc gtccatgccg agagtgatcc tgtgatcgcg cttctcgttg gggtctttgc tgtcgggcag cagcacgggg ccgtcgccga gctgcacgct gccgtcctcg atgttgtggc tctgcttgtc ggccatgata tagacgttgt ccaggatgtt gccgtcctcc ttgaagtcga tgtcgccctc gaacttcacc tcggcgcggg tggtgcgctc ctggacgtag ccttcgggca tgtggtcggg gtagcggctg aagcactgca gccagggcac gggcagcttg ccggtggtgc tggcatcgcc ctcgccctcg ccggacacgc gctcgaccag gatgggcacc accccggtga gggatccact agttctagag cggccgcctg gtcccggtgt cttctatgga ggtcaaaaca 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 WO 01/48224 WO 0148224PCT/AUOO/OI 596 gcgtggatgg cgagtttacc tcagtgatag gaaagtcgag tccctatcag aaaagtgaaa cggtacccgg tgaaccgtca gggaccgatc agctgacgcg ttggggaccc ggcaaagttt tcatgataat ttcttttcat taaattcact aggcaatcag aaat gataag ggtagaaaca acactgtttg gttcatgcct catcattttg ggtgtggcca tatggggaca ttcattgcaa gcaaatcatt tgctggctgc tgctgtccat ttgttttgtg cagatttttc tcgactgcat ttccgcttcc agc tcac tca catgtgagca tttccatagg gcgaaacccg ctctcctgtt cgtggcgctt caagctgggc ctatcgtctt taacaggatt taactacggc cttcggaaaa tttttttgtt gatcttttct catgagatta atcaatctaa ggcacctatc gtagataact cgtctccagg actccctatc agaaaagtga tttaccactc tgatagagaa gtcgagttta gtcgagtagg gatcgcctgg cagcc tcc gc tgctagcgcg t tgattgttc tcagggtgtt tttgtttctt tttctgtaac ttcgtttatt ggtaattata gtagaatatt actacatcct agatgaggat tcttcttttt gcaaagaatt atgccctggc tcatgaagcc tagtgtgtgg taaaacatca catgaacaaa tccttattc ttattttttt ctcctctcct taatgaatcg tcgctcactg aaggcggtaa aaaggccagc ctccgccccc acaggac tat ccgaccctgc tctcaatgct tgtgtgcacg gagtccaacc agcagagcga tacactagaa agagttggta tgcaagcagc acggggtctg tcaaaaagga agtatatatg tcagcgatct acgatacggg cgatc tgacg agtgatagag aagtcgagtt cctatcagtg aagtgaaagt ccactcccta cgtgtacggt agacgccatc ggccccgaat gcc tcgacga tttctttttc gtttagaatg tcactttcta ttttttcgtt tgtcagattg ttgtacttca tctgcatata ggtaatcatc aaaatactct cctacagctc cactcctcag tcacaaatac ccttgagcat gaattttttg gaatgagtat ggtggctata atagaaaagc ctttaacatc gactactccc gccaacgcgc actcgctgcg tacggttatc aaaaggccag ctgacgagca aaagatacca cgcttaccgg cacgctgtag aaccccccgt cggtaagaca ggtatgtagg ggacagtatt gctcttgatc agattacgcg acgctcagtg tcttcaccta agtaaacttg gtctatttcg agggcttacc gttcactaaa aaaagtgaaa taccactccc atagagaaaa cgagtttacc tcagtgatag gggaggccta cacgctgttt tcgagctcgg tatctctaga gctattgaaa ggaagatgtc ctctgttgac aaactttagc taagtactt-t gcacagtttt aattctggct ctgcctttct gagtccaaac ctgggcaacg gtgcaggctg cactgagatc c tgacttctg tgtctctcac ttggtttaga aagaggtcat cttgacttga cctaaaattt agtcatagct ggggagaggc ctcggtcgtt cacagaatca.

gaaccgtaaatcacaaaaat ggcgtttCcc atacctgtcc gtatctcagt -tcagcccgac cgacttatcg cggtgctaca tggtatctgc cggcaaacaa cagaaaaaaa gaacgaaaac gatcctttta gtctgacagt ttcatccata atctggcccc cgagctctgc gtcgagttta tatcagtgat gtgaaagtcg actccctatc agaaaagtga tataagcaga tgacctccat tacccgggga ctgagaactt aattcatgtt ccttgtatca aacca ttgtc ttgcatttgt ttatataggt ccactcccta agagaaaagt agtttaccac agtgatagag aagtcgagct gctcgtttag agaagacacc tcctctagtc cagggtgagt atatggaggg ccatggaccc tcctcttatt aacgaatttt 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 ctctaatcac 'ttttttttca 3720 agagaacaat tgttataatt 3780 ggcgtggaaa.

ctttatggtt cgggc ccc tc tgctggttgt cctatcagaa tttttccctc ggtaataaag tcggaaggac gtttggcaac cagtatatga ggttagattt tccttacatg gtccctcttc ggtttgcgta cggctgcggc ggggataacg aaggccgcgt 'cgacgctcaa.

cctggaagct gcctttctcc tcggtgtagg cgctgcgcct ccactggcag gagttcttga gctctgctga accaccgctg ggatctcaag tcacgttaag aattaaaaat tacc aat gct gttgcctgac agtgc tgcaa -tattcttatt acaatgatat tgctaaccat tgtgctgtct ggtggtggct tgccaaaaat gaaatttatt atatgggagg atatgccata aacagccccc tttttatatt ttttactagc tcttatgaac ttgggcgctc gagcggtatc caggaaagaa -tgc tggcgt t ccctcgtgcg cttcgggaag tcgttcgctc tatccggtaa cagccactgg agtggtggcc agccagttac gtagcggtgg aagatccttt ggattttggt gaagttttaa taatcagtga tccccgtcgt tgataccgcg 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 WO 01/48224 WO 0148224PCT/AUOO/01596 agacccacgc gcgcagaagt agc tagagta catcgtggtg aaggcgagtt gatcgttgtc taattctctt caagtcattc ggataatacc ggggcgaaaa tgcacccaac aggaaggcaa actcttcctt catatttgaa agtgccacct tatcacgagg tcaccggctc ggtcctgcaa agtagttcgc tcacgctcgt acatga toc agaagtaagt ac tgtcatgc tgagaatagt gcgccacata ctctcaagga tgatcttcag aatgccgcaa tttcaatatt tgtatttaga gacgtctaag ccctttcgtc cagatttatc ctttatccgc cagttaatag cgtt tggtat ccatgttgtg tggccgcagt catccgtaag gtatgcggcg gcagaacttt tcttaccgct *catcttttac aaaagggaat attgaagcat aaaataaaca aaaccattat ttca agcaataaac ctccatccag tttgcgcaac ggcttcattc caaaaaagcg gttatcactc atgcttttct accgagttgc aaaagtgctc gttgagatcc tttcaccagc aagggcgaca ttatcagggt aataggggtt cagccagccg tctattaatt gttgttgcca agctccggtt gttagctcct atggttatgg gtgactggtg tcttgcccgg atcattggaa agttcgatgt gtttctgggt cggaaatgtt tattgtctca ccgcgcacat gaagggccga gttgccggga ttgctacagg cccaacgatc tcggtcctcc cagcactgca agtactcaac cgtcaatacg aacgttcttc aacc cac tc g gagcaaaaac gaatactcat tgagcggata ttccccgaaa 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6624 tatcatgaca. ttaacctata aaaataggcg <210> <211> 7910 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Seqluence :pBIT (dHSP) -RFP-oHoxDS/BH <400> ctcgagcggc agtgaattgt tctttttggg catactgctc gtataaatag acgtcgctaa *cagtaaagtg :,.gcaactactg gaattgggaa *ttaacagcgc tcgcccagaa ctttgctcga tagaagggga tactaagtca atgaaactct cattatatgc agcatcaagt tacgacaagc ttgaattgat cgccagtgtg aatacgactc tctctccctc tcgttggttc aggcgcttcg gcgaaagcta caagttaaag aaatctgcca ttcgttaaca attagagctg gctaggtgta cgccttagcc aagc tggcaa tcgcgatgga cgaaaatcaa actcagcgct cgctaaagaa tatcgaatta catatgcgga atggatatct ac tatagggc tctgcactaa gagagagcgc tctacggagc agcaaataaa tgaatcaattagaagtaatt gatctgcggc cttaatgagg gagcagccta attgagatgt gattttttac gcaaaagtac ttagcctttt gtggggcatt gaaagggaaa t ttgatcacc t tagaaaaac gcagaattcg ccctttgtaa gaattggccg ttattcgtta tgctctctca. ctctgtcaca gcctcgaatg. ttcgcgaaaa gacaattcaa. ttcaaacaagcaagcgcagc tgaacaagct aaaagtaacc attgaataca cgcggtctag .tcggaatcga cattgtattg gtaataacgc atttaggtac tatgccaaca ttactttagg cacctactac aaggtgcaga aacttaaatg agcaaccaag agaagagaac attagataaa aggtttaaca gcatgtaaaa ccatactcac taaaagtttt acggcctaca aggtttttca ttgcgtattg tgatagtatg gccagccttc tgaaagtggg aacgacggcc ttctctcttt cagtaaacgg .gagcgccgga caaagtgaac aaacaatctg taaatcaact tctgaatagg agtaaagtga acccgtaaac aataagcggg ftttgccct t agatgtgctt gaaaaacagt ctagagaatg gaagatcaag ccgccattat ttattcggcc tccgcgtaca 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 gccgcgcgcg tacgaaaaac aattacgggt ctaccatcga gggcctgctc gatctcccgg 1200 WO 01/48224 PCT/AUOO/01596 acgacgacgc ccccgaagag gcggggctgg cggctccgcg cctgtccttt ctccccgcgg 1260 gacacacgcg acttagacgg acatgttggg acggcgctct ttgacgagta tttggacaaa gctattgctt attcatttta ctctacaaat gctatctgtg agactcgggc ',cgggaatgcg c tcgaccaag tggtggcggc gtgatgtcca atgtagatgg tggatctcgc c ccatggtc t accttgtaga ccgtcctcga tagtcgggga gacaggatgt ttgtggccct acggtgccct *cgcaccatgg *ctggatcggt atctgacggt tgatagagaa gtcgagttta tatcagtgat *gtgaaagtcg actccctatc tgtacggtgg *acgccatcca .ccccgaattc ttggatctga aatccgttcg gctaaagaaa tgtatcgtaa aaataaataa ttaggtaata aaacttaaga agactctttg cggcgctcag tcacttgcct tgtagcgac L gtaaggttga cagactgtcg cgaggacgtg ggacggggat ggatatggcc cggtgggtag ccacaactag tatttgtaac tgtttcaggt gtggtatggc caaggtcccc ggcgccctgc cgcgaccttc cttgcatgcc cctcggtgcg gcttggagtc acttgaactc ccttcagcac tcttctgcat.

tgaagcagcc agttcatcac tgtcggcggg cccaggcgaa cgtaggggcg c catgcgcac tggcgaccgg cccggtgtct tcactaaacg aagtgaaagt ccactcccta agagaaaagt agtttaccac agtgatagag gaggcctata cgctgttttg gagctcggta ccgtccatcg gaaaaaatca tcatcactaa gactttcaaa tttatttttt ctattgttgt caaacttata gccttagtcg ctggaattag t teggagaga gtagaggaac agaaaaactg acggcccCCC gcgatggcgc tccccgggtc gacttcgagt ggggcgcgag aatgcagtga cattataagc tcagggggag tgattatgat ggacgcgcgc ccgtcccacc agcatcgccg tgcaggtcga ctcgtactgc cacgtagtag caccaggtag gccgtcgcgg tacggggccg gtcctgcagg gcgctcccac gtgcttcacg gggcaggggg gccctcgccC cttgaagcgc tggatcccgg tctatggagg agctctgctt cgagtttacc tcagtgatag gaaagtcgag tccctatcag aaaagtgaaa taagcagagc acctccatagcccggggatc caataaaatg.

gaaaatcatc tatagaatgt agtctacaag ctataagcaa tctatggaat atataaccca acggatcccc gccttctagt gcgagatttt tccttttcca ctgcgttgtt cgaccgatgt cagcctgggg atgccgacgc gctagacgat cgggatttac cccccacgac ttgagcagat gtttaccgat gatccagaca tgataagata aaaaaatgct ttatttgtga tgcaataaac aagttaacaa gtgtgggagg ttttttaaag cctgcaagcc tcgtcgtctg tccatgagca gagcgcccgc aggtcaacag gcggtaaccg gcatgtcccc tggcggacgg ctctagagtc gcggccgcta tccacgatgg 'tgtagtCCtc.

tagccgggca gctgcacggg tggccgccgt-ccttcagctt gggtacaggc gctcggtgga tcggagggga agttcacgcc gaggagtcc t gggtcacggt ttgaagccct cggggaagga tacaccttgg agccgtactg ccgcccttgg tcaccttcag tcgccctcga tctcgaactc atgaactcct tgatgacgtt gccgcctgca ggaattcggg tcaaaacagc gtggatggcg atataggtcg agtttaccac *actccctatc agtgatagag agaaaagtga aagtcgagtt tttaccactc cctatcagtg tgatagagaa aagtgaaagt gtcgagc-tcg :gtacccgggt tcgtttagtg aaccgtcaga aagacaccgg gaccgatcca ctctagtcag ctgacgcgtt agccattatg agatcgaaag aaagccgaat ataattaaaa agaatgaacc catgtatatt acattaaatg acaagttgac taacattttt gctaaattaa attcgatcga aacattctta tatgttataa cccattgatg gacaccagac caactggtaa gaatcatccg tcggttttgg gggccagctc ggctttcctc gctccagcgt ctgagtcgac tttcctttca ggctggacag gacgagctcc ttcgatctgg tccgccccct gcccttggaa cattgatgag aatttgtgat caacaattgc caagtaaaac gccggaccac cgccgaggca.

gcctcttcat gaagtatcag *caggaacagg 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 -cttc.ttggcc 2160 ,'cagggccttg 2220 ggcc tcccag gatgaacttc caccacgccg cagcttcttg gaac tggggg cttcacggtg gtggccgttc cttggaggag gccgcggagg tc tccaggcg tcc ctatcag aaaagtgaaa taccactccc atagagaaaa cgagtttacc cgagtaggcg tcgcctggag gcctccgcgg gggctagtga ggtc tacgaa tgtattacta agatactaat tttaaatttc gac ttggtaa tcagtctcaa aacaaaaatt tggtagcgac aaccagatct ctgatggtga aggaatggag tgcc Lcgaaa 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 WO 01/48224 WO 0148224PCT/AU00/11596 gcctcttcgt tttcccatag tacaagtcca aatccgaaca tccggtgtgt acggcacctc accatgatca cctaagttcc cgctacatca caagtgaaga *tctagactga ttgaaaaatt gatgtcccttgttgacaacc tttagcttgc tactttctct agttttagag ctggctggcg ctttctcttt ccaaaccggg gcaacgtgct aggctgccta gagatctttt cttctgggta tctzcactcgg tttagagttt ggtcatcagt acttgaggtt aaattttcct atagctgtcc agaggcggtt gtcgttcggc gaatcagggg.

cgtaaaaagg aaaaatcgac tttccccctg.

ctgtccgcct ctcagttcgg cccgaccgct t tatcgccac gctacagagt atctgcgctc aaacaaacca aaaaaaggat gaaaactcac c tt ttaaat t gacagttacc tccatagt tg gatgaaaact tgctcctcgg gcatgtactg tattgagcaa gtctccccga ccagcaacac gtcagttccg tcatgaattc ccatcaggag tctggttcca gaacttcagg catgttatat gtatcaccat attgtctcct atttgtaacg aatcactttt aacaattgtt tggaaatatt atggttacaa cccctctgct ggttgttgtg tcagaaggtg tccctctgcc aaggacatat ggcaacatat atatgaaaca agattttttt tacatgtttt ctcttctctt tgcgtattgg tgcggcgagc ataacgcagg ccgcgttgct gctcaagtca gaagctccct ttctcccttc tgtaggtcgt gcgccttatc tggcagcagc tcttgaagtg tgctgaagcc ccgctggtag ctcaagaaga gttaagggat aaaaatgaag aatgcttaat cctgac tccc tcgtatcgtg tttgctctgc tggctgccct ttctacatgt gcgccgaatg ttcgggtcat cgttttcaga gtgcatataa agggaccact gccgatttgc ttggggtggg ttttcgcttc gcgtagctca aactcgttca ggaagtttgt atcagttcgc atcactgtat ttccgtcggt cgatctcggg aatgagtcca ctgaccgagc aacagcaccg tgagagcgcg gaccacggcg gaggaggaag cgctgtggcc ggtctgcgtt cccgtcgtct gattcagacg ctggagctgg aaaaggagtt cctctacagt gaaagccgag ctggcccaaa atctcgctct ctccgaaagg aaaccgacgg atgaatcact agcgcggcct cgacgatatc gtgagtttgg ggacccttga ttgttctttc tttttcgcta ggagggggca aagttttcag ggtgttgttt agaatgggaa ggaccctcat gataattttg tttctttcac tttctactct cttattttct tttcattttc tgtaactttt ttcgttaaac aatttttaaa ttcactttcg.tttatttgtc-agattgtaag ttttcaaggc aatcagqggta attatattgt-.acttcagcac ataattaaat gataaggtag aatatttctg zcatataaatt cttattggta gaaacaacta catcctggta atcatcctgc tgatatacac tgtttgagat gaggataaaa tactctgagt aaccatgttc atgccttctt ctttttccta cagctcctgg ctgtctcatc attttggcaa agaattcact cctcaggtgc gtggctggtg tggccaatgc cctggctcac aaataccact aaaaattatg gggacatcat gaagcccctt gagcatctga tttattttca ttgcaatagt gtgtgggaat tttttgtgtc gggagggcaa atcatttaaa acatcagaat gagtatttgg gccatatgct ggctgccatg aacaaaggtg gbtataaaga gccccctgct gtccattcct tattccatag aaaagccttg tatattttgt tttgtgttat ttttttcttt aacatcccta actagccaga tttttcctcc tctcctgact actcccagtc atgaactcga ctgcattaat gaatcggcca acgcgcgggg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg ggtatcagct cactcaaagg cggtaatacg gttatccaca aaagaacatg tgagcaaaag,.gccagcaaaa ggccaggaac ggcgtttttc cataggctcc*7gcccccctga. .cgagcatcac gaggtggcga aacccgacag 'gactataaag ataccaggcg cgtgcgctct cctgttccga ccctgccgct taccggatac gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cggtaactat-cgtcttgagt ccaacccggt aagacacgac cactggtaac aggattagca gagcgaggta tgtaggcggt gtggcctaac tacggctaca ctagaaggac agtatttggt agttaccttc ggaaaaagag ttggtagctc ttgatccggc cggtggtttt tttgtttgca agcagcagat tacgcgcaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac tttggtcatg agattatcaa aaaggatctt cacctagatc ttttaaatca atctaaagta tatatgagta aacttggtct cagtgaggca cctatctcag cgatctgtct atttcgttca cgtcgtgtag ataactacga tacgggaggg cttaccatct 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 WO 01/48224 WO 0148224PCT/AUOO/01596 ggccccagtg ataaaccagc atccagtcta cgcaacgttg tcattcagct aaagcggtta tcactcatgg ttttctgtga 'agttgctctt gtgctcatca agatccagtt accagcgttt gcgacacgga cagggttatt ggggt tccgc atgacat taa c tgcaatgat cagccggaag t taattgttg ttgccattgc ccggttccca gctccttCgg t tatggcagc ctggtgagta .gcccggcgtc ttggaaaacg cgatgtaacc c tgggtgagc aatgttgaat gtctcatgag gcacatttcc cctataaaaa accgcgagac ggccgagcgc ccgggaagct tacaggcatc acgatcaagg tcctccgatc actgcataat ctcaaccaag aatacgggat ttcttcgggg cactcgtgca aaaaacagga actcatactc cggatacata ccgaaaagtg taggcgtatc ccacgctcac agaagtggtc agagtaagta gtggtgtcac cgagt tacat gttgtcagaa tctcttact~g tcattctgag aataccgcgc cgaaaactct cccaactgat aggcaaaatg ttcctttttc tttgaatgta ccacctgacg acgaggccct cggctccaga ctgcaacttt gttcgccagt gctcgtcgtt gatcccccat gtaagt tggc tcatgccatc aatagtgtat cacatagcag caaggatctt cttcagcatc ccgcaaaaaa aatattattg tttagaaaaa tttatcagca atccgcctcc taatagtttg tggtatggct gttgtgcaaa cgcagtgtta cgtaagatgc gcggcgaccg aactttaaaa accgctgttg ttttactttc gggaataagg aagcatttat taaacaaata 7020 7080 7140 7200 7260 7320 7380 7440 7500 7560 7620 7680 7740 7.800 tctaagaaac cattattatc 7860 ttcgtcttca 7910 <210> 21 <211> 5919 <212> DNA <213> Artificial Sequence <220>- <223> Description of Artificial Sequence:pHSP-GUS P lasni d <400> 21 gggcgaattg tccaggatcc gaaaatccgt ctagctaaag tgtatcgtaa aaataaataa ttaggtaata aaacttaaaa agactctttg cggcgctcag gaattcccca ttgcctccct aaagccgccg cgcaatatgc gcgc tgacgc ctccacatgt atgataatcg tctgccgttt acatcaaaga gtgatcggac ggcccgacgt tgaccgtcca tcggaaaaaa aaatcatcac gactttcaaa tttatttttt ctattgttgt caaacttata gccttagtcg ctggaattag ccgaggctgt.

gctgcggttt acttcggttt cttgcgaggt gatcaaagac cggtgtacat gctgatgcag ccaaatcgcc gatcgc tgat gcgtcgggtc cgcatgctcc tcgcaataaa tcagaaaatc taatatagaa agtctacaag ctataagcaa tc tatggaat atataaccca acggatcccc gccttctaga agccgacgat ttcaccgaag gcggtcgcga cgcaaaatcg gcggtgatac tgagtgcagc tttctcctgc gc tttggaca ggtatcggtg gagtttacgc cggccgccat ggcggccgcg ggaattcgat atgagccatt atgagatcga aagggtctac atcaaagccg aatataatta aaatgtatta tgtagaatga .accatgtakta tagatacztaa acattaaatg acaagttgac.tt.taaatttc taacattttt. gctaaattaa gacttggtaa attcgatcga tatgt Lataa gacaccagac ccgcggccgc ggtgcgccag ttcatgccag gtgaagatcc gcgaaattcc atatccagcc ccggc Laacg caggccagaa taccatccgt tgagcgtcgc gttgcttccg cccattgatg caactggtaa agat ctcgac gagagttgtt tccagcgttt ctttcttgtt atacctgttc atgcacactg tatccacgcc gttctttttc aataacggtt agaacattac ccagtggcgc -tcagtctcaa aacaaaaatt tggtagcgac gtaggccttt.

gatt cat tgt ttgcagcaga accgccaacg accgacgacg atactcttca gtattcggtg cagtaccttc caggcacagc attgacgcag gaaatattcc 1 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 WO 01/48224 WO 0148224PCT/AUOO/01596 cgtgcacctt tggtttttgt ccgttgactg cctaaagaga tctgcccagt ccaatccagt cgtaagtccg aggaactgtt cactctgtct .cagaggtgcg *tgttgatccg acagacgcgt gtgttcggcg tggaagtaag gtctgccagt acatacggcg *tgattattga tggcctgccc ttacgaatat ctttcttgta ctgaatgccc accatgggac gtattcaata gttactttta ctg'cgcttgt tgaattgtcg *ttcgaggcgc agagagcatt cagagaaatt -ttttgggatt tgggagagc t gcttggcgta cacacaacat aactcacatt agctgcatta- 2 ccgcttcctc ctcactcaaa tgtgagcaaa tccataggct gaaacccgac ctcctgttcc tggcgctttc agctgggc tg atcgtcttga acaggattag actacggcta tcggaaaaag gcggacgggt cacgcgctat cctcttcgct ggttaaagcc cgagcatctc ccattaatgc catcttcatg cgccc ttcac ggcttttggc gattcaccac catcacgcag ggttacagtc tggtgtagag actgcttttt tcagttcgtt tgacatcggc cccacacttt aacctttcgg ctgcatcggc acgcgctttc acaggccgtc gtcgagatct attacttctt attigattcac ttatttgctt ctccgtagac gctctctcga agtgcagaga tctcgagttt ctaggaattc cccaacgcgt atcatggtca acgagccgga aattgcgttg atgaatcggc gctcactgac ggcggtaata aggccagcaa ccgcccccct gaccctgccg tcatagctca tgtgcacgaa gtccaacccg cagagcgagg cactagaagg agttggtagc atccggttcg cagctcttta gtacagttct gacagcagca ttcagcgtaa gtggtcgtgc acgaccaaag tgccactgac tgtgacgcac ttgcaaagtc ttcaacgctg ttgcgcgaca cattacgctg cttgccgttt gttcacacaa ttcaaatggc gccgtaatga tataaagact gaactgatcg ccaccaacgc gagttttttg gttaacgaat ggcagatttc tttaacttgc agctttcgct gaagcgctct .accaacgaga gggagaccca tcttctgcca tatcactagt tggatgcata tagctgtttc agcataaagt cgctcactgc caacgcgcgg tcgctgcgct cggttat cca aaggccagga gacgagcatc agataccagg cttaccggat cgctgtaggt ccccccgttc gtaagacacg tatgtaggcg acagtatttg tcttgatccg ttggcaatac atcgcctgta ttcggcttgt gtttcatcaa gggtaatgcg accatcagca ccagtaaagt cggatgccga agttcataga ccgctagtgc acatcaccat tgcgtcacca cgatggattc tcgtcggtaa acggtgatac gtatagccgc.

gtgatcgcat: tcgcgctgat t taaaac tgc tgatcaattc atttcacggg tcccaattcc agtagttgca actttactgc tagcgacgtg atttatactc gcagtatgcc aaaagaaaag aacaaatgac gaattcgcgg gcttgagtat ctgtgtgaaa tccacatcac agtgcgcttg tgcccgcttc tcaccacgat aggtacggta cgttatcgaa agaacggttt cgcgaagcgg gataacc ttc cttgtccagt tggccaccac cggtgatatc cggcatagtt tcaccattcc gtacacttttcacgcttggg ctgagtttcc gaaaccaatg gccatgttca ggagttggcc tcc tttgcca gtggttaatc gtagatatca acccggttgc tgcaaccacc ctgccagtca gtccacccag aaagaaatca cggcgggata cccggcaata 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 cctgatgctc catcacttcc 2160 cgaaacgcag-,cacgatacgc .2220 accagacgtt ctggcacagc cacagttttc ttggggtttc ctattcagag gttgatttac agattgttta t tcac ttbtgc cggcgctctt gtttactgtg agagaataac ctaccacaat gcccgcataa aattgcccgg gcgatccaga tacaggacgg ttctcttctt ttggttgctg gcttgttcag ttgtttgaat ttcgcgaaca tgacagagtg gaataacggc aaccagtttg 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 ccgcctgcag .gtcgaccata tctatagtgt cacctaaata ttgttatccg .ctcacaattc gtaaagcctg :.gggtg.cctaa ,tgagtgagct 3180 ccgctttcca gtcgggaaac ggagaggcgg,.tttgcgtatt .cggtcgttcg gctgcggcga cagaatcagg ggataacgca accgtaaaaa. ggccgcgttg acaaaaatcg acgctcaagt cgtttccccc tggaagctcc acctgtccgc ctttctccct atctcagttc ggtgtaggtc agcccgaccg ctgcgcctta acttatcgcc actggcagca gtgctacaga gttcttgaag gtatctgcgc tctgctgaag gcaaacaaac caccgctggt gaaaaaaagg atctcaagaa ctgtcgtgcc gggcgctctt gcggtatcag ggaaagaaca ctggcgtttt cagaggtggc ctcgtgcgct tcgggaagcg gttcgctcca tccggtaact gccactggta tggtggccta ccagttacct agcggtggtt gatcctttga 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 tttttgtttg caagcagcag attacgcgca WO 01/48224 WO 014S224PCT/AUOO/01596 tcttttctac ggggtctgac tgagattatc aaaaaggatc caatctaaag tatatatgag cacctatctc agcgatctgt agataactac gatacgggag acccacgctc accggct.cca gcagaagtgg tcctgcaact ctagagtaag tagttcgcca.

.tcgtggtgtc acgctcgtcg ggcgagttac .atgatccccc tcgttgtcag .aagtaagttg *attctcttac tgtcatgcca agtcattctg agaatagtgt ataataccgc gccacatagc ggcgaaaact ctcaaggatc cacccaactg atcttcagca *gaaggcaaaa tgccgcaaaa tcttcctttt tcaatattat tatttgaatg tatttagaaa tgccacctgt atgcggtgtg gcgaaattgt aaacgttaat cattttttaa ccaataggcc agatagggtt gagtgttgtt ccaacgtcaa agggcgaaaa ccaaatcaag ttttttgcgg gcccccgatt tagagcttga aagcgaaagg agcgggcgct ccacacccgc cgcgcttaat caactgttgg gaagggcgat gggatgtgct-gcaaggcgat taaaacgacg gccagtgaat gctcagtgga ttcacc taga taaacttggt ctatttcgtt ggcttaccat gatttatcag ttatccgcct gttaatagtt tttggtatgg atgttgtgca gccgcagtgt tccgtaagat atgcggcgac agaactttaa ttaccgctgt tcttttactt aagggaataa tgaagcattt aataaacaaa aaataccgca attttgttaa gaaatcggca ccagtttgga accgtctatc tcgaggtgcc cggggaaagc agggcgctgg gcgccgctac cggtgcgggc acgaaaactc tccttttaaa ctgacagtta catccatagt ctggccccag caataaacca ccatccagtc tgcgcaacgt cttcattcag aaaaagcggt tatcactcat gcttttctgt cgagttgctc aagtgctcat acgttaaggg ttaaaaatga ccaatgctta tgcctgactc tgctgcaatg gccagccgga tattaattgt tgttggcatt c tccggttcc tagctccttc ggttatggca gactggtgag ttgcccggcg cattggaaaa tgagatccag.. ttcgatgtaa tcaccagcgt ttctgggtga gggcgacacg -gaaatgttga.

attttggtca agttttaaat atcagtgagg cccgtcgtgt ataccgcgag agggccgagc tgccgggaag gctacaggca caacgatcaa ggtcctccga gcactgcata tactcaacca tcaatacggg cgttcttcgg cccactcgtg gcaaaaacag atactcactac agcggataca ccccgaaaag accgcatcag taaatcagct gaatagaccg aacgtggact gaaccatcac cctaaaggga.

gaagggaaga.

cgcgtaacca.

tcaggctgcg tggcgaaagg 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5919 atcagggtta taggggttcc cagatgcgta aattcgcgtt aaatccctta acaagagtcc agggcgatgg gtaaagc tc t cggcgaacgt caagtgtagc agggcgcgtc ctcttcgcta t Lgtctcatg gcgcacattt aggagaaaat ,aaatatttgt taaatcaaaa actattaaag cccactacgt aaatcggaac ggcgagaaag ggtcacgctg cattcgccat ttacgccagc taagttgggt .aacgccaggg tgtaatacga ctcactata ttttcccagt cacgacgttg <210> 22 <211> 3968 .<212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:pHSP7O-1MCS Plasmid <400> 22 tgtaaaacga cggccagtga attgtaatac gactcactat agggcgaatt gatgcatgct cgagcggccg ccagtgtgat ggatatctgc agaattcgcc cgacggccag tgaattgtaa tacgactcac tatagggcga attggccgtt ctctcttttc tttttgggtc tctccctctc tgcactaatg ctctctcact gtaaacggca tactgctctc gttggttcga gagagcgcgc ctcgaatgtt gggccctcta ctttgtaaaa attcgttatt ctgtcacaca cgcgaaaaga WO 01/48224 ~VO 0148224PCTAUOO/01 596 gcgccggagt aagtgaacac acaatctgca aatcaactgc tgaataggga cagc tgagcg ggccaaagag ttgtcttaag tagtattacc .aaattattta gtcttacgat tgatttcttt ttccgaacgg .cggtcagatc cacctaaata ctcacaattc tgagtgagct ctgtcgtgcc gggcgctctt gcggtatcag ggaaagaaca ctggcgtttt cagaggtggc ctcgtgcgct tcgggaagcg gttcgctcca tccggtaact gccactggta tggtggccta ccagttacct *agcggtggtt gatcctttga attttggtca agttttaaat atcagtgagg.

cccgtcgtgt ataccgcgag agggccgagc tgccgggaag gctacaggca caacgatcaa ggtcctccga gcactgcata tactcaacca tcaatacggg cgttcttcgg cccactcgtg gcaaaaacag ataaatagag gtcgctaagc gtaaagtgca aactactgaa attgggaatt ccggtcgcta tctaattttt tttttgagac taattaccaa tttgaaattt acaattagta agctagtaat attttcgtag caatcac tag gcttggcgta cacacaacat aactcacatt agctgcatta ccgcttcctc ctcactcaaa tgtgagcaaa tccataggct gaaacccgac ctcctgttcc tggcgctttc agctgggctg atcgtcttga acaggattag actacggcta tcggaaaaag tttttgtttg tcttttctac tgagat tatc caatctaaag cacctatctc agataac tac acccacgctc gcagaagtgg c bagagtaag tcgtggtgtc ggcgagttac tcgttgtcag attctcttac agtcattctg ataataccgc ggcgaaaact cacccaactg gaaggcaaaa gcgcttcgtc gaaagc taag agttaaagtg atc tgc caag cgttaacaga ccattaccag gttcatcaat tgataagaat gtcttaattt aaagtcaact tctaatatac acattttaat accctttcga cccaacgcgt atcatggtca acgagccgga aattgcgttg atgaatcggc gctcactgac ggcggtaata aggccagcaa ccgcccccct aggactataa gaccc tgccg tcatagc tca tgtgcacgaa gtccaacccg cagagcgagg cactagaagg agttggtagc caagcagcag ggggtctgac aaaaaggatc tatatatgag agcgatc tgt gatacgggag accggctcca tcctgcaact tagttcgcca acgctcgtcg atgatccccc aagtaagttg tgtcatgcca agaatagtgt gccacatagc ctcaaggatc atc ttcagca tgccgcaaaa tacggagcga caaataaaca aatcaattaa aagtaattat tc tgcggccg t tggtctggt gggttataac gtttcgatcg agcaaaaatg tgtcatttaa atgggttcat tatattcggc tc tcataatg tggatgcata tagctgtttc agcataaagt cgctcactgc caacgcgcgg tcgctgcgct cggttatcca aaggccagga gacgagcatc agataccagg cttaccggat cgctgtaggt ccccccgttc gtaagacacg tatgtaggcg acagtatttg tcttgatccg attacgcgca gc tcagtgga caattcaatt agcgcagctg aagtaaccag tgaatacaag cggtctagaa gtcggggatc atatgggtta aatattccat ttattgctta tgtcttgtag tctacattct tttgatgatt gctcatttta gcttgagtat !ctgtgtgaaa gtaaagcctg ccgctttcca ggagaggcgg cggtcgttcg cagaatcagg accgtaaaaa acaaaaatcg cgtttccccc acctgtccgc atctcagttc agcccgaccg acttatcgcc gtgctacaga gtatctgcgc gcaaacaaac gaaaaaaagg caaacaagca aacaagctaa caaccaagta aagagaac Lc ggcctaattc cgtcgac taa tattataagt agaacaacaa tagaaaaaat acttttgaaa atattagtga ttctgatttt ttgcgatgga tctatagtgt -ttgttatccg gggtgcctaa gtcgggaa ac tttgcgtatt gc tgcggcga ggataacgca ggccgcgttg acgc tcaagt tggaagctcc ctttctccct ggtg taggtc ctgcgcctta actggcagca gttcttgaag tctgctgaag caccgctggt atctcaagaa acgttaag.gg ttaaaaat-ga ccaatgctta tgcctgactc tgctgcaatg gccagccgga tattaattgt tgt tggcatt ctccggttcc tagctccttc ggt tatggca gactggtgag ttgcccggcg cattggaaaa ttcgatgtaa ttctgggtga gaaatgttga 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2-400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 ttcacctaga tccttttaaa taaacttggt wctgacagtta ctatttcgtt ggcttaccat gatttatcag ttatccgcct gttaatagtt tttggtatgg atgttgtgca gccgcagtgt tccgtaagat atgcggcgac agaactttaa ttaccgctgt tcttttactt aagggaataa catccatagt ctggccccag caataaacca ccatccagtc tgcgcaacgt cttcattcag aaaaagcggt tatcactcat gcttttctgt cgagttgctc aagtgctcat tgagatccag tcaccagcgt gggcgacacg WO 01/48224 ~VO 0148224PCT/AUOO/01596 atactcatac agcggataca ccccagaaaag accgcatcag taaatcagct gaatagaccg aacgtggac t gaaccatcac cctaaaggga gaagggaaga cgcgtaacca tcaggctgcg tggcgaaagg cacgacgt tcttcctttt tatttgaatg tgccacctqt gcgaaattgt cattttttaa agatagggtt ccaacgtcaa ccaaatcaag gcccccgatt aagcgaaagg ccacacccgc caactgttgg gggatgtgct tcaatattat tatttagaaa atgcggtgtg aaacgttaat ccaataggcc gagtgttgtt agggcgaaaa ttttttgcgg tagagcttga agcgggcgc t cgcgcttaat gaagggcgat gcaaggcgat tgaagcattt aataaacaaa aaataccgca attttgttaa gaaatcggca ccagtt tgga accgtctatc tcgaggtgcc cggggaaagc agggcgc tgg gcgccgc tac cggtgcgggc taagttgggt atcagggtta taggggt tcc cagatgcgta aattcgcgtt aaatccctta acaagagtcc agggcgatgg gtaaagctct cggcgaacgt caagtgtagc agggcgcgtc ctcttcgcta aacgccaggg ttgtctcatg gcgcacattt aggagaaaat aaatatttgt taaatcaaaa actattaaag cccactacgt aaatcggaac ggcgagaaag ggtcacgctg cattcgccat ttacgccagc ttttcccagt 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 3968 <210> 23 <211> 129 <212> DNA <213> Pacific Oyster <220> <223> HoxCgl <400> 23 cagacgctgg agctggaaaa ggagttcctc tacagtcgct acatcaccat caggaggaaa gccgagctgg cccaaaatct cgctctctcc gaaaggcaag tgaagatctg gttccaaaac 120 cgacggatg 129 <210> 24 <211> 129 <212> DNA <213> Pacific Oyster <220> <223> HoxCg3 <400> 24 cagacgttgg agttggaaaa ggagtttcac agcaaaaagt acttatcgct gactgaacga tctcatattg cacataatct aaaattaagt gaagtccaag taaaaatttg gttccaaaac 120 cggcgcatg 129 <210> <211> 18 <212> DNA <213> Artificial Sequaence WO 01/48224 WO 0148224PCTIAU00IOI 596 <220> <223> Description of Artificial Sequence:Oyster specific antisense <400> gagatcgttc agtcagcg 18 <210> 26 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Broader spectrum antisense <400> 26 catgsgssgg ttttgga 17 <210> 27 <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:CG1.1-Sal.for Forward Primer <400> 27 atggatgtcg dctcagacgc tggag <210> 28 <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:CG1.1.Pst.rev Reverse Primer <400> 28 gattcactag tcaattcctg cagtt WO 01/48224 WO 0148224PCT/AUOO/01596 <210> 29 <211> 4626 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequenrce:pHSP-oHoxDS/BH Plasmid <400> 29 tgtaaaacga cgttattctc tcacacagta gaaaagagcg acaagcaaag aagctaaaca ccaagtaaat agaactctga atcttcactt gtgatgtagc aggaacttag c tgatcatgg ggaggtgccg cacacaccgg atgttcggat ctggacttgt actatgggaa cacgaagagg ttcaacctta cagtcgctac aaggcaagtg gctgagcgcc c caaagagt c gtcttaagtt gtat taccta attatttatt c ttac gatac atttctttag ccgaacgga t gtcagatcca cctaaatagc cacaattcca agtgagctaa gtcgtgccag gcgctcttcc ggtatcagct aaagaacatg ggcgtttttc ,cggccagtga attgtaatac tcttttcttt ttgggtctct.

aacggcatac .ccggagtata tgaacacgtc atctgcagta caactgcaac atagggaatt gcctttcgga gactgtagag gagacgacgg .tcgccgtggt ttggactcat agcgaactga tgaagcgaaa attatatgca aacatgtaga ctttcgaggc cctccattcc atcaccatca aagatc tggt ggtcgctacc taatttttgt tttgagactg attaccaagt tgaaatttaa aattagtatc ctagtaatac t ttcgtagac atcactagcc ttggcgtaat cacaacatac ctcacattaa ctgcattaat gcttcctcgc cac tcaaagg tgagcaaaag cataggctcc tgctctcgtt aatagaggcg gctaagcgaa aagtgcaagt tactgaaatc gggaattcac gagagcgaga gaactccttt gaacgcagac ccgcgctctc tcccgagatc tacaaacttc acccacccca c tc tgaaaac aagggc agcc actgtccagc tgtcgactca ggaggaaagc tccaaaaccg attaccagtt tcatcaa tgg ataagaatgt cttaatttag agtcaacttg taatatacat attttaatta cctttcgatc caacgcgttg catggtcata gagccggaag ttgcgttgcg gaatcggcca tcactgactc cggtaatacg gccagcaaaa gcccccctga gactcactat ccctctctgC ggttcgagag cttcgtctac agctaagcaa.

taaagtgaat tgccaagaag tagtgattca ttttgggcca tccagctcca cggccacagc acggtgctgt gaccgacgga ctgaacgagt agcaaatcgg gatgacccga agcagagcaa ctgaaaggaa gacgctggag cgagctggcc acggatgatt ggtctggtgt.

gttataacat ttcgatcgaa caaaaatgtt tcatttaatg gggttcattc tattcggctt tcataatggc gatgcatagc gctgtttcct cataaagtgt ctcactgccc acgcgcgggg gctgcgctcg gt tatccaca ggccaggaac cgagcatcac agggcgaatt actaatgctc agcgcgcctc ggagcgacaa ataaacaagc caattaaaag taattattga.

tccgtcggtt gctcggcttt.

gcgtctgaat gcttcctcct tgctcggtca aatacagtga ttgagctacg cagtggtccc acattcggcg acacgatacg aaacaacgca ctggaaaagg caaaatctcg cactagaagg cggggatccg atgggttata.

-tattccatag attgcttata tcttgtagac tacattctat tgatgatttt tcattttatt ttgagtattc gtgtgaaatt aaagcc tggg gctttccagt agaggcggtt gtcgttcggc gaatcagggg cgtaaaaagg aaaaatcgac ggccgttatt tctcactctg 120 gaatgttcgc 180 ttcaattcaa 240 .gcagctgaac 300 taaccagcaa 360 atacaagaag 420 ttggaaccag 480 cctcctgatg 540 cgaattcatg 600 ccggaactga 660 ggtgttgctg 720 ttcggggaga 780 cttgctcaat 840 tcagtacatg 900 cccgaggagc 960 aagttttcat. 1020 gcagtttttc 1080 agttcctcta 1140 ctctctccga 1200 cctaattcca 1260 ,tcgactaagg 1320 ttataagttt 1380 -aacaacaata 1440 -gaaaaaataa 1500 ttttgaaagt 1560 attagtgatg 1620 ctgatttttt 1680 gcgatggacg 1740 tatagtgtca 1800 gttatccgct 1860 gtgcctaatg 1920 cgggaaacct 1980 tgcgtattgg 2040 tgcggcgagc 2100 ataacgcagg 2160 ccgcgttgct. 2220 gctcaagtca 2280 WO 01/48224 ~VO 0148224PCT/AUOO/01 596 gaggtggcga. aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct 2340 cgtgcgctct gggaagcgtg tcgc tccaag cggtaactat cac tggtaac gtggcctaac agttaccttc cggtggtttt tcctttgatc tttggtcatg ttttaaatca cagtgaggca cgtcgtgtag accgcgagac ggccgagcgc tacaggcatc *acgatcaagg tcctccgatc actgcataat ctcaaccaag aatacgggat ttcttcgggg cactcgtgca.

aaaaacagga.

actcatactc cggatacata ccgaaaagtg *cgcatcaggc aatcagc tca atagaccgag cgtggactcc accatcaccc taaagggagc *agggaagaaa cgtaaccacc aggctgcgca gcgaaagggg cctgttccga gcgctttctc ctgggctgtg cgtcttgagt aggattagca tacggctaca ggaaaaagag tttgtttgca ttttctacgg agattatcaa atctaaagta cctatctcag ataactacga ccacgctcac agaagtggtc agagtaagta gtggtgtcac cgagttacat gttgtcagaa tctcttactg tcattctgag aataccgcgc cgaaaactct cccaactgat aggcaaaatg ttcctttttC tttgaatgta.

ccacctgtat gaaattgtaa ttttttaacc atagggttga aacgtcaaag aaatcaagtt ccccgattta gcgaaaggag acacccgccg actgttggga gatgtgctgc ccctgccgct atagctcacg tgcacgaacc ccaacccggt gagcgaggta ctagaaggac ttggtagctc agcagcagat ggtctgacgc *aaaggatctt tatatgagta cgatctgtct tacgggaggg cggctccaga.

ctgcaacttt gttcgccagt gctcgtcgtt gatcccc cat gtaagttggc tcatgccatc aatagtgtat cacatagcag caaggatctt cttcagcatc ccgcaaaaaa aatattattg tttagaaaaa.

gcggtgtgaa.

acgttaatat aa taggccga gtgttgttcc ggcgaaaaac ttttgcggtc gagcttgacg cgggcgctag cgcttaatgc taccggatac ctgtaggtat cccc gt tcag aagacacgac tgtaggcggt agtatttggt ttgatccggc .tacgcgcaga tcagtggaac cacc tagatc aacttggtct atttcgttca cttaccatct.

tttatcagca atccgcctcc taatagtttg:, tggtatggct gt tgtgcaaa.

cgcagtgtta cgtaagatgc.

gcggcgaccg' aactttaaaa accgctgttg ttttactttc gggaataagg aagcatttat taaacaaata ataccgcaca tttgttaaaa aatcggcaaa agtttggaac cgtctatcag gaggtgccgt, gggaaagccg ggcgctggca.

gccgctacag ctgtccgcct ctcagttcgg cccgaccgct t tatcgccac gctacagagt atctgcgctc aaacaaacca.

aaaaaaggat gaaaactcac cLttttaaat t gacagttacc tccatagttg ttctcccttc tgtaggtcgt gcgcct tatc Lggcagcagc tcttgaagtg tgctgaagcc ccgctggtag ctcaagaaga gttaagggat aaaaatgaag aatgcttaat cctgactccc ggccccagtg. ctgcaatgat ataaaccagc .cagccggaag atccagtcta Ittaattgttg cgcaacgttg :,ttggcattgc tcattcagct aaagcggtta tcactcatgg ttttctgtga.

agttgctctt gtgctcatca agatccagtt accagcgt tt gcgacacgga.

cagggttatt ggggttccgc gatgcgtaag ttcgcgttaa.

atcccttata aagagtccac* ,ggcgatggcc-.

aaagctctaa.

gcgaacgtgg agtgtagcgg ggcgcgtcca.

cttcgctatt cgccagggtt ccggttccca gctccttcgg ttatggcagc ctggtgagta.

gcccggcgtc ttggaaaacg cgatgtaacc ctgggtgagc aatgttgaat gtctcatgag gcacatttcc gagaaaatac atatttgtta.

aatcaaaaga tat Laaagaa cactacgtga a tcggaaccc cgagaaagga.

tcacgctgcg ttcgccattc acgccagctg ttcccagtca 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4626 agggcgatcg gtgcgggcct aaggcgatta agttgggtaa <210> <211> <212> <213> <220> 7713

DNA

Artificial Sequence WO 01/48224 WO 0148224PCT/AJOO/01596 <223> Description of Artificial Sequence :pBIT (CMV) -EGFP-zfBMP (DS) expression vector <400> c tcgaggagc ggc tcatgtc tcaattacgg gtaaatggcc tatgttccca cgctaaactg gacgtcaatg tttcctactt tggcagtaca cccattgacg cgtaacaact ataagcagag gacctccata gattagataa aaggtttaac ggcatgtaaa accatactca ctaaaagttt c acggcc tac aaggtttttc gttgcgtatt ctgatagtat gtgaaagtgg *agggcctgct gcctgtcctt tcagcctggg cgctagacga ccccccacga tgtttaccga atgataagat tttatttgtg caagt taaca gttttttaaa ctcgtcgtct agagcgcccg ggcggtaacc ctggcggacg cgtccatgcc gcttctcgtt gcagcacggg tgccgtcctc cggccatgat ttggcccatt caacattacc ggtcattagt cgcctggctg cccacttggc acggtaaatg ggcagtacat tcaatgggcg tcaatgggag ccgccccatt ctcgtttagt gaagacaccg aagtaaagtg aacccgtaaa aaa taagc gg cttttgccct tagatgtgct agaaaaacag actagagaat ggaagatcaa gccgccatta c ttattcggc gtccgcgtac .cgatctcccg.

tctccccgcg ggacgagctc tttcgatctg ctccgccccc tgcccttgga' acat tgatga aaatttgtga acaacaattg gcaagtaaaaggccggacca ccgccgaggc ggcctcttca ggaagtatca gagagtgatc ggggtctttg gccgtcgccg gatgttgtgg atagacgttg gcatacgttg gccatgttga tcatagccca accgcccaac aatagggac t .agtacatcaa gcccgcctgg ctacgtatta tggatagcgg tttgttttgg gacgcaaatg gaaccgtcag ggaccgatcc attaacagcg ctcgcccaga gctttgctcg t tagaagggg ttactaagtc tatgaaactc gcattatatg gagcatcaag ttacgacaag cttgaattga agccqcgcgc gacgacgacg ggacacacgc cac ttagacg gacatgttgg tacggcgctc attgacgagt.

gtttggacaa.

tgctat tgct cattcatttt cctctacaaa cgctatctgt* aagactcggg tcgggaatgc gc tcgaccaa ccggcggcgg ctcagggcgg atgggggtgt cggatc ttga tggctgttgt tatccatatc cattgattat tatatggagt gacccccgcc ttccattgac gtgtatcata cattatgccc gtcatcgcta tttgactcac ataatatgta tgac tagtta tccgcgttac .cattgacgtc.

gtcaatgggt.

tgccaagtac agtacatgac ttaccatggt ggggatttcc catttatatt ttaatagtaa ataacttacg aataatgacg ggagtattta gccccctatt cttatgggac gatgcggttt aagtctccac caccaaaat-c.,aacgggactt tccaaaatgt 600 ggcggtaggc gtgtacggtg. ggaggtc tat 660 atcgcctgga agcctccgcg cattagagct agctaggtgt acgccttagc aaagc tggca atcgcgatgg tcgaaaatca cactcagcgc tcgctaaaga ctatcgaatt tcata tgcgg gtacgaaaaa cccccgaaga gcagactgtc gcgaggacgt: gacgccatcc. sacgctgtttt 720 gccccgaatt gcttaatgag agagcagect cat tgagatg agatttttta agcaaaagta attagccttt tgtggggcat agaaagggaa.

atttgatcac attagaaaaa caattacggg ggcggggc tg gacggccccc catatgtcta gtcggaatcg acattgtatt ttagataggc cgtaataacg catttaggta t tatgccaac tttactttag acacctacta caaggtgcag caacttaaat tctaccatcg gcggctccgc ccgaccgatg 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 ggcgatggcg,7catgcc~gacg 1620 gggacgggga.:ttccccgggt .ccgggattta 1680 tggatatggc: cgacttcgag acggtgggta ~gggggcgcga accacaacta ttatttgtaa atgtt tcagg -tgtggtatgg gcaaggtccc cggcgccctg gcgcgacctt gcttgatatc tcacgaactc actgggtgct tctgctggta agttcacctt agttgtactc gaatgcagtg ccattataag ttcaggggga ctgattatga cggacgcgcg cccgtcccac cagcatcgcc gaattcttac cagcaggacc caggtagtgg gtggtcggcg gatgccgt tc cagcttgtgc .tttgagcaga ggatccagac aaaaaaatgc ctgcaataaa ggtgtgggag tcctgcaagc ctccatgagc caggtcaaca ggcatgtccc ttgtacagct atgtgatcgc ttgtcgggca agctgcacgc t tctgc ttgt cccaggatgt 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 WO 01/48224 WO 0148224PCT/AUOO/01596 tgccgtcctc cgaacttcac cctggacgta ggtagcggct cgggcagctt cctcgccctc gga tgggcac tagttctaga tcttctatgg acgagctctg agtcgagttt ctatcagtga agtgaaagtc.

cactccctat gagaaaagtg atataagcag ttgacctcca gtacccgggg ccggccacag cacggtgctg cgaccgacgg cc tgaacgag aagcaaa tcg cgatgacccg cagcagagca cctgaaagga .ccgatttgct *actcgttcag tccgtcggtc -~acagcaccgt gctgtggccg gagt ttgggg agggggcaaa accctcatga tattttcttt tttttaaatt ttcaaggcaa aattaaatga tattggtaga atatacactg ccatgttcat gtctcatcat ggctggtgtg aaattatggg tattttcatt gagggcaaat catatgctgg c ttgaagtcg ctcggcgcgg gccttcgggc gaagcac tgc gccggtggtg gccggacacg caccccggtg gcggccgcct aggtcaaaac cttatatagg accactccct tagagaaaag gagtttacca cagtgataga aaagtcgagc agctcgttta tagaagacac atcctctagt cgcttcctcc ttgctcggtc aaatacagtg tttgagctac gcagtggtcc aacattcggc aacacgatac aaaacaacgc tggggtgggt .gaagtttgta gatctcggga gagagcgcgg gtctgcgttc cgcgtgctag acccttgatt gttttcaggg taattttgtt tcattttctg cactttcgtt* tcagggtaat taaggtagaa aacaac taca tttgagatga gcct tc ttct tttggcaaag gccaatgccc gacatcatga gcaatagtgt catttaaaac ctgccatgaa atgcccttca gtcttgtagt atggcggact acgccgtagg cagatgaact ctgaacttgt aacagctcct gcaggaattc agcgtggatg tcgagtttac atcagtgata tgaaagtcga ctccctatca gaaaagtgaa tcggtacccg gtgaaccgtc cgggaccgat cagaattcat tccggaactg aggtgttgct attcggggag gcttgctcaa c tcagtacat gcccgaggag gaagttttca agcagttttt tttcgcttca tcagttcgct atgagtccaa accacggcga .ccgtcgtctc cgcggcctcg gttctttctt tgttgtttag tctttcactt taactttttt tatttgtcag tatattgtac tatttctgca tcctggtaat ggataaaata ttttcctaca aattcactcc tggctcacaa agc ccc ttga gtggg-aattt atcagaatga caaaggtggc gc tcgatgcg tgccgtcgtc tgaagaagtc tcagggtggt tcagggtcag ggccgtttac Cgcccttgct ggggccgcgg gcgtctccag cactccctat -gagaaaagtg gtttaccact gtgatagaga agtcgagttt gttcaccagg cttgaagaag gtgctgcttc cacgagggtg cttgccgtag gtcgccgtcc caccatccgc aggctggatc gcgatctgac cagtgataga aaagtcgagt ccctatcagt aaagtgaaag accactccct ggtcgagtag ,.gcgtgtacgg.

agatcgcctg gagacgccatccagcctccg cggccccgaa* gtgtcgccct atggtgcgct atgtggtcgg ggccagggca gtggcatcgc agctcgacca ggggatccac ggtcccggtg ggttcactaa gaaaagtgaa ttaccactcc gatagagaaa tcgagtttac atcagtgata tgggaggcct .vcacgc.tgtt *ttcgagctcg ggaacgcaga tccgcgctct ttcccgagat atacaaactt aacccacccc actctgaaaa aaagggcagc cac tgtccag ctgtcgactg cgtagctcaa tcactgtatt tgaccgagca aggaggaagc aattggatat 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 gaggaactta actgatcatg gggaggtgcc acacacaccg tatgttcgga gctggacttg cactatggga tcacgaagag cttcaacctt atccgaacat ccggtgtgtg cggcacctcc ccatgatcag ctaagttcct ggagacgacg gtcgccgtgg gttggactca gagcgaactg ttgaagcgaa tattatatgc aaacatgtag gctttcgagg acctccattc attgagcaag tctccccgaa cagcaacacc tcagttccgg.

catc tgcagc acgatatctc :tagaC,tgaga i&acttcagggt aatgggaaga tgtcccttgt'atcaccatgg tctactctgt cgttaaactt attgtaagta ttcagcacag tataaattct catcctgcct ctctgagtcc gctcctgggc tcaggtgcag ataccac tga gcatctgact tttgtgtctc gtatttggtt tataaagagg tgacaaccat-tgtctcctct 4680 tagcttgcat ctttctctaa -t tttagagaa ggctggcgtg ttctctttat aaaccgggcc aacgtgctgg gctgcctatc gatctttttc tctgggtaat tcac tcggaa tagagtttgg tcatcagtat .ttgtaacgaa tcactttttt caattgttat gaaatattct ggttacaatg cctctgctaa ttgttgtgct agaaggtggt cctctgccaa aaaggaaatt ggacatatgg caacatatgc atgaaacagc 4740 4800 4860 .4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 WO 01/48224 WO 0148224PCT/AUOO/01596 cccctgctgt tattttgttt tagccagatt ggagatccct tgggcgctct agcggtatca aggaaagaac gctggcgttt tcagaggtgg cctcgtgcgc ;.ttcgggaagc cgttcgctcc atccggtaac agccactggt gtggtggcct gccagttacc tagcggtgg t .agatcctttg gattttggtc aagttttaaa.

aatcagtgag ccccgtcgtg gataccgcga aagggccgag ttgccgggaa tgctacaggc ccaacgatca cggtcc tccg agcactgcat gtactcaacc gtcaatacgg acgt tcttcg acccactcgtagcaaaaaca aatactcata gagcggatac tccccgaaaa aaataggcgt ccattcctta tgtgttattt tttcCtcctc cgactgcatt tccgcttcct gctcactcaa atgtgagcaa ttccataggc cgaaacccga tctcctgttc gtggcgcttt aagctgggct tatcgtcttg aacaggatta aactacggct ttcggaaaaa.

ttttttgttt atcttttcta atgagattat tcaatctaaa gcacctatct tagataacta gacccacgct cgcagaagtg gctagagtaa.

atcgtggtgt aggcgagtta atcgttgtca aattctctta aagtcattct gataataccg gggcgaaaac gcacccaact ggaaggcaaa.

ctcttccttt .atatttgaat gtgccacctg atcacgaggc ttccatagaa ttttctttaa tcctgactac aatgaatcgg cgctcactga aggcggtaat aaggccagca tccgcccccc caggac tata cgaccc tgcc -ctcaatgc tc gtgtgcacga agtccaaCc gcagagcgag acactagaag gagttggtag gcaagcagca.

cggggtctga caaaaaggat gtatatatga cagcgatctg cgatacggga caccggctcc g Lcc tgcaac: gtagttcgcc cacgctcgtc catgatcccc gaagtaagtt ctgtcatgcc gagaatagtg cgccacatag tctcaaggat gatcttcagc atgccgcaaa ttcaatatta gtatttagaa acgtctaaga cctttcgtct aagccttgac ttgaggttag atttttttta 5520 catccctaaa attttcctta catgttttac 5580 tcccagtcat agctgtccct cttctcttat 5640 ccaacgcgcg gggagaggcg gtttgcgtat 5700 ctcgctgcgc tcggtcgttc ggctgcggcg 5760 acggttatcc acagaatcag gggataacgc 5820 aaaggccagg aaccgtaaaa aggccgcgtt 5880 tgacgagcat cacaaaaatc gacgctcaag 5940 aagataccag gcgtttcccc ctggaagctc 6000 gcttaccgga tacctgtccg cctttctccc 6060 acgctgtagg tatctcagtt cggtgtaggt 6120 accccccgtt cagcccgacc gctgcgcctt 6180 ggtaagacac gacttatcgc cactggcagc 6240 gtatgtaggc ggtgctacag agttcttgaa 6300 gacagtatt~t ggtatctgcg ctctgctgaa 6360 ctcttgatcc ggcaaacaaa .ccaccgctgg 6420 gattacgcgc,-agaaaaaaag gatctcaaga 6480 cgctcagtgg aacgaaaact cacgttaagg 6540 cttcacctag atccttttaa attaaaaatg 6600 gtaaacttgg tctgacagtt accaatgctt 6660 tctatttcgt tcatccatag ttgcctgact 6720 gggcttacca tctggcccca gtgctgcaat 6780 agatttatca gcaataaacc agccagccgg 6840 tttatccgcc tccatccagt ctattaattg 6900 agttaatagt ttgcgcaacg ttgttgccat 6960 gtttggtatg gcttcattca gctccggttc 7020 catgttgtgc aaaaaagcgg ttagctcctt 7080 ggccgcagtg ttatcactca tggttatggc 7140 atccgtaaga tgcttttctg tgactggtga 7200 tatgcggcga ccgagttgct cttgcccggc 7260 cagaacttta aaagtgctca tcattggaaa 7320 cttaccgctg ;ttgagatcca gttcgatgta aaagggaata :..agggcgacac. ggaaatgttg ttgaagcatt tatcagggtt-attgtctcat aaataaacaa .ataggggttc cgcgcacatt aaccattatt atcatgacat taacctataa tca 7380 7440 7500 7560 7620 7680 7713 <210> 31 <211> 28 <212> DNA <213> Artificial Sequence <22 0> <223> Description of Artificial Sequence:Dmhsp Forward Primer WO 01/48224 WO 0148224PCT/AUOO/O1 596 <400> 31 gaattcctag aatcccaaaa caaactgg 28 <210> 32 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Dmhst. Reverse Primer <400> 32 ggatcctgac cgtccatcgc aataaaatga gcc 33 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Goosecoid Forward Primer <400> 33 ggagacaggc agtcccggta gatc 24 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Goosecoid Reverse Primer <400> 34 tgggaattgt cccactctct gctc 24 <210> <211> 5318 <212> DNA <213> Artificial Sequence WO 01/48224 WO 0148224PCT/AUOO/0I 596 <220> <223> Description of Artificial Sequence:Goosecoid Promoter <400> tagttattac acaggcagtc .ggaaggcacc.

gcgggaagcc, tggctgaatt acccagagtg cgcgtttcta ttttgggaaa.

tagggggttg cctcatttct ttagccacaa gggtcggggc.

aagattaacc.

cgaatggaaa tggcccccct cctccccatt tctgcatatt ggttgagccg gggaggagag gcgctcgccc *ccaaatcact.

accatggtga gacggcgacg tacggcaagc *accctcgtga aagcagcacg .ttcttcaagg c tggtgaacc cacaagctgg aacggcatca; gccgaccact cactacctga gtcctgctgg taaagcggccctttaaaaaa ttgttaactt tcacaaa taa tatcttaagg taaatcagct gaatagaccg aacgtggact gaaccatcac tagcgc taco coggtagatc ccttctccca tctggaagca tgctcttcacaccgctttaa gagacggagg gctgcggggg taaaagcaaa -tgaatttgag.

ggagaggtcg tgggcaatta gattaggtta cctcttggca coacaccacc accaggaact gtcggagctg ggcgggagga gcgctc tctt agtgaattct gcaagggcga taaacggcca tgaccctgaa ccaccctgac acttcttcaa acgacggcaa gcatcgagct agtacaac ta aggtgaactt ggactcagat ccacgagaat gactaataat 'tcgcttcaga tggtgtgtta gaagaagaag ttttgctctg ggggggtgga gggggcactt cagat tccga ctacaaccat gcggcggagt ggccgcccgc atttoattaa tctctccccc caaaggaaaa aaatccagga cgtcctaccc gggagttcgg tcqgtttgct gcagtcgacg ggagctgttc caagttcagc gttcatctgc ctacggcgtg gtccgccatg ctacaagacc gaagggcatc caacagccac caagatccgc ctogagctca agcttcgaat tcgattggag taaagccaaa aaaatttttt ttgggggggg caaaaataca cagaacctat cggcacccac gcgctcctct gggtggtgaa ttttaaagac ggagctaggg agagtcaggg tagttttcag aagaaaaaag acaacttgta cgaaggcgga agaaaatttg gctttcgcaa aaacaaaaga gaagtgaaat taggcagtga gttcacgggg tcagtcttag :ttgagggagg: acacagccac aagagagtaa aaagtagtcc..taaagtaaaa aggaaaccgc.accccataa't tgttaacggc *ccagcaaggc t tctcaatcc tcccctgcaa.

gaaaaggacc tgacgtcgac gcgggttgag acgcaggggg cgcccgcggg gtaccgcggg accggggtgg gtgtccggcg accaccggoa cagtgcttca ggcaggacaa cggggccgcg acaatctttt gcgcc cccc g aaatctggtt tcagtataaa ttcagctagg cggggagggg agcagagagt cccgggatcc tgcccatcct agggcgaggg agctgcccgt gccgctaccc agagagaaaa tagtattaat ocggggctgc tcaggccctg cccaccccca ctgtttgtca accaacaaga cggcggcgag cgcgagttgc gggacaattc accggtcgcc ggtcgagctg cgatgccacc gccctggccc cgaccacatg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 cccgaaggct. acgtccagga. .gcgcaccatc cgcgccgagg2 -tgaagttcga. gggcgacacc gacttcaagg aggacggcaa *catcct.gggg aacgtctata tcatggccga accagcagaa-cacccccatc gcacccagtc cgccctgagc agt tcgtgac.-cgoogccggg gcgactctag atcataatca octoccacac ctccccctga gtttattgca gcttataatg agcatttttt tcactgcatt cgtaaattgt aagcgttaat cattttttaa. ccaataggcc agatagggtt gagtgttgtt ccaacgtcaa agggcgaaaa cctaatcaag ttttttgggg cacaacatcg ggcgacggcc aaagacccca at cacto tog gccataccac acctgaaaca gttacaaata ctagttgtgg attttgttaa gaaatcggca ccagtttgga accgtc tatc tcgaggtgcc aggacggcag ccgtgctgct acgagaagcg goatggacga atttgtagag taaaatgaat aagcaatagc tttgtccaaa.

aattcgcgtt aaatccctta acaagagtcc agggcgatgg gtaaagcac t caagcagaag cgtgcagctc gcccgacaac cgatcacatg gctgtacaag gttttacttg gcaattgttg atcacaaatt ctcatcaatg aaatttttgt taaatcaaaa actattaaag cccactacgt aaatcggaac WO 01/48224 WO 0148224PCT/AUOO/01596 cctaaaggga gcccccgatt tagagcttga gaagggaaga aagcgaaagg agcgggcgct cgcgtaacca ccacacccgc cgcgcttaat tttcggggaa atgtgcgcgg aacccctatt tatccgctca tgagacaata accctgataa cctgaggcgg aaagaaccag ctgtggaatg gctccccagc aggcagaagt atgcaaagca gaaagtcccc aggctcccca gcaggcagaa .caaccatagt cccgccccta actccgccca attctccgcc ccatggctga ctaatttttt cctctgagct attccagaag .tagtgaggag atcgatcaag agacaggatg. aggatcgttt ggttctccgg ccgcttgggt ggagaggcta ggctgctctg atgccgccgt gttccggctg aagaccgacc tgtccggtgc cctgaatgaa ctggccacga cgggcgttcc ttgcgcagct gactggctgc tattgggcga agtgccgggg gccgagaaag tatccatcat ggctgatgca *acctgcccat tcgaccacca agcgaaacat gccggtcttg .tcgatcagga tgatctggac ctgttcgcca ggctcaaggc gagcatgccc gatgcctgct tgccgaatat catggtggaa.

ggccggctgg gtgtggcgga ccgctatcag gaagagcttg gcggcgaatg ggctgaccgc gattcgcagc gcatcgcctt ctatcgcctt ggttcgaaat gaccgaccaa gcgacgccca ccgccttcta tgaaaggttg ggcttcggaa tccagcgcgg ggatctcatg ctggagttct cacggaagga gacaataccg gaaggaaccc *aaacgcacgg tgttgggtcg tttgttcata ctgtcgatac cccaccgaga ccccattggg caccccaccc cccaagttcg ggtgaaggcc *gccctgccat. agcctcaggt-tactcatata aatttaaaag gatctaggtg aagatccttt gtgagttttcgttccactga gcgtcagacc atcctttttt tctgcgcgta atctgctgct tggtttgttt gccggatcaa gagctaccaa gagcgcagat accaaatact gtccttctag *actctgtagc accgcctaca tacctcgctc, gtggcgataa gtcgtgtctt accgggttgg agcggtcggg ctgaacgggg ggttcgtgca ccgaactgag atacctacag cgtgagctat aggcggacag gtatccggta agcggcaggg cagggggaaa cgcctggtat ctttatagtc gtcgattttt gtgatgctcg tcaggggggc cctttttacg gttcctggcc ttttgctggc cccctgattc tgtggataac cgtattaccg cggggaaagc agggcgc tgg gcgccgctac tgtttatttt atgcttcaat tgtgtcagtt tgcatctcaa gtatgcaaag tcccgcccc t ttatttatgc gcttttttgg cgcatgattg ttcggctatg tcagcgcagg ctgcaagacg gtgctcgacg cagga-tctcc atgcggcggc cgcatcgagc gaagagcatc gacggcgagg aatggccgct gacatagcgt ttcctcgtgc cttgacgagt acctgccatc.

tcgttttccg tc gcccaccc gcgctatgac aacgcggggt gccaatacgc cggcgaacgt caagtgtagc agggcgcgtc tctaaataca aatattgaaa agggtgtgga ttagtcagca catgcatctc aactccgccc agaggcc gag aggcc taggc aacaagatgg actgggcaca ggcgCccggt ggcgagaaag ggtcacgctg aggtggcact ttcaaatatg aaggaagagt aagtccccag accaggtgtg aattagtcag agttccgccc gccgcctcgg ttttgcaaag attgcacgca acagacaatc tcttttitgtc aggcagcgcg-gctatcgtgg t tgtcactga 'agcgggaagg tgtcatctca ~cettgctcct 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 tgcatacgct gagcacgtac aggggctcgc atctcgtcgt tttctggatt tggctacccg tttacggtat tcttctgagc acgagatttc ggacgccggc tagggggagg ggcaataaaa tcggtcccag tgatccggct tcggatggaa gccagccgaa gacccatggc catcgactgt tgatattgct cgccgctccc gggactctgg gattccaccg tggatgatcc ctaactgaaa agacagaata ggctggcact ccgcgtttct tccttttccc 4380 cagggctcgc agccaacgtc ggggcggcag ttgata-atct ,catgaccaaa *atcccttaac ccgtagaaaatgcaaacaaa ctctttttcc tgtagccgta .tgctaatcc t actcaagacg cacagcccag gagaaagcgc tcggaacagg ctgtcgggtt ggagcctatg cttttgctca ccatgcat gatcaaaggaaaaaccaccg gaaggtaact gttaggccac gttaccagtg atagttaccg cttggagcga cacgcttccc agagcgcacg tcgccacctc gaaaaacgcc catgttcttt tcttcttgag ctaccagcgg ggcttcagca cacttcaaga gctgctgcca gataaggcgc acgacc taca gaagggagaa agggagcttc tgac ttgagc agcaacgcgg cctgcgttat 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5318 WO 01/48224 WO 0148224PCT/AUOO/01596 <210> 36 <211> 3930 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Goosecoid cDNA in pTRE <400> 36 ctcgagttta tatcagtgat gtgaaagtcg actccctatc.

agaaaagtga ctcggtaccc agtgaaccgt ccgggaccga tcgacaacat gcgccgcggc gcggcacctc gcctcccggc tgcacgtgca cccagcagtg tgtctccggt agctgcagct ccgatgagca gcac tcggga ttaagaaccg: acgccgagaa g taaaagcga ctagaggatc cagtgaaaaa ataagctgca ggggaggtgt tatgatcctg gcgcgctcca cccaccaggt tcgccggcat caggagctaa cccaatggca' accagaccgt ttgggcgctc gagcggtatc caggaaagaa tgctggcgtt gtcagaggtg ccactcccta agagaaaagt agtttaccac agtgatagag aagtcgagtt gggtcgagta cagatcgcct tccagcctcc cctggccgcc tccggtggtc ctcggactac cgcggtcggc ggcggcgccc ctcctgcgtC gccgcaccag gctcaaccag gctcgaagcc gcagctggcc ccgagccaag gtggaacaag tttggactcg cagacatgat aatgctttat ataaacaagt -gggaggtttt caagcctcgt tgagcagagc .caacaggcgg gtcccctggC ggaagctaaa tcgtaaagaa tcagctgcat t tccgct tcc agctcactca catgtgagca t ttccatagg gcgaaacccg tcagtgatag gaaagtcgag tccctatcag aaaagtgaaa taccactccc ggcgtgtacg ggagacgcca gcggccccga cggccgcgct ttcccggctc ggcgccttct agctcccgcc gtgggcccgg ccgacgcccc atgctgccct ctgcactgtc ctggagaacc aggaaggtgc tggagacgac acgtcctcaa gacagctgag aagatacatt ttgtgaaatt taacaacaac .ttaaagcaag cgtctggccg gcccgccgcc taaccggcct ggacgggaag atggagaaaa cattttgagg taatgaatcg tcgctcactg aaggcggtaa aaaggccagc ctccgccccc acaggactat agaaaagtga aagtcgagtt taccactccc tttaccactc cctatcagtg atagagaaaa tgatagagaa aagtgaaagt cgagtttacc qtcgagttta ccactcccta-tcagtgatag tatcagtgat agagaaaagt .gaaagtcgag gtgggaggcc tatataagca ,gagctcg'tt tccacgctgt tttgacctcc atagaagaca attagcttat gcccgccagc atgttcagca gcaaagacgc ggtgctcccg gtggcgccca tacacgggga ctcgctctac ggcgccggcg acccgcgccc tgtggccccc ggaggcgcgg tgggctacaa cagctacttc tacgggcagc cttgctgcgg ggctgtgccg ccgctgggcg cagcctacca gggccccggt tctgtactgg acatgaacgt gggcacgctg tcgcgcactg ggcggaagcg gcggcaccgc accatcttca tcttccagga gacgaagtac ccagacgtgg accttcggga ggagaaggtg gaggtctggt.

agaagcgatc ctcctcggag gagtcagaaa .aagcctcgcc ggagaagagg gaagaggaag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 aattcctgca gcccggggga.tccactagtt 1260 gatgagtttg;gacaaaccac ;aactagaatg 1320 tgtgatgcta aattgcattc taaaacctct.

gaccacgcta gaggcaagac cttcatcggg tatcagctcg aaatcactgg catttcagtc gccaacgcgc actcgctgcg tacggttatc aaaaggccag c tgacgagca aaagatacca ttgctttatt tgtaacca-tt 1380 attttatgtt* acaaatgtgg tctgtgcaag tcgggcggcg aatgcgcgcg accaagcttg atataccacc agttgctcaa ggggagaggc ctcggtcgtt cacagaatca gaaccgtaaa tcacaaaaat ggcgtttccc tcaggttcag tatggctgat gtcc ccggac ccctgcccgt accttcagca gcgagatttt gttgatatat tgtacctata ggtttgcgta cggc tgcggc ggggataacg aaggccgcgt cgacgctcaa cctggaagct 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 WO 01/48224 WO 0148224PCT/AUOO/01 596 ccctcgtgcg ctctcctgtt cttcgggaag cgtggcgctt tcgttcgctc caagctgggc tatccggtaa ctatcgtctt cagccactgg taacaggatt agtggtggcc taactacggc agccagttac cttcggaaaa gtagcggtgg tttttttgtt aagatccttt gatcttttct .ggattttggt catgagatta gaagttttaa atcaatctaa *taatcagtga. ggcacctatc tccccgtcgt. gtagataact tgataccgcg agacccacgc gaagggccga .gcgcagaagt gttgccggga agctagagta *ttgctacagg-:catcgtggtg.

cccaacgatc aaggcgagtt tcggtcctcc gatcgttgtc cagcactgca taattctctt agtactcaac caagtcattc .cgtcaatacg ggataatacc aacgttcttc ggggcgaaaa aacccactcg tgcacccaac gagcaaaaac aggaaggcaa gaatactcat actcttcctt -tgagcggata catatttgaa ttccccgaaa agtgccacct aaaataggcg-tatcacgagg ccgaccctgc tctcaatgct tgtgtgcacg gagtccaacc agcagagcga tacactagaa agagttggta tgcaagcagc acggggtctg tcaaaaagga agtatatatg tcagcgatct acgatacggg tcaccggctc ggtcctgcaa agtagttcgc tcacgctcgt acatgatccc agaagtaagt actgtcatgc tgagaatagt gcgccacata c tctcaagga tgatcttcag aatgccgcaa tttcaatatt tgtatt taga gacgtctaag ccctttcgtc cgcttaccgg cacgctgtag aaccccccgt cggtaagaca ggtatgtagg ggacagtatt gctcttgatc agattacgcg acgctcagtg tcttcaccta agtaaacttg gtctatttcg agggcttacc cagatt tatc ctttatccgc cagttaatag cgtttggtat ccatgttgtg tggccgcagt catccgtaag gtatgcggcg gcagaacttt tcttaccgct catcttttac aaaagggaat attgaagcat aaaataaaca aaaccat tat atacctgtcc gtatc tcagt tcagcccgac cgacttatcg cggtgctaca tggtatc tgc cggcaaacaa cagaaaaaaa gaacgaaaac gatcctttta gtctgacagt ttcatccata atctggcccc agcaataaac ctccatccag: gcctttctcc tcggtgtagg cgc tgcgcctI ccactggcag gagttcttga gctctgctga accaccgctg ggatctcaag tcacgttaag aattaaaaat taccaa tgc t gttgcctgac agtgctgcaa cagccagccg tctattaatt 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 .3120 tttgcgcaac .gttgttgcca 3180 ggcttcattc.agctccggtt, 3240 caaaaaagcg gttatcactc atgcttttct accgagttgc aaaagtgctc gttgagatcc tttcaccagc aagggcgaca ttatcagggt aataggggtt tatcatgaca gttagctcct atggttatgg gtgactggtg tcttgcccgg atcattggaa agttcgatgt gtttctgggt cggaaatgtt tattgtctca ccgcgcacat ttaacctata 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3930 <210> 37 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Exon I Forward Primer (bp 296-316) <400> 37 ggttaagctt atgcccgcca gcatgttcag c <210> 38 <211> 36 <212> DNA <213> Artificial Sequence WO 01/48224 WO 0148224PCT/AUOO/01596 <220> <223> Description of Artificial Sequence:Exon 1 Reverse Primer (bp 631-650) <400> 38 gcggggccct cgtagcctgg gggcgtcggg acgcag 36 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:.Exon.2 Forward Primer (bp 1165-1183) <400> 39 cgagggcccc ggttctgtac t 21 <210> <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Exon 2 Reverse Primer (bp 1398-1418) <400> tttgagctcc accttctcct cccgaag 27 <210> 41 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Exon 3 Forward Primer <400> 41 gtctggttta agaaccgccg a 21 WO 01/48224 WO 0148224PCT/AUOO/01596 <210> 42 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Exon 3 Reverse Primer <400> 42 ggaattctca gctgtccgag tccaaatc <210> 43 <211> 3723 <212> DNA <213> Artificial Sequence <220> *<223> Description of Artificial Sequence: pCD91142 <400> 43 ggtaccgggc agcatcgaca cccagcgccg ggcggcggca gcgggcctcc cagc tgcacg ggcgcccagc ctggtgtctc actgagctgc ttcaccgatg gtgggcactc tggtttaaga gaaaacgccg *,gaaggtaaaa agttctagag caattcactg taatcgcctt cgatcgccct attttgttaa gaaatcggca ccagtttgga accgtctatc tcgaggtgcc cggggaaagc agggcgctgg gcgccgctac cccccctcga acatcctggc cggctccggt cctcctcgga cggccgcggt tgcaggcggc agtgctcc tg cggtgccgca agctgctcaa agcagc tcga gggagcagct accgccgagc agaagtggaa ggtcgacggt cgcccggccg ggtcttcccg ctacggcgcc cggcagc tcc gcccgtgggc cgtcccgacg ccagatgctg ccagc tgcac agccctggag ggccaggaag caagtggaga caagacgtcc atcgataagc cgctgcaaag gctctacacg ttctacccgc cgcc Lgggct .ccggcttgct cccccagcct ccctacatga tgtcggcgga ttatgcccgc acgcggtgct gggactcgc t gccctgtggc acaacagc ta gcggggc tgi accagggccc acgtgggcac agcggcggca aacctcttcc. aggagacgaa, gtgcaccttc. gggaggagaugcgatttgga .ctcggacagc cggccgccac cgcggtggag gccgtcgttt tacaacgtcg gcagcacatc tcccaacagt aattcgcgtt aaatccctta acaagagtcc agggcgatgg gtaaagcact cggcgaacgt caagtgtagc agggcgcgtc cccct ttcgc tgcgcagcct aaatttttgt taaatcaaaa actattaaag cccactacgt aaatcggaac ggcgagaaag ggtcacgctg aggtggcact cgacagaagc.

tcaaaagcc t tgagaattcc ctccaattcg tgactgggaa cagctggcgt gaatggcgaa taaatcagct gaatagaccg aacgtggact gaaccatcac cctaaaggga gaagggaaga cgcgtaacca ttLtcggggaa ga-tcctcctc cgccggagaa tgcagcccgg ccctatagtg aaccctggzg aatagcgaag tggaaattgt cattttttaa agatagggtt ccaacgtcaa cc taatcaag gcccccgatt aagcgaaagg ccacacccgc atgtgcgcgg cagcatgttC cccggtggcg ctacggcgcc ccccggaggc cttctacggg gccgccgc tg cggttctgta gctgtcgcgc ccgcaccatc gtacccagac ggtggaggtc ggaggagtca gagggaagag gggatccact agtcgtatta ttacccaact aggcccgcac aagcgttaat ccaataggcc gagtgttgtt agggcgaaaa ttttttgggg tagagc ttga agcgggcgct cgcgcttaat aacccc tatt 120 180 240 300 360 420 480 540 600 .660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 WO 01/48224 WO 0148224PCT/AUOO/01 596 tgtttatttt tctaaataca atgcttcaat aatattgaaa attccctttt ttgcggcatt gtaaaagatg ctgaagatca agcggtaaga tccttgagag aaagttctgc tatgtggcgc cgccgcatac actattctca cttacggatg gcatgacagt actgcggcca acttacttct cacaacatgg gggatcatgt *.ataccaaacg acgagcgtgactattaactg gcgaactact gcggataaag ttgcaggacc gataaatctg gagccggtga ggtaagccct cccgtatcgt cgaaatagac agatcgctga .caagtttact .catatatact taggtgaaga tcctttttga cactgagcgt-cagaccccgt *cgcgtaatct gctgcttgca gatcaagagc taccaactct aatactgtcc ttctagtgta cctacatacc tcgctctgct tgtcttaccg ggttggactc acggggggtt cgtgcacaca ctacagcgtg agctatgaga ccggtaagcg gcagggtcgg tggtatcttt atagtcctgt tgctcgtcag gggggcggag ctggcctttt gctggccttt gataaccgta ttaccgcctt cgcagcgagt cagtgagcga gcgcgttggc ~cgattcatta agtgagcgca acgcaattaa ttcaaatatg aaggaagagt Ltgccttcct gttgggtgca ttttcgcccc ggtattatcc gaatgacttg aagagaatta gacaacgatc aactcgcctt caccacgatg tactctagct acttctgcgc gcgtgggtct agttatctac gataggtgcc ttagattgat taatc tca tg agaaaagatc aacaaaaaaa t tttccgaag gccgtagtta aatcctgtta aagacgatag gcccagc ttg aagcgccacg aacaggagag cgggtttcgc cctatggaaa tgctcacatg tgagtgagct ggaagcggaa.

atgcagctgg tgtgagttag tatccgctca atgagtattc gtttttgctc cgagtgggtt gaagaacgtt cgtattgacg gttgagtact tgcagtgctg ggaggaccga gatcgttggg cctgtagcaa tcccggcaac tcggcCcttc cgcggtatca acgacgggga tcactgatta.

ttaaaac-ttc accaaaatcc aaaggatctt ccaccgctac gtaactggct ggccaccact ccagtggctg ttaccggata gagcgaacga cttcccgaag cgcacgaggg cacctctgac aacgccagca ttctttcctg gataccgctc gagcgcccaa cacgacaggt tgagacaata accctgataa aacatttccg tgtcgccctt acccagaaac gctg'gtgaaa acatcgaact ggatctcaac ttccaatgat gagcactttt ccgggcaaga gcaactcggt caccagtcac agaaaagcat ccataaccat gagtgataac aggagctaac .cgcttttttg aaccggagct gaatgaagcc tggcaacaac gttgcgcaaa aattaataga ctggatggag cggctggctg gtttattgct ttgcagcact ggggccagat .gtcaggcaac tatggatgaa agcattggta -actgtcagac .atttttaatt ±taaaaggatc cttaacgtga gttttcgttC cttgagatcc tttttttctg cagcggtggt ttgtttgccg tcagcagagc gcagatacca tcaagaacftc tgtagcaccg ctgccagtgg cgataagtcg aggcgcagcg gtcgggctga cctacaccga actgagatac ggagaaaggc ggacaggtat agcttccagg gggaaacgcc ttgagcgtcg atttttgtga.

acgcggcctt tttacggttc cgttatcccc tgattctgtg gccgcagccg aacgaccgag 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 tacgcaaacc:'.gcctctcccc 3.480 ttcccgactggaaagcgggc 35'40 tttatgcttc. cggctcgtat-gttgtgtgga aacagctat'g accatgatta cgccaagctc ctg ctcactcatt:*aggcacccca -ggctttacac attgtgagcg gataacaatt- tcacacagga.

gaaattaacc ctcactaaag ggaacaaaag 3600 3660 3720 3723 <210> 44 <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Primer Sequence:gsc F4 Forward WO 01/48224 WO 0148224PCT/AUOO/01596 <400> 44 ttaagcttgc caccatgccc gccagcatgt <210> <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:gsc R4 Reverse Primer <400> ttggatccgc gctgtccgag tccaaatc <210> 46 <211> 5436 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: pSFM6 <400> 46 tagttattaa cgttacataa gacgtcaata atgggtggag aagtacgccc 'catgacctta catggtgatg atttccaagt ggactttcca ccggactcag aacatcc tgg gcggc tccgg acc tcc tcgg ccggccgcgg gtgcaggcgg cagtgctcct ccggtgccgc 'cagctgctca gagcagctcg cgggagcagc aaccgccgag tagtaatcaa ct tacggtaa atgacgtatg tatttacggt cctattgacg tgggactttc cggttttggc ctccacccca aaatgtcgta gtctatataaatctcgagct ccgcccggcc tggtcttccc actacggcgc tcggcagctc cgcccgtggg gcgtcccgac ac caga tgc t accagc tgca aagccctgga tggccaggaa ccaagtggag ttacggggtc atggcccgcc ttcccatagt aaactgccca tcaatgacgg ctacttggca agtacatcaa ttgacgtcaa acaactccgc gcagagctgg caagcttgcc gcgctgcaaa ggctctacac cttctacccg ccgcctgggc cccggcttgc gcccccagcc gccctacatg ctgtcggcgg gaacctcttc ggtgcacctt acgacagaag attagttcat agcccatata tggagttccg tggctgaccg cccaacgacc cccgcccatt aacgccaata gggactttcc attgacgtca cttggcagta catcaagtgt atcatatgcc taaatggccc gcctggcatt atgcccagta gtacatctac .gtattagtca ,tcgctattac tgggcgtgga t-agcggtttg .actcacgggg tgggagtttg Sttttggcacc cccattgacg-caaatgggcg tttagtgaac.

accatgcccg gacgcggtgc ggggac tcgc cgccctgtgg tacaacagct tgcggggctg taccagggcc aacgtgggca aagcggcggc caggagacga cgggaggaga cgatcctcct cgtcagatcc ccagcatgtt tcccggtggc tctacggcgc cccccggagg acttctacgg tgccgccgct ccggttctgt cgctgtcgcg accgcaccat agtacccaga aggtggaggt cggaggagtc aaaatcaacg gtaggcgtgt gctagcgcta cagcatcgac gcccagcgcc cggcggcggc cgcgggcctc gcagctgcac gggcgcccag actggtgtct cactgagctg cttcaccgat cgtgggcact ctggtttaag agaaaacgcc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 WO 01/48224 WO 0148224PCT/AUOO/01596 gagaagtgga agcgatttgg aacgtcatca gagttcgaga ctgaaggtga cagtacggct tccttccccg accg tgac cc ggcgtgaact tccaccgagc aagctgaagg cccgtgcagc gaggactaca tagcggccgc ttaaaaaacc gttaacttgt acaaataaag tcttaaggcg aat cagc tca .atagaccgag cgtggactcc accatcaccc taaagggagc agggaagaaa cgtaaccacc tcggggaaat tccgctcatg tgaggcggaa tccccagcag -aagtccccag accatagtcc tctccgcccc tctgagctat cgatcaagag ttctccggcc ctgctctgat gaccgacctg ggccacgacg ctggctgcta cgagaaagta ctgcccattc cggtcttgtc gttcgccagg tgcctgcttg ccggctgggt agagcttggc ttcgcagcgc ttcgaaatga acaagacgtc actcggacag aggagttcat tcgagggcga ccaagggcgg ccaaggtgta agggcttcaa aagactcctc tcccctccga gcctgtaccc acggcggcca tgcccggcta.

ccatcgtgga gactctagat tcccacacct ttattgcagc catttttttc taaattgtaa ttttttaacc atagggttga aacgtcaaag taatcaagtt ccccgattta gcgaaaggag acacccgccg gtgcgcggaa agacaataac agaaccagct gcagaagtat gctccccagc.

cgcccctaac atggctgact tccagaagta acaggatgag gcttgggtgg.

gccgccgtgt tccggtgccc *ggcgttcctt ttgggcgaag tccatcatgg gaccaccaag gatcaggatg ctcaaggcga ccgaatatca gtggcggacc ggcgaatggg atcgccttct ccgaccaagc ctcaaaagc cgcggatcca gcgcttcaag gggcgagggc ccc cc tgccc cgtgaagcac gtgggagcgc cctgcaggac cggccccgta ccgcgacggc ctacctggtg ctactacgtg gcagtacgag cataatcagc ccccctgaac ttataatggt actgcattcE gcgttaatat aataggccga gtgttgttcc ggcgaaaaac ttttggggtc gagcttgacg cgggcgctag cgcttaatgc cccctatttg cctgataaat, gtggaatgtg gcaaagcatg aggcagaagt tccgcccatc aatttttttt gtgaggaggc gatcgtttcg agaggctatt tccggctgtc tgaatgaact gcgcagctgt tgccggggca ctgatgcaat cgaaacatcg atctggacga gcatgcccga tggtggaaaa gctatcagga ctgaccgc tt atcgccttct gacgcccaac tcgccggaga ccggtcgcca gtgcgcatgg cgcccctacg ttcgcctggg cccgccgaca gtgatgaac t ggctgcttca atgcagaaga gtgctgaagg gagttcaagt gactccaagc cgcaccgagg cataccacat c tgaaac at a tacaaataaa agttgtggtt tttgttaaaa aatcggcaaa.

agtt tggaac cgtctatcag gaggtgccgt gggaaagccg ggcgctggca gccgctacag tttatttttc gcttcaataa tgtcagttag ca tc tcaat t atgcaaagca ccgcccctaa agagggaaga ccatggtgcg agggcaccgt agggccacaa acatcctgtc tccccgacta tcgaggacgg tctacaaggt agaccatggg gcgagatcca ccatctacat tggacatcac gccgc cacca ttgtagaggt ggaaggtaaa ctcctccaag gaacggccac caccgtgaag cccccagttc caagaagctg cggcgtggtg gaagttcatc ctgggaggcc caaggccctg ggccaagaag ctcccacaac cctgttcctg tttacttgct gcaatagcat. .cacaaatttc tgtccaaact :,catcaatgta 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 ttcgcgttaa atcettata aagagtccac ggcgatggcc aaagcac taa gcgaacgtgg agtgtagcgg ggcgcgtcag taaatacatt tat tgaaaaa ggtgtggaaa agtcagcaac tgcatctcaa ctccgcccag atttttgtta aatcaaaaga tattaaagaa cactacgtga atcggaaccc cgagaaagga tcacgctgcg gtggcacttt caaatatgta ggaagagtcc gtccccaggc caggtgtgga ttagtcagca t tc cgccca t atttatgcag.:aggccgaggc .cgcc,tcggcc 3 240 ttttttggag: gcctaggctt .ttgcaaagat 3300 catgat tgaa cggc tatgac agcgcagggg gcaagacgag gctcgacgtt ggatctcctg gcggcggctg catcgagcga agagcatcag cggcgaggat tggccgc ttt catagcgttg cctcgtgctt tgacgagttc ctgccatcac caagatggattrtgcacgcagg 3360 tgggcacaac cgcccggttc gcagcgcggc gtcactgaag tcatctcacc catacgcttg gcacgtac tc gggc tcgcgc ctcgtcgtga tctggattca gctacccgtg tacggtatcg ttctgagcgg gagatttcga agacaatcgg tttttgtcaa tatcgtggct cgggaaggga ttgctcctgc atccggctac ggatggaagc cagccgaact cccatggcga tcgactgtgg atattgctga ccgctcccga gactctgggg ttccaccgcc 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 WO 01/48224 WO 0148224PCT/AUOO/01596 gccttctatg cagcgcgggg cggaaggaga acgcacggtg gtcgataccc ccccaccccc cc tgccat ag tttaaaagga gagttttcgt cctttttttc .gtttgtttgc gcgcagatac tctgtagcac ggcgataagt cggtcgggct gaactgagat.

gcggacaggt cgatttttgt, tttttacggt cc tgattc tg aaaggttggg atctcatgct caatac cgga ttgggtcgtt caccgagacc caagttcggg cctcaggtta tctaggtgaa -tccac tgagc Lgcgcgtaat cggatcaaga caaatactgt cgcc tacata cgtgtcttac gaacgggggg acctacagcg atccggtaag cctggtatct gatgctcgtc tcctggcctt tggataaccg cttcggaatc gttttccggg ggagttcttc gcccacccta aggaacccgc gctatgacgg tgttcataaa cgcggggttc ccattggggc caatacgccc tgaaggccca gggctcgcag ctcatatata ctttagattg gatccttttt. gataatctca gtcagacccc gtagaaaaga ctgctgcttg. caaacaaaaa gctaccaact ctttttccga ccttctagtg tagccgtagt cctcgctctg ctaatcctgt.

cgggttggac tcaagacgat ttcgtgcaca cagcccagct tgagctatga. gaaagcgcca cggcagggtc ggaacaggag ttatagtcct gtcgggtttc aggggggcgg agcctatgga ttgctggcct tttgctcaca tattaccgcc atgcat acgccggc tg gggggaggct caataaaaag ggtcccaggg gcgtttcttc ccaacgtcgg atttaaaact.

tgaccaaaat tcaaaggatc aaccaccgct.

aggtaactgg t aggccac ca taccagtggc agttaccgga ;tggagcgaac gatgatcctc aactgaaaca acagaataaa ctggcactct cttttcccca ggcggcaggc tcatttttaa cccttaacgt.

ttcttgagat accagcggtg cttc agcaga cttcaagaac tgctgccagt taaggcgcag gacctacacc 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5436 *cgcttcccga. .agggagaaag agcgcacgag ggagcttcca gccacctctg acttgagcgt aaaacgccag caacgcggcc tgttctttcc tgcgttatcc <210> 47 <211> 5604 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Description of Artificial SequencepSFM7 <400> 47 tagttattac acaggcagtc .ggaaggcacc, *gcgggaagcc tggctgaatt acccagagtg cgcgtttcta t tt tgggaaa tagggggttg cctcatttct t tagcca caa gggtcggggc aagattaacc cgaatggaaa tggcccccct tagcgctacc ccggtagatc ccttctccca.

tctggaagca.

tgctcttcac accgctttaa.

ctttcatggt gagacggagg gctgcggggg taaaagcaaa.

tgaatttgag ggagaggtcg tgggcaatta gattaggtta cctcttggca ggactcagat. ctcgagctca -agcttcgaat.

-ccacgagaat taaagccaaa gactaataat. caaaaataca tcgcttcaga .tggtgtgtta gaagaagaag t tttgc tc tg ggggggtgga gggggcactt cagattccga ctacaaccat.

gcggcggagt.

ggccgcccgc atttcattaa tctctccccc gcgctcctct.

aagaaaaaag agaaaatttg gaagtgaaa t tcagtcttag aagagagtaa aggaaaccgc tgttaacggc ccagcaaggc ttctcaatcc tcccctgcaa aaaatttttt cagaacctat gggtggtgaa agagtcaggg acaacttgta gctttcgcaa.

taggcagtga ttgagggagg aaagtagtcc accccataat ggcaggacaa cggggccgCg acaatct ttt gcgccccccg tcgattggag ttgggggggg 120 cggcacccac 180 ttttaaagac 240 tagttttcag 300 cgaaggcgga 360 aaacaaaaga 420 gttcacgggg 480 acacagccac 540 taaagtaaaa 600 agagagaaaa 660 tagtattaat 720 ccggggctgc 780 tcaggccctg 840 cccaccccca 900 WO 01/48224 WO 0148224PCT/AUOO/01596 cctccccatt ccacaccacc tctgcatatt accaggaact ggttgagccg gtcggagctg gggaggagag ggcgggagga gcgctcgccc gcgctctctt ccaaatcact agtgaattct ctagattaga taaaagtaaa tcgaaggttt aacaacccgt attggcatgt aaaaaataag *ggcaccatac tcacttttgc acgctaaaag ttttagatgt gtacacggcc tacagaaaaa aacaaggttt ttcactagag taggttgcgt attggaagat ctactgatag tatgccgcca cagagccagc cttcttattc .aatgtgaaag ,tgggtccgcg tcgagggcct gctcgatctc cgcgcctgtc ctttctcccc atgtcagcct gggggacgag acgcgctaga cgatttcgat ttacccccca cgactccgcc agatgtttac cgatgccctt ctctagatca taatcagcca ccacacctcc ccctgaacct attgcagctt ataatggtta tttttttcac tgcattctag aattgtaagc gttaatattt ttttaaccaa taggccgaaa -agggttgagt gttgttccag cgtcaaaggg cgaaaaaccg *atcaagtttt ttggggtcga ccgatttaga gcttgacggg gaaaggagcg ggcgctaggg acccgccgcg cttaatgcgc gcgcggaaccocctatttgtt **acaataaccc tgataaatgc .aaccagctgt ggaatgtgtg agaagtatgc aaagcatgca tccccagcag gcagaagtat cccctaactc cgcccatcc ggctgactaa ttttttttat cagaagtagt gaggaggc tt aggatgagga tcgtttcgca ttgggtggag aggctattcg cgccgtgttc cggctgtcag cggtgccctg aatgaaeztgc cgttccttgc gcagctgtgc caaaggaaaa aaatccagga cgtcctaccc gggagttcgg tcggtttgct gcagtcgacg gtgattaaca aaactcgccc cgggctttgc cctttagaag gctttactaa.

cagtatgaaa aatgcattat caagagcatc ttattacgac ggccttgaat tacagccgcg ccggacgacg gcgggacaca ctccacttag ctggacatgt ccctacggcg ggaattgacg taccacattt gaaacataaa caaataaagc ttgtggtttg tgttaaaatt tcggcaaaat tttggaacaa tctatcaggg ggtgccgtaa gaaagccggc cgctggcaag cgctacaggg tatttttcta ttcaataata tcagttaggg tctcaattag gcaaagcatg gcccc taact ttatgcagag ttttggaggc tgattgaaca gctatgactg cgcaggggcg aagacgaggc tcgacgttgt gaaaaggacc tgacgtcgac gcgggt tgag acgcaggggg cgcccgcggg gtaccgcggg gcgcattaga agaagctagg tcgacgcctt gggaaagctg gtcatcgcga ctctcgaaaa atgcactcag aagtcgctaa aagctatcga tgatcatatg cgcgtacgaa acgc cc ccga cgcgcagact acggcgagga tgggggacgg ctctggatat agtacggtgg gtagaggttt atgaatgcaa aatagcatca tccaaactca cgcgttaaat cccttataaa gagtccacta cgatggccca agcactaaat gaacgtggcg aaatctqgtt ctgtttgtca tcagtataaa accaacaaga ttcagctagg cggcggcgag cggggagggg cgcgagttgc agcagagagt gggacaattc cccaccggtc gccaccatgt gctgcttaat gaggtcggaa tgtagagcag cctacattgt agccattgag atgttagata gcaagatttt ttacgtaata tggagcaaaa gtacatttag tcaattagcc tttttatgcc cgctgtgggg cattttactt agaagaaagg gaaacaccta attatttgat. vcaccaaggtg ,cggattagaa aaacaactta :aaacaatt-ac gggtctacca agaggcgggg ctggcggctc gtcgacggcc cccccgaccg cgtggcgatg gcgcatgccg ggattccccg ggtccgggat ggccgacttc gagtttgagc gtaggaattc gcggccgcga tacttgcttt aaaaaacctc ttgttgttgt taacttgttt caaatttcac aaataaagca tcaatgtatc ttaaggcgta ttttgttaaa tcagctcatt tcaaaagaat agaccgagat ttaaagaacg tggactccaa ctacgtgaac catcacccta 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 -cggaacccta...<aagggag.ccc 2820 ;agaaaggaag ggaagaaagc -2880 tgtagcggtc :acgctgcgcg-.taaccacc-ac 2940 cgcgtcaggt:ggcacttttc ggggaaatgt. 3000 aatacattca ttgaaaaagg tgtggaaagt tcagcaacca catctcaatt ccgcccagtt gccgaggccg ctaggctttt agatggattg ggcacaacag cccggttctt agcgcggcta cactgaagcg aatatgtatc aagagtcctg ccccaggctc ggtgtggaaa agtcagcaac ccgcccattc cctcggcctc gcaaagatcg cacgcaggtt acaatcggc t tttgtcaaga tcgtggctgg ggaagggact cgctcatgag aggcggaaag cccagcaggt gtccccaggc catagtcccg tccgccccat tgagctattc atcaagagac ctccggccgc gctc tgatgc ccgacc tgtc ccacgacggg ggc tgc tatt 3060 3120 '3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 WO 01/48224 WO 0148224PCT/AUOO/01 596 gggcgaagtg ccggggcagg atctcctgtc catcatggct gatgcaatgc ggcggctgca ccaccaagcg aaacatcgca tcgagcgagc tcaggatgat ctggacgaag agcatcaggg caaggcgagc atgcccgacg gcgaggatct gaatatcatg gtggaaaatg gccgcttttc *ggcggaccgc tatcaggaca tagcgttggc cgaatgggct gaccgcttcc tcgtgcttta *cgccttctat cgccttcttg acgagttctt gaccaagcga cgcccaacct gccatcacga aggttgggct tcggaatcgt tttccgggac ctcatgctgg agttcttcgc ccaccctagg ataccggaag gaacccgcgc iatgacggca gggtcgtttg ttcataaacg cggggttcgg *ccgagacccc attggggcca atacgcccgc agttcgggtg- aaggcccagg gctcgcagcc *tcaggttact catatatact ttagattgat taggtgaaga-tcctttttga taatctcatg cactgagcgt cagaccccgt agaaaagatc cgcgtaatct gctgcttgca aacaaaaaaa *gatcaagagc taccaactct ttttccgaag.

*aatactgtcc ttctagtgta gccgtagtta cctacatacc tcgctctgct aatcctgtta tgtcttaccg ggttggactc aagacgatag acggggggtt cgtgcacaca gcccagcttg ctacagcgtg agctatgaga aagcgccacg *ccggtaagcg gcagggtcgg-aacaggagag tggtatcttt atagtcctgt cgggtttcgc tgctcgtcag gggggcggag cctatggaaa ctggcctttt-gctggccttt tgctcacatg gataaccgta ttaccgccat gcat.

atctcacctt tacgcttgat acgtactcgg gctcgcgcca cgtcgtgacc tggattcatc tacccgtgat cggtatcgcc c tgagcggga gatttcgatt gccggctgga gggaggctaa ataaaaagac tcccagggct gctcctgccg ccggctacct atggaagccg gccgaac tgt catggcgatg gactgtggcc attgctgaag gctcccgatt ctctggggtt ccaccgccgc tgatcctcca ctgaaacacg agaataaaac .ggcactctgt gtttcttcct-tttccccacc aacgtcgggg: -cggcaggccc.

ttaaaacttc atttttaatt agaaagtatc gcccattcga gtcttgtcga tcgccaggct cctgcttgcc ggc tgggtgt agcttggcgg cgcagcgcat cgaaatgacc cttctatgaa gcgcggggat gaaggagaca gcacggtgtt cgatacccca ;ccaccccca tgccatagcc 'taaaaggatc gttttcgttC tttttttctg ttgtttgccg gcagatacca tgtagcaccg cgataagtcg gtcgggctga actgagatac ggacaggtat gggaaacgcc atttttgtga tttacggttc tgattctgtg 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5604 accaaaatcc aaaggatctt ccaccgctac gtaactggct ggccaccact ccagtiggctg ttaccggata gagcgaacga cttcccgaag cgcacgaggg cacctctgac aacgccagca ttctttcctg cttaacgtga cttgagatcc cagcggtggt tcagcagagc tcaagaactc ctgccagtgg aggcgcagcg cctacaccga ggagaaaggc agcttccagg ttgagcgtcg acgcggcctt cgttatcccc <210> 48 <211> 6310 <212> DNA <213>,Artificial Sequence <220> <223> Description of Atificial Sequence:pSFM2O <400> 48 tagttattac acaggcagtc ggaaggcacc gcgggaagcc tggctgaatt acccagagtg tagcgctacc ccggtagatc ccttctccca tctggaagca tgctcttcac accgctttaa ggactcagat ccacgagaat gactaataat tcgcttcaga tggtgtgtta gaagaagaag ctcgagctca taaagccaaa caaaaataca gcgctcctct ggagctaggg aagaaaaaag agcttcgaat aaaatttttt cagaacctat gggtggtgaa agagtcaggg acaacttgta tcgattggag t tgggggggg cggcacccac ttttaaagac tagttttcag cgaaggcgga WO 01/48224 WO 0148224PCT/AUOO/01596 cgcgtttc ta ttttgggaaa tagggggttg cctcatttct ttagccacaa gggtcggggc aagattaacc cgaatggaaa tggcccccct cctccccatt tctgcatatt ggttgagccg gcgctcgccc ccaaatcact ctcgagctcg tggaagacgc ccgctggaga cttttacaga ttcggttggc gcagtgaaaa cgcagcc tac aaaagctccc ttcagtcgat ttgtgccaga ctactggtct .atgccagaga t tccat tcc a gagtcgtctt agattcaaag ttgacaaata aggaagtcgg ggctcactga cggtcggtaa .cgctgggcgt atgtaaacaa gagacatagc tgattaagta accccaacat ccgccgc cgt acgtcgccag aagtaccgaa aggccaagaa cagccatacc gaacctgaaa tggttacaaa ttctagttgt ctttcatggt ttttgctctg agaaaatttg gagacggagg ggggggtgga gaagtgaaat gctgcggggg gggggcactt tcagtcttag taaaagcaaa cagattccga aagagagtaa tgaatttgag ctacaaccat aggaaaccgc ggagaggtcg gcggcggagt tgttaacggc tgggcaatta ggccgcccgc ccagcaaggc gattaggtta atttcattaa ttctcaatcc cctcttggca tctctccccc tcccctgcaa ccacaccacc caaaggaaaa gaaaaggacc accaggaact .aaatccagga .tgacgtcgac gtcggagctg cgtcctaccc gcgggttgag ,ggcgggagga gggagttcgg acgcaggggg gcgctctctt tcggtttgct cgcccgcggg agtgaattct gcagtcgacg gtaccgcggg gtacccgggt cgacaagctt ggcattccgg.

;caaaaacata aagaaaggcc cggcgccatt gcaactgcat aaggctatga agagatacgc tgcacatatc gaggtggaca tcacttacgc agaagctatg-aaacgatatg ggctgaatac ctctcttcaa ttctttatgc cggtgttggg cgcgaacgac atttataatg aacgtgaatt cgtggtgttc gtttccaaaa aggggttgca aatcatccaa aaaattatta tcatggattc gtacacgttc gtcacatctc atctacctcc gtccttcgat agggacaaga caattgcact gcctaaaggt gtcgctctgc ctcatagaac tcctattttt ggcaatcaaa tcattccgga tcacggtttt ggaatgttta ctacactcgg -datgtataga tttgaagaag agctgtttct .tgcgctgctg gtgccaaccc tattctcctt cgatttatct aatttacacg aaattgcttc.

ggaagcggtt gccaagaggt tccatctgcc.

gactacatca gctattctga ttacacccga.

agttgttcca ttttttgaag. cgaaggttgt taatcaaaga ggcgaactgt gtgtgagagg tccggaagcg accaacgcct tgattgacaa ttactgggac gaagacgaac acttcttcat caaaggctat caggtggctc ccgctgaatt cttcgacgca ggtgtcgcag gtcttcccga tgttgttttg gagcacggaa agacgatgac tcaagtaaca accgcgaaaa agttgcgcgg aggtcttacc ggaaaactcg acgcaagaaa gggcggaaag atcgccgtgt aattctaggg acatttgtag aggttttact tgctttaaaa cataaaatga atgcaattgt tgttgttaac taaagcaata gcatcacaaa tttcacaaat ggtttgtcca aactcatcaa tgtatcttaa gctttcgcaa taggcagtga ttgagggagg aaagtagtcc accccataat ggcaggacaa cggggccgcg acaatctttt gcgccccccg aaatctggtt .tcagtataaa aaacaaaaga gttcacgggg acacagccac taaagtaaaa agagagaaaa tagtattaat ccggggctgc tcaggccctg c ccaccccca ctgtttgtca accaacaaga ttcagctagg cggcggcgag cggggagggg cgcgagttgc agcagagagt *gggacaattc cccgqggatcc .aagctcagat tactgttggt aaagccacca :,c~tatccgctg:..ga-agatggaa cctggttcct tgagtacttc aaatcacaga cgcgttattt gctcaacagt aaaaattttg taaaacggat cggttttaat gatcatgaac tgcc tgcgtg tactgcgatt atat ttgata gaggagcctt cttcgccaaa ggaacaattg gaaatgtccg atcgtcgtat atcggagttg atgggcattt aacgtgcaaa taccagggat gaatacgatt tcctctggat agattctcgc t taagtgttg tgtggatttc caggattaca agcactctga 420 480 540 600 660 720 780 840 900 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 tggtggcgct: 4cccctctcta 'aggtatcagg- icaaggatatg -gggggatgat aaaccgggcg ggatctggat--accgggaaaa tcctatgatt ggatggatgg cgt tgaccgc ggaatccatc.

cgatgacgcc ggaaaaagag aggagttgtg aatcagagag ccgcgactct aacctcccac ttgtttattg aaagcatttt ggcgtaaatt atgtccggtt* ctacattctg ctgaagtctc ttgctccaac ggtgaacttc atcgtggatt tttgtggacg atcctcataa agatcataat acctccccct cagcttataa tttcactgca gtaagcgtta WO 01/48224 WO 0148224PCT/AUOO/01 596 atattttgtt ccgaaatcgg ttccagtttg aaaccgtcta ggtcgaggtg gacggggaaa ctagggcgct atgcgccgct tttgtttatt aaatgcttca -tgtgtgtcag.

catgcatct c aagtatgcaa catcccgccc ttttatttat aggctttttt .ttcgcatgat tattcggcta tgtcagcgca aactgcaaga ctgtgctcga ggcaggatc t caatgcggcg atcgcatcga acgaagagca ccgacggcga .aaaatggccg, *aggacatagc gcttcctcgt ttcttgacga caacctgcca *cttcgcccac ccgcgctatg taaacgcggg ::,gggccaatac cccagggctc tatactttag ttttgataat ccccgtagaa cttgcaaaca aactcttttt agtgtagccg tctgctaatc ggactcaaga cacacagccc atgagaaagc ggtcggaaca aaaattcgcg caaaatccct gaacaagagt tcagggcgat ccgtaaagca gccggcgaac ggcaagtgta acagggcgcg tttctaaata ataatattga ttagggtgtg aattagtcag agca tgc atc .ctaactccgc gcagaggccg ggaggcc tag tgaacaagat tgac tgggca ggggcgcccg cgaggcagcg cgttgtcact cctgtcatct gc tgcatacg gcgagcacgt tcaggggctc ggatctcgtc cttttctgga gttggctacc gctttacggt gttcttctga tcacgagatt cgggacgccg cctaggggga acggcaataa gttcggtccc gcccgcgttt gcagccaacg attgatttaa ctcatgacca aagatcaaag aaaaaaccac ccgaaggtaa tagttagg~c ctgttaccag cgatagttac agcttggagc gccacgcttc ggagagcgca ttaaattttt tataaatcaa ccactattaa ggcccactac ctaaatcgga gtggcgagaa gcggtcacgc tcaggtggca cattcaaata aaaaggaaga gaaagtcccC.

caaccaggtg tcaattagtc ccagttccgc aggccgcctc gcttttgcaa ggattgcacg caacagacaa gttctttttg cggctatcgt gaagcgggaa caccttgctc cttgatccgg actcggatgg gcgccagccg gtgacccatg ttcatcgact cgtgatattg atcgccgctc gcgggactct tcgattccac gc tggatgat ggctaactga aaagacagaa agggctggca, cttccttttc tcggggcggc aacttcattt aaatccct ta gatcttcttg cgctaccagc ctggcttcag accacttcaa tggctgctgc cggataaggc gaacgaccta ccgaagggag cgagggagct gttaaatcag aagaatagac agaacgtgga gtgaaccatc accctaaagg aggaagggaa tgcgcgtaac cttttcgggg tgtatccgct gtcctgaggc aggctcccca; tggaaagtcc agcaaccata ccattctccg ctcatttttt cgagataggg ctccaacgtc accctaatca gagcCcccga gaaagcgaaa caccacaccc aaatgtgcgc catgagacaa ggaaagaacc gcaggcagaa ccaggctccc gtcccgcccc ccccatggct aaccaatagg ttgagtgttg aaagggcgaa agttttttgg tttagagctt ggagcgggcg gccgcgctta ggaaccccta taaccctgat agc tgtggaa gtatgcaaag cagcaggcag taactccgcc gactaatttt ggcctctgag ctattccaga.-agtagtgagg agatcgat-ca agagacagga tgaggat-cgt caggttctcc ggccgcttgg -gtggagaggc tcggctgctc tcaagaccga ggctggccac gggactggct c Lgccgagaa ctacc tgccc aagccggtct aactgttcgc gcgatgcctg gtggccggct ctgaagagct ccgattcgca ggggttcgaa cgccgccttc tgatgccgcc cctgtccggt gacgggcgtt gctattgggc agtatccatc attcgaccac tgtcgatcag caggc tcaag cttgccgaat gggtgtggcg tggcggcgaa gcgcatcgcc atgaccgacc tatgaaaggt gtgttccggc gccctgaatg ccttgcgcag gaagtgccgg atggctgatg caagcgaaac gatgatctgg gcgagcatgc atcatggtgg gaccgcta tc tgggctgacc ttctatcgcc aagcgacgcc tgggcttcgg ,tgctggagtt 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4850 4920 4980 5040 5100 5160 5-220 5280 5340 cctccagcgc.,;ggggatctca aacacggaag .gagacaatac -:cggaaggaac taaaacgcrc'ggtgttgggtcgtttgttca ctctgtcgat accccaccga :gaccccattg cccaccccac aggccctgcc ttaatttaaa acgtgagttt.

agatcctttt ggtggtttgt cagagcgcag gaactctgta cagtggcgat gcagcggtcg caccgaact~g aaaggcggac tccaggggga cccccaagtt cgggtgaagg 5400 atagcctcag aggatctagg tcgttccact.

tttctgcgcg ttgccggatc ataccaaata gcaccgccta aagtcgtgtc ggc tgaacgg agatacctac aggtatccgg aacgcctggt gttactcata tgaagatcct gagcgtcaga taatctgctg aagagctacc ctgtccttct catacctcgc ttaccgggtt ggggttcgtg agcgtgagct taagcggcag atctttatag 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 WO 01/48224 WO 0148224PCT/AUOO/01596 tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg 6180 gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 6240 gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 6300 cgccatgcat 6310 <210> 49 <211> 5143 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:pSFM21 <400> 49 tagttattac tagcgctacc acggtaccgc gggcccggga cttggcattc cggtactgtt gcccggcgcc attctatccg tgaagagata cgccctggtt acatcactta cgctgagtac atgggctgaa tacaaatcac tgccggtgtt gggcgcgtta atgaacgtga attgctcaac aaaaggggtt gcaaaaaatt ttatcatgga ttctaaaacg ctcatctacc tcccggtttt agacaattgc actgatcatg tgcctcatag aactgcctgc .aaatcattcc- ggatactgcg ttactacact cggatatttg aagagctgtt tctgaggagc ccctattctc cttcttcgcc acgaaattgc ttctggtggc ggttccatct. gccaggtatc.

.tgattacacc cgagggggat aagcgaaggt tgtggatctg tgtgtgtgag aggtcctatg ccttgattga caaggatgga aacacttctt catcgttgac ctcccgctga attggaatcc caggtcttcc cgacgatgac gaaagacgat gacggaaaaa aaaagttgcg cggaggagtt tcgacgcaag aaaaatcaga tgtaattcta gggccgcgac acttgcttta aaaaacctcc tg-ttgttgtt aacttgttta ggactcagat tccaagc tca gg taaagcca .ctggaagatg cctggaacaa ttcgaaatgt agaatcgtcg tttatcggag agtatgggca ttgaacgtgc gat taccagg aatgaatacg aactcctctg gtgagattct -attttaagtg, atatgtggat cttcaggatt aaaagcactc gctcccctct.

aggcaaggatgataaaccgg gataccggga :attatgtccg tggctacatt cgcctgaagt atcttgctcc gccggtgaac gagatcgtgg gtgtttgtgg gagatcctca tctagatcat cacacctccc ttgcagctta ctcgagctca agcttcgaat. .tctgcagtcg gatctcgagc .tcggtacccg ggtcgacaag 120 ccatggaaga gaaccgc tgg ttgcttttac ccgttcggtt tatgcagtga ttgcagttgc tttcgcagcc aaaaaaagc t gatttcagtc attttgtgcc gatctactgg cgcatgccag ttgttccatt ttcgagtcgt acaagattca cgccaaaaac agagcaac tg agatgcacat ggcagaagct aaac tc tct t gcccgcgaac taccgtggtg cccaatcatc gatgtacacg agagtcctLc tctgcctaaa agatcctatt ccatcacggt cttaatgtat ataaagaaag cataaggcta.

atcgaggtgg atgaaacgat caattcttta gacatttata ttcgtttcca caaaaaatta ttcgtcacat gatagggaca ggtgtcgctc tttggcaatc tttggaatgt agatttgaag aagtg.cgctg :ctggtgccaa 1020 tgattgacaa -atacgattta .tctaatttac 1080 ctaaggaagt- cggggaagcg .gttgccaaga 1140 atgggctcac tgagactaca.

gcgcggtcgg .taaagttgtt.

aaacgctggg gttatgtaaa ctggagacat ctctgattaa aacaccccaa ttcccgccgc attacgtcgc acgaagtacc taaaggccaa aatcagccat cctgaacctg taatggttac cgttaatcaa caatccggaa agcttactgg gtacaaaggc catcttcgac cgttgttgtt cagtcaagta gaaaggtctt gaagggcgga accacatttg aaacataaaa aaataaagca tcagctattc ccattttttg agaggcgaac gcgaccaacg gacgaagacg tatcaggtgg gcaggtgtcg t tggagcacg acaaccgcga accggaaaac aagatcgccg tagaggtttt tgaatgcaat atagcatcac 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 WO 01/48224 ~VO 0148224PCT/AUOO/OI 596 aaatttcaca aataaagcat ttttttcact caatgtatzct taaggcgtaa attgtaagcg tttgttaaat cagctcattt tttaaccaat caaaagaata gaccgagata gggttgagtg taaagaacgt ggactccaac gtcaaagggc tacgtgaacc atcaccctaa tcaagttttt ggaaccctaa agggagcccc cgatttagag gaaaggaagg gaagaaagcg aaaggagcgg cgcitgcgcgt aaccaccaca cccgccgcgc *gcacttttcg gggaaatgtg cgcggaaccc .atatgtatcc gctcatgaga caataaccct agagtcctga ggcggaaaga accagctgtg cccaggctcc ccagcaggca gaagtatgca gtgtggaaag tccccaggct ccccagcagg *gtcagcaacc atagtcccgc ccctaactcc *.cgcccattct. ccgccccatg gctgactaat ctcggcctct gagctattcc agaagtagtg caaagatcga tcaagagaca ggatgaggat **acgcaggttc tccggccgct tgggtggaga *.caatcggctg ctctgatgcc gccgtgttcc.

ttgtcaagac cgacctgtcc ggtgccctga *cgtggctggc cacgacgggc gttccttgcg gaagggactg gctgctattg ggcgaagtgc ctcctgccga gaaagtatcc atcatggctg cggctacctg cccattcgac caccaagcga .tggaagccgg tcttgtcgat caggatgatc ccgaactgtt cgccaggctc aaggcgagca .atggcgatgc ctgcttgccg aatatcatgg actgtggccg gctgggtgtg gcggaccgct ttgctgaaga gcttggcggc gaatgggctg *.ctcccgattc gcagcgcatc. gccttctatc .tctggggttc gaaatgaccg accaagcgac .caccgccgcc ttctatgaaa ggttgggctt gatcctccag cgcggggatc tcatgctgga tgaaacacgg aaggagacaa taccggaagg *...:gaataaaacg -cacggtgttg ggtcgtttgt, gcactctgtc gataccccac cgagacccca ttccccaccc caccccccaa gttcgggtga .ggcaggccct .gccatagcct- caggttactc tttttaattt aaaaggatct aggtgaagat ttaacgtgag ttttcgttcc actgagcgtc ttgagatcct ttttttctgc gcgtaatctg agcggtggtt tgtttgccgg atcaagagct cagcagagcg cagataccaa atactgtcct caagaactct gtagcaccgc ctacatacct tgccagtggc gataagtcgt gtcttaccgg ggcgcagcgg tcgggctgaa cggggggttc ctacaccgaa ctgagatacc tacagcgtga gcattctagt ttaatatttt aggccgaaat ttgttccagt gaaaaaccgt tggggtcgag cttgacgggg gcgctagggc ttaatgcgcc ctatttgttt gataaatgctgaatgtgtgt aagcatgcat cagaagtatg tgtggtttgt gttaaaattc cggcaaaatc ttggaacaag ctatcagggc gtgccgtaaa aaagccggcg gctggcaagt go tacagggc atttttctaa tcaataatat cagttagggt ctcaattagt caaagcatgc.

ccaaactcat gcgttaaatt ccttataaat agtccactat gatggcccac gcactaaatc aacgtggcga gtagcggtca gcgtcaggtg atacattcaa tgaaaaagga gtggaaagtc cagcaaccag atctcaatta 2040 2100 2160 2220 2280 2340 2400 2460 .252 0.

2580 2640 2700 2760 2820 gcccatcccg'-cccctaactc:.cgcccagttc 2880 ttttttt-att. tatgcagagg:ccgaggccgc 2940 aggaggctitt cgtttcgcat ggctattcgg.

ggctgtcagc atgaactgca cagctgtgct cggggcagga atgcaatgcg aacatcgcat tggacgaaga tgcccgacgg tggaaaatgg atcaggacat accgcttcctgccttcttga gcccaacctg cggaatcgtt.

gttct.tc-gcc: tcataaacgc ttggggccaa aggcccaggg .atatatactt.

cctttttgat agaccccgta o tgcttgcaa accaactctt tctagtgtag cgctctgcta gttggactca gtgcacacag gctatgagaa :tttggaggcc.taggcttttg 3000 gattgaacaa o tatgac tgg gcaggggcgc agacgaggca cgacgttgtc tctcctgtca gcggctgcat cgagcgagca gcatcagggg cgaggatctc ccgcttttct agcgt tggct .cgtgctttac cgagttcttc gatggattgc 3060 gcacaacaga .312 0 ccggttcttt 3180 gcgcggctat 3240 actgaagcgg 3300 tctcaccttg 3360 acgcttgatc 3420 cgtactcgga 3480 ctcgcgccag 3540 gtcgtgaccc .3600 ggattcatcg 3660 acccgtgata 3720 ggtatcgccg 3780 tgagcgggac 3840 .ccatcacgag. .att-tcgattc 3900 t-tccgggarcg:"ccggctggat 3960 *caccctaggg !ggaggctaac 4020 atgacggcaa. taaaaagaca 4q80S ggggttcggt. cccagggctg 4140 tacgcccgcg. tt'tcttcctt 4200 ctcgcagcca acgtcggggc 4260 tagattgatt taaaacttca 4320 aatctcatga ccaaaatccc 4380 gaaaagatca aaggatcttc 4440 acaaaaaaac caccgctacc 4500 tttccgaagg taactggctt 4560 ccgtagttag gccaccactt 4620 atcctgttac cagtggctgc 4680 agacgatagt taccggataa 4740 cccagcttgg agcgaacgac 4800 agcgccacgc ttcccgaagg 4860 WO 01/48224 ~VO 0148224PCT/AUOO/01 596 gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc cgcggccttt ttacggttcc tggccttttg ctggcctttt gttatcccct gattctgtgg ataaccgtat taccgccatg acaggagagc gcacgaggga gggtttcgcc acctctgact ctatggaaaa acgccagcaa gctcacatgt tctttcctgc cat 4920 4980 5040 5100 5143 <210> <211> 5662 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:pSFM23 <400> tagttattaa cgttacataa gacgtcaata .atgggtggag aagtacgccc c atgacc t a catggtgatg atttccaagt ggactttcca acggtgggag *.ccggactcag gtaaagccac tggaagatgg ctggaacaat **tcgaaatgtc gadtcgtcgt ttatcggagt gtatgggcat 'attaccaggg atgaatacga.

.actcctctgg tgagattctc t tttaagtgt tatgtggatt ttcaggatta aaagcactct ctcccctctc ggcaaggata ataaaccggg ataccgggaa tagtaatcaa. ttacggggtc cttacggtaa. atggcccgcc atgacgtatg ttcccatagt tatttacggt. aaactgccca cctattgacg tcaatgacgg tgggactttc ctacttggca cggttttggc agtacatcaa ctccacccca ttgacgtcaa aaatgtcgta acaactccgc gtctatataa gcagagctgg atctcgagct cggtacccgg catggaagac. gccaaaaaca* aaccgctgga gagcaactgc *tgcttttaca gatgcacata cgttcggttg .gcagaagcta atgcagtgaa aactctcttc tgcagttgcg cccgcgaacg ttcgcagcct accgtggtgt aaaaaagctc ccaatcatcc atttcagtcg atgtacacgt ttttgtgcca gagtccttcg atctactggt ctgcctaaag gcatgccaga gatcctattt tgttccattc catcacggtt tcgagtcgtc ttaatgtata caagattcaa agtgcgctgc gattgacaaa tacgatttat taaggaagtc ggggaagcgg tgggctcact gagactacat cgcggtcggt aaagttgttc aacgctgggc gttaatcaaa at tag ttcat. agcccatata. ttggagttccg tggctgaccg aacgccaata cttggcagta taLaatggccc gtacatctac tgggcgtgga tgggagt ttg cccattgacg tttagtgaac gtcgacaagc taaagaaagg ataaggctat tcgaggtgga tgaaacgata cccaacgacc gggactttcc catcaagtgt gcctggcatt gtattagtca tagcggtttg ttttggcacc caaatgggcg cgtcagatcc ttggcattcc cccggcgcca gaagagatac catcacttac tgggctgaat cccgcccatt attgacgtca atcatatgcc atgcccagta tcgctattac ac Lcacgggg aaaatcaacg gtaggcgtgt gctagcgcta ggtactgttg ttctatccgc gccctggttc gctgagtact acaaatcaca gccggt.ttg.ggcgcgttat 960 acatttataa tgaacgtgaa..ttgctcaaca tcgtttccaa .aaaggggttg--:caaaaaattt -aaaaaattat tatcatggat:.tctaaaacgg tcgtcacatc.. tcatctacct atagggacaa gacaattgca gtgtcgctct .gcctcataga ttggcaatca ttggaatgtt gatttgaaga tggtgccaac ctaatttaca ttgccaagag cagctattct cattttttga gaggcgaact aatcattccg tactacactc agagctgttt cctattctcc cgaaattgct gttccatctg gattacaccc agcgaaggtt gtgtgtgaga cccggtttta ctgatcatga.

ac tgcctgcg gatactgcga ggatatttga ctgaggagcc ttcttcgcca tctggtggrcg ccaggtatca gagggggatg gtggatctgg ggtcctatga 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 ttatgtccgg ttatgtaaac aatccggaag cgaccaacgc cttgattgac aaggatggat 1920 WO 01/48224 WO 0148224PCT/AU00/01596 ggctacattc tggagacata gcttactggg acgaagacga acacttcttc atcgttgacc 1980 gcctgaagtc tctgattaag tcttgctcca acaccccaac ccggtgaact tcccgccgcc agatcgtgga ttacgtcgcc tgtttgtgga cgaagtaccg *agatcctcat aaaggccaag ctagatcata atcagccata *acacctcccc .ctgaacctga *tttttcactg cattctagtt ttgtaagcgt :taatattttg .ttaaccaata ggccgaaatc *ggttgagtgt tgttccagtt.

tcaaagggcg aaaaaccgtc caagtttttt ggggtcgagg gatttagagc :ttgacgggga.

aaggagcggg cgctagggcg ccgccgcgct taatgcgccg gcggaacccc-tatttgttta aataaccctg ataaatgctt *ccagctgtgg aatgtgtgtc .aagtatgcaa agcatgcatc cccagcaggc agaagtatgc cctaactccg cccatcccgc ctgactaatt ttttttattt :gaagtagtga ggaggctttit gatgaggatc gtttcgcatg gggtggagag gctattcggc .*.ccgtgttccg gctgtcagcg gtgccctgaa tgaactgcaa ttccttgcgc agctgtgctc gcgaagtgcc 'ggggcaggat tcatggctga tgcaatgcgg -accaagcgaa acatcgcatc aggatgatct-ggacgaagag aggcgagcat gcccgacggc atatcatggt ggaaaatggc -cggaccgcta-tcaggacata aatgggctga ccgcttcctc ccttctatcg ccttcttgac ccaagcgacg cccaacctgc gttgggcttc ggaatcgttt catgctggag ttcttcgccc accggaagga acccgcgcta gtcgtttgtt cataaacgcg gagaccccat tggggccaat ttcgggtgaa ggcccagggc tacaaaggct atcttcgacg gttgttgttt agtcaagtaa aaaggtctta aagggcggaa ccacatttgt aacataaaat aataaagcaa gtggtttgtc ttaaaattcg ggcaaaatcc tggaacaaga, tatcagggcg tgccgtaaag aagccggcga ctggcaagtg ctacagggcg tttttctaaa caataatatt agttagggtg tcaattagtc aaagcaigca ccctaactcc atgcagaggc ttggaggcct attgaacaag tatgactggg caggggcgcc gacgaggcag gacgttgtca ctcctgtcat cggctgcata gagcgagcac.

ca-tcaggggc gaggatc tcg cgcttttctg .gcgttggcta gtgctttacg gagttcttct catcacgaga tccgggacgc accctagggg tgacggcaat gggttcggtc acgcccgcgt tcgcagccaa atcaggtggc caggtgtcgc tggagcacgg caaccgcgaa ccggaaaact agatcgccgt agaggtttta gaatgcaatt .tagcatcaca .caaactcatc cgttiaaattt cttataaatc .gtccactatt atggcccact: tcccgctgaa aggtcttccc aaagacgatg aaagttgcgc cgacgcaaga gtaattctag cttgctttaa gttgttgtta aatttcacaa aatgtatctt ttgttaaatc aaaagaatag aaagaacgtg ttggaatcca gacgatgacg acggaaaaag ggaggagttg aaaatcagag ggccgcgact aaaacctccc ,acttgtttat ataaagcatt aaggcgtaaa agctcatttt accgagatag gactccaacg 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 acgtgaacca--tcaccct-aat 2820 cactaaatcg gaaccctaaa,,gggagccccc 2880- .acgtggcgag-aaaggaaggg.'.aagaaagcga 2940 tagcggtcac cgtcaggtgg tacattcaaa gaaaaaggaa tggaaagtcc agcaaccagg tctcaattag gcccagttcc cgaggccgcc aggcttttgc atggattgca cacaacagac .cggttctttt -cgcggctatc gctgcgcgta cacttttcgg tatgtatccg gagtcctgag ccaggc tccc tgtggaaagt tcagcaacca gcccattctc tcggcc tctg aaagatcgat cgcaggttct aatcggc tgc tgtcaagacc g'tggctggcc accaccacac ggaaatgtgc ctcatgagac gcggaaagaa cagcaggcag ccccaggctc tagtcccgcc cgc cccatgg agctattcca caagagacag ccggccgctt tctgatgccg gacctgtccg acgacgggcg ctgaagcggg .aagggactgg-,.ctgctattgg *ctcacct-t-gc, .tcctgccgag:caaagtatcca cgcttgatcc-ggctacctgc Ccattcgacc gtactcggat .ggaagccggt cttgtcgatc 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 tcgcgccagc-*cgaactgttc tcgtgaccca gattcatcga cccgtgatat gtatcgccgc gagcgggac t tttcgattcc cggctggatg gaggctaact aaaaagacag ccagggctgg ttcttccttt cgtcggggcg tggcgatgcc ctgtggccgg tgctgaagag tcccgattcg ctggggttcg accgccgcct atcctccagc gaaacacgga aataaaacgc cactc tgtcg tccccacccc gcaggccctg gccaggctca cttggcggcg cagcgcatcg aaatgaccga tctatgaaag gcggggatct aggagacaat acggtgttgg ataccccacc accccccaag ccatagcctc WO 01/48224 WO 0148224PCT/AUOO/01596 aggttactca tatatacttt agattgattt aaaacttcat ggtgaagatc ctttttgata atctcatgac caaaatccct ctgagcgtca gaccccgtag aaaagatcaa aggatcttct cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca tcaagagcta ccaactcttt ttccgaaggt aactggczttc tactgtcctt ctagtgtagc cgtagttagg ccaccacttc *tacatacctc gctctgctaa tcctgttacc agtggctgct tcttaccggg ttggactcaa gacgatagtt accggataag ggggggttcg tgcacacagc ccagcttgga gcgaacgacc acgcggagctatgagaaa *gcgccacgct tcccgaaggg ggtagcgcagggtcggaa caggagagcgcacgagggag gtatctttat agtcctgtcg-ggtttcgcca cctctgactt ,;..ctcgtcaggggggcggagcc tatggaaaaa cgccagcaac *ggccttttgc tggccttttg ctcacatgtt ctttcctgcg taaccgtatt accgccatgc at ttttaattta taacgtgagt tgagatcctt gcggtggttt agcagagcgc aagaactctg gccagtggcg gcgcagcggt tacaccgaac agaaaggcgg cttccagggg gagcgtcgat gcggcctttt ttatcccctg aaaggatcta tttcgttcca tttttctgcg gtttgccgga agataccaaa tagcaccgcc ataagtcgtg cgggctgaac tgagatacct acaggtatcc gaaacgcctg ttttgtgatg .tacggttcct attctgtgga 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5662 <210> 51 <211> 3871 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: pSFM24 <400> 51 ctcgagttta ccactcccta tcagtgatag agaaaagtga aagtcgagtt taccactccc tatcagtgat agagaaaagt gtgaaagtcg agtttaccac agaaaagtga aagtcgagtt c tcggtaccc.-gggtcgagta agtgaaccgt cagatcgcctccgggaccga tccagcctcc *ggcgaggagc tgttcaccgg ggccacaagt-tcagcgtgtc ctgaagttca tctgcaccac ctgacctacg gcgtgcagtg, *ttcaagtccg-ccatgcccga ggcaactaca agacccgcgc gagctgaagg gcatcgactt aactacaaca gccacaacgt aacttcaaga tccgccacaa cagaacaccc ccatcggcga cagtccgccc tgagcaaaga gtgaccgccg ccgggatcac tctagaggat ccagacatga gcagtgaaaa aaatgcttta .gaaagtcgag tccctatcag aaaagt gaaa taccactccc ggcgtgtacg ggagacgcca gcgggcccgg ggtggtgccc ,cggcgagggc cggcaagctg tttaccactc cctatcagtg atagagaaaa tgatagagaa aagtgaaagt cgagtttacc .gtcgagttta .ccactcccta tcagtgatag tatcagtgat agagaaaagt gaaagtcgag gtgggaggcc., tatataagca, gagctcg~ttt tccacgctgt: tttgacctcc,-tagaagaca gatc'cacCggr tCg9ccaccat:.xgUgtgagcaag atcctggtcg gagggcgatg cccgtgccct -agctggacgg -cgartgtaaac 540 cttcagccgc-taccccgacc aggctacgtc. caggagcgca cgaggtgaag caaggaggac ctatatcatg catcgaggac cggccccgtg ccccaacgag tctcggcatg taagatacat tttgtgaaat ttcgagggcg ggcaacatcc gccgacaagc ggcagcgtgc ctgctgcccg aagcgcgatc gacgagctgt tgatgagttt ttgtgatgct ccacc tacgg ggcccaccct acatgaagca ccatcttctt.

acaccctggt.

tggggcacaa agaagaacgg agctcgccga acaaccacta acatggtcct acaagtaaag ggacaaacca attgctttat caagctgacc cgtgaccacc gcacgac ttc caaggacgac gaaccgcatc gc tggagtac catcaaggtg ccactaccag cctgagcacc gctggagttc cggccgcgac caactagaat ttgtaaccat 600 660 720 7.80 840 900 960 1020 1080 1140 1200 1260 1320 WO 01/48224 WO 0148224PCTAUOO/OI 596 tataagctgc gggggaggtg ttatgatcct cgcgcgctcc tcccaccagg atcgccggca tcaggagcta tcccaatggc aaccagaccg attgggcgct cgagcggtat- .gcaggaaaga -ttgctggcgt .agtcagaggttccctcgtgc aataaacaag ttaacaacaa tgggaggttt tttaaagcaa gcaagcctcg tcgtctggcc atgagcagag cgcccgccgc tcaacaggcg gtaaccggcc tgtcccctgg cggacgggaa aggaagc taa aatggagaaa atcgtaaaga acattttgag ttcagctgca ttaatgaatc :cttccgcttc.-ctcgctcact cagctcactc aaaggcggta acatgtgagc aaaaggccag .ttttccatag gctccgcccc ggcgaaaccc gacaggacta gctctcctgt tccgaccctg caattgcatt gtaaaacctc ggaccacgct cgaggcaaga tcttcatcgg gtatcagctc aaaatcactg gcatttcagt ggccaacgcg gactcgctgc atacggttat.

caaaaggcca cctgacgagc taaagatacc cattttatgt tacaaatgtg atctgtgcaa ctcgggcggc gaatgcgcgc gaccaagctt gatataccac cagttgctca cggggagagg gctcggtcgt ccacagaatc.

ggaaccgtaa atcacaaaaa aggcgtttcc ccgct-taccg .gatacctgtc.

ttcaggttca gtatggctga ggtccccgga gccctgcccg gaccttcagc ggcgagattt cgttgatata atgtacctat cggtttgcgt tcggctgcgg aggggataac aaaggccgcg tcgacgctca ccctggaagc cgcctttctc .ttcggtgtag ccgc tgt-gccgccactggca agagttcttg cgctctgctg aaccaccgct aggatctcaa ctcacgttaa aaattaaaaa ttaccaatgc agttgcctga cagtgctgca ccagccagcc gtctattaat 1380 1440 1500 1560 1620 1680 1740 1800 1860 19 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 *ccttcgggaa gcgtggcgct ttctcaatgc-'tcacgctgtaggtatctcag .gtcgttcgct ccaagctggg ctgtgtgcac .gaaccccccg .ttcagcccga ttatccggta gcagccactg.: m-aagtggtggc aagccagtta ggtlagcggtg gaagatcctt gggattttgg tgaagtttta ttaatcagtg .ctccccgtcg atgataccgc ggaagggccg tgttgccggg attgctacag tcccaacgat ttcggtcctc gc agcac tgc gagtactcaa gcgtcaatac.

aaacgttctt *taacccactctgagcaaaaa.

tgaatac tca atgagcggat tttccccgaa aaaaataggc actatcgtct tgagtccaac gtaacaggat -tagcagagcg ctaactacgg. ctacactaga cc ttcggaaa gtttttttgt tgatcttttc tcatgagatt aatcaa t cta aggcacc tat tgtagataac gagacccacg agcgcagaag aagctagagt gcatcgtggt caaggcgagt.

cgatcgttgt ataattctct ccaagtcatt gggataatac cggggcgaaa gtgcacccaa caggaaggca tactcttcct acatatttga aagtgccacc gtatcacgag aagagttggt t tgcaagcag tacggggtct atcaaaaagg aag ta tata t ctcagcgatc tacgatacgg ctcaccggct tggtcctgca aagtagttcg gtcacgctcg tacatgatcc cagaagtaagtactgtcatg..

ctgagaatag cgcgccacat actctcaagg ctgatcttca aaatgccgca ttttcaatat atgtatttag tgacgtctaa gccctttcgt ccggtaagac aggtatgtag aggacagtat agctcttgat cagattacgc gacgctcagt atcttcacct gagtaaactt tgtctatttc gagggcttac ccagatttat actttatccg ccagttaata tcgtttggta acgacttatc -gcggtgc tac ttggtatctg ccggcaaaca gcagaaaaaa ggaacgaaaa agatcctttt ggtc tgacag gttcatccat catctggccc cagcaataaa c ctc cat cca gtttgcgcaa cgttgttgcc 3120 tggcttcatt cagctccggt 3180 .cccatgt tgt:..-gcaaaaaagc; 'ggt tagc tcc ttggccgcag ;.tgttatcact *catggttatg ccatccgtaa-,gatgcttttc :tgtgactggt tgtatgcggc gaccgagttg ctcttgcccg agcagaactt taaaagtgct catcattgga atcttaccgc tgttgagatc cagttcgatg gcatctttta ctttcaccag cgtttctggg aaaaagggaa taagggcgac acggaaatgt tattgaagca tttatcaggg ttattgtctc aaaaataaac aaataggggt tccgcgcaca gaaaccatta ttatcatgac attaacctat 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3840 3871 <210> 52 <211> 4824 <212> DNA WO 01/48224 WO 0148224PCT/AUOO/01596 <213> Artificial Sequence <220> <223> Description of Artificial <400> 52 *ctcgagttta ccactcccta tcagtgatag tatcagtgat agagaaaagt gaaagtcgag 3 .*-gtgaaagtcg agtttaccac tccctatcag *actccctatc agtgatagag aaaagtgaaa agaaaagtga-aagtcgagtt .taccactccc ctcggtaccc gggtcgagta ggcgtgtacg agtgaaccgt cagatcgcct ggagacgcca ccgggaccga tccagcctcc.gcggccccga *tactgttggt aaagccacca tggaagacgc *ctatccgctg. gaagatggaa ccgctggaga *cctggttcct ggaacaattg cttttacaga .tgagtacttc gaaatgtccg ttcggttggc aaatcacaga atcgtcgtat -gcagtgaaaa cgcgttattt atcggagttg cagttgcgcc .gctcaacagt. atgggcattt cgcagcctac aaaaattttg- aacgtgcaaa aaaagctccc taaaacggat taccagggat ttcagtcgat cggttttaat gaatacgatt ttgtgccaga gatcatgaac tcctctggat ctactggtct tgcctgcgtg agattctcgc atgccagaga tactgcgatt. ttaagtgttg ttccattcca :atatttgata tgtggatttc gagtcgtctt gaggagcctt caggattaca agattcaaag -cttcgccaaa agcactctga ttgacaaata tggtggcgct cccctctcta aggaagtcgg aggtatcagg caaggatatg ggctcactgagggggatgat. aaaccgggcg cggtcggtaa ggatctggat accgggaaaa cgctgggcgt tcctatgatt-atgtccggtt atgtaaacaa ggatggatgg ctacattctg gagacatagc *cgttgaccgc ctgaagtctc tgattaagta ggaatccatc ttgctccaac accccaacat .cgatgacgcc ggtgaacttc ccgccgccgt *ggaaaaagag atcgtggatt acgtcgccag aggagttgtg tttgtggacg aagtaccgaa aatcagagag atcctcataa aggccaagaa gatccagaca tgataagata cattgatgag aaaaaatgct ttatttgtga aatttgtgat tgcaataaac aagttaacaa caacaattgc gtgtgggagg ttttttaaag caagtaaaac cctgcaagcc tcgtcgtctg gccggaccac tccatgagca gagcgcccgc cgccgaggca agaaaagtga aagtcgagtt taccactccc tttaccactc cctatcagtg atagagaaaa tgatagagaa aagtgaaagt .cgagtttacc gtcgagttta ccactcccta tcagtgatag tatcagtgat agagaaaagt gaaagtcgag gtgggaggcc tatataagca gagctcgttt tccacgctgt tttgacctcc atagaagaca attctgcagt cgacaagctt ggcattccgg caaaa-acata. aagaaaggcc .cggcgccatt gcaactgcat., aaggctatga., agagatacgc tgcacatatvc:. gaggtggaca.tcactt-acgc agaagctatg ctctcttcaa cgcgaacgac cgtggtgttc aatcatccaa gtacacgttc gtccttcgat gcctaaaggt tcctattttt tcacggtttt aatgtataga tgcgctgctg aaacgatatg ttctttatgc atttataatg gtttccaaaa aaaattatta gtcacatctc agggacaaga gtcgctctgc ggcaatcaaa ggaatgttta tttgaagaag gtgccaaccc ggctgaatac cggtgttggg aacgtgaatt aggggt tgca tcatggattc atctacctcc caattgcact ctcatagaac tcattccgga ctacactcgg agctgtttct tattctcctt aaattgcttc tccatctgcc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 -1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 cgatttatct .aatttacacg ggaagcggtt gccaagaggt gac tacatca'-, gc tat tc tga.,t tacacccga taatcaa-aga -ggcgaactgt3gtgtgagagg tccggaagcg-*accaacgcct -tgattgacaa -ttactgggac. gaagacgaac caaaggctat cttcgacgca tgttgttttg.

tcaagtaaca aggtcttacc gggcggaaag tttggacaaa gctattgctt attcatttta ctctacaaat gctatctgtg agactcgggc caggtggctc ggtgtcgcag gagcacggaa accgcgaaaa ggaaaacZtcg atcgccgtgt ccacaactag tatttgtaac tgtttcaggt gtggtatggc caaggtcccc ggcgccctgC *acttcttcat ccgctgaatt gtcttcccga agacgatgac.

agttgcgcgg acgcaagaaa aattctagag aatgcagtga cat tataagc tcagggggag tgattatgat ggacgcgcgc ccgtcccacc WO 01/48224 ~VO 0148224PCT/AUOO/01596 aggtcaacag gcggtaaccg gcatgtcccc tggcggacgg ctaaggaagc taaaatggag ggcatcgtaa agaacatttt ccgttcagct gcattaatga gctcttccgc ttcctcgctc tatcagctca ctcaaaggcg agaacatgtg agcaaaaggc *cgtttttcca- taggctccgc ggtggcgaaa-cccgacagga tgcgctctcc tgttccgacc *gaagcgtggc gctttctcaa -gctccaagct gggctgtgtg gtaactatcg tcttgagtcc ctggtaacag gattagcaga ggcctaacta cggctacact ttaccttcgg aaaaagagtt gtggtttttt tgtttgcaag ctttgatctt ttctacgggg tggtcatgag. attatcaaaa *ttaaatcaat ctaaagtata gtgaggcacc tatctcagcg tcgtgtagat aactacgata cgcgagaccc acgctcaccg ccgagcgcag aagtggtcct gggaagc tag agtaagtagt caggcatcgt ggtgtcacgc gatcaaggcg. agttacatga.

ctccgatcgt tgtcagaagt tgcataattc tcttactgtc caaccaagtc attctgagaa tacgggataa taccgcgcca cttcggggcg aaaactctca ctcgtgcacc caactgatct aaacaggaag gcaaaatgcc tcatactctt :cctttttcaa gatacatatt tgaatgtatt *gaaaagtgcc acctgacgtc ggcgtatcac gaggcccttt gcctcttcat gaagtatcag aaaaaaatca gaggcatttc atcggccaac actgactcgc gtaatacggt cagcaaaagg ccccctgacg ctataaagat.

ctgccgctta tgctcacgct cacgaacccc aacccggtaa gcgaggtatg agaaggacag ggtagctctt cagcagatta tctgacgctc aggatcttca.

tatgagtaaa atctgtctat cgggagggct gctccagatt gcaactt tat tcgccagtta tcgtcgtttg tcccccatgt aagttggccga tgcca tccg tagtgtatgc catagcagaa.

aggatcttac.

tcagcatctt gcaaaaaagg.

tattattgaa.

tagaaaaata.

taagaaacca cgtc cgggaatgcg ctcgaccaag ctggatatac agtcagttgc gcgcggggag tgcgctcggt tatccacaga ccaggaaccg agcatcacaa accaggcgtt ccggatacct gtaggtatct ccgttcagcc .gacacgactt cgcgaccttc cttggcgaga caccgttgat tcaatgtacc aggcggtttg cgttcggctg atcaggggat taaaaaggcc aaatcgacgc.

*tccccctgga.

gtccgccttt cagttcggtg cgaccgctgc.

agcatcgccg tt ttcaggag atatcccaat tataaccaga cgtattgggc cggcgagcgg aacgcaggaa gcgttgctgg tcaagtcaga.

agctccctcg ctcccttcgg taggtcgttc gccttatccg 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 atcgccactg ,gcagcagcca. 3360 taggcggtgc ;tacagagttc ttgaagtggt tatttggtat ctgcgctctg .ctgaagcc'ag gatccggcaa,--acaaaccacc gctgg..tagcg cgcgcagaaa agtggaacga cctagatcct cttggtctga ttcgttcatc taccatctgg tatcagcaat ccgcc tccat atagtttgcg gtatggcttc tgtgcaaaaa cagtgttatc taagatgctt ggcgaccgag aaaaggatc t aaactcacgt t ttaaattaa cagttaccaa catagttgcc ccccagtgct aaaccagcca ccagtctatt caacgttgtt attcagctcc agcggttagc actcatggtt ttctgtgact ttgctcttgc caagaagatc taagggattt aaatgaagtt tgcttaatca tgactccccg gcaatgatac gccggaaggg aattgttgcc gccattgcta ggttcccaac tccttcggtc atggcagcac ggtgagtac t ccggcgtcaa 3420 34,80 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4824 ctttaaaagt,.gctcatcatt .ggaaaacg~tt cgctgttgag atcca~ttcg iatgtaacc.ca.

ttactttcac cagcgtttct.gggtgagcaa gaataagggc *gacacggaaa tgttgaatac gcatttatca gggttattgt ctcatgagcg aacaaatagg ggttccgcgc. acatttcccc ttattatcat-gacattaacc tataaaaata <210> 53 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Forward Primer WO 01/48224 WO 0148224PCT/AUOO/0I 596 <400> 53 gcggcaccgc accatctt 18 <210> 54 <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Reverse Primer <400> 54 ggccgtcagc tgtccgagtc <210> <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Forward Primer <400> accggatttg gccgtatt 18 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> -<223> Description of Artificial Sequence:Reverse Primer <400> 56 tctgggatgg aaattgtgga g 21 <210> 57 <211> 4386 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial WO 01/48224 ~VO 0148224PCT/AUOO/01596 <400> 57 ctcgagttta tatcagtgat gtgaaagtcg actccctatc agaaaagtga ctcggtaccc agtgaaccgt -tcgacaacat gcgccgcggc *gcggcacctc **gcctcccggc tgcacgtgca cccagcagtg tgtctccggt agctgcagct -ccgatgagca gcactcggga ttaagaaccg **acgccgagaa gtaaaagcga cccacgttca ccctggtagg gccccgcagc *.ctgttgtagc acagggcgcg *gagtccccgt accgcgtctt ggcataagct.

*tacattgatg gaaatttgtg aacaacaatt agcaagtaaa 'tggccggacc.

*gccgccgagg cggcctcttc.

gggaagtatc agaaaaaaat ttgaggcatt gaatcggcca tcactgactc cggtaatacg gccagcaaaa gcccccctga gactataaag Ccctgccgct ccactcccta agagaaaagt agtttaccac agtgatagag aagtcgagtt ggg tcgagta cagatcgcct tccagcctcc.

cctggccgcc tccggtggtc c tcgga ctac cgcggtcggc ggcggcgccc ctcctgcgtc gccgcaccag gctcaaccag gctcgaagcc gcagctggcc ccgagccaag gtggaacaag tttggactcg tgtagggcag ctgggggcgt aagccgggcc ccaggcggga.

ggtagaaggc gtagagccgg tgcagcgcgg tatcgatacc agtttggacaatgctattgc gcattcattt acctctacaa -acgctatctg caagactcgg atcgggaatg agctcgacca.

cactggatat tcagtcagtt acgcgcgggg gctgcgctcg gttatccaca ggccaggaac cgagcatcac ataccaggcg taccggatac tcagtgatag gaaagtcgag tccctatcag aaaagtgaaa taccactccc ggcgtgtacg ggagacgcca gcggccccga cggccgcgct ttcccggctc gqcgccttct agctcccgcc gtgggcccgg ccgacgcccc atgctgccct ctgcactgtc ctggagaacc aggaaggtgc tggagacgac acgtcctcaa gacagctgag catctggtgc cgggacgcag cacgggcgcc gctgccgac gccgtagtcc gaagaccacc ccgggcggcc gtcgacggta aaccacaact tttatttgta tatgtttcag atgtggtatg tgcaaggtcc gcggcgccct cgcgcgacct agcttggcga accaccgttg gc tcaatgta agaggcggtt gtcgttcggc gaatcagggg cgtaaaaagg aaaaatcgac tttccccctg ctgtccgcct agaaaagtga tttaccactc tgatagagaa gtcgagttta tatcagtgat gtgggaggc tccacgctgt attagcttat gcaaagacgc.

tacacgggga acccgcgccc tgggctacaa aagtcgagtt cctatcagtg aagtgaaagt ccac tcccta agagaaaagt tatataagca tttgacctcc gcccgccagc ggtgctcccg ctcgctctac tgtggccccc cagctacttc taccactccc atagagaaaa cgagtttacc tcagtga tag gaaagtcgag gagctcgttt atagaagaca, atgttcagca gtggcgccca ggcgccggcg ggaggcgcgg .tacgggcagc ccgctgggcg cttgctgcgg -ggctgtgccg cagcctacca. gggccccggt.tctgtactgg 840 acatgaacgt-gggcacgctg cgcgcactg 900 ggcggaagcg tcttccagga accttcggga agaagcgat c aagcc tcgcc aattcctgca ggcaccggag gagcactgct gcctgcacgt gcggccggga gaggaggtgc ggagccgcgg aggatgttgt ccgcgggccc gcggcaccgc gacgaagtac ggagaaggtg ctcc tcggag ggagaagagg gctcagtgcg acaccagtac gggcgcccag gcagctgccc ggcccgcgcc cgccgccggc cgc tgggcgc accatcttca ccagacgtgg gaggtctggt gagtcagaaa gaagaggaag cgacagcgtg agaaccgggg cggcggcaca gtagaagtag tccgggggcc gccgtagagc caccgggagc 960 1020 1080.

1140 1200 1260 1320 1380 1440.

1500.

1560 1620 cgatgctgaa catgctggcg.1680 gggatccaga catgataaga 1740 agaatgcagt igaaaaaaatg. ctt~tat.ttgt accattataa gctgcaataa acaagttaac gttcaggggg. aggtgtggga*:ggttttttaa gctgattatg atcctgcaag- cctcgtcgtc ccggacgcgc gctccatgag gcccgtccca. ccaggtcaac .tcagcatcgc cggcatgtcc .gattttcagg agctaaggaa atatatccca cctataacca tgcgtattgg tgcggCgagc ataacgcagg ccgcgttgct gctcaagtca gaagctccct ttctcccttc atggcatcgt gaccgttcag gcgctcttcc ggtatcagct aaagaacatg ggcgtttttc gaggtggcga cgtgcgctct gggaagcgtg cagagcgccc aggcggtaac cc tggcggac gctaaaatgg aaagaacat t ctgcattaat gcttcctcgc cactcaaagg tgagcaaaag cataggctcc aacccgacag cctgttccga gcgctttctc 1800 1860 19-20 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 WO 01/48224 ~'/O01/4224PCT/AUOO/01596 aatgctcacg ctgtaggtat ctcagttcgg tgcacgaacc ccccgttcag cccgaccgct ccaacccggt aagacacgac ttatcgccac gagcgaggta tgtaggcggt gctacagagt ctagaaggac agtatttggt atctgcgctc ttggtagctc ttgatccggc aaacaaacca.

agcagcagat tacgcgcaga. aaaaaaggat ggtctgacgc tcagtggaac gaaaactcac aaaggatctt cacctagatc cttttaaatt tatatg-agta aacttggtct gacagttacc.

.cgatctgtct atttcgttca tccatagttg.

tacgggaggg cttaccatct ggccccagtg cggctccaga tttatcagca ataaaccagc -ctgcaacttt atccgcctcc atccagtcta gttcgccagt taatagtttg cgcaacgttg gctcgtcgtt -tggtatggct tcattcagct gatcccccat -gttgtgcaaa aaagcggttagtaagttggc cgcagtgtta tcactcatgg tcatgccatc cgtaagatgc ttttctgtga .aatagtgtat gcggcgaccg-agttgctctt Cacatagcag aactttaaaa gtgctcatca caaggatctt accgctgttg agatccagtt cttcagcatc ttttactttc accagcgttt ccgcaaaaaa gggaataagg gcgacacgga aatattattg aagcatttat cagggttatt tttagaaaaa taaacaaata ggggttccgc tctaagaaac cattattatc atgacattaa ttcgtc tgtaggtcgt gcgccttatc tggcagcagc tcttgaagtg tgc tgaagcc ccgc tgg tag ctcaagaaga gt taagggat .aaaaa tgaag aatgcttaat cctgactccc.

.ctgcaatgat cagccggaag ttaattgttg tcgctccaag ctgggctgtg cggtaac tat cgtcttgagt cactggtaac aggattagca gtggcctaac tacggctaca agttaccttc ggaaaaagag cggtggtttt tttgtttgca tcctttgatc ttttctacgg tttggtcatg agattatcaa ttttaaatca atctaaagta cagtgaggca. cctatctcag cgtcgtgtag ataactacga accgcgagac ccacgctcac ggccgagcgc agaagtggtc ccgggaagct agagtaagta 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 .3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260- 4320 4380 4386 t tgccattgc*.tacaggca-tc -gtggtgtcac .ccggttccca .acgatcaagg r-gagttacat :gctccttcgg ,tcctccgatczgttgtcagaa t tatggcagc ctggtgagta gcccggcgtc ttggaaaacg c gatgtaacc c tgggtgagc aatgttgaat gtctcatgag gcacatttcc cc Lataaaaa actgcataat c tcaaccaag aatacgggat ttcttcgggg cactcgtgca aaaaacagga actcatactc cggatacata ccgaaaagtg tctcttactg tcattctgag aataccgcgc cgaaaactct cccaac tgat aggcaaaatg ttcctttttc tttgaatgta ccacctgacg taggcgtatc .acgaggccct <210> 58 <211> 4653 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:pSFM8 <400> 58 tagttattaa cgttacataa gacgtcaata atgggtggag aagtacgccc catgacctta catggtgatg atttccaagt ggactttcca tagtaatcaa cttacggtaa atgacgtatg tatttacggt cctattgacg tgggactttc cggttttggc ctccacccca aaatgtcgta ttacggggtc a tggcccgcc ttcccatagt aaactgccca tcaatgacgg ctacttggca agtacat caa t tgacgtcaa acaac tccgc attagttcat tggctgaccg aacgccaata cttggcagta taaatggccc gtacatctac tgggcgtgga.

tgggagtttg cccattgacg agcccatata cccaacgacc gggactttcc catcaagtgt gcctggcatt gtattagtca tagcggtttg ttttggcacc caaatgggcg tggagttccg cccgcccatt at tgacgtca atcatatgcc atgcccagta tcgctattac actcacgggg aaaatcaacg gtaggcgtgt WO 01/48224 WO 0148224PCT/AUOO/01596 acggtgggag ccggactcag taccttcctc cgttttctga taaaccagac tgcccacgtc *cggtgaagat gctcagtgcg .acaccagtac ~gcagctgccc .ggcccgcgcc !cgccgccggc *cgctgggcgc cgatgctgaa aacttgttta .aa taaagcat, taaggcgtaa cagctcattt gaccgagata ggac tccaac atcaccctaa agggagcccc gaagaaagcg aaccaccaca gggaaatgtg gctcatgaga ggcggaaaga ccagcaggca atagtcccgc ccgccccatg gagctattcc tcaagagaca tccggccgct ctctgatgcc cgacctgtcc cacgacgggc.

.gctgctattg, gaaagtatcc cccattcgac tct tgtcgat cgccaggctc ctgcttgccg gctgggtgtg gcttggcggc gcagcgcatc gaaatgaccg gtctatataa atctcgagct ttccctcttc ctcctccgag ctccaccttc tgggtacttc ggtgcggtgc cgacagcgtg agaaccgggg .cggcggcaca gtagaagtag tccgggggcc gccgtagagc* caccgggagc .catgctggcg -ttgcagctta.

ttttttcact attgtaagcg 'tttaaccaat gggttgagtg gtcaaagggc.

tcaagttttt cgatttagag aaaggagcgg cccgccgcgc cgcggaaccc caataaccc t accagctgtg gaagtatgca* ccccagcaggccctaactcc gctgactaat' agaagtagtg ggatgaggat tgggtggaga gccgtgttccggtgccc tga gttccttgcg ggcgaagtgc.

atcatggctg caccaagcga caggatgatc aaggcgagca aatatcatgg gcggaccgct gaatgggctg gccttctatc accaagcgac gcagagctgg tttagtgaac caagcttcga attctcagct tccggcgagg cttttgagga gaggatcgct tctgtcgtct tcctcccgaa ggtgcacctt gtctcctgga agaggttctc cgccgcttcc gccgacagtg cccacgttca tgtagggcag ,ccctggtagg. ctgggggcgt gccccgcagc aagccgggcc ctgttgtagc ccaggcggga acagggcgcg ggtagaaggc gagtccccgt gtagagccgg accgcgtctt .tgcagcgcgg ggcataagct tatcgatacc: taatggttac aaataaagca.

gcattctagt tgtgg'tttgtttaatatttt gttaaaattc aggccgaaat cggcaaaatc ttgttccagt ttggaacaag gaaaaaccgt ctatcagggc tggggtcgag gtgccgtaaa cttgacgggg aaagccggcg gcgctagggc gctggcaagt ttaatgcgcc gctacagggc ctatttgttt atttttctaa gataaatgct -tcaataatat gaatgtgtgt cagttagggt aagcatgcat ctcaattagt cagaagtatg caaagcatgc gcccatcccg cccctaactc tttttttatt tatgcagagg aggaggcttt tttggaggccfl cgtttcgcat gattga-acaa ggctattcgg ctatgactgg' ggctgtcagc .gcaggggcgc atgaactgca agacgaggca.

cagctgtgct cgacgttgtc cggggcagga tctcctgtca atgcaatgcg gcggctgcat aacatcgcat cgagcgagca tggacgaaga gcatcagggg tgcccgacgg cgaggatctc tggaaaatgg ccgcttttct atcaggacat agcgt tggct aCCgCttcct cgtgctttac gCCttCttga cgagttcttc gcccaacctg ccatcacgag cgtcagatcc gtccgagtcc cgtcttgttc ccacttggct c tggccagc cagggcttcg cagctggttg catctggtgc cgggacgcag.

cacgggcgcc gctgccgacc gccgtagtcc gctagcgcta aaatcgcttt cacttctcgg cggcggttct tgctcccgag agctgctcat agcagctgca ggcaccggag gagcactgct gcctgcacgt gcggccggga gaggaggtgc 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 gaagaccacc ggagccgcgg 1320 ccgggcggcc aggatgttgt 1380 -*gtcgacgg.a- ccgcgggccc :atagcatcac..aaatttcaca ccaaactcabt..caatgtatct gcgttaaatt ccttataaat agtccactat gatggcccac gcactaaatc aacgtggcga gtagcggtca gcgtcaggtg atacattcaa tgaaaaagga gtggaaagtc atc tcaat ta cgcccagttc tttgttaaat caaaagaata taaagaacgt tacgtgaacc ggaaccctaa gaaaggaagg cgctgcgcgt gcacttttcg atatgtatcc agagtcctga cccaggctcc gtgtggaaag gtcagcaacc cgcccatt ct 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040- 2100 2160.

2220 2280.

2340 2400 .ccgaggccgci.ctcggcctct. 2460 -taggottttg-.,caaagatcga 2520 .gatggattgcr.acgcagg.ttc 2580 gcacaacaga caatcggctg 2640 ccggttcttt gcgcggctat actgaagcgg tctzcaccttg acgcttgatc cgtactcgga ctcgcgccag gtcgtgaccc gga ttcatcg acccgtgata ggtatcgccg tgagcgggac atttcgattc t tgtcaagac cgtggctggc gaagggac tg Ct~cctgccga cggctacctg tggaagccgg ccg'aactgtt atggcgatgc actgtggccg t tgctgaaga ctcccgattc tctggggttc caccgccgcc 2700 2760 2820 2880 .2940 3000 3060 3120 3180 3240 3300 3360 3420 WO 01148224 WO 0148224PCT/AUOO/01596 ttctatgaaa cgcgggga tc aaggagacaa cacggtgttg gataccccac caccccccaa gccatagcct aaaaggatct ttttcgttcc ttttttctgc tgtttgccgg cagataccaa.

gtagcaccgc gataagtcgt tcgggctgaa ctgagatacc gacaggtatc ggaaacgcct tttt tgtgat .ttacggttcc gattctgtgg ggttgggctt tcatgctgga taccggaagg ggtcgtttgt cgagacccca gttcgggtga caggttactc aggtgaagat actgagcgtc gcgtaatctg atcaagagct atactgtcct ctacatacct gtcttaccgg *cggggggttc tacagcgtga cggtaagcgg ggtatcttta gctcgtcagg tggccttttg ataaccgtat cggaatcgtt ttccgggacg gttcttcgcc caccctaggg aacccgcgct atgacggcaa tcataaacgc ggggttcggt ttggggccaa tacgcccgcg aggcccaggg ctcgcagcca atatatactt tagattgatt cctttttgat aatctcatga agaccccgta.. gaaaagatca ctgcttgcaa acaaaaaaac ccggctggat ggaggctaac taaaaagaca cccagggc tg tttcttcctt acgtcggggc taaaacttca ccaaaatccc .aaggatcttc caccgctacc taactggctt gccaccactt cagtggctgc taccggataa gatcctccag tgaaacacgg gaataaaacg gcactctgtc ttccccacc ggcaggccct tttttaattt ttaacgtgag ttgagatcct agcggtggtt cagcagagcg caagaactct tgccagtggc ggcgcagcgg .accaactctt tctagtgtag cgctctgcta gttggactca gtgcacacag.

gctatgagaa cagggtcgga tagtcctgtc ggggcggagc ctggcctttt taccgccatg tttccgaagg ccgtagttag atcctgttac agacgatagt 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4653 .cccagcitgg-.,agcgaacgac.-ct-acaccgaa agcgccacgc ttcccgaaggi.gagaaaggcg -acaggagagc. gcacgaggga&..gctbtccaggg gggtttcgcc acctctgact tgagcgtcga ctatggaaaa acgccagcaa cgcggccttt gctcacatgt tctttcctgc gttatcccct cat <210> 59 <211> 3926 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:pSFM9 <400> 59 ctcgagttta ccactcccta tatcagtgat gtgaaagtcg actccctatci agaaaagtga ctcggtaccc .agtgaaccgt.

ccgggaccga taccttcctc cgttttctga taaaccagac tgcccacgtc cggtgaagat gctcagtgcg acaccagtac gggcgcccag agagaaaagt agtttaccac agtgatagag aagtcgagtt gggtcgagta cagatcgcct tccagcc tcc ttccctcttc ctcctccgag ctccaccttc tgggtacttc ggtgcggtgc cgacagcgtg agaaccgggg cggcggcaca gaaagtcgag tccctatcag aaaagtgaaa taccactccc ggcgtgtacg ggagacgcca gcggccccga tccggcgagg gaggatcgct tcctcccgaa gtctcctgga cgccgcttcc cccacgttca ccctggtagg gccccgcagc tttaccactc.cctatcag.tg.,atagagaaaa 120 tgatagagaa 'aagtgaaagt-cgagtttacc 180 gtcgagttta tatcagtgat gtgggaggcc tccacgctgt attctcagct c ttttgagga tctgtcgtct ggtgcacctt agaggttctc gccgacagtg tgtagggcag c tgggggcgt aagccgggcc ccactcccta tcagtgatag 240 agagaaaagt, gaaagtcgag 300 tatataagca tttgacctcc gtccgagtcc cgtcttgttC ccacttggct cc tggccagc cagggcttcg cagctggttg catctggtgc cgggacgcag cacgggcgcc gagctcgttt atagaagaca aaatcgcttt cacttctcgg cggcggttct tgctcccgag agctgctcat agcagctgca ggcaccggag gagcac tgc t gcctgcacgt 360 420 480 540 600 660 720 780 840 900 960 WO 01/48224PC/UO059 PCT/AUOO/01596 gcagctgccc gtagaagtag ctgttgtagc ggcccgcgcc tccgggggcc acagggcgcg cgccgccggc gccgtagagc gagtccccgt cgctgggcgc caccgggagc accgcgtctt cgatgctgaa catgctggcg ggcataagct gggatccaga catgataaga tacattgatg gaaaaaaatg ctttatttgt gaaatttgtg gctgcaataa acaagttaac aacaacaatt aggtgtggga ggttttttaa agcaagtaaa atcctgcaag. cctcgtcgtc tggccggacc -igctccatgag-cagagcgccc gccgccgagg *ccaggtcaac aggcggtaac cggcctcttc :cggcatgtcc cctggcggac.-.gggaagtatc i 'agctaaggaa gctaaaatgg agaaaaaaat atggcatcgt aaagaacatt ttgaggcatt *gaccgttcag ctgcattaat gaatcggcca gcgctcttcc gcttcctcgc tcactgactc ggtatcagct .cactcaaagg cggtaatacg aaagaacatg tgagcaaaag gccagcaaaa ggcgtttttc cataggctcc gcccccctga gaggtggcga aacccgacag gactataaag *cgtgcgctct cctgttccga ccctgccgct gggaagcgtg gcgctttctc aatgctcacg tcgctccaag ctgggctgtg tgcacgaacc cggtaactat cgtcttgagt ccaacccggt cactggtaac aggattagca gagcgaggta .gtggcctaac. .tacggct~ca .ctagaaggacagttaccttc ggaaaaagag ttggtagctc *cggtggtttt tttgtttgca agcagcagat tcctttgatc ttttctacgg ggtctgacgc tttggtcatg agattatcaa aaaggatctt ttttaaatca atctaaagta tatatgagta cagtgaggca cctatctcag cgatctgtct* cgtcgtgtag ataactacga tacgggaggg *accgcgagac ccacgctcac cggctccaga.

t;ggccgagcgc agaagtggtc .ctgcaacttt ccgggaagct agagtaagta gttcgccagt .tacaggcatc gtggtgtcac. gctcgtcgtt acgatcaagg. cgagttacat gatcccccat tcctccgatc gttgtcagaa gtaagttggc actgcataat tctcttactg tcatgccatc ctcaaccaag tcattctgag aatagtgtat aatacgggat aataccgcgc cacatagcag ttcttcgggg cgaaaactct caaggatctt cactcgtgca cccaactgat cttcagcatc aaaaacagga aggcaaaatg ccgcaaaaaa actcatactc ttcctttttc aatattattg cggatacata tttgaatgta tttagaaaaa ccaggcggga ggtagaaggc gtagagccgg tgcagcgcgg tatcgatacc agtttggaca atgctattgc gcattcattt acctctacaa .acgctatctg caagac tcgg- .atcgggaatg agctcgacca gctgccgacc gccgtagtcc gaagaccacc ccgggcggcc gtcgacggta aaccacaact tttatttgta tatgt ttcag atgtggtatg tgcaaggtcc gcggcgccct cgcgcgacct agcttggcga gcggccggga gaggaggtgc ggagccgcgg aggatgttgt ccgcgggccc agaatgcagt accattataa gttcaggggg gc tgattatg ccggacgcgc gcccgtccca tcagcatcgc gattttcagg atatatccca cactggatat .accaccgttg tcagtcagtt.. gctcaatgtazatcctata-acca acgcgcggg. agaggcggtt,..tgogtattgg .gctgcgctcg:gtcgt~tcggc.*tgcggcgagc.

1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 :18 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520.

2580.* 2640 2700' 2760 2820 2880 2940 3000 gttatccaca ggccaggaac cgagcatcac ataccaggcg taccggatac ctgtaggtat ccccgttcag aagacacgac tgtaggcggt agtatttggt ttgatccggc tacgcgcaga tcagtggaac cacctagatc gaatcagggg cgtaaaaagg aaaaatcgac tttccccctg ctgtccgcct ctcagttcgg cccgaccgct ttatcgccac gctacagagt atctgcgctc aaacaaacca aaaaaaggat gaaaac tcac cttttaaatt ataacgcagg ccgcgttgct gctcaagtca gaagctccct ttctcccttc tgtaggtcgt gcgccttatc tggcagcagc tcttgaagtg tgctgaagcc ccgctggtag ctcaagaaga gttaagggat aaaaatgaag aacttggtct .gacagt tacc.:aatgcttaat atttcgttca tccatagttg-: :cctgactc-c cttaccaxtct.% ggccccagtg. ctgcaatgat tttatcagca atccgcctcc taatagt ttg tggtatggct .gttgtgcaaa.

cgcagtgtta cgtaagatgc gcggcgaccg aactttaaaa accgctgttg ttttactttc gggaataagg aagcatttat ataaaccagccagccggaag 3060 atccagtcta ttaattgttg cgcaacgttg ttgccattgctcattcagct ccggttccca aaagcggtta-gctccttcgg tcactcatgg ttatggcagc ttttctgtga ctggtgagta agttgctctt gcccggcgtc gtgctcatca ttggaaaacg agatccagtt cgatgtaacc accagcgttt ctgggtgagc gcgacacgga aatgttgaat cagggttatt gtctcatgag 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 taaacaaata ggggttccgc gcacatttcc 3840 WO 01/48224 WO 0148224PCT/AUOO/01596 ccgaaaagtg ccacctgacg tctaagaaac cattattatc atgacattaa cctataaaaa 3900 taggcgtatc acgaggccct ttcgtc 3926 <210> <211> 1147 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Promoter <400> ggagacaggc agtcccggta gatcccacga ggggggaagg caccccttctt*cccagactaa :ccacgcggga agcctctgga '-agcatcgctt -agactggctg~ aatttgctct -tcactggtgt gaattaaagc caaaaaaatt. taatcaaaaa:.tacacagaac-icta-tcggc-ac .120 cagagcgctc.- ctc.tgggtgg tgaattttaa gttaggagctagggagagtc..agggtagttt.,,240.

tcagacccag cggacgcgtt aagattttgg ggggtagggg ccaccctcat.

aaaattagcc aaaagggtcg taataagatt c tgccgaatg cctgtggccc.

cccacctccc gtcatctgca aagaggttga cgaggggagg agtgaccgct tctactttca gaaagagacg gttggctgcg ttcttaaaag acaatgaatt gggcggagag aacctgggca gaaagattag ccctcctctt cattccacac tattaccagg gccggtcgga agagggcggg t taagaagaa tggtttttgc gagggggggg gggggggggc caaacagatt tgagctacaa gtcggcggcg attaggccgc gttaatttca ggcatctctc cacccaaagg aactaaatcc gctgcgtcct.

aggagggagt gaagaagaaa tctgagaaaa tggagaagtg actttcagtc ccgaaagaga ccataggaaa gagttgttaa ccgcccagca t taattc tca cccctcccct aaaagaaaag aggatgacgt acccgcgggt tcggacgcag aaagacaact tttggctttC aaat taggca ttagt tgagg gtaaaaagta ccgcacccca cggcggcagg aggccggggc atccacaatc gcaagcgccc gaccaaatct cgactcagta tgagttcagc ggggcgggga tgtacgaagg gcaaaaacaa gtgagttcac gaggacacag gtcctaaagt taatagagag acaatagtat cgcgccgggg tttttcaggc cccgcccacc ggttctgttt taaaaccaac taggcggcgg ggggcgcgag 300 360 420 480 540 600 660 720 780.

840, 9 00.

960 1020 1080 ttgcgcgctc! gcccgcgctc 'tctttcggtt tgctcgcccg- cgggagcaga-,,gagtgggaca.2L-40.

attccca 1147 ,<210> 61 <211> 771 <212:> DNA <213> Artificial Sequence <220>.

<223> Description of Artificial Sequence:Blocker Molecule <400> 61 atgcccgcca gcatgttcag catcgacaac atcctggccg cccggccgcg ctgcaaagac gcggtgctcc cggtggcgcc cagcgccgcg gctccggtgg tcttcccggc tctacacggg 120 gactcgctct acggcgccgg cggcggcacc tcctcggact acggcgcctt. ctacccgcgc 180 WO 01/48224 WO 0148224PCT/AUOO/01596 cctgtggccc aacagctact ggggc tgtgc cagggccccg gtgggcacgc cggcggcacc gagacgaagt gaggagaagg tcc tcctcgg ccggagaaga ccggaggcgc tctacgggca cgccgctggg gttctgtact tgtcgcgcac gcaccatctt acccagacgt tggaggtc tg aggagtcaga gggaagagga gggcctcccg gctgcacgtg cgcccagcag ggtgtctccg tgagc tgcag caccgatgag gggcac tcgg gtttaagaac aaacgccgag aggtaaaagc gccgcggtcg caggcggcgc tgctcctgcg gtgccgcacc ctgctcaacc cagctcgaag gagcagctgg cgccgagcca aagtggaaca gatttggact gcagctcccg ccgtgggccc tcccgacgcc agatgctgcc agctgcactg ccctggagaa ccaggaaggt agtggagacg agacgtcctc cggacagctg cctgggctac ggcttgctgc cccagcctac ctacatgaac tcggcggaag cctcttccag gcaccttcgg acagaagcga aaaagcctcg a <210> 62 <211> 779 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Blocker Mroecule <400> 62 catccgtcgg cagc tcggc t cagcgtctga gcgcttcctc gttgctcggt.

gaaatacagt gtttgagcta ggcagtggtc gaacattcgg aaacacgata aaaaacaacg agctggaaaa cccaaaatct ttttggaacc ttcctcctga atcgaattca ctccggaact caggtgttgc gattcgggga cgcttgctca cctcagtaca cgcccgagga cgaagttttc cagcagtttt ggagttcctc cgctctctcC agatcttcac tggtgatgta tgaggaactt gac tgatcat tgggaggtgc gacacacacc atatgttcgg tgctggactt gcactatggg atcacgaaga tcttcaacct tacagtcgct.

gaaaggcaag ttgcctttcg gcgactgtag aggagacgac ggtcgccgtg cgttggactc ggagcgaact attgaagcga gtattatatg aaaacatgta gagagagcga aggaactcct gggaacgcag gtccgcgctc attcccgaga gatacaaact aaacccaccc cactctgaaa gaaagggcag gattttgggc tttccagctc accggccaca tcacggtgct tcgaccgacg tcctgaacga caagcaaatc acgatgaccc ccagcagagc 120 180 240 300 360- 420 480 540 600 660 720 779 ggctttcgag .gcactgtcca. .gcctgaaagg tacctccatt cctgtcgact -cagacgctgg acatcaccat,.caggaggaaa.,gccgagctgg tgaagatctg gttccaaaac cgacggatg <210> 63 <211> 1432 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:Gene <400> 63 gaattcatga ggaacttagg agacgacggg aacgcagacc ggccacagcg cttcctcctc cggaactgac tgatcatggt cgccgtggtc cgcgctctca cggtgctgtt gctcggtcag 120 WO 01/48224 gtgt tgctgg tcggggagac ttgctcaata cagtacatgc ccgaggagca agttttcatc cagtttttct cgcattttca atttacgagg gacacccgtc gtggcacgct cctaaggagt agtcgttccc tacagccatg cgacgagggc ctctatgtgg.

catgctttct aaccatgcca tgcatcccga attc ttaaaa ccccaatgaa tatatgaata gaggtgccgt acacaccgga tgttcggatt tggacttgta ctatgggaaa acgaagaggc tcaaccttac gggaccaagt tgttcaggcc tggtgcagga gggcccgcga cagaagtatc ttcacgcgga acggtcaagg tggactcatt gcgaactgat gaagcgaaaa ttatatgcac acatgtagaa tttcgaggca ctccattcct tctcggagat agctttggcc ctctcacacg atcccagcac cgaggaggct tgaggactcg cacagccgtc cccgagatcg acaaacttcc cccaccccaa tctgaaaacg agggcagcca ctgtccagcc ggcgaggagc gccagtacga .ccctccaaag cgctgggaaa aaccacgggc gagagcaacc -tgggcacaag ttgcattcga accgacggaa t ga a cgag tt gcaaatcggc atgacccgaa gcagagcaaa tgaaaggaaa tgatctccgc gtggcttcca agcctctaac gcttcgacgt tccttgtaga ggaggaagca cccgacctct accgagaaaa cgaactgtag tcgtggcacc cggaccatc t Ccaaca ttc c tggacgagta ggtgccgatg t tggaggaag aaaaaaaaaa PCT/AUOO/OI 596 atacagtgat 180 tgagctacgc 240 agtggtccct 300 cattcggcgc 360 cacgatacga 420 aacaacgcag 480 tgcggagctg 540 cagaattaac 600 cagacttctg 660 gggttcagct 720 ggtgctccat 780 cgtgagggtc 840 gctggtaacc 900 gcggcaggct 960 .gcgacatgct .1.020 gccaggctat .1080 -aaactcca-cc .1140 caaagcctgt 1200 cgagaaggtc 1260 agaacaatct 1320 aaaagaaata 1380 aa 1432 aaaagccgag.gagaa-agcac .,caccagcgct .acttcagtga tgtcggctgg ,*aacgagtgga ;actgccatgg .cgagtgtccgl.ttccctctgc ttgtccagac gctggtgaac tcggtcaact cggagctcag ccctatctca ctgctgtacc actaccagga catggtggtg gagggctgtg gacttttatt tatacaaaag agcgagctat tatttatgtt gaatgaacaa aacaaaaaaa

Claims (20)

1. A method of controlling fertility in a non-human animal comprising the steps of: 1) stably transforming an animal cell or single celled embryo with a construct comprising: a) a first nucleic acid molecule, which is activated in a defined spatio-temporal pattern, and which is operably linked to b) a second nucleic acid molecule, which encodes a transactivating protein; and c) a third nucleic acid molecule, which is operably linked to a fourth nucleic acid molecule, wherein activation of said first nucleic acid molecule controls the expression of the second nucleic acid molecule, which in turn activates the third nucleic acid molecule, which effects the expression of the fourth nucleic acid molecule which encodes a blocker molecule which disrupts gametogenesis or embryogenesis in the animal; and 20 2) and growing a whole animal directly from that cell or implanting the cell into a host animal, whereby a whole animal develops from the implanted cell.

2. A method according to claim 1, wherein either or both 25 the first and fourth nucleic acid molecules are transiently activated or transiently affect development in S* a defined spatio-temporal pattern.

3. A method according to claim 1 or claim 2, wherein each of the first, second, third and fourth nucleic acids may be genomic DNA, cDNA, RNA, or a hybrid molecule thereof.

4. A method according to claim 3, wherein the nucleic acid molecule is a full-length molecule, or a biologically active fragment thereof. H:\terryr\Keep\Retype\P 4 6 6 11 Amended Claims CSIRO May 2005.doc 13/05/05 FLi/AUUU/UiDYO Received 13 March 2002 127 A method according to claim 1, wherein the first nucleic acid molecule is a DNA molecule encoding a promoter region.

6. A method according to claim 5, wherein the promoter is activated only during embryonic development and/or gametogenesis, and is crucial for completion of embryogenic development and/or gametogenesis.

7. A method according to claim 5 or claim 6, wherein the promoter has the nucleotide sequence shown in SEQ ID NO:1, SEQ. ID NO:8, SEQ ID NO:60 or a biologically active fragment thereof.

8. A method according to claim 1, wherein the second nucleic acid molecule is a cDNA molecule encoding a tetracycline-responsive transcriptional activator protein (tTA), as defined herein.

9. A method according to claim 8, wherein the tTA has the nucleotide sequence shown in SEQ ID NO:2. A method according to claim 1, wherein the third nucleic acid molecule is DNA molecule encoding a repressible promoter.

11. A method according to claim 10, wherein the promoter consists of the tet responsive element (TRE) which is coupled to and tightly regulates a minimal promoter region.

12. A method according to claim 11, wherein minimal promoter is the PainCv as shown in SEQ ID NO:3.

13. A method according to claim 1, wherein the fourth nucleic acid molecule encodes a blocker molecule selected from the group consisting of antisense RNA, double-stranded RNA (dsRNA), sense RNA and ribozyme. AMENDED SHEET IPEAAU 128

14. A method according to claim 13, wherein the molecule is dsRNA or sense RNA that when mis-expressed disrupts development in a defined spatio-temporal pattern. A method according to claim 13, wherein the RNA is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO 13, SEQ ID NO 62, SEQ ID NO 23, SEQ ID NO 24, and SEQ ID NO 61.

16. A method according to claim 1, wherein the stable transformation is effected by microinjection, transfection or infection, wherein the construct stably integrates into the genome by homologous recombination.

17. A nucleic acid molecule, which encodes a promoter and is transiently activated in a defined spatio-temporal pattern, wherein the encoded promoter has a nucleotide sequence as shown in either SEQ ID NO 1, SEQ ID NO 8, e. 20 or SEQ ID NO 60, and wherein said nucleic acid is crucial for completion of embryogenic development and/or gametogenesis.

18. A nucleic acid molecule, which encodes a promoter having a) a nucleotide sequence as shown in SEQ ID NO :1, SEQ ID NO 8 and SEQ ID NO 60 or b) a biologically active fragment of the sequence in a) or c) a nucleic acid molecule which has at least sequence homology to the sequence in a) or b) or d) a nucleic acid molecule which is capable of hybridizing to the sequence in a) or b) under stringent conditions; and wherein said nucleic acid is crucial for completion of embryogenic development and/or gametogenesis. H:\terryr\Keep\Retype\P46611 Amended Claims CSIRO May 2005.doc 13/05/05 129

19. A nucleic acid molecule that encodes the coding region of a gene including: a) a nucleotide sequence selected from the group consisting of SEQ ID NO 63, SEQ ID NO 23, SEQ ID NO 24 and SEQ ID NO 61; or b) a biologically active fragment of any one of the sequences in a) or c) a nucleic acid molecule which has at least sequence homology with any one of the sequences disclosed in a) or b) or d) a nucleic acid molecule that is capable of binding to any one of the sequences disclosed in a) or b) under stringent conditions; and wherein said nucleic acid is crucial for completion of embryogenic development and/or gametogenesis.

20. A nucleic acid molecule which encodes a blocker molecule capable of disrupting gametogenesis or embryogenesis in a non-human animal, wherein the blocker molecule is encoded by a sequence selected from the group consisting of SEQ ID NO 13, SEQ ID NO 62, SEQ ID NO :23 and SEQ ID NO 61. 25 21. A nucleic acid molecule according to claim wherein the blocker molecule is selected from the group consisting of antisense RNA, dsRNA, sense RNA and ribozyme.

22. A nucleic acid molecule according to claim 21, wherein the molecule is dsRNA or sense RNA that when mis- expressed disrupts development in a defined spatio- temporal pattern.

23. A transgenic non-human animal stably transformed with a nucleic acid according to claim 17. H:\terryr\Keep\Retype\P46611 Amended Claims CSIRO May 2005.doc 13/05/05 130

24. A transgenic animal according to claim 23, wherein the animal is selected from the group consisting of fish, mammals, amphibians, and mollusc. Dated this 1 3 th day of May 2005 COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION By their Patent Attorneys GRIFFITH HACK Fellows Institute of Patent and Trade Mark Attorneys of Australia a a H:\terryr\Keep\Retype\P46611 Amended Claims CSIRO May 2005.doc 13/05/05