AU778868B2

AU778868B2 - Schizophrenia associated genes, proteins and biallelic markers

Info

Publication number: AU778868B2
Application number: AU35719/00A
Authority: AU
Inventors: Bernard Bihain; Marta Blumenfeld; Lydie Bougueleret; Ilya Chumakov; Daniel Cohen; Laurent Essioux
Original assignee: Genset SA
Current assignee: Merck Biodevelopment SAS
Priority date: 1999-03-30
Filing date: 2000-03-30
Publication date: 2004-12-23
Anticipated expiration: 2020-03-30
Also published as: AU3571900A; CA2361408A1; WO2000058510A3; EP1165836A2; WO2000058510A2; JP2002539845A

Description

,-.;.com/Login.dog/SexarTqgappof/FetctfDfail-t.dog/WO0058510.cpc?fromCache=1part=maintoolbar-bottom] Page 3 of 737 WO 00/58510 PCT/IB00/00435 SCHIZOPHRENIA ASSOCIATED GENES, PROTEINS AND BIALLELIC

MARKERS

FIELD OF THE INVENTION The invention concerns the human sbgl, g34665, sbg2, g35017 and g35018 genes, polynucleotides, polypeptides biallelic markers, and human chromosome 13q31-q33 biallelic markers. The invention also concerns the association established between schizophrenia and bipolar disorder and the biallelic markers and the sbgl, g34665, sbg2, g35017 and g35018 genes and nucleotide sequences. The invention provides means to identify compounds useful in the treatment of schizophrenia, bipolar disorder and related diseases, means to determine the predisposition of individuals to said disease as well as means for the disease diagnosis and prognosis.

BACKGROUND OF THE INVENTION Advances in the technological armamentarium available to basic and clinical investigators have enabled increasingly sophisticated studies of brain and nervous system function in health and disease. Numerous hypotheses both neurobiological and pharmacological have been advanced with respect to the neurochemical and genetic mechanisms involved in central nervous system (CNS) disorders, including psychiatric disorders and neurodegenerative diseases. However, CNS disorders have complex and poorly understood etiologies, as well as symptoms that are overlapping, poorly characterized, and difficult to measure. As a result future treatment regimes and drug development efforts will be required to be more sophisticated and focused on multigenic causes, and will need new assays to segment disease populations, and provide more accurate diagnostic and prognostic information on patients suffering from CNS disorders.

Neurological Basis of CNS Disorders Neurotransmitters serve as signal transmitters throughout the body. Diseases that affect neurotransmission can therefore have serious consequences. For example, for over 30 years the leading theory to explain the biological basis of many psychiatric disorders such as depression has been the monoamine hypothesis. This theory proposes that depression is partially due to a deficiency in one of the three main biogenic monoamines, namely dopamine, norepinephrine and/or serotonin.

In addition to the monoamine hypothesis, numerous arguments tend to show the value W00058510 fhttD:/wwwaettheoatent.com/Loain.doo/Sexam.sunortFetc/efaut.doaANOO5851 0.coc?fromCache=l part=maintoolbar=bottoml Paae 4 of 737 WO 00/58510 PCT/IB00/00435 2 in taking into account the overall function of the brain and no longer only considering a single neuronal system. In this context, the value of dual specific actions on the central aminergic systems including second and third messenger systems has now emerged.

Endocrine Basis of CNS Disorders It is furthermore apparent that the main monoamine systems, namely dopamine, norepinephrine and serotonin, do not completely explain the pathophysiology of many CNS disorders. In particular, it is clear that CNS disorders may have an endocrine component; the hypothalamic-pituitary-adrenal (HPA) axis, including the effects of corticotrophin-releasing factor and glucocorticoids, plays an important role in the pathophysiology of CNS disorders.

In the hypothalamus-pituitary-adrenal (HPA) axis, the hypothalamus lies at the top of the hierarchy regulating hormone secretion. It manufactures and releases peptides (small chains of amino acids) that act on the pituitary, at the base of the brain, stimulating or inhibiting the pituitary's release of various hormones into the blood. These hormones, among them growth hormone, thyroid-stimulating hormone and adrenocorticotrophic hormone (ACTH), control the release of other hormones from target glands. In addition to functioning outside the nervous system, the hormones released in response to pituitary hormones also feed back to the pituitary and hypothalamus. There they deliver inhibitory signals that serve to limit excess hormone biosynthesis.

CNS Disorders Neurotransmitter and hormonal abnormalities are implicated in disorders of movement Parkinson's disease, Huntington's disease, motor neuron disease, etc.), disorders of mood unipolar depression, bipolar disorder, anxiety, etc.) and diseases involving the intellect Alzheimer's disease, Lewy body dementia, schizophrenia, etc.). In addition, these systems have been implicated in many other disorders, such as coma, head injury, cerebral infarction, epilepsy, alcoholism and the mental retardation states of metabolic origin seen particularly in childhood.

Genetic Analysis of Complex Traits Until recently, the identification of genes linked with detectable traits has relied mainly on a statistical approach called linkage analysis. Linkage analysis is based upon establishing a correlation between the transmission of genetic markers and that of a specific trait throughout generations within a family. Linkage analysis involves the study of families with multiple affected individuals and is useful in the detection of inherited-traits, which are caused by a single gene, or possibly a very small number of genes. But, linkage studies have proven difficult when applied to complex genetic traits. Most traits of medical relevance do not follow simple Mendelian monogenic inheritance. However, complex diseases often aggregate in W00058510 [http:fww.qethe patent.c omIL gin.dowSexam.supportIFetch/Default.dogwO0058510 .cpc?fromCache=l 1art=maintoolbar=bottomI Page 5 of 737 WO 00/58510 PCT/IB00/00435 3 families, which suggests that there is a genetic component to be found. Such complex traits are often due to the combined action of multiple genes as well as environmental factors. Such complex trait, include susceptibilities to heart disease, hypertension, diabetes, cancer and inflammatory diseases. Drug efficacy, response and tolerance/toxicity can also be considered as multifactoral traits inv6lving a genetic component in the same way as complex diseases.

Linkage analysis cannot be applied to the study of such traits for which no large informative families are available. Moreover, because of their low penetrance, such complex traits do not segregate in a clear-cut Mendelian manner as they are passed from one generation to the next.

Attempts to map such diseases have been plagued by inconclusive results, demonstrating the need for more sophisticated genetic tools.

Knowledge of genetic variation in the neuronal and endocrine systems is important for understanding why some people are more susceptible to disease or respond differently to treatments. Ways to identify genetic polymorphism and to analyze how they impact and predict disease susceptibility and response to treatment are needed.

Although the genes involved in the neuronal and endocrine systems represent major drug targets and are of high relevance to pharmaceutical research, we still have scant knowledge concerning the extent and nature of, sequence variation in these genes and their regulatory elements. In the case where polymorphisms have been identified the relevance of the variation is rarely understood. While polymorphisms hold promise for use as genetic markers in determining which genes contribute to multigenic or quantitative traits, suitable markers and suitable methods for exploiting those markers have not been found and brought to bare on the genes related to disorders of the brain and nervous system.

The basis for accomplishment of these goals is to use genetic association analysis to detect markers that predict susceptibility for these traits. Recently, advances in the fields of genetics and molecular biology have allowed identification of forms, or alleles, of human genes that lead to diseases. Most of the genetic variations responsible for human diseases identified so far, belong to the class of single gene disorders. As this name implies, the development of single gene disorders is determined, or largely influenced, by the alleles of a single gene. The alleles that cause these disorders are, in general, highly deleterious (and highly penetrant) to individuals who carry them. Therefore, these alleles and their associated diseases, with some exceptions, tend to be very rare in the human population. In contrast, most common diseases and non-disease traits, such as a physiological response to a pharmaceutical agent, can be viewed as the result of many complex factors. These can include environmental exposures (toxins, allergens, infectious agents, climate, and trauma) as well as multiple genetic factors.

Association studies seek to analyze the distributions of chromosomes that have occurred W00058510 [http:/lwww.getthepatentcomILogin.dog/Sexam.support/FechDefault.dog/W005851 0.cpc?fromCache=1 part=ma intoolba r=bottoml Page 6 of 737 WO 00/58510 PCT/IB00/00435 4 in populations of unrelated (at least not directly related) individuals. An assumption in this type of study is that genetic alleles that result in susceptibility for a common trait arose by ancient mutational events on chromosomes that have been passed down through many generations in the population. These alleles can become common throughout the population in part because the trait they influence, if deleterious, is only expressed in a fraction of those individuals who carry them. Identification of these "ancestral" chromosomes is made difficult by the fact that genetic markers are likely to have become separated from the trait susceptibility allele through the process of recombination, except in regions of DNA which immediately surround the allele.

The identities of genetic markers contained within the fragments of DNA surrounding a susceptibility allele will be the same as those from the ancestral chromosome on which the allele arose. Therefore, individuals from the population who express a complex trait might be expected to carry the same set of genetic markers in the vicinity of a susceptibility allele more often than those who do not express the trait; that is these markers will show an association with the trait.

Schizophrenia Schizophrenia is one of the most severe and debilitating of the major psychiatric diseases. It usually starts in late adolescence or early adult life and often becomes chronic and disabling. Men and women are at equal risk of developing this illness; however, most males become ill between 16 and 25 years old, while females develop symptoms between 25 and People with schizophrenia often experience both "positive" symptoms delusions, hallucinations, disorganized thinking, and agitation) and "negative" symptoms lack of drive or initiative, social withdrawal, apathy, and emotional unresponsiveness).

Schizophrenia affects 1% of the world population. There are an estimated 45 million people with schizophrenia in the world, with more than 33 million of them in the developing countries. This disease places a heavy burden on the patient's family and relatives, both in terms of the direct and indirect costs involved and the social stigma associated with the illness, sometimes over generations. Such stigma often leads to isolation and neglect.

Moreover, schizophrenia accounts for one fourth of all mental health costs and takes up one in three psychiatric hospital beds. Most schizophrenia patients are never able to work. The cost of schizophrenia to society is enormous. In the United States, for example, the direct cost of treatment of schizophrenia has been estimated to be close to 0.5% of the gross national product. Standardized mortality ratios (SMRs) for schizophrenic patients are estimated to be two to four times higher than the general population, and their life expectancy overall is 20 shorter than for the general population. The most common cause of death among schizophrenic patients is suicide (in 10 of patients) which represents a 20 times higher risk than for the W0005851 0[q~p twww. q etthepatent.com/Loin.d og/Sexam.support/Fetchefa ult dogiO 585 1 0.cpcfromC ache= 1 part=maintoolbar-bottom) Page 7 of 737 WO 00/58510 PCT/IB00/00435 general population. Deaths from heart disease and from diseases of the respiratory and digestive system are also increased among schizophrenic patients.

Bipolar Disorder Bipolar disorders are relatively common disorders with severe and potentially disabling effects. In addition to the severe effects on patients' social development, suicide completion rates among bipolar patients are reported to be about Bipolar disorders are characterized by phases of excitement and often including depression; the excitement phases, referred to as mania or hypomania, and depression can alternate or occur in various admixtures, and can occur to different degrees of severity and over varying time periods. Because bipolar disorders can exist in different forms and display different symptoms, the classification of bipolar disorder has been the subject of extensive studies resulting in the definition of bipolar disorder subtypes and widening of the overall concept to include patients previously thought to be suffering from different disorders. Bipolar disorders often share certain clinical signs, symptoms, treatments and neurobiological features with psychotic illnesses in general and therefore present a challenge to the psychiatrist to make an accurate diagnosis. Furthermore, because the course of bipolar disorders and various mood and psychotic disorders can differ greatly, it is critical to characterize the illness as early as possible in order to offer means to manage the illness over a long term.

Bipolar disorders appear in about 1.3% of the population and have been reported to constitute about half of the mood disorders seen in a psychiatric clinic. Bipolar disorders have been found to vary with gender depending of the type of disorder; for example, bipolar disorder I is found equally among men and women, while bipolar disorder II is reportedly more common in women. The age of onset of bipolar disorders is typically in the teenage years and diagnosis is typically made in the patient's early twenties. Bipolar disorders also occur among the elderly, generally as a result of a medical or neurological disorder.

The costs of bipolar disorders to society are enormous. The mania associated with the disease impairs performance and causes psychosis, and often results in hospitalization. This disease places a heavy burden on the patient's family and relatives, both in terms of the direct and indirect costs involved and the social stigma associated with the illness, sometimes over generations. Such stigma often leads to isolation and neglect. Furthermore, the earlier the onset, the more severe are the effects of interrupted education and social development.

The DSM-IV classification of bipolar disorder distinguishes among four types of disorders based on the degree and duration of mania or hypomania as well as two types of disorders which are evident typically with medical conditions or their treatments, or to substance abuse. Mania is recognized by elevated, expansive or irritable mood as well as by W00058510 [http:/Mwww.getthepatent.com/Login.dog/Sexam.su portFetch/Defaut. dog O05851 0. cfrOmC ache= 1 pa rtm aiMoolbar-bottom] Page 8 of 737 WO 00/58510 PCT/IB00/00435 6 distractability, impulsive behavior, increased activity, grandiosity, elation, racing thoughts, and pressured speech. Of the four types of bipolar disorder characterized by the particular degree and duration of mania, DSM-IV includes: bipolar disorder I, including patients displaying mania for at least one week; bipolar disorder II, including patients displaying hypomania for at least 4 days, characterized by milder symptoms of excitement than mania, who have not previously displayed mania, and have previously suffered from episodes of major depression; bipolar disorder not otherwise specified (NOS), including patients otherwise displaying features of bipolar disorder II but not meeting the 4 day duration for the excitement phase, or who display hypomania without an episode of major depression; and cyclothymia, including patients who show numerous manic and depressive symptoms that do not meet the criteria for hypomania or major depression, but which are displayed for over two years without a symptom-free interval of more than two months.

The remaining two types of bipolar disorder as classified in DSM-VI are disorders evident or caused by various medical disorder and their treatments, and disorders involving or related to substance abuse. Medical disorders which can cause bipolar disorders typically include endocrine disorders and cerebrovascular injuries, and medical treatments causing bipolar disorder are known to include glucocorticoids and the abuse of stimulants. The disorder associated with the use or abuse of a substance is referred to as "substance induced mood disorder with manic or mixed features".

Diagnosis of bipolar disorder can be very challenging. One particularly troublesome difficulty is that some patients exihibit mixed states, simultaneously manic and dysphoric or depressive, but do not fall into the DSM-IV classification because not all required criteria for mania and major depression are met daily for at least one week. Other difficulties include classification of patients in the DSM-IV groups based on duration of phase since patients often cycle between excited and depressive episodes at different rates. In particular, it is reported that the use of antidepressants may alter the course of the disease for the worse by causing "rapidcycling". Also making diagnosis more difficult is the fact that bipolar patients, particularly at what is known as Stage III mania, share symptoms of disorganized thinking and behavior with bipolar disorder patients. Furthermore, psychiatrists must distinguish between agitated depression and mixed mania; it is common that patients with major depression (14 days or more) exhibit agitiation, resulting in bipolar-like features. A yet further complicating factor is that bipolar patients have an exceptionally high rate of substance, particularly alcohol abuse.

While the prevalence of mania in alcoholic patients is low, it is well known that substance abusers can show excited symptoms. Difficulties therefore result for the diagnosis of bipolar W0005851 0 [http:/www.ethepatent.conVLogin.dog/Sexamsupport/Fetch/efault.dogNVO0058 5 l 0.cpc?fromCache= 1 part=maintoolbar=bottom] Page 9 of 737 WO 00/58510 PCT/IB00/00435 7 patients with substance abuse.

Treatment As there are currently no cures for bipolar disorder or schizophrenia, the objective of treatment is to reduce the severity of the symptoms, if possible to the point of remission. Due to the similarities in symptoms, schizophrenia and bipolar disorder are often treated with some of the same medicaments. Both diseases are often treated with antipsychotics and neuroleptics.

For schizophrenia, for example, antipsychotic medications are the most common and most valuable treatments. There are four main classes of antipsychotic drugs which are commonly prescribed for schizophrenia. The first, neuroleptics, exemplified by chlorpromazine (Thorazine), has revolutionized the treatment of schizophrenic patients by reducing positive (psychotic) symptoms and preventing their recurrence. Patients receiving chlorpromazine have been able to leave mental hospitals and live in community programs or their own homes. But these drugs are far from ideal. Some 20% to 30% of patients do not respond to them at all, and others eventually relapse. These drugs were named neuroleptics because they produce serious neurological side effects, including rigidity and tremors in the arms and legs, muscle spasms, abnormal body movements, and akathisia (restless pacing and fidgeting). These side effects are so troublesome that many patients simply refuse to take the drugs. Besides, neuroleptics do not improve the so-called negative symptoms of schizophrenia and the side effects may even exacerbate these symptoms. Thus, despite the clear beneficial effects of neuroleptics, even some patients who have a good short-term response will ultimately deteriorate in overall functioning.

The well known deficiencies in the standard neuroleptics have stimulated a search for new treatments and have led to a new class of drugs termed atypical neuroleptics. The first atypical neuroleptic, Clozapine, is effective for about one third of patients who do not respond to standard neuroleptics. It seems to reduce negative as well as positive symptoms, or at least exacerbates negative symptoms less than standard neuroleptics do. Moreover, it has beneficial effects on overall functioning and may reduce the chance of suicide in schizophrenic patients. It does not produce the troubling neurological symptoms of the standard neuroleptics, or raise blood levels of the hormone prolactin, excess of which may cause menstrual irregularities and infertility in women, impotence or breast enlargement in men. Many patients who cannot tolerate standard neuroleptics have been able to take clozapine. However, clozapine has serious limitations. It was originally withdrawn from the market because it can cause agranulocytosis, a potentially lethal inability to produce white blood cells. Agranulocytosis remains a threat that requires careful monitoring and periodic blood tests. Clozapine can also cause seizures and other disturbing side effects drowsiness, lowered blood pressure, drooling, bed-wetting, W00058510 [httPJhvww. etthepatent.omLogin.do~examfsuportiFetch/Defaultdo NVO005851 0. ccfromCache= 1 part=mantoolbar=bottom] Page10 of737 WO 00/58510 PCT/IB00/00435 8 and weight gain). Thus it is usually taken only by patients who do not respond to other drugs.

Researchers have developed a third class of antipsychotic drugs that have the virtues of clozapine without its defects. One of these drugs is risperidone (Risperdal). Early studies suggest that it is as effective as standard neuroleptic drugs for positive symptoms and may be somewhat more effective for negative symptoms. It produces more neurological side effects than clozapine but fewer than standard neuroleptics. However, it raises prolactin levels.

Risperidone is now prescribed for a broad range of psychotic patients, and many clinicians seem to use it before clozapine for patients who do not respond to standard drugs, because they regard it as safer. Another new drug is Olanzapine (Zyprexa) which is at least as effective as standard drugs for positive symptoms and more effective for negative symptoms. It has few neurological side effects at ordinary clinical doses, and it does not significantly raise prolactin levels.

Although it does not produce most ofclozapine's most troubling side effects, including agranulocytosis, some patients taking olanzapine may become sedated or dizzy, develop dry mouth, or gain weight. In rare cases, liver function tests become transiently abnormal.

Outcome studies in schizophrenia are usually based on hospital treatment studies and may not be representative of the population of schizophrenia patients. At the extremes of outcome, 20 of patients seem to recover completely after one episode of psychosis, whereas 14-19% of patients develop a chronic unremitting psychosis and never fully recover. In general, clinical outcome at five years seems to follow the rule of thirds: with about 35 of patients in the poor outcome category; 36 in the good outcome category, and the remainder with intermediate outcome. Prognosis in schizophrenia does not seem to worsen after five years.

Whatever the reasons, there is increasing evidence that leaving schizophrenia untreated for long periods early in course of the illness may negatively affect the outcome. However, the use of drugs is often delayed for patients experiencing a first episode of the illness. The patients may not realize that they are ill, or they may be afraid to seek help; family members sometimes hope the problem will simply disappear or cannot persuade the patient to seek treatment; clinicians may hesitate to prescribe antipsychotic medications when the diagnosis is uncertain because of potential side effects. Indeed, at the first manifestation of the disease, schizophrenia is difficult to distinguish from bipolar manic-depressive disorders,-severe depression, drugrelated disorders, and stress-related disorders. Since the optimum treatments differ among these diseases, the long term prognosis of the disorder also differs the beginning of the treatment.

For both schizophrenia and bipolar disorder, all the known molecules used for the treatment of schizophrenia have side effects and act only against the symptoms of the disease.

There is a strong need for new molecules without associated side effects and directed against targets which are involved in the causal mechanisms of schizophrenia and bipolar disorder.

W00058510 [httpww.getthepatent.com/Login.dog/SexamsuportFetchDefaut.doAVO005851 0.cpc?fromCache= 1p0art=maintoolbar--botom Page 11 of 737 WO 00/58510 PCT/IB00/00435 9 Therefore, tools facilitating the discovery and characterization of these targets are necessary and useful.

Schizophrenia and bipolar disorder are now considered to be brain diseases, and emphasis is placed on biological determinants in researching the conditions. In the case of schizophrenia, neuroimaging and neuropathological studies have shown evidence of brain abnormalities in schizophrenic patients. The timing of these pathological changes is unclear but are likely to be a defect in early brain development. Profound changes have also occurred in hypotheses concerning neurotransmitter abnormalities in schizophrenia. The dopamine hypothesis has been extensively revised and is no longer considered as a primary causative model.

The aggregation of schizophrenia and bipolar disorder in families, the evidence from twin and adoption studies, and the lack of variation in incidence worldwide, indicate that schizophrenia and bipolar disorder are primarily genetic conditions, although environmental risk factors are also involved at some level as necessary, sufficient, or interactive causes. For example, schizophrenia occurs in 1% of the general population. But, if there is one grandparent with schizophrenia, the risk of getting the illness increases to about one parent with Schizophrenia, to about 10%. When both parents have schizophrenia, the risk rises to approximately Consequently, there is a strong need to identify genes involved in schizophrenia and bipolar disorder. The knowledge of these genes will allow researchers to understand the etiology of schizophrenia and bipolar disorder and could lead to drugs and medications which are directed against the cause of the diseases, not just against their symptoms.

There is also a great need for new methods for detecting a susceptibility to schizophrenia and bipolar disorder, as well as for preventing or following up the development of the disease. Diagnostic tools could also prove extremely useful. Indeed, early identification of subjects at risk of developing schizophrenia would enable early and/or prophylactic treatment to be administered. Moreover, accurate assessments of the eventual efficacy of a medicament as well as the patent's eventual tolerance to it may enable clinicians to enhance the benefit/risk ratio of schizophrenia and bipolar disorder treatment regimes.

SUMMARY OF THE INVENTION The present invention stems from the identification of novel polymorphisms including biallelic markers located on the human chromosome 13q31-q33 locus, the identification and characterization of novel schizophrenia-related genes located on the human chromosome 13q31q33 locus, and from the identification of genetic associations between alleles of biallelic W00058510 [httpQJtww.getthepatent.comILogpaog/Sexam-s pport/Fetch/Default.dogNVO005851 0.cpcromCacle=dart=maintoolbar-boftom Page 12 of 737 WO 00/58510 PCT/IB00/00435 markers located on the human chromosome 13q31-q33 locus and disease, as confirmed and characterized in a panel of human subjects. The invention furthermore provides a fine structure map of the region which includes the schizophrenia-associated gene sequences.

The present invention pertains to nucleic acid molecules comprising the genomic sequences of novel human genes encoding sbgl, g34665, sbg2, g35017 and g35018 proteins, proteins encoded thereby, as well as antibodies thereto. The sbgl, g34665, sbg2, g35017 and g35018 genomic sequences may also comprise regulatory sequence located upstream and downstream (3'-end) of the transcribed portion of said gene, these regulatory sequences being also part of the invention. The invention also deals with the cDNA sequence encoding the sbgl and g35018 proteins.

Oligonucleotide probes or primers hybridizing specifically with a sbgl, g34665, sbg2, g35017 or g35018 genomic or cDNA sequence are also part of the present invention, as well as DNA amplification and detection methods using said primers and probes.

A further object of the invention consists of recombinant vectors comprising any of the nucleic acid sequences described above, and in particular of recombinant vectors comprising a sbgl, g34665, sbg2, g35017 or g35018 regulatory sequence or a sequence encoding a sbgl, g34665, sbg2, g35017 or g35018 protein, as well as of cell hosts and transgenic non human animals comprising said nucleic acid sequences or recombinant vectors.

The invention also concerns to biallelic markers of the sbgl, g34665, sbg2, g35017 or g35018 gene and the use thereof. Included are probes and primers for use in genotyping biallelic markers of the invention.

An embodiment of the invention encompasses any polynucleotide of the invention attached to a solid support polynucleotide may comprise a sequence disclosed in the present specification; optionally, said polynucleotide may comprise, consist of, or consist essentially of any polynucleotide described in the present specification; optionally, said determining may be performed in a hybridization assay, sequencing assay, microsequencing assay, or an enzymebased mismatch detection assay; optionally, said polynucleotide may be attached to a solid support, array, or addressable array; optionally, said polynucleotide may be labeled.

Finally, the invention is directed to drug screening assays and methods for the screening of substances for the treatment of schizophrenia, bipolar disorder or a related CNS disorder based on the role ofsbgl, g34665, sbg2, g35017 and g35018 nucleotides and polynucleotides in disease. One object of the invention deals with animal models of schizophrenia, including mouse, primate, non-human primate bipolar disorder or related CNS disorder based on the role of sbgl in disease. The invention is also directed to methods for the screening of substances or molecules that inhibit the expression of sbgl, g34665, sbg2, g3501 7 or g35018, as well as with W00058510 [htt:/Iww w.getthepatent.comLog i n.dog/Sexam.suport/Fetchefau It. dog V0005851 0.cpc?fromCache= 1 part=maintoobar-bottom] Page 13 of 737 WO 00/58510 PCT/IB00/00435 11 methods for the screening of substances or molecules that interact with a sbgl, g34665, sbg2, g35017 or g35018 polypeptide, or that modulate the activity of a sbgl, g34665, sbg2, g35017 or g35018 polypeptide.

As noted above, certain aspects of the present invention stem from the identification of genetic associations between schizophrenia and bipolar disorder and alleles of biallelic markers located on the human chromosome 13q31-q33 region, and more particularly on a subregion thereof referred to herein as Region D. The invention provides appropriate tools for establishing further genetic associations between alleles of biallelic markers on the 13q31- 13q33 locus and either side effects or benefit resulting from the administration of agents acting on schizophrenia or bipolar disorder, or schizophrenia or bipolar disorder symptoms, includng agents like chlorpromazine, clozapine, risperidone, olanzapine, sertindole, quetiapine and ziprasidone.

The invention provides appropriate tools for establishing further genetic associations between alleles of biallelic markers on the 13q31-13q33 locus and a trait. Methods and products are provided for the molecular detection of a genetic susceptibility in humans to schizophrenia and bipolar disorder. They can be used for diagnosis, staging, prognosis and monitoring of this disease, which processes can be further included within treatment approaches. The invention also provides for the efficient design and evaluation of suitable therapeutic solutions including individualized strategies for optimizing drug usage, and screening of potential new medicament candidates.

Additional embodiments are set forth in the Detailed Description of the Invention and in the Examples.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a diagram showing the exon structure of the sbgl gene.

Figure 2 is a table demonstrating the statistical significance of allelic frequencies of selected chromosome 13q31-q33 biallelic markers of the invention in sporadic and familial French Canadian schizophrenia cases and controls.

Figure 3 is a table demonstrating the results of a haplotype association analysis between total French Canadian schizophrenia cases and haplotypes which consist of chromosome 13q31q33 biallelic markers of the invention.

Figure 4 is a table showing the involvement of selected biallelic markers of the invention in statistically significant haplotypes.

Figure 5 is a table demonstrating the results of a haplotype association analysis between French Canadian schizophrenia cases and haplotypes which consist of chromosome 13q31 -q33 W0005851 0 [http:1twwwgetthe patent. com/Log in.dog/Sexa nsupportietchiefauItdogNO005851 0 trom~acne= 1 part~malntoolbar-bottom]Page 14 of 737 WO 00/58510 PCT/IB00/00435 12 biallelic markers of the invention.

Figure 6 is a table demonstrating the results of a haplotype association analysis between French Canadian schizophrenia cases and haplotypes which consist of chromosome 13q31-q33 biallelic markers of the invention.

Figures 7A and 7B show the results of a haplotype association analysis (Omnibus LR test value distribution) between schizophrenia cases and haplotypes comprising Region D biallelic markers of the invention.

Figures 8A and 8B show the results of a haplotype association analysis (HaplotMaxM test value distribution) between schizophrenia cases and haplotypes comprising Region D biallelic markers of the invention.

Figures 9A and 9B show the results of a haplotype association analysis (Omnibus LR test value distribution) between bipolar disorder cases and haplotypes comprising Region D biallelic markers of the invention.

Figures 10A and 10B show the results of a haplotype association analysis (HaploMaxM test value distribution) between bipolar disorder cases and haplotypes comprising Region D biallelic markers of the invention.

Figures 11 A and 11B show the results of a haplotype association analysis (HaploMaxS test value distribution) between bipolar disorder cases and haplotypes comprising Region D biallelic markers of the invention.

Figure 12 shows a comparison of the number of significant single and multipoint biallelic marker analyses in subregions Dl to D4 of Region D in French Canadian samples.

Figure 13 shows a summary of the number of significant single and multipoint biallelic marker analyses across Region D in French Canadian samples.

Figure 14 shows a comparison of the number of significant single and multipoint biallelic marker analyses in subregions Dl to D4 of Region D in United States schizophrenia samples.

Figure 15 shows a summary of the number of significant single and multipoint biallelic marker analyses across Region D in United States schizophrenia samples.

Figure 16 shows a comparison of the number of significant single and multipoint biallelic marker analyses in subregions DI to D4 of Region D in Argentinian bipolar disorder samples.

Figure 17 shows a summary of the number of significant single and multipoint biallelic marker analyses across Region D in Argentinian bipolar disorder samples.

Figure 18 shows the effect of injection of an sbgl peptide on locomotor activity and stereotypy of mice.

W0005851 0 fhttp IwwA. etthe patent. com/Lo g.dog/Sexam.supnrIecIea~d~W05S 0.cc?fromCache= 1 part=maintoolbar--boftomL Page 15 of 737 WO 00/58510 PCT/IBOO/00435 13 Figure 19 is a block diagram of an exemplary computer system.

Figure 20 is a flow diagram illustrating one embodiment of a process 200 for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database.

Figure 21 is a flow diagram illustrating one embodiment of a process 250 in a computer for determining whether two sequences are homologous.

Figure 22 is a flow diagram illustrating one embodiment of an identifier process 300 for detecting the presence of a feature in a sequence.

BRIEF DESCRIPTION OF THE SEQUENCES PROVIDED IN THE SEQUENCE LISTING SEQ ID No. I contains the approximately 319kb of genomic nucleotide sequence comprising sbgl, g34665, sbg2, g35017 and g35018 nucleic acid sequences and the biallelic markers Al to A360 and polymorphisms A361 to A489 located on the human chromosome 13q31-q33 locus.

SEQ ID Nos. 2 to 26 contain cDNA sequences of the sbgl gene.

SEQ ID Nos. 27 to 35 contain amino acid sequences of sbgl polypeptides, encoded by cDNAs of SEQ ID Nos. 2 to 26.

SEQ ID No. 36 to 40 contain cDNA sequences of the g35018 gene SEQ ID No. 41 to 43 contain amino acid sequences of an g35018 polypeptides.

SEQ ID No. 44 to 53 contain primers used to isolate sbgl cDNAs SEQ ID No. 54 to 111 contain genomic nucleotide sequences comprising exons of the sbgl gene from several different primates.

SEQ ID Nos. 112 to 229 respectively contain the nucleotide sequence of the amplicons which comprise the biallelic markers A243 to A360 located on the human chromosome 13q31q33 locus.

SEQ ID No 230 contains a primer containing the additional PU 5' sequence described further in Example 2 SEQ ID No 231 contains a primer containing the additional RP 5' sequence described further in Example 2.

In accordance with the regulations relating to Sequence Listings, the following codes have been used in the Sequence Listing to indicate the locations of biallelic markers within the sequences and to identify each of the alleles present at the polymorphic base. The code in the sequences indicates that one allele of the polymorphic base is a guanine, while the other W00058510 [http:/Avww.getthepatent.comfLogjn.dog/Sexam.sortFetchDefaut. dogO005851 o.cocfromC ache= 1 Dart=maintoolbar-bottom] Page 16 of 737 WO 00/58510 PCT/IB00/00435 14 allele is an adenine. The code in the sequences indicates that one allele of the polymorphic base is a thymine, while the other allele is a cytosine. The code in the sequences indicates that one allele of the polymorphic base is an adenine, while the other allele is an cytosine. The code in the sequences indicates that one allele of the polymorphic base is a guanine, while the other allele is a thymine. The code in the sequences indicates that one allele of the polymorphic base is a guanine, while the other allele is a cytosine. The code in the sequences indicates that one allele of the polymorphic base is an adenine, while the other allele is an thymine.

DETAILED DESCRIPTION OF THE INVENTION The identification of genes involved in a particular trait such as a specific central nervous system disorder, like schizophrenia, can be carried out through two main strategies currently used for genetic mapping: linkage analysis and association studies. Linkage analysis requires the study of families with multiple affected individuals and is now useful in the detection of mono- or oligogenic inherited traits. Conversely, association studies examine the frequency of marker alleles in unrelated trait individuals compared with trait negative controls, and are generally employed in the detection of polygenic inheritance.

Candidate region on the chromosome 13 (linkage analysis) Genetic link or "linkage" is based on an analysis of which of two neighboring sequences on a chromosome contains the least recombinations by crossing-over during meiosis.

To do this, chromosomal markers, like microsatellite markers, have been localized with precision on the genome. Genetic link analysis calculates the probabilities of recombinations on the target gene with the chromosomal markers used, according to the genealogical tree, the transmission of the disease, and the transmission of the markers. Thus, if a particular allele of a given marker is transmitted with the disease more often than chance would have it (recombination level between 0 and it is possible to deduce that the target gene in question is found in the neighborhood of the marker.

Using this technique, it has been possible to localize several genes demonstrating a genetic predisposition of familial cancers. In order to be able to be included in a genetic link study, the families affected by a hereditary form of the disease must satisfy the "informativeness" criteria: several affected subjects (and whose constitutional DNA is available) per generation, and at best having a large number of siblings.

By linkage analysis, observations have been made, according to which a candidate region for schizophrenia is present on chromosome 13q32 locus (Blouin et al., 1998). Linkage analysis has been successfully applied to map simple genetic traits that show clear Mendelian inheritance patterns and which have a high penetrance, but this method suffers from a variety of W00058510 IhttDJ/ ww.getthepatent.com/Login.dog/Sexam.su port/Fetch/Default.docj/00058510.cpcfromCacte=1part=maintoolbar-bottom1 Page 17 of 737 WO 00/58510 PCT/IB00/00435 drawbacks. First, linkage analysis is limited by its reliance on the choice of a genetic model suitable for each studied trait. Furthermore, the resolution attainable using linkage analysis is limited, and complementary studies are required to refine the analysis of the typical 20 Mb regions initially identified through this method. In addition, linkage analysis have proven difficult when applied to complex genetic traits, such as those due to the combined action of multiple genes and/or environmental factors. In such cases, too great an effort and cost are needed to recruit the adequate number of affected families required for applying linkage analysis to these situations. Finally, linkage analysis cannot be applied to the study of traits for which no large informative families are available.

In the present invention alternative means for conducting association studies rather than linkage analysis between markers located on the chromosome 13q31-q33 locus and a trait, preferably schizophrenia or bipolar disorder, are disclosed.

In the present application, additional biallelic markers located on the human chromosome 13q31-q33 locus associated with schizophrenia are disclosed. The identification of these biallelic markers in association with schizophrenia has allowed for the further definition of the chromosomal region suspected of containing a genetic determinant involved in a predisposition to develop schizophrenia and has resulted in the identification of novel gene sequences disclosed herein which are associated with a predisposition to develop schizophrenia.

The present invention thus provides an extensive fine structure map of the 13q31-q33 locus, including novel biallelic markers located on the human 13q31-q33 locus, approximately 319kb of genomic nucleotide sequence of a subregion of the human 13q3 l-q33 locus, and polymorphisms including biallelic markers and nucleotide deletions in said 319kb genomic sequence. The biallelic markers of the human chromosome 13q31-q33 locus and the nucleotide sequences, polymorphisms and gene sequences located in Region D subregion of the human chromosome 13q31-q33 locus are useful as genetic and physical markers for further mapping studies. The approximately 319kb of genomic nucleotide sequence disclosed herein can further serve as a reference in genetic or physical analysis of deletions, substitutions, and insertions in that region. Additionally, the sequence information provides a resource for the further identification of new genes in that region. Additionally, the sequences comprising the the schizophrenia-associated genes are useful, for example, for the isolation of other genes in putative gene families, the identification of homologs from other species, treatment of disease and as probes and primers for diagnostic or screening assays as described herein.

These identified polymorphisms are used in the design of assays for the reliable detection of genetic susceptibility to schizophrenia and bipolar disorder. They can also be used in the design of drug screening protocols to provide an accurate and efficient evaluation of the W00058510 [httpJ/www.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.dog/WO0058510.cpc?fromCace= 1part=malntoolbar=bottom Page 18 of 737 WO 00/58510 PCT/IBOO/00435 16 therapeutic and side-effect potential of new or already existing medicament or treatment regime.

Definitions As used interchangeably herein, the term "oligonucleotides", and "polynucleotides" include RNA, DNA, or RNA/DNA hybrid sequences of more than one nucleotide in either single chain or duplex form. The term "nucleotide" as used herein as an adjective to describe molecules comprising RNA, DNA, or RNA/DNA hybrid sequences of any length in singlestranded or duplex form. The term "nucleotide" is also used herein as a noun to refer to individual nucleotides or varieties of nucleotides, meaning a molecule, or individual unit in a larger nucleic acid molecule, comprising a purine or pyrimidine, a ribose or deoxyribose sugar moiety, and a phosphate group, or phosphodiester linkage in the case of nucleotides within an oligonucleotide or polynucleotide. Although the term "nucleotide" is also used herein to encompass "modified nucleotides" which comprise at least one modifications an alternative linking group, an analogous form of purine, an analogous form of pyrimidine, or an analogous sugar, for examples of analogous linking groups, purine, pyrimidines, and sugars see for example PCT publication No. WO 95/04064. However, the polynucleotides of the invention are preferably comprised of greater than 50% conventional deoxyribose nucleotides, and most preferably greater than 90% conventional deoxyribose nucleotides. The polynucleotide sequences of the invention may be prepared by any known method, including synthetic, recombinant, ex vivo generation, or a combination thereof, as well as utilizing any purification methods known in the art.

The term "purified" is used herein to describe a polynucleotide or polynucleotide vector of the invention which has been separated from other compounds including, but not limited to other nucleic acids, carbohydrates, lipids and proteins (such as the enzymes used in the synthesis of the polynucleotide), or the separation of covalently closed polynucleotides from linear polynucleotides. A polynucleotide is substantially pure when at least about 50 preferably 60 to 75% of a sample exhibits a single polynucleotide sequence and conformation (linear versus covalently close). A substantially pure polynucleotide typically comprises about preferably 60 to 90% weight/weight of a nucleic acid sample, more usually about and preferably is over about 99% pure. Polynucleotide purity or homogeneity may be indicated by a number of means well known in the art, such as agarose or polyacrylamide gel electrophoresis of a sample, followed by visualizing a single polynucleotide band upon staining the gel. For certain purposes higher resolution can be provided by using HPLC or other means well known in the art.

The term "isolae" requires that the material be removed from its original environment W00058510 [http:Ivww.getthepatent.com/Login .do/Sexam.support/FetchDefault.doANO05851 0.cpc?fromCache=l part=maintoolbar=bottom] Page 19 of 737 WO 00/58510 PCT/IB00/00435 17 the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or DNA or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotide could be part of a vector and/or such polynucleotide or polypeptide could be part of a composition, and still be isolated in that the vector or composition is not part of its natural environment.

The term "primer" denotes a specific oligonucleotide sequence which is complementary to a target nucleotide sequence and used to hybridize to the target nucleotide sequence. A primer serves as an initiation point for nucleotide polymerization catalyzed by either DNA polymerase, RNA polymerase or reverse transcriptase.

The term "probe" denotes a defined nucleic acid segment (or nucleotide analog segment, polynucleotide as defined herein) which can be used to identify a specific polynucleotide sequence present in samples, said nucleic acid segment comprising a nucleotide sequence complementary of the specific polynucleotide sequence to be identified.

The terms "trait" and "phenotvpe" are used interchangeably herein and refer to any clinically distinguishable, detectable or otherwise measurable property of an organism such as symptoms of, or susceptibility to a disease for example. Typically the terms "trait" or "phenotype" are used herein to refer to symptoms of, or susceptibility to schizophrenia or bipolar disorder, or to refer to an individual's response to an agent acting on schizophrenia or bipolar disorder, or to refer to symptoms of, or susceptibility to side effects to an agent acting on schizophrenia or bipolar disorder.

The term "allele" is used herein to refer to variants of a nucleotide sequence. A biallelic polymorphism has two forms. Typically the first identified allele is designated as the original allele whereas other alleles are designated as alternative alleles. Diploid organisms may be homozygous or heterozygous for an allelic form.

The term "heterozygositv rate" is used herein to refer to the incidence of individuals in a population, which are heterozygous at a particular allele. In a biallelic system the heterozygosity rate is on average equal to 2 Pa(l-Pa), where Pa is the frequency of the least common allele. In order to be useful in genetic studies a genetic marker should have an adequate level of heterozygosity to allow a reasonable probability that a randomly selected person will be heterozygous.

The term "genotype" as used herein refers the identity of the alleles present in an individual or a sample. In the context of the present invention a genotype preferably refers to the description of the biallelic marker alleles present in an individual or a sample. The term W00058510 [http:#/ww. ettheiatentcomlo in.do /SexamsuportFetcDefa uIt.dog W0005851 0cpcfromCache= 1 part=maintoolbar=bottomL Page 20 of 737 WO 00/58510 PCT/IB00/00435 18 "genotyping" a sample or an individual for a biallelic marker involves determining the specific allele or the specific nucleotide(s) carried by an individual at a biallelic marker.

The term "mutation" as used herein refers to a difference in DNA sequence between or among different genomes or individuals which has a frequency below 1%.

The term "haolotvpe" refers to a combination of alleles present in an individual or a sample on a single chromosome. In the context of the present invention a haplotype preferably refers to a combination of biallelic marker alleles found in a given individual and which may be associated with a phenotype.

The term "polymorphism" as used herein refers to the occurrence of two or more alternative genomic sequences or alleles between or among different genomes or individuals.

"Polymorphic" refers to the condition in which two or more variants of a specific genomic sequence can be found in a population. A "polymorphic site" is the locus at which the variation occurs. A polymorphism may comprise a substitution, deletion or insertion of one or more nucleotides. A single nucleotide polymorphism is a single base pair change. Typically a single nucleotide polymorphism is the replacement of one nucleotide by another nucleotide at the polymorphic site. Deletion of a single nucleotide or insertion of a single nucleotide, also give rise to single nucleotide polymorphisms. In the context of the present invention "single nucleotide polymorphism" preferably refers to a single nucleotide substitution. Typically, between different genomes or between different individuals, the polymorphic site may be occupied by two different nucleotides.

The terms "biallelic polymorphism" and "biallelic marker" are used interchangeably herein to refer to a polymorphism having two alleles at a fairly high frequency in the population, preferably a single nucleotide polymorphism. A "biallelic marker allele" refers to the nucleotide variants present at a biallelic marker site. Typically the frequency of the less common allele of the biallelic markers of the present invention has been validated to be greater than preferably the frequency is greater than 10%, more preferably the frequency is at least heterozygosity rate of at least 0.32), even more preferably the frequency is at least heterozygosity rate of at least 0.42). A biallelic marker wherein the frequency of the less common allele is 30% or more is termed a "high quality biallelic marker." All of the genotyping, haplotyping, association, and interaction study methods of the invention may optionally be performed solely with high quality biallelic markers.

The location of nucleotides in a polynucleotide with respect to the center of the polynucleotide are described herein in the following manner. When a polynucleotide has an odd number of nucleotides, the nucleotide at an equal distance from the 3' and 5' ends of the polynucleotide is considered to be "at the center" of the polynucleotide, and any nucleotide W0005851 0 [httpMww.g etMe patent.comog i n.dog/Sexa m. su o rtFetctgefault. d og O005 85 1 0.cpcifromCarhe= 1 part=maintoolbar-boftomJ Page 21 of 737 WO 00/58510 PCT/IB00/00435 19 immediately adjacent to the nucleotide at the center, or the nucleotide at the center itself is considered to be "within I nucleotide of the center." With an odd number ofnucleotides in a polynucleotide any of the five nucleotides positions in the middle of the polynucleotide would be considered to be within 2 nucleotides of the center, and so on. When a polynucleotide has an even number of nucleotides, there would be a bond and not a nucleotide at the center of the polynucleotide. Thus, either of the two central nucleotides would be considered to be "within 1 nucleotide of the center" and any of the four nucleotides in the middle of the polynucleotide would be considered to be "within 2 nucleotides of the center", and so on. For polymorphisms which involve the substitution, insertion or deletion of 1 or more nucleotides, the polymorphism, allele or biallelic marker is "at the center" of a polynucleotide if the difference between the distance from the substituted, inserted, or deleted polynucleotides of the polymorphism and the 3' end of the polynucleotide, and the distance from the substituted, inserted, or deleted polynucleotides of the polymorphism and the 5' end of the polynucleotide is zero or one nucleotide. If this difference is 0 to 3, then the polymorphism is considered to be "within 1 nucleotide of the center." If the difference is 0 to 5, the polymorphism is considered to be "within 2 nucleotides of the center." If the difference is 0 to 7, the polymorphism is considered to be "within 3 nucleotides of the center," and so on. For polymorphisms which involve the substitution, insertion or deletion of 1 or more nucleotides, the polymorphism, allele or biallelic marker is "at the.center" of a polynucleotide if the difference between the distance from the substituted, inserted, or deleted polynucleotides of the polymorphism and the 3' end of the polynucleotide, and the distance from the substituted, inserted, or deleted polynucleotides of the polymorphism and the 5' end of the polynucleotide is zero or one nucleotide. If this difference is 0 to 3, then the polymorphism is considered to be "within 1 nucleotide of the center." If the difference is 0 to 5, the polymorphism is considered to be "within 2 nucleotides of the center." If the difference is 0 to 7, the polymorphism is considered to be "within 3 nucleotides of the center," and so on.

The term "upstream" is used herein to refer to a location which, is toward the 5' end of the polynucleotide from a specific reference point.

The terms "base paired" and "Watson Crick base paired" are used interchangeably herein to refer to nucleotides which can be hydrogen bonded to one another be virtue of their sequence identities in a manner like that found in double-helical DNA with thymine or uracil residues linked to adenine residues by two hydrogen bonds and cytosine and guanine residues linked by three hydrogen bonds (See Stryer, Biochemistry, 4th edition, 1995).

The terms "complementary" or "complement thereof" are used herein to refer to the sequences of polynucleotides which is capable of forming Watson Crick base pairing with W00058510 [ppJ/www.getthe patent.com g ogorec ef 0.cpcfromCache= 1art=maintoolbar=bottom] Page 22 of 737 WO 00/58510 PCT/IB00/00435 another specified polynucleotide throughout the entirety of the complementary region. This term is applied to pairs of polynucleotides based solely upon their sequences and not any particular set of conditions under which the two polynucleotides would actually bind.

The terms "sbgl gene when used herein, encompasses genomic, mRNA and cDNA sequences encoding the sbgl protein, including the untranslated regulatory regions of the genomic DNA.

The terms g34665 gene when used herein, encompasses genomic, mRNA and cDNA sequences encoding the g3 466 5 protein, including the untranslated regulatory regions of the genomic DNA.

The terms "sbg2 gene when used herein, encompasses genomic, mRNA and cDNA sequences encoding the sbg2 protein, including the untranslated regulatory regions of the genomic DNA.

The terms g35017 gene when used herein, encompasses genomic, mRNA and cDNA sequences encoding the g35017 protein, including the untranslated regulatory regions of the genomic DNA.

The terms "g35018 gene when used herein, encompasses genomic, mRNA and cDNA sequences encoding the g35018 protein, including the untranslated regulatory regions of the genomic DNA.

As used herein the term "13q31-q33-related biallelic marker" relates to a set of biallelic markers residing in the human chromosome 13q31-q33 region. The term 13q31-q33-related biallelic marker encompasses all of the biallelic markers disclosed in Table 6b and any biallelic markers in linkage disequilibrium therewith ,as well as any biallelic markers disclosed in Table 6c and any biallelic markers in linkage disequilibrium therewith. The preferred chromosome 13q3 I-q33-related biallelic marker alleles of the present invention include each one the alleles described in Tables 6b individually or in groups consisting of all the possible combinations of the alleles listed.

As used herein the term "Region D-related biallelic marker" relates to a set of biallelic markers in linkage disequilibrium with the subregion of the chromosome 13q31-q33 region referred to herein as Region D. The term Region D-related biallelic marker encompasses the biallelic markers Al to A242, A249 to A251, A257 to A263, A269 to A270, A278, A285 to A299, A303 to A307, A324, A330, A334 to A335, A346 to 357 and A361 to A489 disclosed in Table 6b and any biallelic markers in linkage disequilibrium with markers Al to A242, A249 to A251, A257 to A263, A269 to A270, A278, A285 to A299, A303 to A307, A324, A330, A334 to A335, A346 to 357 and A361 to A489.

As used herein the term "sbgl-related biallelic marker" relates to a set of biallelic W0006851 0 [httqpJwwwgetthepatent.com/Login.dog/Sexa m. suportFetch/Default.d og1W005851 0.cpcfromache= 1 partgmaintoolbar-bottom] Page 23 of 737 WO 00/58510 PCT/IB00/00435 21 markers in linkage disequilibrium with the sbgl gene or an sbgl nucleotide sequence. The term sbgl-related biallelic marker encompasses the biallelic markers A85 to A219 disclosed in Table 6b and any biallelic markers in linkage disequilibrium therewith.

As used herein the term "g34665-related biallelic marker" relates to a set of biallelic markers in linkage disequilibrium with the g34665 gene or an sbgl nucleotide sequence. The term g34665-related biallelic marker encompasses the biallelic markers A230 to A236 disclosed in Table 6b and any biallelic markers in linkage disequilibrium therewith.

As used herein the term "sbg2-related biallelic marker" relates to a set of biallelic markers in linkage disequilibrium with the sbg2 gene or an sbg2 nucleotide sequence. The term sbg2-related biallelic marker encompasses the biallelic markers A79 to A99 disclosed in Table 6b and any biallelic markers in linkage disequilibrium therewith.

As used herein the term "g35017-related biallelic marker" relates to a set of biallelic markers in linkage disequilibrium with the g35017 gene or an g35017 nucleotide sequence. The term g35017-related biallelic marker encompasses biallelic marker A41 disclosed in Table 6b and any biallelic markers in linkage disequilibrium therewith.

As used herein the term "g35018-related biallelic marker" relates to a set of biallelic markers in linkage disequilibrium with the g35018 gene or a g35018 nucleotide sequence. The term g35018-related biallelic marker encompasses the biallelic markers Al to A39 disclosed in Table 6b and any biallelic markers in linkage disequilibrium therewith.

The term "polypeptide" refers to a polymer of amino acids without regard to the length of the polymer; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term also does not specify or exclude prost-expression modifications of polypeptides, for example, polypeptides which include the covalent attachment of glycosyl groups, acetyl groups, phosphate groups, lipid groups and the like are expressly encompassed by the term polypeptide. Also included within the definition are polypeptides which contain one or more analogs of an amino acid (including, for example, non-naturally occurring amino acids, amino acids which only occur naturally in an unrelated biological system, modified amino acids from mammalian systems etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.

The term "purified" is used herein to describe a polypeptide of the invention which has been separated from other compounds including, but not limited to nucleic acids, lipids, carbohydrates and other proteins. A polypeptide is substantially pure when at least about preferably 60 to 75% of a sample exhibits a single polypeptide sequence. A substantially pure polypeptide typically comprises about 50%, preferably 60 to 90% weight/weight of a protein sample, more usually about 95%, and preferably is over about 99% pure. Polypeptide purity or W00058510 fhttD:/ww.aeheoatent. comoin.doaISexam.suooortiFetcd/Defaut.doaA0005851 0.coc?fromCache 1Dart=maintoolbarbotom Paae 24 of 737 WO 00/58510 PCT/IB00/00435 22 homogeneity is indicated by a number of means well known in the art, such as agarose or polyacrylamide gel electrophoresis of a sample, followed by visualizing a single polypeptide band upon staining the gel. For certain purposes higher resolution can be provided by using HPLC or other means well known in the art.

As used herein, the term "non-human animal" refers to any non-human vertebrate, birds and more usually mammals, preferably primates, farm animals such as swine, goats, sheep, donkeys, and horses, rabbits or rodents, more preferably rats or mice. As used herein, the term "anima!" is used to refer to any vertebrate, preferable a mammal. Both the terms "animal" and "mammal" expressly embrace human subjects unless preceded with the term "non-human".

As used herein, the term "antibody" refers to a polypeptide or group ofpolypeptides which are comprised of at least one binding domain, where an antibody binding domain is formed from the folding of variable domains of an antibody molecule to form three-dimensional binding spaces with an internal surface shape and charge distribution complementary to the features of an antigenic determinant of an antigen., which allows an immunological reaction with the antigen. Antibodies include recombinant proteins comprising the binding domains, as wells as fragments, including Fab, Fab', F(ab)2, and F(ab')2 fragments.

As used herein, an "antigenic determinant" is the portion of an antigen molecule, in this case an sbgl polypeptide, that determines the specificity of the antigen-antibody reaction. An "epitope" refers to an antigenic determinant of a polypeptide. An epitope can comprise as few as 3 amino acids in a spatial conformation which is unique to the epitope. Generally an epitope comprises at least 6 such amino acids, and more usually at least 8-10 such amino acids.

Methods for determining the amino acids which make up an epitope include x-ray crystallography, 2-dimensional nuclear magnetic resonance, and epitope mapping e.g. the Pepscan method described by Geysen et al. 1984; PCT Publication No. WO 84/03564; and PCT Publication No. WO 84/03 506.

Variants and Fragments The invention also relates to variants and fragments of the polynucleotides described herein, particularly of a nucleotide sequence of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229, and particularly of a nucleotide sequence of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 containing one or more biallelic markers and/or other polymorphisms according to the invention.

Variants of polynucleotides, as the term is used herein, are polynucleotides that differ from a reference polynucleotide. A variant of a polynucleotide may be a naturally occurring W00058510 [httpJtwww.qetihepatent.comfIogin.dogSexam.suport/Fetch/DefauIt.dogWO005851 0.Cpc-omCache= 1part=maintoolbar-bottom] Page 25 of 737 WO 00/58510 PCT/IB00/00435 23 variant such as a naturally occurring allelic variant, or it may be a variant that is not known to occur naturally. Such non-naturally occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms.

Generally, differences are limited so that the nucleotide sequences of the reference and the variant are closely similar overall and, in many regions, identical.

Variants of polynucleotides according to the invention include, without being limited to, nucleotide sequences which are at least 95% identical to a polynucleotide selected from the group consisting of the nucleotide sequences SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or to any polynucleotide fragment of at least 8 consecutive nucleotides of a polynucleotide selected from the group consisting of the nucleotide SEQ ID Nos. I to 26, 36 to 40 and 54 to 229, and preferably at least 99% identical, more particularly at least 99.5% identical, and most preferably at least 99.8% identical to a polynucleotide selected from the group consisting of the nucleotide SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or to any polynucleotide fragment of at least 40, 50, 70, 80, 100, 250, 500 1000 or 2000, to the extent that the length is consistent with the particular sequence ID, consecutive nucleotides of a polynucleotide selected from the group consisting of the nucleotide sequences of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229.

Nucleotide changes present in a variant polynucleotide may be silent, which means that they do not alter the amino acids encoded by the polynucleotide. However, nucleotide changes may also result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence. The substitutions, deletions or additions may involve one or more nucleotides. The variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions.

A polynucleotide fragment is a polynucleotide having a sequence that is entirely the same as part but not all of a given nucleotide sequence, preferably the nucleotide sequence of an sbgl polynucleotide, and variants thereof, or of a polynucleotide of any of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229, or a polynucleotide comprising one of the biallelic markers Al to A360 or polymorphism A361 to A489, or the complements thereof. Such fragments may be "freestanding", i.e. not part of or fused to other polynucleotides, or they may be comprised within a single larger polynucleotide of which they form a part or region. Indeed, several of these fragments may be present within a single larger polynucleotide. Optionally, such fragments may comprise, consist of, or consist essentially of a contiguous span of at least 8, 10, 12, 15, 18, 25, 30, 35, 40, 50, 70, 80, 100, 250, 500, 1000 or 2000 nucleotides in length of any of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229.

Identity Between Nucleic Acids Or Polypeptides W00058510 http: w .getthepatent.comin.dog/Sexam.suportFetchDefault.do O 55 .cpc?fromCache= 1 part=maintoolbar=bottom] Page 26 of 737 WO 00/58510 PCT/IB00/00435 24 The terms "percentage of sequence identity" and "percentage homology" are used interchangeably herein to refer to comparisons among polynucleotides and polypeptides, and are determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequehces. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Homology is evaluated using any of the variety of sequence comparison algorithms and programs known in the art. Such algorithms and programs include, but are by no means limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85(8):2444-2448; Altschul et al., 1990, J. Mol. Biol.

215(3):403-410; Thompson et al., 1994, Nucleic Acids Res. 22(2):4673-4680; Higgins et al., 1996, Methods Enzymol. 266:383-402; Altschul et al., 1990, J. Mol. Biol. 215(3):403-410; Altschul et al., 1993, Nature Genetics 3:266-272). In a particularly preferred embodiment, protein and nucleic acid sequence homologies are evaluated using the Basic Local Alignment Search Tool ("BLAST") which is well known in the art (see, Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87:2267-2268; Altschul et al., 1990, J. Mol. Biol. 215:403-410; Altschul et al., 1993, Nature Genetics 3:266-272; Altschul et al., 1997, Nuc. Acids Res.

25:3389-3402). In particular, five specific BLAST programs are used to perform the following task: BLASTP and BLAST3 compare an amino acid query sequence against a protein sequence database; BLASTN compares a nucleotide query sequence against a nucleotide sequence database; BLASTX compares the six-frame conceptual translation products of a query nucleotide sequence (both strands) against a protein sequence database; TBLASTN compares a query protein sequence against a nucleotide sequence database translated in all six reading frames (both strands); and TBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.

The BLAST programs identify homologous sequences by identifying similar segments, which are referred to herein as "high-scoring segment pairs," between a query amino or nucleic W00058510 [httpJtwwgetthepatentpcomfogin.dog/Sexam.suportFetcVDefauIt.dgAN0005851 .cpc?fromCache=1part=maintoolbar--boftomi Page 27 of 737 WO 00/58510 PCT/IB00/00435 acid sequence and a test sequence which is preferably obtained from a protein or nucleic acid sequence database. High-scoring segment pairs are preferably identified aligned) by means of a scoring matrix, many of which are known in the art. Preferably, the scoring matrix used is the BLOSUM62 matrix (Gonnet et al., 1992, Science 256:1443-1445; Henikoff and Henikoff, 1993, Proteins 17:49-61). Less preferably, the PAM or PAM250 matrices may also be used (see, Schwartz and Dayhoff, eds., 1978, Matrices for Detecting Distance Relationships: Atlas of Protein Sequence and Structure, Washington: National Biomedical Research Foundation). The BLAST programs evaluate the statistical significance of all highscoring segment pairs identified, and preferably selects those segments which satisfy a userspecified threshold of significance, such as a user-specified percent homology. Preferably, the statistical significance of a high-scoring segment pair is evaluated using the statistical significance formula of Karlin (see, Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87:2267-2268).

The BLAST programs may be used with the default parameters or with modified parameters provided by the user.

Stringent Hybridization Conditions By way of example and not limitation, procedures using conditions of high stringency are as follows: Prehybridization of filters containing DNA is carried out for 8 h to overnight at 0 C in buffer composed of6X SSC, 50 mM Tris-HCI (pH 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 pg/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65C, the preferred hybridization temperature, in prehybridization mixture containing 100 g/ml denatured salmon sperm DNA and 5-20 X 10 cpm of 32 P-labeled probe.

Subsequently, filter washes can be done at 37C for 1 h in a solution containing 2 x SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA, followed by a wash in 0.1 X SSC at 50 0 C for 45 min.

Following the wash steps, the hybridized probes are detectable by autoradiography. Other conditions of high stringency which may be used are well known in the art and as cited in Sambrook et al., 1989; and Ausubel et al., 1989. These hybridization conditions are suitable for a nucleic acid molecule of about 20 nucleotides in length. There is no need to say that the hybridization conditions described above are to be adapted according to the length of the desired nucleic acid, following techniques well known to the one skilled in the art. The suitable hybridization conditions may for example be adapted according to the teachings disclosed in the book of Hames and Higgins (1985) or in Sambrook et al.(1989).

Genomic Sequences of the polynucleotides of the invention W0005851 0 [htto/ww.oathheoatent.comLoain.doa/Sexam.suDootFetcDefault-doaNvo00585J O.c1)cfrOmCarhe= 1 Dart=maintoolbar-boftoml Paae 28 of 737 WO 00/58510 PCT/IB00/00435 26 The present invention concerns genomic DNA sequences of the sbgl, g34665, sbg2, g35017 and g35018 genes, as well as DNA sequences of the human chromosome 13q31-q33 region, and more particularly, a subregion thereof referred to herein as region D.

As referred to herein, genomic sequences of sbg2, g35017 and g35018 are indicated by nucleotide position in the 5' to 3' orientation on SEQ ID No 1. sbgl and g34665 are transcribed in the opposite direction, ie. from the nucleic acid strand complementary to SEQ ID No 1.

Genomic sequences of sbgl and g34 6 6 5 are thus indicated by nucleotide position in the 3' to orientation on SEQ ID No 1.

Preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of nucleotide positions 31 to 292651 and 292844 to 319608 of SEQ ID No. 1, or the complements thereof. Further nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides, to the extent that the length of said span is consistent with the length of the SEQ ID, of SEQ ID Nos. 112 to 229. Optionally, said span is at least 12, 15, 18, 20, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of SEQ ID Nos. 112 to 114, 115 to 117, 119, 121, 125 to 145, 147 to 150, 159 to 170, and 176 to 229.

The invention also encompasses a purified, isolated, or recombinant polynucleotide comprising a nucleotide sequence having at least 70, 75, 80, 85, 90, or 95% nucleotide identity with a nucleotide sequence of of nucleotide positions 31 to 292651 and 292844 to 319608 of SEQ ID No. 1, or a complementary sequence thereto or a fragment thereof. Another object of the invention consists of a purified, isolated, or recombinant nucleic acid that hybridizes with a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of SEQ ID No 1 or a complementary sequence thereto or a variant thereof, under the stringent hybridization conditions as defined above.

Additional preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100 or 200 nucleotides of SEQ ID No 1 or the complements thereof, wherein said contiguous span comprises a biallelic marker. Optionally, said contiguous span comprises ar biallelic marker selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to A112, A114 to A177, A179 to A197, A199 to A222, A224 to A242. Optionally allele 2 is present at the biallelic marker. It should be noted that nucleic acid fragments of any size and sequence may be comprised by the polynucleotides described in this section.

W00058510 fhtto://www.aettheDatent-comlLooin doa/Sexam.sunort/Fetch/Default.doa/WO0058510.coc?fromCache=1part=maintoolbar=bottom] Pae 29 of 737 WO 00/58510 PCT/IBOO/00435 Another particularly preferred set of nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides, to the extent that such a length is consistent with the lengths of the particular nucleotide position, of SEQ ID No. I or the complements thereof, wherein said contiguous span comprises at least 1, 2, 3, 5, or nucleotide positions of any one of the following ranges of nucleotide positions, designated posi to posl66, of SEQ ID No. 1 listed in Table 1 below: Table 1 Position Position in SEQ ID No 1 Position Position in SEQ ID No I Begining End Begining End pos 1 36 2000 pos84 156001 158000 pos2 2001 4000 pos 85 158001 160000 pos3 4001 6000 pos86 160001 162000 pos4 6001 8000 pos87 162001 164000 8001 10000 pos88 164001 166000 pos 6 10001 12000 pos89 166001 168000 pos7 12001 14000 pos90 168001 170000.

pos 8 14001 16000 pos91 170001 172000 pos9 16001 18000 pos92 172001 174000 pos 10 18001 20000 pos93 174001 176000 pos 11 20001 22000 pos94 176001 178000 pos 12 22001 24000 pos95 178001 180000 pos 13 24001 26000 pos 9 6 180001 182000 pos 14 26001 28000 pos 9 7 182001 184000 pos 15 28001 29966 pos98 184001 186000 pos 16 30116 32000 pos99 186001 188000 pos 17 32001 34000 pos 100 188001 190000 pos 18 34001 36000 pos 101 190001 192000 pos 19 36001 38000 pos 102 192001 194000 pos 20 38001 40000 pos 103 194001 196000 pos 21 40001 42000 pos 104 196001 198000 pos 2 2 42001 44000 pos 105 198001 200000 pos 23 44001 46000 pos 106 200001 201000 W00581 0[htp~lww~gttepaen~collgin.dog/$examsuportFetchDefault.doIWO005851 o.cpc?fromCachle= 1 Dart= m aintoolba r--bottom] Page 30 of 737 WO 00/58510 PCT/EBOO/00435 Position Position in SEQ ID No 1 Position Position in SEQ ID No 1 Begining End Begining End pos 24 46001 48000 pos 107 201001 202000 pos 25 48001 50000 pos 108 202001 204000 pos 26 50001 52000 pos 109 204001 206000 pos 27 52001 54000 pos 110 206001 208000 pos 2 8 54001 56000 pos 111 208001 210000 pos 2 9 56001 58000 pos 112 210001 212000 pos 30 58001 60000 pos 113 212001 214000 pos 31 60001 62000 pos 114 214001 216000 pos 3 2 62001 64000 pos 115 216001 218000 pos 33 64001 66000 pos 116 218001 220000 pos 3 4 66001 68000 pos 117 220001 222000 pos 3 5 68001 70000 pos 118 222001 224000 pos 3 6 70001 72000 pos 119 224001 226000 pos 3 7 72001 74000 pos 120 226001 228000 pos 38 74001 76000 pos 121 228001 230000 pos 39 76001 78000 pos 122 230001 232000 pos 40 78001 80000 pos 123 232001 234000 pos 41 80001 82000 pos 124 234001 236000 pos 42 182001 84000 pos 125 236001 2 38000 pos 43 84001 86000 pos 126 238001 240000 pos 44 86001 88000 pos 127 240001 242000 pos 45 88001 90000 pos 128 242001 244000 pos 46 90001 92000 pos 129 244001 246000 pos 47 92001 94000 pos 130 246001 248000 pos 48 94001 96000 pos 131 248001 250000 pos 4 9 96001 98000 pos 132 250001 252000 pos 50 98001 100000 pos 133 252001 254000 pos 51 10000 102000 pos 134 254001 256000 pos 5 2 10200 104000 pos 135 256001 258000 pos 5 3 10400 106000 pos 136 258001 260000 pos 54 10600 108000 pos 137 1260001 262000 W0005851 0 rhttoltwww.aettheoatent.comlLoain-doolsexam.suooortlFetchloefault doaNV0005851 0.cpc?fromCacthe= 1 oart=maintoolbar--boftoml Paae 31 of 737 WO 00/58510 PCTIBOO/00435 Position Position in SEQ ID No 1 Position Position in SEQ fl) No 1 Begining End Begining End pos 55 10800 110000 pos13S8 262001 264000 pos 56 11000 102000 pos 139 264001 266000 57 10200 104000 pos 140 266001 268000 pos 58 10400 106000 p05 141 268001 270000 pos 59 10600 108000 pos 142 270001 272000 pos 60 10800 110000 pos 143 272001 274000 pos 6 1 11000 112000 pos 144 274001 276000 pos 62 11200 114000 pos 145 276001 278000 pos 63 11400 116000 pos 146 278001 280000 pos 64 11600 118000 pos 147 280001 .282000 pos 6 5 11800 120000 pos 148 282001 284000 pos; 66 12000 122000 pos 149 284001 286000 pos 6 7 12200 124000 pos 150 286001 288000pos 6 8 12400 126000 pos; 151 288001 290000 pos 6 9 12600 128000 pos 152 290001 292000 pos 70 12800 130000 pos 153 292001 294000 pos 71 13000 132000 pos 154 294001 296000 pos 72 13200 134000 pos 155 296001 298000 pos 73 13400 136000 pos 156 298001 300000 pos 74 13600 138000 pos 157 300001 302000 pos 75 13800 140000 pos 158 302001 304000 pos 76 14000 142000 pos 159 304001 306000 pos 77 14200 144000 pos 160 306001 308000 pos 78 14400 146000 pos 161 308001 310000 pos 79 14600 148000 pos 162 310001 312000 148000 150000 pos; 163 312001 314000 pos 8 1 150001 15200.0 pos 164 314001 316000 pos 82 152001 154000 posl 6 5 316001 318000 pos 83 154001 1156000 pos 166 318001 319608 Nucleic Acid Sequences of sbgl, g34665, sbg2, g3501 7 and g35018 The present invention encompasses the g34665, g346 7 3, g34667, g35017 and g35018 W0005851 0 etthepatent.comortFetDefau.do 0058510ccfromCache= part~maintoolbar=bottom] Page 32 of 737 WO 00/58510 PCT/IB00/00435 genes and nucleotide sequences.

g346 6 In one aspect, the invention concerns g34665 genomic sequences consisting of, consisting essentially of, or comprising the sequence of nucleotide positions 292653 to 296047 of SEQ ID No 1, a sequence complementary thereto, as well as fragments and variants thereof.

These polynucleotides may be purified, isolated, or recombinant.

Particularly preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 50, 60, 70, 80, 90, 100, 150 or 200 nucleotides, to the extent that the length of said span is consistent with the nucleotide position range, of nucleotide positions 292653 to 292841, 295555 to 296047 or 295580 to 296047 of SEQ ID No I. Further preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150 or 200 nucleotides, to the extent that the length of said span is consistent with the nucleotide position range, of nucleotide positions 292653 to 292841, 295555 to 296047, or 295580 to 296047 of SEQ ID No 1, or the complements thereof, wherein said contiguous span comprises a g34665-related biallelic marker. Optionally, said biallelic marker is selected from the group consisting of A230 to A236. It should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section.

The invention also encompasses a purified, isolated, or recombinant polynucleotide comprising a nucleotide sequence having at least 70, 75, 80, 85, 90, 95, 97, 98 or 99% nucleotide identity with a nucleotide sequence of of nucleotide positions 290653 to 292652, 292653 to 296047, 292653 to 292841, 295555 to 296047, 295580 to 296047 and 296048 to 298048 of SEQ ID No 1 or a complementary sequence thereto or a fragment thereof. The nucleotide differences as regards to nucleotide positions 290652 to 292652, 292653 to 296047, 292653 to 292841, 295555 to 296047, 295580 to 296047 and 296048 to 298048 of SEQ ID No I may be generally randomly distributed throughout the entire nucleic acid. Nevertheless, preferred nucleic acids are those wherein the nucleotide differences as regards to the nucleotide sequence of SEQ ID No I are predominantly located outside the coding sequences contained in the exons. These nucleic acids, as well as their fragments and variants, may be used as oligonucleotide primers or probes in order to detect the presence of a copy of the g34665 gene in a test sample, or alternatively in order to amplify a target nucleotide sequence within the g346 6 5 sequences.

Another object of the invention consists of a purified, isolated, or recombinant nucleic acid that hybridizes with a g34665 nucleotide sequence of any of nucleotide positions 292653 to W0005851 0 [htnJvww.getthepatent.com/Login.dog/Sexam.suportFetchDefaut.doqNVO005851 0.cpc?fromCahe= 1 part=maintoolbar-bottom Page 33 of 731 WO 00/58510 PCT/IB00/00435 31 296047, 292653 to 292841, 295555 to 296047, 295980 to 296047 and 296048 to 298048 SEQ ID No I or a complementary sequence thereto or a variant thereof, under the stringent hybridization conditions as defined above.

The g3 4 6 6 5 genomic nucleic acid comprises at least 3 exons. The exon positions in SEQ ID No I are detailed below in Table 2.

Table 2 Exon Position in SEQ ID No 1 Intron Position in SEQ ID No 1 Beginning End Beginning End B 292653 292841 B-Ab 292842 295554 Ab 295555 296047 B-A 292842 295979 A 295980 296047 Thus, the invention embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the 3 exons of the g34665 gene, or a sequence complementary thereto. The invention also deals with purified, isolated, or recombinant nucleic acids comprising a combination of two exons of the g34665 gene.

Intron B-Ab refers to the nucleotide sequence located between Exon B and Exon Ab, and so on. The position of the introns is detailed in Table 2. Thus, the invention embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the 2 introns of the g34665 gene, or a sequence complementary thereto.

While this section is entitled "Genomic Sequences of g34665," it should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section, flanking the genomic sequences of g34665 on either side or between two or more such genomic sequences.

A g34665 polynucleotide or gene may further contain regulatory sequences both in the non-coding 5'-flanking region and in the non-coding 3'-flanking region that border the region containing said genes or exons.

Polynucleotides derived from 5' and 3' regulatory regions are useful in order to detect the presence of at least a copy of a nucleotide sequence comprising a g34665 nucleotide sequence of SEQ ID No. 1 or a fragment thereof in a test sample. Polynucleotides carrying the regulatory elements located at the 5' end and at the 3' end of the genes comprising the exons of the present invention may be advantageously used to control the transcriptional and translational W00058510 tt:Itwlww. ethepatent.com/Loqi.do /Sexam.support/Fetch/Defaut.do O00585 1 0.cpcfromCache= 1 part=maintaoobar bottom] Page 34 of 737 WO 00/58510 PCT/IB00/00435 32 activity of a heterologous polynucleotide of interest.

Methods for identifying the relevant polynucleotides c6mprising biologically active g34665 regulatory fragments or variants of SEQ ID No 1 are further described herein. Thus, the present invention also relates to a purified or isolated nucleic acid comprising a polynucleotide which is selected from the group consisting of the 5' and 3' regulatory regions ofg34665, or a sequence complementary thereto or a biologically active fragment or variant thereof.

g3501 7 In one aspect, the invention concerns g35017 genomic sequences consisting of, consisting essentially of, or comprising the sequence of nucleotide positions 94124 to 94964 of SEQ ID No 1, a sequence complementary thereto, as well as fragments and variants thereof.

These polynucleotides may be purified, isolated, or recombinant.

The invention also encompasses a purified, isolated, or recombinant polynucleotide comprising a nucleotide sequence having at least 70, 75, 80, 85, 90, or 95% nucleotide identity with a nucleotide sequence of of nucleotide positions 94124 to 94964 SEQ ID No I or a complementary sequence thereto or a fragment thereof. The nucleotide differences as regards to nucleotide positions 94124 to 94964 SEQ ID No 1 may be generally randomly distributed throughout the entire nucleic acid. Nevertheless, preferred nucleic acids are those wherein the nucleotide differences as regards to the nucleotide sequence of SEQ ID No I are predominantly located outside the coding sequences contained in the exons. These nucleic acids, as well as their fragments and variants, may be used as oligonucleotide primers or probes in order to detect the presence of a copy of the g35017 gene in a test sample, or alternatively in order to amplify a target nucleotide sequence within the g35017 sequences.

Another object of the invention consists of a purified, isolated, or recombinant nucleic acid that hybridizes with a g35017 nucleotide sequence of any of nucleotide positions 94124 to 94964 of SEQ ID No I or a complementary sequence thereto or a variant thereof, under the stringent hybridization conditions as defined above.

Particularly preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200 or 500 nucleotides of nucleotide position 94124 to 94964 of SEQ ID No I or the complements thereof. Particularly preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200 or 500 nucleotides of nucleotide position 94124 to 94964 of SEQ ID No 1 or the complements thereof, wherein said contiguous span comprises a g35017 related biallelic marker. Optionally, said W0005851 0 [pl/www. m gi.dog/Sexa msupporttFetch/DefauIt. dog O00585 1 0cpcfrom Ga cte 1 part=maintoolbar--bottom Page 35 of 737 WO 00/58510 PCT/IB00/00435 33 biallelic marker is the biallelic marker designated A41 in Table 6b. It should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section.

While this section is entitled "Genomic Sequences of g35017," it should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section, flanking the genomic sequences of g35017 on either side or between two or more such genomic sequences.

A g35017 polynucleotide or gene may further contain regulatory sequences both in the non-coding 5'-flanking region and in the non-coding 3'-flanking region that border the region containing said genes or exons.

Polynucleotides derived from g35017 5' and 3' regulatory regions are useful in order to detect the presence of at least a copy of a nucleotide sequence comprising an g35017 nucleotide sequence of SEQ ID No. 1 or a fragment thereof in a test sample. Polynucleotides carrying the regulatory elements located at the 5' end and at the 3' end of the genes comprising the exons of the present invention may be advantageously used to control the transcriptional and translational activity of a heterologous polynucleotide of interest.

Methods for identifying the relevant polynucleotides comprising biologically active regulatory fragments or variants of a g35017 nucleic acid sequence of SEQ ID No 1 are further described herein. Thus, the present invention also relates to a purified or isolated nucleic acid comprising a polynucleotide which is selected from the group consisting of the 5' and 3' regulatory regions, or a sequence complementary thereto or a biologically active fragment or variant thereof. In one aspect, the 5' regulatory region may comprise a nucleotide sequence g35018 In one aspect, the invention concenrs g35018 genomic sequences consisting of, consisting essentially of, or comprising the sequence of nucleotide positions 1108 to 65853 of SEQ ID No 1, a sequence complementary thereto, as well as fragments and variants thereof.

These polynucleotides may be purified, isolated, or recombinant.

Particularly preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 50, 60, 70, 80, 90, 100, 150, 200, 500, or 1000 nucleotides, to the extent that said span is consistent with the nucleotide position range, of SEQ ID No 1, wherein said contiguous span comprises at least 1, 2, 3, 5, or 10 of the following nucleotide positions of SEQ ID No 1: 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812 and 65505 to 65853, or the complements thereof. Further W00058510 Lp hww.nethepatent.comLogin.dogSexamsupporYetch/DefaultdoqMO005851 O.cpc?fromCache=1 part=maintoolbar=bottoml Page 36 of 737 WO 00/58510 PCT/IB00/00435 34 preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 80, 90, 100, 150, 200, 500, or 1000 nucleotides of nucleotide positions 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812 or 65505 to 65853 of SEQ ID No 1, or the complements thereof, wherein said contiguous span comprises a g35018 related biallelic marker. Optionally, said biallelic marker is selected from the group consisting of Al to A39. It should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section.

The invention also encompasses a purified, isolated, or recombinant polynucleotide comprising a nucleotide sequence having at least 70, 75, 80, 85, 90, or 95% nucleotide identity with a nucleotide sequence of nucleotide positions 31 to 1107, 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854 of SEQ ID No 1 or a complementary sequence thereto or a fragment thereof. The nucleotide differences as regards to nucleotide positions 31 to 1107, 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854 of SEQ ID No 1 may be generally randomly distributed throughout the entire nucleic acid. Nevertheless, preferred nucleic acids are those wherein the nucleotide differences as regards to the nucleotide sequence of nucleotide positions 31 to 1107, 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854 of SEQ ID No I are predominantly located outside the coding sequences contained in the exons. These nucleic acids, as well as their fragments and variants, may be used as oligonucleotide primers or probes in order to detect the presence of a copy of the g35018 gene in a test sample, or alternatively in order to amplify a target nucleotide sequence within the g35018 sequences.

Another object of the invention consists of a purified, isolated, or recombinant nucleic acid that hybridizes with a g35018 nucleotide sequence of any of nucleotide positions 31 to 1107, 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854 SEQ ID No 1, or a complementary sequence thereto or a variant thereof, under the stringent hybridization conditions as defined above.

Yet further nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 70, 80, 90, 100, 150, 200 or 500 nucleotides, to the extent that said span is consistent with the W00058510 [http:/Iwww.getthepatent.com/Login.dog/Sexam.supportIFetch/DefauitdogNVO005851O.cpc?fromCache=1part=maintoolbar-bottom] Page 37 of 737 WO 00/58510 PCT/IB00/00435 nucleotide position range, of SEQ ID No 1, wherein said contiguous span comprises at least 1, 2, 3, 5, or 10 of the following nucleotide positions of SEQ IDNo 1: 1255 to 1289, 29967 to 30115, 30225 to 30282, or the complements thereof, as well as polynucleotides having at least 75, 80, 85, 90, or 95% nucleotide identity with said span and polynucleotides capable of hybridizing with said span.

The g35018 genomic nucleic acid comprises at least 8 exons. The exon positions in SEQ ID No 1 are detailed below in Table 3.

Table 3 Exon Position in SEQ ID No 1 Intron Position in SEQ ID No 1 Beginning End Beginning End A 1108 1289 A 1290 14876 B 14877 14920 B 14921 18777 Bbis 18778 18862 Bbis 18863 25592 C 25593 25740 C 25741 29387 D 29388 29502 D 29503 29966 E 29967 30282 E 30283 64665 F 64666 64812 F 64813 65504 G 65505 65853 Thus, the invention embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the 8 exons of the g35018 gene, or a sequence complementary thereto. The invention also deals with purified, isolated, or recombinant nucleic acids comprising a combination of at least two exons of the 35018 gene, wherein the polynucleotides are arranged within the nucleic acid, from the to the 3'-end of said nucleic acid, in the same order as in SEQ ID No 1.

Intron 1 refers to the nucleotide sequence located between Exon 1 and Exon 2, and so on. The position of the introns is detailed in Table 3. Thus, the invention embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the 7 introns of the g35018 gene, or a sequence complementary thereto.

While this section is entitled "Genomic Sequences of g35018," it should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section, flanking the genomic sequences of g35018 on either side or between two or more such genomic sequences.

A g35018 polynucleotide or gene may further contain regulatory sequences both in the W0005851 0 [http:twwwgetthepatent.com/Login.dog/ xm ortJFetchIDefaut.dogAN0005851 O.cpc?fromCache= 1 part=maintoolbar=bottoml Page 38 of 737 WO 00/58510 PCT/IB00/00435 36 non-coding 5'-flanking region and in the non-coding 3'-flanking region that border the region containing said genes or exons.

Polynucleotides derived from 5' and 3' regulatory regions are useful in order to detect the presence of at least a copy of a nucleotide sequence comprising an g35018 nucleotide sequence of SEQ ID No. 1 or a fragment thereof in a test sample. Polynucleotides carrying the regulatory elements located at the 5' end and at the 3' end of the genes comprising the exons of the present invention may be advantageously used to control the transcriptional and translational activity of a heterologous polynucleotide of interest.

Methods for identifying the relevant polynucleotides comprising biologically active regulatory fragments or variants of SEQ ID No 1 are further described herein. Thus, the present invention also relates to a purified or isolated nucleic acid comprising a polynucleotide which is selected from the group consisting of the 5' and 3' regulatory regions, or a sequence complementary thereto or a biologically active fragment or variant thereof.

In one embodiment, a 5' regulatory region may comprise an isolated, purified, or recombinant polynucleotide comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 50, 60, 70, 80, 90, 100, 150, 200, 500, or 1000 nucleotides of nucleotide positions 31 to 1107 of SEQ ID No I, or the complements thereof. In one embodiment, a 3' regulatory region' may comprise an isolated, purified, or recombinant polynucleotide comprising a contiguous span of at least 12, 15, 18,20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, or 1000 nucleotides of nucleotide positions 65854 to 67854 of SEQ ID No 1, or the complements thereof.

Genomic Sequences ofsbgl polynucleotides Particularly preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising, consisting essentially of, or consisting of a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, or 1000 nucleotides of nucleotide positions 213818 to 243685 of SEQ ID No 1, or the complements thereof. Also encompassed are purified, isolated, or recombinant polynucleotide comprising a nucleotide sequence having at least 70, 75, 80, 85, 90, or 95% nucleotide identity with nucleotide positions 213818 to 243685 of SEQ ID No 1, or a complementary sequence thereto or a fragment thereof. Nucleic acids of the invention encompass an sbgl nucleic acid from any source, including primate, non-human primate, mammalian and human sbgl nucleic acids.

Further preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, or 1000 nucleotides of SEQ ID No 1 or the W0005851 0[hftp:/twww. etthepatent.com/Login.dog/$examsuportFetch/efault.dogAN0005851 0.cpc?fromCarhe= 1part=maintoolbar--botoml Page 39 of 737 WO 00/58510 PCTIIBOOIOO435 complements thereof, wherein said contiguous span comprises an sbgI related biallelic marker.

Optinally, said biallelic marker is selected from the group consisting of A85 to A219.

Optinally, said biallelic marker is selected from the group consisting of A85 to A94, A96 to A106, A108 to Al112, Al 114 to A177, Al179 to A197 and A199 to A219.

It should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section.

The human sbgl gene comprises exons selected from at least 22 different exons or exon forms, referred to herein as exons MSI1, M 1, M692, M862, MS2, M 1069, M 1090, Ml 1117, N N2, Nbis, 0, 01, 02, Obis, P, X, QI, Q, Qbis, Rbis and R Of these, the following exon sets contain sequence overlap and do not occur together in an mRNA: exons MI, M692, M862, MS2, M1090 M1069 and MI1117; exons MSI, MI. M692 and M862; exons N and N2; exons 0 1 and 02; exons Q and Qbis; exons R and R bis; and exons Q and Qi1.

The nucleotide positions of sbgl exons in SEQ ID No. I are detailed below in Table 4.

The exon structure of the sbgl gene is further shown in Figure 1.

Table 4 Exon Position in SEQ ID No I Beginning End R 215819 215941 Rbis 215819 215975 Qbis 216661 216952 Q 216661 217061 QI 217027 217061 X 229647 229742 P 230408 230721 Obis 231272 231412 02 231787 231880 01 231870 231879 0 234174 234321 Nbis 237406 237428 N2 239719 239807 N 239719 239853 M117 240528 240569 FM109r 240528 240596 W00058510 [http:/Mww. etthepatent.com-og in.dog/SexamsuppoFetchefa u t.dogNIO005B 1 0.cPcfromCache= 1 part=maintoo bar=bottoml Page 40 of 737 WO 00/58510 PCT/IB00/00435 38 M1069 240528 240617 MS2 240528 240644 M862 240528 240824 M692 240528 240994 Ml 240528 241685 MS1 240800 240993 Thus, the invention embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the exons of the sbgl gene, or a sequence complementary thereto. Preferred are purified, isolated, or recombinant polynucleotides comprising at least one exon having the nucleotide position ranges listed in Table 4 selected from the group consisting of the exons MSI, Ml, M692, M862, MS2, M1069, M1090, M 117, N, N2, Nbis, 0, 01, 02, Obis, P, X, Ql, Q, Qbis, R and Rbis of the sbgl gene, or a complementary sequence thereto or a fragment or a variant thereof. Also encompassed by the invention are purified, isolated, or recombinant nucleic acids comprising a combination of at least two exons of the sbgl gene selected from the group consisting of exons MS1, M1, M692, M862, MS2, M1069, M1090, M 1117, N, N2, Nbis, 0, 01, 02, Obis, P, X, Q1, Q, Qbis, R and Rbis, wherein the polynucleotides are arranged within the nucleic acid in the same relative order as in SEQ IDNo. 1.

Particularly preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100 or 200 nucleotides of SEQ ID No 1, wherein said contiguous span comprises at least 1, 2, 3, 5, or 10 of the following nucleotide positions of SEQ ID No 1:213818 to 215818, 215819 to 215941,215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993 and 241686 to 243685, or the complements thereof.

Another object of the invention consists of a purified, isolated, or recombinant nucleic acid that hybridizes with an sbgl nucleotide sequence of nucleotide positions 213818 to 243685, 213818 to 215818, 215819 to 215941, 215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, W0005851 0 [http:/t www.getthepatent.com/Login-do/Sexam. supportFetchoefa ut.dogNVO005851 Page 41 of 737 WO 00/58510 PCT/IB00/00435 39 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993 or 241686 to 243685 of SEQ ID No 1, or a complementary sequence thereto or a variant thereof, under the stringent hybridization conditions as defined above.

The present invention further embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the introns of the sbgl gene, or a sequence complementary thereto.

In other embodiments, the present invention encompasses the sbgl gene as well as sbgl genomic sequences consisting of, consisting essentially of, or comprising the sequence of nucleotide positions 215819 to 241685 of SEQ ID No 1, a sequence complementary thereto, as well as fragments and variants thereof.

The invention also encompasses a purified, isolated, or recombinant polynucleotide comprising a nucleotide sequence of sbgl having at least 70, 75, 80, 85, 90, or 95% nucleotide identity with a sequence selected from the group consisting of nucleotide positions 213818 to 215818, 215819 to 215941, 215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993 and 241686 to 243685 of SEQ ID No. I or a complementary sequence thereto or a fragment thereof. The nucleotide differences as regards the nucleotide positions 213818 to 215818, 215819 to 215941, 215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993 and 241686 to 243685 of SEQ ID No. I may generally be distributed throughout the nucleic acid.

These nucleic acids, as well as their fragments and variants, may be used as oligonucleotide primers or probes in order to detect the presence of a copy of a gene comprising an sbgl nucleic acid sequence in a test sample, or alternatively in order to amplify a target nucleotide sequence within an sbgl nucleic acid sequence or adjoining region.

Additional preferred nucleic acids of the invention include isolated, purified, or recombinant sbgl polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100 or 200 nucleotides of nucleotide positions 213818 to 215818, 215819 to 215941, 215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412,231787 to 231880, W00058510 [http/www.getthepatent.com/Login.do/Sexam.support/Fetch/Default.dog /00058510.cpc?fromCache=1part=maintoolbar=bottom] Page 42 of 737 WO 00/58510 PCT/IB00/00435 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993, 215819 to 241685 and 241686 to 243685 of SEQ ID No 1, or the complements thereof, wherein said contiguous span comprises at least one biallelic marker. Optionally, said contiguous span comprises an sbgl-related biallelic marker. It should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section. Either the original or the alternative allele may be present at said biallelic marker.

Yet further nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 80, 90, 100, 150, 200 or 500 nucleotides, to the extent that said span is consistent with the nucleotide position range, of SEQ ID No 1, wherein said contiguous span comprises at least 1, 2, 3, 5, or 10 of the following nucleotide positions of SEQ ID No 1: 215820 to 215941, 216661 to 217009, 230409 to 290721, 231272 to 231411, 234202 to 234321, 240528 to 240567, 240528 to 240827 and 240528 to 240996, or the complements thereof, as well as polynucleotides having at least 70, 75, 80, 85, 90, or 95% nucleotide identity with said span, and polynucleotides capable of hybridizing with said span.

The present invention also comprises a purified or isolated nucleic acid encoding an sbgl protein having the amino acid sequence of any one of SEQ ID Nos 27 to 35 or a peptide fragment or variant thereof.

While this section is entitled "Genomic Sequences of sbgl," it should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section, flanking the genomic sequences sbgl on either side or between two or more such genomic sequences.

Sbgl cDNA Sequences The expression of the sbgl gene has been shown to lead to the production of several mRNA species. Several cDNA sequences corresponding to these mRNA are set forth in SEQ ID Nos 2 to 26.

The invention encompasses a purified, isolated, or recombinant nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID Nos 2 to 26, complementary sequences thereto, splice variants thereof, as well as allelic variants, and fragments thereof. Moreover, preferred polynucleotides of the invention include purified, isolated, or recombinant sbgl cDNAs consisting of, consisting essentially of, or comprising a nucleotide sequence selected from the group consisting of SEQ ID Nos 2 to 26. Particularly W00058510 fttpJtwww.getthepatent.com/Login.dog/exam.suportIFetch/Defaut.doNO00585 1O.cpctromace= part=maintoornarbotIomI Page 43 t 737 WO 00/58510 PCT/IB00/00435 41 preferred nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 8, 12, 15, 18, 20, 25, 30, 35, 40, 50, 75, 80, 100, 200 or 500 nucleotides, to the extent that the length of said contiguous span is consistent with the length of the SEQ ID, of a nucleotide sequence selected from the group consisting of SEQ ID Nos 2 to 26, or the complements thereof.

The invention also pertains to a purified or isolated nucleic acid comprising a polynucleotide having at least 70, 80, 85, 90 or 95% nucleotide identity with a polynucleotide selected from the group consisting of SEQ ID Nos 2 to 26, advantageously 99% nucleotide identity, preferably 99.5% nucleotide identity and most preferably 99.8% nucleotide identity with a polynucleotide selected from the group consisting of SEQ ID Nos 2 to 26, or a sequence complementary thereto or a biologically active fragment thereof.

Another object of the invention relates to purified, isolated or recombinant nucleic acids comprising a polynucleotide that hybridizes, under the stringent hybridization conditions defined herein, with a polynucleotide selected from the group consisting of SEQ ID Nos 2 to 26, or a sequence complementary thereto or a variant thereof or a biologically active fragment thereof.

The sbgl cDNA forms of SEQ ID Nos 2 to 26 are further described in Table 5a below.

Shown on the Table 5a are the positions of the 5' UTR, the open reading frame (ORF), the 3' UTR and the polyA signal on the respective SEQ ID No. Also shown are the sbgl exons comprising the cDNA form of a particular SEQ ID No.

Table SEQ cDNA Pos range of Pos range of Pos range of Pos range of ID No 5UTR ORF 3UTR polyA signal 2 M862NOQbisR 1 253 254 304 305 995 971 976 3 M862NOObisP 1 253 254 304 305 1035 1020 1025 4 MI 1 187 188 520 521 1158 M862NOP 1 253 254 304 305 894 879 884 6 M1090NOXQbisR 1 25 26 76 77 863 839 844 7 M1117N2001P 2 310 311 603 588 593 8 MII 7N20P 2 358 359 593 578 583 9 MI 117NOO1P 2 49 50 649 634 639 M1117NOO2P 2 49 50 733 718 723 11 MSIMS2NOQbisR 1 267 268 318 319 1009 985 990 W00058510 [http:/tww.getthepatent.comfLogin.dog/Sexam.supportl/Fetch/Default.dogqNVW00058510.cpc?fromCache=1part=maintoolbar=bottom] Page 44 of 737 WO 00/58510 PCT/IBOO/00435 12 M1069NOQR 1 46 47 97 98 897 873 878 13 M1069N2OQIQbisR 1 46 47 343 344 777 753 758 14 M1069NOQ1QbisR 1 46 47 97 98 823 799 804 M1069N2002QbisR 1 46 47 427 428 836 812 817 16 M1069NOO2QbisR 1 46 47 97 98 882 858 863 17 M 1069N2NbisOO2X 1 46 47 235 236 955 931 936 QbisR 18 M1069N2OQR 1 46 47 343 344 851 827 832 19 M1069N2OQbisR 1 46 47 508 509 742 718 723 M1069NNbisOQR 1 46 47 97 98 920 896 901 21 M1069NNbisOQbisR 1 46 47 97 98 811 787 792 22 M1069NOO2XQbisR 1 46 47 97 98 978 954 959 23 M1069NOXQR 1 46 47 97 98 993 969 974 24 M 1069NOQbisRbis 1 46 47 97 98 822 M 1069N2OQbisRbis 1 46 47 508 509 776 26 M 1069N2OXQR 1 46 47 367 368 947 923 928 Primers used to isolate the particular sbgl cDNAs listed above from RNA from various tissues are provided below in Table 5b. Primers designed to hybridize to nucleic acid sequences of exons MS 1, M862, M 1090, MI 117 and MS2, and exons P and R resulted in the cloning of multiple cDNA forms for several sets of primers. The primers used are listed in SEQ ID Nos 44 ot 53.

mRNA forms of sbgl were found to differ among tissues; Table 5c lists cDNA forms cloned from various tissues and the relative percentages and numbers of clones found per tissue for each listed sbgl mRNA form.

The present inventors have also identified further variations in cDNA sequence as obtained from various tissues and compared with the consensus sbgl genomic nucleotide sequence. The tissues from which cDNA was cloned were obtained from pooled individuals numbering from I I to 60. Table 5d below describes the identities of variants, the nucleotide position of the variation in nucleotide sequence of SEQ ID No 2, and the number of samples having the specified sequence for each respective nucleotide position on the sbgl cDNA sequence of SEQ ID No. 2. Also indicated in Table 5d are amino acid changes in the corresponding sbgl polypeptide sequence (described herein), if any, resulting from the nucleotide sequence variations in the cDNA of SEQ ID No 2.

W00058510 [http:/twww.gethepatentcom/Lo in.dog/Sexam.suportiFetch/Default.dogAN00585 10.cpc?fromCache= 1art=maintoolbar-bottom] Page 45 of 737 WO 00/58510 PCT/IB00/00435 43 These variants may represent rare polymorphisms or may be the result of tissue-specific RNA editing. Alternatively, some variations may be the result of the presence in the human genome of one or more sbgl-related genes or a small family of sbgl-related genes with strict tissue specificity of expression and small variation in gene structure. The latter hypothesis was tested by applicants for the case where the exon-intron structure of these genes are identical, demonstrating that variations in at least exons M and N are not the result of the presence of related genes.

The present invention thus further encompasses variant sbgl polynucleotides having at least one nucleotide substitution as described in Table 5d below. The nucleotide and amino acid variations as shown in Table 5d are shown in terms of the nucleotide sequence ofSEQ ID No. 2, and specify variations as found in exons M862, N, O, Qbis and R. The invention encompasses purified, isolated, or recombinant polynucleotides and polypeptides encoded thereby, wherein the polynucleotides comprise a contiguous span of at least 8, 12, 15, 18, 20, 25, 30, 35, 40, 60, 70, 80, 100, 150, or 200 nucleotides of SEQ ID No 2 or the complement thereof, and wherein said contiguous span further comprises a nucleotide sequence variation according to Table The present invention comprises a purified or isolated sbgl cDNA encoding an sbgl protein or a peptide fragment or variant thereof. In one embodiment, a purified or isolated nucleic acid encoding an sbgl protein may have the amino acid sequence of any of SEQ ID Nos 27 to 35 or a peptide fragment or variant thereof.

Preferred nucleic acids of the invention also include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 8, 12, 15, 18, 20, 25, 30, 35, 40, 50, 75, 80, 100, 200 or 500 nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID Nos 2 to 26, or the complements thereof, wherein said span comprises a sbgl-related biallelic marker of the invention. The positions of selected biallelic markers of the invention in sbgl cDNA sequences and polypeptide sequences are listed below in Table Said contiguous span may comprise a biallelic marker selected from the group of biallelic markers listed in Table 5e; optionally, said biallelic marker is selected from the group consisting of the biallelic markers located in an sbgl cDNA form, as listed in Table 5e; optionally, said biallelic marker is selected from the group consisting of the biallelic markers located in an sbgl coding sequence, as listed in Table Expression of sbgl mRNA was further confirmed by Northern blotting. Using a probe corresponding to exon O of the sbgl gene, a band corresponding to an sbgl mRNA was detected.

While this section is entitled "sbgl cDNA Sequences," it should be noted that nucleic W0005851 10 PhqtJwww. ef~~tn~ amIoin.dog/Sexam.suport/Fetch/Default.dog/WO00585 0.cPc?frOmCache=l1 art=maintoolbar--boftomI Page 46 of737 WO 00/58510 PCTIBOO/00435 acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section, flanking the genomic sequences of sbgl on either side or between two or more such genomic sequences.

0 a (.n Table PRIMERS cDNA Form Observed Tissueb g34872MbisEco CCCGAATTCCCAAACTTCTTTCATTTAAAGAACCA MSlMS2NOQbisR testis (SEQ ID No 26) g34 87 2LR130 9nBAmH1 ATGCGGGATCCAGAGATTCTCCCAGTCACACAGGCC3 (SEQ ID No 27) -0 g34 872genoLF22nEcoRI TACTGGAATTCCAGGTAGAGTGAAGCAAGTAATGTGTGTGTGAG M8 62NO~bisR (SEQ ID No 28) testis 0 g34 872LR130 9nBknHl ATGCGGGATCCAGAGATTCTCCCAGTCACACAGGC aniygdala (SEQ ID No 27) caudate nucleus C cerebellum3 hippocampus substantia nigra thalamus g34 872MterEco CGAGAATTCGATGATTTAGCTGGGAGGACCCAA (SEQ ID No g34872LRl305nBam TCGGGATCCAGTCACACAGGCCAGGT M1090NOQBISR testis C

CL

M109ON20QBISR 0 g34872LF1140ECOR1 GCTGGGAATTCGCTGGAAAAGCTGATGGGTGCTGATTCTC M1117NOQBISR 0 (SEQ ID No 32) testis C, g34872LRI309nBAmHl ATGCGGGATCCAGAGATTCTCCCAGTCACACAGGC M11l7N200BISR amygdala (SEQ ID No 27) M11l7N2002QbisR caudate nucleus M1117NOO2QbisR cerebellum M1117N200R corpus callosumn Cortex hippocampus3 substantia nigra a

(D

g34 872LF10 64Eco TCAGAATTCTCATCTCTGCTTCACAATGCCG (SEQ ID No 34)

C

g34872LRl3O9nBAmHl ATGCGGGATCCAGAGATTCTCCCAGTCACACAGGC MS2NOQlQbisR testis (SEQ ID No 27) MS2NOO2QbisR3 MS2N2O0lQbisR MS2NOQR 0 MS2NOQbisR

C

0 g3 4872genoLF22nEcoRI TACTGGAATTCCAGGTAGAGTGAAGCAAGTAATGTGTGTGTGAG 0 61 00 (SEQ D No32)> (SEQ ID No 33)M112O (SQ D1o351M6NOP 8 -3 g3482LF140EOR1GCTGGAATCGCGGAAAGCGATGGTGTGATC0 (SE IDNo 2) ri 0 0

(A~

c 0 0 LA CL 0* 0 0

CD

0 C0 Table Se Primers for Cloning Tissue Percentage cDNA Form cloned (exons) testicle 100% MSlMS2NOQbisR (95 clones) o CD M862 and R 3 testicle 100% M862NOQbisR (188 clones)a amygdala 100% M862NOQbisR (42 clones) caudate nucleus 100% M862NOQbisR (39 clones) cerebellum 100% tl862NOQbisR (87 clones) hippocampus 100% M862NOQbisR (36 clones) substantia nigra 100% M862NOQbisR (96 clones) thalamus 100% M862NOQbisR (30 clones) M1090 and R testicle 45% M1090NOQBISR (5 clones) M1090NOQBISR (5 clones) N1117and R10% M109ON20QBISR (1 clone) testicle 26% M1117NOQBISR (23 clones)0 70% Mlll7N2OQBISR (62 clones) 2% Mlll7N2002QbisR (2 clones) 0 1% Mlll7NOO2QbisR (1 clones) C, amygdala 100% M1117NOQBISR (90 clones) 7 caudate nucleus 100% M1117NOQBISR (94 clones)0 cerebellum 100% M1117NOQBISR (88 clones) corpus callosum. 100% M111l7NOQBISR (94 clones) cortex 100% M111l7NOQBISR (95 clones) 2 hippocampus 100% Mlll7N200R (66 clones) 0 substantia nigra 100% Mlll7N200R (90 clones) P MS2 and R testicle 1% MS2N2002QbisR (1 clones) 2% MS2N2OQlQbisR (2 clones) 19% MS2NOO2QbisR (18 clones) 2% M.S2NOQlQbisR 2 clones) 8% MS2NOQR (8 clones)

C

67% MS2NOQbisR (63 clones) 1 0 0 M1069 and R Testicle 67% MNOQbisR 16% MNOQR 3% MN2OqbisR 6% MNOXQR 2% 1% MNOO2XqbisR 2% MNNbisOQbisR 1% MNNbisOQR 1% MN2NbisOO2XqbisR 1% Brain Hypothalamus cDNA Cerebellum PAmygdala Cdna MQLT4 cells Spinal cord 100% MNOQbisR 100% 100% MNOQbisR 100% 100% 57% MNOQbisR 21% MN2OqbisR 18% MNOQR 3% MNOQbisRbis 1% M862 and P testicle 97% M862NOObisP (88 clones) 3% M862N0P (3 clones) M1117 and P hippocampus testicle 100% M1117NOP (80 clones) 58% M1117NOP (54 clones) 37% M11l7N2OP 35 clones) 1% Ml117N2001P (1 clone) 1% M1117NO01P 1 clone) 2% M1117NO02P 2 clones) M1117 and 0 Testicle Cerebellum Hippocampus Caudate nucleus Corpus callosum Amygdala 0 Lung MNO O1D Fetal liver

MNO

Pancreas

MNO

Stomach

MNO

cell line

MNO

Spinal cord MN20O= trachea MN20OX 0 C,3

CCA

00 I0

CD

C"

C,

0 0 0 0r Cr 0 00 w CA i1 Table Pos (1 to 998) genomic 122 170 178 209 226 248 258 286 301 325 351 391 393 429 436 468 497 511 529 538 540 571 584 608 616 702 706 718 803 829 856

A

T

G

T

A

G

T

beginning of exon N T/A: L->Q

A/G:R->G

A/G:K->R

A/T: S->C

T/C:S->P

beginning of exon 0

A/G:T->A

T/C:H->H

T/C:L->S

pr A/G:H->R G/A: R->K TIC: S->P

AIG:Q->R

beginning of exon Qbis T/C: V->V

T/C:V->A

T/C:Y->H

A/G:N->S

A/G: D->G

A

C

G

testicle 4 7A/ iG 48BA 48T 4 8G 47T/1C 48BA 4 8G 4 8T 4 8T 46T/2A 48BA 4 8G 48BA 4 8T 47A/1G 47T/1C 4 8T 48BA 4 8G 4 8T 48BA 48BT 4 8T 48BT 48BA 48BA 48BA 48BC 4 2G/ 6A 48BC 46A/1G 4 6C 4 6C sbgl (exons MB62NOQbisR) cerebellum Subs nigra amygdaia caudate nucleus 25SA 2 5A 25ST 25SG 25ST 2 5G 2 5G 25C 25T 25ST 25A 25G 25A 21T/4C 25A 25T 25ST 25A 25G 25C 25A 19T/6C 25ST 25ST 24G/1A 2 5A 25SA 25SC 25G 25SC 25SA 25SC 25SC 43A/lG 20G/24A 4 4T 24G/20A 19T/25C 44A 44G 4 4T 44T 44T 43A/lG 44G 44A 44T 1A iT/iC 28T 3 9A 23G/17A 40OT 4 3A 4 4T 4 4T 4 4T 44A 4 4A 44A 2 SC/ 19T 2 SG/ 19A 25C/19T 4 3A/ iG 43C/1T 44C 40A/2G 40A/2G 35T/7C 4 2G 41T/lA 41A/lG 38G/4A 41T/lC 4 2T 3 6T/ 6A 35A/7G 4 2G 29A/13T 4 2T 15G/2A 23T/2C 31C/9T 4 1A/ iG 4 2G 4 2T 37A/5G 4 2T 4 iT/iC 4 2T 4 2A 4 2A 3BA/4G 41C/lN 32G/lOA 40OC/2N 29G/13A 38C/4T 3 1C/1 iT 17A/11G 28A 19T/9C 2 BG 28BT 28BA 28BG 28BT 24T/4C 21T/7A 28A 28G 28A 28BT 2G 12T lEG/liT/iN 1BA/lOG 28G 28T 24A/4G 28BT 21T/7C 17T/11C 28A iBA/lOG 28BA 27C/1N 24G/4A 27C/1N 23G/5A 28C 23C/5T 876 beginning of exon R 901 C 915 A W0005851 0 [httpiMww.getthepatent.coni/Logi~o/ea~uprlecleal~o1008 1 .~~rmate atmitobrbt]Pge 53 of 737 WO 00/58510 PCT/iBOO/00435 Table Amplicon Biallelic Allele I Allele 2 Genomic cDNA form: position of marker Marker Name position on cDNA (position in on SEQ polypeptide) IDNo 1 8-132 8-132-179 A T 215838 M862NOQbisR:976 MI 09ONOXQbisR:844 MS I MS2NQQbisR:990 MI O69NOQR:878 M 1069N20Q IQbisR:758 M 1069N0Q IQbisR:804 M IO69N2002QbisR:8 17 M IO69NOO2QbisR:863 M 1069N2NbisOO2XQbisR:936 MI 069N20QR:832 M 1069N2OQbisR:723 M 1O69NNbisOQR:901 MI O69NNbisOQbisR:792 Mt O69NOO2XQbisR:959 Mt O69NOXQR:974 MI O69NOQbisRbis:803 Mt O69N2OQbisRbis:757 MI O69N2OXQR:928 8-132 8-132-164 A G 215853 M862NOQbisR:96t M IO9ONOXQbisR:829

MS]I

MS2NOQbisR:975 M IO69NOQR: 863 M1069N20Q1 QbisR:743 Mt 069N0Q1 QbisR:789 MI O69N2002QbisR:802 M1O69NOO2QbisR:848 M lO69N2NbisOO2XQbisR:921 M1O69N2OQR:817 M lO69N2OQbisR:708 M1O69NNbisOQR:886 M1069NNbisOQbisR:777 M1O69NOO2XQbisR:944 Ml O69NQXQR:959 M lO69NOQbisRbiS:788 MI O69N2OQbisRbis:742 W0005851 0 [httgpJ/www.getthepatent.rcomILogin.dogi/Sexam.support/FetchiIDefault.dogiWO005851 0.epc?fromCac?~e= 1 part=maintoolbar--bottom] Page 540of737 WO 00/58510 PCTIBOO/00435 fI69N2QXQR:913 8-132 8-132-97 215920 M862NOQbisR:894 M 1O9ONOXQbisR:762 MS 1 MS2NOQbisR:908 M1O69NOQR:796 M IO69N2OQ1QbisR:676 M 1069N0Q IQbisR:722 M IO69N2002QbisR:735 M1O69NOO2QbisR:78 I M lO69N2NbisOO2XQbisR:854 M 1069N20QR:750 Ml O69N2OQbisR:64 1 MI O69NNbisOQR:8 19 Ml O69NNbisOQbisR:7 Ml O69NOO2XQbisR:877 Ml O69NOXQR:892 Ml O69NOQbisRbis:72 I Ml O69N2OQbisRbis:675 MI O69N2OXQR:846 99-13929 99-13929-201 G T 216028 8-131 8-131-363 G T 216538 8-131 8-131-199 G T 216702 M862NOQbisR:831 M 1O9ONOXQbisR:699 MS I MS2NOQbisR:845 M1069NOQR:733 M 1069N20Q lQbisR:613 M1O69NOQ1QbisR:659 Ml O69N2002QbisR:672 MIO69NOQ2QbisR:71 8 MI O69N2NbisOO2XQbisR:791 MI 069N20QR:687 M1069N2OQbisR:578 M 1O69NNbisOQR:756 MI O69NNbisOQbisR:67 MI o69NOO2XQbisR:8 14 MI O69NOXQR:829 MI O69NOQbisRbis:624 MI O69N2OQbisRbis:578 MI O69N2OXQR:783 8-130 8-130-236 C IT 1216874 M862NOQbisR:659 W0005851 0 [http:Avww.geheatentcomLogin.dog/Sexam.suportFetchDefautdogfO005851 0.cpc?tromLacnle= 1partmaintooioar--ontomj Page bb o? -31 WO 00/58510 PCTIIBOO/00435 53 M 1O9ONOXQbisR:527 MS I MS2NOQbisR:673 MI O69NOQR:561 Ml 069N20Q lQbisR:44 I MI 069N0Q1 QbisR:487 MI O69N2002QbisR:500 Mi O69NOO2QbisR:546 M 1O69N2NbisOO2XQbisR:619 Ml 069N20QR:5 M 1069N2OQbisR:406 M IO69NNbisQQR:584 M 1O69NNbisOQbisR:475 M IO69NOO2XQbisR:642 M IO69NOXQR:657 MI O69NOQbisRbis:452 M10O69N2OQbisRbis:406 M1O69N2OXQR:6I11 8-130 8-130-220 G T 216890 M862NQQbisR:643 Ml O9ONOXQbisR:5 II

MSI

MS2NOQbisR:657 M 1O69NOQR:545 M 1069N20Q IQbisR:425 M 1069N0Q1 QbisR:471 Ml O69N2002QbisR:484 Ml O69NOO2QbisR:530 M lO69N2NbisOO2XQbisR.603 M I 069N20QR.499 M1069N2OQbisR:390 (115) Ml O69NNbisOQR:568 Ml O69NNbisOQbisR:459 Ml O69NOO2XQbisR:626 MIO69NOXQR.641 MI O69NOQbisRbis:436 MlO69N2OQbisRbis:390 (1150 M IO69N2OXQR:595 8-130 8-130-144 C T 216966 MIO069NOQR:469 MI 069N20QR:423 MI O69NNbisOQR:492 MI O69NOXQR:565 MIO69N2OXQR:519 8-308130-143 A G 1216967 MIO69NOQR:468 W0005851 0 [http:/Aww. getthepa tent. co mILoagn.d og/Sexa m.support/Fetrh/Defa ult. dogNVO005851 0. cpc?fro mCa cle= 1 part= m aintoolIba r--bottom]_Page 56 of 737 WO 00/58510 PCT/iBOOIOO435 Mi 069N20QR:422 MI O69NNbisOQR:49 1 MI O69NOXQR:564 Ml O69N2OXQR:5 18 8-130 8-130-102 C T 217008 MIO069NOQR:427 M 1069N20QR:38 I Ml O69NNbisOQR:450 M1O69NOXQR:523 MI O69N2OXQR:477 8-130 8-130-101 G T 217009 M 1O69NOQR:426 Ml 069N20QR:380 MI O69NNbisOQR:449 MI O69NOXQR:522 M IO69N2QXQR:476 8-130 8-130-83 A C 217027 M1O69NOQR:408 M 1069N20Q IQbisR:362 M 1069NOQ IQbisR:408 MI 069N20QR:362 M 1O69NNbisOQR:43 I M IO69NOXQR:504 M1O69N2OXQR:458 8-143 8-143-245 G T 229669 M1O9ONOXQbisR:426 Ml O69N2NbisOO2XQbisR:S 18 Ml O69NOO2XQbisR:54 1 M IO69NOXQR:447 M 1O69N2OXQR:401 8-143 8-143-242 A G 229672 M IO9ONOXQbisR:423 Ml O69N2NbisOO2XQbisR:S M IO69NOO2XQbisR:538 M 1O69NOXQR:444 M 1O69N2OXQR:398 8-143 8-143-239 C T 229675 MIO09ONOXQbisR:420 Ml IO69N2NbisOO2XQbisR:5 12 Ml O69NOO2XQbisR:535 M 1069NOXQR:441 Ml O69N2OXQR:395 8-143 8-143-232 G C 229682 M 1O9ONOXQbisR:413 Ml O69N2NbisOO2XQbisR:50S MI O69NOO2XQbisR:528 MI O69NOXQR:434 M 1O69N2OXQR: 388 W0005851 0.[httpi/Mww. etthe patent.com4,og in.d og/exa ms pprtFetchDefaut.dogSVO00585 1 .cpc?fromCache=l1part=maintoolbar--botom] Page 57of 737 WO 00/58510 PCTIIBOO/00435 8-119 8-119-210 A C 230432 M862NOObisP:1011 M862N0P:870 MI! 17N2001P:579 M I 17N20P:569 M1117NOO1P:625 M I I 17N002P:709 8-119 9-119-204 A C 230438 M862NOObisP:1005 M862N0P:864 MlI I 17N2001 P:573 Mi I 7N20P:563 M1117N001P:619 MI111 7N002P:703 8-119 8-119-200 A G 230442 M862NOObisP:l001 M862N0P:860 M11I17N2001P:569 MI I 17N20P:559 M11I7NOO1P:615 Ml 1 17N002P:699 8-119 8-119-195 A C 230447 M862NOObisP:996 M862N0P:855 M11I17N2001P:.564 Ml 1 17N20P:554 M11I7NOO1P:610 Ml 1 17N002P:694 8-119 8-119-125 C T 230517 M862NOObisP:926 M862N0P:785 Ml 117N2001 P:494 Ml I17N20P:484 M1II7NOOIP:540 M 1117NOO2P:624 8-119 8-119-120 A G 230522 M862NQObisP:921 M862N0P:780 Ml I17N2001 P:489 M11I17N2OP:479 MI I 7NOOIP:535 M I I 17N002P:619 8-119 8-119-97 C T 230545 M862NOObisP:898 M862N0P:757 M11I17N2001P:466 M I I 17N20P:456 MlI I 17NOO IP:512 M I I 17N002P:596 8-119 18-119-93 1G IT 1230549 M862NOObisP:894 W0005851 0 ttpIwww.getthepatent.com/Login.dog/Sexam.support/Fetch[DefauItdogAN0005851O .cpc?fromCar-he= 1part=maintoolbar--boftom] Page 58 of 737 WO 00/58510 PCTIBOO/00435 M862N0P:753 M11 17N2001P:462 M III 17N20P:452 M I I7NOO IP:508 M11I17N002P:592 8-119 8-119-38 A T 230604 M862NOObisP:839 M862N0P:698 MIII 7N2001P:407 MI 117N20P:397 Ml I7NOO IP:453 M1II7NO2P:537 8-138 8-138-234 C T 230684 M862NOObisP:759 M862N0P:61 8 M11I17N2001P:327 M1117N20P:317 Ml 117N001P:373 MIlI 17N002P:457 8-138 8-138-218 A G 230700 M862NOObisP:743 M862N0P:602 M1117N2001P:311 Ml 117N20P:301 MI 117N001P:357 MI I17NOQ2P:441 8-142 8-142-211 CAAA 231293 M862NOObisP:700 8-142 8-142-132 A G 231372 M862NOObisP:621 8-145 8-145-197 C T 231811 MI117NQO2P:395 MIO69N2002QbisR:397 MI 069NOQ2QbisR:443 M lO69N2NbisOO2XQbisR:420 M IO69NOO2XQbisR:443 8-145 8-145-154 C T 231854 231854 MI I 17N002P:352 MI 069N2002QbisR:354 8-145 8-145-138 A C 231870 M1III7N2001 P:289 (96) MI 117N001P:335 MI117NO2P:336 MI 069N2002QbisR:338 (98) M IO69NOO2QbisR:384 M I069N2NbisQO2XQbisR:361 MI O69NOO2XQbisR:384 8-137 8-137-182- C T 234277 M862NOQbisR:477 M862NOObisP:477 W0005851 0 [http:/M~wgetthepatent.comfIgin.dog/Sexam.suportFetch/efaut.doqNVO005851 0.cpc?fromCache= 1part~maintoolbar--botoml Page 59 of 737 WO 00158510 PCTIBOO/00435 57 M862N0P:477 Ml O9ONOXQbisR:249 Ml I17N200lIP: 176 (59) M I I 7N2QP: 176 (59) MI 1I17NOO IP:222 MI! I7NOO2P:222 MS I MS2NOQbisR:491 M1O69NOQR:270 M1069N20Q lQbisR:224 M IO69NOQIQbisR:270 M lO69N2002QbisR:224 M lO69NOO2QbisR: 270 M lO69N2NbisOO2XQbisR:247 Ml 069N20QR:224 M10O69N2OQbisR:224 8-137 8-137-152 A C 234307 M862NOQbisR:447 M862NQObisP:447 M862N0P:447 Ml O9ONOXQbisR:2 19 M II 17N200 IP:l146 (49) Ml1l7N20P:l46 (49) Ml 1117NOO IP:l192 M III7NOO2P:l92 MS 1 MS2NOQbisR:46l Ml O69NOQR:240 Ml 069N20Q lQbisR: 194 Ml 069N0Q lQbisR:240 Ml O69N2002QbisR: 194 Ml O69NOO2QbisR:240 M1O69N2NbisQO2XQbisR:2 17 (57) M 1O69N2OQR: 194 MI O69N2OQbisR: 194 M1069NNbisOQR:263 Ml O69NNbisOQbisR:263 Ml O69NOO2XQbisR:240 Ml O69NOXQR:240 Ml O69NOQbisRbis:240 Ml O69N2OQbisRb is:! 94 Ml 069N2OXQR: 194 99-16038 99-16038-118 C T 239763 M862NOQbisR:388 M862NOObisP:388 W000585 10 [tqp:ltwwgetthepatentcomLogin.dog/Sexam.supportFetchDefault.doN0005851O0cpc?romCachie= 1part=maintoolbar--bottom] Page 60 of 737 WO 00/58510 PCTIiBOO/00435 58 M862N0P:388 MI O9ONOXQbisR: 160 M1117N2001P:87 (29) M1I1I17N20P:87 (29) M11I17N001P:133 MlI 17N002P:.133 MS i MS2NOQbisR:402 MIO69NOQR:181 M1O69N2OQIQbisR:135 Ml O69NOQ1QbisR:1 81 M1O69N2002QbisR:1 35 M 1O69NOO2QbisR: 181 M1O69N2NbisQO2XQbisR:135 M1069N20QR:135 M1069N2OQbisR: 135 Ml O69NNbisOQR: 181 MI O69NNbisOQbisR: 181 MI O69NO02XQbisR: 181 M1O69NOXQR:181 M1O69NOQbisRbis:181 M1O69N2OQbisRbis:1 35 M IO69N2OXQR:1 35 8-153 8-153-313 C T 239763 M862NOQbisR:388 M862NOObisP:388 M862N0P:388 MI O9ONOXQbisR: 160 M1117N2001P:87 (29) MI1117N20P:87 (29) MI 117N001IP: 133 MI I17N002P:133 MS 1 MS2NOQbisR:402 MI O69NOQR: 181 MI 069N20Q1 QbisR:1 35 M1O69NQQbisR: 181 MI O69N2002QbisR: 135 MI O69NOO2QbisR: 181 M1O69N2NbisOO2XQbisR:135 MI 069N20QR: 135 MIO69N2OQbisR:135 Ml IO69NNbisOQR: 181 MI O69NNbisOQbisR: 181 W0005851 0[httpJM'ww. etthepatent.com/Login.doq/$exam.supportFetc/Default.doNVO005851 0.cpc?fromCachie= 1part=maintoolbar--botoml Page 61of 737 WO 00/58510 PCT/IBOO/00435 59 M]O69NOO2XQbisR: 181 M1O69NOXQR:181 M 1O69NOQbisRbis: 181 M IO69N2OQbisRbis: 135 M IO69N2OXQR:1 35 8-135 8-135-166 G T 240543 M&62NOQbisR:282 M862NQObisP:282 MI:1143 M862N0P:282 MI O90NOXQbisR:54 M I I17N2001 P:27 (9) MIII 7N20P:27 (9) M1117NOO1P:27 (9) MIII 7N002P:27 (9) MS I MS2NQQbisR:296 M1O69NOQR:75 M1O69N2OQ1QbisR:75 MIO69NOQ1QbisR:75 MI O69N2002QbisR:75 M 1O69NOO2QbisR:75 M IO69N2NbisOO2XQbisR:75 M1O69N2OQR:75 M10O69N2OQbisR:75 Ml O69NNbisOQR:75 M1O69NNbisOQbisR:75 Ml O69NOO2XQbisR:75 MIO69NOXQR:75 MI O69NOQbisRbis:75 M10O69N2OQbisRbis:75 MI O69N2OXQR:75 8.135 8-135-1 12 A G 240597 M862NOQbisR:228 M862NOObisP.228 MI1: 1089 MS62NOP:228 MS I MS2NOQbisR:242 Ml O69NOQR:21 MIO69N2OQ1QbisR:21 MIO69NOQIQbisR:21 MI O69N2002QbisR:2 I M1O69NOO2QbisR:21 MI O69N2NbisOO2XQbisR:2 1 W0005851 0 [http://www.qetthe patent. com/Loqin.dog/Sexa m.supp 8lecleautdgJO 51~ 0.cpc~from Cache= 1 part=maintaolbar--bottomLPage 62 of 737 WOO00/58510 PCTIiBOO/00435 M1069N2OQR:21 M 1O69N2OQbisR:2 1 M1069NNbisOQR:21 M 1O69NNbisOQbisR:21 MI O69NOO2XQbisR:21 M IO69NOXQR:21 M IO69NOQbisRbis:21 M IO69N2OQbisRbis:2 1 M 1O69N2QXQR:21 99-16050 99-16050-235 G C 240772 M862NQQbisR:53 M862NQObisP:53 MI:914 M862N0P:53 8-144 8-144-378 C T 240858 M1:828

MSI

MS2NOQbisR: 136 8-144 8-144-234 C T 241002 MI1:684 8-144 8-144-196 A T 241040 M 1:646 8-144 8-144-127 TGGAT 241109 MI:577

AC

8-141 8-141-304 C T 241217 M1:469 8-141 8-141-260 C T 241261 MI:425 8-141 8-141-161 G T 241360 MI:326 (47) 8-140 8-140-286 A G 241507 M 1;179 8-140 8-140-173 A C 241620 M1:66 8-140 18-140-108 G C 241685 M1:1 Sbgl Coding Regions The sbgl open reading frame is contained in the corresponding mRNA of a cDNA sequence selected from the group consisting of SEQ ID Nos 2 to 26. The effective sbgl coding sequence (CDS) may include several forms as indicated above, in some embodiments encompassing isolated, purified, and recombinant polynucleotides which encode a polypeptide comprising a contiguous span of at least 4 amino acids, preferably 6, more preferably at least 8 or 10 amino acids, yet more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of SEQ ID Nos 27 to 35. The effective sbgl coding sequence (CDS) may comprise the region between the first nucleotide of the ATG codon and the end nucleotide of the stop codon of SEQ ID Nos 2 to 26 as indicated in Table 5a above.

The above disclosed polynucleotide that contains the coding sequence of the sbgl gene may be expressed in a desired host cell or a desired host organism when this polynucleotide is placed under the control of suitable expression signals. The expression signals may be either W00058510 [http www.getthe pa tent. comILgin.dog/Sexam.supoprtlFetch/oefault.dog VO005851 0.cpc?fromCache=l 1art=maintoolbar=bottom] Page 63 of 737 WO 00/58510 PCT/IB00/00435 61 the expression signals contained in the regulatory regions in the sbgl gene of the invention or in contrast the signals may be exogenous regulatory nucleic sequences. Such a polynucleotide, when placed under the suitable expression signals, may also be inserted in a vector for its expression and/or amplification.

Regulatory Sequences Of sbgl As mentioned, the genomic sequence of the sbgl gene contains regulatory sequences both in the non-coding 5'-flanking region and in the non-coding 3'-flanking region that border the sbgl coding region containing the exons of the gene.

In one aspect, the 3'-regulatory sequence of the sbgl gene may comprise the sequence localized between the nucleotide in position 213818 and the nucleotide in position 215818 of the nucleotide sequence of SEQ ID No 1. In one aspect, the 5'-regulatory sequence of the sbgl gene may comprise the sequence localized between the 5' end of the particular form of exon M and nucleotide position 243685 of SEQ ID No 1.

Polynucleotides derived from the 5' and 3' regulatory regions are useful in order to detect the presence of at least a copy of an sbgl nucleotide sequence of SEQ ID No 1 or a fragment thereof in a test sample.

The promoter activity of the 5' regulatory regions contained in sbgl can be assessed as described below.

In order to identify the relevant biologically active polynucleotide fragments or variants of an sbgl regulatory region, one of skill in the art will refer to Sambrook et al.(1989), which describes the use of a recombinant vector carrying a marker gene beta galactosidase, chloramphenicol acetyl transferase, etc.) the expression of which will be detected when placed under the control of a biologically active polynucleotide fragment or variant of the sbgl sequence of SEQ ID No 1. Genomic sequences located upstream of the first exon of the sbgl gene are cloned into a suitable promoter reporter vector, such as the pSEAP-Basic, pSEAP- Enhancer, ppgal-Basic, ppgal-Enhancer, or pEGFP-1 Promoter Reporter vectors available from Clontech, or pGL2-basic or pGL3-basic promoterless luciferase reporter gene vector from Promega. Briefly, each of these promoter reporter vectors include multiple cloning sites positioned upstream of a reporter gene encoding a readily assayable protein such as secreted alkaline phosphatase, luciferase, 0 galactosidase, or green fluorescent protein. The sequences upstream of the sbgl coding region are inserted into the cloning sites upstream of the reporter gene in both orientations and introduced into an appropriate host cell. The level of reporter protein is assayed and compared to the level obtained from a vector which lacks an insert in the cloning site. The presence of an elevated expression level in the vector containing the insert W00058510 [htqf.m/ww.getthepatent.comILog in.dog/Sexam.suDortIFetch/Defa uIt.d ogO005851 0.cpcfro mCache= 1 part=maintoolbar-boftom Page 64 of737 WO 00/58510 PCT/IB00/00435 62 with respect to the control vector indicates the presence of a promoter in the insert. If necessary, the upstream sequences can be cloned into vectors which contain an enhancer for increasing transcription levels from weak promoter sequences. A significant level of expression above that observed with the vector lacking an insert indicates that a promoter sequence is present in the inserted upstream sequence.

Promoter sequence within the upstream genomic DNA may be further defined by constructing nested 5' and/or 3' deletions in the upstream DNA using conventional techniques such as Exonuclease III or appropriate restriction endonuclease digestion. The resulting deletion fragments can be inserted into the promoter reporter vector to determine whether the deletion has reduced or obliterated promoter activity, such as described, for example, by Coles et al.(1998). In this way, the boundaries of the promoters may be defined. If desired, potential individual regulatory sites within the promoter may be identified using site directed mutagenesis or linker scanning to obliterate potential transcription factor binding sites within the promoter individually or in combination. The effects of these mutations on transcription levels may be determined by inserting the mutations into cloning sites in promoter reporter vectors. This type of assay is well-known to those skilled in the art and is described in WO 97/17359, US Patent No. 5,374,544; EP 582 796; US Patent No. 5,698,389; US 5,643,746; US Patent No. 5,502,176; and US Patent 5,266,488.

The strength and the specificity of the promoter of the sbgl gene can be assessed through the expression levels of a detectable polynucleotide operably linked to the sbgl promoter in different types of cells and tissues. The detectable polynucleotide may be either a polynucleotide that specifically hybridizes with a predefined oligonucleotide probe, or a polynucleotide encoding a detectable protein, including an sbgl polypeptide or a fragment or a variant thereof. This type of assay is well-known to those skilled in the art and is described in US Patent No. 5,502,176; and US Patent No. 5,266,488. Some of the methods are discussed in more detail below.

Polynucleotides carrying the regulatory elements located at the 5' end and at the 3' end of the sbgl coding region may be advantageously used to control the transcriptional and translational activity of an heterologous polynucleotide of interest.

Thus, the present invention also concerns a purified or isolated nucleic acid comprising a polynucleotide which is selected from the group consisting of the 5' and 3' regulatory regions of sbgl, or a sequence complementary thereto or a biologically active fragment or variant thereof. In one aspect, regulatory region" may comprise the nucleotide sequence located between positions 213818 and 215818 of SEQ ID No 1. In one aspect, regulatory region" may comprise the nucleotide sequence located between the 5' end of a particular variant of exon W00058510[http:twww. etthepatent.camlLOgin1dg/$exam suppoWetch/DefauIt.dog/NV005851 O.cpcfromCache= 1 part=maintoolbar-boftoml Page 65 of 737 WO 00/58510 PCT/IB00/00435 63 M and nucleotide position 243685 of SEQ ID No 1. The 5' end of particular form of exon M may be selected from the group consisting of nucleotide postions 240569, 241596, 240617, 240644, 240824, 240994, 241685 and 240993 of SEQ ID No 1. In a preferred aspect, the regulatory region comprises the nucleotides of nucleotide positions 241686 to 243685 of SEQ IDNo 1.

The invention also pertains to a purified or isolated nucleic acid comprising a polynucleotide having at least 95% nucleotide identity with a polynucleotide selected from the group consisting of the 5' and 3' regulatory regions, advantageously 99 nucleotide identity, preferably 99.5% nucleotide identity and most preferably 99.8% nucleotide identity with a polynucleotide selected from the group consisting of the 5' and 3' regulatory regions, or a sequence complementary thereto or a variant thereof or a biologically active fragment thereof.

Another object of the invention consists of purified, isolated or recombinant nucleic acids comprising a polynucleotide that hybridizes, under the stringent hybridization conditions defined herein, with a polynucleotide selected from the group consisting of the nucleotide sequences of the and 3' regulatory regions of sbgl, or a sequence complementary thereto or a variant thereof or a biologically active fragment thereof.

Preferred fragments of the 5' regulatory region have a length of about 1500 or 1000 nucleotides, preferably of about 500 nucleotides, more preferably about 400 nucleotides, even more preferably 300 nucleotides and most preferably about 200 nucleotides.

Preferred fragments of the 3' regulatory region are at least 50, 100, 150, 200, 300 or 400 bases in length.

"Biologically active" sbgl polynucleotide derivatives of SEQ ID No 1 are polynucleotides comprising or alternatively consisting in a fragment of said polynucleotide which is functional as a regulatory region for expressing a recombinant polypeptide or a recombinant polynucleotide in a recombinant cell host. It could act either as an enhancer or as a repressor.

For the purpose of the invention, a nucleic acid or polynucleotide is "functional" as a regulatory region for expressing a recombinant polypeptide or a recombinant polynucleotide if said regulatory polynucleotide contains nucleotide sequences which contain transcriptional and translational regulatory information, and such sequences are "operably linked" to nucleotide sequences which encode the desired polypeptide or the desired polynucleotide.

The regulatory polynucleotides of the invention may be prepared from the nucleotide sequence of SEQ ID No 1 by cleavage using suitable restriction enzymes, as described for example in Sambrook et al.(1989). The regulatory polynucleotides may also be prepared by digestion of SEQ ID No 1 by an exonuclease enzyme, such as Bal31 (Wabiko et al., 1986).

W00058510 [http:lwwwgetthepatent.com/Login.dog/SexamsupportFetchDoefault.doVO0058 5 1 0.cpc?fromCache=1 part=maintoolbar-botoml Page 66 of 737 WO 00/58510 PCT/IB00/00435 64 These regulatory polynucleotides can also be prepared by nucleic acid chemical synthesis, as described elsewhere in the specification.

The sbgl regulatory polynucleotides according to the invention may be part of a recombinant expression vector that may be used to express a coding sequence in a desired host cell or host organism. The recombinant expression vectors according to the invention are described elsewhere in the specification.

A preferred 5'-regulatory polynucleotide of the invention includes the region (5'-UTR) of the sbgl cDNA, or a biologically active fragment or variant thereof.

A preferred 3'-regulatory polynucleotide of the invention includes the 3'-untranslated region (3'-UTR) of the sbgl cDNA, or a biologically active fragment or variant thereof.

A further object of the invention consists of a purified or isolated nucleic acid comprising: a) a nucleic acid comprising a regulatory nucleotide sequence selected from the group consisting of: a nucleotide sequence comprising a polynucleotide of the sbgl 5' regulatory region or a complementary sequence thereto; (ii) a nucleotide sequence comprising a polynucleotide having at least 95% of nucleotide identity with the nucleotide sequence of the sbgl 5' regulatory region or a complementary sequence thereto; (iii) a nucleotide sequence comprising a polynucleotide that hybridizes under stringent hybridization conditions with the nucleotide sequence of the sbgl 5' regulatory region or a complementary sequence thereto; and (iv) a biologically active fragment or variant of the polynucleotides in (ii) and (iii); b) a polynucleotide encoding a desired polypeptide or a nucleic acid of interest, operably linked to the nucleic acid defined in above; and c) optionally, a nucleic acid comprising a regulatory polynucleotide, preferably a 3'regulatory polynucleotide of the sbgl gene.

In a specific embodiment of the nucleic acid defined above, said nucleic acid includes the 5'-untranslated region (5'-UTR) of the sbgl cDNA, or a biologically active fragment or variant thereof.

In a second specific embodiment of the nucleic acid defined above, said nucleic acid includes the 3'-untranslated region (3'-UTR) of the sbgl cDNA, or a biologically active fragment or variant thereof.

The regulatory polynucleotide of the 5' regulatory region, or its biologically active fragments or variants, is operably linked at the 5'-end of the polynucleotide encoding the W0005851 0 (http:/Mww.gettheIatent.om/Lo dpl .dogWO 8 0.cpcfromCacbe= 1art=maintoolbar=bottom] Page 67 of 737 WO 00/58510 PCT/IB00/00435 desired polypeptide or polynucleotide.

The regulatory polynucleotide of the 3' regulatory region, or its biologically active fragments or variants, is advantageously operably linked at the 3'-end of the polynucleotide encoding the desired polypeptide or polynucleotide.

The desired polypeptide encoded by the above-described nucleic acid may be of various nature or origin, encompassing proteins of prokaryotic or eukaryotic origin. Among the polypeptides expressed under the control of an sbgl regulatory region include bacterial, fungal or viral antigens. Also encompassed are eukaryotic proteins such as intracellular proteins, like "house keeping" proteins, membrane-bound proteins, like receptors, and secreted proteins like endogenous mediators such as cytokines. The desired polypeptide may be the sbgl protein, especially the protein of the amino acid sequences of SEQ ID Nos 27 to 35, or a fragment or a variant thereof.

The desired nucleic acids encoded by the above-described polynucleotide, usually an RNA molecule, may be complementary to a desired coding polynucleotide, for example to the sbgl coding sequence, and thus useful as an antisense polynucleotide.

Such a polynucleotide may be included in a recombinant expression vector in order to express the desired polypeptide or the desired nucleic acid in host cell or in a host organism.

Suitable recombinant vectors that contain a polynucleotide such as described herein are disclosed elsewhere in the specification.

Genomic Sequences of sbg2 polynucleotides Particularly preferred sbg2 nucleic acids of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 50, 60, 70, 80, 90, 100, 150, 200 nucleotides, to the extent that the length of said span is consistent with said nucleotide position range, of nucleotide positions 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915 ofSEQ ID No 1, or the complements thereof.

It should be noted that nucleic acid fragments of any size and sequence may be comprised by the polynucleotides described in this section.

The human sbg2 gene comprises exons selected from at least 4 exons, referred to herein as exons S, T, U and V. The nucleotide positions of sbg2 exons in SEQ ID No. 1 are detailed below in Table Table Exon Position in SEQ ID No 1 Intron Position in SEQ ID No 1 Beginning End Beginning End W0005851 0 jhttp:Iwww.qefthe patent.com/L qin.dog/Sexa m. supporIFetdVDefa ult. d ogVO05851 O.cpctromCache= 1 part=maintoolbar=bottom] Page 68 of 737 WO 00/58510 PCT/IB00100435 66 S 201188 201234 S 201235 214675 T 214676 214793 T 214794 215701 U 215702 215746 U 215747 216835 V 216836 216915 Thus, the invention embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the exons of the sbg2 gene, or a sequence complementary thereto. Preferred are purified, isolated, or recombinant polynucleotides comprising at least one exon having the nucleotide position ranges listed in Table 5f selected from the group consisting of the exons S, T, U and V of the sbg2 gene, or a complementary sequence thereto or a fragment or a variant thereof. Also encompassed by the invention are purified, isolated, or recombinant nucleic acids comprising a combination of at least two exons of the sbg2 gene selected from the group consisting of exons S, T, U and V, wherein the polynucleotides are arranged within the nucleic acid in the same relative order as in SEQ ID No. 1.

The present invention further embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the introns of the sbg2 gene, or a sequence complementary thereto. The position of the introns is detailed in Table 5f. Intron S refers to the nucleotide sequence located between Exon S and Exon T, and so on. Thus, the invention embodies purified, isolated, or recombinant polynucleotides comprising a nucleotide sequence selected from the group consisting of the 3 introns of the sbg2 gene, or a sequence complementary thereto.

The invention also encompasses a purified, isolated, or recombinant polynucleotide comprising a nucleotide sequence of sbg2 having at least 70, 75, 80, 85, 90, 95, 98 or 99% nucleotide identity with a sequence selected from the group consisting of nucleotide positions 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915 of SEQ ID No. 1 or a complementary sequence thereto or a fragment thereof. The nucleotide differences as regards the nucleotide positions 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915 of SEQ ID No. I may be generally randomly distributed throughout the entire nucleic acid.

Another object of the invention relates to purified, isolated or recombinant nucleic acids comprising a polynucleotide that hybridizes, under the stringent hybridization conditions defined herein, with a polynucleotide selected from the group consisting of nucleotide positions 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915 of SEQ ID No 1, or a sequence complementary thereto or a variant thereof or a W0005851 0 [httoJtwww.getthepatentcomLog.d og/$exa msupoort/FetchDefa ult. dog10005851 0.cpcf romCd8e= 1 part maintoolbar=-ottoI Page b9 ot 737 WO 00/58510 PCT/IB00/00435 67 biologically active fragment thereof.

Additional preferred nucleic acids of the invention include isolated, purified, or recombinant sbg2 polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 35, 40,45, 50, 55, 60, 65, 70, 75, 80, 90, 100 or 200 nucleotides of nucleotide positions 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915 of SEQ ID No I or the complements thereof, wherein said contiguous span comprises an sbg2-related biallelic marker. Optionally, said biallelic marker is selected from the group consisting of A79 to A99. It should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section. Either the original or the alternative allele may be present at said biallelic marker.

An sbg2 polynucleotide or gene may further contain regulatory sequences both in the non-coding 5'-flanking region and in the non-coding 3'-flanking region that border the region containing said genes or exons. Polynucleotides derived from 5' and 3' regulatory regions are useful in order to detect the presence of at least a copy of a nucleotide sequence comprising an sbg2 nucleotide sequence of SEQ ID No. 1 or a fragment thereof in a test sample.

Polynucleotides carrying the regulatory elements located at the 5' end and at the 3' end of the genes comprising the exons of the present invention may be advantageously used to control the transcriptional and translational activity of a heterologous polynucleotide of interest.

While this section is entitled "sbg2 cDNA Sequences," it should be noted that nucleic acid fragments of any size and sequence may also be comprised by the polynucleotides described in this section, flanking the genomic sequences of sbg2 on either side or between two or more such genomic sequences.

Polynucleotide Constructs The terms "polvnucleotide construct" and "recombinant polynucleotide" are used interchangeably herein to refer to linear or circular, purified or isolated polynucleotides that have been artificially designed and which comprise at least two nucleotide sequences that are not found as contiguous nucleotide sequences in their initial natural environment. It should be noted that the present invention embodies recombinant vectors comprising any one of the polynucleotides described in the present invention.

DNA Constructs that Enables Directing Temporal and Spatial Expression of sbgl, g34665, sbg2, g35017 and g3501 8 Nucleic Acid Sequences in Recombinant Cell Hosts and in Transgenic Animals In order to study the physiological and phenotypic consequences of a lack of synthesis W00058510 [httpJltwww.qetthepatent.com/Login.dog/Sexam.suportFetchIDefaut.dogNVO005851 .cpc?fromCacr-e=1 1art=maintoolbar=bottom] Page 70 of 737 WO 00/58510 PCT/IB00/00435 68 of a protein encoded by a nucleotide sequence comprising an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide, both at the cell level and at the multi cellular organism level, the invention also encompasses DNA constructs and recombinant vectors enabling a conditional expression of a specific allele of a nucleotide sequence comprising an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide and also of a copy of a sequence comprising a nucleotide sequence of an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide, or a fragment thereof, harboring substitutions, deletions, or additions of one or more bases. These base substitutions, deletions or additions may be located either in an exon, an intron or a regulatory sequence, in particular a 5' regulatory sequence of an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide.

In a preferred embodiment, the nucleotide sequence comprising an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide further comprises a biallelic marker of the present invention.

A first preferred DNA construct is based on the tetracycline resistance operon tet from E. coli transposon Tn 10 for controlling the expression of an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide, such as described by Gossen et al. (1992, 1995) and Furth et al.(1994).

Such a DNA construct contains seven tet operator sequences from Tn 10 (tetop) that are fused to either a minimal promoter or a 5'-regulatory sequence of the sbgl, g34665, sbg2, g35017 or g35018 polynucleotide, said minimal promoter or said sbgl, g34665, sbg2, g35017 or g35018 polynucleotide regulatory sequence being operably linked to a polynucleotide of interest that codes either for a sense or an antisense oligonucleotide or for a polypeptide, including an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide-encoded polypeptide or a peptide fragment thereof. This DNA construct is functional as a conditional expression system for the nucleotide sequence of interest when the same cell also comprises a nucleotide sequence coding for either the wild type (tTA) or the mutant (rTA) repressor fused to the activating domain of viral protein VP16 of herpes simplex virus, placed under the control of a promoter, such as the HCMVIE1 enhancer/promoter or the MMTV-LTR. Indeed, a preferred DNA construct of the invention comprises both the polynucleotide containing the tet operator sequences and the polynucleotide containing a sequence coding for the tTA or the rTA repressor.

In a specific embodiment, the conditional expression DNA construct contains the sequence encoding the mutant tetracycline repressor rTA, the expression of the polynucleotide of interest is silent in the absence of tetracycline and induced in its presence.

DNA Constructs Allowing Homologous Recombination: Replacement Vectors A second preferred DNA construct will comprise, from 5'-end to 3'-end: a first nucleotide sequence comprising an sbgl polynucleotide; a nucleotide sequence comprising a positive selection marker, such as the marker for neomycine resistance (neo); and a second nucleotide sequence comprising a respective sbgl polynucleotide, and is located on the W00058510 fhttp Wwww.g etthepatent.com/og i n.dogiSexa m.su portFetchDefa ut.dogO005851 0.cpc/fomCa che= 1 part=maintoolbarbottom] Page 71 of 737 WO 00/58510 PCT/IB00/00435 69 genome downstream of the first sbgl polynucleotide sequence Also encompassed are DNA construct prepared in an analogous manner using g34665, sbg2, g35017 or g35018 nucleotide sequences in place of the sbgl sequences described above.

In a preferred embodiment, this DNA construct also comprises a negative selection marker located upstream the nucleotide sequence or downstream the nucleotide sequence Preferably, the negative selection marker comprises the thymidine kinase (tk) gene (Thomas et al., 1986), the hygromycine beta gene (Te Riele et al., 1990), the hprt gene Van der Lugt et al., 1991; Reid et al., 1990) or the Diphteria toxin A fragment (Dt-A) gene (Nada et al., 1993; Yagi et al.1990). Preferably, the positive selection marker is located within and exon of an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide so as to interrupt the sequence encoding the sbgl, g34665, sbg2, g35017 or g35018 protein. These replacement vectors are described, for example, by Thomas et al.(1986; 1987), Mansour et al.(1988) and Koller et al.(1992).

The first and second nucleotide sequences and may be indifferently located within an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide regulatory sequence, an intronic sequence, an exon sequence or a sequence containing both regulatory and/or intronic and/or exon sequences. The size of the nucleotide sequence of(a) and ranges from 1 to kb, preferably from 1 to 10 kb, more preferably from 2 to 6 kb and most preferably from 2 to 4 kb.

DNA Constructs Allowing Homologous Recombination: Cre-LoxP System.

These new DNA constructs make use of the site specific recombination system of the PI phage. The PI phage possesses a recombinase called Cre which interacts specifically with a 34 base pairs loxP site. The loxP site is composed of two palindromic sequences of 13 bp separated by a 8 bp conserved sequence (Hoess et al., 1986). The recombination by the Cre enzyme between two loxP sites having an identical orientation leads to the deletion of the DNA fragment.

The Cre-loxP system used in combination with a homologous recombination technique has been first described by Gu et al.(1993, 1994). Briefly, a nucleotide sequence of interest to be inserted in a targeted location of the genome harbors at least two loxP sites in the same orientation and located at the respective ends of a nucleotide sequence to be excised from the recombinant genome. The excision event requires the presence of the recombinase (Cre) enzyme within the nucleus of the recombinant cell host. The recombinase enzyme may be brought at the desired time either by incubating the recombinant cell hosts in a culture medium containing this enzyme, by injecting the Cre enzyme directly into the desired cell, such as described by Araki et al.(1995), or by lipofection of the enzyme into the cells, such as W00058510 rhu:/thwwW.gelhepatent. co mlLogin.dogSexam.supt lhe= 1 part~maintoolbar-botoml Page 72 of 737 WO 00/58510 PCT/IBOO/00435 described by Baubonis et al.(1993); transfecting the cell host with a vector comprising the Cre coding sequence operably linked to a promoter functional in the recombinant cell host, which promoter being optionally inducible, said vector being introduced in the recombinant cell host, such as described by Gu et al.(1993) and Sauer et al.(1988); introducing in the genome of the cell host a polynucleotide comprising the Cre coding sequence operably linked to a promoter functional in the recombinant cell host, which promoter is optionally inducible, and said polynucleotide being inserted in the genome of the cell host either by a random insertion event or an homologous recombination event, such as described by Gu et al.(1994).

In a specific embodiment, the vector containing the sequence to be inserted in an sbgl, g34665, sbg2, g35017 or g35018 gene sequence by homologous recombination is constructed in such a way that selectable markers are flanked by loxP sites of the same orientation, it is possible, by treatment by the Cre enzyme, to eliminate the selectable markers while leaving the sbgl, g34665, sbg2, g35017 or g35018 polynucleotide sequences of interest that have been inserted by an homologous recombination event. Again, two selectable markers are needed: a positive selection marker to select for the recombination event and a negative selection marker to select for the homologous recombination event. Vectors and methods using the Cre-loxP system are described by Zou et al.(1994).

Thus, in one aspect, a further preferred DNA construct of the invention comprises, from to 3'-end: a first nucleotide sequence that is comprised by an sbgl polynucleotide; (b) a nucleotide sequence comprising a polynucleotide encoding a positive selection marker, said nucleotide sequence comprising additionally two sequences defining a site recognized by a recombinase, such as a loxP site, the two sites being placed in the same orientation; and a second nucleotide sequence comprising an sbgl polynucleotide, and is located on the genome downstream of the first sbgl polynucleotide sequence Also encompassed are DNA construct prepared in an analogous manner using g34665, sbg2, g35017 or g35018 nucleotide sequences in place of the sbgl sequences described above.

The sequences defining a site recognized by a recombinase, such as a loxP site, are preferably located within the nucleotide sequence at suitable locations bordering the nucleotide sequence for which the conditional excision is sought. In one specific embodiment, two loxP sites are located at each side of the positive selection marker sequence, in order to allow its excision at a desired time after the occurrence of the homologous recombination event.

In a preferred embodiment of a method using the third DNA construct described above, the excision of the polynucleotide fragment bordered by the two sites recognized by a recombinase, preferably two loxP sites, is performed at a desired time, due to the presence within the genome of the recombinant host cell of a sequence encoding the Cre enzyme W00058510 ahttpoJww.getthepatent.comLaogindo/Sexam.supprtFetch/oefaut.dogNVO0585 10.cpc?fromCabe=l 1art=maintoolbar=botomI Page 73 of 737 WO 00/58510 PCT/IB00/00435 71 operably linked to a promoter sequence, preferably an inducible promoter, more preferably a tissue-specific promoter sequence and most preferably a promoter sequence which is both inducible and tissue-specific, such as described by Gu et al.(1994).

The presence of the Cre enzyme within the genome of the recombinant cell host may result from the breeding of two transgenic animals, the first transgenic animal bearing the sbgl, g34665, sbg2, g35017 or g35018 polynucleotide -derived sequence of interest containing the loxP sites as described above and the second transgenic animal bearing the Cre coding sequence operably linked to a suitable promoter sequence, such as described by Gu et al.(1994).

Spatio-temporal control of the Cre enzyme expression may also be achieved with an adenovirus based vector that contains the Cre gene thus allowing infection of cells, or in vivo infection of organs, for delivery of the Cre enzyme, such as described by Anton and Graham (1995) and Kanegae et al.(1995).

The DNA constructs described above may be used to introduce a desired nucleotide sequence of the invention, preferably an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide, and most preferably an altered copy an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide sequence, within a predetermined location of the targeted genome, leading either to the generation of an altered copy of a targeted gene (knock-out homologous recombination) or to the replacement of a copy of the targeted gene by another copy sufficiently homologous to allow an homologous recombination event to occur (knock-in homologous recombination). In a specific embodiment, the DNA constructs described above may be used to introduce an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide.

Nuclear Antisense DNA Constructs Other compositions containing a vector of the invention comprise an oligonucleotide fragment of the sbgl, g34665, sbg2, g35017 or g35018 polynucleotide sequences of SEQ ID No.1 respectively, as an antisense tool that inhibits the expression of the corresponding gene.

Preferred methods using antisense polynucleotide according to the present invention are the procedures described by Sczakiel et al.(1995) or those described in PCT Application No WO 95/24223.

Preferably, the antisense tools are chosen among the polynucleotides (15-200 bp long) that are complementary to the 5'end of an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide mRNA. In one embodiment, a combination of different antisense polynucleotides complementary to different parts of the desired targeted gene are used.

Preferably, the antisense polynucleotides of the invention have a 3' polyadenylation signal that has been replaced with a self-cleaving ribozyme sequence, such that RNA polymerase II transcripts are produced without poly(A) at their 3' ends, these antisense W00058510 fhtt:twwwetthepatent.comLogindog/Sexam.suportFetDefault.dog art=maintoobarbottom Page 74 of 737 WO 00/58510 PCT/IB00/00435 72 polynucleotides being incapable of export from the nucleus, such as described by Liu et al.(1994). In a preferred embodiment, these sbgl, g34665, sbg2, g35017 org35018 antisense polynucleotides also comprise, within the ribozyme cassette, a histone stem-loop structure to stabilize cleaved transcripts against exonucleolytic degradation, such as the structure described by Eckner et al.(1991).

Oligonucleotide Probes And Primers The polynucleotides of the invention are useful in order to detect the presence of at least a copy of a nucleotide sequence of SEQ ID No. 1 or of the respective sbgl, g34665, sbg2, g35017 and g35018 polynucleotide or gene, or a fragment, complement, or variant thereof in a test sample.

Particularly preferred probes and primers of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides, to the extent that said span is consistent with the length of the nucleotide position range, of SEQ ID No 1, wherein said contiguous span comprises at least 1, 2, 3, 4, 5, 7 or 10 of the following nucleotide positions of SEQ ID No 1: nucleotide positions 31 to 292651 and 292844 to 319608; 290653 to 292652, 292653 to 296047, 292653 to 292841, 295555 to 296047, 295580 to 296047 and 296048 to 298048; 94124 to 94964; 31 to 1107, 1108 to 65853, 1108 to 1289; 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854; 213818 to 215818, 215819 to 215941, 215819 to 215975, 21 6 6 6 1 to 21 6 9 5 2 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993 and 241686 to 243685; 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915; or a complementary sequence thereto or a fragment thereof.

Probes and primers of the invention also include isolated, purified, or recombinant polynucleotides having at least 70, 75, 80, 85, 90, or 95% nucleotide identity with a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of nucleotide positions 31 to 292651 and 292844 to 319608 of SEQ ID No. 1.

W00058510 [tlp-;/twww.gethepatent.comgin.dog/SexamsuporetcWDefa 1art=maintoolbar-boftom] Page 75 of 737 WO 00/58510 PCT/IB00/00435 73 Preferred probes and primers of the invention also include isolated, purified, or recombinant polynucleotides comprising an sbgl, g34665, sbg2, g35017 or g35018 nucleotide sequence having at least 70, 75, 80, 85, 90, or 95% nucleotide identity with at least one sequence selected from the group consisting of the following nucleotide positions of SEQ ID No. 1: 290653 to 292652, 292653 to 296047, 292653 to 292841, 295555 to 296047, 295580 to 296047 and 296048 to 298048; 94124 to 94964; (c)31 to 1107, 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854; 213818 to 215818, 215819 to 215941, 215819 to 215975, 216661 to 216952, 216661 to 217061,217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993 and 241686 to 243685; 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915; or a complementary sequence thereto or a fragment thereof.

Another set of probes and primers of the invention include isolated, purified, or recombinant polynucleotides comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of SEQ ID No. 1 or the complements thereof, wherein said contiguous span comprises at least 1, 2, 3, 5, or nucleotide positions of any one of the ranges of nucleotide positions, designated posl to pos166, of SEQ ID No. 1 listed in Table 1 above.

The invention also relates to nucleic acid probes characterized in that they hybridize specifically, under the stringent hybridization conditions defined above, with a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of nucleotide positions 31 to 292651 and 292844 to 319608 of SEQ ID No. 1, or a variant thereof or a sequence complementary thereto. Particularly preferred are nucleic acid probes characterized in that they hybridize specifically, under the stringent hybridization conditions defined above, with a nucleic acid selected from the group consisting of nucleotide positions: 290653 to 292652, 292653 to 296047, 292653 to 292841, 295555 to 296047, 295580 to 296047 and 296048 to 298048; 94124 to 94964; W00058510 [http:/Avwwqgetthepatent.comfogin.dog/Sexam.support/FetchDefauitdoqNVO0058510.cpc?fromCache=I1pQart=maintolbar-bottoml Page 76 of 737 WO 00/58510 PCT/IB00/00435 74 31 to 1107, 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854; 213818 to 215818, 215819 to 215941, 215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994,240528 to 241685, 240800 to 240993 and 241686 to 243685; 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915; or a complementary sequence thereto or a fragment thereof.

The formation of stable hybrids depends on the melting temperature (Tm) of the DNA.

The Tm depends on the length of the primer or probe, the ionic strength of the solution and the G+C content. The higher the G+C content of the primer or probe, the higher is the melting temperature because G:C pairs are held by three H bonds whereas A:T pairs have only two.

The GC content in the probes of the invention usually ranges between 10 and 75 %,.preferably between 35 and 60 and more preferably between 40 and 55 A probe or a primer according to the invention may be between 8 and 2000 nucleotides in length, or is specified to be at least 12, 15, 18, 20, 25, 35, 40, 50, 60, 70, 80, 100, 250, 500 1000 nucleotides in length. More particularly, the length of these probes can range from 8, 20, or 30 to 100 nucleotides, preferably from 10 to 50, more preferably from 15 to nucleotides. Shorter probes tend to lack specificity for a target nucleic acid sequence and generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. Longer probes are expensive to produce and can sometimes self-hybridize to form hairpin structures. The appropriate length for primers and probes under a particular set of assay conditions may be empirically determined by one of skill in the art.

The primers and probes can be prepared by any suitable method, including, for example, cloning and restriction of appropriate sequences and direct chemical synthesis by a method such as the phosphodiester method of Narang et al.(1979), the phosphodiester method of Brown et al.(1979), the diethylphosphoramidite method of Beaucage et al.(1981) and the solid support method described in EP 0 707 592.

Detection probes are generally nucleic acid sequences or uncharged nucleic acid analogs such as, for example peptide nucleic acids which are disclosed in International Patent Application WO 92/20702, morpholino analogs which are described in U.S. Patents Numbered 5,185,444; 5,034,506 and 5,142,047. The probe may have to be rendered "non-extendable" in W00058510 [httpJ/Avww.getthepatent.com/L gin.do /$exam suportFetch/Defaut.dog/WO005851 0.cpcfromCarhe= 1 part=maintoolbar-bottom] Page 77 of 737 WO 00/58510 PCT/IB00/00435 that additional dNTPs cannot be added to the probe. In and of themselves analogs usually are non-extendable and nucleic acid probes can be rendered non-extendable by modifying the 3' end of the probe such that the hydroxyl group is no longer capable of participating in elongation.

For example, the 3' end of the probe can be functionalized with the capture or detection label to thereby consume or otherwise block the hydroxyl group. Alternatively, the 3' hydroxyl group simply can be cleaved, replaced or modified; U.S. Patent Application Serial No. 07/049,061 filed April 19, 1993, describes modifications which can be used to render a probe nonextendable.

Any of the polynucleotides of the present invention can be labeled, if desired, by incorporating a label detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radioactive substances 32 35S, 3 H, 1251), fluorescent dyes (5-bromodesoxyuridin, fluorescein, acetylaminofluorene, digoxigenin) or biotin. Preferably, polynucleotides are labeled at their 3' and 5' ends. Examples of non-radioactive labeling of nucleic acid fragments are described in the French patent No. FR-7810975 or by Urdea et al (1988) or Sanchez-Pescador et al (1988).

In addition, the probes according to the present invention may have structural characteristics such that they allow the signal amplification, such structural characteristics being, for example, branched DNA probes as those described by Urdea et al. in 1991 or in the European patent No.

EP 0 225 807 (Chiron).

A label can also be used to capture the primer, so as to facilitate the immobilization of either the primer or a primer extension product, such as amplified DNA, on a solid support. A capture label is attached to the primers or probes and can be a specific binding member which forms a binding pair with the solid's phase reagent's specific binding member biotin and streptavidin). Therefore depending upon the type of label carried by a polynucleotide or a probe, it may be employed to capture or to detect the target DNA. Further, it will be understood that the polynucleotides, primers or probes provided herein, may, themselves, serve as the capture label. For example, in the case where a solid phase reagent's binding member is a nucleic acid sequence, it may be selected such that it binds a complementary portion of a primer or probe to thereby immobilize the primer or probe to the solid phase. In cases where a polynucleotide probe itself serves as the binding member, those skilled in the art will recognize that the probe will contain a sequence or "tail" that is not complementary to the target. In the case where a polynucleotide primer itself serves as the capture label, at least a portion of the primer will be free to hybridize with a nucleic acid on a solid phase. DNA Labeling techniques are well known to the skilled technician.

The probes of the present invention are useful for a number of purposes. They can be W00058510 [npJtww.gethepatent.comLogin.dog/Sexam.suparFetchDefauIt.dogNVO005851 .cpc?fromCahe=1 1part=maintoolbar-bottomlPage 78 of 737 WO 00/58510 PCT/IB00/00435 76 notably used in Southern hybridization to genomic DNA. The probes can also be used to detect PCR amplification products. They may also be used to detect mismatches in a sequence comprising a polynucleotide of SEQ ID Nos I to 26, 36 to 40 and 54 to 229, or an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide or gene or mRNA using other techniques.

Any of the polynucleotides, primers and probes of the present invention can be conveniently immobilized on a solid support. Solid supports are known to those skilled in the art and include the walls of wells of a reaction tray, test tubes, polystyrene beads, magnetic beads, nitrocellulose strips, membranes, microparticles such as latex particles, sheep (or other animal) red blood cells, duracytes and others. The solid support is not critical and can be selected by one skilled in the art. Thus, latex particles, microparticles, magnetic or nonmagnetic beads, membranes, plastic tubes, walls of microtiter wells, glass or silicon chips, sheep (or other suitable animal's) red blood cells and duracytes are all suitable examples.

Suitable methods for immobilizing nucleic acids on solid phases include ionic, hydrophobic, covalent interactions and the like. A solid support, as used herein, refers to any material which is insoluble, or can be made insoluble by a subsequent reaction. The solid support can be chosen for its intrinsic ability to attract and immobilize the capture reagent. Alternatively, the solid phase can retain an additional receptor which has the ability to attract and immobilize the capture reagent. The additional receptor can include a charged substance that is oppositely charged with respect to the capture reagent itself or to a charged substance conjugated to the capture reagent. As yet another alternative, the receptor molecule can be any specific binding member which is immobilized upon (attached to) the solid support and which has the ability to immobilize the capture reagent through a specific binding reaction. The receptor molecule enables the indirect binding of the capture reagent to a solid support material before the performance of the assay or during the performance of the assay. The solid phase thus can be a plastic, derivatized plastic, magnetic or non-magnetic metal, glass or silicon surface of a test tube, microtiter well, sheet, bead, microparticle, chip, sheep (or other suitable animal's) red blood cells, duracytes and other configurations known to those of ordinary skill in the art. The polynucleotides of the invention can be attached to or immobilized on a solid support individually or in groups of at least 2, 5, 8, 10, 12, 15, 20, or 25 distinct polynucleotides of the invention to a single solid support. In addition, polynucleotides other than those of the invention may be attached to the same solid support as one or more polynucleotides of the invention.

Consequently, the invention also comprises a method for detecting the presence of a nucleic acid comprising a nucleotide sequence selected from a group consisting of SEQ ID Nos.

1 to 26, 36 to 40 and 54 to 229, a fragment or a variant thereof or a complementary sequence W00058510 [httpwllww.getthepatent.com/Login.dog/SXmSportFethDefault.dogNVO005851O.cpc?fromCache=1 part=maintoolbar--boftom Page 79 of 737 WO 00/58510 PCT/IB00/00435 77 thereto in a sample, said method comprising the following steps of: a) bringing into contact a nucleic acid probe or a plurality of nucleic acid probes which can hybridize with a nucleotide sequence included in a nucleic acid selected form the group consisting of the nucleotide sequences of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229, a fragment or a variant thereof or a complementary sequence thereto and the sample to be assayed; and b) detecting the hybrid complex formed between the probe and a nucleic acid in the sample.

The invention further concerns a kit for detecting the presence of a nucleic acid comprising a nucleotide sequence selected from a group consisting of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229, a fragment or a variant thereof or a complementary sequence thereto in a sample, said kit comprising: a) a nucleic acid probe or a plurality of nucleic acid probes which can hybridize with a nucleotide sequence included in a nucleic acid selected form the group consisting of the nucleotide sequences of SEQ ID Nos. I to 26, 36 to 40 and 54 to 229, a fragment or a variant thereof or a complementary sequence thereto; and b) optionally, the reagents necessary for performing the hybridization reaction.

In a first preferred embodiment of this detection method and kit, said nucleic acid probe or the plurality of nucleic acid probes are labeled with a detectable molecule. In a second preferred embodiment of said method and kit, said nucleic acid probe or the plurality of nucleic acid probes has been immobilized on a substrate. In a third preferred embodiment, the nucleic acid probe or the plurality of nucleic acid probes comprise either a sequence which is selected from the group consisting of the nucleotide sequences of PI to P360 and the complementary sequence thereto, BI to B229, Cl to C229, Dl to D360, El to E360, or a nucleotide sequence comprising a biallelic marker selected from the group consisting of Al to A360 or a polymorphism selected from the group consisting of A361 to A489, or the complements thereto.

Oligonucleotide Arrays A substrate comprising a plurality of oligonucleotide primers or probes of the invention may be used either for detecting or amplifying targeted sequences in a nucleotide sequence of SEQ ID No. 1, more particularly in an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide, or in genes comprising an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide and may also be used for detecting mutations in the coding or in the non-coding sequences of an sbgl, g34665, sbg2, g35017 or g35018 nucleic acid sequence, or genes comprising an sbgl, g34665, sbg2, g3501 7 or g35018 nucleic acid sequence.

Any polynucleotide provided herein may be attached in overlapping areas or at random W0005851 0 [httlJw.gettho/examsuportiFetchDefaut.doNVO005851 0.cpcfromCache= 1 part=maintoolbar-bottom] Pag 80 of 737 WO 00/58510 PCT/IB00/00435 78 locations on the solid support. Alternatively the polynucleotides of the invention may be attached in an ordered array wherein each polynucleotide is attached to a distinct region of the solid support which does not overlap with the attachment site of any other polynucleotide.

Preferably, such an ordered array of polynucleotides is designed to be "addressable" where the distinct locations are recorded and can be accessed as part of an assay procedure. Addressable polynucleotide arrays typically comprise a plurality of different oligonucleotide probes that are coupled to a surface of a substrate in different known locations. The knowledge of the precise location of each polynucleotides location makes these "addressable" arrays particularly useful in hybridization assays. Any addressable array technology known in the art can be employed with the polynucleotides of the invention. One particular embodiment of these polynucleotide arrays is known as GenechipsTM, and has been generally described in US Patent 5,143,854; PCT publications WO 90/15070 and 92/10092. These arrays may generally be produced using mechanical synthesis methods or light directed synthesis methods which incorporate a combination of photolithographic methods and solid phase oligonucleotide synthesis (Fodor et al., 1991, incorporated herein by reference). The immobilization of arrays ofoligonucleotides on solid supports has been rendered possible by the development of a technology generally identified as "Very Large Scale Immobilized Polymer Synthesis" (VLSIPS

M

in which, typically, probes are immobilized in a high density array on a solid surface of a chip. Examples of VLSIPSTM technologies are provided in US Patents 5,143,854; and 5,412,087 and in PCT Publications WO 90/15070, WO 92/10092 and WO 95/11995, which describe methods for forming oligonucleotide arrays through techniques such as light-directed synthesis techniques.

In designing strategies aimed at providing arrays of nucleotides immobilized on solid supports, further presentation strategies were developed to order and display the oligonucleotide arrays on the chips in an attempt to maximize hybridization patterns and sequence information. Examples of such presentation strategies are disclosed in PCT Publications WO 94/12305, WO 94/11530, WO 97/29212 and WO 97/31256.

In another embodiment of the oligonucleotide arrays of the invention, an oligonucleotide probe matrix may advantageously be used to detect mutations occurring in an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide, including in genes comprising an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide and preferably in an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide regulatory region. For this particular purpose, probes are specifically designed to have a nucleotide sequence allowing their hybridization to the genes that carry known mutations (either by deletion, insertion or substitution of one or several nucleotides). By known mutations in an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide, it is meant, mutations in an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide that have W00058510 (htto://wwwgetthepatent.com/Login.dog/Sexam.supporttFetch/DefauIt.doqNVO005851 .cpc?fromCache=1part=maintoolbar-botom] Page 81 of 737 WO 00/58510 PCT/IB00/00435 79 been identified according; the technique used by Huang et al.(1996) or Samson et al.(1996), for example, may be used to identify such mutations.

Another technique that is used to detect mutations in an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide is the use of a high-density DNA array. Each oligonucleotide probe constituting a unit element of the high density DNA array is designed to match a specific subsequence of an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide. Thus, an array consisting ofoligonucleotides complementary to subsequences of the target gene sequence is used to determine the identity of the target sequence with the wild-type gene sequence, measure its amount, and detect differences between the target sequence and the reference wild-type nucleic acid sequence of an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide. In one such design, termed 4L tiled array, is implemented a set of four probes C, G, preferably nucleotide oligomers. In each set of four probes, the perfect complement will hybridize more strongly than mismatched probes. Consequently, a nucleic acid target of length L is scanned for mutations with a tiled array containing 4L probes, the whole probe set containing all the possible mutations in the known wild reference sequence. The hybridization signals of the mer probe set tiled array are perturbed by a single base change in the target sequence. As a consequence, there is a characteristic loss of signal or a "footprint" for the probes flanking a mutation position. This technique was described by Chee et al. in 1996.

Consequently, the invention concerns an array of nucleic acid molecules comprising at least one polynucleotide described above as probes and primers. Preferably, the invention concerns an array of nucleic acid comprising at least two polynucleotides described above as probes and primers.

Sbgl, g34665, sbg2, g35017 and g35018 Proteins and Polypeptide Fragments: The terms "sbal polvoeptides", "g34665 polvpeptides", "sb2 polvpetides", "g35017 polypeptides", "g35017 polvpeptides" are used herein to embrace all of the proteins and polypeptides encoded by the respective sbgl, g34665, sbg2, g35017 and g35018 polypeptides of the present invention. Forming part of the invention are polypeptides encoded by the polynucleotides of the invention, as well as fusion polypeptides comprising such polypeptides.

The invention embodies proteins from humans, mammals, primates, non-human primates, and includes isolated or purified sbgl proteins consisting, consisting essentially, or comprising the sequence of SEQ ID Nos 27 to 35, isolated or purified g34665, g35017 and sbg2 proteins encoded by the g34665, g35017 and sbg2 polynucleotide sequence of SEQ ID No 1, and isolated or purified g35018 proteins consisting, consisting essentially, or comprising the sequence of SEQ ID Nos 41 to 43.

W0005851 0 [tnp/www. getthe -q in.dog/Sexam.supportFeth/efauIt. dog O005851 0.ccfro nCache= 1 part=maiModba r--bottom] Page 82 of 737 WO 00/58510 PCT/IB00/00435 It should be noted that the sbgl, g34665, sbg2, g35017 and g35018 proteins of the invention also comprise naturally-occurring variants of the amino acid sequence of the respective human sbgl, g34665, sbg2, g35017 and g3501 8 proteins.

The present invention embodies isolated, purified, and recombinant polypeptides comprising a contiguous span of at least 4 amino acids, preferably at least 6, more preferably at least 8 to 10 amino acids, more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids, to the extent that said span is consistent with the length of a particular SEQ ID, of SEQ ID Nos 27 to 35 and 41 to 43. In other preferred embodiments the contiguous stretch of amino acids comprises the site of a mutation or functional mutation, including a deletion, addition, swap or truncation of the amino acids in an sbgl, g34665, sbg2, g35017 and g35018 protein sequence.

The invention also embodies isolated, purified, and recombinant sbgl polypeptides comprising a contiguous span of at least 4 amino acids, preferably at least 6 or at least 8 to amino acids, more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of SEQ ID Nos 27 to 35, wherein said contiguous span comprises an amino acid variation according to Table The present inventors have further identified potential cleavage sites in the sbgl polypeptides, and several specific sbgl peptides. An sbgl peptide has further been tested in behavioral studies by injection in mice, as further detailed in Example 7. In particular, the polypeptide of SEQ ID No 29 contains a protease cleavage site at amino acid positions 62 to 63; the polypeptide of SEQ ID No 30 contains a protease cleavage site at amino acid positions 63 to 64 and 110 to 111; the polypeptide of SEQ ID No 32 contains a protease cleavage site at amino acid positions 63 to 64; the polypeptide of SEQ ID No 33 contains a protease cleavage site at amino acid positions 54 to 55 and 57 to 58; the polypeptide of SEQ ID No 34 contains a protease cleavage site at amino acid positions 63 to 64 and 122 to 123; and the polypeptide of SEQ ID No 35 contains a protease cleavage site at amino acid positions 62 to 63 and 63 to 64.

Additionally, sbgl polypeptides of SEQ ID Nos 30, 32 and 34 contain cysteine residues predicted to be capable of forming a disulfide bridge at amino acid positions 82 and 104 of SEQ ID No 30, amino acid positions 82 and 106 and SEQ ID No 32, and amino acid positions 132 and 142 of SEQ ID No 34. In particularly preferred embodiment, the invention comprises isolated, purified, and recombinant sbgl peptides comprising a contiguous span of at least 4 amino acids, preferably at least 6 or at least 8 to 10 amino acids, more preferably at least 12 or amino acids of an amino acid position range selected from the group consisting of amino acid positions: 1 to 63 and 64 to 102 of SEQ ID No 29; 1 to 64, 65 to 111 and 112 to 119 of SEQ ID No 30; I to 64 and 65 to 126 of SEQ ID No 32; 1 to 64, 65 to 123 and 124 to 153 of SEQ ID No 34; and 1 to 61 and 65 to 106 of SEQ ID No W0005851 0 fhtto:/Awwy.aettheratent.comlLoain.doo/Sexam.SUooortFetch/Default.doWOO0585i O.ctcfrom~ar-he= 1 Part=maintoolbar-botom] Paqe 83 of 737 WO 00/58510 PCT/IB00/00435 81 The invention further embodies sbgl, g34665, sbg2, g35017 and g35018 polypeptides, including isolated and recombinant polypeptides, encoded respectively by sbgl, g34665, sbg2, g35017 and g35018 polynucleotides consisting, consisting essentially, or comprising a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200 or 500 nucleotides, to the extent that the length of said span is consistent with the nucleotide position range, of SEQ ID No 1, wherein said contiguous span comprises at least 1, 2, 3, 4, 5, 7 or 10 of the following nucleotide positions of SEQ ID No 1: 290653 to 292652, 292653 to 296047, 292653 to 292841, 295555 to 296047 and 295580 to 296047; 94144 to 94964 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, and 65505 to 65853; 215819 to 215941, 215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880,231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685 and 240800 to 240993; 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915; or the complements thereof.

The present invention further embodies isolated, purified, and recombinant polypeptides encoded by an sbgl polynucleotide or gene comprising at least one sbgl nucleotide sequence selected from the group consisting of the following sbgl exons: MSI, M1, M692, M862, MS2, M1069, M1090, MI 117, N, N2, Nbis, 0, 01, 02, Obis, P, X, Ql, Q, Qbis, R and Rbis.

The invention also encompasses a purified, isolated, or recombinant polypeptides comprising an amino acid sequence having at least 70, 75, 80, 85, 90, 95, 98 or 99% amino acid identity with the amino acid sequence of SEQ ID Nos 27 to 35 and 41 to 43 or a fragment thereof.

Sbgl, g34665, sbg2, g35017 and g35018 proteins are preferably isolated from human or mammalian tissue samples or expressed from human or mammalian genes. The sbgl, g34665, sbg2, g35017 and g35018 polypeptides of the invention can be made using routine expression methods known in the art. The polynucleotide encoding the desired polypeptide, is ligated into an expression vector suitable for any convenient host. Both eukaryotic and prokaryotic host systems is used in forming recombinant polypeptides, and a summary of some of the more common systems. The polypeptide is then isolated from lysed cells or from the culture medium W00058510 rhttp:/twww. ettheatent.comrn1.og.dog/Sexa msupoartFetch/DefaultdoNVO00585 1 .cpcfromCache= 1 part=maintoolbar-botom Page 84 of 737 WO 00/58510 PCT/IB00/00435 82 and purified to the extent needed for its intended use. Purification is by any technique known in the art, for example, differential extraction, salt fractionation, chromatography, centrifugation, and the like. See, for example, Methods in Enzymology for a variety of methods for purifying proteins.

In addition, shorter protein fragments can be produced by chemical synthesis.

Alternatively the proteins of the invention is extracted from cells or tissues of humans or nonhuman animals. Methods for purifying proteins are known in the art, and include the use of detergents or chaotropic agents to disrupt particles followed by differential extraction and separation of the polypeptides by ion exchange chromatography, affinity chromatography, sedimentation according to density, and gel electrophoresis.

Any sbgl, g34665, sbg2, g35017 or g35018 cDNA or fragment thereof, including the respective cDNA sequences of SEQ ID Nos 2 to 26 and 36 to 40 is used to express sbgl, g34665, sbg2, g35017 or g35018 proteins and polypeptides. The nucleic acid encoding the sbgl, g34665, sbg2, g35017 or g35018 protein or polypeptide to be expressed is operably linked to a promoter in an expression vector using conventional cloning technology. The sbgl, g34665, sbg2, g35017 or g35018 insert in the expression vector may comprise the full coding sequence for the respective sbgl, g34665, sbg2, g35017 or g35018 protein or a portion thereof. For example, the sbgl or g35018 derived insert may encode a polypeptide comprising at least 10 consecutive amino acids of the respective sbgl or g35018 protein of SEQ ID Nos 27 to 35 and 41 to 43.

The expression vector is any of the mammalian, yeast, insect or bacterial expression systems known in the art. Commercially available vectors and expression systems are available from a variety of suppliers including Genetics Institute (Cambridge, MA), Stratagene (La Jolla, California), Promega (Madison, Wisconsin), and Invitrogen (San Diego, California). If desired, to enhance expression and facilitate proper protein folding, the codon context and codon pairing of the sequence is optimized for the particular expression organism in which the expression vector is introduced, as explained by Hatfield, et al., U.S. Patent No. 5,082,767.

In one embodiment, the entire coding sequence of the sbgl, g34665, sbg2, g35017 or g35018 cDNA through the poly A signal of the cDNA are operably linked to a promoter in the expression vector. Alternatively, if the nucleic acid encoding a portion of the sbgl, g34665, sbg2, g35017 or g35018 protein lacks a methionine to serve as the initiation site, an initiating methionine can be introduced next to the first codon of the nucleic acid using conventional techniques.

Similarly, if the insert from the sbgl, g34665, sbg2, g35017 or g35018 cDNA lacks a poly A signal, this sequence can be added to the construct by, for example, splicing out the Poly A signal from pSG5 (Stratagene) using BglI and Sail restriction endonuclease enzymes and incorporating it into the mammalian expression vector pXTI (Stratagene). pXTI contains the LTRs and a portion W0005851 0 [http:/Avww.getthepatent.com/Login.dog/Sexam.supporttFetch[Default.doqO005851 u.cpctrom;ane= 1 partmaintoolbar=bottom] Page 85 of 737 WO 00/58510 PCT/IB00/00435 83 of the gag gene from Moloney Murine Leukemia Virus. The position of the LTRs in the construct allow efficient stable transfection. The vector includes the Herpes Simplex Thymidine Kinase promoter and the selectable neomycin gene. The nucleic acid encoding the sbgl, g34665, sbg2, g35017 or g35018 protein or a portion thereof is obtained by PCR from a bacterial vector containing the a nucleotide sequence of an exon of an sbgl, g34665, sbg2, g35017 or g35018 gene as described herein and in SEQ ID No 1, or from an sbgl or g35018 cDNA comprising a nucleic acid of SEQ ID No 2 to 26 and 36 to 40 using oligonucleotide primers complementary to the sbgl, g34665, sbg2, g35017 or g35018 nucleic acid or portion thereof and containing restriction endonuclease sequences for Pst I incorporated into the 5' primer and Bglll at the 5' end of the corresponding cDNA 3' primer, taking care to ensure that the sequence encoding the sbg 1, g34665, sbg2, g35017 or g35018 protein or a portion thereof is positioned properly with respect to the poly A signal. The purified fragment obtained from the resulting PCR reaction is digested with Pstl, blunt ended with an exonuclease, digested with Bgl II, purified and ligated to pXTI, now containing a poly A signal and digested with BglII.

The ligated product is transfected into mouse NIH 3T3 cells using Lipofectin (Life Technologies, Inc., Grand Island, New York) under conditions outlined in the product specification. Positive transfectants are selected after growing the transfected cells in 600ug/ml G418 (Sigma, St. Louis, Missouri).

Alternatively, the nucleic acids encoding the sbgl, g34665, sbg2, g35017 or g35018 protein or a portion thereof is cloned into pED6dpc2 (Genetics Institute, Cambridge, MA). The resulting pED6dpc2 constructs is transfected into a suitable host cell, such as COS 1 cells.

Methotrexate resistant cells are selected and expanded.

The above procedures may also be used to express a mutant sbgl, g34665, sbg2, g35017 or g35018 protein responsible for a detectable phenotype or a portion thereof.

The expressed proteins are purified using conventional purification techniques such as ammonium sulfate precipitation or chromatographic separation based on size or charge. The protein encoded by the nucleic acid insert may also be purified using standard immunochromatography techniques. In such procedures, a solution containing the expressed sbgl, g34665, sbg2, g35017 or g35018 protein or portion thereof, such as a cell extract, is applied to a column having antibodies against the sbgl, g34665, sbg2, g35017 or g35018 protein or portion thereof is attached to the chromatography matrix. The expressed protein is allowed to bind the immunochromatography column. Thereafter, the column is washed to remove non-specifically bound proteins. The specifically bound expressed protein is then released from the column and recovered using standard techniques.

To confirm expression of the sbgl, g34665, sbg2, g35017 or g35018 protein or a portion W00058510 fhttpQ/twww.getthe patent.com/Locgin.dog/Sexa m suort/Fetch/Default. dgiO005851 0.cpc0fromCa he= 1 part=ma intoo bar--botom Pag86 of 737 WO 00/58510 PCT/IB00/00435 84 thereof, the proteins expressed from host cells containing an expression vector containing an insert encoding the sbgl, g34665, sbg2, g35017 or g35018 protein or a portion thereof can be compared to the proteins expressed in host cells containing the expression vector without an insert. The presence of a band in samples from cells containing the expression vector with an insert which is absent in samples from cells containing the expression vector without an insert indicates that the sbgl, g34665, sbg2, g35017 or g35018 protein or a portion thereof is being expressed. Generally, the band will have the mobility expected for the sbgl, g34 6 65, sbg2, g35 0 17 or g35018 protein or portion thereof. However, the band may have a mobility different than that expected as a result of modifications such as glycosylation, ubiquitination, or enzymatic cleavage.

Antibodies capable of specifically recognizing the expressed sbgl, g34665, sbg2, g35017 or g35018 protein or a portion thereof are described below.

If antibody production is not possible, the nucleic acids encoding the sbgl, g34665, sbg2, g35017 or g35018 protein or a portion thereof is incorporated into expression vectors designed for use in purification schemes employing chimeric polypeptides. In such strategies the nucleic acid encoding the sbgl, g34665, sbg2, g35017 or g35018 protein or a portion thereof is inserted in frame with the gene encoding the other half of the chimera. The other half of the chimera is 03globin or a nickel binding polypeptide encoding sequence. A chromatography matrix having antibody to -globin or nickel attached thereto is then used to purify the chimeric protein. Protease cleavage sites is engineered between the -globin gene or the nickel binding polypeptide and the sbgl, g3466 5 sbg2, g35017 or g35018 protein or portion thereof. Thus, the two polypeptides of the chimera is separated from one another by protease digestion.

One useful expression vector for generating p-globin chimeric proteins is (Stratagene), which encodes rabbit P-globin. Intron II of the rabbit p-globin gene facilitates splicing of the expressed transcript, and the polyadenylation signal incorporated into the construct increases the level of expression. These techniques are well known to those skilled in the art of molecular biology. Standard methods are published in methods texts such as Davis et al., (1986) and many of the methods are available from Stratagene, Life Technologies, Inc., or Promega.

Polypeptide may additionally be produced from the construct using in vitro translation systems such as the In vitro Express T Translation Kit (Stratagene).

Antibodies That Bind sbgl, g34665, sbg2, g35017 or g35018 Polypeptides of the Invention Any sbgl, g34665, sbg2, g35017 or g35018 polypeptide or whole protein may be used to generate antibodies capable of specifically binding to an expressed sbgl, g34665, sbg2, g35017 and g35018 protein or fragments thereof.

W00058510 [http/www.getthepatent.com/Login.dog/Sexam.support/Fetch/Default dogNWO0058510.cpc?fromCache= lpart=maintoolbar=bottom] Page 87 of 737 WO 00/58510 PCT/IB00/00435 For an antibody composition to specifically bind to an sbgl, g34665, sbg2, g35017 or g35018 protein, it must demonstrate at least a 10%, 15%, 20%, 25%, 50%, or 100% greater binding affinity for full length sbgl, g34665, sbg2, g35017 or g35018 protein than for any full length protein in an ELISA, RIA, or other antibody-based binding assay. For an antibody composition to specifically bind to a variant sbgl, g34665, sbg2, g35017 or g35018 protein, it must demonstrate at least a 10%, 15%, 20%, 25%, 50%, or 100% greater binding affinity for the respective full length variant sbgl, g34665, sbg2, g35017 or g35018 protein than for the respective reference sbgl, g34665, sbg2, g35017 or g35018 full length protein in an ELISA, RIA, or other antibody-based binding assay.

One antibody composition of the invention is capable of specifically binding or specifically binds to the respective sbgl org35018 proteins of SEQ ID Nos 27 to 35 and 41 to 43. Other antibody compositions of the invention are capable of specifically binding or specifically bind to an sbgl, sbg2 or g35018 protein variant. Optionally said sbgl protein variant may be a natural variant provided in Tables 5d or In one embodiment, the invention concerns antibody compositions, either polyclonal or monoclonal, capable of selectively binding, or selectively bind to an epitope-containing a polypeptide comprising a contiguous span of at least 6 amino acids, preferably at least 8 to amino acids, more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of an sbgl, g34665, sbg2, g35017 or g35018 polypeptide.

The invention also concerns a purified or isolated antibody capable of specifically binding to a mutated sbgl, g34665, sbg2, g35017 or g35018 protein or to a fragment or variant thereof comprising an epitope of the mutated sbgl, g34665, sbg2, g35017 or g35018 protein. In another preferred embodiment, the present invention concerns an antibody capable of binding to a polypeptide comprising at least 10 consecutive amino acids of an sbgl, g34665, sbg2, g35017 or g35018 protein and including at least one of the amino acids which can be encoded by the trait causing mutations.

In a preferred embodiment, the invention concerns the use in the manufacture of antibodies of a polypeptide comprising a contiguous span of at least 6 amino acids, preferably at least 8 to 10 amino acids, more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of any of SEQ ID Nos 27 to 35 and 41 to 43.

Non-human animals, and more particularly non-human mammals and non-human primates, whether wild-type or transgenic, which express a different species of sbgl, g34665, sbg2, g35017 or g35018 than the one to which antibody binding is desired, and animals which do not express sbgl, g34665, sbg2, g35017 or g35018 an sbgl, g34665, sbg2, g35017 or g3501 8 knock out animal as described in herein) are particularly useful for preparing antibodies.

W00058510 (t!pItwww.gethepate nt.comLogin.dogexa m. sueportFetchDefaut.ogm 1 Page 88 of 737 WO 00/58510 PCT/IB00/00435 86 sbgl, g34665, sbg2, g35017 or g35018 knock out animals will recognize all or most of the exposed regions of an sbgl, g34665, sbg2, g35017 or g35018 protein as foreign antigens, and therefore produce antibodies with a wider array of sbgl, g34665, sbg2, g35017 or g35018 epitopes. Moreover, smaller polypeptides with only 10 to 30 amino acids may be useful in obtaining specific binding to any one of the sbgl, g34665, sbg2, g35017 or g35018 proteins. In addition, the humoral immune system of animals which produce a species of sbgl, g34665, sbg2, g35017 or g35018 that resembles the antigenic sequence will preferentially recognize the differences between the animal's native sbgl, g34665, sbg2, g35017 or g35018 species and the antigen sequence, and produce antibodies to these unique sites in the antigen sequence.. Such a technique will be particularly useful in obtaining antibodies that specifically bind to any one of the sbgl, g34665, sbg2, g35017 or g35018 proteins.

Antibody preparations prepared according to either protocol are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples; they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample.

The antibodies may also be used in therapeutic compositions for killing cells expressing the protein or reducing the levels of the protein in the body. Thus in one embodiment, the invention comprises the use of an antibody capable of specifically recognizing sbgl, g34665, sbg2, g35017 or g35018 for the treatment of schizophrenia or bipolar disorder.

The antibodies of the invention may be labeled by any one of the radioactive, fluorescent or enzymatic labels known in the art.

Consequently, the invention is also directed to a method for detecting specifically the presence of an sbgl, g34665, sbg2, g35017 or g35018 polypeptide according to the invention in a biological sample, said method comprising the following steps: a) bringing into contact the biological sample with a polyclonal or monoclonal antibody that specifically binds an sbgl, g34665, sbg2, g35017 or g35018 polypeptide, or to a peptide fragment or variant thereof; and b) detecting the antigen-antibody complex formed.

The invention also concerns a diagnostic kit for detecting in vitro the presence of an sbgl, g34665, sbg2, g35017 or g35018 polypeptide according to the present invention in a biological sample, wherein said kit comprises: a) a polyclonal or monoclonal antibody that specifically binds an sbgl, g34665, sbg2, g35017 or g35018 polypeptide, or to a peptide fragment or variant thereof, optionally labeled; b) a reagent allowing the detection of the antigen-antibody complexes formed, said reagent carrying optionally a label, or being able to be recognized itself by a labeled reagent, W00058510 [httpltwww.getthepatent.com/Logi.dog/$exam.suportFetch/DefauIt.dociNVO005851o.cctromcache=1part=maintootbar-bottom] Page 89 of 737 WO 00/58510 PCT/IB00/00435 87 more particularly in the case when the above-mentioned monoclonal or polyclonal antibody is not labeled by itself.

Biallelic markers of the inventions Advantages of the biallelic markers of the present invention The biallelic marker of the inventions of the present invention offer a number of important advantages over other genetic markers such as RFLP (Restriction fragment length polymorphism) and VNTR (Variable Number of Tandem Repeats) markers.

The first generation of markers, were RFLPs, which are variations that modify the length of a restriction fragment. But methods used to identify and to type RFLPs are relatively wasteful of materials, effort, and time. The second generation of genetic markers were VNTRs, which can be categorized as either minisatellites or microsatellites. Minisatellites are tandemly repeated DNA sequences present in units of 5-50 repeats which are distributed along regions of the human chromosomes ranging from 0.1 to 20 kilobases in length. Since they present many possible alleles, their informative content is very high. Minisatellites are scored by performing Southern blots to identify the number of tandem repeats present in a nucleic acid sample from 4 the individual being tested. However, there are only 10 potential VNTRs that can be typed by Southern blotting. Moreover, both RFLP and VNTR markers are costly and time-consuming to develop and assay in large numbers.

Single nucleotide polymorphism or biallelic markers can be used in the same manner as RFLPs and VNTRs but offer several advantages. Single nucleotide polymorphisms are densely spaced in the human genome and represent the most frequent type of variation. An estimated number of more than 10 7 sites are scattered along the 3x10 9 base pairs of the human genome.

Therefore, single nucleotide polymorphism occur at a greater frequency and with greater uniformity than RFLP or VNTR markers which means that there is a greater probability that such a marker will be found in close proximity to a genetic locus of interest. Single nucleotide polymorphisms are less variable than VNTR markers but are mutationally more stable.

Also, the different forms of a characterized single nucleotide polymorphism, such as the biallelic markers of the present invention, are often easier to distinguish and can therefore be typed easily on a routine basis. Biallelic markers have single nucleotide based alleles and they have only two common alleles, which allows highly parallel detection and automated scoring.

The biallelic markers of the present invention offer the possibility of rapid, high-throughput genotyping of a large number of individuals.

Biallelic markers are densely spaced in the genome, sufficiently informative and can be assayed in large numbers. The combined effects of these advantages make biallelic markers W00058510 [http:/www.getthenatent.coMII..ogn-dog/Sexam.support/Fetch/Default.dogNVO0058510.cpc?fromCache=1part=maintoolbar--botoml Page 90 of 737 WO 00/58510 PCT/IB00/00435 88 extremely valuable in genetic studies. Biallelic markers can be used in linkage studies in families, in allele sharing methods, in linkage disequilibrium studies in populations, in association studies of case-control populations. An important aspect of the present invention is that biallelic markers allow association studies to be performed to identify genes involved in complex traits. Association studies examine the frequency of marker alleles in unrelated caseand control-populations and are generally employed in the detection of polygenic or sporadic traits. Association studies may be conducted within the general population and are not limited to studies performed on related individuals in affected families (linkage studies). Biallelic markers in different genes can be screened in parallel for direct association with disease or response to a treatment. This multiple gene approach is a powerful tool for a variety of human genetic studies as it provides the necessary statistical power to examine the synergistic effect of multiple genetic factors on a particular phenotype, drug response, sporadic trait, or disease state with a complex genetic etiology.

Polymorphisms. Biallelic Markers And Polynucleotides Comprising Them Polynucleotides of the present invention In one aspect, the invention concerns biallelic markers associated with schizophrenia.

The invention comprises chromosome 13q3 -q33-related biallelic markers, region D-related biallelic markers, sbgl-related biallelic markers, g34665-related biallelic markers, sbg2-related biallelic markers, g35017-related biallelic markers and g35018-related biallelic markers. The markers and polymorphisms are generally referred to herein as Al, A2, A3 and so on. The polymorphisms and biallelic markers of the invention comprise the biallelic markers designated Al to A360 in Table 6b. The polymorphisms of the invention also comprise the polymorphisms designated A361 to A489 in Table 6c. Also included are biallelic markers in linkage disequilibrium with the biallelic markers of the invention.

Details of chromosome 13q31-q33-related biallelic markers on the subregions designated Region D including subregions thereof designated Regions Dl, D2 ,D3 and D4, and adjacent regions referred to as Region E and Region G are shown below and in Tables 6B and 6c. Regions D, G and E of the chromosome 13q31-q33 locus are also shown in Figure 2.

References to the corresponding SEQ ID number, to alternative marker designations, and positions of the sequence features within the SEQ ID are given in Tables 6b and 6c for biallelic markers Al to A242 and 361 to 489 located in Region D3 and D4. Further biallelic markers from the group designated A243 to A360 in Tables 6b and 6c are located in Regions Dl, D2, G and E. The relative positions of biallelic markers on Region G and E are further detailed below in Table 5g; the relative positions of biallelic markers on Region Dl and D2 are further detailed W0005851 0 Chttp:ilwww. etthe patent. com/Log in.do /Sexam.suportFetchDefault.dgWO55 Occfmahe1 rtmnaobrbtml ae91 of 737 WO 00/58510 PCT/LBOOIOO43S below in Table Table Blallelic Region E biallelic Position on marker markers contig A311 99-26171-71 20778 A333 99-26173-470 22456 A308 99-26166-257 24731 A310 99-26169-211 31620 A312 99-26183-156 35869 A309 99-26167-278 43220 A78 99-20978-89 51405 A275 99-20983-48 65076 A272 99-20977-72 70519 A274 99-20981-300 94914 A327 99-6080-99 134366 A325 99-5912-49 149345 A252 99-15229-412 154582 A276 99-22310-148 161605 A254 99-15232-291 162153 A247 99-14021-108 164660 A300 99-26126-498 170445 A329 99-7337-204 198083 A243 8-94-252 206618 A253 99-15231-219 212050 A246 8-98-68 213871 A245 8-97-98 215017 A326 99-6012-220 216597 A255 99-15239-377 223699 A244 8-95-43 236882 A38 99-7308-157 239008 A248 99-14364-415 255729 Blallelic Region G blallelic Position on coatig marker markers A359 99-27912-272 153458 A322 99-26234-336 210058 A267 99-15672-166 266449 A283 99-25917-115 268222 A266 99-15668-139 278427 A282 99-25906-131 291272 A265 99-15665-398 306920 A264 99-15664-185 311251 A268 99-15682-3 18 315770 A271 99-20933-81 342868 A323 99-26238-186 347179 A302 99-26146-264 349864- A321 99-26233-275 362053 A279 99-25869-182 362236- A317 99-26222-149 391049 A301 99-26138-193 400078 A318 99-26223-225 405361 A319 99-26225-148 416529 A284 99-25924-215 421281 A320 99-26228-172 427201 A280 99-25881-275 435974 A281 99-25897-264 440452 A337 99-26769-256 471739 A338 99-26772-268 483511 A339 99-26776-209 494003 A340 99-26779-437 505947 A341 99-26781-25 514635 A342 99-26782-300 516212 A343 99-26783-81 519187 A344 99-26787-96 529412 A345 99-26789-201 540145 A316 99-26201-267 584018 W0005851 0[tp/w. q eth aet 0I i~o/eams potFthDf l.dqV055.cpc?from~a che= 1 part= ma intoo Iba r--bottom] Page 92 of 737 WO 00/58510 PCT/IBOO/00435 A315 99-26191-58 601044 A314 99-26190-20 602591 A313 99-26189-164 603145 A277 99-25029-24 1 727473 A336 199-26559-315 740802 Table Biallelic Region DI biallelic Position on marker markers contig A357 99-27365/42 1 48742 A356 99-27361/181 54932 A257 99-15253/382 56599 A355 99-27360/142 57371 A251 99-15065/85 61002 A346 99-27297/280 61855 A262 99-15355/150 62749 A324 99-5873/159 64700 A261 99-15280/432 76977 A347 99-27306/108 92355 A249 99-15056/99 93854 A258 99-15256/392 98336 A349 99-27323/372 100260 A260 99-15261/202 101114 A250 99-15063/155 105587 A259 99-15258/337 110395 A348 99-27312/58 117521 A351 99-27345/189 134904 A352 99-27349/267 138974 A353 99-27352/197 141065 A354 99-27353/105 141494 Biallelic Region D2 biallelic Position on contig marker markers A304 99-26150/276 168065 A307 99-26156/290 173255 A306 99-26154/107 175557 A305 199-26153/44 177194 A298 99-25985/194 186447 A292 99-25974/143 190018 A335 99-26284/394 193065 A303 199-26147/396 196922 A285 199-25950/121 205288 A294 99-25978/166 215025 A293 99-25977/311 216394 A291 99-25972/317 224712 A297 99-25984/312 230966 A287 99-25965/399 236799 A286 99-25961/376 244955 A288 99-25966/241 254680 A350 99-27335/191 25486 A289 99-25967/57 257662 A290 99-25969/200 261166 A296 99-25980/173 261957 A295 199-25979/93 263848 A299 99-25989/398 269515 A334 199-26267/524 275710 The polynucleotide of the invention may consist of, consist essentially of, or comprise a contiguous span of nucleotides of a sequence from any of SEQ ID Nos. I to 26, 36 to 40 and 54 to 229 as well as sequences which are complementary thereto ("complements thereof'). The "4contiguous span" may be at least 8, 10, 12, 15, 18, 20, 25, 35, 40, 50, 70, 80, 100, 250, 500, W00058510 fhttp lhwwetthe patent.omio in.dogexamOsu.cpcfromCacte= 1art=maintoolbar=bottom Page 93 of 737 WO 00/58510 PCT/IB00/00435 91 1000 or 2000 nucleotides in length, to the extent that a contiguous span of these lengths is consistent with the lengths of the particular Sequence ID.

The present invention encompasses polynucleotides for use as primers and probes in the methods of the invention. These polynucleotides may consist of, consist essentially of, or comprise a contiguous span of nucleotides of a sequence from any of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 as well as sequences which are complementary thereto ("complements thereof'). The "contiguous span" may be at least 8, 10, 12, 15, 18, 20, 25, 35, 40, 50, 70, 100, 250, 500, 1000 or 2000 nucleotides in length, to the extent that a contiguous span of these lengths is consistent with the lengths of the particular Sequence ID. It should be noted that the polynucleotides of the present invention are not limited to having the exact flanking sequences surrounding the polymorphic bases which, are enumerated in the Sequence Listing. Rather, it will be appreciated that the flanking sequences surrounding the biallelic markers and other polymorphisms of the invention, or any of the primers of probes of the invention which, are more distant from the markers, may be lengthened or shortened to any extent compatible with their intended use and the present invention specifically contemplates such sequences. It will be appreciated that the polynucleotides of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 may be of any length compatible with their intended use. Also the flanking regions outside of the .contiguous span need not be homologous to native flanking sequences which actually occur in human subjects. The addition of any nucleotide sequence, which is compatible with the nucleotides intended use is specifically contemplated. The contiguous span may optionally include the biallelic markers of the invention in said sequence. Biallelic markers generally comprise a polymorphism at one single base position. Each biallelic marker therefore corresponds to two forms of a polynucleotide sequence which, when compared with one another, present a nucleotide modification at one position. Usually, the nucleotide modification involves the substitution of one nucleotide for another. Optionally allele I or allele 2 of the biallelic markers disclosed in Table 6b may be specified as being present at the biallelic marker of the invention. The contiguous span may optionally include a nucleotide at a polymorphism position described in Table 6c, including single nucleotide substitutions, deletions as well as multiple nucleotide deletions. The polymorphisms of Table 6c have not been validated as biallelic markers, but are expected to be mostly biallelic and may also be referred to as biallelic markers herein. Optionally, allele I or allele 2 of the polymorphisms of Table 6c may be specified as being present at the polymorphism of the invention. Preferred polynucleotides may consist of, consist essentially of, or comprise a contiguous span of nucleotides of a sequence from SEQ ID Nos. I to 26, 36 to 40 and 54 to 229 as well as sequences which are complementary thereto. The "contiguous span" may be at least 8, 10, 12, 15, 18, 20, 25, 35, W00058510 [htt0:/Mww.getthepatent.comIgagin.dog/SexamsuportFtc/Defa It. d og/O0 585 1 0.cpcfromCache= 1 part=maintoolbar=bottoml Page 94 of 737 WO 00/58510 PCT/IB00/00435 92 70, 80, 100, 250, 500, 1000 or 2000 nucleotides in length, to the extent that a contiguous span of these lengths is consistent with the lengths of the particular Sequence ID.

A preferred probe or primer comprises a nucleic acid comprising a polynucleotide selected from the group of the nucleotide sequences of P to P360 and the complementary sequence thereto, BI to B229, CI to C229, Dl to D360, El to E360.

The invention also relates to polynucleotides that hybridize, under conditions of high or intermediate stringency, to a polynucleotide of any of SEQ ID Nos. I to 26, 36 to 40 and 54 to 229 as well as sequences, which are complementary thereto. Preferably such polynucleotides are at least 20, 25, 35, 40, 50, 70, 80, 100, 250, 500, 1000 or 2000 nucleotides in length, to the extent that a polynucleotide of these lengths is consistent with the lengths of the particular Sequence ID. Preferred polynucleotides comprise a polymorphism of the invention. Optionally either allele I or allele 2 of the polymorphism disclosed in Table 6c may be specified as being present at the polymorphism of the invention. Particularly preferred polynucleotides comprise a biallelic marker of the invention. Optionally either allele 1 or allele 2 of the biallelic markers disclosed in Table 6b may be specified as being present at the bialle;: marker of the invention.

Conditions of high stringency are further described herein.

The primers of the present invention may be designed from the disclosed sequences for any method known in the art. A preferred set of primers is fashioned such that the 3' end of the contiguous span of identity with the sequences of any of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 is present at the 3' end of the primer. Such a configuration allows the 3' end of the primer to hybridize to a selected nucleic acid sequence and dramatically increases the efficiency of the primer for amplification or sequencing reactions. In a preferred set of primers the contiguous span is found in one of the sequences described in Table 6a. Allele specific primers may be designed such that a biallelic marker or other polymorphism of the invention is at the 3' end of the contiguous span and the contiguous span is present at the 3' end of the primer. Such allele specific primers tend to selectively prime an amplification or sequencing reaction so long as they are used with a nucleic acid sample that contains one of the two alleles present at said marker. The 3' end of primer of the invention may be located within or at least 2, 4, 6, 8, 12, 15, 18, 20, 25, 50, 100, 250, 500, or 1000 nucleotides upstream of a biallelic marker of the invention in said sequence or at any other location which is appropriate for their intended use in sequencing, amplification or the location of novel sequences or markers. Primers with their 3' ends located I nucleotide upstream of an biallelic marker of the invention have a special utility as microsequencing assays. Preferred microsequencing primers are described in Table 6d.

The probes of the present invention may be designed from the disclosed sequences for any method known in the art, particularly methods which allow for testing if a particular W0005851 0 [httpJMviwetthepatent.comog i n.d og/Sexa m.sup ortFetchefa ult. doo 005851 0 CC_.'ffOMGache= 1 part=Mantoolbar-bOttOm] Page 95 of 737 WO 00/58510 PCT/IB00/00435 93 sequence or marker disclosed herein is present. A preferred set of probes may be designed for use in the hybridization assays of the invention in any manner known in the art such that they selectively bind to one allele of a biallelic marker or other polymorphism, but not the other under any particular set of assay conditions. Preferred hybridization probes may consists of, consist essentially of, or comprise a contiguous span which ranges in length from 8, 10, 12, 18 or 20 to 25, 35, 40, 50, 60, 70, or 80 nucleotides, or be specified as being 12, 15, 18, 20, 40, or 50 nucleotides in length and including an biallelic marker or other polymorphism of the invention in said sequence. In a preferred embodiment, either of allele 1 or 2 disclosed in Table 6b or 6c may be specified as being present at the biallelic marker site. In another preferred embodiment, said biallelic marker may be within 6, 5, 4, 3, 2, or I nucleotides of the center of the hybridization probe or at the center of said probe.

In one embodiment the invention encompasses isolated, purified, and recombinant polynucleotides comprising, consisting of, or consisting essentially of a contiguous span of 8 to nucleotides of any one of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229 and the complement thereof, wherein said span includes a polymorphism of the invention, a chromosome 13q31q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g3501 7 or g35018 -related biallelic marker in said sequence; optionally, wherein said polymorphism, chromosome 13q31-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker selected from the group consisting of Al to A489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; optionally, wherein said chromosome 13q31-q33related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to Al12, Al 14 to A177, A179 to A197, A199 to A222, A224 to A246, A250, A251, A253, A255, A259, A266, A268 to A232, A328 to 489; optionally, wherein said chromosome 13q3 I-q33-related biallelic marker, region D-related biallelic marker, sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to Al 12, Al 14 to A177, A179 to A197, A199 to A222, A224 to A242 and 361 to 489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; optionally, wherein said chromosome 13q3 -q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of A I to A69, A71 to A74, A76 to A94, A96 to A 106, A108 to A 112, A 114 to A 177, A179 to A197, A199 to A222, A224 to A242, A250 to A251, A259 A269 to A270, A278, A285 to A299, A303 to A307, A330, A334 to A335 and A346 to 357 and and 361 to 489, and W00058510 hqpJtwww.getheatentcomLogin.dog/Sexam.supportiFetchoefault.dogA0005851 0.CPc?fromCache= 1part=maintoolbar=bottoml Page 96 of 737 WO 00/58510 PCT/IB00/00435 94 the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; optionally, wherein said contiguous span is 18 to 35 nucleotides in length and said biallelic marker is within 4 nucleotides of the center of said polynucleotide; optionally, wherein said polynucleotide consists of said contiguous span and said contiguous span is 25 nucleotides in length and said biallelic marker is at the center of said polynucleotide; optionally, wherein the 3' end of said contiguous span is present at the 3' end of said polynucleotide; and optionally, wherein the 3' end of said contiguous span is located at the 3' end of said polynucleotide and said biallelic marker is present at the 3' end of said polynucleotide. In a preferred embodiment, said probes comprise, consists of, or consists essentially of a sequence selected from the following sequences: PI to P360 and the complementary sequences thereto.

In another embodiment the invention encompasses isolated, purified and recombinant polynucleotides comprising, consisting of, or consisting essentially of a contiguous span of 8 to nucleotides of any one of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229, or the complement thereof, wherein the 3' end of said contiguous span is located at the 3' end of said polynucleotide, and wherein the 3' end of said polynucleotide is located within 20 nucleotides upstream of a polymorphism of the invention, chromosome 13q3 l-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker in said sequence; optionally, wherein said chromosome 13q3 l-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of Al to A489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; optionally, wherein said a chromosome 13q3 1-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to A 112, Al 14 to A177, A179 to A197, A199 to A222, A224 to A246, A250, A251, A253, A255, A259, A266, A268 to A232, A328 to A360, and and 361 to 489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; optionally, wherein said chromosome 13q3 l-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to Al 12, Al 14 to A177, A179 to A197, A199 to A222, A224 to A242 and 361 to 489; optionally, wherein said chromosome 13q3 1-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of optionally, wherein said chromosome 13q31 -q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic W00058510 [http:/ww.getlhete t ofo he=1art=maintoobarbotom1 Page 97 of 737 WO 00/58510 PCT/IB00/00435 marker is selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to Al 12, Al 14 to A177, A179 to A197, A199 to A222, A224 to A242, A250 to A251, A259, A269 to A270, A278, A285 to A299, A303 to A307, A330, A334 to A335, A346 to 357 and 361 to 489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; optionally, wherein the 3' end of said polynucleotide is located 1 nucleotide upstream of said chromosome 13q31-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker; and optionally, wherein said polynucleotide comprises, consists of, or consists essentially of a sequence selected from the following sequences: DI to D360 and El to E360.

In a further embodiment, the invention encompasses isolated, purified, or recombinant polynucleotides comprising, consisting of, or consisting essentially of a sequence selected from the following sequences: BI to B229 and Cl to C229.

In an additional embodiment, the invention encompasses polynucleotides for use in hybridization assays, sequencing assays, and enzyme-based mismatch detection assays for determining the identity of the nucleotide at a chromosome 13q31-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker in any of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or the complement thereof, as well as polynucleotides for use in amplifying segments of nucleotides comprising a polymophism of the invention, a chromosome 13q3 l-q33-related biallelic marker, region Drelated biallelic marker, or sbgl-, g34665-, sbg2-, g3501 7 or g35018 -related biallelic marker in any of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229 or the complement thereof; optionally, wherein said chromosome 13q31-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of Al to A489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; optionally, wherein said chromosome 13q31-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting ofAl to A69, A71 to A74, A76 to A94, A96 to A106, A108 to A 12, Al14 to A177, Al79 to A197, A199 to A222, A224 to A246, A250, A251, A253, A255, A259, A266, A268 to A232, A328 to A360 and 361 to 489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; optionally, wherein chromosome 13q3 -q33-related biallelic marker, region Drelated biallelic marker, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A 08 to Al 12, Al 14 to A177, A179 to A197, A199 to A222, A224 to A242, A250 to A251, A259, A269 to A270, A278, A285 to A299, A303 to A307, A330, A334 to A335 and A346 to 357 and W00058510 [httpJtwww.gettheatent.comLgin.dog/Sexam.suprtFetch/Defauit.d O l o1 Page 8 737 WO 00/58510 PCT/IB00/00435 96 361 to 489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith; and optionally, wherein chromosome 13q3 I-q33-related biallelic marker, region D-related biallelic marker, or sbgl-, g34 6 65-, sbg2-, g35017- or g35018 -related biallelic marker is selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A08 to All112, Al114 to A177, A179 to A197, A199 to A222, A224 to A242 and 361 to 489, and the complements thereof, or optionally the biallelic markers in linkage disequilibrium therewith.

These arrays may generally be produced using mechanical synthesis methods or light directed synthesis methods, which incorporate a combination of photolithographic methods and solid phase oligonucleotide synthesis (Fodor et al., Science, 251:767-777, 1991). The immobilization of arrays of oligonucleotides on solid supports has been rendered possible by the development of a technology generally identified as "Very Large Scale Immobilized Polymer Synthesis" (VLSIPSTM) in which, typically, probes are immobilized in a high density array on a solid surface of a chip. Examples of VLSIPS T M technologies are provided in US Patents 5,143,854 and 5,412,087 and in PCT Publications WO 90/15070, WO 92/10092 and WO 95/11995, which describe methods for forming oligonucleotide arrays through techniques such as light-directed synthesis technique. In designing strategies aimed at providing arrays of nucleotides immobilized on solid supports, further presentation strategies were developed to order and display the oligonucleotide arrays on the chips in an attempt to maximize hybridization patterns and sequence information. Examples of such presentation strategies are disclosed in PCT Publications WO 94/12305, WO 94/11530, WO 97/29212 and WO 97/31256.

Oligonucleotide arrays may comprise at least one of the sequences selected from the group consisting of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229; and the sequences complementary thereto or a fragment thereof of at least 8, 10, 12, 15, 18, 20, 25, 35, 40, 50, 80, 100, 250, 500, 1000 or 2000 consecutive nucleotides, to the extent that fragments of these lengths is consistent with the lengths of the particular Sequence ID, for determining whether a sample contains one or more alleles of the biallelic markers of the present invention..

Oligonucleotide arrays may also comprise at least one of the sequences selected from the group consisting of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229; and the sequences complementary thereto or a fragment thereof of at least 8, 10, 12, 15, 18, 20, 25, 35, 40, 50, 70, 80, 100, 250, 500, 1000 or 2000 consecutive nucleotides, to the extent that fragments of these lengths is consistent with the lengths of the particular Sequence ID, for amplifying one or more alleles of the biallelic markers of Table 6b or polymorphisms of Table 6c. In other embodiments, arrays may also comprise at least one of the sequences selected from the group consisting of SEQ ID Nos. I to 26, 36 to 40 and 54 to 229; and the sequences complementary thereto or a fragment W0005851 0 ttthatent.comfl .do l ae=1art=maintoolbarbotom Page 99 of 737 WO 00/58510 PCT/IB00/00435 97 thereof of at least 8, 10, 12, 15, 18, 20, 25, 35, 40, 50, 70, 80, 100, 250, 500, 1000 or 2000 consecutive nucleotides, to the extent that fragments of these lengths is consistent with the lengths of the particular Sequence ID, for conducting microsequencing analyses to determine whether a sample contains one or more alleles of the biallelic markers of the invention. In still further embodiments, the oligonucleotide array may comprise at least one of the sequences selecting from the group consisting of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229; and the sequences complementary thereto or a fragment thereof of at least 8, 10, 12, 15, 18, 20, 25, 50, 70, 80, 100, 250, 500 1000 or 2000 nucleotides in length, to the extent that fragments of these lengths is consistent with the lengths of the particular Sequence ID, for determining whether a sample contains one or more alleles of the polymorphisms and biallelic markers of the present invention.

A further object of the invention relates to an array of nucleic acid sequences comprising either at least one of the sequences selected from the group consisting of PI to P360, BI to B229, Cl to C229, DI to D360 El to E360 or the sequences complementary thereto or a fragment thereof of at least 8, 10, 12, 15, 18, 20, 25, 30, or 40 consecutive nucleotides thereof, or at least one sequence comprising at least 1, 2, 3, 4, 5, 10, 20 biallelic markers selected from the group consisting of Al to A489 or the complements thereof. The invention also pertains to an array of nucleic acid sequences comprising either at least 1, 2, 3, 4, 5, 10, of the sequences selected from the group consisting of P1 to P360, BI to B229, Cl to C229, Dl to D360, El to E360 or the sequences complementary thereto or a fragment thereof of at least 8 consecutive nucleotides thereof, or at least two sequences comprising a biallelic marker selected from the group consisting of Al to A360 or the complements thereto.

The present invention also encompasses diagnostic kits comprising one or more polynucleotides of the invention, optionally with a portion or all of the necessary reagents and instructions for genotyping a test subject by determining the identity of a nucleotide at an biallelic marker of the invention. The polynucleotides of a kit may optionally be attached to a solid support, or be part of an array or addressable array of polynucleotides. The kit may provide for the determination of the identity of the nucleotide at a marker position by any method known in the art including, but not limited to, a sequencing assay method, a microsequencing assay method, a hybridization assay method, or enzyme-based mismatch detection assay. Optionally such a kit may include instructions for scoring the results of the determination with respect to the test subjects' predisposition to schizophrenia, or likely response to an agent acting on schizophrenia, or chances of suffering from side effects to an agent acting on schizophrenia.

Finally, in any embodiments of the present invention, a biallelic marker may may W0005851 0 [http:/twww.getthepatent.comfLogin.doq/$exam.supportFetrhDefaut.dog/WOO05851 0cpc?fromCar-he1p~Jart=maintoolbar--botom]_Pagqe 100 of 737 WO 00/58510 PCTIIBOO/00435 98 optionally comprise: a biallelic marker selected from the group consisting of sbg I -related markers A85 to A219, or more preferably a biallelic marker selected from the group consisting of sbgl -related markers A85 to A94, A96 to A106, A108 to Al 12, Al 114 to A177, A 179 to A197 and A199 to A219; a biallelic marker selected from the group consisting of g34665-related markers A230 to A236; a biallelic marker selected from the group consisting of sbg2-related markers A79 to A99; the g35017-related marker A41; a biallelic marker selected from the group consisting of g3 501 8-related markers Al to A39; a biallelic marker selected from the group consisting of A239, A227, A198, A228, A223, A 107, A218, A270, A75, A62, A65 and a biallelic marker selected from the group consisting of A48, A60, A61, A62, A75, A76, ASO, A07, A108, A198, A218, A221, A223, A227, A228, A239, A285, A286, A287, A288, A290, A292, A293, A295,A299 and A304; a biallelic marker selected from the group consisting of A304, A307, A305, A298, A292, A293, A29 1, A287, A286, A288, A289, A290, 99- A295 A299. A24 1, A239, A228, A227, A223, A22 1, A218, A 198, A 178, 99-24649/186 A 108, A 107, A80, A75, A70, A65, and A62; and/or a biallelic marker selected from the group consisting of A304, A307, A305, A298, A292, A293, A291, A287, A286, A288, A289, A290, A295 A299, A241, A239, A228, A227, A223, A221, A2l8, A198, A178, A108, A107, A80, A76, A75, A70, A65, A62, A61, A48.

Optionally, in any of the embodiments described herein, a Region D- or chromosome 13q3 l-q33-related biallelic marker may be selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A 106, A 108 to Al 12, Al 14 to A177, Al 79 to A197, A199 to A222, A224 to A242, A250 to A25 1, A259, A269 to A270, A278, A285 to A299, A303 to A307, A330, A334 to A335, A346 to 357 and 361 to 489. Optionally, in any of the embodiments described herein, a chromosome 1 3q31I -q33-related biallelic marker may be selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to Al 12, Al 14 to A177, Al 79 to A197, A199 to A222, A224 to A246, A250, A25 1, A253, A255, A259, A266, A268 to A232 and A328 to A489. A set of said Region D-related biallelic markers or chromosome 13q31I-q33-related biallelic markers may comprise at least 1, 2, 3, 4, W00058510 rhttjltwww.aettheoatent.COMLoqin.doq/Sexam.SUooort/Fetch/Default.doa/OO0585lO.rpc?fromCacle=1par tt Pace 101 of 737 WO 00/58510 PCT/IB00/00435 99 20, 40, 50, 100 or 200 of said biallelic markers, respectively.

Optionally, any of the compositions of methods described herein may specifically exclude at least 1, 2, 3, 4, 5, 10, 20 biallelic markers, or all of the biallelic markers selected from the group consisting of: A70, A75, A95, A107, Al 13, A178, A198, A223, A247 to A249, A252, A254, A256 to A258, A260 to A265, A267, A324 to A328.

Furthermore, in any of the embodiments of the present invention, a set of chromosome 13q31-q33-related biallelic markers, Region D-related biallelic markers, or sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic markers may comprise at least 1, 2, 3, 4, 5, 10, 50, 100 or 200 of said biallelic markers.

Methods For De Novo Identification Of Biallelic Markers Any of a variety of methods can be used to screen a genomic fragment for single nucleotide polymorphisms such as differential hybridization with oligonucleotide probes, detection of changes in the mobility measured by gel electrophoresis or direct sequencing of the amplified nucleic acid. A preferred method for identifying biallelic markers involves comparative sequencing of genomic DNA fragments from an appropriate number of unrelated individuals.

In a first embodiment, DNA samples from unrelated individuals are pooled together, following which the genomic DNA of interest is amplified and sequenced. The nucleotide sequences thus obtained are then analyzed to identify significant polymorphisms. One of the major advantages of this method resides in the fact that the pooling of the DNA samples substantially reduces the number of DNA amplification reactions and sequencing reactions, which must be carried out. Moreover, this method is sufficiently sensitive so that a biallelic marker obtained thereby usually demonstrates a sufficient frequency of its less common allele to be useful in conducting association studies. Usually, the frequency of the least common allele of a biallelic marker identified by this method is at least In a second embodiment, the DNA samples are not pooled and are therefore amplified and sequenced individually. This method is usually preferred when biallelic markers need to be identified in order to perform association studies within candidate genes. Preferably, highly relevant gene regions such as promoter regions or exon regions may be screened for biallelic markers. A biallelic marker obtained using this method may show a lower degree of informativeness for conducting association studies, e.g. if the frequency of its less frequent allele may be less than about 10%. Such a biallelic marker will however be sufficiently informative to conduct association studies and it will further be appreciated that including less informative biallelic markers in the genetic analysis studies of the present invention, may allow WOUObtbSb1 nu [nt:llwvww.getthepatentcomlogin.dogSexam.suorJetcDetault.osgvuuu~es1 .cpcrromacne= 1 pan=mantoolar= ootom Page 1ot 3 WO 00/58510 PCT/IB00/00435 100 in some cases the direct identification of causal mutations, which may, depending on their penetrance, be rare mutations.

The following is a description of the various parameters of a preferred method used by the inventors for the identification of the biallelic markers of the present invention.

Genomic DNA samples The genomic DNA samples from which the biallelic markers of the present invention are generated are preferably obtained from unrelated individuals corresponding to a heterogeneous population of known ethnic background. The number of individuals from whom DNA samples are obtained can vary substantially, preferably from about 10 to about 1000, more preferably from about 50 to about 200 individuals. Usually, DNA samples are collected from at least about 100 individuals in order to have sufficient polymorphic diversity in a given population to identify as many markers as possible and to generate statistically significant results.

As for the source of the genomic DNA to be subjected to analysis, any test sample can be foreseen without any particular limitation. These test samples include biological samples, which can be tested by the methods of the present invention described herein, and include human and animal body fluids such as whole blood, serum, plasma, cerebrospinal fluid, urine, lymph fluids, and various external secretions of the respiratory, intestinal and genitourinary tracts, tears, saliva, milk, white blood cells, myelomas and the like; biological fluids such as cell culture supernatants; fixed tissue specimens including tumor and non-tumor tissue and lymph node tissues; bone marrow aspirates and fixed cell specimens. The preferred source ofgenomic DNA used in the present invention is from peripheral venous blood of each donor. Techniques to prepare genomic DNA from biological samples are well known to the skilled technician.

Details of a preferred embodiment are provided in Example I. The person skilled in the art can choose to amplify pooled or unpooled DNA samples.

DNA Amplification The identification of biallelic markers in a sample of genomic DNA may be facilitated through the use of DNA amplification methods. DNA samples can be pooled or unpooled for the amplification step. DNA amplification techniques are well known to those skilled in the art.

Various methods to amplify DNA fragments carrying biallelic markers are further described hereinafter herein. The PCR technology is the preferred amplification technique used to identify new biallelic markers.

In a first embodiment, biallelic markers are identified using genomic sequence information generated by the inventors. Genomic DNA fragments, such as the inserts of the BAC clones described above, are sequenced and used to design primers for the amplification of W00058510 [http: www.getihepatent. com/Login .dog/Sexam.suP ort/Fetch/Default.dogN000O 58 5 1 0cpcfromCache= 1 part=maintoolba r=bottom]age 103 of 737 WO 00/58510 PCT/IB00/00435 101 500 bp fragments. These 500 bp fragments are amplified from genomic DNA and are scanned for biallelic markers. Primers may be designed using the OSP software (Hillier L. and Green 1991). All primers may contain, upstream of the specific target bases, a common oligonucleotide tail that serves as a sequencing primer. Those skilled in the art are familiar with primer extensions, which can be used for these purposes.

In another embodiment of the invention, genomic sequences of candidate genes are available in public databases allowing direct screening for biallelic markers. Preferred primers, useful for the amplification of genomic sequences encoding the candidate genes, focus on promoters, exons and splice sites of the genes. A biallelic marker present in these functional regions of the gene have a higher probability to be a causal mutation.

Sequencing Of Amplified Genomic DNA And Identification Of Single Nucleotide Polymorphisms The amplification products generated as described above, are then sequenced using any method known and-available to the skilled technician. Methods for sequencing DNA using either the dideoxy-mediated method (Sanger method) or the Maxam-Gilbert method are widely known to those of ordinary skill in the art. Such methods are for example disclosed in Maniatis et al. (Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Second Edition, 1989). Alternative approaches include hybridization to high-density DNA probe arrays as described in Chee et al. (Science 274, 610, 1996).

Preferably, the amplified DNA is subjected to automated dideoxy terminator sequencing reactions using a dye-primer cycle sequencing protocol. The products of the sequencing reactions are run on sequencing gels and the sequences are determined using gel image analysis. The polymorphism search is based on the presence of superimposed peaks in the electrophoresis pattern resulting from different bases occurring at the same position.

Because each dideoxy terminator is labeled with a different fluorescent molecule, the two peaks corresponding to a biallelic site present distinct colors corresponding to two different nucleotides at the same position on the sequence. However, the presence of two peaks can be an artifact due to background noise. To exclude such an artifact, the two DNA strands are sequenced and a comparison between the peaks is carried out. In order to be registered as a polymorphic sequence, the polymorphism has to be detected on both strands.

The above procedure permits those amplification products, which contain biallelic markers to be identified. The detection limit for the frequency of biallelic polymorphisms detected by sequencing pools of 100 individuals is approximately 0.1 for the minor allele, as verified by sequencing pools of known allelic frequencies. However, more than 90% of the biallelic polymorphisms detected by the pooling method have a frequency for the minor allele W0005851 0 (http:/twww.getthe atent.comlLog in.dogSexam.supportIFetchDefauIt.dogiW0058 5 1 .cpc?fromCahe= 1 part=maintoolbarsbottoml Page 104 of 737 WO 00/58510 PCT/IB00/00435 102 higher than 0.25. Therefore, the biallelic markers selected by this method have a frequency of at least 0.1 for the minor allele and less than 0.9 for the major allele. Preferably at least 0.2 for the minor allele and less than 0.8 for the major allele, more preferably at least 0.3 for the minor allele and less than 0.7 for the major allele, thus a heterozygosity rate higher than 0.18, preferably higher than 0.32, more preferably higher than 0.42.

In another embodiment, biallelic markers are detected by sequencing individual DNA samples, the frequency of the minor allele of such a biallelic marker may be less than 0.1.

Validation of the biallelic markers of the present invention The polymorphisms are evaluated for their usefulness as genetic markers by validating that both alleles are present in a population. Validation of the biallelic markers is accomplished by genotyping a group of individuals by a method of the invention and demonstrating that both alleles are present. Microsequencing is a preferred method of genotyping alleles. The validation by genotyping step may be performed on individual samples derived from each individual in the group or by genotyping a pooled sample derived from more than one individual. The group can be as small as one individual if that individual is heterozygous for the allele in question. Preferably the group contains at least three individuals, more preferably the group contains five or six individuals, so that a single validation test will be more likely to result in the validation of more of the biallelic markers that are being tested. It should be noted, however, that when the validation test is performed on a small group it may result in a false negative result if as a result of sampling error none of the individuals tested carries one of the two alleles. Thus, the validation process is less useful in demonstrating that a particular initial result is an artifact, than it is at demonstrating that there is a bonafide biallelic marker at a particular position in a sequence. All of the genotyping, haplotyping, association, and interaction study methods of the invention may optionally be performed solely with validated biallelic markers.

Evaluation of the frequency of the biallelic markers of the present invention The validated biallelic markers are further evaluated for their usefulness as genetic markers by determining the frequency of the least common allele at the biallelic marker site.

The determination of the least common allele is accomplished by genotyping a group of individuals by a method of the invention and demonstrating that both alleles are present. This determination of frequency by genotyping step may be performed on individual samples derived from each individual in the group or by genotyping a pooled sample derived from more than one individual. The group must be large enough to be representative of the population as a W0005851 0 fhttpitwww.getthepatent.com/Login.dog/Sexam.support/Fetch/DefaultfdoqNV000585 1 .cpcfromiCacie 1 partmaintooIbar-boftom Page 105 of 737 WO 00/58510 PCT/IB00/00435 103 whole. Preferably the group contains at least 20 individuals, more preferably the group contains at least 50 individuals, most preferably the group contains at least 100 individuals. Of course the larger the group the greater the accuracy of the frequency determination because of reduced sampling error. A biallelic marker wherein the frequency of the less common allele is 30% or more is termed a "high quality biallelic marker." All of the genotyping, haplotyping, association, and interaction study methods of the invention may optionally be performed solely with high quality biallelic markers.

Another embodiment of the invention comprises methods of estimating the frequency of an allele in a population comprising genotyping individuals from said population for a 13q31-q33-related biallelic marker and determining the proportional representation of said biallelic marker in said population. In addition, the methods of estimating the frequency of an allele in a population encompass methods with any further limitation described in this disclosure, or those following, specified alone or in any combination: Optionally, said 13q31q33-related biallelic marker may be in a sequence selected individually or in any combination from the group consisting of SEQ Nos 1 to 26, 36 to 40 and 54 to 229; and the complements thereof; optionally, said 13q31-q33-related biallelic marker may be selected from the biallelic markers described in Table 6b or 6c; optionally, determining the frequency of a biallelic marker allele in a population may be accomplished by determining the identity of the nucleotides for both copies of said biallelic marker present in the genome of each individual in said population and calculating the proportional representation of said nucleotide at said 13q31-q33-related biallelic marker for the population; optionally, determining the frequency of a biallelic marker allele in a population may be accomplished by performing a genotyping method on a pooled biological sample derived from a representative number of individuals, or each individual, in said population, and calculating the proportional amount of said nucleotide compared with the total.

Methods Of Genotyping An Individual For Biallelic Markers Methods are provided to genotype a biological sample for one or more biallelic markers of the present invention, all of which may be performed in vitro. Such methods of genotyping comprise determining the identity of a nucleotide at an biallelic marker of the invention by any method known in the art. These methods find use in genotyping case-control populations in association studies as well as individuals in the context of detection of alleles of biallelic markers which, are known to be associated with a given trait, in which case both copies of the biallelic marker present in individual's genome are determined so that an individual may be classified as homozygous or heterozygous for a particular allele.

These genotyping methods can be performed nucleic acid samples derived from a single W00058510 [http:/twww.etthepatent.comlLog i n.d og/$exam.SUport/Fetchefa ut.d oqO05851 0.cpc?fromCache=1 part=maintoolbar-bottom] Page 106 of 737 WO 00/58510 PCT/IB00/00435 104 individual or pooled DNA samples.

Genotyping can be performed using similar methods as those described above for the identification of the biallelic markers, or using other genotyping methods such as those further described below. In preferred embodiments, the comparison of sequences of amplified genomic fragments from different individuals is used to identify new biallelic markers whereas microsequencing is used for genotyping known biallelic markers in diagnostic and association study applications.

Another embodiment of the invention encompasses methods of genotyping a biological sample comprising determining the identity of a nucleotide at a 13q3 1-q33-related biallelic marker. In addition, the genotyping methods of the invention encompass methods with any further limitation described in this disclosure, or those following, specified alone or in any combination: Optionally, said 13q3 -q33-related biallelic marker may be in a sequence selected individually or in any combination from the group consisting of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229, and the complements thereof; optionally, said 13q31-q33-related biallelic marker may be selected individually or in any combination from the biallelic markers described in Table 6b and 6c; optionally, said method further comprises determining the identity of a second nucleotide at said biallelic marker, wherein said first nucleotide and second nucleotide are not base paired (by Watson Crick base pairing) to one another, optionally, said biological sample is derived from a single individual or subject; optionally, said method is performed in vitro; optionally, said biallelic marker is determined for both copies of said biallelic marker present in said individual's genome; optionally, said biological sample is derived from multiple subjects or individuals; optionally, said method further comprises amplifying a portion of said sequence comprising the biallelic marker prior to said determining step; optionally, wherein said amplifying is performed by PCR, LCR, or replication of a recombinant vector comprising an origin of replication and said portion in a host cell; optionally, wherein said determining is performed by a hybridization assay, sequencing assay, microsequencing assay, or an enzyme-based mismatch detection assay.

Source of DNA for genotvDing Any source of nucleic acids, in purified or non-purified form, can be utilized as the starting nucleic acid, provided it contains or is suspected of containing the specific nucleic acid sequence desired. DNA or RNA may be extracted from cells, tissues, body fluids and the like as described herein. While nucleic acids for use in the genotyping methods of the invention can be derived from any mammalian source, the test subjects and individuals from which nucleic acid samples are taken are generally understood to be human.

Amplification Of DNA Fragments Comprising Biallelic Markers W0005851 0 [http:twww g etthepa tent.comfLogin.dog/Sexa nsuporYtFetch/Default.d oqNO005 8 51 .cpcfromCache= 1 part=maintoolbar-bottom] Pae 107 of 737 WO 00/58510 PCT/IB00/00435 105 Methods and polynucleotides are provided to amplify a segment of nucleotides comprising one or more biallelic marker of the present invention. It will be appreciated that amplification of DNA fragments comprising biallelic markers may be used in various methods and for various purposes and is not restricted to genotyping. Nevertheless, many genotyping methods, although not all, require the previous amplification of the DNA region carrying the biallelic marker of interest. Such methods specifically increase the concentration or total number of sequences that span the biallelic marker or include that site and sequences located either distal or proximal to it. Diagnostic assays may also rely on amplification of DNA segments carrying a biallelic marker of the present invention.

Amplification of DNA may be achieved by any method known in the art. The established PCR (polymerase chain reaction) method or by developments thereof or alternatives. Amplification methods which can be utilized herein include but are not limited to Ligase Chain Reaction (LCR) as described in EP A 320 308 and EP A 439 182, Gap LCR (Wolcott, the so-called "NASBA" or "3SR" technique described in Guatelli J.C. et al.

(1990) and in Compton J. (1991), Q-beta amplification as described in EP A 4544 610, strand displacement amplification as described in Walker et al. (1996) and EP A 684 315 and, target mediated amplification as described in PCT Publication WO 9322461.

LCR and Gap LCR are exponential amplificatibn techniques, both depend on DNA ligase to join adjacent primers annealed to a DNA molecule. In Ligase Chain Reaction (LCR), probe pairs are used which include two primary (first and second) and two secondary (third and fourth) probes, all of which are employed in molar excess to target. The first probe hybridizes to a first segment of the target strand and the second probe hybridizes to a second segment of the target strand, the first and second segments being contiguous so that the primary probes abut one another in 5' phosphate-3'hydroxyl relationship, and so that a ligase can covalently fuse or ligate the two probes into a fused product. In addition, a third (secondary) probe can hybridize to a portion of the first probe and a fourth (secondary) probe can hybridize to a portion of the second probe in a similar abutting fashion. Of course, if the target is initially double stranded, the secondary probes also will hybridize to the target complement in the first instance. Once the ligated strand of primary probes is separated from the target strand, it will hybridize with the third and fourth probes which can be ligated to form a complementary, secondary ligated product. It is important to realize that the ligated products are functionally equivalent to either the target or its complement. By repeated cycles of hybridization and ligation, amplification of the target sequence is achieved. A method for multiplex LCR has also been described (WO 9320227). Gap LCR (GLCR) is a version of LCR where the probes are not adjacent but are separated by 2 to 3 bases.

W00058510 [http:llwww. etthepatent.com/Login-dog/Sexam.supprtJFetch/Defaut.dogAN0005851o.gpc?tromCacle=lpart=maintoolbarbottom] Page 108 of737 WO 00/58510 PCTIIB00/00435 106 For amplification of mRNAs, it is within the scope of the present invention to reverse transcribe mRNA into cDNA followed by polymerase chain reaction (RT-PCR); or, to use a single enzyme for both steps as described in U.S. Patent No. 5,322,770 or, to use Asymmetric Gap LCR (RT-AGLCR) as described by Marshall R.L. et al. (1994). AGLCR is a modification of GLCR that allows the amplification of RNA.

Some of these amplification methods are particularly suited for the detection of single nucleotide polymorphisms and allow the simultaneous amplification of a target sequence and the identification of the polymorphic nucleotide as it is further described herein.

The PCR technology is the preferred amplification technique used in the present invention. A variety of PCR techniques are familiar to those skilled in the art. For a review of PCR technology, see Molecular Cloning to Genetic Engineering White, B.A. Ed. (1997) and the publication entitled "PCR Methods and Applications" (1991, Cold Spring Harbor Laboratory Press). In each of these PCR procedures, PCR primers on either side of the nucleic acid sequences to be amplified are added to a suitably prepared nucleic acid sample along with dNTPs and a thermostable polymerase such as Taq polymerase, Pfu polymerase, or Vent polymerase. The nucleic acid in the sample is denatured and the PCR primers are specifically hybridized to complementary nucleic acid sequences in the sample. The hybridized primers are extended. Thereafter, another cycle ofdenaturation, hybridization, and extension is initiated.

The cycles are repeated multiple times to produce an amplified fragment containing the nucleic acid sequence between the primer sites. PCR has further been described in several patents including US Patents 4,683,195, 4,683,202 and 4,965,188.

Primers can be prepared by any suitable method. As for example, direct chemical synthesis by a method such as the phosphodiester method ofNarang S.A. et al. (1979), the phosphodiester method of Brown E.L. et al. (1979), the diethylphosphoramidite method of Beaucage et al. (1981) and the solid support method described in EP 0 707 592.

In some embodiments the present invention provides primers for amplifying a DNA fragment containing one or more biallelic markers of the present invention. It will be appreciated that the primers listed are merely exemplary and that any other set of primers which produce amplification products containing one or more biallelic markers of the present invention.

The spacing of the primers determines the length of the segment to be amplified. In the context of the present invention amplified segments carrying biallelic markers can range in size from at least about 25 bp to 35 kbp. Amplification fragments from 25-3000 bp are typical, fragments from 50-1000 bp are preferred and fragments from 100-600 bp are highly preferred.

It will be appreciated that amplification primers for the biallelic markers may be any sequence W00058510 [http:/twww. etthepatent.com/Logn.dog/Sexam.supporVFetch/DefauItdoqtWO005851 0.cpc?romCache 1part=malntoolbar=bottomPage 109 Of 737 WO 00/58510 PCT/IB00/00435 107 which allow the specific amplification of any DNA fragment carrying the markers.

Amplification primers may be labeled or immobilized on a solid support as described in the section titled "Oligonucleotide Probes and Primers".

Methods of Genotyping DNA samples for Biallelic Markers Any method known in the art can be used to identify the nucleotide present at a biallelic marker site. Since the biallelic marker allele to be detected has been identified and specified in the present invention, detection will prove simple for one of ordinary skill in the art by employing any of a number of techniques. Many genotyping methods require the previous amplification of the DNA region carrying the biallelic marker of interest. While the amplification of target or signal is often preferred at present, ultrasensitive detection methods which do not require amplification are also encompassed by the present genotyping methods.

Methods well-known to those skilled in the art that can be used to detect biallelic polymorphisms include methods such as, conventional dot blot analyzes, single strand conformational polymorphism analysis (SSCP) described by Orita et al. (1989), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis, mismatch cleavage detection, and other conventional techniques as described in Sheffield, V.C. et al. (1991), White et al. (1992), Grompe, M. et al. (1989) and Grompe, M. (1993). Another method for determining the identity of the nucleotide present at a particular polymorphic site employs a specialized exonuclease-resistant nucleotide derivative as described in US patent 4,656,127.

Preferred methods involve directly determining the identity of the nucleotide present at a biallelic marker site by sequencing assay, enzyme-based mismatch detection assay, or hybridization assay. The following is a description of some preferred methods. A highly preferred method is the microsequencing technique. The term "sequencing assay" is used herein to refer to polymerase extension of duplex primer/template complexes and includes both traditional sequencing and microsequencing.

1) Sequencing assays The nucleotide present at a polymorphic site can be determined by sequencing methods.

In a preferred embodiment, DNA samples are subjected to PCR amplification before sequencing as described above. DNA sequencing methods are described in herein. Preferably, the amplified DNA is subjected to automated dideoxy terminator sequencing reactions using a dye-primer cycle sequencing protocol. Sequence analysis allows the identification of the base present at the biallelic marker site.

2) Microsequencing assays In microsequencing methods, a nucleotide at the polymorphic site that is unique to one of the alleles in a target DNA is detected by a single nucleotide primer extension reaction. This W00058510 [httpJfwww. etthepatent com/Login.dog/Sexam support/Fetc/Defaut.dogAN0005851 0.cpc?romCahe=1 part=maintoolbar--bottom] Page 110 of 737 WO 00/58510 PCT/IB00/00435 108 method involves appropriate microsequencing primers which, hybridize just upstream of a polymorphic base of interest in the target nucleic acid. A polymerase is used to specifically extend the 3' end of the primer with one single ddNTP (chain terminator) complementary to the selected nucleotide at the polymorphic site. Next the identity of the incorporated nucleotide is determined in any suitable way.

Typically, microsequencing reactions are carried out using fluorescent ddNTPs and the extended microsequencing primers are analyzed by electrophoresis on ABI 377 sequencing machines to determine the identity of the incorporated nucleotide as described in EP 412 883.

Alternatively capillary electrophoresis can be used in order to process a higher number of assays simultaneously. An example of a typical microsequencing procedure that can be used in the context of the present invention is provided in example 4.

Different approaches can be used to detect the nucleotide added to the microsequencing primer. A homogeneous phase detection method based on fluorescence resonance energy transfer has been described by Chen and Kwok (1997) and Chen et al. (1997). In this method amplified genomic DNA fragments containing polymorphic sites are incubated with a fluorescein-labeled primer in the presence of allelic dye-labeled dideoxyribonucleoside triphosphates and a modified Taq polymerase. The dye-labeled primer is extended one base by the dye-terminator specific for the allele present on the template. At the end of the genotyping reaction, the fluorescence intensities of the two dyes in the reaction mixture are analyzed directly without separation or purification. All these steps can be performed in the same tube and the fluorescence changes can be monitored in real time. Alternatively, the extended primer may be analyzed by MALDI-TOF Mass Spectrometry. The base at the polymorphic site is identified by the mass added onto the microsequencing primer (see Haff L.A. and Smirnov I.P., 1997).

Microsequencing may be achieved by the established microsequencing method or by developments or derivatives thereof. Alternative methods include several solid-phase microsequencing techniques. The basic microsequencing protocol is the same as described previously, except that the method is conducted as a heterogenous phase assay, in which the primer or the target molecule is immobilized or captured onto a solid support. To simplify the primer separation and the terminal nucleotide addition analysis, oligonucleotides are attached to solid supports or are modified in such ways that permit affinity separation as well as polymerase extension. The 5' ends and internal nucleotides of synthetic oligonucleotides can be modified in a number of different ways to permit different affinity separation approaches, biotinylation.

If a single affinity group is used on the oligonucleotides, the oligonucleotides can be separated from the incorporated terminator regent. This eliminates the need of physical or size separation.

W00058510 rhttpJIww.gehepatent.comLogLndog/Sexam.suportiFetch/oefault.dogiO005851 0.cpc?fromCache=l 1art~maintoolbar-bottom Page 111 of 737 WO 00/58510 PCT/IB00/00435 109 More than one oligonucleotide can be separated from the terminator reagent and analyzed simultaneously if more than one affinity group is used. This permits the analysis of several nucleic acid species or more nucleic acid sequence information per extension reaction. The affinity group need not be on the priming oligonucleotide but could alternatively be present on the template. For example, immobilization can be carried out via an interaction between biotinylated DNA and streptavidin-coated microtitration wells or avidin-coated polystyrene particles. In the same manner oligonucleotides or templates may be attached to a solid support in a high-density format. In such solid phase microsequencing reactions, incorporated ddNTPs can be radiolabeled (Syvlnen, 1994) or linked to fluorescein (Livak and Hainer, 1994). The detection of radiolabeled ddNTPs can be achieved through scintillation-based techniques. The detection of fluorescein-linked ddNTPs can be based on the binding of antifluorescein antibody conjugated with alkaline phosphatase, followed by incubation with a chromogenic substrate (such asp-nitrophenyl phosphate). Other possible reporter-detection pairs include: ddNTP linked to dinitrophenyl (DNP) and anti-DNP alkaline phosphatase conjugate (Harju et al., 1993) or biotinylated ddNTP and horseradish peroxidase-conjugated streptavidin with ophenylenediamine as a substrate (WO 92/15712). As yet another alternative solid-phase microsequencing procedure, Nyren et al. (1993) described a method relying on the detection of DNA polymerase activity by an enzymatic luminometric inorganic pyrophosphate detection assay (ELIDA).

Pastinen et al. (1997), describe a method for multiplex detection of single nucleotide polymorphism in which the solid phase minisequencing principle is applied to an oligonucleotide array format. High-density arrays of DNA probes attached to a solid support (DNA chips) are further described in herein.

In one aspect the present invention provides polynucleotides and methods to genotype one or more biallelic markers of the present invention by performing a microsequencing assay.

Preferred microsequencing primers include those being featured Table 6d. It will be appreciated that the microsequencing primers listed in Table 6d are merely exemplary and that, any primer having a 3' end immediately adjacent to a polymorphic nucleotide may be used.

Similarly, it will be appreciated that microsequencing analysis may be performed for any biallelic marker or any combination of biallelic markers of the present invention. One aspect of the present invention is a solid support which includes one or more microsequencing primers listed in Table 6d, or fragments comprising at least 8, at least 12, at least 15, or at least consecutive nucleotides thereof and having a 3' terminus immediately upstream of the corresponding biallelic marker, for determining the identity of a nucleotide at biallelic marker site.

W00058510 [http:/twww. Q etthepatent.comLogin.do examsup cpcfromCace=part=maintoobarbotoml Page 112 of 737 WO 00/58510 PCT/IB00/00435 110 3) Mismatch detection assays based on polymerases and ligases In one aspect the present invention provides polynucleotides and methods to determine the allele of one or more biallelic markers of the present invention in a biological sample, by mismatch detection assays based on polymerases and/or ligases. These assays are based on the specificity of polymerases and ligases. Polymerization reactions places particularly stringent requirements on correct base pairing of the 3' end of the amplification primer and the joining of two oligonucleotides hybridized to a target DNA sequence is quite sensitive to mismatches close to the ligation site, especially at the 3' end. The terms "enzyme based mismatch detection assay" are used herein to refer to any method of determining the allele of a biallelic marker based on the specificity of ligases and polymerases. Preferred methods are described below.

Methods, primers and various parameters to amplify DNA fragments comprising biallelic markers of the present invention are further described herein.

Allele specific amplification Discrimination between the two alleles of a biallelic marker can also be achieved by allele specific amplification, a selective strategy, whereby one of the alleles is amplified without amplification of the other allele. This is accomplished by placing a polymorphic base at the 3' end of one of the amplification primers. Because the extension forms from the 3'end of the primer, a mismatch at or near this position has an inhibitory effect on amplification. Therefore, under appropriate amplification conditions, these primers only direct amplification on their complementary allele. Designing the appropriate allele-specific primer and the corresponding assay conditions are well with the ordinary skill in the art.

Ligation/amplification based methods The "Oligonucleotide Ligation Assay" (OLA) uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target molecules. One of the oligonucleotides is biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate that can be captured and detected. OLA is capable of detecting biallelic markers and may be advantageously combined with PCR as described by Nickerson D.A. et al. (1990). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.

Other methods which are particularly suited for the detection of biallelic markers include LCR (ligase chain reaction), Gap LCR (GLCR) which are described herein. As mentioned above LCR uses two pairs of probes to exponentially amplify a specific target. The sequences of each pair of oligonucleotides, is selected to permit the pair to hybridize to abutting sequences of the same strand of the target. Such hybridization forms a substrate for a template- W00058510 [http J/www.getthepatent.com/Login.dog/Sexam support/Fetch/Default.doNV/W005851 0.cpc?tromcache= part=maintoolbar=bottom] Pae 113 of 737 WO 00/58510 PCT/IB00/00435 111 dependant ligase. In accordance with the present invention, LCR can be performed with oligonucleotides having the proximal and distal sequences of the same strand of a biallelic marker site. In one embodiment, either oligonucleotide will be designed to include the biallelic marker site. In such an embodiment, the reaction conditions are selected such that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide(s) that is complementary to the biallelic marker on the oligonucleotide. In an alternative embodiment, the oligonucleotides will not include the biallelic marker, such that when they hybridize to the target molecule, a "gap" is created as described in WO 90/01069.

his gap is then "filled" with complementary dNTPs (as mediated by DNA polymerase), or by an additional pair of oligonucleotides. Thus at the end of each cycle, each single strand has a complement capable of serving as a target during the next cycle and exponential allele-specific amplification of the desired sequence is obtained.

Ligase/Polymerase-mediated Genetic Bit Analysis m is another method for determining the identity of a nucleotide at a preselected site in a nucleic acid molecule (WO 95/21271). This method involves the incorporation of a nucleoside triphosphate that is complementary to the nucleotide present at the preselected site onto the terminus of a primer molecule, and their subsequent ligation to a second oligonucleotide. The reaction is monitored by detecting a specific label attached to the reaction's solid phase or by detection in solution.

4) Hybridization assay methods A preferred method of determining the identity of the nucleotide present at a biallelic marker site involves nucleic acid hybridization. The hybridization probes, which can be conveniently used in such reactions, preferably include the probes defined herein. Any hybridization assay may be used including Southern hybridization, Northern hybridization, dot blot hybridization and solid-phase hybridization (see Sambrook et al., Molecular Cloning A Laboratory Manual, Second Edition, Cold Spring Harbor Press, 1989).

Hybridization refers to the formation of a duplex structure by two single stranded nucleic acids due to complementary base pairing. Hybridization can occur between exactly complementary nucleic acid strands or between nucleic acid strands that contain minor regions of mismatch. Specific probes can be designed that hybridize to one form ofa biallelic marker and not to the other and therefore are able to discriminate between different allelic forms.

Allele-specific probes are often used in pairs, one member of a pair showing perfect match to a target sequence containing the original allele and the other showing a perfect match to the target sequence containing the alternative allele. Hybridization conditions should be sufficiently stringent that there is a significant difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles.

W0005851 0 fhttit ww.getthepa tent. co m/Loqotq/Sexa m. supportFetch/Defa uIt dog 005851 0.cpc?fromCache= 1 part=maintoolbar=bottom] Page 114 of 737 WO 00/58510 PCT/IB00/00435 112 Stringent, sequence specific hybridization conditions, under which a probe will hybridize only to the exactly complementary target sequence are well known in the art (Sambrook et al., Molecular Cloning A Laboratory Manual, Second Edition, Cold Spring Harbor Press, N.Y., 1989). Stringent conditions are sequence dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. By way of example and not limitation, procedures using conditions of high stringency are as follows: Prehybridization of filters containing DNA is carried out for 8 h to overnight at 65C in buffer composed of6X SSC, 50 mM Tris-HCI (pH 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 pg/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65C, the preferred hybridization temperature, in prehybridization mixture containing 100 pg/ml denatured salmon sperm DNA and 5-20 X 106 cpm of 32 P-labeled probe.

Alternatively, the hybridization step can be performed at 65 0 C in the presence of SSC buffer, 1 x SSC corresponding to 0.15M NaCI and 0.05 M Na citrate. Subsequently, filter washes can be done at 37C for 1 h in a solution containing 2X SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA, followed by a wash in 0.1 X SSC at 50 0 C for 45 min. Alternatively, filter washes can be performed in a solution containing 2 x SSC and 0.1% SDS, or 0.5 x SSC and 0.1% SDS, or 0.1 x SSC and 0.1% SDS at 68 0 C for 15 minute intervals. Following the wash steps, the hybridized probes are detectable by autoradiography. By way of example and not limitation, procedures using conditions of intermediate stringency are as follows: Filters containing DNA are prehybridized, and then hybridized at a temperature of 60°C in the presence of a 5 x SSC buffer and labeled probe. Subsequently, filters washes are performed in a solution containing 2x SSC at 50°C and the hybridized probes are detectable by autoradiography. Other conditions of high and intermediate stringency which may be used are well known in the art and as cited in Sambrook et al. (Molecular Cloning A Laboratory Manual, Second Edition, Cold Spring Harbor Press, 1989) and Ausubel et al. (Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, 1989).

Although such hybridizations can be performed in solution, it is preferred to employ a solid-phase hybridization assay. The target DNA comprising a biallelic marker of the present invention may be amplified prior to the hybridization reaction. The presence of a specific allele in the sample is determined by detecting the presence or the absence of stable hybrid duplexes formed between the probe and the target DNA. The detection of hybrid duplexes can be carried out by a number of methods. Various detection assay formats are well known which utilize detectable labels bound to either the target or the probe to enable detection of the hybrid duplexes. Typically, hybridization duplexes are separated from unhybridized nucleic acids and W00058510 [http:/hvww.getthepatent.comLogin.dog/Sexam.suppo rtFeth/Defaut. doIO005 8 51 0.cpcfro mCache= 1 part=maintaobar-bofto m]Page 1150737 WO 00/58510 PCT/IB00/00435 113 the labels bound to the duplexes are then detected. Those skilled in the art will recognize that wash steps may be employed to wash away excess target DNA or probe. Standard heterogeneous assay formats are suitable for detecting the hybrids using the labels present on the primers and probes.

Two recently developed assays allow hybridization-based allele discrimination with no need for separations or washes (see Landegren U. et al.,1998). The TaqMan assay takes advantage of the 5' nuclease activity of Taq DNA polymerase to digest a DNA probe annealed specifically to the accumulating amplification product. TaqMan probes are labeled with a donor-acceptor dye pair that interacts via fluorescence energy transfer. Cleavage of the TaqMan probe by the advancing polymerase during amplification dissociates the donor dye from the quenching acceptor dye, greatly increasing the donor fluorescence. All reagents necessary to detect two allelic variants can be assembled at the beginning of the reaction and the results are monitored in real time (see Livak et al, 1995). In an alternative homogeneous hybridization-based procedure, molecular beacons are used for allele discriminations.

Molecular beacons are hairpin-shaped oligonucleotide probes that report the presence of specific nucleic acids in homogeneous solutions. When they bind to their targets they undergo a conformational reorganization that restores the fluorescence of an internally quenched fluorophore (Tyagi et al., 1998).

By assaying the hybridization to an allele specific probe, one can detect the presence or absence of a biallelic marker allele in a given sample.

High-Throughput parallel hybridizations in array format are specifically encompassed within "hybridization assays" and are described below.

Hybridization to addressable arrays of oligonucleotides Hybridization assays based on oligonucleotide arrays rely on the differences in hybridization stability of short oligonucleotides to perfectly matched and mismatched target sequence variants. Efficient access to polymorphism information is obtained through a basic structure comprising high-density arrays of oligonucleotide probes attached to a solid support (the chip) at selected positions. Each DNA chip can contain thousands to millions of individual synthetic DNA probes arranged in a grid-like pattern and miniaturized to the size of a dime.

The chip technology has already been applied with success in numerous cases. For example, the screening of mutations has been undertaken in the BRCAI gene, in S. cerevisiae mutant strains, and in the protease gene of HIV-1 virus (Hacia et at., 1996; Shoemaker et al., 1996 Kozal et al., 1996). Chips of various formats for use in detecting biallelic polymorphisms can be produced on a customized basis by Affymetrix (GeneChipTM), Hyseq (HyChip and HyGnostics), and Protogene Laboratories.

W00058510 [hupJtv. g etthe patent.co m/LoL.dog/exam.su poWFetchDefa u It. dogi b85U.cpc?tromCache=l art=maintoolbar=bottom Page 116 of 737 WO 00/58510 PCT/IB00/00435 114 In general, these methods employ arrays of oligonucleotide probes that are complementary to target nucleic acid sequence segments from an individual which, target sequences include a polymorphic marker. EP785280, describes a tiling strategy for the detection of single nucleotide polymorphisms. Briefly, arrays may generally be "tiled" for a large number of specific polymorphisms. By "tiling" is generally meant the synthesis of a defined set of oligonucleotide probes which is made up of a sequence complementary to the target sequence of interest, as well as preselected variations of that sequence, substitution of one or more given positions with one or more members of the basis set of monomers, i.e.

nucleotides. Tiling strategies are further described in PCT application No. WO 95/11995. In a particular aspect, arrays are tiled for a number of specific, identified biallelic marker sequences.

In particular the array is tiled to include a number of detection blocks, each detection block being specific for a specific biallelic marker or a set of biallelic markers. For example, a detection block may be tiled to include a number of probes, which span the sequence segment that includes a specific polymorphism. To ensure probes that are complementary to each allele, the probes are synthesized in pairs differing at the biallelic marker. In addition to the probes differing at the polymorphic base, monosubstituted probes are also generally tiled within the detection block. These monosubstituted probes have bases at and up to a certain number of bases in either direction from the polymorphism, substituted with the remaining nucleotides (selected from A, T, G, C and Typically the probes in a tiled detection block will include substitutions of the sequence positions up to and including those that are 5 bases away from the biallelic marker. The monosubstituted probes provide internal controls for the tiled array, to distinguish actual hybridization from artefactual cross-hybridization. Upon completion of hybridization with the target sequence and washing of the array, the array is scanned to determine the position on the array to which the target sequence hybridizes. The hybridization data from the scanned array is then analyzed to identify which allele or alleles of the biallelic marker are present in the sample. Hybridization and scanning may be carried out as described in PCT application No. WO 92/10092 and WO 95/11995 and US patent No. 5,424,186.

Thus, in some embodiments, the chips may comprise an array of nucleic acid sequences of fragments of about 15 nucleotides in length. In further embodiments, the chip may comprise an array including at least one of the sequences selected from the group consisting of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 and the sequences complementary thereto, or a fragment thereof at least about 8 consecutive nucleotides, preferably 10, 15, 20, more preferably 25, 47, or 50 consecutive nucleotides. In some embodiments, the chip may comprise an array of at least 2, 3, 4, 5, 6, 7, 8 or more of these polynucleotides of the invention. Solid supports and polynucleotides of the present invention attached to solid supports are further described in the W0005851 0 [htlp:/www.getthepatent.comfLoqin.dog/Sexam.supporFetchiDefault. dogNV00 5 8 5 1 0.cpc?fromCache 1 part=maintoobar=bottom] Page 117 of 737 WO 00/58510 PCT/IB00/00435 115 section titled "Oligonucleotide probes and Primers".

Integrated Systems Another technique, which may be used to analyze polymorphisms, includes multicomponent integrated systems, which miniaturize and compartmentalize processes such as PCR and capillary electrophoresis reactions in a single functional device. An example of such technique is disclosed in US patent 5,589,136, which describes the integration of PCR amplification and capillary electrophoresis in chips.

Integrated systems can be envisaged mainly when microfluidic systems are used. These systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic wafer included on a microchip. The movements of the samples are controlled by electric, electroosmotic or hydrostatic forces applied across different areas of the microchip. For genotyping biallelic markers, the microfluidic system may integrate nucleic acid amplification, microsequencing, capillary electrophoresis and a detection method such as laser-induced fluorescence detection.

Methods Of Genetic Analysis Using The Biallelic Markers Of The Present Invention Different methods are available for the genetic analysis of complex traits (see Lander and Schork, 1994). The search for disease-susceptibility genes is conducted using two main methods: the linkage approach in which evidence is sought for cosegregation between a locus and a putative trait locus using family studies, and the association approach in which evidence is sought for a statistically significant association between an allele and a trait or a trait causing allele (Khoury J. et al, 1993). In general, the biallelic markers of the present invention find use in any method known in the art to demonstrate a statistically significant correlation between a genotype and a phenotype. The biallelic markers may be used in parametric and non-parametric linkage analysis methods. Preferably, the biallelic markers of the present invention are used to identify genes associated with detectable traits using association studies, an approach which does not require the use of affected families and which permits the identification of genes associated with complex and sporadic traits.

The genetic analysis using the biallelic markers of the present invention may be conducted on any scale. The whole set of biallelic markers of the present invention or any subset of biallelic markers of the present invention may be used. In some embodiments a subset of biallelic markers corresponding to one or several candidate genes of the present invention may be used. Alternatively, a subset of biallelic markers of the present invention localised on a specific chromosome segment may be used. Further, any set of genetic markers including a W00058510 [http:llwww.getthepatentcom/log in.dog/Sexam.supprtFetchiDefault.dogiWO005851 O.CpCfromCacie=1 pa rt=ma intoolbar-botoml Page 118 o0737 WO 00/58510 PCT/IB00/00435 116 biallelic marker of the present invention may be used. As mentioned above, it should be noted that the biallelic markers of the present invention may be included in any complete or partial genetic map of the human genome. These different uses are specifically contemplated in the present invention and claims.

Linkage analysis Linkage analysis is based upon establishing a correlation between the transmission of genetic markers and that of a specific trait throughout generations within a family. Thus, the aim of linkage analysis is to detect marker loci that show cosegregation with a trait of interest in pedigrees.

Parametric methods When data are available from successive generations there is the opportunity to study the degree of linkage between pairs of loci. Estimates of the recombination fraction enable loci to be ordered and placed onto a genetic map. With loci that are genetic markers, a genetic map can be established, and then the strength of linkage between markers and traits can be calculated and used to indicate the relative positions of markers and genes affecting those traits (Weir, 1996). The classical method for linkage analysis is the logarithm of odds (lod) score method (see Morton 1955; Ott J, 1991). Calculation oflod scores requires specification of the mode of inheritance for the disease (parametric method). Generally, the length of the candidate region identified using linkage analysis is between 2 and 20Mb. Once a candidate region is identified as described above, analysis of recombinant individuals using additional markers allows further delineation of the candidate region. Linkage analysis studies have generally relied on the use of a maximum of 5,000 microsatellite markers, thus limiting the maximum theoretical attainable resolution of linkage analysis to about 600 kb on average.

Linkage analysis has been successfully applied to map simple genetic traits that show clear Mendelian inheritance patterns and which have a high penetrance the ratio between the number of trait positive carriers of allele a and the total number of a carriers in the population). However, parametric linkage analysis suffers from a variety of drawbacks. First, it is limited by its reliance on the choice of a genetic model suitable for each studied trait.

Furthermore, as already mentioned, the resolution attainable using linkage analysis is limited, and complementary studies are required to refine the analysis of the typical 2Mb to regions initially identified through linkage analysis. In addition, parametric linkage analysis approaches have proven difficult when applied to complex genetic traits, such as those due to the combined action of multiple genes and/or environmental factors. It is very difficult to model these factors adequately in a lod score analysis. In such cases, too large an effort and W00058510 [http:twww. etthepatent.com/Log in.dog/Sexansuppo rtFetchIDefautdoNVO05851 0.cpc?fromCache= 1 part=maintoolbarbottom] Page 119 of 737 WO 00/58510 PCT/IB00/00435 117 cost are needed to recruit the adequate number of affected families required for applying linkage analysis to these situations, as recently discussed by Risch, N. and Merikangas, K. (1996).

Non-parametric methods The advantage of the so-called non-parametric methods for linkage analysis is that they do not require specification of the mode of inheritance for the disease, they tend to be more useful for the analysis of complex traits. In non-parametric methods, one tries to prove that the inheritance pattern of a chromosomal region is not consistent with random Mendelian segregation by showing that affected relatives inherit identical copies of the region more often than expected by chance. Affected relatives should show excess "allele sharing" even in the presence of incomplete penetrance and polygenic inheritance. In non-parametric linkage analysis the degree of agreement at a marker locus in two individuals can be measured either by the number of alleles identical by state (IBS) or by the number of alleles identical by descent (IBD). Affected sib pair analysis is a well-known special case and is the simplest form of these methods.

The biallelic markers of the present invention may be used in both parametric and nonparametric linkage analysis. Preferably biallelic markers may be used in non-parametric methods which allow the mapping of genes involved in complex traits. The biallelic markers of the present invention may be used in both IBD- and IBS- methods to map genes affecting a complex trait. In such studies, taking advantage of the high density of biallelic markers, several adjacent biallelic marker loci may be pooled to achieve the efficiency attained by multi-allelic Smarkers (Zhao et al., 1998).

However, both parametric and non-parametric linkage analysis methods analyse affected relatives, they tend to be of limited value in the genetic analysis of drug responses or in the analysis of side effects to treatments. This type of analysis is impractical in such cases due to the lack of availability of familial cases. In fact, the likelihood of having more than one individual in a family being exposed to the same drug at the same time is extremely low.

Population Association Studies The present invention comprises methods for identifying one or several genes among a set of candidate genes that are associated with a detectable trait using the biallelic markers of the present invention. In one embodiment the present invention comprises methods to detect an association between a biallelic marker allele or a biallelic marker haplotype and a trait. Further, the invention comprises methods to identify a trait causing allele in linkage disequilibrium with any biallelic marker allele of the present invention.

As described above, alternative approaches can be employed to perform association studies: genome-wide association studies, candidate region association studies and candidate W0005851 0 [httpJtww.getthepatent.comfLog indog/Sexa m .SUPortlFetche faut. doNVO 585 O.cpc?fromCache= 1 part=maintoolbar=bottom] Page 120 of 737 WO 00/58510 PCT/IB00/00435 118 gene association studies. The candidate region analysis clearly provides a short-cut approach to the identification of genes and gene polymorphisms related to a particular trait when some information concerning the biology of the trait is available. Further, the biallelic markers of the present invention may be incorporated in any map of genetic markers of the human genome in order to perform genome-wide association studies. Methods to generate a high-density map of biallelic markers has been described in US Provisional Patent application serial number 60/082,614. The biallelic markers of the present invention may further be incorporated in any map of a specific candidate region of the genome (a specific chromosome or a specific chromosomal segment for example).

As mentioned above, association studies may be conducted within the general population and are not limited to studies performed on related individuals in affected families.

Association studies are extremely valuable as they permit the analysis of sporadic or multifactor traits. Moreover, association studies represent a powerful method for fine-scale mapping enabling much finer mapping of trait causing alleles than linkage studies. Studies based on pedigrees often only narrow the location of the trait causing allele. Association studies using the biallelic markers of the present invention can therefore be used to refine the location of a trait causing allele in a candidate region identified by Linkage Analysis methods. Biallelic markers of the present invention can be used to identify the involved gene; such uses are specifically contemplated in the present invention and claims.

1) Determining the frequency of a biallelic marker allele or of a biallelic marker haplotype in a population Another embodiment of the present invention encompasses methods of estimating the frequency of a haplotype for a set of biallelic markers in a population, comprising the steps of: a) genotyping each individual in said population for at least one 13q3 l-q33-related biallelic marker, b) genotyping each individual in said population for a second biallelic marker by determining the identity of the nucleotides at said second biallelic marker for both copies of said second biallelic marker present in the genome; and c) applying a haplotype determination method to the identities of the nucleotides determined in steps a) and b) to obtain an estimate of said frequency. In addition, the methods of estimating the frequency of a haplotype of the invention encompass methods with any further limitation described in this disclosure, or those following, specified alone or in any combination: optionally said haplotype determination method is selected from the group consisting of asymmetric PCR amplification, double PCR amplification of specific alleles, the Clark method, or an expectation maximization algorithm; optionally, said second biallelic marker is a 13q3 I-q33-related biallelic marker in a sequence selected from the group consisting of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229, and the W0005851 0 fhttpJtwww.getthepatent.com/Login.do/Sexam.suDortFetchDefault.doNVO005851 0.cpcfromCache= 1 part=malntoolbar--bottomL age 121 of 737 WO 00/58510 PCT/IB00/00435 119 complements thereof; optionally, said 13q31-q33-related biallelic marker may be selected individually or in any combination from the biallelic markers described in Tables 6b and 6c; optionally, the identity of the nucleotides at the biallelic markers in everyone of the sequences of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229 is determined in steps a) and b).

Association studies explore the relationships among frequencies for sets of alleles between loci.

Determining the frequency of an allele in a population Allelic frequencies of the biallelic markers in a population can be determined using one of the methods described above under the heading "Methods for genotyping an individual for biallelic markers", or any genotyping procedure suitable for this intended purpose. Genotyping pooled samples or individual samples can determine the frequency of a biallelic marker allele in a population. One way to reduce the number of genotypings required is to use pooled samples.

A major obstacle in using pooled samples is in terms of accuracy and reproducibility for determining accurate DNA concentrations in setting up the pools. Genotyping individual samples provides higher sensitivity, reproducibility and accuracy and; is the preferred method used in the present invention. Preferably, each individual is genotyped separately and simple gene counting is applied to determine the frequency of an allele of a biallelic marker or of a genotype in a given population.

Determining the frequency of a haplotype in a population The gametic phase of haplotypes is unknown when diploid individuals are heterozygous at more than one locus. Using genealogical information in families gametic phase can sometimes be inferred (Perlin et al., 1994). When no genealogical information is available.

different strategies may be used. One possibility is that the multiple-site heterozygous diploids can be eliminated from the analysis, keeping only the homozygotes and the single-site heterozygote individuals, but this approach might lead to a possible bias in the sample composition and the underestimation of low-frequency haplotypes. Another possibility is that single chromosomes can be studied independently, for example, by asymmetric PCR amplification (see Newton et al., 1989; Wu et al., 1989) or by isolation of single chromosome by limit dilution followed by PCR amplification (see Ruano et al., 1990). Further, a sample may be haplotyped for sufficiently close biallelic markers by double PCR amplification of specific alleles (Sarkar, G. and Sommer 1991). These approaches are not entirely satisfying either because of their technical complexity, the additional cost they entail, their lack of generalisation at a large scale, or the possible biases they introduce. To overcome these difficulties, an algorithm to infer the phase of PCR-amplified DNA genotypes introduced by Clark A.G. (1990) may be used. Briefly, the principle is to start filling a preliminary list of haplotypes present in W00058510 rhnD:J/ww.aetheoatent. comLoain.doa/Sexam.suoowFetc-hDefault.doaA iOOO5851 0.cpcfromCache= 1 part=maintoolbar-botoml Paqe 122 of 737 WO 00/58510 PCT/IB00/00435 120 the sample by examining unambiguous individuals, that is, the complete homozygotes and the single-site heterozygotes. Then other individuals in the same sample are screened for the possible occurrence of previously recognised haplotypes. For each positive identification, the complementary haplotype is added to the list of recognised haplotypes, until the phase information for all individuals is either resolved or identified as unresolved. This method assigns a single haplotype to each multiheterozygous individual, whereas several haplotypes are possible when there are more than one heterozygous site. Alternatively, one can use methods estimating haplotype frequencies in a population without assigning haplotypes to each individual. Preferably, a method based on an expectation-maximization (EM) algorithm (Dempster et al., J. R. 1977) leading to maximum-likelihood estimates of haplotype frequencies under the assumption of Hardy-Weinberg proportions (random mating) is used (see Excoffier L.

and Slatkin 1995). The EM algorithm is a generalised iterative maximum-likelihood approach to estimation that is useful when data are ambiguous and/or incomplete. The EM algorithm is used to resolve heterozygotes into haplotypes. Haplotype estimations are further described below under the heading "Statistical methods>>. Any other method known in the art to determine or to estimate the frequency of a haplotype in a population may also be used.

2) Linkage Disequilibrium analysis Linkage disequilibrium is the non-random association of alleles at two or more loci and represents a powerful tool for mapping genes involved in disease traits (see Ajioka R.S. et al., 1997). Biallelic markers, because they are densely spaced in the human genome and can be genotyped in more numerous numbers than other types of genetic markers (such as RFLP or VNTR markers), are particularly useful in genetic analysis based on linkage disequilibrium.

The biallelic markers of the present invention may be used in any linkage disequilibrium analysis method known in the art.

Briefly, when a disease mutation is first introduced into a population (by a new mutation or the immigration of a mutation carrier), it necessarily resides on a single chromosome and thus on a single "background" or "ancestral" haplotype of linked markers.

Consequently, there is complete disequilibrium between these markers and the disease mutation: one finds the disease mutation only in the presence of a specific set of marker alleles.

Through subsequent generations recombinations occur between the disease mutation and these marker polymorphisms, and the disequilibrium gradually dissipates. The pace of this dissipation is a function of the recombination frequency, so the markers closest to the disease gene will manifest higher levels of disequilibrium than those that are further away. When not broken up by recombination, "ancestral" haplotypes and linkage disequilibrium between marker alleles at different loci can be tracked not only through pedigrees but also through populations.

W00058510 htt:/twww.aeLttheoatent.com/Loain.doo/Sexam~suoNoFetch/efault.doa/W00 5851 O.cpc?fromCache=1 part=maintaolbar=bottoml Paae 123 of 737 WO 00/58510 PCT/IB00/00435 121 Linkage disequilibrium is usually seen as an association between one specific allele at one locus and another specific allele at a second locus.

The pattern or curve of disequilibrium between disease and marker loci is expected to exhibit a maximum that occurs at the disease locus. Consequently, the amount of linkage disequilibrium between a disease allele and closely linked genetic markers may yield valuable information regarding the location of the disease gene. For fine-scale mapping of a disease locus, it is useful to have some knowledge of the patterns of linkage disequilibrium that exist between markers in the studied region. As mentioned above the mapping resolution achieved through the analysis of linkage disequilibrium is much higher than that of linkage studies. The high density of biallelic markers combined with linkage disequilibrium analysis provides powerful tools for fine-scale mapping. Different methods to calculate linkage disequilibrium are described below under the heading "Statistical Methods".

3) Population-based case-control studies of trait-marker associations As mentioned above, the occurrence of pairs of specific alleles at different loci on the same chromosome is not random and the deviation from random is called linkage disequilibrium. Association studies focus on population frequencies and rely on the phenomenon of linkage disequilibrium. If a specific allele in a given gene is directly involved in causing a particular trait, its frequency will be statistically increased in an affected (trait positive) population, when compared to the frequency in a trait negative population or in a random control population. As a consequence of the existence of linkage disequilibrium, the frequency of all other alleles present in the haplotype carrying the trait-causing allele will also be increased in trait positive individuals compared to trait negative individuals or random controls. Therefore, association between the trait and any allele (specifically a biallelic marker allele) in linkage disequilibrium with the trait-causing allele will suffice to suggest the presence of a trait-related gene in that particular region. Case-control populations can be genotyped for biallelic markers to identify associations that narrowly locate a trait causing allele. As any marker in linkage disequilibrium with one given marker associated with a trait will be associated with the trait. Linkage disequilibrium allows the relative frequencies in case-control populations of a limited number of genetic polymorphisms (specifically biallelic markers) to be analysed as an alternative to screening all possible functional polymorphisms in order to find trait-causing alleles. Association studies compare the frequency of marker alleles in unrelated case-control populations, and represent powerful tools for the dissection of complex traits.

Case-control populations (inclusion criteria) Population-based association studies do not concern familial inheritance but compare the prevalence of a particular genetic marker, or a set of markers, in case-control populations.

W0005851 0 [httDJ/www.getthepatent.com/Login.dog/Sexam supportFetchDefault.docN005851 O.cpc?fromCache=1 part=maintoolbar=bottomi Page 124 of 737 WO 00/58510 PCTIBOO/00435 122 They are case-control studies based on comparison of unrelated case (affected or trait positive) individuals and unrelated control (unaffected or trait negative or random) individuals.

Preferably the control group is composed of unaffected or trait negative individuals. Further, the control group is ethnically matched to the case population. Moreover, the control group is preferably matched to the case-population for the main known confusion factor for the trait under study (for example age-matched for an age-dependent trait). Ideally, individuals in the two samples are paired in such a way that they are expected to differ only in their disease status.

In the following "trait positive population,), "case population" and "affected population" are used interchangeably.

An important step in the dissection of complex traits using association studies is the choice of case-control populations (see Lander and Schork, 1994). A major step in the choice of case-control populations is the clinical definition of a given trait or phenotype. Any genetic trait may be analysed by the association method proposed here by carefully selecting the individuals to be included in the trait positive and trait negative phenotypic groups. Four criteria are often useful: clinical phenotype, age at onset, family history and severity. The selection procedure for continuous or quantitative traits (such as blood pressure for example) involves selecting individuals at opposite ends of the phenotype distribution of the trait under study, so as to include in these trait positive and trait negative populations individuals with nonoverlapping phenotypes. Preferably, case-control populations comprise phenotypically homogeneous populations. Trait positive and trait negative populations comprise phenotypically uniform populations of individuals representing each between 1 and 98%, preferably between I and 80%, more preferably between I and 50%, and more preferably between I and 30%, most preferably between I and 20% of the total population under study, and selected among individuals exhibiting non-overlapping phenotypes. The clearer the difference between the two trait phenotypes, the greater the probability of detecting an association with biallelic markers. The selection of those drastically different but relatively uniform phenotypes enables efficient comparisons in association studies and the possible detection of marked differences at the genetic level, provided that the sample sizes of the populations under study are significant enough.

In preferred embodiments, a first group of between 50 and 300 trait positive individuals, preferably about 100 individuals, are recruited according to their phenotypes. A similar number of trait negative individuals are included in such studies.

In the present invention, typical examples of inclusion criteria include affection by schizophrenia.

Association analysis W00058510 [http:/twwvgetthepatent.comLoqin dogSexa m. suportIFetch/Defa ut. dog O005851 O.cpc?fromCactie=1part-ma intoolbar-botoml Page 125 of 737 WO 00/58510 PCT/IB00/00435 123 The general strategy to perform association studies using biallelic markers derived from a region carrying a candidate gene is to scan two groups of individuals (case-control populations) in order to measure and statistically compare the allele frequencies of the biallelic markers of the present invention in both groups.

If a statistically significant association with a trait is identified for at least one or more of the analysed biallelic markers, one can assume that: either the associated allele is directly responsible for causing the trait (the associated allele is the trait causing allele), or more likely the associated allele is in linkage disequilibrium with the trait causing allele. The specific characteristics of the associated allele with respect to the gene function usually gives further insight into the relationship between the associated allele and the trait (causal or in linkage disequilibrium). If the evidence indicates that the associated allele within the gene is most probably not the trait causing allele but is in linkage disequilibrium with the real trait causing allele, then the trait causing allele can be found by sequencing the vicinity of the associated marker.

Another embodiment of the present invention encompasses methods of detecting an association between a haplotype and a phenotype, comprising the steps of: a) estimating the frequency of at least one haplotype in a trait positive population according to a method of estimating the frequency of a haplotype of the invention; b) estimating the frequency of said haplotype in a control population according to the method of estimating the frequency of a haplotype of the invention; and c) determining whether a statistically significant association exists between said haplotype and said phenotype. In addition, the methods of detecting an association between a haplotype and a phenotype of the invention encompass methods with any further limitation described in this disclosure, or those following, specified alone or in any combination: Optionally, said 13q3 I-q33-related biallelic marker may be in a sequence selected individually or in any combination from the group consisting of SEQ ID Nos I to 26, 36 to 40 and 54 to 229, and the complements thereof; optionally, said 13q31-q33-related biallelic marker may be selected individually or in any combination from the biallelic markers described in Tables 6b and 6c; optionally, said control population may be a trait negative population, or a random population; optionally, said phenotype is a disease involving schizophrenia, a response to an agent acting on schizophrenia, or a side effects to an agent acting on schizophrenia.

Haplotype analysis As described above, when a chromosome carrying a disease allele first appears in a population as a result of either mutation or migration, the mutant allele necessarily resides on a chromosome having a set of linked markers: the ancestral haplotype. This haplotype can be W0005851 0 (http:/www.gettheatent.comLogin.dog/Sexam.supportiFet&Defaul.dogMNO005851 O.cc?fromCahe= 1 part=maintoolbar=bottoml Page 126 of 737 WO 00/58510 PCT/IB00/00435 124 tracked through populations and its statistical association with a given trait can be analysed.

Complementing single point (allelic) association studies with multi-point association studies also called haplotype studies increases the statistical power of association studies. Thus, a haplotype association study allows one to define the frequency and the type of the ancestral carrier haplotype. A haplotype analysis is important in that it increases the statistical power of an analysis involving individual markers.

In a first stage of a haplotype frequency analysis, the frequency of the possible haplotypes based on various combinations of the identified biallelic markers of the invention is determined. The haplotype frequency is then compared for distinct populations of trait positive and control individuals. The number of trait positive individuals, which should be, subjected to this analysis to obtain statistically significant results usually ranges between 30 and 300, with a preferred number of individuals ranging between 50 and 150. The same considerations apply to the number of unaffected individuals (or random control) used in the study. The results of this first analysis provide haplotype frequencies in case-control populations, for each evaluated haplotype frequency a p-value and an odd ratio are calculated. If a statistically significant association is found the relative risk for an individual carrying the given haplotype of being affected with the trait under study can be approximated.

Interaction Analysis The biallelic markers of the present invention may also be used to identify patterns of biallelic markers associated with detectable traits resulting from polygenic interactions. The analysis of genetic interaction between alleles at unlinked loci requires individual genotyping using the techniques described herein. The analysis of allelic interaction among a selected set of biallelic markers with appropriate level of statistical significance can be considered as a haplotype analysis. Interaction analysis comprises stratifying the case-control populations with respect to a given haplotype for the first loci and performing a haplotype analysis with the second loci with each subpopulation.

Statistical methods used in association studies are further described herein.

4) Testing for linkage in the presence of association The biallelic markers of the present invention may further be used in TDT (transmission/disequilibrium test). TDT tests for both linkage and association and is not affected by population stratification. TDT requires data for affected individuals and their parents or data from unaffected sibs instead of from parents (see Spielmann S. et al., 1993; Schaid D.J. et al., 1996, Spielmann S. and Ewens W.J, 1998). Such combined tests generally reduce the false positive errors produced by separate analyses.

W00058510 [httDJAww.aetthenatent.com/Loain.doo/Sexam.suDoortiFetch/DefaultdoaNVO005851 O.cpcfromCache=1 part=maintoolbar=bottoml Pacie 127 of 737 WO 00/58510 PCT/IB00/00435 125 Statistical methods In general, any method known in the art to test whether a trait and a genotype show a statistically significant correlation may be used.

1) Methods in linkage analysis Statistical methods and computer programs useful for linkage analysis are well-known to those skilled in the art (see Terwilliger J.D. and Ott 1994; Ott 1991).

2) Methods to estimate haplotype frequencies in a population As described above, when genotypes are scored, it is often not possible to distinguish heterozygotes so that haplotype frequencies cannot be easily inferred. When the gametic phase is not known, haplotype frequencies can be estimated from the multilocus genotypic data. Any method known to person skilled in the art can be used to estimate haplotype frequencies (see Lange 1997; Weir, 1996) Preferably, maximum-likelihood haplotype frequencies are computed using an Expectation- Maximization (EM) algorithm (see Dempster et al., 1977; Excoffier L. and Slatkin 1995). This procedure is an iterative process aiming at obtaining maximum-likelihood estimates of haplotype frequencies from multi-locus genotype data when the gametic phase is unknown. Haplotype estimations are usually performed by applying the EM algorithm using for example the EM-HAPLO program (Hawley M.E. et al.,1994) or the Arlequin program (Schneider.et al., 1997). The EM algorithm is a generalised iterative maximum likelihood approach to estimation and is briefly described below.

In the following part of this text, phenotypes will refer to multi-locus genotypes with unknown phase. Genotypes will refer to known-phase multi-locus genotypes. Suppose a sample of N unrelated individuals typed for K markers. The data observed are the unknownphase K-locus phenotypes that can categorised in F different phenotypes. Suppose that we have H underlying possible haplotypes (in case ofK biallelic markers, H=2K).

For phenotype j, suppose that cj genotypes are possible. We thus have the following equation Ci Ci Pj pr(genotypei) pr(hk, h) Equation 1 1=1 1=1 where Pj is the probability of the phenotypej, hk and h, are the two haplotypes constituent the genotype i. Under the Hardy-Weinberg equilibrium, pr(hFtbh becomes: pr(hk,h) pr(hk)2 if hk h i pr(hk 2pr(hk).pr(hl) if hk h. Equation 2 The successive steps of the E-M algorithm can be described as follows: Starting with initial values of the of haplotypes frequencies, noted p, O) these initial values serve to estimate the genotype frequencies (Expectation step) and then W00058510 [http:/twww.getthepatent.com/Login .dog/Sexam.su yppo FetchDefaut.dog000585 1 0.cpc?fromCa che= 1 part=maintoolbar-bottom] Page 128 of 737 WO 00/58510 PCT/IB00/00435 126 estimate another set of haplotype frequencies (Maximisation step), noted these two steps are iterated until changes in the sets of haplotypes frequency are very small.

A stop criterion can be that the maximum difference between haplotype frequencies between two iterations is less than 10' 7 These values can be adjusted according to the desired precision of estimations. In details, at a given iteration s, the Expectation step comprises calculating the genotypes frequencies by the following equation: pr(genotype pr(phenotype ).pr(genotype, Iphenotype) (s) nj pr(hk,hi)(s) Equation 3 N p(S) where genotype i occurs in phenotypej, and where hk and ht constitute genotype i. Each probability is derived according to eq.1, and eq.2 described above.

Then the Maximisation step simply estimates another set of haplotype frequencies given the genotypes frequencies. This approach is also known as gene-counting method (Smith, 1957).

pS+i) t 1 t.pr(genotype)(s) Equation 4 2 j=1=l Where St is an indicator variable which count the number of time haplotype t in genotype i. It takes the values of 0, 1 or 2.

To ensure that the estimation finally obtained is the maximum-likelihood estimation several values of departures are required. The estimations obtained are compared and if they are different the estimations leading to the best likelihood are kept.

3) Methods to calculate linkage disequilibrium between markers A number of methods can be used to calculate linkage disequilibrium between any two genetic positions, in practice linkage disequilibrium is measured by applying a statistical association test to haplotype data taken from a population. Linkage disequilibrium between any pair of biallelic markers comprising at least one of the biallelic markers of the present invention (Mi, Mj) having alleles (avbi) at marker Mi and alleles (aj/bj) at marker Mj can be calculated for every allele combination (aiaj, aibj; bi,aj and bi,bj), according to the Piazza formula A.i 2 404 4 (04 03) (04 where 4= frequency of genotypes not having allele ai at Mi and not having allele aj at Mj 03= frequency of genotypes not having allele a at Mi and having allele aj at Mj 02= frequency of genotypes having allele a at Mi and not having allele aj at Mj W00058510 [http:/tww.getthepatent.com/Login.dog/Sexam.suprort/Fetch/efauttdgWO0 5 8 5 10.cpc?fromCache=1 part=maintoolbar= bottom] Page 129 of737 WO 00/58510 PCT/IB00/00435 127 Linkage disequilibrium (LD) between pairs of biallelic markers (Mi, Mj) can also be calculated for every allele combination (ai,aj;ai,bj ;bi,aj and b,bj), according to the maximum-likelihood estimate (MLE) for delta (the composite genotypic disequilibrium coefficient), as described by Weir (Weir 1996). The MLE for the composite linkage disequilibrium is: Daij= (2n 1 n 2 n 3 n 4 2)/N 2(pr(a,).pr(aj)) where ni Z phenotype a/aj), n2 phenotype (ai/a, a/bj), n 3 E phenotype aj/aj), n4= 2 phenotype (a/bi, a/bj) and N is the number of individuals in the sample. This formula allows linkage disequilibrium between alleles to be estimated when only genotype, and not haplotype, data are available.

Another means of calculating the linkage disequilibrium between markers is as follows.

For a couple of biallelic markers, M and M(a/bj), fitting the Hardy-Weinberg equilibrium, one can estimate the four possible haplotype frequencies in a given population according to the approach described above.

The estimation of gametic disequilibrium between ai and aj is simply: Daiaj pr(haplotype(a ,a pr(al).pr(aj).

Where pr(ad is the probability of allele ao and pr(a) is the probability of allele aj and where pr(haplotype (ab, is estimated as in Equation 3 above.

For a couple of biallelic marker only one measure of disequilibrium is necessary to describe the association between Mand Mj.

Then a normalised value of the above is calculated as follows: D'.aiI D.l.j max (-pr(ai).pr(aj) -pr(bs).pr(bj)) with D.i.j<0 D'ai D.1.j max (pr(b).pr(aj), pr(at).pr(bj)) with D.i.j>0 The skilled person will readily appreciate that other LD calculation methods can be used without undue experimentation.

Linkage disequilibrium among a set of biallelic markers having an adequate heterozygosity rate can be determined by genotyping between 50 and 1000 unrelated individuals, preferably between 75 and 200, more preferably around 100.

4) Testing for association Methods for determining the statistical significance of a correlation between a phenotype and a genotype, in this case an allele at a biallelic marker or a haplotype made up of such alleles, may be determined by any statistical test known in the art and with any accepted threshold of statistical significance being required. The application of particular methods and thresholds of significance are well with in the skill of the ordinary practitioner of the art.

Testing for association is performed by determining the frequency of a biallelic marker allele in case and control populations and comparing these frequencies with a statistical test to W00058510 fhttoltww-a-thenatent.com/Loain.doa/Sexam.suaortFetch/Default.dooNVO005851 0.cpc?fromCache=l part=maintoolbarbotom] Paqe 130 of 737 WO 00/58510 PCT/IB00/00435 128 determine if their is a statistically significant difference in frequency which would indicate a correlation between the trait and the biallelic marker allele under study. Similarly, a haplotype analysis is performed by estimating the frequencies of all possible haplotypes for a given set of biallelic markers in case and control populations, and comparing these frequencies with a statistical test to determine if their is a statistically significant correlation between the haplotype and the phenotype (trait) under study. Any statistical tool useful to test for a statistically significant association between a genotype and a phenotype may be used. Preferably the statistical test employed is a chi-square test with one degree of freedom. A P-value is calculated (the P-value is the probability that a statistic as large or larger than the observed one would occur by chance).

Statistical significance In preferred embodiments, significance for diagnosis purposes, either as a positive basis for further diagnostic tests or as a preliminary starting point for early preventive therapy, the p value related to a biallelic marker association is preferably about 1 x 10-2 or less, more preferably about I x l0' or less, for a single biallelic marker analysis and about I x 10' 3 or less, still more preferably I x 10" or less and most preferably of about I x 10 8 or less, for a haplotype analysis involving several markers. These values are believed to be applicable to any association studies involving single or multiple marker combinations.

The skilled person can use the range of values set forth above as a starting point in order to carry out association studies with biallelic markers of the present invention. In doing so, significant associations between the biallelic markers of the present invention and diseases involving schizophrenia can be revealed and used for diagnosis and drug screening purposes.

Phenotypic permutation In order to confirm the statistical significance of the first stage haplotype analysis described above, it might be suitable to perform further analyses in which genotyping data from case-control individuals are pooled and randomised with respect to the trait phenotype. Each individual genotyping data is randomly allocated to two groups, which contain the same number of individuals as the case-control populations used to compile the data obtained in the first stage. A second stage haplotype analysis is preferably run on these artificial groups, preferably for the markers included in the haplotype of the first stage analysis showing the highest relative risk coefficient. This experiment is reiterated preferably at least between 100 and 10000 times.

The repeated iterations allow the determination of the percentage of obtained haplotypes with a significant p-value level.

Assessment of statistical association W00058510 [http:/w etthepatent.comoin.dog/Sexam.suport/Fetch/DefauIt.dog 10cpcfromCace= art=maintoobarbottom]Page 131 of 737 WO 00/58510 PCT/IB00/00435 129 To address the problem of false positives similar analysis may be performed with the same case-control populations in random genomic regions. Results in random regions and the candidate region are compared as described in US Provisional Patent Application entitled "Methods, software and apparati for identifying genomic regions harbouring a gene associated with a detectable trait".

Evaluation of risk factors The association between a risk factor (in genetic epidemiology the risk factor is the presence or the absence of a certain allele or haplotype at marker loci) and a disease is measured by the odds ratio (OR) and by the relative risk If is the probability of developing the disease for individuals with R and P(R) is the probability for individuals without the risk factor, then the relative risk is simply the ratio of the two probabilities, that is: RR= In case-control studies, direct measures of the relative risk cannot be obtained because of the sampling design. However, the odds ratio allows a good approximation of the relative risk for low-incidence diseases and can be calculated: OR f- F 1-F F-) F' is the frequency of the exposure to the risk factor in cases and F is the frequency of the exposure to the risk factor in controls. F' and F are calculated using the allelic or haplotype frequencies of the study and further depend on the underlying genetic model (dominant, recessive, additive...).

One can further estimate the attributable risk (AR) which describes the proportion of individuals in a population exhibiting a trait due to a given risk factor. This measure is important in quantitating the role of a specific factor in disease etiology and in terms of the public health impact of a risk factor. The public health relevance of this measure lies in estimating the proportion of cases of disease in the population that could be prevented if the exposure of interest were absent. AR is determined as follows: AR=PE(RR-I)/ (PE(RR-I)+I) AR is the risk attributable to a biallelic marker allele or a biallelic marker haplotype. PE is the frequency of exposure to an allele or a haplotype within the population at large; and RR is the relative risk which, is approximated with-the odds ratio when the trait under study has a relatively low incidence in the general population.

AR is the risk attributable to a biallelic marker allele or a biallelic marker haplotype.

PE is the frequency of exposure to an allele or a haplotype within the population at large; and W0005851 0 [http:/Mww.getthepatent.comILo in.dog/Sexam. support[Fetch[Default. dofO005851 0. cpcromCache= 1 part=maintoolbar=botoml Page 132 of 737 WO 00/58510 PCT/IB00/00435 130 RR is the relative risk which, is approximated with the odds ratio when the trait under study has a relatively low incidence in the general population.

Association of Biallelic Markers of the Invention with Schizophrenia In the context of the present invention, an association between chromosome 13q31-q33related biallelic markers, including Region D biallelic markers, and schizophrenia and bipolar disorder were established. Several association studies using different populations and screening samples thereof, and with different sets of biallelic markers distributed on the chromosome 13q31-q33 region and Region D thereof were carried out. Further details concerning these association studies and the results are provided herein in Examples 5a to This information is extremely valuable. The knowledge of a potential genetic predisposition to schizophrenia, even if this predisposition is not absolute, might contribute in a very significant manner to treatment efficacy of schizophrenia and to the development of new therapeutic and diagnostic tools.

Identification Of Biallelic Markers In Linkage Disequilibrium With The Biallelic Markers of the Invention Once a first biallelic marker has been identified in a genomic region of interest, the practitioner of ordinary skill in the art, using the teachings of the present invention, can easily identify additional biallelic markers in linkage disequilibrium with this first marker. As mentioned before, any marker in linkage disequilibrium with a first marker associated with a trait will be associated with the trait. Therefore, once an association has been demonstrated between a given biallelic marker and a trait, the discovery of additional biallelic markers associated with this trait is of great interest in order to increase the density of biallelic markers in this particular region. The causal gene or mutation will be found in the vicinity of the marker or set of markers showing the highest correlation with the trait.

Identification of additional markers in linkage disequilibrium with a given marker involves: amplifying a genomic fragment comprising a first biallelic marker from a plurality of individuals; identifying of second biallelic markers in the genomic region harboring said first biallelic marker; conducting a linkage disequilibrium analysis between said first biallelic marker and second biallelic markers; and selecting said second biallelic markers as being in linkage disequilibrium with said first marker. Subcombinations comprising steps (b) and are also contemplated.

Methods to identify biallelic markers and to conduct linkage disequilibrium analysis are described herein and can be carried out by the skilled person without undue experimentation.

W0005851 0 rhttlwww.getthepatent.com _ogndog$exam.suporfFetchDefault.dog/o00585 1 0.cpc?fromCache=l part=maintoobar=bottom] Page 133 of 737 WO 00/58510 PCT/IB00/00435 131 The present invention then also concerns biallelic markers and other polymorphisms which are in linkage disequilibrium with the specific biallelic markers of the invention and which are expected to present similar characteristics in terms of their respective association with a given trait. In a preferred embodiment, the invnetion concerns biallelic markers which are in linkage disequilibrium with the specific biallelic markers.

Identification Of Functional Mutations Once a positive association is confirmed with a biallelic marker of the present invention, the associated candidate gene sequence can be scanned for mutations by comparing the sequences of a selected number of trait positive and trait negative individuals. In a preferred embodiment, functional regions such as exons and splice sites, promoters and other regulatory regions of the gene are scanned for mutations. Preferably, trait positive individuals carry the haplotype shown to be associated with the trait and trait negative individuals do not carry the haplotype or allele associated with the trait. The mutation detection procedure is essentially similar to that used for biallelic site identification.

The method used to detect such mutations generally comprises the following steps: (a) amplification of a region of the candidate DNA sequence comprising a biallelic marker or a group of biallelic markers associated with the trait from DNA samples of trait positive patients and trait negative controls; sequencing of the amplified region; comparison of DNA sequences from trait-positive patients and trait-negative controls; and determination of mutations specific to trait-positive patients. Subcombinations which comprise steps and (c) are specifically contemplated.

It is preferred that candidate polymorphisms be then verified by screening a larger population of cases and controls by means of any genotyping procedure such as those described herein, preferably using a microsequencing technique in an individual test format.

Polymorphisms are considered as candidate mutations when present in cases and controls at frequencies compatible with the expected association results.

Candidate polymorphisms and mutations of the sbgl nucleic acid sequences suspected of being involved in a predisposition to schizophrenia can be confirmed by screening a larger population of affected and unaffected individuals using any of the genotyping procedures described herein. Preferably the microsequencing technique is used. Such polymorphisms are considered as candidate "trait-causing" mutations when they exhibit a statistically significant correlation with the detectable phenotype.

Biallelic Markers Of The Invention In Methods Of Genetic Diagnostics W00058510 [htto:/'ww.getthepatent. comLo in.dow/Sexam.supportlFetchloefaul.dog/O005851 0cpc?fromCache=1 part=maintoolbar=bottoml Page 134 of 737 WO 00/58510 PCT/IB00/00435 132 The biallelic markers and other polymorphisms of the present invention can also be used to develop diagnostics tests capable of identifying individuals who express a detectable trait as the result of a specific genotype or individuals whose genotype places them at risk of developing a detectable trait at a subsequent time. The trait analyzed using the present diagnostics may be any detectable trait, including predisposition to schizophrenia, age of onset of detectable symptoms, a beneficial response to or side effects related to treatment against schizophrenia. Such a diganosis can be useful in the monitoring, prognosis and/or prophylactic or curative therapy for schizophrenia.

The diagnostic techniques of the present invention may employ a variety of methodologies to determine whether a test subject has a genotype associated with an increased risk of developing a detectable trait or whether the individual suffers from a detectable trait as a result of a particular mutation, including methods which enable the analysis of individual chromosomes for haplotyping, such as family studies, single sperm DNA analysis or somatic hybrids.

The diagnostic techniques concern the detection of specific alleles present within the human chromosome 13q31-q33 region; optionally within the Region D subregion; and optionally within an sbgl, g34665, sbg2, g35017 or g35018 nucleic acid sequence. More particularly, the invention concerns the detection of a nucleic acid comprising at least one of the nucleotide sequences of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or a fragment thereof or a complementary sequence thereto including the polymorphic base.

These methods involve obtaining a nucleic acid sample from the individual and, determining, whether the nucleic acid sample contains at least one allele or at least one biallelic marker haplotype, indicative of a risk of developing the trait or indicative that the individual expresses the trait as a result of possessing a particular the human chromosome 13q31 -q33 region, Region D, sbgl, g34665, sbg2, g35017 or g35018-related polymorphism or mutation (trait-causing allele).

Preferably, in such diagnostic methods, a nucleic acid sample is obtained from the individual and this sample is genotyped using methods described above in "Methods Of Genotyping DNA Samples For Biallelic markers." The diagnostics may be based on a single biallelic marker or a on group of biallelic markers.

In each of these methods, a nucleic acid sample is obtained from the test subject and the biallelic marker pattern of one or more of the biallelic markers of the invention is determined.

In one embodiment, a PCR amplification is conducted on the nucleic acid sample to amplify regions in which polymorphisms associated with a detectable phenotype have been identified. The amplification products are sequenced to determine whether the individual W00058510 [htt wwg ettheatent comogin.dog/$exam.support/FetchDefaut.dogA10005851 0 .cpc?fromCache= 1 part=maintoolbar= bottom] Page 135 of 737 WO 00/58510 PCT/IB00/00435 133 possesses one or more human chromosome 13q31-q33 region, Region D, sbgl, g346 65 sbg2, g35017 or g35018-related polymorphisms associated with a detectable phenotype. The primers used to generate amplification products may comprise the primers listed in Table 6a.

Alternatively, the nucleic acid sample is subjected to microsequencing reactions as described above to determine whether the individual possesses one or more human chromosome 13q31q33 region-related polymorphisms associated with a detectable phenotype resulting from a mutation or a polymorphism in the human chromosome 13q31 -q33 region, Region D, sbg g34 6 65, sbg2, g35017 or g35018-related biallelic marker. The primers used in the microsequencing reactions may include the primers listed in 6d. In another embodiment, the nucleic acid sample is contacted with one or more allele specific oligonucleotide probes which, specifically hybridize to one or more human chromosome 13q31-q33 region, Region D, sbgl, g34665, sbg2, g3501 7 or g35018-related alleles associated with a detectable phenotype. The probes used in the hybridization assay may include the probes listed in Table 6c. In another embodiment, the nucleic acid sample is contacted with a second oligonucleotide capable of producing an amplification product when used with the allele specific oligonucleotide in an amplification reaction. The presence of an amplification product in the amplification reaction indicates that the individual possesses one or more human chromosome 13q31-q33 region, Region D, sbgl, g34665, sbg2, g35017 or g35018-related alleles associated with a detectable phenotype.

In a preferred embodiment the identity of the nucleotide present at, at least one, biallelic marker selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to Al 12, Al 14 to A177, Al79 to A197, A199 to A222, A224 to A246, A250, A251, A253, A255, A259, A266, A268 to A232, A328 to A360 and A361 to A489 and the complements thereof, is determined and the detectable trait is schizophrenia. Diagnostic kits comprise any of the polynucleotides of the present invention.

These diagnostic methods are extremely valuable as they can, in certain circumstances, be used to initiate preventive treatments or to allow an individual carrying a significant haplotype to foresee warning signs such as minor symptoms.

Diagnostics, which analyze and predict response to a drug or side effects to a drug, may be used to determine whether an individual should be treated with a particular drug. For example, if the diagnostic indicates a likelihood that an individual will respond positively to treatment with a particular drug, the drug may be administered to the individual. Conversely, if the diagnostic indicates that an individual is likely to respond negatively to treatment with a particular drug, an alternative course of treatment may be prescribed. A negative response may be defined as either the absence of an efficacious response or the presence of toxic side effects.

W00058510 [htptwww.getthepatent.com/Login.dog/Sexam.suportFetchDefauIt.dog/WOD5851 O.cpc?romCache=1 1art=maintooIbar=bottom]Page 136 of 737 WO 00/58510 PCT/IB00/00435 134 Clinical drug trials represent another application for the markers of the present invention. One or more markers indicative of response to an agent acting against schizophrenia or to side effects to an agent acting against schizophrenia may be identified using the methods described above. Thereafter, potential participants in clinical trials of such an agent may be screened to identify those individuals most likely to respond favorably to the drug and exclude those likely to experience side effects. In that way, the effectiveness of drug treatment may be measured in individuals who respond positively to the drug, without lowering the measurement as a result of the inclusion of individuals who are unlikely to respond positively in the study and without risking undesirable safety problems.

PREVENTION, DIAGNOSIS AND TREATMENT OF PSYCHIATRIC DISEASE An aspect of the present invention relates to the preparation of a medicament for the treatment of psychiatric disease, in particular schizophrenia and bipolar disorder. The present invention embodies medicaments acting on sbgl, g34665, sbg2, g35017 or g35018.

In preferred embodiments, medicaments of the invention act on sbgl, either directly or indirectly, by acting on the sbgl pathways. For example, the medicaments may modulate, and more preferably decrease the level of sbgl activity which occurs in a cell or particular tissue, or increase or descrease the activity of the sbgl protein. In certain embodiments, the invention thus comprises use of a compound capable of increasing or decreasing sbgl expression or sbgl protein activity in the preparation or manufacture of a medicament. Preferably, said compound is used for the treatment of a psychiatric disease, preferably for the treatment of schizophrenia or bipolar disorder. Preferably, said compound acts directly by binding to sbgl or an sbgl receptor.

Such medicaments may also increase or decrease the activity of a compound analogous to sbgl, a compound comprising an amino acid sequence having at least 25% homology to a sequence selected from the group consisting of SEQ ID NOs. 27 to 35, a compound comprising an amino acid sequence having at least 50% homology to a sequence selected from the group consisting of SEQ ID NOs. 27 to 35, and a compound comprising an amino acid sequence having at least 80% homology to a sequence selected from the group consisting of SEQ ID NOs. 27 to Medicaments which increase or descrease the activity of these compounds in an individual may be used to ameliorate or prevent symptoms in individuals suffering from or predisposed to a psychiatric disease, as discussed above in the section entitled "indications".

Alternatively, sbgl activity may be increased or decreasing by the expression of the genes encoding the identified sbgl-modulating compounds using gene therapy. Examples of vectors and promoters suitable for use in gene therapy are described above. Sbgl activity may also be W0005851 0 [htt:www.getthepatent.com/Logig.dog/Sen m.suDporIFetchIDefault.dogNVO005851 0.cpc?fromCache=1 part=maintoolbar=bottom] Page 137 of 737 WO 00/58510 PCT/IB00/00435 135 increased or decreased by preparing an antibody which binds to an sbgl peptide, an sbgl receptor or a protein related thereto, as well as fragments of these proteins. Such antibodies may modulate the interaction between sbgl and an sbgl receptor or a protein related thereto. Antibodies and methods of obtaining them are further described herein.

As described above, the present invention provides cellular assays for identifying compounds for the treatment of psychiatric disease. The assays are based on detection of sbgl expression, measurement of sbgl protein activity, or based on the determination of other suitable schizophrenia, bipolar disorder or related psychiatric disease endpoints. Compounds for the treatment of psychiatric disease include derivative proteins or peptides which are capable of inhibiting the activity of a wild type sbgl protein, which may be identified by determining their ability to bind a wild type sbgl protein. Compounds also include antibodies, and small molecules and drugs which may be obtained using a variety of synthetic approaches familiar to those skilled in the art, including combinatorial chemistry based techniques.

The invention further encompasses said methods for the prevention, treatment, and diagnosis of disease using any of the g34665, sbg2, g35017 or g35018 nucleic acids of proteins of the invention in analogous methods.

Sbgl in Methods of Diagnosis or Detecting Predisposition Individuals affected by or predisposed to schizophrenia and bipolar disorder may express abnormal levels of sbgl, g34665, sbg2, g35017 or g35018. Individuals having increased or decreased sbgl, g34665, sbg2, g35017 or g35018 activity in their plasma, body fluids, or body tissues may be at risk of devloping schizophrenia, bipolar disorder or a variety of potentially related psychiatric conditions. In one aspect of the present invention is a method for determining whether an individual is at risk of suffering from or is currently suffering from schizophrenia, bipolar disorder or other psychotic disorders, mood disorders, autism, substance dependence or alcoholism, mental retardation, or other psychiatric diseases including cognitive, anxiety, eating, impulse-control, and personality disorders, as defined with the Diagnosis and Statistical Manual of Mental Disorders fourth edition (DSM-IV) classification, comprising determining whether the individual has an abnormal level ofsbgl activity in plasma, body fluids, or body tissues. The level ofsbgl or analogous compounds in plasma, body fluids, or body tissues may be determined using a variety approaches. In particular, the level may be determined using ELISA, Western Blots, or protein electrophoresis.

Biallelic Markers Of The Invention In Methods Of Genetic Diagnostics The biallelic markers and other polymorphisms of the present invention can also be used to develop diagnostics tests capable of identifying individuals who express a detectable trait as the result of a specific genotype or individuals whose genotype places them at risk of W0005851 0 [http.itwww.getthepatent.com/LogEloging/Sexam.support/FetchDefault.dog000585 1 0.qpcfromCarche= 1 part=maintooibar-bottoml Page 138 of 737 WO 00/58510 PCT/IB00/00435 136 developing a detectable trait at a subsequent time. The trait analyzed using the present diagnostics may be used to diagnose any detectable trait, including predisposition to schizophrenia or bipolar disorder, age of onset of detectable symptoms, a beneficial response to or side effects related to treatment against schizophrenia or bipolar disorder. Such a diagnosis can be useful in the monitoring, prognosis and/or prophylactic or curative therapy for schizophrenia or bipolar disorder.

These methods involve obtaining a nucleic acid sample from the individual and, determining, whether the nucleic acid sample contains at least one allele or at least one biallelic marker haplotype, indicative of a risk of developing the trait or indicative that the individual expresses the trait as a result of possessing a particular the human chromosome 13q31-q33 region-related polymorphism or mutation (trait-causing allele).

In each of these methods, a nucleic acid sample is obtained from the test subject and the biallelic marker pattern of one or more of a biallelic marker of the invention is determined.

In one embodiment, a PCR amplification is conducted on the nucleic acid sample to amplify regions in which polymorphisms associated with a detectable phenotype have been identified. The amplification products are sequenced to determine whether the individual possesses one or more human chromosome 13q31-q33 region, Region D, sbgl, g34665, sbg2, g35017 or g35018-related polymorphisms associated with a detectable phenotype. The primers used to generate amplification products may comprise the primers listed in Table 6a.

W0005851 0 [httpJ/www~getthepatent.com/Login.dog/Sexam.supportFetchDefault.doNO005851 0.cpc?fromCache= 1 part=maintoolbar=bottom] Page 139 of 737 WO 00/58510 PCT/IB00/00435 137 Alternatively, the nucleic acid sample is subjected to microsequencing reactions as described above to determine whether the individual possesses one or more human chromosome 13q31q33 region, Region D, sbgl, g34665, sbg2, g35 0 1 7 or g35018-related polymorphisms associated with a detectable phenotype resulting from a mutation or a polymorphism in the human chromosome 13q31-q33 region. The primers used in the microsequencing reactions may include the primers listed in Table 6d. In another embodiment, the nucleic acid sample is contacted with one or more allele specific oligonucleotide probes which, specifically hybridize to one or more human chromosome 13q31-q33 region, Region D, sbgl, g34665, sbg2, g35017 or g35018-related alleles associated with a detectable phenotype. The probes used in the hybridization assay may include the probes listed in 6b. In another embodiment, the nucleic acid sample is contacted with a second oligonucleotide capable of producing an amplification product when used with the allele specific oligonucleotide in an amplification reaction. The presence of an amplification product in the amplification reaction indicates that the individual possesses one or more human chromosome 13q31-q33 region, Region D, sbgl, g34665, sbg2, g35017 or g35018-related alleles associated with a detectable phenotype. In a preferred embodiment, the detectable trait is schizophrenia or bipolar disorder. Diagnostic kits comprise any of the polynucleotides of the present invention.

Clinical drug trials represent another application for the markers of the present invention. One or more markers indicative of response to an agent acting against schizophrenia or to side effects to an agent acting against schizophrenia may be identified using the methods described above. Thereafter, potential participants in clinical trials of such an agent may be screened to identify those individuals most likely to respond favorably to the drug and exclude those likely to experience side effects. In that way, the effectiveness of drug treatment may be measured in individuals who respond positively to the drug, without lowering the measurement as a result of the inclusion of individuals who are unlikely to respond positively in the study and W00058510 fhttpnJ/wwwgetihepatent.com/Lagin.dog/exam support/FetchDefauIt.dogNVO005851 O.cpc?fromCache=1D part=maintoolbar--bottom)age 140 of 737 WO 00/58510 PCT/IB00/00435 138 without risking undesirable safety problems.

Prevention And Treatment Of Disease Using Biallelic Markers In large part because of the risk of suicide, the detection of susceptibility to schizophrenia, bipolar disorder as well as other psychiatric disease in individuals is very important. Consequently, the invention concerns a method for the treatment of schizophrenia or bipolar disorder, or a related disorder comprising the following steps: selecting an individual whose DNA comprises alleles of a biallelic marker or of a group of biallelic markers of the human chromosome 13q31-q33 region, preferably Region D-related markers, and more preferably sbgl, g34665, sbg2, g35017 or g35018-related markers associated with schizophrenia or bipolar disorder; following up said individual for the appearance (and optionally the development) of the symptoms related to schizophrenia or bipolar disorder, and administering a treatment acting against schizophrenia or bipolar disorder or against symptoms thereof to said individual at an appropriate stage of the disease.

Another embodiment of the present invention comprises a method for the treatment of schizophrenia or bipolar disorder comprising the following steps: selecting an individual whose DNA comprises alleles of a biallelic marker or of a group of biallelic markers, of the human chromosome 13q31-q33 region, preferably Region Drelated markers, and more preferably sbgl, g34665, sbg2, g35017 or g35018-related markers associated with schizophrenia or bipolar disorder; administering a preventive treatment of schizophrenia or bipolar disorder to said individual.

In a further embodiment, the present invention concerns a method for the treatment of schizophrenia or bipolar disorder comprising the following steps: selecting an individual whose DNA comprises alleles of a biallelic marker or of a group of biallelic markers of the human chromosome 13q3 1-q33, preferably Region D-related markers, and more preferably sbgl, g34665, sbg2, g35017 or g35018-related markers associated with schizophrenia or bipolar disorder; administering a preventive treatment of schizophrenia or bipolar disorder to said individual; following up said individual for the appearance and the development of schizophrenia or bipolar disorder symptoms; and optionally administering a treatment acting against schizophrenia or bipolar disorder or against symptoms thereof to said individual at the appropriate stage of the disease.

For use in the determination of the course of treatment of an individual suffering from disease, the present invention also concerns a method for the treatment of schizophrenia or W00058510 [httQJMww etthepatent.com[Login doglSexam.suport/Fetchefault.dog/W0005851 0.cpc?fromcac*-e=1 part=maintoolbar=bottom] Page 141 of 737 WO 00/58510 PCT/IB00/00435 139 bipolar disorder comprising the following steps: selecting an individual suffering from schizophrenia or bipolar disorder whose DNA comprises alleles of a biallelic marker or of a group of biallelic markers of the human chromosome 13q31-q33 region, preferably Region D-related markers, and preferably sbgl, g34665, sbg2, g3501 7 or g35018-related markers, associated with the gravity of schizophrenia or bipolar disorder or of the symptoms thereof; and administering a treatment acting against schizophrenia or bipolar disorder or symptoms thereof to said individual.

The invention also concerns a method for the treatment of schizophrenia or bipolar disorder in a selected population of individuals. The method comprises: selecting an individual suffering from schizophrenia or bipolar disorder and whose DNA comprises alleles of a biallelic marker or of a group of biallelic markers of the human chromosome 13q31-q33 region, preferably Region D-related markers, and more preferably sbgl, g34665, sbg2, g35017 or g35018-related markers associated with a positive response to treatment with an effective amount of a medicament acting against schizophrenia or bipolar disorder or symptoms thereof, and/or whose DNA does not comprise alleles of a biallelic marker or of a group of biallelic markers of the human chromosome 13q31-q33 region, preferably Region D-related markers, and more preferably sbgl, g34665, sbg2, g35017 or g35018-related markers associated with a negative response to treatment with said medicament; and administering at suitable intervals an effective amount of said medicament to said selected individual.

In the context of the present invention, a "positive response" to a medicament can be defined as comprising a reduction of the symptoms related to the disease. In the context of the present invention, a "negative response" to a medicament can be defined as comprising either a lack of positive response to the medicament which does not lead to a symptom reduction or which leads to a side-effect observed following administration of the medicament.

The invention also relates to a method of determining whether a subject is likely to respond positively to treatment with a medicament. The method comprises identifying a first population of individuals who respond positively to said medicament and a second population of individuals who respond negatively to said medicament. One or more biallelic markers is identified in the first population which is associated with a positive response to said medicament or one or more biallelic markers is identified in the second population which is associated with a negative response to said medicament. The biallelic markers may be identified using the techniques described herein.

W0005851 0 rhttPp.www. getthepatent.comILogin.dog/SexamsupportFetch/Default.dogNWO005851 0.cpcfromCactle=1 part=maintoolbar-bottom]Pag e 142 of 737 WO 00/58510 PCT/IB00/00435 140 A DNA sample is then obtained from the subject to be tested. The DNA sample is analyzed to determine whether it comprises alleles of one or more biallelic markers associated with a positive response to treatment with the medicament and/or alleles of one or more biallelic markers associated with a negative response to treatment with the medicament.

In some embodiments, the medicament may be administered to the subject in a clinical trial if the DNA sample contains alleles of one or more biallelic markers associated with a positive response to treatment with the medicament and/or if the DNA sample lacks alleles of one or more biallelic markers associated with a negative response to treatment with the medicament. In preferred embodiments, the medicament is a drug acting against schizophrenia or bipolar disorder.

Using the method of the present invention, the evaluation of drug efficacy may be conducted in a population of individuals likely to respond favorably to the medicament.

Another aspect of the invention is a method of using a medicament comprising obtaining a DNA sample from a subject, determining whether the DNA sample contains alleles of one or more biallelic markers associated with a positive response to the medicament and/or whether the DNA sample contains alleles of one or more biallelic markers associated with a negative response to the medicament, and administering the medicament to the subject if the DNA sample contains alleles of one or more biallelic markers associated with a positive response to the medicament and/or if the DNA sample lacks alleles of one or more biallelic markers associated with a negative response to the medicament.

The invention also concerns a method for the clinical testing of a medicament, preferably a medicament acting against schizophrenia or or bipolar disorder or symptoms thereof. The method comprises the following steps: administering a medicament, preferably a medicament susceptible of acting against schizophrenia or or bipolar disorder or symptoms thereof to a heterogeneous population of individuals, identifying a first population of individuals who respond positively to said medicament and a second population of individuals who respond negatively to said medicament, identifying biallelic markers in said first population which are associated with a positive response to said medicament, selecting individuals whose DNA comprises biallelic markers associated with a positive response to said medicament, and administering said medicament to said individuals.

In any of the methods for the prevention, diagnosis and treatment of schizophrenia and W0005851 0 [httpJtwww.getthepatentcom/Login.dog/Sexam.spptechffuldgiO 58 1p.g~rmale art=ma intoolba r--bottom1 Page 143 of 737 WO 00/58510 PCTIBOOIOO435 141 bipolar disorder, including methods of using a medicament, clinical testing of a medicament determining whether a subject is likely to respond positively to treatment with a medicament, said biallelic marker may optionally comprise: a biallelic marker selected from the group consisting of biallelic markers AlI to A489; a biallelic marker selected from the group consisting of biallelic markers Al to A69, A71 to A74, A76 to A94, A96 to A106, A108toAl123 Al14 to A77, A179 toA197, A199 to A222, A224 to A242, A250 to A25 1, A259 A269 to A270, A278, A285 to A295, A303 to A307, A330, A334 to A335 and A346 to 357; a biallelic marker selected from the group consisting of biallelic markers AlI to A69, A71 to A74, A76 to A94, A96 toAlO6, AlOSto Al12, A114to A177, A179to A197, A199to A222, A224 to A246, A250, A251, A253, A255, A259, A266, A268 to A232 and A328 to A489; a biallelic marker selected from the group consisting of sbgl-related markers A85 to A219, or more preferably a biallelic marker selected from the group consisting of sbgl -related markers A85 to A94, A96to A106, A08to Al2, Al14 to A177, A179 to A197and A199 to A219; a biallelic marker selected from the group consisting of g34665-related markers A230 to A236; a biallelic marker selected from the group consisting of sbg2-related markers A79 to A99; the g35017-related biallelic marker A41; a biallelic marker selected from the group consisting of i35018-related markers AlI to A39; a biallelic marker selected from the group consisting of A239, A227, A 198, A228, A223, A 107, A218, A270, A75, A62, A65 and a biallelic marker selected from the group consisting of A48, A60, A61, A62, A75, A76, A80, A107, A108, A198, A218, A221, A223, A227, A228, A239, A285, A286, A2S7, A288, A290, A292, A293, A295,A299 and A304; a biallelic marker selected from the group consisting of A304, A307, A305, A298, A292, A293, A29 1, A287, A286, A288, A289, A290, 99- A295 A299. A24 1, A23 9, A228, A227, A223, A22 1, A218, Al198, A 178, 99-24649/186 A 108 A 107, A80, A75, A70, A65, and A62; and/or a biallelic marker selected from the group consisting of A304, A307, A305, A298, A292, A293, A29 1, A287, A286, A288, A289, A290, A295 A299, A24 1, A239, A228, A227, W00058510 IhttoJ.wwgetthepatent.com/Login .dogSexam. supportfFetchDefauIt.dogNVO005851 0.cpc?fromCache= 1 part=maintoolbar=bottom] Page 144 of 737 WO 00/58510 PCT/IB00/00435 142 A223, A221, A218, A198, A178, A108, A107, A80, A76, A75, A70, A65, A62, A61, A48.

Such methods are deemed to be extremely useful to increase the benefit/risk ratio resulting from the administration of medicaments which may cause undesirable side effects and/or be inefficacious to a portion of the patient population to which it is normally administered.

Once an individual has been diagnosed as suffering from schizophrenia or bipolar disorder, selection tests are carried out to determine whether the DNA of this individual comprises alleles of a biallelic marker or of a group of biallelic markers associated with a positive response to treatment or with a negative response to treatment which may include either side effects or unresponsiveness.

The selection of the patient to be treated using the method of the present invention can be carried out through the detection methods described above. The individuals which are to be selected are preferably those whose DNA does not comprise alleles of a biallelic marker or of a group of biallelic markers associated with a negative response to treatment. The knowledge of an individual's genetic predisposition to unresponsiveness or side effects to particular medicaments allows the clinician to direct treatment toward appropriate drugs against schizophrenia or bipolar disorder or symptoms thereof.

Once the patient's genetic predispositions have been determined, the clinician can select appropriate treatment for which negative response, particularly side effects, has not been reported or has been reported only marginally for the patient.

The biallelic markers of the invention have demonstrated an association with schizophrenia and bipolar disorders. However, the present invention also comprises any of the prevention, diagnostic, prognosis and treatment methods described herein using the biallelic markers of the invention in methods of preventing, diagnosing, managing and treating related disorders, particularly related CNS disorders. By way of example, related disorders may comprise psychotic disorders, mood disorders, autism, substance dependence and alcoholism, mental retardation, and other psychiatric diseases including cognitive, anxiety, eating, impulse-control, and personality disorders, as defined with the Diagnosis and Statistical Manual of Mental Disorders fourth edition (DSM-IV) classification".

Recombinant Vectors The term "vector" is used herein to designate either a circular or a linear DNA or RNA molecule, which is either double-stranded or single-stranded, and which comprise at least one polynucleotide of interest that is sought to be transferred in a cell host or in a unicellular or multicellular host organism.

W00058510 [httn:llwww.getthepatent.com/Login.dog/Sexam.supportlFetch/efault.dogNVO005851 0.cpc?fromCache=1 part=maintoolbar= bottoml Page 145 of 737 WO 00/58510 PCT/IB00/00435 143 The present invention encompasses a family of recombinant vectors that comprise a polynucleotide derived from an sbgl, g34665, sbg2, g35017 or g35018 nucleic acid sequence.

Consequently, the present invention further comprises recombinant vectors comprising: sbgl genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 215819 to 215941, 215819 to 215975, 21 66 6 1 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685 and 240800 to 240993 of SEQ ID No. 1, SEQ ID Nos 2 to 26 and primate sbgl DNAs of SEQ ID Nos 54 to 111, and the complements thereof; g3 4 665 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 292653 to 292841, 295555 to 296047 and 295580 to 296047 of SEQ ID No. 1, and the complements thereof; sbg2 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 201188 to 201234, 214676 to 214793, 215702 to 21 5 746 and 21 6 836 to 2 169 15 of SEQ ID No. 1, and the complements thereof; g35017 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 94124 to 94964 of SEQ ID No. 1, and the complements thereof; g35018 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, and 65505 to 65853 of SEQ ID No. 1, and the complements thereof.

Generally, a recombinant vector of the invention may comprise any of the polynucleotides described herein, as well as any sbgl, g34665, sbg2, g35017 or g35018 primer or probe as defined above.

In a first preferred embodiment, a recombinant vector of the invention is used to amplify the inserted polynucleotide derived from an sbgl, g34665, sbg2, g35017 or g35018 genomic sequence or cDNA of the invention in a suitable cell host, this polynucleotide being amplified at every time that the recombinant vector replicates.

A second preferred embodiment of the recombinant vectors according to the invention comprises expression vectors comprising either a regulatory polynucleotide or a coding nucleic acid of the invention, or both. Within certain embodiments, expression vectors are employed to express an sbgl, g34665, sbg2, g35017 or g35018 polypeptide which can be then purified and, for example be used in ligand screening assays or as an immunogen in order to raise specific W0005851 0 [http:/Awwgefthe atentcom/Login.dog/Sexam.suportIFetchIDefauIt.dogNO005851 0.cPc?fromCache= 1 part=maintobar-bottoml Page 146 of 737 WO 00/58510 PCT/IB00/00435 144 antibodies directed against an sbgl, g34665, sbg2, g35017 or g35018 protein. In other embodiments, the expression vectors are used for constructing transgenic animals and also for gene therapy. Expression requires that appropriate signals are provided in the vectors, said signals including various regulatory elements, such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in host cells. Dominant drug selection markers for establishing permanent, stable cell clones expressing the products are generally included in the expression vectors of the invention, as they are elements that link expression of the drug selection markers to expression of the polypeptide.

More particularly, the present invention relates to expression vectors which include nucleic acids encoding an sbgl, g34665, sbg2, g35017 or g35018 protein or variants or fragments thereof, under the control of a regulatory sequence of the respective sbgl, g34665, sbg2, g35017 or g35018 regulatory polynucleotides, or alternatively under the control of an exogenous regulatory sequence.

The invention also pertains to a recombinant expression vector useful for the expression of a sbgl, g346 6 5 sbg2, g35017 or g35018 cDNA sequence.

Recombinant vectors comprising a nucleic acid containing a human chromosome 13q31-33-related biallelic marker, preferably a Region D-related biallelic marker or more preferably an sbgl-, g34665-, sbg2-, g35017- or g35018-related biallelic marker is also part of the invention. In a preferred embodiment, said biallelic marker is selected from the group consisting of Al to A489, and the complements thereof.

Some of the elements which can be found in the vectors of the present invention are described in further detail in the following sections.

1. General features of the expression vectors of the invention A recombinant vector according to the invention comprises, but is not limited to, a YAC (Yeast Artificial Chromosome), a BAC (Bacterial Artificial Chromosome), a phage, a phagemid, a cosmid, a plasmid or even a linear DNA molecule which may comprise a chromosomal, non-chromosomal, semi-synthetic and synthetic DNA. Such a recombinant vector can comprise a transcriptional unit comprising an assembly of: a genetic element or elements having a regulatory role in gene expression, for example promoters or enhancers. Enhancers are cis-acting elements of DNA, usually from about 10 to 300 bp in length that act on the promoter to increase the transcription.

a structural or coding sequence which is transcribed into mRNA and eventually translated into a polypeptide, said structural or coding sequence being operably linked to the regulatory elements described in and appropriate transcription initiation and termination sequences. Structural units W00058510 _t!qpJt-ww0get5hepatent.comlogin.dogm S e 8510.cpc?fromCache=l 1art=maintoolbar--bottom] Page 147 of 737 w1ww. ettheptent.com/o-qifdoq$exacsuorVltch/efautf o _E WO 00/58510 PCT/IB00/00435 145 intended for use in yeast or eukaryotic expression systems preferably include a leader sequence enabling extracellular secretion of translated protein by a host cell. Alternatively, when a recombinant protein is expressed without a leader or transport sequence, it may include a Nterminal residue. This residue may or may not be subsequently cleaved from the expressed recombinant protein to provide a final product.

Generally, recombinant expression vectors will include origins of replication, selectable markers permitting transformation of the host cell, and a promoter derived from a highly expressed gene to direct transcription of a downstream structural sequence. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably a leader sequence capable of directing secretion of the translated protein into the periplasmic space or the extracellular medium. In a specific embodiment wherein the vector is adapted for transfecting and expressing desired sequences in mammalian host cells, preferred vectors will comprise an origin of replication in the desired host, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5'-flanking nontranscribed sequences. DNA sequences derived from the SV40 viral genome, for example origin, early promoter, enhancer, splice and polyadenylation sites may be used to provide the required non-transcribed genetic elements.

The in vivo expression of an sbgl, g34665, sbg2, g35017 or g35018 polypeptide or fragments or variants thereof may be useful in order to correct a genetic defect related to the expression of the native gene in a host organism or to the production of a biologically inactive sbgl, g34665, sbg2, g35017 or g35018 protein.

Consequently, the present invention also comprises recombinant expression vectors mainly designed for the in vivo production of the sbgl, g34665, sbg2, g35017 or g35018 polypeptide by the introduction of the appropriate genetic material in the organism of the patient to be treated. In preferred embodiments, said genetic material comprises at least one nucleotide sequence selected from the group of nucleotide posittion ranges consisting of: sbgl genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 215819 to 215941, 215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685 and 240800 to 240993 of SEQ ID No. I, SEQ ID Nos 2 to 26 and primate sbgl DNAs of SEQ ID Nos. 54 to 111, and the complements thereof; W0005851 0 rhttDJlAw.getthepatent.com/Login.dog/Sexam.supportiFetchDefaut.dogNVO005851 O.cpcfromCache= 1 part=maintoolbar=bottom Page 148 of 737 WO 00/58510 PCT/IB00/00435 146 g34665 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 292653 to 292841, 295555 to 296047 and 295580 to 296047 of SEQ ID No. 1, and the complements thereof; sbg2 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 2169 1 5 of SEQ ID No. I, and the complements thereof; g3501 7 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 94124 to 94964 of SEQ ID No. 1, and the complements thereof; and g35018 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, and 65505 to 65853 of SEQ ID No. 1, and the complements thereof.

This genetic material may be introduced in vitro in a cell that has been previously extracted from the organism, the modified cell being subsequently reintroduced in the said organism, directly in vivo into the appropriate tissue.

2. Regulatory Elements Promoters The suitable promoter regions used in the expression vectors according to the present invention are chosen taking into account the cell host in which the heterologous gene has to be expressed. The particular promoter employed to control the expression of a nucleic acid sequence of interest is not believed to be important, so long as it is capable of directing the expression of the nucleic acid in the targeted cell. Thus, where a human cell is targeted, it is preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of being expressed in a human cell, such as, for example, a human or a viral promoter.

A suitable promoter may be heterologous with respect to the nucleic acid for which it controls the expression or alternatively can be endogenous to the native polynucleotide containing the coding sequence to be expressed. Additionally, the promoter is generally heterologous with respect to the recombinant vector sequences within which the construct promoter/coding sequence has been inserted.

Promoter regions can be selected from any desired gene using, for example, CAT (chloramphenicol transferase) vectors and more preferably pKK232-8 and pCM7 vectors.

Preferred bacterial promoters are the Lad, LacZ, the T3 or T7 bacteriophage RNA polymerase promoters, the gpt, lambda PR, PL and trp promoters (EP 0036776), the polyhedrin promoter, or the p10 protein promoter from baculovirus (Kit Novagen) (Smith et al., 1983; W00058510 [httpQJww w .getthepatent.comLogindog/Sexam.support/Fetch/DefauItfdoqNVO005851.pc?fromlCache=1pgart=maintoolbar--botom] Page 149 of 737 WO 00/58510 PCT/IB00/00435 147 O'Reilly et al., 1992), the lambda PR promoter or also the trc promoter.

Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-L. Selection of a convenient vector and promoter is well within the level of ordinary skill in the art.

The choice of a promoter is well within the ability of a person skilled in the field of genetic engineering. For example, one may refer to the book of Sambrook et al.(1989) or also to the procedures described by Fuller et al.(1996).

Other regulatory elements One will typically desire to include a polyadenylation signal to effect proper polyadenylation of the gene transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed such as human growth hormone and SV40 polyadenylation signals. Also contemplated as an element of the expression cassette is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.

The vector containing the appropriate DNA sequence as described above, more preferably an sbgl gene regulatory polynucleotide, a polynucleotide encoding an sbgl, g34665, sbg2, g35017 or g35018 polypeptide comprising at least one nucleotide sequence selected from the group of nucleotide sequence ranges consisting of: sbgl genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 215819 to 215941, 215 8 19 to 21 59 75, 21 666 1 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685 and 240800 to 240993 of SEQ ID No. 1, SEQ ID Nos 2 to 26 and primate sbgl DNAs or SEQ ID Nos. 54 to 111, and the complements thereof; g34665 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 292653 to 292841, 295555 to 296047 and 295580 to 296047 of SEQ ID No. 1, and the complements thereof; sbg2 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915 of SEQ ID No. 1, and the complements thereof; g35017 genomic DNA or cDNAs comprised in the nucleic acids of any of nucleotide positions 94124 to 94964 of SEQ ID No. 1, and the complements thereof; g35018 genomic DNA or cDNAs comprised in the nucleic acids of any of W00058510 fhtto:/twww.getthepatent.comLgiin.dog/$exam sup prtIFetchIDefau.dogMV00585 .cvc?fromCare= 1 part=maintoolbar-bottom] Page 150 of 737 WO 00/58510 PCT/IB00/00435 148 nucleotide positions 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, and 65505 to 65853 of SEQ ID No. 1, and the complements thereof.

3. Selectable Markers Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression construct. The selectable marker genes for selection of transformed host cells are preferably dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, TRP1 for S. cerevisiae or tetracycline, rifampicin or ampicillin resistance in E. coli, or levan saccharase for mycobacteria, this latter marker being a negative selection marker.

4. Preferred Vectors.

Bacterial vectors As a representative but non-limiting example, useful expression vectors for bacterial use can comprise a selectable marker and a bacterial origin of replication derived from commercially available plasmids comprising genetic elements of pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia, Uppsala, Sweden), and GEMI (Promega Biotec, Madison, WI, USA).

Large numbers of other suitable vectors are known to those of skill in the art, and commercially available, such as the following bacterial vectors: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX 174, pbluescript SK, pbsks, pNH8A, pNH 6A, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS (Pharmacia); pWLNEO, pSV2CAT, pOG44, pXTI, pSG (Stratagene); pSVK3, pBPV, pMSG, pSVL (Pharmacia); pQE-30 (QIAexpress).

Bacteriophage vectors The PI bacteriophage vector may contain large inserts ranging from about 80 to about 100 kb.

The construction of P bacteriophage vectors such as p158 or p 158/neo8 are notably described by Sternberg (1992, 1994). Recombinant P1 clones comprising sbgl polynucleotide sequences may be designed for inserting large polynucleotides of more than 40 kb (Linton et al., 1993). To generate Pl DNA for transgenic experiments, a preferred protocol is the protocol described by McCormick et al.(1994). Briefly, E. coli (preferably strain NS3529) harboring the Pl plasmid are grown overnight in a suitable broth medium containing 25 Pg/ml of kanamycin.

The Pl DNA is prepared from the E. coli by alkaline lysis using the Qiagen Plasmid Maxi kit (Qiagen, Chatsworth, CA, USA), according to the manufacturer's instructions. The P1 DNA is purified from the bacterial lysate on two Qiagen-tip 500 columns, using the washing and elution W00058510 [http:/tww.getthepatent.romLoin.docSexam.suopmortFetchDefault.dogWO05851 0.cpcfromGaChe= 1 part=maintoolbar-bottom] Page 151 of 737 WO 00/58510 PCT/IB00/00435 149 buffers contained in the kit. A phenol/chloroform extraction is then performed before precipitating the DNA with 70% ethanol. After solubilizing the DNA in TE (10 mM Tris-HCI, pH 7.4, 1 mM EDTA), the concentration of the DNA is assessed by spectrophotometry.

When the goal is to express a PI clone comprising an sbgl polynucleotide sequence in a transgenic animal, typically in transgenic mice, it is desirable to remove vector sequences from the PI DNA fragment, for example by cleaving the PI DNA at rare-cutting sites within the P1 polylinker (Sfil, NotI or Sall). The PI insert is then purified from vector sequences on a pulsed-field agarose gel, using methods similar using methods similar to those originally reported for the isolation of DNA from YACs (Schedl et al., 1993a; Peterson et al., 1993, At this stage, the resulting purified insert DNA can be concentrated, if necessary, on a Millipore Ultrafree-MC Filter Unit (Millipore, Bedford, MA, USA 30,000 molecular weight limit) and then dialyzed against microinjection buffer (10 mM Tris-HCI, pH 7.4; 250 pM EDTA) containing 100 mM NaCI, 30 pM spermine, 70 pM spermidine on a microdyalisis membrane (type VS, 0.025 pM from Millipore). The intactness of the purified PI DNA insert is assessed by electrophoresis on 1% agarose (Sea Kern GTG; FMC Bio-products) pulse-field gel and staining with ethidium bromide.

Baculovirus vectors A suitable vector for the expression of an sbgl polypeptide encoded by polynucleotides of SEQ ID No. 1 or fragments or variants thereof is a baculovirus vector that can be propagated in insect cells and in insect cell lines. A specific suitable host vector system is the pVL1392/1393 baculovirus transfer vector (Pharmingen) that is used to transfect the SF9 cell line (ATCC NOCRL 1711) which is derived from Spodopterafrugiperda.

Other suitable vectors for the expression of the sbgl polypeptide encoded by the SEQ ID No. 1 or fragments or variants thereof in a baculovirus expression system include those described by Chai et al.(1993), Vlasak et al.(1983) and Lenhard et al.(1996).

Viral vectors In one specific embodiment, the vector is derived from an adenovirus. Preferred adenovirus vectors according to the invention are those described by Feldman and Steg (1996) or Ohno et al.(1994). Another preferred recombinant adenovirus according to this specific embodiment of the present invention is the human adenovirus type 2 or 5 (Ad 2 or Ad 5) or an adenovirus of animal origin (French patent application N* FR-93.05954).

Retrovirus vectors and adeno-associated virus vectors are generally understood to be the recombinant gene delivery systems of choice for the transfer of exogenous polynucleotides in vivo, particularly to mammals, including humans. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal W00058510 [httpi/wwwgetthepatet.com/Login.dog/Sexam supportlFetch/Default.dogAN000585 1 O.cpcfromCache=1 part=maintoolbar=botomPage 152 of737 WO 00/58510 PCT/IB00/00435 150 DNA of the host.

Particularly preferred retroviruses for the preparation or construction of retroviral in vitro or in vitro gene delivery vehicles of the present invention include retroviruses selected from the group consisting of Mink-Cell Focus Inducing Virus, Murine Sarcoma Virus, Reticuloendotheliosis virus and Rous Sarcoma virus. Particularly preferred Murine Leukemia Viruses include the 4070A and the 1504A viruses, Abelson (ATCC No VR-999), Friend (ATCC No VR-245), Gross (ATCC No VR-590), Rauscher (ATCC No VR-998) and Moloney Murine Leukemia Virus (ATCC No VR-190; PCT Application No WO 94/24298). Particularly preferred Rous Sarcoma Viruses include Bryan high titer (ATCC Nos VR-334, VR-657, VR- 726, VR-659 and VR-728). Other preferred retroviral vectors are those described in Roth et al.(1996), PCT Application No WO 93/25234, PCT Application No WO 94/ 06920, Roux et al., 1989, Julan et al., 1992 and Neda et al., 1991.

Yet another viral vector system that is contemplated by the invention comprises the adeno-associated virus (AAV). The adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle (Muzyczka et al., 1992). It is also one of the few viruses that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable integration (Flotte et al., 1992; Samulski et al., 1989; McLaughlin et al., 1989). One advantageous feature of AAV derives from its reduced efficacy for transducing primary cells relative to transformed cells.

BAC vectors The bacterial artificial chromosome (BAC) cloning system (Shizuya et al., 1992) has been developed to stably maintain large fragments ofgenomic DNA (100-300 kb) in E. coli. A preferred BAC vector comprises pBeloBAC 11 vector that has been described by Kim et al.(1996). BAC libraries are prepared with this vector using size-selected genomic DNA that has been partially digested using enzymes that permit ligation into either the Bar HI or HindIII sites in the vector. Flanking these cloning sites are T7 and SP6 RNA polymerase transcription initiation sites that can be used to generate end probes by either RNA transcription or PCR methods. After the construction of a BAC library in E. coli, BAC DNA is purified from the host cell as a supercoiled circle. Converting these circular molecules into a linear form precedes both size determination and introduction of the BACs into recipient cells. The cloning site is flanked by two Not I sites, permitting cloned segments to be excised from the vector by Not I digestion. Alternatively, the DNA insert contained in the pBeloBACI 1 vector may be linearized by treatment of the BAC vector with the commercially available enzyme lambda terminase that leads to the cleavage at the unique cosN site, but this cleavage method results in a W00058510 rhuD:/Mwwwgelhe patent.comfLoqin Aog/Sexam.suportlFetch/Defa ult. d oqmv05851 0.cpcfromCache= 1 Dart=maintoo bar-botomlPage 153 of 737 WO 00/58510 PCT/IB00/00435 151 full length BAC clone containing both the insert DNA and the BAC sequences.

Delivery Of The Recombinant Vectors In order to effect expression of the polynucleotides and polynucleotide constructs of the invention, these constructs must be delivered into a cell. This delivery may be accomplished in vitro, as in laboratory procedures for transforming cell lines, or in vivo or ex vivo, as in the treatment of certain diseases states.

One mechanism is viral infection where the expression construct is encapsulated in an infectious viral particle.

Several non-viral methods for the transfer of polynucleotides into cultured mammalian cells are also contemplated by the present invention, and include, without being limited to, calcium phosphate precipitation (Graham et al., 1973; Chen et al., 1987), DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al., 1986; Potter et al., 1984), direct microinjection (Harland et al., 1985), DNA-loaded liposomes (Nicolau et al., 1982; Fraley et al., 1979), and receptor-mediate transfection (Wu and Wu, 1987; 1988). Some of these techniques may be successfully adapted for in vivo or ex vivo use.

Once the expression polynucleotide has been delivered into the cell, it may be stably integrated into the genome of the recipient cell. This integration may be in the cognate location and orientation via homologous recombination (gene replacement) or it may be integrated in a random, non specific location (gene augmentation). In yet further embodiments, the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle.

One specific embodiment for a method for delivering a protein or peptide to the interior of a cell of a vertebrate in vivo comprises the step of introducing a preparation comprising a physiologically acceptable carrier and a naked polynucleotide operatively coding for the polypeptide of interest into the interstitial space of a tissue comprising the cell, whereby the naked polynucleotide is taken up into the interior of the cell and has a physiological effect. This is particularly applicable for transfer in vitro but it may be applied to in vivo as well.

Compositions for use in vitro and in vivo comprising a "naked" polynucleotide are described in PCT application N° WO 90/11092 (Vical Inc.) and also in PCT application No.

WO 95/11307 (Institut Pasteur, INSERM, Universitt d'Ottawa) as well as in the articles of Tacson et al.(1996) and of Huygen et al.(1996).

In still another embodiment of the invention, the transfer of a naked polynucleotide of the invention, including a polynucleotide construct of the invention, into cells may be proceeded with a particle bombardment (biolistic), said particles being DNA-coated microprojectiles W00058510 [http:/t www.ge tthepatent.comLogin.dog/Sexam.supportFetchDefaut.dog/WOU5651 u.gctromLaCtle 1 part=malntoolbarbotto] Page 154 o 737 WO 00/58510 PCT/IB00/00435 152 accelerated to a high velocity allowing them to pierce cell membranes and enter cells without killing them, such as described by Klein et al.(1987).

In a further embodiment, the polynucleotide of the invention may be entrapped in a liposome (Ghosh and Bacchawat, 1991; Wong et al., 1980; Nicolau et al., 1987).

In a specific embodiment, the invention provides a composition for the in vivo production of the sbgl, g34665, sbg2, g35017 and g35018 protein or polypeptide described herein. It comprises a naked polynucleotide operatively coding for this polypeptide, in solution in a physiologically acceptable carrier, and suitable for introduction into a tissue to cause cells of the tissue to express the said protein or polypeptide.

The amount of vector to be injected to the desired host organism varies according to the site of injection. As an indicative dose, it will be injected between 0,1 and 100 Pg of the vector in an animal body, preferably a mammal body, for example a mouse body.

In another embodiment of the vector according to the invention, it may be introduced in vitro in a host cell, preferably in a host cell previously harvested from the animal to be treated and more preferably a somatic cell such as a muscle cell. In a subsequent step, the cell that has been transformed with the vector coding for the desired sbgl polypeptide or the desired fragment thereof is reintroduced into the animal body in order to deliver the recombinant protein within the body either locally or systemically.

Cell Hosts Another object of the invention comprises a host cell that have been transformed or transfected with one of the polynucleotides described herein, and more precisely a polynucleotide comprising an sbgl polynucleotide selected from the group consisting of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229, or a fragment or a variant thereof. Are included host cells that are transformed (prokaryotic cells) or that are transfected (eukaryotic cells) with a recombinant vector such as one of those described above.

Generally, a recombinant host cell of the invention comprises any one of the polynucleotides or the recombinant vectors described therein.

Preferred host cells used as recipients for the expression vectors of the invention are the following: a) Prokaryotic host cells: Escherichia coli strains (I.E.DHS-a strain), Bacillus subtilis, Salmonella typhimurium, and strains from species like Pseudomonas, Streptomyces and Staphylococcus.

b) Eukaryotic host cells: HeLa cells (ATCC NOCCL2; N°CCL2.1; NOCCL2.2), Cv 1 cells (ATCC NOCCL70), COS cells (ATCC NOCRL1650; NoCRL1651), Sf-9 cells (ATCC N°CRL1711), C127 cells (ATCC No CRL-1804), 3T3 (ATCC NO CRL-6361), CHO (ATCC No W0005851 0 rhILp~Jwww.gettheatent.com/Loin .dogSexam.supportFetch/Default.dogdw005851 0. cpc?fromCache= 1 part=maintaolba r=bottom] Page 155 of 737 WO 00/58510 PCT/IBOO/00435 153 CCL-61), human kidney 293. (ATCC N° 45504; NO CRL-1573) and BHK (ECACC N 0 84100501; N O 84111301).

c) Other mammalian host cells.

Sbgl, g3 4 66 5 sbg2, g35017 and g35018 gene expression in mammalian, and typically human, cells may be rendered defective with the replacement of an sbgl nucleic acid counterpart in the genome of an animal cell by an sbgl polynucleotide according to the invention. These genetic alterations may be generated by homologous recombination events using specific DNA constructs that have been previously described.

One kind of cell hosts that may be used are mammal zygotes, such as murine zygotes.

For example, murine zygotes may undergo microinjection with a purified DNA molecule of interest, for example a purified DNA molecule that has previously been adjusted to a concentration range from 1 ng/ml -for BAC inserts- 3 ng/pl -for P1 bacteriophage inserts- in mM Tris-HCI, pH 7.4, 250 pM EDTA containing 100 mM NaCI, 30 pM spermine, and70 pM spermidine. When the DNA to be microinjected has a large size, polyamines and high salt concentrations can be used in order to avoid mechanical breakage of this DNA, as described by Schedl et al (1993b).

Any of the polynucleotides of the invention, including the DNA constructs described herein, may be introduced in an embryonic stem (ES) cell line, preferably a mouse ES cell line.

ES cell lines are derived from pluripotent, uncommitted cells of the inner cell mass of preimplantation blastocysts. Preferred ES cell lines are the following: ES-E14TG2a (ATCC n° CRL-1821), ES-D3 (ATCC n° CRL1934 and n° CRL-11632), YS001 (ATCC n° CRL-11776), 36.5 (ATCC nO CRL- 1116). To maintain ES cells in an uncommitted state, they are cultured in the presence of growth inhibited feeder cells which provide the appropriate signals to preserve this embryonic phenotype and serve as a matrix for ES cell adherence. Preferred feeder cells are primary embryonic fibroblasts that are established from tissue of day 13- day 14 embryos of virtually any mouse strain, that are maintained in culture, such as described by Abbondanzo et al.(1993) and are inhibited in growth by irradiation, such as described by Robertson (1987), or by the presence of an inhibitory concentration of LIF, such as described by Pease and Williams (1990).

The constructs in the host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.

Following transformation of a suitable host and growth of the host to an appropriate cell density, the selected promoter is induced by appropriate means, such as temperature shift or chemical induction, and cells are cultivated for an additional period.

Cells are typically harvested by centrifugation, disrupted by physical or chemical W00058510 [http: Jtww.getthepatent.com/Login .dog/Sexam.supportFetchDefauIt.do NV00U5851 0.cpc?tromCache=l part=maintolbar=bottoml Page 1 56t737 WO 00/58510 PCT/IB00/00435 154 means, and the resulting crude extract retained for further purification.

Microbial cells employed in the expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known by the skill artisan.

Transgenic Animals The terms "transgenic animals" or "host animals" are used herein designate animals that have their genome genetically and artificially manipulated so as to include one of the nucleic acids according to the invention. Preferred animals are non-human mammals and include those belonging to a genus selected from Mus mice), Rattus rats) and Oryctogalus (e.g.

rabbits) which have their genome artificially and genetically altered by the insertion of a nucleic acid according to the invention. In one embodiment, the invention encompasses nonhuman host mammals and animals comprising a recombinant vector of the invention or an sbgl, g34665, sbg2, g35017 or g35018 gene disrupted by homologous recombination with a knock out vector. The invention also encompasses non-human primates comprising a recombinant vector of the invention or an sbgl, g34665, sbg2, g35017 or g35018 gene disrupted by homologous recombination with a knock out vector.

The transgenic animals of the invention all include within a plurality of their cells a cloned recombinant or synthetic DNA sequence, more specifically one of the purified or isolated nucleic acids comprising an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide or a DNA sequence encoding an antisense polynucleotide such as described in the present specification.

Generally, a transgenic animal according the present invention comprises any one of the polynucleotides, the recombinant vectors and the cell hosts described in the present invention.

In a first preferred embodiment, these transgenic animals may be good experimental models in order to study the diverse pathologies related to cell differentiation, in particular concerning the transgenic animals within the genome of which has been inserted one or several copies of a polynucleotide encoding a native sbgl, g34665, sbg2, g35017 or g35018 protein, or alternatively a mutant sbgl, g34665, sbg2, g35017 or g35018 protein.

In a second preferred embodiment, these transgenic animals may express a desired polypeptide of interest under the control of regulatory polynucleotides which lead to good yields in the synthesis of this protein of interest, and optionally a tissue specific expression of this protein of interest.

The design of the transgenic animals of the invention may be made according to the conventional techniques well known from the one skilled in the art. For more details regarding the production of transgenic animals, and specifically transgenic mice, it may be referred to US W00058510 [ht ttwwethepatent.comLogin.dog/examsupport/Fetch/Default.dogMO05851 O.cpc?fromCace=1 part=maintoolbar=bottomlPage 157 of 737 WO 00/58510 PCT/IB00/00435 155 Patents Nos 4,873,191, issued Oct. 10, 1989; 5,464,764 issued Nov 7, 1995; and 5,789,215, issued Aug 4, 1998.

Transgenic animals of the present invention are produced by the application of procedures which result in an animal with a genome that has incorporated exogenous genetic material. The procedure involves obtaining the genetic material, or a portion thereof, which encodes either an sbgl, g34665, sbg2, g35017 or g35018 polynucleotide or antisense polynucleotide such as described in the present specification.

A recombinant polynucleotide of the invention is inserted into an embryonic or ES stem cell line. The insertion is preferably made using electroporation, such as described by Thomas et al.(1987). The cells subjected to electroporation are screened by selection via selectable markers, by PCR or by Southern blot analysis) to find positive cells which have integrated the exogenous recombinant polynucleotide into their genome, preferably via an homologous recombination event. An illustrative positive-negative selection procedure that may be used according to the invention is described by Mansour et al.(1988).

Then, the positive cells are isolated, cloned and injected into 3.5 days old blastocysts from mice, such as described by Bradley (1987). The blastocysts are then inserted into a female host animal and allowed to grow to term.

Alternatively, the positive ES cells are brought into contact with embryos at the days old 8-16 cell stage (morulae) such as described by Wood et al.(1993) or by Nagy et al.(1993), the ES cells being internalized to colonize extensively the blastocyst including the cells which will give rise to the germ line.

The offspring of the female host are tested to determine which animals are transgenic e.g. include the inserted exogenous DNA sequence and which are wild-type.

Thus, the present invention also concerns a transgenic animal containing a nucleic acid, a recombinant expression vector or a recombinant host cell according to the invention.

Recombinant Cell Lines Derived From The Transgenic Animals Of The Invention.

A further object of the invention comprises recombinant host cells obtained from a transgenic animal described herein. In one embodiment the invention encompasses cells derived from non-human host mammals and animals comprising a recombinant vector of the invention or a gene comprising an sbgl, g34665, sbg2, g35017 or g35018 nucleic acid sequence disrupted by homologous recombination with a knock out vector.

Recombinant cell lines may be established in vitro from cells obtained from any tissue of a transgenic animal according to the invention, for example by transfection of primary cell cultures with vectors expressing onc-genes such as SV40 large T antigen, as described by Chou (1989) and Shay et al.(1991).

W00058510 [httpJwww getthepatent.com/Login.dog/Sexam.suprt/Fetch/Defa u It. dog 005851 0.cpcfromCache=1 p1art=maintoolbar-botom Page158 of737 WO 00/58510 PCT/IB00/00435 156 Assays For Identification Of Compounds For Treatment Of Schizophrenia And Bipolar Disorder The present invention provides assays which may be used to test compounds for their ability to treat CNS disorders, and in particular, to ameliorate symptoms of a CNS disorder mediated by sbgl, g34665, sbg2, g35017 or g35018. In preferred embodiments, compounds tested for their ability to ameliorate syptoms of schizophrenia or bipolar disorder mediated by sbgl, g34665, sbg2, g35017 or g35018. Compounds may also be tested for their ability to treat related disorders, including among others psychotic disorders, mood disorders, autism, substance dependence and alcoholism, mental retardation, and other psychiatric diseases including cognitive, anxiety, eating, impulse-control, and personality disorders, as defined with the Diagnosis and Statistical Manual of Mental Disorders fourth edition (DSM-IV) classification.

The present invention also provides cell and animal, including primate and mouse, models of schizophrenia, bipolar disorder and related disorders.

In one aspect, provided are non-cell based, cell based and animal based assays for the identification of such compounds that affect sbgl activity. Sbgl activity may be affected by any mechanism; in certain embodiments, sbgl activity is affected by modulating sbgl gene expression or the activity of the sbgl gene product.

The present methods allow the identification of compounds that affect sbgl activity directly or indirectly. Thus, the non-cell based, cell based and animal.assays of the present invention may also be used to identify compounds that act on an element of a sbgl pathway -other than sbgl itself. These compounds can then be used as a therapeutic treatment to modulate sbgl and other gene products involved in schizophrenia, bipolar disorder and related disorders.

Cell and non-cell based assays In one aspect, cell based assays using recombinant or non-recombinant cells may be used to identify compounds which modulate sbgl activity.

In one aspect, a cell based assay of the invention encompasses a method for identifying a test compound for the treatment of schizophrenia or bipolar disorder comprising exposing a cell to a test compound at a concentration and time sufficient to ameliorate an endpoint related to schizophrenia or bipolar disorder, and determining the level of sbgl activity in a cell.

Sbgl activity can be measured, for example, by assaying a cell for mRNA transcript level, sbgl peptide expression, localization or protein activity. Preferably the test compound is a compound capable of or suspected to be capable of ameliorating a symptom of schizophrenia, bipolar disorder or a related disorder. Test compounds capable of modulating sbgl activity may W00058510 [htto:/w w.ae ttheD atenlcomIooin.doo/Sexam.suoortFetch/Defaut.doaNVO005851 0.cpc?fromCache= 1 part=maintoolbar=bottoml Paqe 159 of 737 WO 00/58510 PCT/IB00/00435 157 be selected for use in developing medicaments. Such cell based assays are further described herein in the section titled "Method For Screening Ligands That Modulate The Expression Of The sbgl, g34665, sbg2, g35017 and g35018 Gene." In another aspect, a cell based assay of the invention encompasses a method for identifying a compound for the treatment of schizophrenia or bipolar disorder comprising (a) exposing a cell to a level of sbgl activity sufficient to cause a schizophrenia-related or bipolar disorder-related endpoint, and exposing said cell to a test compound. A test compound can then be selected according to its ability to ameliorate said schizophrenia-related or bipolar disorder-related endpoints. sbgl activity may be provided by any suitable method, including but not limited to providing a vector containing an sbgl nucleotide sequence, treating said cell with a compound capable of increasing sbgl expression and treating said cell with an sbgl peptide. Preferably said cell is treated with an sbgl peptide comprising a contiguous span of at least 4 amino acids of SEQ ID Nos. 27 to 35; most preferably said sbgl peptide comprises amino acid positions 124 to 153 of SEQ IDNo 34, as described in Example 7. Preferably the test compound is a compound capable of or suspected to be capable of ameliorating a symtpom of schizophrenia, bipolar disorder or a related disorder, alternatively, the test compound is suspected of exacerbating an endpoint schizophrenia, bipolar disorder or a related disorder. A test compound capable of ameliorating any detectable symptom or endpoint of a schizophrenia, bipolar disorder or a related disorder may be selected for use in developing medicaments.

In another embodiment, the invention provides cell and non-cell based assays to sbgl to determine whether sbg peptides bind to the cell surface, and to identify compounds for the treatment of schizophrenia, bipolar disorder and related disorders that interact with an sbgl receptor. In one such embodiment, an sbgl polynucleotide, or fragments thereof, is cloned into expression vectors such as those described herein. The proteins are purified by size, charge, immunochromatography or other techniques familiar to those skilled in the art. Following purification, the proteins are labeled using techniques known to those skilled in the art. The labeled proteins are incubated with cells or cell lines derived from a variety of organs or tissues to allow the proteins to bind to any receptor present on the cell surface. Following the incubation, the cells are washed to remove non-specifically bound protein. The labeled proteins are detected by autoradiography. Alternatively, unlabeled proteins may be incubated with the cells and detected with antibodies having a detectable label, such as a fluorescent molecule, attached thereto. Specificity of cell surface binding may be analyzed by conducting a competition analysis in which various amounts of unlabeled protein are incubated along with the labeled protein. The amount of labeled protein bound to the cell surface decreases as the amount of competitive unlabeled protein increases. As a control, various amounts of an W00058510 [hqttww.getthepatent. com[Logn.d og/Sexam .suportFetchDefaut.dogNO0585 1 0.cpc?fromCache= 1 part=maintoolbar-bottom] Page 160 of 737 WO 00/58510 PCT/IB00/00435 158 unlabeled protein unrelated to the labeled protein is included in some binding reactions. The amount of labeled protein bound to the cell surface does not decrease in binding reactions containing increasing amounts of unrelated unlabeled protein, indicating that the protein encoded by the nucleic acid binds specifically to the cell surface.

In another embodiment, the present invention comprises non-cell based binding assays, wherein an sbgl polypeptide is prepared and purified as in cell based binding assays described above. Following purification, the proteins are labeled and incubated with a cell membrane extract or isolate derived from any desired cells from any organs, tissue or combination of organs or tissues of interest to allow the sbgl polypeptide to bind to any receptor present on a membrane. Following the incubation, the membranes are washed to remove non-specifically bound protein. The labeled proteins may be detected by autoradiography. Specificity of membrane binding of sbgl may be analyzed by conducting a competition analysis in which various amounts of a test compound are incubated along with the labeled protein. Any desired test compound, including test polypeptides, can be incubated with the cells. The test compounds may be detected with antibodies having a detectable label, such as a fluorescent molecule, attached thereto. The amount of labeled sbgl polypeptide bound to the cell surface decreases as the amount of competitive test compound increases. As a control, various amounts of an unlabeled protein or a compound unrelated to the test compound is included in some binding reactions. Test compounds capable of reducing the amount of sbgl bound to cell membranes may be selected as a candidate therapeutic compound.

In preferred embodiments of the cell and non-cell based assays, said sbgl peptide comprising a contiguous span of at least 4 amino acids of SEQ ID Nos. 27 to 35; most preferably said sbgl peptide comprises amino acid positions 124 to 153 of SEQ ID No 34.

Said cell based assays may comprise cells of any suitable origin; particularly preferred cells are human cells, primate cells, non-human primate cells and mouse cells. If non-human primate cells are used, the sbgl may comprise a nucleotide sequence or be encoded by a nucleotide sequence according to the primate nucleic acid sequences of SEQ ID No. 54 to 111, or a sequence complementary thereto or a fragment thereof.

Animal model based assay Non-human animal based assays may also be used to identify compounds which modulate sbgl activity. The invention encompasses animal models and animal based assays suitable, including non-transgenic or transgenic animals, including animals containing a human or altered form of the sbgl gene.

Thus, the present invention comprises treating an animal affected by schizophrenia or bipolar disorder or symptoms thereof with a test compound capable of directly or indirectly W00058510 [h /tww.getthepatent.co mlog inAogLSexam.supP _qffetchloefaut. dog/00585 1 0.cpc?fromCache 1 part=maintoolbar=bottom] Page 161 of 737 WO 00/58510 PCT/IB00/00435 159 modulating sbgl activity.

In one aspect, an animal based assay of the invention encompasses a method for identifying a test compound for the treatment of schizophrenia or bipolar disorder comprising exposing an animal to a test compound at a concentration and time sufficient to ameliorate an endpoint related to schizophrenia or bipolar disorder, and determining the level of sbgl activity at a site in said animal. Sbgl activity can be measured in any suitable cell, tissue or site. Preferably the test compound is a compound capable of or suspected to be capable of ameliorating a symptom of schizophrenia, bipolar disorder or a related disorder. Optionally.

said test compound is capable or suspected to be capable of modulating sbgl activity. Test compounds capable of modulating sbgl activity may be selected for use in developing medicaments.

In another aspect, a animal based assay of the invention encompasses a method for identifying a compound for the treatment of schizophrenia or bipolar disorder comprising (a) exposing an animal to a level of sbgl activity sufficient to cause a schizophrenia-related or bipolar disorder-related symptom or endpoint, and exposing said animal to a test compound.

A test compound can then be selected according to its ability to ameliorate said schizophreniarelated or bipolar disorder-related endpoints. sbgl activity may be provided by any suitable method, including but not limited to providing a vector containing an sbgl nucleotide sequence, treating said animal with a compound capable of increasing sbgl expression and treating said cell with an sbgl peptide. Preferably, said animal is treated with an sbgl peptide comprising a contiguous span of at least 4 amino acids of SEQ ID Nos. 27 to 35; most preferably said sbgl peptide comprises amino acid positions 124 to 153 of SEQ ID No 34, as described in Example 7. Preferably the test compound is a compound capable of or suspected to be capable of ameliorating a symptom of schizophrenia, bipolar disorder or a related disorder, alternatively, the test compound is suspected of exacerbating a symptom of schizophrenia, bipolar disorder or a related disorder. A test compound capable of ameliorating any detectable symptom or endpoint of a schizophrenia, bipolar disorder or a related disorder may be selected for use in developing medicaments.

Any suitable animal may be used. Preferably, said animal is a primate, a non-human primate, a mammal, or a mouse.

In one embodiment, a mouse is treated with an sbgl peptide, exposed to a test compound, and symptoms indicative of schizophrenia, bipolar disorder or a related disorder are assessed by observing stereotypy. In other embodiments, said symptoms are assessed by performing at least one test from the group consisting of home cage observation, neurological evaluation, stress-induced hypothermia, forced swim, PTZ seizure, locomotor activity, tail W00058510 [httpJAww.qenhepatent.com/Login dog/Sexam.supportIFetch/DefauItdogMO00585 I0.cpc?fromCache=1 part=maintoolbar=botom] Page 162 of 737 WO 00/58510 PCT/IBO0/00435 160 suspension, elevated plus maze, novel object recognition, prepulse inhibition, thermal pain, Ymaze, and metabolic chamber tests (Psychoscreen T M tests available from Psychogenics Inc.).

Other tests are known in Crawley et al, Horm. Behav. 31(3):197-211 (1997); Crawley, Brain Res 835(1):18-26 (1999) for example.

In one example, the present inventors have tested sbgl peptides by injection into mice.

An sbgl peptide comprising amino acid positions 124 to 153 of SEQ ID No 34 was injected peritoneally into adult mice as described herein in Example 7. Upon observation, mice injected with the sbgl peptide exhibited a decrease in the frequency of their movements over the time course of the experiment. Figure 18 demonstrates (left top panel of the figure) a comparison of the average number of movements in 3 separate time points 10, and 15 min) with the average movements per min in the last period of observations (30, 35, 40, and 45 min). The sbgl peptide also increased stereotypy this effect was most prominent during the last period of observations. Because the onset of stereotypy was variable, data are presented as the average of stereotypy for observations over the entire time period.

The present inventors have also determined that the sbgl gene exists in several nonhuman primates. In a preferred embodiment of the animal models and drug screening assays of the invention, a non-human primate is treated with an sbgl peptide and exposed to a test compound, wherein said sbgl peptide is encoded by a nucleotide sequence according to the primate nucleic acid sequences of SEQ ID No. 54 to 111, or a sequence complementary thereto or a fragment thereof.

Any suitable test compound may be used with the screening methods of the invention.

Examples of compounds that may be screened by the methods of the present invention include small organic or inorganic molecules, nucleic acids, including polynucleotides from random and directed polynucleotide libraries, peptides, including peptides derived from random and directed peptide libraries, soluble peptides, fusion peptides, and phosphopeptides, antibodies including polyclonal, monoclonal, chimeric, humanized, and anti-idiotypic antibodies, and single chain antibodies, FAb, F(ab) 2 and FAb expression library fragments, and epitope-binding fragments thereof. In certain aspects, a compound capable of ameliorating or exacerbating a symptom or endpoint of schizophrenia, bipolar disorder or a related disorder may include, by way of example, antipsychotic drugs in general, neuroleptics, atypical neuroleptics, antidepressants, anti-anxiety drugs, noradrenergic agonists and antagonists, dopaminergic agonists and antagonists, serotonin reuptake inhibitors, benzodiazepines.

s W00058510 rh Awm etthepatent.com/Login.do /Sexam.su pport/Fetc/Defaut.dog/W00 05 851 0.cpcfromCarhe= 1 part=maintoolbar-bottom] Page 63 of 73 7 WO 00/58510 PCT/IB00/00435 161 Methods for screening substances interacting with an sbgl, g34665, sbg2, g35017 or g35018 polypeptides For the purpose of the present invention, a ligand means a molecule, such as a protein, a peptide, an antibody or any synthetic chemical compound capable of binding to the sbgl, g34665, sbg2, g35017 or g35018 protein or one of its fragments or variants or to modulate the expression of the polynucleotide coding for the sbgl, g34665, sbg2, g35017 or g35018 or a fragment or variant thereof.

In the ligand screening method according to the present invention, a biological sample or a defined molecule to be tested as a putative ligand of the sbgl, g34665, sbg2, g35017 or g35018 protein is brought into contact with the corresponding purified sbgl, g34 6 65, sbg2, g35017 or g3501 8 protein, for example the corresponding purified recombinant sbgl, g34665, sbg2, g35017 or g35018 protein produced by a recombinant cell host as described hereinbefore, in order to form a complex between this protein and the putative ligand molecule to be tested.

As an illustrative example, to study the interaction of the sbgl, g34665, sbg2, g35017 and g35018 protein, or a fragment comprising a contiguous span of at least 4 amino acids, preferably at least 6, or preferably at least 8 to 10 amino acids, more preferably at least 12, 20,25, 30, 40, 50, or 100 amino acids of SEQ ID Nos 27 to 35 and 41 to 43, with drugs or small molecules, such as molecules generated through combinatorial chemistry approaches, the microdialysis coupled to HPLC method described by Wang et al. (1997) or the affinity capillary electrophoresis method described by Bush et al. (1997), can be used.

In further methods, peptides, drugs, fatty acids, lipoproteins, or small molecules which interact with the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment comprising a contiguous span of at least 4 amino acids, preferably at least 6, or preferably at least 8 to amino acids, more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of SEQ ID Nos 27 to 35 and 41 to 43, may be identified using assays such as the following. The molecule to be tested for binding is labeled with a detectable label, such as a fluorescent, radioactive, or enzymatic tag and placed in contact with immobilized sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof under conditions which permit specific binding to occur. After removal of non-specifically bound molecules, bound molecules are detected using appropriate means.

Another object of the present invention comprises methods and kits for the screening of candidate substances that interact with an sbgl, g34665, sbg2, g35017 or g35018 polypeptide.

The present invention pertains to methods for screening substances of interest that interact with an sbgl, g34665, sbg2, g35017 or g35018 protein or one fragment or variant thereof. By their capacity to bind covalently or non-covalently to an sbgl, g34665, sbg2, W00058510 [httDJiwwwggetlhegatent.comLogin.dog/x sport/Fetch/DefaultdoNVO00585 0.cpcfromCache=1 part=maintoolbar=bottoml Page 164 of 737 WO 00/58510 PCT/IB00/00435 162 g35017 or g35018 protein or to a fragment or variant thereof, these substances or molecules may be advantageously used both in vitro and in vivo.

In vitro, said interacting molecules may be used as detection means in order to identify the presence of an sbgl, g346 6 5, sbg2, g35017 or g35 0 1 8 protein in a sample, preferably a biological sample.

A method for the screening of a candidate substance comprises the following steps a) providing a polypeptide comprising, consisting essentially of, or consisting of an sbgl, g34665, sbg2, g35017 or g35018 protein or a fragment comprising a contiguous span of at least 4 amino acids, preferably at least 6 amino acids, more preferably at least 8 to 10 amino acids, more preferably at least 12, 15, 20,25, 30, 40, 50, or 100 amino acids of SEQ ID Nos. 27 to 35 and 41 to 43; b) obtaining a candidate substance; c) bringing into contact said polypeptide with said candidate substance; and d) detecting the complexes formed between said polypeptide and said candidate substance.

The invention further concerns a kit for the screening of a candidate substance interacting with the sbgl, g34 66 5, sbg2, g35017 or g35018 polypeptide, wherein said kit comprises: a) an sbgl, g346 6 5, sbg2, g35017 or g3501 8 protein having an amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID Nos. 27 to 35 and 41 to 43 or a peptide fragment comprising a contiguous span of at least 4 amino acids, preferably at least 6 amino acids, more preferably at least 8 to 10 amino acids, and more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of SEQ ID Nos. 27 to 35 and 41 to 43; and b) optionally means useful to detect the complex formed between the sbgl, g34665, sbg2, g3501 7 org35018 protein or a peptide fragment or a variant thereof and the candidate substance.

In a preferred embodiment of the kit described above, the detection means comprise monoclonal or polyclonal antibodies directed against the sbgl, g346 6 5, sbg2, g35017 or g35018 protein or a peptide fragment or a variant thereof.

Various candidate substances or molecules can be assayed for interaction with an sbgl, g34 66 5 sbg2, g35017 or g35018 polypeptide. These substances or molecules include, without being limited to, natural or synthetic organic compounds or molecules of biological origin such as polypeptides. When the candidate substance or molecule comprise a polypeptide, this polypeptide may be the resulting expression product of a phage clone belonging to a phagebased random peptide library, or alternatively the polypeptide may be the resulting expression W00058510 [httP:/Iwww.getthepatent.comILo in.dog/Sexam.suortFetch/Defaut.dogNVO005851 0.cfromCace= 1part=maintoolbar--bottom ag WO 00/58510 PCT/IB00/00435 163 product of a cDNA library cloned in a vector suitable for performing a two-hybrid screening assay.

The invention also pertains to kits useful for performing the hereinbefore described screening method. Preferably, such kits comprise an sbgl, g34665, sbg2, g35017 or g35018 polypeptide or a fragment or a variant thereof, and optionally means useful to detect the complex formed between the sbgl, g34665, sbg2, g35017 or g35018 polypeptide or its fragment or variant and the candidate substance. In a preferred embodiment the detection means comprise monoclonal or polyclonal antibodies directed against the corresponding sbgl, g34665, sbg2, g35017 or g3501 8 polypeptide or a fragment or a variant thereof.

A. Candidate ligands obtained from random peptide libraries In a particular embodiment of the screening method, the putative ligand is the expression product of a DNA insert contained in a phage vector (Parmley and Smith, 1988).

Specifically, random peptide phages libraries are used. The random DNA inserts encode for peptides of 8 to 20 amino acids in length (Oldenburg K.R. et al., 1992; Valadon et al., 1996; Lucas 1994; Westerink 1995; Felici F. et al., 1991). According to this particular embodiment, the recombinant phages expressing a protein that binds to the immobilized sbgl, g34 6 6 5, sbg2, g35017 or g3501 8 protein is retained and the complex formed between the sbgl, g34665, sbg2, g35017 or g35018 protein and the recombinant phage may be subsequently immunoprecipitated by a polyclonal or a monoclonal antibody directed against the sbgl, g3466 5 sbg2, g35017 or g35018 protein.

Once the ligand library in recombinant phages has been constructed, the phage population is brought into contact with the immobilized sbgl, g34665, sbg2, g35017 or g35018 protein. Then the preparation of complexes is washed in order to remove the non-specifically bound recombinant phages. The phages that bind specifically to the sbgl, g34665, sbg2, g35017 or g3501 8 protein are then eluted by a buffer (acid pH) or immunoprecipitated by the monoclonal antibody produced by the hybridoma anti- sbgl, g34665, sbg2, g35017 or g35018, and this phage population is subsequently amplified by an over-infection of bacteria (for example E. coli). The selection step may be repeated several times, preferably 2-4 times, in order to select the more specific recombinant phage clones. The last step comprises characterizing the peptide produced by the selected recombinant phage clones either by expression in infected bacteria and isolation, expressing the phage insert in another host-vector system, or sequencing the insert contained in the selected recombinant phages.

B. Candidate ligands obtained by competition experiments.

Alternatively, peptides, drugs or small molecules which bind to the sbgl, g34665, sbg2, W00058510 Ahtto:twwgetthepatenttcomLogin.dog/exam.support/Fetchlefault doqNV0058510.cpc?fromCache=l part=maintoolbar-botomlPage 166 of 737 WO 00/58510 PCT/IB00/00435 164 g35017 or g35018 protein, or a fragment comprising a contiguous span of at least 4 amino acids, preferably at least 6 amino acids, more preferably at least 8 to 10 amino acids, and more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of SEQ ID Nos. 27 to 35 and 41 to 43, may be identified in competition experiments. In such assays, the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, is immobilized to a surface, such as a plastic plate. Increasing amounts of the peptides, drugs or small molecules are placed in contact with the immobilized sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, in the presence of a detectable labeled known sbgl, g34665, sbg2, g35017 or g35018 protein ligand.

For example, the sbgl, g34665, sbg2, g35017 or g35018 ligand may be detectably labeled with a fluorescent, radioactive, or enzymatic tag. The ability of the test molecule to bind the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, is determined by measuring the amount of detectably labeled known ligand bound in the presence of the test molecule. A decrease in the amount of known ligand bound to the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, when the test molecule is present indicated that the test molecule is able to bind to the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof.

C. Candidate ligands obtained by affinity chromatography.

Proteins or other molecules interacting with the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment comprising a contiguous span of at 4 amino acids, preferably at least 6 amino acids, more preferably at least 8 to 10 amino acids, and more preferably at least 12, 20, 25, 30, 40, 50, or 100 amino acids of SEQ ID Nos 27 to 35 and 41 to 43, can also be found using affinity columns which contain the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof. The sbgl, g346 6 5, sbg2, g35017 or g35018 protein, or a fragment thereof, may be attached to the column using conventional techniques including chemical coupling to a suitable column matrix such as agarose, Affi Gel®, or other matrices familiar to those of skill in art. In some embodiments of this method, the affinity column contains chimeric proteins in which the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, is fused to glutathion S transferase (GST). A mixture of cellular proteins or pool of expressed proteins as described above is applied to the affinity column. Proteins or other molecules interacting with the sbgl, g34 6 65, sbg2, g35017 or g35018 protein, or a fragment thereof, attached to the column can then be isolated and analyzed on 2-D electrophoresis gel as described in Ramunsen et al. (1997). Alternatively, the proteins retained on the affinity column can be purified by electrophoresis based methods and sequenced. The same method can be used to isolate antibodies, to screen phage display products, or to screen phage display human antibodies.

W00058510[IHP_/twwwetthepatent.comfIogindo /$exam SupportIFetch/Defaut.doMJO005851 0.cpcfromCaCtie= 1 part=maintoolbarbottom] Page167of 737 WO 00/58510 PCT/IB00/00435 165 D. Candidate ligands obtained by optical biosensor methods Proteins interacting with the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment comprising a contiguous span of at least 4 amino acids, preferably at least 6 amino acids, more preferably at least 8 to 10 amino acids, and more preferably at least 12, 15, 20, 30, 40, 50, or 100 amino acids of SEQ ID Nos. 27 to 35 and 41 to 43, can also be screened by using an Optical Biosensor as described in Edwards and Leatherbarrow (1997) and also in Szabo et al. (1995). This technique permits the detection of interactions between molecules in real time, without the need of labeled molecules. This technique is based on the surface plasmon resonance (SPR) phenomenon. Briefly, the candidate ligand molecule to be tested is attached to a surface (such as a carboxymethyl dextran matrix). A light beam is directed towards the side of the surface that does not contain the sample to be tested and is reflected by said surface. The SPR phenomenon causes a decrease in the intensity of the reflected light with a specific association of angle and wavelength. The binding of candidate ligand molecules cause a change in the refraction index on the surface, which change is detected as a change in the SPR signal. For screening of candidate ligand molecules or substances that are able to interact with the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, is immobilized onto a surface.

This surface comprises one side of a cell through which flows the candidate molecule to be assayed. The binding of the candidate molecule on the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, is detected as a change of the SPR signal. The candidate molecules tested may be proteins, peptides, carbohydrates, lipids, or small molecules generated by combinatorial chemistry. This technique may also be performed by immobilizing eukaryotic or prokaryotic cells or lipid vesicles exhibiting an endogenous or a recombinantly expressed sbgl, g34665, sbg2, g35017 or g35018 protein at their surface.

The main advantage of the method is that it allows the determination of the association rate between the sbgl, g34665, sbg2, g35017 or g35018 protein and molecules interacting with the sbgl, g34665, sbg2, g35017 or g35018 protein. It is thus possible to select specifically ligand molecules interacting with the sbgl, g34665, sbg2, g35017 or g35018 protein, or a fragment thereof, through strong or conversely weak association constants.

E. Candidate ligands obtained through a two-hybrid screening assay.

The yeast two-hybrid system is designed to study protein-protein interactions in vivo (Fields and Song, 1989), and relies upon the fusion of a bait protein to the DNA binding domain of the yeast Gal4 protein. This technique is also described in the US Patent NO US 5,667,973 and the US Patent NO 5,283,173 (Fields et al.).

W00058510 rhut:/ www.gethepatent comogin.dog/Sexam.support/FetchwDefaul.dogiwO005851 0.cpc?fromCache=l 1art=maintoolbar=bottom] Page 168 of 737 WO 00/58510 PCT/IB00/00435 166 The general procedure of library screening by the two-hybrid assay may be performed as described by Harper et al. (1993) or as described by Cho et al. (1998) or also Fromont-Racine et al. (1997).

The bait protein or polypeptide comprises, consists essentially of, or consists of an sbgl, g34665, sbg2, g35017 or g35018 polypeptide or a fragment comprising a contiguous span of at least 4 amino acids, preferably at least 6 amino acids, more preferably at least 8 to amino acids, and more preferably at least 12, 15, 20, 25, 30, 40, 50, or 100 amino acids of SEQ ID Nos. 27 to 35 and 41 to 43.

More precisely, the nucleotide sequence encoding the sbgl, g34665, sbg2, g35017 or g35018 polypeptide or a fragment or variant thereof is fused to a polynucleotide encoding the DNA binding domain of the GAL4 protein, the fused nucleotide sequence being inserted in a suitable expression vector, for example pAS2 or pM3.

Then, a human cDNA library is constructed in a specially designed vector, such that the human cDNA insert is fused to a nucleotide sequence in the vector that encodes the transcriptional domain of the GALA protein. Preferably, the vector used is the pACT vector.

The polypeptides encoded by the nucleotide inserts of the human cDNA library are termed "pray" polypeptides.

A third vector contains a detectable marker gene, such as beta galactosidase gene or CAT gene that is placed under the control of a regulation sequence that is responsive to the binding of a complete Gal4 protein containing both the transcriptional activation domain and the DNA binding domain. For example, the vector pG5EC may be used.

Two different yeast strains are also used. As an illustrative but non limiting example the two different yeast strains may be the followings Y190, the phenotype of which is (MATa, Leu2-3, 112 ura3-12, trpl-901, his3-D200, ade2- 101, gal4Dgall80D URA3 GAL-LacZ, LYS GAL-HIS3, cyh); Y187, the phenotype of which is (MATa gal4 gal80 his3 trpl-901 ade2-101 ura3-52 leu2-3, -112 URA3 GAL-lacZmet), which is the opposite mating type of Y190.

Briefly, 20 pg of pAS2/ sbgl, g34665, sbg2, g35017 or g35018 and 20 pg of pACTcDNA library are co-transformed into yeast strain Y190. The transformants are selected for growth on minimal media lacking histidine, leucine and tryptophan, but containing the histidine synthesis inhibitor 3-AT (50 mM). Positive colonies are screened for beta galactosidase by filter lift assay. The double positive colonies (His*, beta-gar) are then grown on plates lacking histidine, leucine, but containing tryptophan and cycloheximide (10 mg/ml) to select for loss of pAS2/ sbgl, g34665, sbg2, g35017 and g35018 plasmids bu retention of pACT-cDNA library plasmids. The resulting Y190 strains are mated with Y187 strains expressing sbgl, g34665, W00058510 fhttpJtwww.getthepatent.com/Login.doq/Sexam.surrort/FetchDefaut.dog/NO0058510.cpcfromCache=l 1art=maintoolbarbottoml.Page 169 of 737 WO 00/58510 PCT/IB00/00435 167 sbg2, g35017 and g35018 or non-related control proteins; such as cyclophilin B, lamin, or SNFI, as Gal4 fusions as described by Harper et al. (1993) and by Bram et al. (Bram RJ et al., 1993), and screened for beta galactosidase by filter lift assay. Yeast clones that are beta galafter mating with the control Gal4 fusions are considered false positives.

In another embodiment of the two-hybrid method according to the invention, interaction between the sbgl, g34665, sbg2, g35 0 1 7 or g35018 or a fragment or variant thereof with cellular proteins may be assessed using the Matchmaker Two Hybrid System 2 (Catalog No.

K 1604-1, Clontech). As described in the manual accompanying the Matchmaker Two Hybrid System 2 (Catalog No. K1604-1, Clontech), nucleic acids encoding the sbgl, g34665, sbg2, g35017 and g35018 protein or a portion thereof, are inserted into an expression vector such that they are in frame with DNA encoding the DNA binding domain of the yeast transcriptional activator GAL4. A desired cDNA, preferably human cDNA, is inserted into a second expression vector such that they are in frame with DNA encoding the activation domain of GAL4. The two expression plasmids are transformed into yeast and the yeast are plated on selection medium which selects for expression of selectable markers on each of the expression vectors as well as GALA dependent expression of the HIS3 gene. Transformants capable of growing on medium lacking histidine are screened for GALA dependent lacZ expression. Those cells which are positive in both the histidine selection and the lacZ assay contain interaction between sbgl, g34665, sbg2, g35017 or g35018 and the protein or peptide encoded by the initially selected cDNA insert.

Method For Screening Substances Interacting With The Regulatory Sequences Of An sbgl, g34665, sbg2, g35017 or g35018 Gene.

The present invention also concerns a method for screening substances or molecules that are able to interact with the regulatory sequences of the sbgl, g34665, sbg2, g35017 or g35018 gene, such as for example promoter or enhancer sequences.

Nucleic acids encoding proteins which are able to interact with the regulatory sequences of the sbgl, g34665, sbg2, g35017 or g35018 gene, more particularly a nucleotide sequence selected from the group consisting of the polynucleotides of the 5' and 3' regulatory region or a fragment or variant thereof, and preferably a variant comprising one of the biallelic markers of the invention, may be identified by using a one-hybrid system, such as that described in the booklet enclosed in the Matchmaker One-Hybrid System kit from Clontech (Catalog Ref. nO K1603-1). Briefly, the target nucleotide sequence is cloned upstream of a selectable reporter sequence and the resulting DNA construct is integrated in the yeast genome (Saccharomyces cerevisiae). The yeast cells containing the reporter sequence in their genome are then transformed with a library comprising fusion molecules between cDNAs encoding candidate W00058510 [htto:llwww.getthepatent.com[Login -dog/Sexam .su port/Fetch/lefault.dogM/000585 1 0.cocfromCache= 1 part=maintoolbar=bottom) Page 170 of737 WO 00/58510 PCT/IB00/00435 168 proteins for binding onto the regulatory sequences of the sbgl, g34665, sbg2, g35017 or g35018 gene and sequences encoding the activator domain of a yeast transcription factor such as GAL4.

The recombinant yeast cells are plated in a culture broth for selecting cells expressing the reporter sequence. The recombinant yeast cells thus selected contain a fusion protein that is able to bind onto the target regulatory sequence of the sbgl, g34665, sbg2, g3501 7 or g35018 gene. Then, the cDNAs encoding the fusion proteins are sequenced and may be cloned into expression or transcription vectors in vitro. The binding of the encoded polypeptides to the target regulatory sequences of the sbgl, g34665, sbg2, g35017 or g35018 gene may be confirmed by techniques familiar to the one skilled in the art, such as gel retardation assays or DNAse protection assays.

Gel retardation assays may also be performed independently in order to screen candidate molecules that are able to interact with the regulatory sequences of the sbgl, g34 6 6 sbg2, g35017 or g35018 gene, such as described by Fried and Crothers (1981), Garner and Revzin (1981) and Dent and Latchman (1993). These techniques are based on the principle according to which a DNA fragment which is bound to a protein migrates slower than the same unbound DNA fragment. Briefly, the target nucleotide sequence is labeled. Then the labeled target nucleotide sequence is brought into contact with either a total nuclear extract from cells containing transcription factors, or with different candidate molecules to be tested. The interaction between the target regulatory sequence of the sbgl, g34665, sbg2, g35017 or g35018 gene and the candidate molecule or the transcription factor is detected after gel or capillary electrophoresis through a retardation in the migration.

Method For Screening Ligands That Modulate The Expression Of The sbgl, g34665, sbg2, g35017 or g35018 Gene Another subject of the present invention is a method for screening molecules that modulate the expression of the sbgl, g34665, sbg2, g35017 or g35018 protein. Such a screening method comprises the steps of: a) cultivating a prokaryotic or an eukaryotic cell that has been transfected with a nucleotide sequence encoding the sbgl, g34665, sbg2, g35017 or g35018 protein or a variant or a fragment thereof, placed under the control of its own promoter; b) bringing into contact the cultivated cell with a molecule to be tested; c) quantifying the expression of the sbgl, g34665, sbg2, g35017 or g35018 protein or a variant or a fragment thereof.

In an embodiment, the nucleotide sequence encoding the sbgl, g34665, sbg2, g35017 or g35018 protein or a variant or a fragment thereof comprises an allele of at least one sbg 1, W00058510 Http:ww.getthe patent.com/Login.d ogSexa m.suportIFetchDefa u It dOgMO0 5 O.cpc?fromCache=1 part=maintoolbar=bottoml Page 171 of 737 WO 00/58510 PCT/IB00/00435 169 g34665, sbg2, g35017 or g35018 related biallelic marker.

Using DNA recombination techniques well known by the one skill in the art, the sbgl, g34665, sbg2, g35017 or g35018 protein encoding DNA sequence is inserted into an expression vector, downstream from its promoter sequence. As an illustrative example, the promoter sequence of the sbgl, g34665, sbg2, g3501 7 or g35018 gene is contained in the nucleic acid of the 5' regulatory region.

The quantification of the expression of the sbgl, g34665, sbg2, g35017 or g35018 protein may be realized either at the mRNA level or at the protein level. In the latter case, polyclonal or monoclonal antibodies may be used to quantify the amounts of the sbgl, g34665, sbg2, g35017 or g35018 protein that have been produced, for example in an ELISA or a RIA assay.

In a preferred embodiment, the quantification of the sbgl, g34665, sbg2, g35017 or g35018 mRNA is realized by a quantitative PCR amplification of the cDNA obtained by a reverse transcription of the total mRNA of the cultivated sbgl, g34665, sbg2, g35017 or g35018 -transfected host cell, using a pair of primers specific for sbgl, g34665, sbg2, g35017 or g35018.

The present invention also concerns a method for screening substances or molecules that are able to increase, or in contrast to decrease, the level of expression of the sbgl, g34 6 6 sbg2, g35017 or g35018 gene. Such a method may allow the one skilled in the art to select substances exerting a regulating effect on the expression level of the sbgl, g34665, sbg2, g35017 or g35018 gene and which may be useful as active ingredients included in pharmaceutical compositions for treating patients suffering from diseases.

Thus, is also part of the present invention a method for screening of a candidate substance or molecule that modulated the expression of the sbgl, g34665, sbg2, g35017 or g3501 8 gene, this method comprises the following steps: providing a recombinant cell host containing a nucleic acid, wherein said nucleic acid comprises a nucleotide sequence of the 5' regulatory region or a biologically active fragment or variant thereof located upstream a polynucleotide encoding a detectable protein; obtaining a candidate substance; and determining the ability of the candidate substance to modulate the expression levels of the polynucleotide encoding the detectable protein.

In a further embodiment, the nucleic acid comprising the nucleotide sequence of the regulatory region or a biologically active fragment or variant thereof also includes a region of the sbgl cDNA of SEQ ID No 2 to 26 or the g35018 cDNA of SEQ ID No 36 to or one of its biologically active fragments or variants thereof.

W00058510 [http~tw ww.getthepatent.rom/Login.dog/Sexam.suportFetchDefauIt.dogM00058510.cpc?fromCarhe=1part=maintoolbar--boftom Page 172 of 737 WO 00/58510 PCT/IB00/00435 170 Among the preferred polynucleotides encoding a detectable protein, there may be cited polynucleotides encoding beta galactosidase, green fluorescent protein (GFP) and chloramphenicol acetyl transferase (CAT).

The invention also pertains to kits useful for performing the herein described screening method. Preferably, such kits comprise a recombinant vector that allows the expression of a nucleotide sequence of the 5' regulatory region or a biologically active fragment or variant thereof located upstream and operably linked to a polynucleotide encoding a detectable protein or the sbgl, g34 6 6 5, sbg2, g35017 or g35018 protein or a fragment or a variant thereof.

In another embodiment of a method for the screening of a candidate substance or molecule that modulates the expression of the sbgl, g34665, sbg2, g35017 or g35018 gene, wherein said method comprises the following steps: a) providing a recombinant host cell containing a nucleic acid, wherein said nucleic acid comprises a 5'UTR sequence of an sbgl, g34665, sbg2, g35017 or g35018 cDNA, preferably of an sbgl or g35018 cDNA of SEQ ID Nos 2 to 26 or 36 to 40, or one of its biologically active fragments or variants, the 5'UTR sequence or its biologically active fragment or variant being operably linked to a polynucleotide encoding a detectable protein; b) obtaining a candidate substance; and c) determining the ability of the candidate substance to modulate the expression levels of the polynucleotide encoding the detectable protein.

In a specific embodiment of the above screening m'ethod, the nucleic acid that comprises a nucleotide sequence selected from the group consisting of the 5'UTR sequence of an sbgl, g34665, sbg2, g35017 or g35018 cDNA, preferably of an sbgl or g35018 cDNA of SEQ ID Nos 2 to 26 or 36 to 40 or one of its biologically active fragments or variants, includes a promoter sequence which is endogenous with respect to the sbgl, g34 66 5, sbg2, g35017 or g35018 5'UTR sequence.

In another specific embodiment of the above screening method, the nucleic acid that comprises a nucleotide sequence selected from the group consisting of the 5'UTR sequence of an sbgl, g34665, sbg2, g35017 or g35018 cDNA or one of its biologically active fragments or variants, includes a promoter sequence which is exogenous with respect to the sbgl, g34665, sbg2, g35017 or g35018 5'UTR sequence defined therein.

In a further preferred embodiment, the nucleic acid comprising the 5'-UTR sequence of an sbgl, g34665, sbg2, g35017 or g35018 cDNA or the biologically active fragments thereof includes an sbgl-related biallelic marker.

The invention further comprises a kit for the screening of a candidate substance modulating the expression of the sbgl, g34665, sbg2, g35017 or g35018 gene, wherein said kit W0005851 0 rtt:/twww.gettheatent.comILogin.dog Sexam.supartFetch/DefautdogW00 1 0.ccfromCache=l 1art=maintoolbar-bottom] Page 173 of 737 WO 00/58510 PCT/IB00/00435 171 comprises a recombinant vector that comprises a nucleic acid including a 5'UTR sequence of the sbgl, g34665, sbg2, g35017 or g 3 5018 cDNA of SEQ ID Nos 2 to 26 or 36 to 40, or one of their biologically active fragments or variants, the 5'UTR sequence or its biologically active fragment or variant being operably linked to a polynucleotide encoding a detectable protein.

For the design of suitable recombinant vectors useful for performing the screening methods described above, it will be referred to the section of the present specification wherein the preferred recombinant vectors of the invention are detailed.

Expression levels and patterns of sbgl, g34665, sbg2, g35017 or g35018 may be analyzed by solution hybridization with long probes as described in International Patent Application No. WO 97/05277. Briefly, the sbgl, g34665, sbg2, g35017 or g35018 cDNA or the sbgl, g34665, sbg2, g35017 and g35018 genomic DNA described above, or fragments thereof, is inserted at a cloning site immediately downstream of a bacteriophage (T3, T7 or SP6) RNA polymerase promoter to produce antisense RNA. Preferably, the sbgl, g34665, sbg2, g35017 and g35018 insert comprises at least 100 or more consecutive nucleotides of the genomic DNA sequence or the cDNA sequences. The plasmid is linearized and transcribed in the presence of ribonucleotides comprising modified ribonucleotides biotin-UTP and DIG- UTP). An excess of this doubly labeled RNA is hybridized in solution with mRNA isolated from cells or tissues of interest. The hybridization is performed under standard stringent conditions (40-50C for 16 hours in an 80% formamide, 0. 4 M NaCI buffer, pH The unhybridized probe is removed by digestion with ribonucleases specific for single-stranded RNA RNases CL3, TI, Phy M, U2 or The presence of the biotin-UTP modification enables capture of the hybrid on a microtitration plate coated with streptavidin. The presence of the DIG modification enables the hybrid to be detected and quantified by ELISA using an anti- DIG antibody coupled to alkaline phosphatase.

Quantitative analysis of sbgl, g34665, sbg2, g35017 or g35018 gene expression may also be performed using arrays. As used herein, the term array means a one dimensional, two dimensional, or multidimensional arrangement of a plurality of nucleic acids of sufficient length to permit specific detection of expression of mRNAs capable of hybridizing thereto. For example, the arrays may contain a plurality of nucleic acids derived from genes whose expression levels are to be assessed. The arrays may include the sbgl, g34665, sbg2, g35017 and g35018 genomic DNA, the sbgl, g34665, sbg2, g35017 or g35018 cDNA sequences or the sequences complementary thereto or fragments thereof, particularly those comprising at least one of the biallelic markers according the present invention. Preferably, the fragments are at least 15 nucleotides in length. In other embodiments, the fragments are at least 25 nucleotides in length. In some embodiments, the fragments are at least 50 nucleotides in length. More W0005851U [htto:/Iwww.getthepatent com/login.dog/$exam .support/Fetch/Default.doqV00O585 10.cpc?tromCache=1 part=maintoolba r-bottom Pag 174 of 737 WO 00/58510 PCT/IB00/00435 172 preferably, the fragments are at least 100 nucleotides in length. In another preferred embodiment, the fragments are more than 100 nucleotides in length. In some embodiments the fragments may be more than 500 nucleotides in length.

For example, quantitative analysis of sbgl, g34665, sbg2, g35017 or g35018 gene expression may be performed with a complementary DNA microarray as described by Schena et al.(1995 and 1996). Full length sbgl, g34665, sbg2, g35017 or g35018 cDNAs or fragments thereof are amplified by PCR and arrayed from a 96-well microtiter plate onto silylated microscope slides using high-speed robotics. Printed arrays are incubated in a humid chamber to allow rehydration of the array elements and rinsed, once in 0. 2% SDS for 1 min, twice in water for 1 min and once for 5 min in sodium borohydride solution. The arrays are submerged in water for 2 min at 95C, transferred into 0. 2% SDS for 1 min, rinsed twice with water, air dried and stored in the dark at Cell or tissue mRNA is isolated or commercially obtained and probes are prepared by a single round of reverse transcription. Probes are hybridized to 1 cm 2 microarrays under a 14 x 14 mm glass coverslip for 6-12 hours at 60 0 C. Arrays are washed for 5 min at 25 0 C in low stringency wash buffer (1 x SSC/0. 2% SDS), then for 10 min at room temperature in high stringency wash buffer 1 x SSC/0. 2% SDS). Arrays are scanned in 0. 1 x SSC using a fluorescence laser scanning device fitted with a custom filter set. Accurate differential expression measurements are obtained by taking the average of the ratios of two independent hybridizations.

Quantitative analysis of sbgl, g34665, sbg2, g35017 or g35018 gene expression may also be performed with full length sbgl, g34665, sbg2, g35017 or g35018 cDNAs or fragments thereof in complementary DNA arrays as described by Pietu et al.(1996). The full length sbgl, g34665, sbg2, g35017 or g35018 cDNA or fragments thereof is PCR amplified and spotted on membranes. Then, mRNAs originating from various tissues or cells are labeled with radioactive nucleotides. After hybridization and washing in controlled conditions, the hybridized mRNAs are detected by phospho-imaging or autoradiography. Duplicate experiments are performed and a quantitative analysis of differentially expressed mRNAs is then performed.

Alternatively, expression analysis using the sbgl, g34665, sbg2, g35017 or g35018 genomic DNA, the sbgl, g34665, sbg2, g35017 or g35018 cDNA, or fragments thereof can be done through high density nucleotide arrays as described by Lockhart et al.(1996) and Sosnowsky et al.(1997). Oligonucleotides of 15-50 nucleotides from the sequences of the sbgl, g34665, sbg2, g35017 or g35018 genomic DNA, the sbgl, g34665, sbg2, g35017 or g35018 cDNA sequences particularly those comprising at least one of biallelic markers according the W0005851 0 [!!p:llwww.getthepatent comogin.dog/Sexam.su portFetch/Default.dOgIVo00U5 1 0.CpctromCache=1 part=maintoolbar=bottom Page 175 of 737 WO 00/58510 PCT/IB00/00435 173 present invention, or the sequences complementary thereto, are synthesized directly on the chip (Lockhart et al., supra) or synthesized and then addressed to the chip (Sosnowski et al., supra).

Preferably, the oligonucleotides are about 20 nucleotides in length.

sbg 1, g34665, sbg2, g35017 or g35018 cDNA probes labeled with an appropriate compound, such as biotin, digoxigenin or fluorescent dye, are synthesized from the appropriate mRNA population and then randomly fragmented to an average size of 50 to 100 nucleotides.

The said probes are then hybridized to the chip. After washing as described in Lockhart et al., supra and application of different electric fields (Sosnowsky et al., 1997)., the dyes or labeling compounds are detected and quantified. Duplicate hybridizations are performed. Comparative analysis of the intensity of the signal originating from cDNA probes on the same target oligonucleotide in different cDNA samples indicates a differential expression of sbgl, g34665, sbg2, g35017 or g35018 mRNA.

Methods For Inhibiting The Expression Of An sbgl, g34665, sbg2, g35017 or g35018 Gene Other therapeutic compositions according to the present invention comprise advantageously an oligonucleotide fragment of the nucleic sequence of sbgl, g34665, sbg2, g35017 or g35018 as an antisense tool or a triple helix tool that inhibits the expression of the corresponding sbgl, g34665, sbg2, g35017 or g35018 gene. A preferred fragment of the nucleic sequence of sbgl, g34 6 6 5, sbg2, g35017 or g35018 comprises an allele of at least one of the biallelic markers of the invention.

Antisense Approach Preferred methods using antisense polynucleotide according to the present invention are the procedures described by Sczakiel et al.(1995).

Preferably, the antisense tools are chosen among the polynucleotides (15-200 bp long) that are complementary to the 5'end of the sbgl, g34665, sbg2, g35017 or g35018 mRNA. In another embodiment, a combination of different antisense polynucleotides complementary to different parts of the desired targeted gene are used.

Preferred antisense polynucleotides according to the present invention are complementary to a sequence of the mRNAs of sbgl, g34665, sbg2, g35017 or g35018 that contains either the translation initiation codon ATG or a splicing donor or acceptor site.

The antisense nucleic acids should have a length and melting temperature sufficient to permit formation of an intracellular duplex having sufficient stability to inhibit the expression of the sbgl, g34665, sbg2, g35017 or g35018 mRNA in the duplex. Strategies for designing antisense nucleic acids suitable for use in gene therapy are disclosed in Green et al., (1986) and W00058510 [http:/twww.getthepatent.com/Login.dog/Sexam.supportVFetch/Default.dogfNO0058510.cpc?fromCache=1 1art=maintoolbar=botoml Page 176 of 737 WO 00/58510 PCT/IB00/00435 174 Izant and Weintraub, (1984).

In some strategies, antisense molecules are obtained by reversing the orientation of the sbgl, g34665, sbg2, g35017 or g35018 coding region with respect to a promoter so as to transcribe the opposite strand from that which is normally transcribed in the cell. The antisense molecules may be transcribed using in vitro transcription systems such as those which employ T7 or SP6 polymerase to generate the transcript. Another approach involves transcription of sbgl, g34 66 5, sbg2, g35017 or g35018 antisense nucleic acids in vivo by operably linking DNA containing the antisense sequence to a promoter in a suitable expression vector.

Alternatively, suitable antisense strategies are those described by Rossi et al.(1991), in the International Applications Nos. WO 94/23026, WO 95/04141, WO 92/18522 and in the European Patent Application No. EP 0 572 287 A2 An alternative to the antisense technology that is used according to the present invention comprises using ribozymes that will bind to a target sequence via their complementary polynucleotide tail and that will cleave the corresponding RNA by hydrolyzing its target site (namely "hammerhead ribozymes"). Briefly, the simplified cycle of a hammerhead ribozyme comprises sequence specific binding to the target RNA via complementary antisense sequences; site-specific hydrolysis of the cleavable motif of the target strand; and release of cleavage products, which gives rise to another catalytic cycle.

Indeed, the use of long-chain antisense polynucleotide (at least 30 bases long) or ribozymes with long antisense arms are advantageous. A preferred delivery system for antisense ribozyme is achieved by covalently linking these antisense ribozymes to lipophilic groups or to use liposomes as a convenient vector. Preferred antisense ribozymes according to the present invention are prepared as described by Sczakiel et al.(1995).

Triple Helix Approach The sbgl, g34665, sbg2, g35017 or g35018 genomic DNA may also be used to inhibit the expression of the sbgl, g346 65 sbg2, g35017 or g35018 gene based on intracellular triple helix formation.

Triple helix oligonucleotides are used to inhibit transcription from a genome. They are particularly useful for studying alterations in cell activity when it is associated with a particular gene.

Similarly, a portion of the sbgl, g34665, sbg2, g35017 or g35018 genomic DNA can be used to study the effect of inhibiting sbgl, g34665, sbg2, g3501 7 or g35018 transcription within a cell. Traditionally, homopurine sequences were considered the most useful for triple helix strategies. However, homopyrimidine sequences can also inhibit gene expression. Such W0005851 0 fhttopffwww.getthepatent.com/Login .dog/Sexam.suppor/Fetch/Defa ult.dogW00 585 1 O.cpc?f rom~ache= 1 part=maintoolbar=bottoml Page 177 of 737 WO 00/58510 PCT/IB00/00435 175 homopyrimidine oligonucleotides bind to the major groove at homopurine:homopyrimidine sequences. Thus, both types of sequences from the sbgl, g34665, sbg2, g35017 or g3 5 01 8 genomic DNA are contemplated within the scope of this invention.

To carry out gene therapy strategies using the triple helix approach, the sequences of the sbgl, g34665, sbg2, g35017 or g35018 genomic DNA are first scanned to identify 10-mer to homopyrimidine or homopurine stretches which could be used in triple-helix based strategies for inhibiting sbgl, g34665, sbg2, g35017 or g35018 expression. Following identification of candidate homopyrimidine or homopurine stretches, their efficiency in inhibiting sbgl, g34665, sbg2, g35017 or g35018 expression is assessed by introducing varying amounts of oligonucleotides containing the candidate sequences into tissue culture cells which express the sbgl, g34 6 6 5, sbg2, g35017 or g35018 gene.

The oligonucleotides can be introduced into the cells using a variety of methods known to those skilled in the art, including but not limited to calcium phosphate precipitation, DEAE- Dextran, electroporation, liposome-mediated transfection or native uptake.

Treated cells are monitored for altered cell function or reduced sbgl, g34665, sbg2, g35017 or g35018 expression using techniques such as Northern blotting, RNase protection assays, or PCR based strategies to monitor the transcription levels of the sbgl, g34665, sbg2, g35017 or g3501 8 gene in cells which have been treated with the oligonucleotide.

The oligonucleotides which are effective in inhibiting gene expression in tissue culture cells may then be introduced in vivo using the techniques described above in the antisense approach at a dosage calculated based on the in vitro results, as described in antisense approach.

In some embodiments, the natural (beta) anomers of the oligonucleotide units can be replaced with alpha anomers to render the oligonucleotide more resistant to nucleases. Further, an intercalating agent such as ethidium bromide, or the like, can be attached to the 3' end of the alpha oligonucleotide to stabilize the triple helix. For information on the generation of oligonucleotides suitable for triple helix formation see Griffin et al.(1989).

Pharmaceutical Compositions And Formulations Sbgl-modulating Compounds Using the methods disclosed herein, compounds that selectively modulate sbgl activity in vitro and in vivo may be identified. The compounds identified by the process of the invention include, for example, antibodies having binding specificity for the sbgl peptide. It is also expected that homologues of sbgl may be useful for modulating sbgl-mediated activity and the related physiological condition associated with schizophrenia or bipolar disorder. Generally, it is further expected that assay methods of the present invention based on the role of sbgl in central W00058510 [http:JMww.getthepatent.com/Login.dog/Sexamfso prtIFetch/Default.dogAOO5851 O.cpc?fromCache=l 1art=maintoolbar-bottom Page 178 of 737 WO 00/58510 PCT/IB00/00435 176 nervous system disorder may be used to identify compounds capable of intervening in the assay cascade of the invention.

Indications While sbgl has demonstrated an association with schizophrenia and bipolar disorder, indications involving sbgl may include various central nervous system disorders. Nervous system disorders are expected to have complex genetic bases and often share certain symptoms. In particular, as described herein, indications may include schizophrenia and other psychotic disorders, mood disorders, autism, substance dependence and alcoholism, mental retardation, and other psychiatric diseases including cognitive, anxiety, eating, impulse-control, and personality disorders, as defined with the Diagnosis and Statistical Manual of Mental Disorders fourth edition (DSM-IV) classification.

Pharmaceutical Formulations and Routes of Administration The compounds identified using the methods of the present invention can be administered to a mammal, including a human patient, alone or in pharmaceutical compositions where they are mixed with suitable carriers or excipient(s) at therapeutically effective doses to treat or ameliorate schizophrenia or bipolar disorder related disorders. A therapeutically effective dose further refers to that amount of the compound sufficient to result in amelioration of symptoms as determined by the methods described herein. Preferably, a therapeutically effective dosage is suitable for continued periodic use or administration. Techniques for formulation and administration of the compounds of the instant application may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition.

Routes of Administration Suitable routes of administration include oral, rectal, transmucosal, or intestinal administration, parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal or intraocular injections. A particularly useful method of administering compounds for treating central nervous system disease involves surgical implantation of a device for delivering the compound over an extended period of time. Sustained release formulations of the invented medicaments particularly are contemplated.

Composition/Formulation Pharmaceutical compositions and medicaments for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries. Proper formulation is dependent upon the route of administration chosen.

For injection, the agents of the invention may be formulated in aqueous solutions, W00058510 [htt:/www.etthepatent.com/Log i nod og/Sexa m. suportFetch/efaut. do O58510.cpc?fromCache=l part=maintoolbar=bottom] Page 179 of 737 WO 00/58510 PCT/IB00/00435 177 preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer such as a phosphate or bicarbonate buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation.

Such penetrants are generally known in the art.

Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with fillers such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.

For buccal administration,the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable gaseous propellant, carbon dioxide. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, gelatin, for use in an inhaler or insufflator, may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The compounds may be formulated for parenteral administration by injection, by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Aqueous suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder or lyophilized form for constitution with a suitable vehicle, such as sterile pyrogen-free water, before use.

In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by W00058510 [httQ:.Iwww.etthepatentcomILogin.dog/$exam.supportIFethDefault.dogNVO00 5 8 5 10.cpc?fromCache=1 part=maintoolbar--botom] Page 180 of 737 WO 00/58510 PCT/IB00/00435 178 implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.

Thus, for example, the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

Additionally, the compounds may be delivered using a sustained-release system, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent. Various sustained release materials have been established and are well known by those skilled in the art.

Sustained-release capsules may, depending on their chemical nature, release the compounds for a few weeks up to over 100 days.

Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.

The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.

Effective Dosage.

Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve their intended purpose. More specifically, a therapeutically effective amount means an amount effective to prevent development of or to alleviate the existing symptoms of the subject being treated. Determination of the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays, and a dose can be formulated in animal.models.

Such information can be used to more accurately determine useful doses in humans.

A therapeutically effective dose refers to that amount of the compound that results in amelioration of symptoms in a patient. Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for determining the LD50, (the dose lethal to 50% of the test population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio between LD50 and Compounds which exhibit high therapeutic indices are preferred.

The data obtained from these cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50, with little or no toxicity. The W00058510 [httilJwww.getthe patent. com/L.aindoSexam.supNV00tign o5851l .CpCfromache 1 part=maintoolbar=bottom] Page 181 of 737 WO 00/58510 PCT/IB00/00435 179 dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See, Fingl et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1).

Computer-Related Embodiments As used herein the term "nucleic acid codes of the invention" encompass the nucleotide sequences comprising, consisting essentially of, or consisting of any one of the following: a) a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of SEQ ID No. 1, and the complements thereof, wherein said contiguous span comprises at least one of the following nucleotide positions of SEQ ID No 1: 31 to 292651 and 292844 to 319608.

b) a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of any of SEQ ID Nos. 54 to 229, and the complements thereof, to the extent that such a length is consistent with the particular sequence ID.

c) a contiguous span of at least 8, 12, 15, 18, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 80, 90, 100 or 200 nucleotides, to the extent that such a length is consistent with the particular sequence ID, of SEQ ID Nos. 2 to 26, 36 to 40 or the complements thereof.

d) a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 90 or 100 nucleotides of SEQ ID No. I or the complements thereof wherein said contiguous span comprises at least one of the following nucleotide positions of SEQ ID No 1: 292653 to 296047, 292653 to 292841, 295555 to 296047 and 295580 to 296047; (ii) 31 to 1107, 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854; (iii) 94124 to 94964; (iv) 213818 to 215818, 215819 to 215941,215819 to 215975, 216661 to 216952, 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412, 231787 to 231880, 231870 to 231879, 234174 to 234321, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993 and 241686 to 243685; and 201188 to 216915,201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915; W00058510 [http:Jtwww.qetthepatent.comLogin.dog/Sexam.sup ortFetch/Default.doq00 5 851 O.cpc?fromCache= 1 part=maintoolbar= bottom Page 182 of 737 WO 00/58510 PCT/IB00/00435 180 e) a contiguous span according to c) or wherein said span includes a biallelic marker selected from the group consisting of Al to A489.

f) a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of SEQ ID No. 1 or the complements thereof, wherein said contiguous span comprises at least 1, 2, 3, 5, or 10 nucleotide positions of any one the ranges of nucleotide positions designated posl to posl66 of SEQ ID No. 1 listed in Table 1 above; g) a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of any of SEQ ID Nos. 2 to 26, 36 to 42, 44 to 48 and 52 to 269, and the complements thereof, wherein said span includes a chromosome 13q31-q33related biallelic marker, a Region D-related biallelic marker, an sbgl-, g34665-, sbg2-, g35017or g35018 -related biallelic marker; h) a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of any of SEQ ID Nos 2 to 26, 36 to 40 and 54 to 229, and the complements thereof, wherein said span includes a chromosome 13q3 1-q33-related biallelic marker, a Region D-related biallelic marker, an sbgl-, g34665-, sbg2-, g35017- or g35018 -related biallelic marker with the alternative allele present at said biallelic marker.

i) a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides of any of SEQ ID No 1, and the complements thereof, wherein said span includes a polymorphism selected from the group consisting of Al to A69, A71 to A74, A76 to A94, A96 to A106, A108 to Al 12, Al14 to A177, A179 to A197, A199 to A222, A224 to A242 and 361 to A489.

The "nucleic acid codes of the invention" further encompass nucleotide sequences homologous to a contiguous span of at least 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 500, 1000 or 2000 nucleotides, to the extent that such a length is consistent with the particular sequence of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229, and the complements thereof. The "nucleic acid codes of the invention" also encompass nucleotide sequences homologous to a contiguous span of at least 12, 15, 18, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90 or 100 nucleotides of SEQ ID No. 1 or the complements thereof, wherein said contiguous span comprises at least one of the following nucleotide positions of SEQ ID No. 1: 292653 to 296047, 292653 to 292841, 295555 to 296047 and 295580 to 296047; (ii) 31 to 1107, 1108 to 65853, 1108 to 1289, 14877 to 14920, 18778 to 18862, 25593 to 25740, 29388 to 29502, 29967 to 30282, 64666 to 64812, 65505 to 65853 and 65854 to 67854; (iii) 94124 to 94964; (iv) 213818 to 215818, 215819 to 215941, 215819 to 215975, 21 6 661 to 216952, W0005851 0 rhttp Jww.getthepatent.comflogin .dog/$exam.suportFechDefault.dog/WO0U58510.cpc?tfomCache=l 1art=maintoolbar=bottom age 153 of 737 WO 00/58510 PCT/IB00/00435 181 216661 to 217061, 217027 to 217061, 229647 to 229742, 230408 to 230721, 231272 to 231412,231787 to 231880, 231870 to 231879, 23 4 174 to 234 3 21, 237406 to 237428, 239719 to 239807, 239719 to 239853, 240528 to 240569, 240528 to 240596, 240528 to 240617, 240528 to 240644, 240528 to 240824, 240528 to 240994, 240528 to 241685, 240800 to 240993 and 241686 to 243685; and 201188 to 216915, 201188 to 201234, 214676 to 214793, 215702 to 215746 and 216836 to 216915.

Homologous sequences refer to a sequence having at least 99%, 98%, 97%, 96%, 90%, 85%, 80%, or 75% homology to these contiguous spans. Homology may be determined using any method described herein, including BLAST2N with the default parameters or with any modified parameters. Homologous sequences also may include RNA sequences in which uridines replace the thymines in the nucleic acid codes of the invention. It will be appreciated that the nucleic acid codes of the invention can be represented in the traditional single character format (See the inside back cover of Stryer, Lubert. Biochemistry, 3 rd edition. W. H Freeman Co., New York.) or in any other format or code which records the identity of the nucleotides in a sequence.

As used herein the term "polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43" encompasses the polypeptide sequence of SEQ ID Nos 27 to 35 and 41 to 43, polypeptide sequences homologous to the polypeptides of SEQ ID Nos. 27 to 35 and 41 to 43, or fragments of any of the preceding sequences. Homologous polypeptide sequences refer to a polypeptide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75% homology to one of the polypeptide sequences of SEQ IDNos. 27 to 35 and 41 to 43. Homology may be determined using any of the computer programs and parameters described herein, including FASTA with the default parameters or with any modified parameters. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error as described above. The polypeptide fragments comprise at least 4, 6, 8, 10, 15, 20, 25, 30, 50, 75, 100, or 150 consecutive amino acids of the polypeptides of SEQ ID Nos. 27 to 35 and 41 to 43. Preferably, the fragments are novel fragments. It will be appreciated that the polypeptide codes of the SEQ ID Nos. 27 to 35 and 41 to 43 can be represented in the traditional single character format or three letter format (See the inside back cover of Starrier, Lubert. Biochemistry, 3" edition. W. H Freeman Co., New York.) or in any other format which relates the identity of the polypeptides in a sequence.

It will be appreciated by those skilled in the art that the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 and polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43 can be stored, recorded, and manipulated on any medium which can be read and accessed by a W00058510 fhtto:/lWWW-.atthenatent.com/Looin-doa/Sexam.sunoortIFetchIDefaultldoajO00585 1.cpcfromCacie=dart=maintoolbar bottomlPaae 184 of 737 WO 00/58510 PCT/IB00/00435 182 computer. As used herein, the words "recorded" and "stored" refer to a process for storing information on a computer medium. A skilled artisan can readily adopt any of the presently known methods for recording information on a computer readable medium to generate embodiment comprising one or more of nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229, or one or more of the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43. Another aspect of the present invention is a computer readable medium having recorded thereon at least 2, 5, 10, 25, 30, or 50 nucleic acid codes of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229. Another aspect of the present invention is a computer readable medium having recorded thereon at least 2, 10, 15, 20, 25, 30, or 50 polypeptide codes of SEQ ID Nos 27 to 35 and 41 to 43.

Computer readable media include magnetically readable media, optically readable media, electronically readable media and magnetic/optical media. For example, the computer readable media may be a hard disk, a floppy disk, a magnetic tape, CD-ROM, Digital Versatile Disk (DVD),.

Random Access Memory (RAM), or Read Only Memory (ROM) as well as other types of other media known to those skilled in the art.

Embodiments of the present invention include systems, particularly computer systems which store and manipulate the sequence information described herein. One example of a computer system 100 is illustrated in block diagram form in Figure 19. As used herein, "a computer system" refers to the hardware components, software components, and data storage components used to analyze the nucleotide sequences of the nucleic acid codes of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229, or the amino acid sequences of the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43. In one embodiment, the computer system 100 is a Sun Enterprise 1000 server (Sun Microsystems, Palo Alto, CA). The computer system 100 preferably includes a processor for processing, accessing and manipulating the sequence data. The processor 105 can be any well-known type of central processing unit, such as the Pentium III from Intel Corporation, or similar processor from Sun, Motorola, Compaq or International Business Machines.

Preferably, the computer system 100 is a general purpose system that comprises the processor 105 and one or more internal data storage components 110 for storing data, and one or more data retrieving devices for retrieving the data stored on the data storage components. A skilled artisan can readily appreciate that any one of the currently available computer systems are suitable.

In one particular embodiment, the computer system 100 includes a processor 105 connected to a bus which is connected to a main memory 115 (preferably implemented as RAM) and one or more internal data storage devices 110, such as a hard drive and/or other computer readable media having data recorded thereon. In some embodiments, the computer system 100 further includes one or more data retrieving device 118 for reading the data stored on the internal W00058510 [htttp:twww. getthepatent.comllogin.do /Sexam.supportFetc/Defaul.dogNVO058510.cpc?fromCacl-e=l part=maintoolbar=bottomPae 185 of 737 WO 00/58510 PCT/IB00/00435 183 data storage devices 110.

The data retrieving device 118 may represent, for example, a floppy disk drive, a compact disk drive, a magnetic tape drive, etc. In some embodiments, the internal data storage device 110 is a removable computer readable medium such as a floppy disk, a compact disk, a magnetic tape, etc.

containing control logic and/or data recorded thereon. The computer system 100 may advantageously include or be programmed by appropriate software for reading the control logic and/or the data from the data storage component once inserted in the data retrieving device.

The computer system 100 includes a display 120 which is used to display output to a computer user. It should also be noted that the computer system 100 can be linked to other computer systems 125a-c in a network or wide area network to provide centralized access to the computer system 100.

Software for accessing and processing the nucleotide sequences of the nucleic acid codes of SEQ ID Nos. I to 26, 36 to 40 and 54 to 229, or the amino acid sequences of the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43 (such as search tools, compare tools, and modeling tools etc.) may reside in main memory 115 during execution.

In some embodiments, the computer system 100 may further comprise a sequence comparer for comparing the above-described nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to and 54 to 229 or polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43 stored on a computer readable medium to reference nucleotide or polypeptide sequences stored on a computer readable medium. A "sequence comparer" refers to one or more programs which are implemented on the computer system 100 to compare a nucleotide or polypeptide sequence with other nucleotide or polypeptide sequences and/or compounds including but not limited to peptides, peptidomimetics, and chemicals stored within the data storage means. For example, the sequence comparer may compare the nucleotide sequences of the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229, or the amino acid sequences of the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43 stored on a computer readable medium to reference sequences stored on a computer readable medium to identify homologies, motifs implicated in biological function, or structural motifs. The various sequence comparer programs identified elsewhere in this patent specification are particularly contemplated for use in this aspect of the invention.

Figure 20 is a flow diagram illustrating one embodiment of a process 200 for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database. The database of sequences can be a private database stored within the computer system 100, or a public database such as GENBANK, PIR OR SWISSPROT that is available through the Internet The process 200 begins at a start state 201 and then moves to a state 202 wherein the new W00058510 [httP:/www.getthepatent.com/login.dog/exam.supportFetchDefault.dogWOO0 5

B

5 1 0.cpc?fromCache=l part=maintoolbar=bottom] Page 186 of 737 WO 00/58510 PCT/IB00/00435 184 sequence to be compared is stored to a memory in a computer system 100. As discussed above, the memory could be any type of memory, including RAM or an internal storage device.

The process 200 then moves to a state 204 wherein a database of sequences is opened for analysis and comparison. The process 200 then moves to a state 206 wherein the first sequence stored in the database is read into a memory on the computer. A comparison is then performed at a state 210 to determine if the first sequence is the same as the second sequence. It is important to note that this step is not limited to performing an exact comparison between the new sequence and the first sequence in the database. Well-known methods are known to those of skill in the art for comparing two nucleotide or protein sequences, even if they are not identical. For example, gaps can be introduced into one sequence in order to raise the homology level between the two tested sequences. The parameters that control whether gaps or other features are introduced into a sequence during comparison are normally entered by the user of the computer system.

Once a comparison of the two sequences has been performed at the state 210, a determination is made at a decision state 210 whether the two sequences are the same. Of course, the term "same" is not limited to sequences that are absolutely identical. Sequences that are within the homology parameters entered by the user will be marked as "same" in the process 200.

If a determination is made that the two sequences are the same, the process 200 moves to a state 214 wherein the name of the sequence from the database is displayed to the user. This state notifies the user that the sequence with the displayed name fulfills the homology constraints that were entered. Once the name of the stored sequence is displayed to the user, the process 200 moves to a decision state 218 wherein a determination is made whether more sequences exist in the database. If no more sequences exist in the database, then the process 200 terminates at an end state 220. However, if more sequences do exist in the database, then the process 200 moves to a state 224 wherein a pointer is moved to the next sequence in the database so that it can be compared to the new sequence. In this manner, the new sequence is aligned and compared with every sequence in the database.

It should be noted that if a determination had been made at the decision state 212 that the sequences were not homologous, then the process 200 would move immediately to the decision state 218 in order to determine if any other sequences were available in the database for comparison.

Accordingly, one aspect of the present invention is a computer system comprising a processor, a data storage device having stored thereon a nucleic acid code of SEQ ID NOs. 1 to 26, 36 to 40 and 54 to 229 or a polypeptide code of SEQ ID Nos 27 to 35 and 41 to 43, a data storage device having retrievably stored thereon reference nucleotide sequences or polypeptide sequences to be compared to the nucleic acid code of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to W00058510 [htt:/tMww.getthepatent.comLogin.dog/Sexam.suport/etchDefaultdoWO00851 O.cpc7tromCace=l part=maintoolbar=bottomI Page 187 of 737 WO 00/58510 PCT/IB00/00435 185 229 or polypeptide code of SEQ ID Nos. 27 to 35 and 41 to 43 and a sequence comparer for conducting the comparison. The sequence comparer may indicate a homology level between the sequences compared or identify structural motifs in the above described nucleic acid code of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 and polypeptide codes of SEQ ID Nos. 27 to and 41 to 43or it may identify structural motifs in sequences which are compared to these nucleic acid codes and polypeptide codes. In some embodiments, the data storage device may have stored thereon the sequences of at least 2, 5, 10, 15, 20, 25, 30, or 50 of the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43.

Another aspect of the present invention is a method for determining the level of homology between a nucleic acid code of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 and a reference nucleotide sequence, comprising the steps of reading the nucleic acid code and the reference nucleotide sequence through the use of a computer program which determines homology levels and determining homology between the nucleic acid code and the reference nucleotide sequence with the computer program. The computer program may be any of a number of computer programs for determining homology levels, including those specifically enumerated herein, including BLAST2N with the default parameters or with any modified parameters. The method may be implemented using the computer systems described above. The method may also be performed by reading 2, 15, 20, 25, 30, or 50 of the above described nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 through use of the computer program and determining homology between the nucleic acid codes and reference nucleotide sequences Figure 21 is a flow diagram illustrating one embodiment of a process 250 in a computer for determining whether two sequences are homologous. The process 250 begins at a start state 252 and then moves to a state 254 wherein a first sequence to be compared is stored to a memory. The second sequence to be compared is then stored to a memory at a state 256. The process 250 then moves to a state 260 wherein the first character in the first sequence is read and then to a state 262 wherein the first character of the second sequence is read. It should be understood that if the sequence is a nucleotide sequence, then the character would normally be either A, T, C, G or U. If the sequence is a protein sequence, then it should be in the single letter amino acid code so that the first and sequence sequences can be easily compared.

A determination is then made at a decision state 264 whether the two characters are the same. If they are the same, then the process 250 moves to a state 268 wherein the next characters in the first and second sequences are read. A determination is then made whether the next characters are the same. If they are, then the process 250 continues this loop until two characters are not the same. If a determination is made that the next two characters are not the W0005851 0 [http:/hvww.getthepatent.comlogin .dog/Sexam.support/Fetc/DefauIt.dogIWO005851 0.cpc?fromCache= 1 part=maintooibar-bottom] Page 188 of 737 WO 00/58510 PCT/IB00/00435 186 same, the process 250 moves to a decision state 274 to determine whether there are any more characters either sequence to read.

If there aren't any more characters to read, then the process 250 moves to a state 276 wherein the level of homology between the first and second sequences is displayed to the user.

The level of homology is determined by calculating the proportion of characters between the sequences that were the same out of the total number of sequences in the first sequence. Thus, if every character in a first 100 nucleotide sequence aligned with a every character in a second sequence, the homology level would be 100%.

Alternatively, the computer program may be a computer program which compares the nucleotide sequences of the nucleic acid codes of the present invention, to reference nucleotide sequences in order to determine whether the nucleic acid code of SEQ ID Nos. 1 to 26, 36 to and 54 to 229 differs from a reference nucleic acid sequence at one or more positions. Optionally such a program records the length and identity of inserted, deleted or substituted nucleotides with respect to the sequence of either the reference polynucleotide or the nucleic acid code of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229. In one embodiment, the computer program may be a program which determines whether the nucleotide sequences of the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 contain a biallelic marker or single nucleotide polymorphism (SNP) with respect to a reference nucleotide sequence. This single nucleotide polymorphism may comprise a single base substitution, insertion, or deletion, while this biallelic marker may comprise abour one to ten consecutive bases substituted, inserted or deleted.

Another aspect of the present invention is a method for determining the level of homology between a polypeptide code of SEQ ID Nos. 27 to 35 and 41 to 43 and a reference polypeptide sequence, comprising the steps of reading the polypeptide code of SEQ ID Nos. 27 to 35 and 41 to 43 and the reference polypeptide sequence through use of a computer program which determines homology levels and determining homology between the polypeptide code and the reference polypeptide sequence using the computer program.

Accordingly, another aspect of the present invention is a method for determining whether a nucleic acid code of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 differs at one or more nucleotides from a reference nucleotide sequence comprising the steps of reading the nucleic acid code and the reference nucleotide sequence through use of a computer program which identifies differences between nucleic acid sequences and identifying differences between the nucleic acid code and the reference nucleotide sequence with the computer program. In some embodiments, the computer program is a program which identifies single nucleotide polymorphisms. The method may be implemented by the computer systems described above and the method illustrated in Figure 21.

The method may also be performed by reading at least 2, 5, 10, 15, 20, 25, 30, or 50 of the nucleic W0058510 http:/twww.getthepatentcom/Loga g/Sexam.supoprt/Fetch/Default.dog0005851O .cpc?fromCache= part=maintoolbar=botom] Page 189 of 737 WO 00/58510 PCT/IB00/00435 187 acid codes of SEQ ID Nos. 1 to 26,36 to 40 and 54 to 229 and the reference nucleotide sequences through the use of the computer program and identifying differences between the nucleic acid codes and the reference nucleotide sequences with the computer program.

In other embodiments the computer based system may further comprise an identifier for identifying features within the nucleotide sequences of the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or the amino acid sequences of the polypeptide codes of SEQ ID Nos.

27 to 35 and 41 to 43.

An "identifier" refers to one or more programs which identifies certain features within the above-described nucleotide sequences of the nucleic acid codes of SEQ ID Nos. I to 26, 36 to 40 and 54 to 229 or the amino acid sequences of the polypeptide codes of SEQ ID Nos. 27 to and 41 to 43. In one embodiment, the identifier may comprise a program which identifies an open reading frame in the cDNAs codes of SEQ ID Nos 2 to 26 and 36 to Figure 22 is a flow diagram illustrating one embodiment of an identifier process 300 for detecting the presence of a feature in a sequence. The process 300 begins at a start state 302 and then moves to a state 304 wherein a first sequence that is to be checked for features is stored to a memory 115 in the computer system 100. The process 300 then moves to a state 306 wherein a database of sequence features is opened. Such a database would include a list of each feature's attributes along with the name of the feature. For example, a feature name could be "Initiation Codon" and the attribute would be "ATG". Another example would be the feature name "TAATAA Box" and the feature attribute would be "TAATAA". An example of such a database is produced by the University of Wisconsin Genetics Computer Group (www.gcg.com).

Once the database of features is opened at the state 306, the process 300 moves to a state 308 wherein the first feature is read from the database. A comparison of the attribute of the first feature with the first sequence is then made at a state 310. A determination is then made at a decision state 316 whether the attribute of the feature was found in the first sequence.

If the. attribute was found, then the process 300 moves to a state 318 wherein the name of the found feature is displayed to the user.

The process 300 then moves to a decision state 320 wherein a determination is made whether move features exist in the database. If no more features do exist, then the process 300 terminates at an end state 324. However, if more features do exist in the database, then the process 300 reads the next sequence feature at a state 326 and loops back to the state 310 wherein the attribute of the next feature is compared against the first sequence.

It should be noted, that if the feature attribute is not found in the first sequence at the decision state 316, the process 300 moves directly to the decision state 320 in order to W00058510 [htto:tww.getthepatent.comlLogin.dog/Sexam.supportFetch/Defaul.dogAN0005851 0.cpc?fromCache=1 part=maintoolbar= bottoml Page 190 of 737 WO 00/58510 PCT/IB00/00435 188 determine if any more features exist in the database.

In another embodiment, the identifier may comprise a molecular modeling program which determines the 3-dimensional structure of the polypeptides codes of SEQ ID Nos. 27 to and 41 to 43. In some embodiments, the molecular modeling program identifies target sequences that are most compatible with profiles representing the structural environments of the residues in known three-dimensional protein structures. (See, Eisenberg et al., U.S. Patent No. 5,436,850 issued July 25, 1995). In another technique, the known three-dimensional structures of proteins in a given family are superimposed to define the structurally conserved regions in that family. This protein modeling technique also uses the known three-dimensional structure of a homologous protein to approximate the structure of the polypeptide codes of SEQ ID Nos. 4 to 8. (See Srinivasan, et al., U.S. Patent No. 5,557,535 issued September 17, 1996). Conventional homology modeling techniques have been used routinely to build models of proteases and antibodies. (Sowdhamini et al., Protein Engineering 10:207, 215 (1997)).

Comparative approaches can also be used to develop three-dimensional protein models when the protein of interest has poor sequence identity to template proteins. In some cases, proteins fold into similar three-dimensional structures despite having very weak sequence identities. For example, the three-dimensional structures of a number of helical cytokines fold in similar threedimensional topology in spite of weak sequence homology.

The recent development of threading methods now enables the identification of likely folding patterns in a number of situations where the structural relatedness between target and template(s) is not detectable at the sequence level. Hybrid methods, in which fold recognition is performed using Multiple Sequence Threading (MST), structural equivalencies are deduced from the threading output using a distance geometry program DRAGON to construct a low resolution model, and a full-atom representation is constructed using a molecular modeling package such as QUANTA.

According to this 3-step approach, candidate templates are first identified by using the novel fold recognition algorithm MST, which is capable of performing simultaneous threading of multiple aligned sequences onto one or more 3-D structures. In a second step, the structural equivalencies obtained from the MST output are converted into interresidue distance restraints and fed into the distance geometry program DRAGON, together with auxiliary information obtained from secondary structure predictions. The program combines the restraints in an unbiased manner and rapidly generates a large number of low resolution model confirmations.

In a third step, these low resolution model confirmations are converted into full-atom models and subjected to energy minimization using the molecular modeling package QUANTA. (See Asz6di et al., Proteins:Structure, Function, and Genetics, Supplement 1:38-42 (1997)).

W0005851 0 fhttptww.getthe patent.comlag in.dog/Sexa m.su00ortFetcoefault.dOgAN005851 O.cpctromCache= 1 part=maintoolbar=bottom] Page 191 of 737 WO 00/58510 PCT/IB00/00435 189 The results of the molecular modeling analysis may then be used in rational drug design techniques to identify agents which modulate the activity of the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43.

Accordingly, another aspect of the present invention is a method of identifying a feature within the nucleic acid codes of SEQ ID Nos. I to 26, 36 to 40 and 54 to 229 or the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43 comprising reading the nucleic acid code(s) or the polypeptide code(s) through the use of a computer program which identifies features therein and identifying features within the nucleic acid code(s) or polypeptide code(s) with the computer program. In one embodiment, computer program comprises a computer program which identifies open reading frames. In a further embodiment, the computer program identifies structural motifs in a polypeptide sequence. In another embodiment, the computer program comprises a molecular modeling program. The method may be performed by reading a single sequence or at least 2, 5, 10, 15, 20, 25,30, or 50 of the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43 through the use of the computer program and identifying features within the nucleic acid codes or polypeptide codes with the computer program.

The nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43 may be stored and manipulated in a variety of data processor programs in a variety of formats. For example, the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or the polypeptide codes of SEQ ID Nos. 27 to and 41 to 43 may be stored as text in a word processing file, such as MicrosoftWORD or WORDPERFECT or as an ASCII file in a variety of database programs familiar to those of skill in the art, such as DB2, SYBASE, or ORACLE. In addition, many computer programs and databases may be used as sequence comparers, identifiers, or sources of reference nucleotide or polypeptide sequences to be compared to the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43. The following list is intended not to limit the invention but to provide guidance to programs and databases which are useful with the nucleic acid codes of SEQ ID Nos. 1 to 26, 36 to 40 and 54 to 229 or the polypeptide codes of SEQ ID Nos. 27 to 35 and 41 to 43. The programs and databases which may be used include, but are not limited to: MacPattern (EMBL), DiscoveryBase (Molecular Applications Group), GeneMine (Molecular Applications Group), Look (Molecular Applications Group), MacLook (Molecular Applications Group), BLAST and BLAST2 (NCBI), BLASTN and BLASTX (Altschul et al, J. Mol. Biol. 215: 403 (1990)), FASTA (Pearson and Lipman, Proc. Natl.

Acad. Sci. USA, 85: 2444 (1988)), FASTDB (Brutlag et al. Comp. App. Biosci. 6:237-245, 1990), Catalyst (Molecular Simulations Inc.), Catalyst/SHAPE (Molecular Simulations Inc.), W00058510 [http:/Awww.getthepatentcomflogin dog/Sexam.supportFetch/Defaut.dociN00585 1 0.cpc?fromCache= 1 part=maintoolbar bottom] Pae 192 of 737 WO 00/58510 PCT/IB00/00435 190 Cerius 2 .DBAccess (Molecular Simulations Inc.), HypoGen (Molecular Simulations Inc.), Insight II, (Molecular Simulations Inc.) Discover (Molecular Simulations Inc.), CHARMm (Molecular Simulations Inc.), Felix (Molecular Simulations Inc.), DelPhi, (Molecular Simulations Inc.), QuanteMM, (Molecular Simulations Inc.), Homology (Molecular Simulations Inc.), Modeler (Molecular Simulations Inc.) ISIS (Molecular Simulations Inc.), Quanta/Protein Design (Molecular Simulations Inc.) WebLab (Molecular Simulations Inc.), WebLab Diversity Explorer (Molecular Simulations Inc.) Gene Explorer (Molecular Simulations Inc.), SeqFold (Molecular Simulations Inc.), the EMBL/Swissprotein database, the MDL Available Chemicals Directory database, the MDL Drug Data Report data base, the Comprehensive Medicinal Chemistry database, Derwents's World Drug Index database, the BioByteMasterFile database, the Genbank database, and the Genseqn database. Many other programs and data bases would be apparent to one of skill in the art given the present disclosure.

Motifs which may be detected using the above programs include sequences encoding leucine zippers, helix-turn-helix motifs, glycosylation sites, ubiquitination sites, alpha helices, and beta sheets, signal sequences encoding signal peptides which direct the secretion of the encoded proteins, sequences implicated in transcription regulation such as homeoboxes, acidic stretches, enzymatic active sites, substrate binding sites, and enzymatic cleavage sites.

Throughout this application, various publications, patents, and published patent applications are cited. The disclosures of the publications, patents, and published patent specifications referenced in this application are all hereby incorporated by reference in their entireties into the present disclosure to more fully describe the state of the art to which this invention pertains.

EXAMPLES

Several of the methods of the present invention are described in the following examples, which are offered by way of illustration and not by way of limitation. Many other modifications and variations of the invention as herein set forth can be made without departing from the spirit and scope thereof and therefore only such limitations should be imposed as are indicated by the appended claims.

Example 1 Identification Of Biallelic Markers DNA Extraction Donors were unrelated and healthy. They presented a sufficient diversity for being representative of a heterogeneous population. The DNA from 100 individuals was extracted and tested for the detection of the biallelic markers.

W 0585 10 [ftftpJtww.getthepatent.comcoLoin.dogSexam.supportFetchlDefaul.dogO005 8 510.ccfromCache=1 part=maintoolbar=bottom] Page 193 of 737 WO 00/58510 PCT/IB00/00435 191 ml of peripheral venous blood were taken from each donor in the presence of EDTA.

Cells (pellet) were collected after centrifugation for 10 minutes at 2000 rpm. Red cells were lysed by a lysis solution (50 ml final volume: 10 mM Tris pH7.6; 5 mM MgCI2; 10 mM NaCI).

The solution was centrifuged (10 minutes, 2000 rpm) as many times as necessary to eliminate the residual red cells present in the supernatant, after resuspension of the pellet in the lysis solution.

The pellet of white cells was lysed overnight at 42 0 C with 3.7 ml of lysis solution composed of: 3 ml TE 10-2 (Tris-HCI 10 mM, EDTA 2 mM) /NaCI 0 4 M 200 pi SDS 500 pi K-proteinase (2 mg K-proteinase in TE 10-2 NaCI 0.4 M).

For the extraction of proteins, 1 ml saturated NaCI (6M) (1/3.5 v/v) was added. After vigorous agitation, the solution was centrifuged for 20 minutes at 10000 rpm.

For the precipitation of DNA, 2 to 3 volumes of 100% ethanol were added to the previous supernatant, and the solution was centrifuged for 30 minutes at 2000 rpm. The DNA solution was rinsed three times with 70% ethanol to eliminate salts, and centrifuged for minutes at 2000 rpm. The pellet was dried at 37 0 C, and resuspended in 1 ml TE 10-1 or I ml water. The DNA concentration was evaluated by measuring the OD at 260 nm (1 unit OD pg/ml DNA). To determine the presence of proteins in the DNA solution, the OD 260 OD 280 ratio was determined. Only DNA preparations having a OD 260 OD 280 ratio between 1.8 and 2 were used in the subsequent examples described below.

The pool was constituted by mixing equivalent quantities of DNA from each individual.

Example 2 Identification Of Biallelic Markers: Amplification Of Genomic DNA By PCR The amplification of specific genomic sequences of the DNA samples of Example I was carried out on the pool of DNA obtained previously. In addition, 50 individual samples were similarly amplified.

PCR assays were performed using the following protocol: Final volume 25 pl DNA 2 ng/pl MgCl 2 2 mM dNTP (each) 200 pM primer (each) 2.9 ng/pl W0005851 0 fhflto~ww-aattheioatent.com/Loqin-~doq/Sexam.surooart/FetchDefault.doaAN000585 1 0.cpc?fromCar-he= 1 part=maintoo~bar--botomj Page 194 of 737 WO 00/58510 PCT/EBOO/00435 Ampli Taq Gold DNA polymerase PCR buffer (IOx 0. 1 M TrisHCl pH8.3 0.5M KCI) 0.05 unitpi lx Each pair of first primers was designed using the sequence information of genomic S. DNA sequences of SEQ ID Nos 1 to 26, 36 to 40 and 54 to 229 disclosed herein and the OSP software (Hillier Green, 1991). This first pair of primers was about 20 nucleotides in length and had the sequences disclosed in Table 6a in the columns labeled "Position range of amplification primer in SEQ ID No." and "Complementary position range of amplification primer in SEQ ID No.".

Table 6a Amplicon SEQ Primer Position range of Primer Complementary ED No name amplification primer name position range of in SEQ ED amplification primer 99-27943 1 BI 7938 7958 Cl1 8446 8465 8-121 1 B2 14699 14718 C2 15100 15118 99-27935 1 B3 21365 21385 C3 21845 21864 8-122 1 B34 25409 25426- C4 25825 25844 8-123 1 B5 29349 29366 C5 29684 29701 8-147 1 B6 29900 29919 C6 30340 30356 99-34243 1 B7 49219 49239 C7 49664 49684 8-127 1 B8 64639 64657 C8 64981 64999 8-128 1 B9 65453 65471 C9 165856 65874 8-129 1 BIO 65547 65566 CIO 65949 65966 99-34240 1 BIl 75629 75649 CII 76140 76158 99-31959 1 B12 94254 94273 C12 94683 94703 99-31960 1 B13 95034 95053 C 13 95543 95563 99-31962 1 B14 96707 96727 C 14 97222 97242 99-44282 1 B15 106357 106377 C15 106805 106822 99-24656 1 B 16 107022 107040 C16 107495 107513 99-24636 1 B17 107132 107152 C17 107613 107630 99-31939 1 B18 108425 108444 C18 108916 108935 99-44281 1 B19 109333 109353 C 19 109848 109868 99-31941 1 B20 112149 112169 C20 112720 112740 99-31942 1 B21 115144 115162 C21 115617 115637 W00058510 [http,:/www.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.dogNO00585l 0.cc?fromCache= 1 part= maintoolbar= bottom] Page 195 of 737 WO 00/58510 PCTIBOO/00435 99-24635 1 B22 155353 155373 C22 155805 155822 99-16059 1 B23 157860 157878 C23 158296 158316 99-24634 1 B24 160770 160787 C24 161240 161257 99-24639 1 B25 160279 160298 C25 160785 160802 99-7652 1 B26 168813 168830 C26 169331 169351 99-16100 1 B27 170666 170686 C27 171153 171173 99-5862 1 B28 173065 173085 C28 173495 173514 99-16083 1 B29 173830 173850 C29 174309 174327 99-16044 1 B30 175453 175470 C30 175881 175901 99-16042 1 B31 180464 180481 C31 180991 181008 99-5919 1 B32 189753 189771 C32 190187 190207 99-24658 1 B33 197116 197135 C33 197555 197572 99-30364 1 B34 198666 198684 C34 199148 199168 99-30366 1 B35 200145 200162 C35 200663 200683 99-16094 1 B36 204263 204282 C36 204643 204662 99-24644 1 B37 204741 204758 C37 205222 205240 99-16107 1 B38 206103 206120 C38 206548 206568 99-15873 1 B39 211454 211471 C39 211893 211910 8-124 1 B40 214564 214581 C40 214965 214983 8-125 1 B41 215506 215525 C41 215924 215942 8-132 1 B42 215628 215647 C42 215998 216016 99-13929 1 B43 215749 215769 C43 216210 216228 8-131 1 B44 216473 216491 C44 216883 216900 8-130 1 B45 216683 216702 C45 217091 217109 8-209 1 B46 217119 217136 C46 217521 217539 99-5897 1 B47 219408 219425 C47 219882 219899 99-24649 1 B48 220505 220522 C48 221004 221021 8-199 1 B49 221384 221402 C49 221807 221824 8-198 1 B50 221740 221759 C50 222167 222185 8-195 1 B51 222696 222713 C51 223073 223093 99-13925 1 B52 223499 223518 C52 224013 224033 8-192 1 B53 225103 225120 C53 225505 225524 99-16090 1 B54 225995 226013 C54 226510 226530 8-189 1 B55 226211 226230 C55 226615 226632 W0005851 0 fttD llww.gettheatent.comLogin.dog/Sexam.suportFetchiDefaut.dogWO005851 0.cpc?fromCache= 1 part=maintoolbar--bottoml page 196 of 737 WO 00/58510 PCT/IBOO/00435 8-188 1 B56 226569 226588 C56 226988 227005 8-187 1 B57 226915 226934 C57 227319 227338 8-185 1 B58 227468 227487 C58 227888 227907 90-16051 1 B59 227768 227788 C59 228214 228231 8-184 1 B60 227832 227849 C60 228234 228252 8-183 1 B61 228209 228227 C61 228635 228654 8-181 1 B62 228898 228917 C62 229499 229517 8-180 1 B63 229443 229462 C63 229624 229642 8-179 1 B64 229442 229459 C64 229857 229874 8-143 1 B65 229487 229506 C65 229896 229913 8-178 1 B66 229739 229756 C66 230141 230159 8-177 1 B67 230097 230115 C67 230517 230536 8-119 1 B68 230210 230227 C68 230622 230641 8-138 1 B69 230517 230536 C69 230899 230917 8-175 1 B70 230705 230724 C70 231127 231144 99-15870 1 B71 231278 231298 C71 231729 231747 8-142 1 B72 231084 231103 C72 231485 231503 8-145 1 B73 231588 231605 C73 231990 232007 8-171 1 B74 232147 232166 C74 232547 232566 8-170 1 B75 232405 232423 C75 232830 232849 8-169 1 B76 232744 232762 C76 233145 233163 8-168 1 B77 233056 233074 C77 233461 233479 8-235 1 B78 233314 233334 C78 233785 233801 8-137 1 B79 234039 234058 C79 1234440 234458 8-165 1 B80 234516 234533 C80 234916 234935 99-16087 1 B81 235081 235101 C81 235515 235533 8-157 1 B82 237972 237989 C82 238381 238399 8-155 1 B83 238607 238626 C83 239029 239046 9§9-16038 1 B84 239405 239425 C84 239862 239880 8-136 1 B85 239606 239624 C85 240012 240029 8-153 1 B86 239651 239670 C86 240058 240075 8-135 1 B87 240356 240375 C87 240691 240708 99-16050 1 B88 240518 240538 C88 240988 241006 8-144 1 1 B89 1240810 1240828 1C89 241217 241235 W0005851 0 [http:/twww.qetthepatent.com/Ltogin.dog/SexamsuportFetc/DefauItdoqMvOO05851 0crpc~fromCarhe= 1 part=maintobar--boftom1 Page 197 of 737 WO 00/58510 PCTJIBOO/00435 8-141 1 B90 241094 241113 C90 241502 241520 99-15880 1 B91 241700 241717 C91 242151 242171 8-140 1 B92 241373 241392 C92 241773 241792 8-240 1 B93 242169 242188 C93 242571 242588 8-225 1 B94 244172 244191 C94 244574 244593 99-25940 1 B95 247513 247533 C95 248023 248043 99-16032 1 B96 248204 248223 C96 248588 248606 99-16055 1 B97 253315 253333 C97 253816 253834 99-16105 1 B98 255697 255715 C98 256133 256152 99-16101 1 B99 258138 258155 C99 258606 258623 99-16033 1 BIOO 259885 259902 C100 260324 260342 99-15875 1 BIOI 279626 279644 CIOl 280154 280173 99-13521 1 B102 287977 287995 C102 288484 288504 8-112 1 B103 292501 292519 C 103 292901 292920 8-111 1 B104 295376 295395 C 104 295777 295795 8-110 1 BIOS 295682 295701 CIO05 296102 296119 8-134 1 B106 295812 295830 C106 296143 296161 99-7462 1 B107 298946 298964 C107 299459 299476 99-16052 1 B1O8 300153 300170 C108 300660 300680 99-16047 1 B109 311615 311632 C109 312126 312144 99-25993 1 BIl10 315649 315668 CHlO 316129 316147 99-25101 1 Bill1 316925 1316943 ClII 1317378 1317395 Amplicon SEQ Primer Position range of Primer Complementary ED No name amplification primer name position range of in SEQ ED) amplification primer SEQ ED 8-94 162 BI112 1250 1267 CI112 1651 1669 8-95 161 B1 13 1125 1144 CI 13 1526 1543 8-97 160 B1 14 1249 1268 CI114 1581 1598 8-98 159 BI 1 1135 1154 CIl15 1550 1568 99-14021 151 B1 16 1394 1411 C1 16 1853 1870 99-14364 152 B1 17 1344 1364 C1 17 1798 1816 99-15056 115 B1 18 1098 1118 CII18 1582 1599 99-15063 116 BI119 1347 1364 C1 19 11784 11804 99-15065 117 B120 1120 1140 C120 1568 1585 W0005851 0 1 .c?fromCache= 1 part=maintoolbar-bottoml.Page18o 3 WO 00/58510 PCT/EB0OI00435 99-15229 157 B121 1419 1437 C 121 1893 1912 99-15231 163 B 122 1189 1209 C122 1701 1719 99-15232 155 B 123 1211 1228 C123 1677 1695 99-15239 164 B124 1139 1156 C124 1579 1599 99-15252 118 B125 1 18 C125 434 451 99-15253 119 B126 1120 1138 C126 1578 1596 99-15256 120 B127 1110 1127 C127 1548 1565 99-15258 121 B128 1165 1183 C 128 1685 1705 99-15261 122 B129 1302 1320 C 129 1782 1802 99-15280 123 B130 1070 1087 COO0 1590 1610 99-15355 124 B 131 1352 1369 C131 1822 1840 99-15663 175 B 132 1349 1369 C132 1781 1798 99-15664 176 B133 1184 1203 C133 11667 1685 99-15665 174 B134 1423 1441 C 134 11879 1898 99-15668 177 B135 1363 1380 C135 1801 1821 99-15672 173 B136 1120 1138 C136 1649 1666 99-15682 178 B137 1184 1202 C137 1665 1683 99-16081 113 B138 114 131 C138 556 575 99-16082 114 B 139 16 33 C139 527 547 99-20933 179 B 140 1130 1149 C140 1563 1581 99-20977 147 B 141 1430 1447 C 141 1921 1941 99-20978 148 B 142 1124 1144 C 142 1571 1589 99-20981 149 B 143 1202 1219 C 143 1630 1650 99-20983 150 B 144 1099 1119 C 144 1530 1548 99-22310 154 B 145 1183 1203 C 145 1630 1648 99-25029 180 B 146 1292 1307 C146 1722 1741 99-25224 125 B 147 937 955 C147 1446 1466 99-25869 181 B 148 1320 1340 C 148 1849 1868 99-25881 182 B 149 1227 1245 C 149 1693 1713 99-25897 183 B150 1242 1262 C150 1736 1756 99-25906 184 B151 1374 1392 C151 1888 1908 99-25917 185 B152 11115 1135 C152 1595 1615 99-25924 186 1B153 11287 1306 C 153 1717 1736 W0005851 01 f/wwAgetthe patent. co m/Loqin.d og/Sexam.suporIFetch/Defa uIt. d 09MOO058 51 0.cpc?fro mC ache= 1 part= m aintoo lba r--bottoml Pagie 199 of 73 7 WO 00/58510 PCT/EBOO/00435 99-25950 126 B154 1381 1399 C154 1859 1879 99-25961 127 B155 1391 1411 C155 1854 1873 99-25965 128 B156 1429 1449 C156 1879 1899 99-25966 129 B157 1219 1239 C157 1721 1741 99-25967 130 B158 1064 1084 C158 1537 1556 99-25969 131 B159 1171 1191 C159 1680 1700 99-25972 132 B160 1368 1388 C160 1795 1815 99-25974 133 B161 1100 1120 C161 1623 1643 99-25977 134 B162 1191 1211 C162 1710 1730 99-25978 135 B163 1155 1175 C163 1644 1663 99-25979 136 B164 1409 1427 C164 1924 1944 99-25980 137 B165 1332 1352 C165 1817 1837 99-25984 138 B166 1293 1310 C166 1794 1812 99-25985 139 B167 1308 1328 C167 1756 1776 99-25989 140 B168 1346 1366 C168 1880 1898 99-26126 165 B169 1004 1022 C169 1525 1545 99-26138 187 B170 1309 1327 C170 1741 1761 99-26146 188 B171 1314 1334 C171 1746 1764 99-26147 141 B172 1433 1453 C172 1879 1896 99-26150 142 B173 1323 1340 C173 1758 1776 99-26153 143 B174 1458 E1476 C174 1885 1905 99-26154 144 B175 1396 1415 C175 1903 1920 99-26156 145 B176 1212 1229 C176 1702 1722 99-26166 166 B177 1237 1257 C177 1739 1757 99-26167 167 B178 1319 1339 C178 1759 1778 99-26169 168 B179 1262 1282 C179 1693 1711 99-26171 169 B180 1431 1450 C180 1860 1880 99-26183 170 B 181 1348 1367 C181 1798 1818 99-26189 189 B182 1215 1235 C182 1644 1664 99-26190 190 B183 1071 1091 C183 1502 1520 99-26191 191 B184 1095 1115 C184 1539 1558 99-26201 192 B185 1304 1324 C185 1749 1767 99-26222 193 B186 1354 1373 C186 1843 1863 W0005851 0 [ht:/Mvww.getthepatent.comLogin.dog/$examsuprleclealdgWO55 0.].rmace atEano~arbtIage 200 of 737 WO 00/58510 PCTAIBOOIOO435 99-26223 194 B187 1277 1297 C187 1842 1862 99-26225 195 B188 1355 1375 C188 1805 1825 99-26228 196 B189 1330 1350 C189 1792 1812 99-26233 197 B190 1254 1274 C190 1755 1775 99-26234 198 B 191 1379 1399 C191 1813 1833 99-26238 199 B 192 1235 1255 C 192 1668 1686 99-5873 146 B193 1176 1194 C193 1632 1649 99-5912 171 B194 1463 1483 C194 1946 1963 99 -6012 158 B195 1292 1310 C 195 1758 1776 99-6080 156 B196 1061 1081 C196 1572 1589 99-7308 153 B 197 1345 1362 C197 1814 1834 99-7337 172 B198 1298 1318 C198 1731 1748 99-16106 200 B199 32 50 C199 518 535 99-25332 201 B200 1 18 C200 461 478 99-25516 202 B201 1 18 C201 385 404 99-26173 203 B202 1033 1052 C202 1570 1589 99227 204 B203 983 1002 C203 1553 1573 99-26284 205 B204 1460 1480 C204 1874 1894 99-26559 206 B205 1187 1207 C205 1650 1670 99-26769 207 B206 1249 1267 C206 1707 1727 99-26772 208 B207 1235 1254 C207 1702 1722 99-26776 209 B208 1294 1314 C208 1755 1775 99-26779 210 B209 1072 1089 C209 1548 1568 99-26781 211 B21 0 1477 1497 C210 1905 1925 99-26782 212 B21 1 1202 1221 C21 1 1695 1715 99-26783 213 B212 1421 1440 C212 1857 1877 99-26787 214 B213 1406 1425 C213 1872 1892 99-26789 215 B214 1301 1319 C214 1771 1791 99-27297 216 B215 1206 1224 C215 1761 1779 99-27306 217 B216 1395 1415 C216 1822 1842 99-27312 218 B217 11445 1463 C217 1940 1960 99-27323 219 B218 1132 1150 C218 1610 1628 99-27335 B219 1322 1342 C219 1768 1788 W00058510 [http: Iw.etthepatent.com/Lo in.dog/Sexam.supprt/Fetch/Default.doqVO005851 0.cpc?fromCache= 1art=maintoolbar=bottom] Page201 of 737 WO 00/58510 PCT/IB00/00435 199 99-27345 221 B220 1139 1159 C220 1672 1689 99-27349 222 B221 1337 1355 C221 1748 1767 99-27352 223 B222 1250 1269 C222 1677 1697 99-27353 224 B223 1085 1105 C223 1584 1604 99-27360 225 B224 1361 1381 C224 1793 1812 99-27361 226 B225 1322 1340 C225 1815 1834 99-27365 227 B226 1081 1099 C226 1590 1609 99-27680 228 B227 1 18 C227 509 526 99-27912 229 B228 1230 1250 C228 1659 1679 99-30329 112 B229 1 18 C229 496 514 Preferably, the primers contained a common oligonucleotide tail upstream of the specific bases targeted for amplification which was useful for sequencing.

Primers from the column labeled "Position range of amplification primer in SEQ ID No." contain the following additional PU 5' sequence: TGTAAAACGACGGCCAGT (SEQ ID No. 126); primers from the column labeled "Complementary position range of amplification primer in SEQ ID No." contain the following RP 5' sequence: CAGGAAACAGCTATGACC (SEQ ID No. 127).

The synthesis of these primers was performed following the phosphoramidite method, on a GENSET UFPS 24.1 synthesizer.

DNA amplification was performed on a Genius II thermocycler. After heating at 95 0

C

for 10 min, 40 cycles were performed. Each cycle comprised: 30 sec at 95C, 54 0 C for 1 min, and 30 sec at 72 0 C. For final elongation, 10 min at 72 0 C ended the amplification. The quantities of the amplification products obtained were determined on 96-well microtiter plates, using a fluorometer and Picogreen as intercalant agent (Molecular Probes).

Example 3 Identification of Polymorphisms a) Identification of Biallelic Markers from Amplified Genomic DNA of Example 2 The sequencing of the amplified DNA obtained in Example 2 was carried out on ABI 377 sequencers. The sequences of the amplification products were determined using automated dideoxy terminator sequencing reactions with a dye terminator cycle sequencing protocol. The products of the sequencing reactions were run on sequencing gels and the sequences were determined using gel image analysis (ABI Prism DNA Sequencing Analysis software (2.1.2 version)).

The sequence data were further evaluated to detect the presence of biallelic markers W0005851 0 [httpwww.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.dog/WO0058 5 10.cpc?fromCache= 1 part=maintoolbar=bottom] Page 202 of 737 WO 00/58510 PCT/IBOO/00435 within the amplified fragments. The polymorphism search was based on the presence of superimposed peaks in the electrophoresis pattern resulting from different bases occurring at the same position as described previously.

The localization of the biallelic markers detected in the fragments of amplification are as shown below in Table 6b.

Table 6b Biallelic Markers Amplicon BM Marker Polymor- SEQ BM Position of Probe Name phism ID No. position probes in No.

All__ A112 in SEQID SEQ ID No.

99-27943 Al 99-27943-150 G C 1 8316 8304 8328 PI 8-121 A2 8-121-28 A T 1 14726 14714 14738 P2 8-121 A3 8-121-36 C T 1 14734 14722 14746 P3 8-121 A4 8-121-154 A T 1 14852 14840 14864 P4 8-121 A5 8-121-187 A C 1 14885 14873 14897 8-121 A6 8-121-243 G T 1 14941 14929 14953 P6 8-121 A7 8-121-281 A C 1 14979 14967 14991 P7 8-121 A8 8-121-352 C T 1 15050 15038 15062 P8 8-121 A9 8-121-364 C T 1 15062 15050 15074 P9 8-121 A10 8-121-371 A G 1 15069 15057 15081 Pl0 99-27935 All 99-27935-193 G C 1 21672 21660 21684 P11 8-122 A12 8-122-72 A T 1 25480 25468 25492 P12 8-122 A13 8-122-100 C T 1 25508 25496 25520 P13 8-122 A14 8-122-271 deletion of 1 25679 25667 25691 P14

CAAA

8-122 A15 8-122-272 A A 1 25680 25668 25692 8-122 A16 8-122-326 A A 1 25734 25722 25746 P16 8-122 A17 8-122-360 C C 1 25768 25756 25780 P17 8-123 A18 8-123-55 A A 1 29403 29391 29415 P18 8-123 A19 8-123-189 C C 1 29537 29525 29549 P19 8-123 A20 8-123-197 C C 1 29545 29533 29557 8-123 A21 8-123-307 G G 1 29655 29643 29667 P21 8-147 A22 8-147-270 A A 1 30169 30157 30181 P22 W00058510 [http:/vww.Qetthepatent.com/Login.dog/Sexam.support/Fetch/Default.dog/WA0058510.cpc?fromCache= 1 part=maintoolbar=bottom] Page203of737 WO 00/58510 PCT/IBOO/00435 99-34243 A23 99-34243-210 A A 1 49475 49463 49487 P23 8-127 A24 8-127-28 A A 1 64666 64654 64678 P24 8-127 A25 8-127-119 A A 1 64757 64745 64769 8-127 A26 8-127-159 A A 1 64797 64785 64809 P26 8-127 A27 8-127-236 C C 1 64874 64862 64886 P27 8-127 A28 8-127-240 A A 1 64878 64866 64890 P28 8-127 A29 8-127-280 G G 1 64918 64906 64930 P29 8-128 A30 8-128-33 C C 1 65485 65473 65497 8-128 A31 8-128-52 A A 1 65504 65492 65516 P31 8-128 A32 8-128-61 G G 1 65513 65501 65525 P32 8-128 A33 8-128-68 C C 1 65520 65508 65532 P33 8-128 A34 8-128-69 A A 1 65521 65509 65533 P34 8-128 A35 8-128-85 A A 1 65537 65525 65549 8-129 A36 8-129-50 C C 1 65596 65584 65608 P36 8-129 A37 8-129-60 deletion of 1 65607 65594 65618 P37

A

8-129 A38 8-129-311 A G 1 65857 65845 65869 P38 8-129 A39 8-129-401 C T 1 65947 65935 65959 P39 99-34240 A40 99-34240-492 A T 1 75667 75655 75679 99-31959 A41 99-31959-281 C T 1 94534 94522 94546 P41 99-31960 A42 99-31960-363 A G 1 95396 95384 95408 P42 99-31962 A43 99-31962-250 C T 1 96956 96944 96968 P43 99-31962 A44 99-31962-450 A G 1 97156 97144 97168 P44 99-44282 A45 99-44282-439 A G 1 106384 106372 106396 99-44282 A46 99-44282-54 C T i 106769 106757 106781 P46 99-24656 A47 99-24656-137 A G 1 107158 107146 107170 P47 99-24656 A48 99-24656-260 A IG 1 107281 107269 107293 P48 99-24636 A49 99-24636-22 A G 1 107609 107597 107621 P49 99-31939 A50 99-31939-75 A G 1 108499 108487 108511 99-31939 A51 99-31939-273 C T 1 108697 108685 108709 P51 99-44281 A52 99-44281-418 G T 1 109451 109439 109463 P52 99-44281 A53 99-44281-257 A G 1 109612 109600 109624 P53 99-44281 A54 99-44281-77 A G 1 109792 109780 109804 P54 99-31941 A55 99-31941-320 G T 1 112468 112456 112480 W00058510 [t!p:/ww.getthepatent.com/Loin.dogi/Sexam.support/Fetch/Default.dogNVO0058510.cpc?fromCache= 1 part=maintoo-bar-bottom] Page 204 of 737 WO 00/58510 PCT/IBOO/00435 99-31942 A56 99-31942-325 G T 1 115468 115456 115480 P56 99-24635 A57 99-24635-79 A T 1 155736 155724 155748 P57 99-16059 A58 99-16059-313 A G 1 158172 158160 158184 P58 99-24639 A59 99-24639-169 C T 1 160634 160622 160646 P59 99-24639 A60 99-24639-163 A C 1 160640 160628 160652 99-24634 A61 99-24634-108 A T 1 160876 160864 160888 P61 99-7652 A62 99-7652-162 A G 1 168974 168962 168986 P62 99-7652 A63 99-7652-488 A G 1 169300 169288 169312 P63 99-16100 A64 99-16100-83 C T 1 170746 170734 170758 P64 99-16100 A65 99-16100-147 A G 1 170810 170798 170822 99-16100 A66 99-16100-195 G T 1 170858 170846 170870 P66 99-16100 A67 99-16100-197 C T 1 170860 170848 170872 P67 99-16100 A68 99-16100-244 C T 1 170906 170894 170918 P68 99-16100 A69 99-16100-381 A C 1 171043 171031 171055 P69 99-5862 A70 99-5862-167 A G 1 173358 173346 173370 99-16083 A71 99-16083-101 C T 1 174227 174215 174239 P71 99-16044 A72 99-16044-351 C T 1 175800 175788 175812 P72 99-16042 A73 99-16042-420 A G 1 180589 180577 180601 P73 99-16042 A74 99-16042-31 G C 1 180978 180966 180990 P74 99-5919 A75 99-5919-215 A G 1 189957 189945- 189969 99-24658 A76 99-24658-410 A G 1 197163 197151 197175 P76 99-30364 A77 99-30364-299 A G 1 198964 198952 198976 P77 99-30366 A78 99-30366-112 G T 1 200256 200244 200268 P78 99-16094 A79 99-16094-75 G T 1 204588 204576 204600 P79 99-24644 A80 99-24644-194 A G 1 204934 204922 204946 99-16107 A81 99-16107-95 A T 1 206197 206185 206209 P81 99-16107 A82 99-16107-161 A G 1 206263 206251 206275 P82- 99-16107 A83 99-16107-383 C T 1 206485 206473 206497 P83 99-15873 A84 99-15873-303 C T 1 211608 211596 211620 P84 8-124 A85 8-124-106 A G 1 214669 214657 214681 8-124 A86 8-124-220 A G 1 214783 214771 214795 P86 8-124 A87 8-124-294 A G 1 214857 214845 214869 P87 8-124 A88 8-124-316 C T 1 214879 214867 214891 P88 8-124 A89 8-124-383 A T 1 214946 214934 214958 P89 W00058510[httpi/www.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.doQg/WNVO0058510.cpc?fromCache= 1 part=maintoolbar=bottom] Page205of737 WO 00/58510 PCT/IBOO/00435 8-125 A90 8-125-33 C T 1 215538 215526 215550 8-132 A91 8-132-312 A G 1 215705 215693 215717 P91 8-132 A92 8-132-179 A T 1 215838 215826 215850 P92 8-132 A93 8-132-164 A G 1 215853 215841 215865 P93 8-132 A94 8-132-97 A G 1 215920 215908 215932 P94 99-13929 A95 99-13929-201 G T 1 216028 216016 216040 8-131 A96 8-131-363 G T 1 216538 216526 216550 P96 8-131 A97 8-131-199 G T 1 216702 216690 216714 P97 8-130 A98 8-130-236 C T 1 216874 216862 216886 P98 8-130 A99 8-130-220 G T 1 216890 216878 216902 P99 8-130 AI00 8-130-144 C T 1 216966 216954 216978 P100 8-130 AI01 8-130-143 A G 1 216967 216955 216979 P101 8-130 A102 8-130-102 C T 1 217008 216996 217020 P102 8-130 A103 8-130-101 G T 1 217009 216997 217021 P103 8-130 A104 8-130-83 A C 1 217027 217015 217039 P104 8-209 A105 8-209-333 A G 1 217207 217195 217219 P105 8-209 A106 8-209-290 A C 1 217250 217238 217262 P106 99-5897 A107 99-5897-143 A C 1 219540 219528 219552 P107 99-24649 A108 99-24649-186 A G 1 220836 220824 220848 P108 99-24649 A109 99-24649-80 G C 1 220942 220930 220954 P109 8-199 All0 8-199-84 G T 1 221741 221729 221753 P110 8-198 Al 8-198-138 A G 1 222048 222036 222060 PIll 8-195 A112 8-195-348 C T 1 222746 222734 222758 P112 99-13925 A113 99-13925-97 A G 1 223595 223583 223607 P113 8-192 A114 8-192-82 A G 1 225443 225431 225455 P114 99-16090 A115 99-16090-225 A G 1 226219 226207 226231 P115 8-189 A116 8-189-340 Deletion of 1 226282 226270 226309 P116 CTAT 4 8-189 A117 8-189-146 G T 1 226487 226475 226499 P117 8-188 A118 8-188-136 C T 1 226870 226858 226882 P118 8-187 A119 8-187-352 G T 1 226987 226975 226999 P119 8-185 A120 8-185-319 G T 1 227589 227577 227601 P120 8-185 A121 8-185-296 A T 1 227612 227600 227624 P121 99-16051 A122 99-16051-226 C T 1 228006 227994 228018 P122 W0005851 0 [http:/Aww.getthepatent.comIogin.dog/Sexam.support/Fetch/Default.dogAWO005851 0.cpc?fromCache= 1 part=maintoolbar=bottoml Page 206 of 737 WO 00/58510 PCT/IBO0/00435 99-16051 A123 99-16051-164 A G 1 228068 228056 228080 P123 8-184 A124 8-184-119 A T 1 228134 228122 228146 P124 8-184 A125 8-184-27 A C 1 228226 228214 228238 P125 8-183 A126 8-183-401 C T 1 228254 228242 228266 P126 8-181 A127 8-181-449 C T 1 229069 229057 229081 P127 8-181 A128 8-181-350 A T 1 229168 229156 229180 P128 8-181 A129 8-181-259 A G 1 229259 229247 229271 P129 8-181 A130 8-181-230 A T 1 229288 229276 229300 P130 8-181 A131 8-181-210 A T 1 229308 229296 229320 P131 8-181 A132 8-181-165 C T 1 229353 229341 229365 P132 8-181 A133 8-181-163 C T 1 229355 229343 229367 P133 8-181 A134 8-181-83 C T 1 229435 229423 229447 P134 8-180 A135 8-180-157 A T 1 229486 229474 229498 P135 8-143 A136 8-143-332 A C 1 229582 229570 229594 P136 8-143 A137 8-143-327 A G 1 229587 229575 229599 P137 8-143 A138 8-143-311 A G 1 229603 229591 229615 P138 8-143 A139 8-143-308 A G 1 229606 229594 229618 P139 8-179 A140 8-179-268 A C 1 229607 229595 229619 P140 8-143 A141 8-143-306 A G 1 229608 229596 229620 P141 8-143 A142 8-143-245 G T 1 229669 229657 229681 P142 8-143 A143 8-143-242 A G 1 229672 229660 229684 P143 8-143 A144 8-143-239 C T 1 229675 229663 229687 P144 8-143 A145 8-143-232 G C 1 229682 229670 229694 P145 8-143 A146 8-143-152 G C 1 229762 229750 229774 P146 8-178 A147 8-178-199 G C 1 229961 229949 229973 P147 8-178 A148 8-178-123 Deletion of 1 230037 230025 230049 P148

A

8-119 A149 8-119-404 C T 1 230238 230226 230250 P149 8-177 Al50 8-177-281 C T 1 230256 230244 230268 P150 8-119 AI51 8-119-377 C T 1 230265 230253 230277 P151 8-119 A152 8-119-309 C T 1 230333 230321 230345 P152 8-119 A153 8-119-294 G T 1 230348 230336 230360 P153 8-119 A154 8-119-284 G C 1 230358 230346 230370 P154 8-119 A155 8-119-272 A T 1 230370 230358 230382 P155 W00058510[http //www.getthepatent.com/Login.dog/Sexam.suDpport/Fetch/Default.dogNW0O0058510.cpc?fromCache= 1 part=maintoolbar=bottom] Page 207 of 737 WO 00/58510 PCT/IBOO/00435 8-119 A156 8-119-262 A T 1 230380 230368 230392 P156 8-119 A157 8-119-248 C T 1 230394 230382 230406 P157 8-119 A158 8-119-247 A G 1 230395 230383 230407 P158 8-119 A159 8-119-210 A C 1 230432 230420 230444 P159 8-119 A160 8-119-204 A C 1 230438 230426 230450 P160 8-119 A161 8-119-200 A G 1 230442 230430 230454 P161 8-119 A162 8-119-195 A C 1 230447 230435 230459 P162 8-119 A163 8-119-125 C T 1 230517 230505 230529 P163 8-119 A164 8-119-120 A G 1 230522 230510 230534 P164 8-119 A165 8-119-97 C T 1 230545 230533 230557 P165 8-119 A166 8-119-93 G T 1 230549 230537 230561 P166 8-119 A167 8-119-38 A T 1 230604 230592 230616 P167 8-138 A168 8-138-234 C T 1 230684 230672 230696 P168 8-138 A169 8-138-218 A G 1 230700 230688 230712 P169 8-138 A170 8-138-163 C T 1 230755 230743 230767 P170 8-138 A171 8-138-54 insertion 1 230864 230852 230876 P171

TA

8-175 A172 8-175-75 G T 1 231070 231058 231082 P172 8-142 A173 8-142-386 C T 1 231118 231106 231130 P173 8-142 A174 8-142-370 C T 1 231134 231122 231146 P174 8-142 A175 8-142-211 deletion 1 231290 231278 231302 P175

CAAA

8-142 A176 8-142-132 A G 1 231372 231360 231384 P176 8-145 A177 8-145-339 C T 1 231669 231657 231681 P177 99-15870 A178 99-15870-400 A G 1 231677 231665 231689 P178 8-145 A179 8-145-231 A T 1 231777 231765 231789 P179 8-145 A180 8-145-197 C T 1 231811 231799 231823 P180 8-145 A181 8-145-154 C T 1 231854 231842 231866 P181 8-145 A182 8-145-138 A C 1 231870 231858 231882 P182 8-145 A183 8-145-78 G C 1 231930 231918 231942 P183 8-171 A184 8-171-247 C T 1 232320 232308 232332 P184 8-170 A185 8-170-373 C T 1 232477 232465 232489 P185 8-169 A186 8-169-266 A G 1 232898 232886 232910 P186 8-169 A187 8-169-166 G T 1 232998 232986 233010 P187 W00058510 [http:jwwwgetthepatent.comLogin.dog/Sexam.support/Fetch/Default.dogN00058510.cpc?fromCache= 1 part=maintoolbar=bottom] Page208 of 737 WO 00/58510 PCT/IBOO/00435 8-168 A188 8-168-380 A G 1 233100 233088 233112 P188 8-235 A189 8-235-349 C T 1 233453 233441 233465 P189 8-235 A190 8-235-182 G T 1 233620 233608 233632 P190 8-137 A191 8-137-340 G C 1 234120 234108 234132 P191 8-137 A192 8-137-182 C T 1 234277 234265 234289 P192 8-137 A193 8-137-152 A C 1 234307 234295 234319 P193 8-165 A194 8-165-185 G C 1 234751 234739 234763 P194 99-16087 A195 99-16087-219 G C 1 235315 235303 235327 P195 8-157 A196 8-157-177 A C 1 238223 238211 238235 P196 8-155 A197 8-155-258 C T 1 238789 238777 238801 P197 99-16038 A198 99-16038-118 C T 1 239763 239751 239775 P198 8-136 A199 8-136-166 A G 1 239864 239852 239876 P199 8-136 A200 8-136-145 A G 1 239885 239873 239897 P200 8-136 A201 8-136-80 C T 1 239950 239938 239962 P201 8-153 A202 8-153-32 A G 1 240044 240032 240056 P202 8-135 A203 8-135-212 A G 1 240497 240485 240509 P203 8-135 A204 8-135-166 G T 1 240543 240531 240555 P204 8-135 A205 8-135-112 A G 1 240597 240585 240609 P205 99-16050 A206 99-16050-235 G C 1 240772 240760 240784 P206 8-144 A207 8-144-378 C T 1 240858 240846 240870 P207 8-144 A208 8-144-234 C T 1 241002 240990 241014 P208 8-144 A209 8-144-196 A T 1 241040 241028 241052 P209 8-144 A210 8-144-127 deletion 1 241002 240090 241014 P210

TGGATA

C

8-141 A211 8-141-304 C T 1 241217 241205 241229 P211 8-141 A212 8-141-260 C T 1 241261 241249 241273 P212 8-141 A213 8-141-161 G T 1 241360 241348 241372 P213 8-140 A214 8-140-286 A G 1 241507 241495 241519 P214 8-140 A215 8-140-173 A C 1 241620 241608 241632 P215 8-140 A216 8-140-108 G C 1 241685 241673 241697 P216 8-140 A217 8-140-41 A G 1 241752 241740 241764 P217 99-15880 A218 99-15880-162 A G 1 241861 241849 241873 P218 8-240 A219 8-240-187 G T 1 242402 242390 242414 P219 W0005851 0 [http:/www.getthepatent.com/Login.dog/Sexam.supportVFetch/Default.dogNVO005851 0.cpc?fromCache= 1 part=maintoolbar=bottom] Page 209 of 737 WO 00/58510 PCT/IBOO/00435 8-225 A220 8-225-281 A T 1 244313 244301 244325 P220 99-25940 A221 99-25940-186 A G 1 247860 247848 247872 P221 99-25940 A222 99-25940-182 C T 1 247864 247852 247876 P222 99-16032 A223 99-16032-292 G T 1 248315 248303 248327 P223 99-16055 A224 99-16055-216 A G 1 253619 253607 253631 P224 99-16105 A225 99-16105-152 A G 1 255848 255836 255860 P225 99-16101 A226 99-16101-436 C T 1 258573 258561 258585 P226 99-16033 A227 99-16033-244 A G 1 260099 260087 260111 P227 99-15875 A228 99-15875-165 C T 1 279789 279777 279801 P228 99-13521 A229 99-13521-31 A G 1 288007 287995 288019 P229 8-112 A230 8-112-241 C T 1 292680 292668 292692 P230 8-112 A231 8-112-155 A C 1 292766 292754 292778 P231 8-112 A232 8-112-45 A T 1 292876 292864 292888 P232 8-111 A233 8-111-301 deletion 1 295491 295479 295503 P233

AGAT

8-110 A234 8-110-404 G C 1 295716 295704 295728 P234 8-110 A235 8-110-89 A G 1 296031 296019 296043 P235 8-134 A236 8-134-94 C T 1 296068 296056 296080 P236 99-7462 A237 99-7462-508 C T 1 298969 298957 298981 P237 99-16052 A238 99-16052-214 A G 1 300365 300353 300377 P238 99-16047 A239 99-16047-115 A G 1 312030 312018 312042 P239 99-25993 A240 99-25993-280 G C 1 315928 315916 315940 P240 99-25993 A241 99-25993-367 A G 1 316014 316002 316026 P241 99-25101 A242 99-25101-151 A G 1 317245 317233 317257 P242 Amplicon BM Marker Polymor- SEQ BM Position of Probe Name phism ID No. position probes in s _-lll all2 SEIDNo.

8-94 A243 8-94-252 A G 162 1501 1489 1513 P243 8-95 A244 8-95-43 T C 161 1501 1489 1513 P244 8-97 A245 8-97-98 G A 160 1501 1489 1513 P245 8-98 A246 8-98-68 T C 159 1501 1489 1513 P246 99-14021 A247 99-14021-108 A G 151 1501 1489 1513 P247 99-14364 A248 99-14364-415 G A 152 1501 1489 1513 P248 99-15056 A249 99-15056-99 G A 115 1501 1489 1513 P249 W00058510 [http J/www.getthepatent.com/Login.dog/exam.suportFetchDefaut.dog/WOO56b 1 o.cpc~trom(acfle 1 part=maintoolbar=bottmJ Page 210 o 737 WO 00/58510 PCT/IBOO/00435 99-15063 A250 99-15063-155 A C 116 1501 1489 1513 P250 99-15065 A251 99-15065-85 C G 117 1501 1489 1513 P251 99-15229 A252 99-15229-412 T C 157 1501 1489 1513 P252 99-15231 A253 99-15231-219 T G 163 1501 1489 1513 P253 99-15232 A254 99-15232-291 G T 155 1501 1489 1513 P254 99-15239 A255 99-15239-377 G C 164 1501 1489 1513 P255 99-15252 A256 99-15252-404 C T 118 404 392 416 P256 99-15253 A257 99-15253-382 C T 119 1501 1489 1513 P257 99-15256 A258 99-15256-392 C T 120 1501 1489 1513 P258 99-15258 A259 99-15258-337 G T 121 1501 1489 1513 P259 99-15261 A260 99-15261-202 A G 122 1501 1489 1513 P260 99-15280 A261 99-15280-432 C T 123 1501 1489 1513 P261 99-15355 A262 99-15355-150 C T 124 1501 1489 1513 P262 99-15663 A263 99-15663-298 G A 175 1501 1489 1513 P263 99-15664 A264 99-15664-185 C A 176 1501 1489 1513 P264 99-15665 A265 99-15665-398 T C 174 1501 1489 1513 P265 99-15668 A266 99-15668-139 C T 177 1501 1489 1513 P266 99-15672 A267 99-15672-166 G A 173 1501 1489 1513 P267 99-15682 A268 99-15682-318 A T 178 1501 1489 1513 P268 99-16081 A269 99-16081-217 C T 113 330 318 342 P269 99-16082 A270 99-16082-218 A G 114 233 221 245 P270 99-20933 A271 99-20933-81 T G 179 1501 1489 1513 P271 99-20977 A272 99-20977-72 A C 147 1501 1489 1513 P272 99-20978 A273 99-20978-89 C G 148 1501 1489 1513 P273 99-20981 A274 99-20981-300 A G 149 1501 1489 1513 P274 99-20983 A275 99-20983-48 T C 150 1501 1489 1513 P275 99-22310 A276 99-22310-148 G A 154 1501 1489 1513 P276 99-25029 A277 99-25029-241 G A 180 1501 1489 1513 P277 99-25224 A278 99-25224-189 A G 125 1126 1114 1138 P278 99-25869 A279 99-25869-182 A C 181 1501 1489 1513 P279 99-25881 A280 99-25881-275 G T 182 1501 1489 1513 P280 99-25897 A281 99-25897-264 A T 183 1501 1489 1513 P281 99-25906 A282 99-25906-131 G T 184 1501 1489 1513 P282 99-25917 A283 99-25917-115 G A 185 1501 1489 1513 P283 W00058510 [http://www.getthepatent-com/Login.dog/Sexam.support/Fetch/Default.dog/WO0058510.cpc?tromCache= 1 part=maintoolbar= bottomIP__age 211 ot 737 WO 00/58510 PCT/IBOO/00435 99-25924 A284 99-25924-215 G C 186 1501 1489 1513 P284 99-25950 A285 99-25950-121 G C 126 1501 1489 1513 P285 99-25961 A286 99-25961-376 T G 127 1501 1489 1513 P286 99-25965 A287 99-25965-399 T C 128 1501 1489 1513 P287 99-25966 A288 99-25966-241 T C 129 1501 1489 1513 P288 99-25967 A289 99-25967-57 T C 130 1501 1489 1513 P289 99-25969 A290 99-25969-200 C A 131 1501 1489 1513 P290 .99-25972 A291 99-25972-317 G A 132 1501 1489 1513 P291 99-25974 A292 99-25974-143 T C 133 1501 1489 1513 P292 99-25977 A293 99-25977-311 A G 134 1501 1489 1513 P293 99-25978 A294 99-25978-166 T C 135 1501 1489 1513 P294 99-25979 A295 99-25979-93 A G 136 1501 1489 1513 P295 99-25980 A296 99-25980-173 A T 137 1501 1489 1513 P296 99-25984 A297 99-25984-312 G A 138 1501 1489 1513 P297 99-25985 A298 99-25985-194 C T 139 1501 1489 1513 P298 99-25989 A299 99-25989-398 T C 140 1501 1489 1513 P299 99-26126 A300 99-26126-498 A G 165 1501 1489 1513 P300 99-26138 A301 99-26138-193 C T 187 1501 1489 1513 P301 99-26146 A302 99-26146-264 C A 188 1501 1489 1513 P302 99-26147 A303 99-26147-396 G A 141 1501 1489 1513 P303 99-26150 A304 99-26150-276 T C 142 1501 1489 1513 P304 99-26153 A305 99-26153-44 A C 143 1501 1489 1513 P305 99-26154 A306 99-26154-107 G T 144 1501 1489 1513 P306 99-26156 A307 99-26156-290 A C 145 1501 1489 1513 P307 99-26166 A308 99-26166-257 G A 166 1501 1489 1513 P308 99-26167 A309 99-26167-278 T C 167 1501 1489 1513 P309 99-26169 A310 99-26169-211 T C 168 1501 1489 1513 P310 99-26171 A311 99-26171-71 A G 169 1501 1489 1513 P311 99-26183 A312 99-26183-156 C T 170 1501 1489 1513 P312 99-26189 A313 99-26189-164 C A 189 1501 1489 1513 P313 99-26190 A314 99-26190-20 C A 190 1501 1489 1513 P314 99-26191 A315 99-26191-58 G A 191 1501 1489 1513 P315 99-26201 A316 99-26201-267 C G 192 1501 1489 1513 P316 99-26222 A317 99-26222-149 A G 193 1501 1489 1513 P317 W0005851 0 [tjwwwgetthepatent.com/Login.do/$exam.supportFetch/efault.dogWO0058-51 c.cpc.tromCachie=l1Part=maintoolbar--boftomI Page 212 01 737 WO 00/58510 PCT111B00100435 99-26223 A318 99-26223-225 G T 194 1501 1489 11513 P318 99-26225 A319 99-26225-148 G T 195 1501 1489 1513 P319 99-26228 A320 99-26228-172 G C 196 1501 1489 1513 P320 99-26233 A321 99-26233-275 T C 197 1501 11489 1513 P321 99-26234 A322 99-26234-336 C G 198 1501 1489 1513 P322 99-26238 A323 99-26238-186 T A 199 1501 1489 1513 P323 99-5873 A324 99-5873-159 G A 146 1501 1489 1513 P324 99-5912 A325 99-5912-49 A G 171 11501 1489 1513 P325 99-6012 A326 99-6012-220 G T 158 1501 1489 1513 P326 99-6080 A327 99-6080-99 G JA 156 1501 1489 1513 P327 99-7308 A328 99-7308-157 C T 153 1501 1489 1513 P328 99-7337 A329 99-7337-204 A C 172 1501 1489 1513 P329 99-16106 A330 99-16106-48 G T 200 79 67 91 P330 99-25332 A331 199-25332-125 A G 201 125 113 1137 P331 99-25516 A332 99-25516-307 C T 202 306 294 318 P332 99-26173 A333 99-26173-470 C T 203 1501 1489 1513 P333 99-26267 A334 99-26267-524 C IT 204 1501 11489' 1513 P334 99-26284 A335 99-26284-394 G A 205 1501 1489 1513 P335 99-26559 A336 99-26559-315 A G 206 1501 1489 1513 P336 99-26769 A337 99-26769-256 A T 207 1501 1489- 1513 P337 99-26772 A338 99-26772-268 C T 208 1501 1489 1513 P338 99-26776 A339 99-26776-209 G T 209 1501 1489 1513 P339 99-26779 A340 99-26779-437 0 C 210 1497 1485 1509 P340 99-26781 A341 99-26781-25 G T 211 1501 1489 1513 P341 99-26782 A342 99-26782-300 A G 212 1501 1489 11513 P342 99-26783 A343 99-26783-81 A T 213 1501 1489 1513 P343 99-26787 A344 99-26787-96 A G 214 1501 1489 15*13 P344 99-26789 A345 99-26789-201 C T 215 1501 1489 1513 P345 99-27297 A346 99-27297-280 T IC 216 1501 1489 1513 P346 99-27306 A347 99-27306-108 C T 217 1501 1489 1513 P347 99-27312 A348 99-27312-58 A C 218 1501 1489 1513 P348 99-27323 A349 99-27323-372 G C 219 1501 1489 1513 P349 99-27335 A350 99-27335-191 A C 220 1501 1489 1513 P350 99-27345 A351 99-27345-189 C G 221 1501 1489 1513 P351 W0005851 0 [ptwp ttheeatent.comlogin.dogla mP 213 of 737 WO 00/58510 PCT/IB00/00435 211 99-27349 A352 99-27349-267 G A 222 1501 1489 1513 P352 99-27352 A353 99-27352-197 C G 223 1501 1489 1513 P353 99-27353 A354 99-27353-105 T C 224 1501 1489 1513 P354 99-27360 A355 99-27360-142 G T 225 1501 1489 1513 P355 99-27361 A356 99-27361-181 A G 226 1501 1489 1513 P356 99-27365 A357 99-27365-421 C T 227 1501 1489 1513 P357 99-27680 A358 99-27680-484 G T 228 484 472 496 P358 99-27912 A359 99-27912-272 C T 229 1501 1489 1513 P359 99-30329 A360 99-30329-380 C T 112 380 368 392 P360 Certain biallelic markers of the invention are insertions or deletions, as indicated above.

In particular, the deletion of the nucleotides AGAT (A223, biallelic marker 8-111-301) in Table 6b above may comprise a single deletion of the AGAT motif, or deletions of two or more AGAT motifs. This marker (A223) may thus also serve as a microsatellite marker.

BM refers to "biallelic marker". All 1 and all2 refer respectively to allele I and allele 2 of the biallelic marker.

b) Identification of Polymorphisms by Comparison of Genomic DNA from Overlapping BACs Genomic DNA from multiple BACs derived from the same DNA donor sample and overlapping in regions of genomic DNA of SEQ ID No. 1 was sequenced. Sequencing was carried out on ABI 377 sequencers. The sequences of the amplification products were determined using automated dideoxy terminator sequencing reactions with a dye terminator cycle sequencing protocol. The products of the sequencing reactions were run on sequencing gels and the sequences were determined using gel image analysis (ABI Prism DNA Sequencing Analysis software (2.1.2 version)).

The sequence data from the overlapping regions of SEQ ID No. 1 were evaluated to detect the presence of sequence polymorphisms. The comparison of sequences identified sequence polymorphisms including single nucleotide substitutions and deletions, and multiple nucleotide deletions. The localization of these polymorphisms within SEQ ID No. 1 is shown below in Table 6c.

Table 6c Polymorphisms Ref. No. Polymorphism Allele 1 Allele 2 Position in SEQ ID type No. 1 A361 Deletion AAGG 61595 to 61598 A362 Deletion ATTTT 75217 to 75221 W0005851 0.[httpJ/Mvw~getthepatent.comL gnadog/exa m.suportIFetchDefa ult.dogAN00058 5 10 0cpc?fromCa cle= 1 part= ma intool bar--bottom I Paq e 2 14 of 737 WO 00/58510 PCT/IBOO/00435 A363 Polymnorphic base C T 75367 A364 Deletion CACA 88634 to 88637 A365 Polymorphic base A G 90113 A366 Deletion ACAC 93698 to 93701 A367 Polymnorphic base C T 94209 A368 Deletion AATG 94331 to 94334 A369 Polymorphic base A G 95396 A370 Polymnorphic base C T 95810 A371 Polyrnorphic base C T 96956 A372 Polymnorphic base A G 97156 A373 Deletion CT1TCMTCT to 98758 A374 Deletion TA 04314 to 104315 A375 Polymnorphic base A C 104455 A376 Polymnorphic base A G 104699 A377 Polymnorphic base C T106253 A378 Polymorphic base A T 106272 A379 Polymnorphic base A C 106350 A380 Polymnorphic base A G 106384 A381 Polymorphic base A G 107158 A382 Deletion AT 107168 to 107169 A383 Polymorphic base A G 107609 A384 Polymnorphic base A G 108032 A385 Deletion ATGGAGATGGC 108668 to 108816

AACACCTACAT

GTGACCM1CC

AGCATGGCAGT

CTCAGAGTGGA

TATGGCAACAG

CTGCACATGAC

CTCTCCAGCAT

GGCAGTCTCAG

AGTGGATATGG

CAACAGCTGCA

CATGACCTCTC

CGGCATGGCAG

A386 Polymnorphic base G T 110222 A387 Polymnorphic base A G 1 11978 A388 Polymnorphic base G T 112468 A389 Deletion ACTT 1 17324 to 117327 A390 Polymnorphic base C T 118972 A391 Deletion 119160 to 119161 A392 Polymnorphic base C T 119316 A393 Polymnorphic base A G 119321 A394 Polymnorphic base A G 119526 A395 Polymnorphic base A G 120573 A396 Polymnorphic base A C 121527 A397 Polymnorphic base C T 126105 A398 Polymnorphic base C G 129789 A399 Polymnorphic base A G 130777 A400 Deletion ATT 136942 to 136944 A401 Polymnorphic base A T 143839 A402 Polymnorphic base C T 146668 A403 Polymnorphic base C T 147281 A404 Polymnorphic base G T 147505 IA405 Deletion T 148183 W0005851 0 [http:/Avww.getthepatent.romfLogin.dog/Sexam.support/Fetch/DefautdogAN0005851 0.cpc?tromCache= 1part~maintoolbar--bottomlEage 215 of 737 WO 00/58510 PCTIBOOIOO435 A406 Polymorphic base A C 148372 A407 Polymorphic base A G 149012 A408 Polymorphic base C T 149113 A409 Polymorphic base A G 151637 A410 Deletion G A41 I Polymorphic base A G 151769 A412 Polymorphic base C T151847 A413 Polymorphic base A C 152691 A414 Polymorphic base A G 152766 A415 Polymorphic base C T 153046 A416 Polymorphic base A G 153123 A417 Polymorphic base C T 153925 A418 Polymorphic base G T 153977 A419 Polymorphic base C T 154502 A420 Polymorphic base A G 154677 A421 Polymorphic base C T 154879 A422 Polymorphic base G T 154918 A423 Polymorphic base C T 155802 .A424 Polymorphic base A G 156448 A425 Polymorphic base A C 157238 A426 Polymorphic base A G 157897 A427 Polymorphic base A G 158172 A428 Polymorphic base A G 158302 A429 Deletion TT 1585 10to 158511 A430 Polymorphic base C T -158803 A431 Polymorphic base C 160172 A432 Polymorphic base C T_ 160634 A433 Polymorphic base C 161236 A434 Polymorphic base A G 162810 A435 Polymorphic base A G 163007 A436 Polymorphic base A G 164877 A437 Polymorphic base C T166844 A438 Deletion TCTC to 166914 A439 Polymorphic base A G 167754 A440 Polymorphic base C T 167787 A441 Polymrorphic base G T 167894 A442 Polymorphic base C T -168346 A443 Polymorphic base A G 168414 A444 Polymorphic base A C 168453 A445 Polymorphic base A G 169300 .A446 Polymorphic base C T -169451 A447 Polymorphic base A G 169627 A448 Polymorphic base C T 169984 A449 Polymorphic base C T 170199 A450 Polymorphic base C T 1 70746 A451I Polymorphic base G T 170858 A452 Polymorphic base C T 170860 A453 Polymorphic base C T 170906 A454 Polymorphic base A G 171309 A455 iPolymorphic base A G 171413 .A456 Polymorphic base C T -171504 A457 Polymorphic base C T -171539 A458 Polymorphic base C T171728 A459 Polymorphic base A G 171898 1A460 Deletion AA 172125 to 172126 W0005851 0 fhttolwww aL-heratentcom/Loindoa]Sexam.suot~rtFetchDefautdoaNVO005851 0.cgpc?fromCache=1 oart=maintoolbar--bottoml Paae 216 of 737 WO 00/58510 PCTIBOOIOO435 A461 Polymorphic base A G 172295 A462 Polymorphic base A G 172298 A463 Polymorphic base A G -172336 A464 Polymorphic base A G -173145 A465 Polymorphic base C T 173304 A466 Polymorphic base C T 174227 A467 Polymorphic base A G 174397 A468 Polymorphic base C T -179154 A469 Polymorphic base C G 180233 A470 Polymorphic base A G 182552 A471 Polymorphic base C T 182733 A472 Deletion A 182773 A473 Polymorphic base A G 185759 A474 Deletion T A475 Deletion TATC to 186979 A476 Polymorphic base A T -188755 A477 Polymorphic base A C 188991 A478 Polymorphic base C T 189002 A479 Polymorphic base A G 189154 A480 Polymorphic base A G189177 A481I Polymorphic base A G 189604 A482 Polymorphic base C T 190063 A483 Deletion T 191 164 A484 Deletion A 193880 A485 Polymorphic base A G 193897 A486 Polymorphic base A T 194441 A487 Dletion T 194459 A488 Polymorphic base A T 195306 A489 Deletion TATC to 226326 Example 4 Validation Of The Polymorphisms Through Microsequencing The biallel ic markers identified in Example 3a were further confirmed and their respective frequencies were determined through microsequencing. Microsequencing was carried out for each individual DNA sample described in Example 1.

Amplification from genomic DNA of individuals was performed by PCR as described above for the detection of the biallelic markers with the same set of PCR primers (Table 6a).

The preferred primers used in microsequencing were about 19 nucleotides in length and hybridized just upstream of the considered polymorphic base. According to the invention, the primers used in microsequencing are detailed in Table 6d.

Table 6d Marker Name Biallelic SEQ Mis. I Position range of Mis. 2 Complementary Marker ED No. microsequencing position range of primer mis. 1 in microsequencing SEQ ED) No. primer mis. 2 in ___SEQ H) No.

99-27943-150 Al I II DI 18273 835 1El 187 135 W00058510 [http:/ww.getthepatent.com/Login.dog$/Sexamsupport/Fetch/Default.dogNVW00058510.cpc?tromCache=1 part=maintoolbar-=bottom] Page 217 of 737 WO 00/58510 PCT/IBOO/00435 8-121-28 A2 1 D2 14707 14725 E2 14727 14745 8-121-36 A3 1 D3 14715 14733 E3 14735 14753 8-121-154 A4 1 D4 14833 14851 E4 14853 14871 8-121-187 A5 1 D5 14866 14884 E5 14886 14904 8-121-243 A6 I D6 14922 14940 E6 14942 14960 8-121-281 A7 1 D7 14960 14978 E7 14980 14998 8-121-352 A8 I D8 15031 15049 E8 15051 15069 8-121-364 A9 I D9 15043 15061 E9 15063 15081 8-121-371 AO 1 D10 15050 15068 El0 15070 15088 99-27935-193 All 1 Dil 21653 21671 Ell 21673 21691 8-122-72 A12 1 D12 25461 25479 E12 25481 25499 8-122-100 A13 1 D13 25489 25507 E13 25509 25527 8-122-271 A14 1 D14 25660 25678 E14 25680 25698 8-122-272 AI5 1 D15 25661 25679 E15 25681 25699 8-122-326 A16 1 D16 25715 25733 E16 25735 25753 8-122-360 A17 I D17 25749 25767 E17 25769 25787 8-123-55 A18 I D18 29384 29402 E18 29404 29422 8-123-189 A19 1 D19 29518 29536 E19 29538 29556 8-123-197 A20 1 D20 29526 29544 E20 29546 29564 8-123-307 A21 1 D21 29636 29654 E21 29656 29674 8-147-270 A22 I D22 29780 29798 E22 29800 29818 99-34243-210 A23 I D23 49456 49474 E23 49476 49494 8-127-28 A24 I D24 64647 64665 E24 64667 64685 8-127-119 A25 1 D25 64738 64756 E25 64758 64776 8-127-159 A26 I D26 64778 64796 E26 64798 64816 8-127-236 A27 I D27 64855 64873 E27 64875 64893 8-127-240 A28 I D28 64859 64877 E28 64879 64897 8-127-280 A29 I D29 64899 64917 E29 64919 64937 8-128-33 A30 1 D30 65466 65484 E30 65486 65504 8-128-52 A31 I D31 65485 65503 E31 65505 65523 8-128-61 A32 1 D32 65494 65512 E32 65514 65532 8-128-68 A33 1 D33 65501 65519 E33 65521 65539 8-128-69 A34 1 D34 65502 65520 E34 65522 65540 8-128-85 A35 1 D35 65518 65536 E35 65538 65556 W0005851 0 [http:/twww.getthepatent.comfi~ogindog/Sexam.supportiFetch/efaut.dogAN00058 5 1 0.cpc?fromCache= 1part=maintoolbar--botom1 Page 218 of 737 WO 00/58510 PCTIBOO/00435 8-129-50 A36 1 D36 65577 65595 E36 65597 65615 8-129-60 A37 1 D37 65587 65605 E37 65607 65625 8-129-311 A38 1 D38 65838 65856 E38 65858 65876 8-129-401 A39 1 D39 65928 65946 E39 65948 65966 99-34240-492 A40 1 D40 175648 75666 E40 75668 75686 99-31959-281 A41 1 D41 194515 94533 E41 94535 94553 99-31960-363 A42 I D42 95377 95395 E42 95397 95415 99-31962-250 A43 1 D43 96937 96955 E43 96957 96975 99-31962-450 A44 I D44 97137 97155 E44 97157 97175 99-44282-439 A45 I D45 106365 106383 E45 106385 1064031 99-44282-54 A46 I D46 106750 106768 E46 106770 106788 99-24656-137 A47 I D47 107139 107157 E47 107159 107177 99-24656-260 A48 1 D48 107262 107280 E48 107282 107300 99-24636-22 A49 I D49 1107590 107608 E49 107610 1107628 99-31939-75 A50 1 D50 108480 108498 E50 108500 108518 99-31939-273 A51 I D51 108778 108796 E5I 108798 108816 99-44281-418 A52 I D52 109432 109450 E52 109452 1094701 99-44281-257 A53 1 D53 109593 1109611 E53 109613 109631 99-44281-77 A54 1 D54 109773 109791 E54 109793 109811 99-31941-320 ASS 1 D55 112449 112467 E55 112469 112487 99-31942-325 A56 I D56 115449 115467 E56 115469 1154871 99-24635-79 A57 1 D57 155717 155735 E57 155737 155755 99-16059-313 ASS 1 D58 158153 158171 E58 158173 158191 99-24639-169 A59 I D59 160615 160633 E59 160635 160653 99-24639-163 A60 1 D60 160621 160639 E60 160641 160659 99-24634-108 A61 1 D61 160857 160875 E61 160877 160895 99-7652-162 A62 I D62 168955 168973 E62 168975 168993 99-7652-488 A63 1 D63 1169281 169299 E63 169301 1693191 99-16100-83 A64 1 D64 170727 170745 E64 170747 170765 99-16100-147 A65 1 D65 170791 170809 E65 170811 170829 99-16100-195 A66 I D66 170839 170857 E66 170859 1170877 99-16100-197 A67 1 D67 1170841 170859 E67 170861 170879 99-16100-244 A68 1 D68 170887 170905 E68 170907 170925 99-16100-381 A69 I D69 1171024 171042 1E69 1171044 171062 W000551 0 h~pLy .efthe patent. com/Lo in.dog/Sexam.suppor/Fetch/DefaultdogAN000585 10.cp)c?fromCache=l1par~anola~otm Page 219 of 737 WO 00/58510 PCTIIBOOIOO435 99-5862-167 A70 1 D70 173339 173357 E70 173359 173377 99-16083-101 A71 I D71 174208 174226 E71 174228 174246 99-16044-351 A72 1 D72 175781 175799 E72 175801 175819 99-16042-420 A73 1 D73 180570 180588 E73 180590 180608 99-16D42-31 A74 1 D74 1180959 180977 E74 180979 180997 99-5919-215 A75 1 D75 189938 189956 E75 189958 189976 99-24658-410 A76 I D76 197144 197162 E76 197164 1971821 99-30364-299 A77 1 D77 198945 198963 E77 198965 198983 99-30366-1 12 A78 1 D78 200237 200255 E78 200257- 200275 99-16094-75 A79 1 D79 204569 204587 E79 204589 204607 99-24644-194 A80 1 D80 204915 204933 E80 204935 1204953 99-16107-95 A81 I D81 206178 206196 E81 206198 206216 99-16107-161 A82 1 D82 206244 206262 E82 206264 206282 99-16107-383 A83 1 D83 206466 206484 E83 206486 2065041 99-15873-303 A84 1 D84 211589 211607 E84 211609 211627 8-124-106 A85 1 D85 214650 214668 E85 214670 214688 8-124-220 A86 1 D86 214764 214782 E86 214784 214802 8-124-294 A87 1 D87 214838 214856 E87 214858 2148761 8-124-316 A8S 1 D88 214860 214878 E88 214880 214898 8-124-383 A89 I D89 214927 214945 E89 214947 214965 8-125-33 A90 1 D90 215519 215537 E90 215539 215557 8-132-312 A91 1 D91 215686 215704 1E91 215706 2157241 8-132-179 A92 1 D92 215819 215837 E92 215839 215857 8-132-164 A93 I D93 215834 215852 E93 215854 215872 8-132-97 A94 1 D94 215901 215919 E94 215921- 215939 99-13929-201 A95 1 D95 216009 1216027 E95 216029 2160471 8-131-363 A96 I D96 216519 216537 E96 216539 2165571 8-131-199 A97 1 D97 216683 216701 E97 216703 216721 8-130-236 A98 I D98 1216855 216873 E98 216875 216893 8-130-220 A99 1 D99 1216871 216889 E99 216891 216909 8-130-144 AIOO 1 DIOO 1216947 216965 MIOO 216967 216985 8-13 0,143 AIOI 1 DIOI 216948 216966 EIOl 216968 216986 8-130-102 A102 1 D102 216989 217007 E102 217009 217027 8-130-101 A103 I D103 216990 1217008 E103 217010 12170281 W0005851 0 [http:/NwwwgettheatentVcom/Loindog/$exam.supportFetch/Defaultdog/WO005851 0.cpc?fromCache= 1 part=maintoolbar-=bottoml Page 220 of 737 WO 00/58510 PCT/IB0O/00435 8-130-83 A104 I D104 217008 217026 E104 217028 217046 8-209-333 A105 I DI05 217188 217206 EI05 217208 217226 8-209-290 A106 I D106 217231 217249 E106 217251 217269 99-5897-143 A107 1 D107 219521 219539 E107 219541 219559 99-24649-186 A108 1 D108 220817 220835 E108 220837 220855 99-24649-80 A109 I D109 220923 220941 E109 220943 220961 8-199-84 AIlG I DliO 221722 221740 El0 221742 221760 8-198-138 AIlI 1 Dill 222029 222047 ElIl 222049 222067 8-195-348 Al12 1 D112 222727 222745 El12 222747 222765 99-13925-97 Al13 1 D113 223576 223594 El13 223596 223614 8-192-82 Al14 1 Di14 225424 225442 El14 225444 225462 99-16090-225 All5 I DIl15 226200 226218 Ell5 226220 226238 8-189-340 Al16 1 DI16 226274 226292 El16 226294 226312 8-189-146 All7 1 D117 226468 226486 El17 226488 226506 8-188-136 A118 1 DI18 226851 226869 El18 226871 226889 8-187-352 Al19 1 Dl19 226968 226986 El19 226988 227006 8-185-319 A120 1 D120 227570 227588 E120 227590 227608 8-185-296 A121 1 D121 227593 227611 E121 227613 227631 99-16051-226 A122 1 D122 227987 228005 E122 228007 228025 99-16051-164 A123 I D123 228049 228067 E123 228069 228087 8-184-119 A124 I DI24 228115 228133 E124 228135 228153 8-184-27 A125 1 D125 228207 228225 E125 228227 228245 8-183-401 A126 I D126 228235 228253 E126 228255 228273 8-181-449 A127 I D127 229050 229068 E127 229070 229088 8-181-350 A128 1 D128 229149 229167 E128 229169 229187 8-181-259 A129 1 D129 229240 229258 E129 229260 229278 8-181-230 A130 I D130 229269 229287 E130 229289 229307 8-181-210 A131 I D131 229289 229307 E131 229309 229327 8-181-165 A132 .1 D132 229334 229352 E132 229354 229372 8-181-163 A133 I D133 229336 229354 E133 229356 229374 8-181-83 A134 I D134 229416 229434 E134 229436 229454 8-180-157 A135 I D135 229467 229485 E135 229487 229505 8-143-332 A136 I D136 229563 229581 E136 229583 229601 8-143-327 A137 I D137 229568 229586 E137 229588 229606 W0005851 0 [httpltwww.getthepatent.comfLogin.dog/Sexam.suportFetch/efaut.doqNVO005851 0.cpc?fromCache~ 1 part=maintoolbar--botom] Page 221 of 737 WO 00/58510 PCTAIBOO/00435 8-143-311 A138 1 D138 229584 229602 E138 229604 229622 8-143-308 A139 1 D139 229587 229605 E139 229607 229625 8-179-268 A140 I D 140 229588 229606 E140 229608 229626 8-143-306 A141 I D141 1229589 229607 E141 229609 229627 8-143-245 A142 I D142 229650 229668 E142 229670 229688 8-143-242 A143 1 D143 229653 229671 E143 229673 229691 8-143-239 A144 I D 144 229656 229674 E144 229676 229694 8-143-232 A 145 1 D145 1229663 229681 E145 229683 229701 8-143-152 A146 1 D146 229743 229761 E146 229763 229781 8-178-199 A147 I D147 229942 229960 E147 229962 229980 8-178-123 A148 1 D148 230018 230036 E148 230038 230056 8-119-404 A149 I D149 1230219 230237 E149 230239 230257 8-177-281 A150 I D150 230237 230255 EI50 230257 230275 8-119-377 A151 I D151 230246 230264 El 51 230266 230284 8-119-309 A152 I D152 230314 230332 E152 230334 230352 8-119-294 A153 1 D153 230329 230347 E153 230349 230367 8-119-284 A154 I D154 1230339 230357 E154 230359 230377 8-119-272 A155 I D155 230351 230369 E155 230371 230389 8-119-262 A156 1 D156 230361 230379 E156 230381 230399 8-119-248 A157 1 D157 230375 230393 E157 230395 230413 8-119-247 A158 I D158 1230376 230394 E158 1230396 230414 8-119-210 A159 I D159 230413 230431 E159 1230433 230451 8-119-204 A160 I D160 230419 230437 E160 230439 230457 8-119-200 A161 I D161 230423 1230441 E161 230443 230461 8-119-195 A162 I D162 230428 230446 E162 230448 230466 8-119-125 A163 I D163 230498 230516 E163 230518 230536 8-119-120 A164 1 DI64 230503 230521 E164 230523 230541 8-119-97 A165 I D165 230526 230544 E165 230546 1230564 8-119-93 A166 1 D166 230530 230548 E166 230550 230568 8-119-38 A167 I D167 230585 230603 E167 230605 230623 8-138-234 A 168 1 D168 230665 230683 E168 230685 230703 8-138-218 A 169 1 D169 230681 230699 E169 230701 230719 8-138-163 A170 1 D170 230736 230754 E170 230756 230774 8-138-54 A171 1 D171 230845 230863 1E171 230865 12308831 W00058510 [http:/Iwww.gethepatent.com/Login.dog/Sexam.supportIFetch/Defaut.doq/WO005 8 5 10.cpc?fromCache= 1 part=maintoolbar=bottom] Page 222 of 737 wo 00/58510 PCTIBOO/00435 8-175-75 A172 I D172 231051 231069 E172 231071 231089 8-142-386 A173 1 D173 231099 231117 E173 231119 231137 8-142-370 A174 1 D174 23.1115 231133 E174 231135 231153 8-142-211 A175 I D175 231274 231292 E175 231294 231312 8-142-132 A176 1 D176 231353 231371 E176 231373 231391 8-145-339 A177 I D177 231650 231668 E177 231670 231688 99-15870-400 A178 1 D178 231658 231676 E178 231678 231696 8-145-231 A179 1 D179 231758 231776 E179 231778 231796 8-145-197 A180 I D180 231792 231810 E180 231812 231830 8-145-154 A181 1 D181 231835 231853 E181 231855 231873 8-145-138 A182 I D182 231851 231869 E182 231871 231889 8-145-78 A183 I D183 231911 231929 E183 231931 231949 8-171-247 A184 I D184 232301 232319 E184 232321 232339 8-170-373 A185 I D185 232458 232476 E185 232478 232496 8-169-266 A186 I D186 232879 232897 E186 232899 232917 8-169-166 A187 I D187 232979 232997 E187 232999 233017 8-168-380 A188 I D188 233081 233099 E188 233101 233119 8-235-349 A189 1 D189 233434 233452 E189 233454 233472 8-235-182 A190 I D190 233601 233619 E190 233621 233639 8-137-340 A191 1 D191 234101 234119 E191 234121 234139 8-137-182 A192 1 D192 234258 234276 E192 234278 234296 8-137-152 A193 1 D193 234288 234306 E193 234308 234326 8-165-185 A194 1 D194 234732 234750 E194 234752 234770 99-16087-219 A195 1 D195 235296 235314 E195 235316 235334 8-157-177 A196 1 D196 238204 238222 E196 238224 238242 8-155-258 A197 1 D197 238770 238788 E197 238790 238808 99-16038-118 A198 1 D198 239744 239762 E198 239764 239782 8-136-166 A199 1 D199 239845 239863 E199 239865 239883 8-136-145 A200 1 D200 239866 239884 E200 239886 239904 8-136-80 A201 1 D201 239931 239949 E201 239951 239969 8-153-32 A202 1 D202 240025 240043 E202 240045 240063 8-135-212 A203 I D203 240478 240496 E203 240498 240516 8-135-166 A204 I D204 240524 240542 E204 240544 240562 8-135-112 A205 I D205 240578 240596 E205 240598 240616 W00058510 [http:llwww.getthepatent.comlLogin.dog/Sexam.supportlFet lDefault doWO005 8 5 10.cpc?fromCache= 1 part=maintoolbar=botomI Page 223 of 737 WO 00/58510 PCT/IBOO/00435 99-16050-235 A206 I D206 240753 240771 E206 240773 240791 8-144-378 A207 I D207 240839 240857 E207 240859 240877 8-144-234 A208 I D208 240983 241001 E208 241003 241021 8-144-196 A209 I D209 241021 241039 E209 241041 241059 8-144-127 A210 I D210 241090 241108 E210 241110 241128 8-141-304 A211 I D211 241198 241216 E211 241218 241236 8-141-260 A212 I D212 241242 241260 E212 241262 241280 8-141-161 A213 I D213 241341 241359 E213 241361 241379 8-140-286 A214 I D214 241488 241506 E214 241508 241526 8-140-173 A215 I D215 241601 241619 E215 241621 241639 8-140-108 A216 I D216 241666 241684 E216 241686 241704 8-140-41 A217 I D217 241733 241751 E217 241753 241771 99-15880-162 A218 I D218 241842 241860 E218 241862 241880 8-240-187 A219 I D219 242383 242401 E219 242403 242421 8-225-281 A220 I D220 244294 244312 E220 244314 244332 99-25940-186 A221 I D221 247841 247859 E221 247861 247879 99-25940-182 A222 I D222 247845 247863 E222 247865 247883 99-16032-292 A223 I D223 248296 248314 E223 248316 248334 99-16055-216 A224 I D224 253600 253618 E224 253620 253638 99-16105-152 A225 I D225 255829. 255847 E225 255849 255867 99-16101-436 A226 I D226 258554 258572 E226 258574 258592 99-16033-244 A227 I D227 260080 260098 E227 260100 260118 99-15875-165 A228 I D228 279770 279788 E228 279790 279808 99-13521-31 A229 I D229 287988 288006 E229 288008 288026 8-112-241 A230 I D230 292661 292679 E230 292681 292699 8-112-155 A231 I D231 292747 292765 E231 292767 292785 8-112-45 A232 I D232 292857 292875 E232 292877 292895 8-111-301 A233 1 D233 295476 295494 E233 295496 295514 8-110-404 A234 I D234 295697 295715 E234 295717 295735 8-110-89 A235 I D235 296012 296030 E235 296032 296050 8-134-94 A236 I D236 296049 296067 E236 296069 296087 99-7462-508 A237 I D237 298950 298968 E237 298970 298988 99-16052-214 A238 I D238 300346 300364 E238 300366 300384 99-16047-115 A239 I D239 312011 312029 E239 312031 312049 WO00058510[http://www.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.dog/WO0058510.cpc?fromCache= 1 part=maintoolbar=bottom] Page 224of737 WO 00/58510 PCT/IBOO/00435 99-25993-280 A240 1 D240 315909 315927 E240 315929 315947 99-25993-367 A241 1 D241 315995 316013 E241 316015 316033 99-25101-151 A242 I D242 317226 317244 E242 317246 317264 Marker Name Biallelic SEQI Mis. 1 Position range of Mis. 2 Complementary Marker ID No. microsequencing position range of primer mis. 1 in microsequencing SEQ ID No. primer mis. 2 in SEQ ID No.

8-94-252 A243 162 D243 1482 1500* E243 1502 1521 8-95-43 A244 161 D244 1481 1500 E244 1502 1520* 8-97-98 A245 160 D245 1482 1500* E245 1502 1521 8-98-68 A246 159 D246 1481 1500 E246 1502 1520* 99-14021-108 A247 151 D247 1482 1500* E247 1502 1521 99-14364-415 A248 152 D248 1482 1500* E248 1502 1521 99-15056-99 A249 115 D249 1482 1500* E249 1502 1521 99-15063-155 A250 116 D250 1482 1500* E250 1502 1521 99-15065-85 A251 117 D251 1481 1500 E251 1502 1520* 99-15229-412 A252 157 D252 1481 1500 E252 1502 1520* 99-15231-219 A253 163 D253 1481 1500 E253 1502 1520* 99-15232-291 A254 155 D254 1481 1500 E254 1502 1520* 99-15239-377 A255 164 D255 1482 1500* E255 1502 1521 99-15252-404 A256 118 D256 384 403 E256 405 423* 99-15253-382 A257 119 D257 1481 1500 E257 1502 1520* 99-15256-392 A258 120 D258 1481 1500 E258 1502 1520* 99-15258-337 A259 121 D259 1481 1500 E259 1502 1520* 99-15261-202 A260 122 D260 1482 1500* E260 1502 1521 99-15280-432 A261 123 D261 1481 1500 E261 1502 1520* 99-15355-150 A262 124 D262 1482 1500* E262 1502 1521 99-15663-298 A263 175 D263 1482 1500* E263 1502 1521 99-15664-185 A264 176 D264 1482 1500* E264 1502 1521 99-15665-398 A265 174 D265 1481 1500 E265 1502 1520* 99-15668-139 A266 177 D266 1482 1500* E266 1502 1521 99-15672-166 A267 173 D267 1482 1500* E267 1502 1521 99-15682-318 A268 178 D268 1482 1500* E268 1502 1521 99-16081-217 A269 113 D269 310 329 E269 331 349* W00058510 http://www.getthepatent.com/Login.do/Sexam.support/FetchlDefault.dogWO00058510.cpc?fromCache= 1 part=maintoolbar=bottom] Page 225 of 737 WO 00/58510 PCT/IBOO/00435 99-16082-218 A270 114 D270 214 232* E270 234 253 99-20933-81 A271 179 D271 1481 1500 E271 1502 1520* 99-20977-72 A272 147 D272 1482 1500* E272 1502 1521 99-20978-89 A273 148 D273 1481 1500 E273 1502 1520* 99-20981-300 A274 149 D274 1481 1500 E274 1502 1520* 99-20983-48 A275 150 D275 1482 1500* E275 1502 1521 99-22310-148 A276 154 D276 1481 1500 E276 1502 1520* 99-25029-241 A277 180 D277 1482 1500* E277 1502 1521 99-25224-189 A278 125 D278 1107 1125* E278 1127 1146 99-25869-182 A279 181 D279 1482 1500* E279 1502 1521 99-25881-275 A280 182 D280 1481 1500 E280 1502 1520* 99-25897-264 A281 183 D281 1482 1500* E281 1502 1521 99-25906-131 A282 184 D282 1481 1500 E282 1502 1520* 99-25917-115 A283 185 D283 1481 1500 E283 1502 1520* 99-25924-215 A284 186 D284 1482 1500* E284 1502 1521 99-25950-121 A285 126 D285 1482 1500* E285 1502 1521 99-25961-376 A286 127 D286 1481 1500 E286 1502 1520* 99-25965-399 A287 128 D287 1481 1500 E287 1502 1520* 99-25966-241 A288 129 D288 1481 1500 E288 1502 1520* 99-25967-57 A289 130 D289 1481 1500 E289 1502 1520* 99-25969-200 A290 131 D290 1482 1500* E290 1502 1521 99-25972-317 A291 132 D291 1482 1500* E291 1502 1521 99-25974-143 A292 133 D292 1481 1500 E292 1502 1520* 99-25977-311 A293 134 D293 1482 1500* E293 1502 1521 99-25978-166 A294 135 D294 1481 1500 E294 1502 1520* 99-25979-93 A295 136 D295 1482 1500* E295 1502 1521 99-25980-173 A296 137 D296 1482 1500* E296 1502 1521 99-25984-312 A297 138 D297 1482 1500* E297 1502 1521 99-25985-194 A298 139 D298 1481 1500 E298 1502 1520* 99-25989-398 A299 140 D299 1481 1500 E299 1502 1520* 99-26126-498 A300 165 D300 1482 1500* E300 1502 1521 99-26138-193 A301 187 D301 1481 1500 E301 1502 1520* 99-26146-264 A302 188 D302 1482 1500* E302 1502 1521 99-26147-396 A303 141 D303 1482 1500* E303 1502 1521 W00058510 [httpl//ww.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.dooNVO005851 .cpc?fromCache= 1 part=-maintoolbar=bottom] Page 226 of 737 WO 00/58510 PCT/IBOO/00435 99-26150-276 A304 142 D304 1481 1500 E304 1502 1520* 99-26153-44 A305 143 D305 1482 1500* E305 1502 1521 99-26154-107 A306 144 D306 1481 1500 E306 1502 1520* 99-26156-290 A307 145 D307 1482 1500* E307 1502 1521 99-26166-257 A308 166 D308 1481 1500 E308 1502 1520* 99-26167-278 A309 167 D309 1482 1500* E309 1502 1521 99-26169-211 A310 168 D310 1482 1500* E310 1502 1521 99-26171-71 A311 169 D311 1481 1500 E311 1502 1520* 99-26183-156 A312 170 D312 1482 1500* E312 1502 1521 99-26189-164 A313 189 D313 1482 1500* E313 1502 1521 99-26190-20 A314 190 D314 1482 1500* E314 1502 1521 99-26191-58 A315 191 D315 1481 1500 E315 1502 1520* 99-26201-267 A316 192 D316 1481 1500 E316 1502 1520* 99-26222-149 A317 193 D317 1481 1500 E317 1502 1520* 99-26223-225 A318 194 D318 1481 1500 E318 1502 1520* 99-26225-148 A319 195 D319 1481 1500 E319 1502 1520* 99-26228-172 A320 196 D320 1482 1500* E320 1502 1521 99-26233-275 A321 197 D321 1482 1500* E321 1502 1521 99-26234-336 A322 198 D322 1481 1500 E322 1502 1520* 99-26238-186 A323 199 D323 1481 1500 E323 1502 1520* 99-5873-159 A324 146 D324 1481 1500 E324 1502 1520* 99-5912-49 A325 171 D325 1481 1500 E325 1502 1520* 99-6012-220 A326 158 D326 1481 1500 E326 1502 1520* 99-6080-99 A327 156 D327 1481 1500 E327 1502 1520* 99-7308-157 A328 153 D328 1482 1500* E328 1502 1521 99-7337-204 A329 172 D329 1482 1500* E329 1502 1521 99-16106-48 A330 200 D330 59 78 E330 80 99 99-25332-125 A331 201 D331 105 124 E331 126 145 99-25516-307 A332 202 D332 286 305 E332 307 326 99-26173-470 A333 203 D333 1481 1500 E333 1502 1521 99-26267-524 A334 204 D334 1481 1500 E334 1502 1521 99-26284-394 A335 205 D335 1481 1500 E335 1502 1521 99-26559-315 A336 206 D336 1481 1500 E336 1502 1521 99-26769-256 A337 207 D337 1481 1500 E337 1502 1521 W0005851 0[http:// w.getthepatent.com/Login.dogI$exam.suportFett1I~efaut.doN005851 0.cpc?tromCactie=l1part=maintoolbar--bottoml Page 227 of 737 WO 00/58510 PCTIBOO/00435 99-26772-268 A338 208 D338 1481 1500 E338 1502 1520* 99-26776-209 A339 209 0339 1481 1500 E339 1502 1521 99-26779-437 A340 210 D340 1477 1496 E340 1498 1517 99-26781-25 A341 211 D341 1482 1500$ E341 1502 1521 99-26782-300 A342 212 D342 1482 1500* E342 1502 1521 99-26783-81 A343 213 D343 1481 1500 E343 1502 1521 99-26787-96 A344 214 D344 1482 1500* E344 1502 1521 99-26789-201 A345 215 0345 1482 1500* E345 1502 1521 99-27297-280 A346 216 D346 1481 1500 E346 1502 1521 99-27306-108 A347 217 D347 1481 1500 E347 1502 1521 99-27312-58 A348 218 D348 11481 1500 E348 1502 1521 99-27323-372 A349 219 0349 1481 1500 E349 1502 1521 99-27335-191 A350 220 D350 1481 1500 E350 1502 1521 99-27345-189 A351 221 D351 1481 1500 E351 1502 1521 99-27349-267 A352 222 D352 1482 1500* E352 1502 1521 99-27352-197 A353 223 0353 1481 1500 E353 1502 1520* 99-27353-105 A354 224 D354 11482 1500* E354 1502 1521 99-27360-142 A355 225 D355 1482 1500* E355 1502 1521 99-27361-181 A356 226 D356 1482 1500* E356 1502 1521 99-27365-421 A357 227 0357 1482 1500* E357 1502 1521 99-27680-484 A358 228 D358 1464 483 E358 485 504 99-27912-272 A359 229 D359 1481 1500 E359 1502 1521 99-30329-380 A360 112 D360 1361 379 E360 381 399 Mis I and Mis 2 respectively refer to microsequencing primers which hybridized with the coding strand or with the non-coding strand of the nuceotide sequences of the invention.

The microsequencing reaction was performed as follows After purification of the amplification products, the microsequencing reaction mixture was prepared by adding, in a 20pi final volume: 10 pmol microsequencing oligonucleotide, 1 U Thermosequenase (Amershamn E79000G), 1.25 ttl Thermosequenase buffer (260 mM Tris HCI pH 9.5, 65 mM MgCI 2 and the two appropriate fluorescent ddNTPs (Perkin Elmer, Dye Terminator Set 401095) complementary to the nucleotides at the polymorphic site of each biallelic marker tested, following the manufacturer's recommendations. After 4 minutes at 94*C, 20 PCR cycles of 15 sec at 55*C, 5 sec at 72*C, and 10 sec at 94*C were carried out in a Tetrad PTC-225 thermocycler (MJ Research). The unincorporated dye terminators were then W0005851 0 rhtD:/tww.gethepatent.com/Login.dog/Sexam.suppowFetch/Default.dog/WO005851 0.cpcfromCarhe= 1 part=maintoolbar--bottom] Page 228 of 737 WO 00/58510 PCT/IB00/00435 226 removed by ethanol precipitation. Samples were finally resuspended in formamide-EDTA loading buffer and heated for 2 min at 95°C before being loaded on a polyacrylamide sequencing gel. The data were collected by an ABI PRISM 377 DNA sequencer and processed using the GENESCAN software (Perkin Elmer).

Following gel analysis, data were automatically processed with software that allows the determination of the alleles of biallelic markers present in each amplified fragment.

The software evaluates such factors as whether the intensities of the signals resulting from the above microsequencing procedures are weak, normal, or saturated, or whether the signals are ambiguous. In addition, the software identifies significant peaks (according to shape and height criteria). Among the significant peaks, peaks corresponding to the targeted site are identified based on their position.. When two significant peaks are detected for the same position, each sample is categorized classification as homozygous or heterozygous type based on the height ratio.

Example Association Study Between Schizophrenia And The Biallelic Markers Of The Invention: Collection Of DNA Samples From Affected And Non-Affected Individuals A) Affected population All the samples were collected from a large epidemiological study of schizophrenia undertaken in hospital centers of Quebec from October 1995 to April 1997. The population was composed of French Caucasian individuals. The study design consisted in the ascertainment of cases and two of their first degree relatives (parents or siblings).

As a whole, 956 schizophrenic cases were ascertained according to the following inclusion criteria: the diagnosis had been done by a psychiatrist; the diagnosis had been done at least 3 years before recruitment time, in order to exclude individuals suffering from transient manic-depressive psychosis or depressive disorders; the patient ancestors had been living in Quebec for at least 6 generations; it was possible to get a blood sample from 2 close relatives.

Among the 956 schizophrenic ascertained cases, 834 individuals were included in the study for the following reasons: for the included individual cases, the diagnosis of schizophrenia was established according to the DSM-IV (Diagnostic and Statistical Manual, Fourth edition, Revised 1994, W00058510 [http:/twww.getthepatent.com/Login.dog/Sexam.support/FetchDefaut.docM0O05851 O.cpc?fromCache=l partmaintoobarbottomj Page 229of737 WO 00/58510 PCT/IB00/00435 227 American Psychiatric Press); samples from individuals suffering from schizoaffective disorder were discarded; individuals suffering from catatonic schizophrenia were also excluded from the population of schizophrenic cases; were also excluded the individuals having a first degree relative or 2 or more second degree relatives suffering from depression or mood disorder; individuals having had severe head trauma, severe obstretical complications, encephalitis, or meningitis before onset of symptoms were also excluded; has also been excluded from the population of schizophrenic cases a patient suffering from epilepsy and treated with anticonvulsants.

The age at onset was not added as an inclusion criteria.

B) Unaffected population Control cases were respectively ascertained based on the following cumulative criteria: the individual must not be affected by schizophrenia or any other psychiatric disorder, the individual must have 35 years old or more; the individual must belong to the French-Canadian population; the individual must have one or two first degree relative available for blood sampling.

Controls were matched with cases sex when possible.

C) Cases and Control Populations Selected for the Association Study The unaffected population retained for the study was composed of 241 individuals. The initial sample of the clinical study was composed of 215 cases and 214 controls. The controls were composed of 116 males and 98 females while the cases were composed of 154 males and 64 females. For each control, two first degree relatives (father, mother, sisters and brothers) were available. In order to match the sex of cases and controls, the parents of female controls were substituted for the female controls where possible and where the parents were known to be unaffected by schizophrenia or other psychosis. The parents of 27 female controls were thus substituted for the respective females, resulting in a total control sample size of 241 individuals.

The composition of the control sample is detailed below in Table 7.

Table 7 Description of control samples Probands 187 Male 116 Female 71 Parents of probands 54 Fathers 27 W00058510 http://www.etthepatent.comLogindog/examsuportFechDefault.do/W0058510.cpc?fromCache= 1 part=maintoolbar=bottom Page 230 of 737 WO 00/58510 PCT/IB00/00435 228 Mothers 27 Total 241 The association data that are presented below were obtained on a population size detailed in Table 8 below, wherein the individuals have been randomly selected from the populations detailed above.

Table 8 Cases and Control Populations Selected for the Association Study sample type Cases Controls sample size 215 241 Gender Male 151 143 Female 64 98 Familial history of psychosis (FH)* positive 82 0 none 133 241 close relatives (first or second degree) Both case and control populations form two groups, each group consisting of unrelated individuals that do not share a known common ancestor. Additionally, the individuals of the control population were selected among those having no family history of schizophrenia or schizophrenic disorder.

Genotyping of affected and control individuals A) Results from the genotvying The general strategy to perform.the association studies was to individually scan the DNA samples from all individuals in each of the populations described above in order to establish the allele frequencies of biallelic markers, and among them the biallelic markers of the invention, in the diploid genome of the tested individuals belonging to each of these populations.

Allelic frequencies of every biallelic marker in each population (cases and controls) were determined by performing microsequencing reactions on amplified fragments obtained by genomic PCR performed on the DNA samples from each individual. Genomic PCR and microsequencing were performed as detailed above in Examples 1 to 3 using the described PCR and microsequencing primers.

Single biallelic marker frequency analysis W0005851 0 [http:/twww.gefthepatent.com/Login.dog/Sexam.supprVFetchDefautdog/WO00 58 5 1 O.CPC?frOMCache= 1 part=maintoolbar--bottom] Page 231 of 737 WO 00/58510 PCT/IBOO/00435 For each allele of the biallelic markers included in this study, the difference between the allelic frequency in the unaffected population and in the population affected by schizophrenia was calculated and the absolute value of the difference was determined. The more the difference in allelic frequency for a particular biallelic marker or a particular set of biallelic markers, the more probable an association between the genomic region harboring this particular biallelic marker or set of biallelic markers and schizophrenia. Allelic frequencies were also useful to check that the markers used in the haplotype studies meet the Hardy-Weinberg proportions (random mating).

The allelic frequencies of biallelic markers in the chromosome 13q3 I-q33 region between the affected and the unaffected population, using the sample population described above, is set forth in Table 9.

Table 9 Allelic frequencies of markers in different sub-samples marker alleles all sample cases controls all HiF+ HIF- 99-20978/89 C/G 0.51 0.47 0.51 0.55 99-20983/48 A/G 0.30 0.28 0.33 0.29 99-20981/300 A/G 0.54 0.51 0.55 0.56 99-20977/n2 A/C 0.40 0.41 0.38 0.35 99-6080/99 CIT 0.58 0.57 0.57 0.55 99-15229/412 A/G 0.54 0.52 0.55 0.53 99-22310/148 Cr1' 0.46 0.48 0.44 0.47 99-15232/291 C/T 0.46 0.48 0.43 0.47 99-14021/108 AIG 0.46 0.48 0.44 0.47 8-98/68 A/G 0.20 0.18 0.23 0.19 8-97/98 C/T 0.78 0.75 0.81 0.80 99-6012/220 C/T 0.20 0.19 0.23 0.19 8-95/43 A/G 0.18 0.20 0.18 0.21 99-7308/157 Cr1' 0.39 0.42 0.36 0.39 99-14364/415 CUr 0.38 0.40 0.36 0.39 99-15672/166 C/T 0.51 0.47 0.54 0.54 99-15668/139 CUT 0.58 0.56 0.62 0.65 99-15665/398 A/G 0.72 0.67 0.72 0.76 99-15663/298 CIT 0.72 0.67 0.72 0.76 99-15664/185 CIT 0.69 0.62 0.72 0.72 W00058510 [t!p-.twww.gethepatent.comLogin.dog/$exam.supporttFetch/DefauItdogNVO005851 0.cpc?fromCache=lpart=maintoolbar--botom]Paqe 232 of 737 WO 00/58510 PCT/IB00/00435 230 99-15682/318 A/T 0.35 0.40 0.34 0.32 99-20933/81 A/C 0.43 0.41 0.42 0.40 99-16081/217 C/T 0.43 0.38 0.46 0.39 99-16082/218 A/G 0.33 0.31 0.35 0.32 99-5862/167 C/T 0.47 0.43 0.44 0.51 99-16100/147 A/G 0.48 0.44 0.45 0.50 99-7652/162 A/G 0.49 0.46 0.46 0.52 99-5919/215 A/G 0.66 0.71 0.69 0.60 99-5897/143 A/C 0.58 0.61 0.53 0.59 99-15870/400 A/G 0.32 0.38 0.27 0.33 99-16032/292 A/C 0.61 0.62 0.64 0.58 99-15880/162 A/G 0.62 0.63 0.65 0.58 99-16038/118 A/G 0.38 0.36 0.35 0.42 99-15875/165 C/T 0.58 0.57 0.57 0.63 99-16033/244 C/T 0.55 0.57 0.49 0.54 99-16047/115 C/T 0.73 0.75 0.68 0.73 In the association study described herein, several individual biallelic markers were shown to be significantly associated with schizophrenia. In particular, several of the chromosome 13q31-q33 region biallelic markers (99-16038/118 (A198), 99-15880/162 (A218), 99-5919/215 (A75), 99-15875/165 (A228), 99-16032/292 (A223)) showed significant association with schizophrenia in both familial and sporadic schizophrenia cases. The significance of the absolute value of the difference of allelic frequency of the individual biallelic markers in the affected and the unaffected population is set forth in Figure 2, with several biallelic marker having allelic frequency differences with p-values approaching or less than 0.05, biallelic marker 99-5919/215 (A75) having a p-value of less than 0.01. Figure 2 also shows the physical order of certain specific biallelic markers. These results show that several biallelic markers individually associated with schizophrenia are physically located in a particular region of significance, the subregion of the chromosome 13q31-q33 region referred to herein as Region D.

Haplotype frequency analysis Analysis of markers Haplotype analysis for association of chromosome 13q31-q33related biallelic markers and schizophrenia was performed by estimating the frequencies of all possible 2, 3 and 4 marker haplotypes in the affected and control populations described above.

Haplotype estimations were performed by applying the Expectation-Maximization (EM) algorithm (Excoffier and Slatkin, 1995), using the EM-HAPLO program (Hawley et al., 1994) W00058510 [http:/lwww.getthepatent.comI1.gin.do /$exam.suppowFetch/DefauIt.dog/O0o5 8 5 1 0.cpcfro mCa rie= 1 Dart=ma iMoolbar-bottoml Page 233 of 737 WO 00/58510 PCT/IB00/00435 231 as described above. Estimated haplotype frequencies in the affected and control population were compared by means of a chi-square statistical test (one degree of freedom).

Haplotype association results in schizophrenia cases The results of the haplotype analysis using the chromosome 13q31-q33-related biallelic markers biallelic markers is shown in Figure 3. In particular, the figures show the most significant haplotypes using the biallelic markers: 99-16047/115 (A239), 99-16033/244 (A227), 99-16038/118 (A198), 99-15875/165 (A228), 99-16032/292 (A223), 99-5897/143 (A107), 99- 15880/162 (A218), 99-16082/218 (A270), 99-5919/215 (A75), 99-7652/162 (A62), 99- 16100/147 (A65), 99-5862/167 A number of biallelic marker haplotypes were shown to be significantly associated with schizophrenia. A first preferred haplotype (HAP287 of Figure 3) consisting of four biallelic markers (99-16038/118 (A198), 99-16082/218 (A270), (99-7652/162 (A62) and 99-16100/147 is highly significantly associated with schizophrenia in both total cases and sporadic cases. Figure 4 shows the characteristics of this haplotype. This haplotype presented a p-value of 3.1x10 and an odd-ratio of 4.01 for total cases and a p-value of 3.9x10 and an odd-ratio of 3.88 for sporadic cases. Phenotypic permutation tests confirmed the statistical significance of these results. Estimated haplotype frequencies were 13.8% in total cases, 13.5% in the sporadic cases, and 3.8 in the controls.

Several other significant haplotypes are listed in Figure 3, including several 3- and 4-marker haplotypes. Considered to be highly significantly associated with schizophrenia are the most significant 2-marker haplotype (HAPI consisting of biallelic markers 99-15875/165 (A228) and 99-5919/215 (A75)) and the most significant 3-marker haplotype (HAP67 consisting of biallelic markers 99-16038/118 (A198), 99-16082/218 (A270) and 99-7652/162 (A218)).

Further preferrred significant haplotypes considered associated with schizophrenia are haplotypes having p-values above a desired threshold level are also; all the haplotypes listed in Figure 3 present p-values below 1.0x 0" 2 for 2-marker haplotypes, 1.0xI 0" 4 for 3-marker haplotypes, and 1.0x1 0- for 4-marker haplotypes. All of the biallelic markers presented in Figure 4 except for 1 (99-16047/115 (A239)) are involved in haplotypes having a p-value above these threshold levels. Figure 3 shows several 2-marker haplotypes, HAPI to HAP8, having pvalues ranging from 1.0x10' 2 to 1.2x10' 3 several 3-marker haplotypes, HAP67 to HAP76, having p-values ranging from 1.3x10 s to 1.0xl10 4 and several 4-marker haplotypes, HAP287 to HAP291, having p-values ranging from 8.2x10' 7 to 3.1x10' 7 Figure 4 shows biallelic markers involved in significant haplotypes having significance thresholds of 1.0x10- 2 1.0x1 0 4 and 1.0x10' 5 for 3- and 4-marker haplotypes, respectively.

W0005851 0 Lhtto twww.gethepatent.com/Login.dog/Sexam.supportFetchDefaut.dogNVO005851 O.cpc?fromCache= 1 part=maintoolbar=bottom] Page 234 of 731 WO 00/58510 PCT/IB00/00435 232 Several 3- and 4-marker haplotypes, HAP 1, HAP8, HAP70, HAP71, HAP76, HAP288, HAP290 and HAP291, often comprised the biallelic marker 99-5919/215 allele A. Furthermore, several 3- and 4-marker haplotypes, HAP7, HAP67, HAP69, HAP287 AND HAP288, often comprised the biallelic marker 99-16038/118 (A198) allele G.

Example Association Study Between Schizophrenia And The Biallelic Markers Of The Invention Collection Of DNA Samples From Affected And Non-Affected Individuals Biallelic markers of the invention were further analyzed in the French Canadian population described above. For this analysis, the proband case population under study consisted of 139 individuals, the control population consisted of 141 individuals, as described in Table 10 below.

Table Cases and Control Populations Selected for the Association Study Sample type Cases Controls Sample size 139 141 Gender Male 94 96 Female 45 Familial history of psychosis (FH)* positive 76 0 none 63 141 close relatives (first or second degree) Genotyping of affected and control individuals A) Results from the genotyping The general strategy for performing the association studies was to individually scan the DNA samples from all individuals in each of the populations described above in order to establish the allele frequencies of biallelic markers, and among them the biallelic markers of the invention, in the diploid genome of the tested individuals belonging to each of these populations.

Allelic frequencies of every biallelic marker in each population (cases and controls) were determined by performing microsequencing reactions on amplified fragments obtained by genomic PCR performed on the DNA samples from each individual. Genomic PCR and W00058510 [http://ww.getthepatent.com/Login.dogSexam.support/Fetch/Default.dog/W0058510.cpc?fromCache= 1 part=maintoolbar=bottom Page 235 of 737 WO 00/58510 PCT/IB00/00435 microsequencing were performed as detailed above in Examples 1 to 3 using the described PCR and microsequencing primers.

Single biallelic marker frequency analysis For each allele of the biallelic markers included in this study, the difference between the allelic frequency in the unaffected population and in the population affected by schizophrenia was calculated and the absolute value of the difference was determined. The allelic frequencies of between the affected and the unaffected population in the regions is set forth in Table 11, using the sample population described above and in Table 10. The more the difference in allelic frequency for a particular biallelic marker or a particular set of biallelic markers, the more probable an association between the genomic region harboring this particular biallelic marker or set of biallelic markers and schizophrenia. Allelic frequencies were also useful to check that the markers used in the haplotype studies meet the Hardy-Weinberg proportions (random mating).

Table 11 Allelic frequencies of markers in differents sub-samples Marker polymorphism Cases All controls All cases HF+ HF- 99-20978/89 C/G 50,37 47,26 54,03 55,43 99-20983/48 A/G 30,37 28,67 32,5 26,52 99-20977/72 A/C 41,01 42,11 39,68 34,4 99-20981/300 A/G 52,17 51,33 53,17 99-6080/99 C/T 58,82 58 59,84 54,85 99-15229/412 A/G 54,92 52,86 57,26 51,88 99-22310/148 C/T 44,2 46,71 41,13 48,57 99-15232/291 G/T 43,85 46,43 40,83 49,28 99-14021/108 A/G 44,85 47,26 42,06 48,54 8-94/252 A/G 2,22 1,97 2,54 2,52 8-98/68 A/G 19,06 17,76 20,63 19,06 8-97/98 C/T 76,26 74,34 78,57 77,3 99-6012/220 G/T 20 18,49 21,77 18,79 99-7308/157 C/T 40,31 41,89 38,18 39,36 99-14364/415 C/T 39,93 40,79 38,89 8-95/43 A/G 20,29 20,39 20,16 22,14 99-15672/166 C/T 49,28 47,37 51,59 56,74 99-15668/139 C/T 58,21 56,16 60,66 66,67 99-15665/398 A/G 70,5 67,76 73,81 76,79 W0005851 0 [tts./twww.getthepa tent.com/Log in.d og/Sexa m. suportFetch/Defa ut.dogO0585 1 O.cpc?fromCache=l1part=maintoolbar--bottomI Page 236 of 737 WO 00/58510 PCT/IBOO/00435 99-15663/298 C/T 70,5 67,76 73,81 76,95 99-15664/185 G/T 66,54 62,33 71,43 72,5 99-15682/318 ANI 35,27 39,58 29,82 32,66 99-20933/81 A/C 43,12 42,76 43,55 42,45 99-26146/264 Gfl' 39,62 38,67 40,91 39,85 99-25922/147 GiT 44,19 39,58 50 40,94 99-16081/217 C/T 42,28 38,82 46,67 36,74 99-16082/218 A/G 34,73 31,94 38,14 33,81 99-24656/260 A/G 48,87 49,3 2 48,31 54,04 99-24639/163 G/l' 38,52 33,33 45 40,51 99-24634/108 N/T 44,85 42,67 47,54 99-7652/162 A/G 45,29 44,08 46,77 50,36 99-16100/147 AIG 44,66 42,75 46,77 48,89 99-5862/167 C/i' 43,53 4 1,45 46,03 49,29 99-5919/215 AIG 69,42 71,05 67,46 60,28 99-246581410 C/T 64,13 69,08 58,06 61,07 99-24644/194 A/G 39,42 41,22 37,3 40,51 99-5897/143 A/C 57,61 160,67 53,97 61,07 99-24649/186 C/T 67,75 67,33 68,25 62,95 99-15870/400 A/G 33,46 36,67 29,51 30,29 99-16038/118 A/G 34,53 36,18 32,54 43,62 99-15880/162 A/G 65,11 63,16 67,46 56,43 99-25940/182 A/G 59,42 56,67 62,7 52,59 99-16032/292 A/C 64,03 61,84 66,67 55,67 99-16033/244 C/T 54,51 56,76 51,69 56,44 99-15875/165 C/T 56,88 57,89 55,65 66,3 99-16047/1 15 C/T 71,69 74,67 68,03 75,19 99-25993/367 N/G 44,53 40,79 49,18 40,51 99-25989/398 N/G 32,81 1 33,33 32,2 27,86 99-25979/93 N/G 68,12 69,08 66,94 69,32 99-25969/200 G/T 36,67 38,67 34,17 38,85 99-25966/241 N/G 66,3 67,11 65,32 63,21I 99-25961/376 N/C 39,63 42,57 36,07 37,31 99-25965/399 N/G 50,36 15 1,97 48,39 49,64 99-25977/3 11 N/G 72,01 67,76 77,59 73,72 99-25950/121 C/G 31,75 36 26,61 27,54 99-25974/143 N/G 25,55 28,29 22,13 22,7 99-26150/276 NG 46,54 51,43 40,83 47,76 W00058510 [httpJtww w.g et thepatent.com/Login.dog/SexamnsupportFetcwoefault. dogAoN0 o058 0.c ~fro mCa che= 1 part=maintolbar--bottom] Page 237 of 737 WO 00/58510 PCT/IB00/00435 235 99-15258/337 G/T 25,55 26,97 23,77 24,1 99-15261/202 A/G 63,06 59,46 67,5 65,15 99-15256/392 C/T 64,96 61,33 69,35 65,3 99-15056/99 C/T 32,72 36,49 28,23 31,11 99-15280/432 C/T 42,28 44 40,16 38,97 99-15355/150 C/T 72,3 70,39 74,6 68,79 99-15253/382 C/T 63,04 62,67 63,49 62,95 99-5873/159 C/T 78,1 79,05 76,98 77,34 Haplotype frequency analysis Analysis of markers Haplotype analysis for association of chromosome 13q31-q33related biallelic markers and schizophrenia was performed by estimating the frequencies of all possible 2, 3 and 4 marker haplotypes in the affected and control populations described above.

Haplotype estimations were performed by applying the Expectation-Maximization (EM) algorithm (Excoffier and Slatkin, 1995), using the EM-HAPLO program (Hawley et al., 1994) as described above. Estimated haplotype frequencies in the affected and control population were compared by means of a chi-square statistical test (one degree of freedom).

Haplotype association results in schizophrenia cases Haplotype studies yielded significant results indicating an association of the nucleotide sequences of the invention with schizophrenia. Significant results are shown in Figures 5 and 6, including descriptions of the frequency of the haplotype leading to the maximum chi square test (reference no. in figures), the test of the frequency of a particular haplotype in cases vs in controls (reference no. in figures) and the p- value assuming that the test has a chi-square distribution with 1 degree of freedom (ddl) (reference no. in figures). The results of the haplotype analysis using 28 preferred biallelic markers of the invention, 99-24656-260 (A48), 99-24639-163 (A60), 99-24634-108 (A61), 99-7652-162 (A62), 99-16100-147 (A65), 99-5862- 167 (A70), 99-5919-215 (A75), 99-24658-410 (A76), 99-24644-194 (A80), 99-5897-143 (A107), 99-24649-186 (A108), 99-16038-118 (A198), 99-15880-162 (A218), 99-25940-182 (A221), 99-16032-292 (A223), 99-16033-244 (A227), 99-15875-165 (A228), 99-16047-115 (A239), 99-25950-121 (A285), 99-25961-376 (A286), 99-25965-399 (A287), 99-25966-241 (A288), 99-25969-200 (A290), 99-25974-143 (A292), 99-25977-311 (A293), 99-25979-93 (A295), 99-25989-398 (A299), and 99-26150-276 (A304) are shown in Figures 5 and 6.

Figures 5 and 6 also show the physical order of the biallelic markers comprising the haplotypes.

Figure 5 shows the results of the haplotype analysis using the following biallelic markers located on the approximately 319kb sequence of SEQ ID No. 1: 99-24656-260 (A48), 99-24639-163 (A60), 99-24634-108 (A61), 99-7652-162 (A62), 99-16100-147 (A65), 99-5862- W0005851 0 PpJq t vw.getthepatentcom/Login.dog/Sexam.supportFetchDefault.dogNV005851 0.cpc?fromCache= 1 part=maintoolbar- bottom] Page 238 of 737 WO 00/58510 PCT/IB00/00435 236 167 (A70), 99-5919-215 (A75), 99-24658-410 (A76), 99-24644-194 (A80), 99-5897-143 (A107), 99-24649-186 (A108), 99-16038-118 (A 198), 99-15880-162 (A218), 99-25940-182 (A221), 99-16032-292 (A223), 99-16033-244 (A227), 99-15875-165 (A228), and 99-16047- 115(A239).

Figure 6 shows the results of the haplotype analysis using the following biallelic markers located on the approximately 319kb of SEQ ID No. las well as additional biallelic markers located on the human chromosome 13q31-q33 locus: 199-16038-118 (A198), 99- 15880-162 (A218), 99-25940-182 (A221), 99-16032-292 (A223), 99-16033-244 (A227), 99- 15875-165 (A228), 99-16047-115 (A239), 99-25950-121 (A285), 99-25961-376 (A286), 99- 25965-399 (A287), 99-25966-241 (A288), 99-25969-200 (A290), 99-25974-143 (A292), 99- 25977-311 (A293), 99-25979-93 (A295), 99-25989-398 (A299), and 99-26150-276 (A304).

A number of biallelic marker haplotypes were shown to be significantly associated with schizophrenia.

Several preferred haplotype all showing highly significant association with schizophrenia and including various 3- and 4- marker haplotypes are haplotypes 817, 818 and 819, 137, 138, I and 2 of Figure 6, and haplotypes 970, 154 and 1 of Figure 5. The pvalues, odd-ratios and estimated haplotype frequencies are further described in Figures 5 and 6.

In particular, the two marker haplotype 1 of Figure 5 consisting of biallelic markers 99-5862- 167 (A70) and 99-15875-165 (A228) showed a highly significant p-value of7.8x10 5 and an odd-ratio of 1.61. Haplotype 818 of Figure 6 consisting of four biallelic markers (99-16032-292 (A223), 99-25969-200 (A290), 99-25977-311 (A293), and 99-25989-398 (A299)) presented a p-value of 3.1xl0 7 and an odd-ratio of 9.08. Another example showing significance is haplotype 817 of Figure 6 consisting of four biallelic markers (99-16033-244 (A227), 99- 15875-165 (A228), 99-25950-121 (A285) and 99-25979-93 (A295)), presented a p-value of 2.4x10 7 and an odd-ratio of 100. Phenotypic permutation tests confirmed the statistical significance of these results. Estimated haplotype frequencies were 10.5% in cases and 0 in the controls. Haplotype 970 of Figure 5 consisting of four biallelic markers (99-5919-215 99-24658-410 (A76), 99-15875-165 (A228), and 99-16047-115 (A239)) presented a pvalue of 7.8x10 7 and an odd-ratio of 2.41. Phenotypic permutation tests confirmed the statistical significance of these results. Estimated haplotype frequencies were 25.7% in cases and 12.5 in the controls.

Several other significant haplotypes are listed in Figures 5 and 6, including several 2-, 3- and 4-marker haplotypes. Considered to be highly significantly associated with schizophrenia are the most significant 2-marker haplotypes (for example haplotype 1 of Figure W00058510 [htto:llwww.getthepatentcamlogin.dog/$exam.su portFetchDefaut.dogMJO0585 1 0.cpc?fromCahe= 1 part~maintooibar=bottom] Page 239 of 737 WO 00/58510 PCT/IB00/00435 237 noted above and the most significant 3-marker haplotypes (for example haplotype 137 of Figure 6 consisting of biallelic markers (99-15875-165 (A228), 99-16047-115 (A239) and 99- 25950-121 (A285)).

Further preferrred significant haplotypes considered associated with schizophrenia are haplotypes having p-values above a desired threshold level; all the haplotypes listed in Figures and 6 present p-values below 1.0x10 2 for 2-marker haplotypes, 1.0x10 4 for 3-marker haplotypes, and 1.0x0" 5 for 4-marker haplotypes. Figures 5 and 6 show several 2-marker haplotypes, haplotypes 1 to 9 and haplotypes 1 to 5 of Figures 5 and 6 respectively, having pvalues ranging from 7.8x10" 5 to 8.6x10 3 several 3-marker haplotypes, haplotypes 154 to 163 and 137 to 141 of Figures 5 and 6 respectively, having p-values ranging from 3.9x10' to 4 and several 4-marker haplotypes, haplotypes 970 to 973 and 817 to 836 of Figures and 6 respectively, having p-values ranging from 2.4x10" 7 to 7.3x10 6 Additionally, a particularly large number of the significant 3- and 4-marker haplotypes often comprised the biallelic markers A223, A76, A227, A239, A286, A290, A299 and most commonly A228 (99-15875-165), allele T.

The statistical significance of the results obtained for the haplotype analysis was evaluated by a phenotypic permutation test reiterated 100 times on a computer. For this computer simulation, data from the affected and control individuals were pooled and randomly allocated to two groups which contained the same number of individuals as the case-control populations used to produce the data summarized in figures 5 and 6. A haplotype analysis was then run on these artificial groups for the markers included in the haplotypes showing strong association with schizophrenia. This experiment was reiterated 100 times and the results are shown in the columns of Figures 5 and 6 labelled "Haplotype test by permutation procedure".

For a given haplotype, these results demonstrate the number of obtained (simulated) haplotypes having a p-value comparable to the one obtained for the given haplotype among 100 iterations.

These results, set forth in Figures 5 and 6 validate the statistical significance of the association between the haplotypes and schizophrenia.

Example Association Study Between Schizophrenia and the Biallelic Markers of the Invention in French Canadian Samples Collection Of DNA Samples From Affected And Non-Affected Individuals Biallelic markers of the present invention were further genotyped in French Canadian samples as described above in order to compare the association of the 1st and the 2nd portion of Region D with schizophrenia. The population used in the study was the same as described above with the exception that 2 male FH+ cases were not included.

W0005851 0 Lrhtp -/Iww.g etthe patent. co mLog in.do /Sexam.supportIFetch/Default.dogMWO00585 0.qpc?fromCache=l1part=maintoolbar--bottom]_Page 240 of 737 WO 00/58510 PCTJLBOOIOO435 238 The biallelic markers analyzed in the study include 34 preferred biallelic markers of the invention located in Region D of the chromosome 13q31-33 region. Included in the analysis were the 14 following biallelic markers from the first of two portions of Region D: 99- 26150/276 (A304), 99-26156/290 (A307), 99-26153/44 (A305), 99-25985/194 (A298), 99- 25974/143 (A292), 99-25977/311 (A293), 99-25972/3 17 (A291), 99-25965/399 (A287), 99- 2596 1/376 (A286), 99-25966/24 1 (A288), 25967/57 (A289), 99-25969/200 (A290), 99- 25979/93 (A295) and 99-25989/398 (A299). Included in the analysis were also the following biallelic markers from the second of two portions of Region D: 99-25993/367 (A24 1), 99-16047/115 (A239), 99-15875/165 (A228), 99-16033/244 (A227), 99-16032/292 (A223), 99- 25940/182 (A221), 99-15 880/162 (A218), 99-1603 8/118 (A 198), 99-15 870/400 (A 178), 99- 24649/186 (A 108), 99-5897/143 (A 107), 99-24644/194 (A80), 99-2465 8/4 10 (A76), 99- 5919/215 (A75), 99-5862/167 (A70), 99-16100/147 (A65), 99-7652/162 (A62), 99-24634/108 (A61), 99-24639/163 (A60) and 99-24656/260 (A48).

Single biallelic marker association results in schizophrenia cases Single biallelic marker studies yielded significant results, indicating an association of the nucleotide sequences of the invention with schizophrenia. Biallelic markers used in the analysis included the set of 34 biallelic markers shown in Table I11 below, 14 biallelic markers of which were located on the first of two portions of Region D, and 20 of which were located on the second portion. The distribution of markers in shown in Table 12 below. As summarized in Table 13 analyses using these biallelic markers demonstrated a significant association with schizophrenia for 5 markers on the second portion of Region D.

Table 11 CONTIG ISNPS GENOTYPED IPOLYMORPHISM I FREQUENCY IN I I I CONTROLS I" ~portion 99-26150/276 A/G 99-26156/290 A/C 69 99-26153/44 A/C 61 99-25985/194 C/T 29 99-25974/143 A/G 99-25977/311 A/G 73 99-25972/317 CIT 72 99-25965/399 A/G 49 99-25961/376 A/C 99-25966/241 A/G 63 99-25967/57 A/G 43 99-25969/200 GIT 99-25979/93 A/G 72 99-25989/398 A/G 29 99-16047/115 1CIT 99-15875/165 C/T 63 2nd portion 99-16033/244 54 W0005851 0 [http:Mww.g ethepatent.comLog in.do /SexamfsuportIFetchDefaut.do NVO005851 0.c cfromCache= 1 part=maintoolbar=bottom Page 241 of 737 WO 00/58510 PCT/IB00/00435 99-16032/292 A/C 58 99-25940/182 A/G 53 99-15880/162 A/G 58 99-16038/118 A/G 42 99-15870/400 A/G 33 99-24649/186 C/T 99-5897/143 A/C 59 99-24644/194 A/G 39 99-24658/410 C/T 58 99-5919/215 A/G 99-5862/167 C/T 51 99-16100/147 A/G 99-7652/162 A/G 52 99-24634/108 Af /53 99-24639/163 G/T 44 99-24656/260 A/G Table 12 Region No. of Biallelic Mean frequency Mean markers inter-marker distance (a) D luhalf 14 (14) 0.34 (0.07) 7 (6.3) D 2 half 20 0.42 (0.06) 11(13) D land 2 half 34(22) 0.39 (0.07) 10.3(11) Haplotype frequency analysis Analysis of markers Haplotype analysis for association of chromosome 13q31-q33related biallelic markers and schizophrenia was performed by estimating the frequencies of all possible 2, 3 and 4 marker haplotypes in the affected and control populations described above.

Haplotype estimations were performed by applying the Expectation-Maximization (EM) algorithm (Excoffier and Slatkin, 1995), using the EM-HAPLO program (Hawley et al., 1994) as described above.

Haplotype association results in schizophrenia cases Significant results were also obtained in haplotype studies indicating an association of the nucleotide sequences of the invention with schizophrenia.

The present inventors having previously demonstrated highly significant association of biallelic markers located on the Region D subregion of the human chromosome 13q3 I-q33 locus with disease. Using the Omnibus LR test which compares the profile of haplotype frequencies, and Haplo-maxM test which is based on haplotype differences for each haplotype in two groups, Figures 7 and 8 describe the results of an analysis of the first and second portions of Region D which demonstrated an association of the second portion of Region D with W00058510 rhttnD:llwww.getthepatentcom/Login.dog/sexam.suD ort/Fetch/Default.dogO005851 0.cpc?fromCache=l 1art=maintoolbar-bottom] Page 242 of 737 WO 00/58510 PCT/IB00/00435 240 schizophrenia.

For combinations of 2 and 3 biallelic markers, one likelihood ratio test is obtained based on the haplotype frequency values calculated using the E-M algorithm. A permutation procedure was used, where data from the affected and control individuals was pooled and randomly allocated to two groups which contained the same number of individuals as the casecontrol populations used to produce the data. A haplotype analysis was then run on these artificial groups for the markers included in the haplotypes showing strong association with schizophrenia. This experiment was reiterated 100 times. For a given haplotype, these results demonstrate the number of obtained (simulated) haplotypes having a p-value comparable to the one obtained for the given haplotype among 100 iterations.

Figure 7 shows a comparison of the LR test value distributions of haplotype frequencies in the two portions of Region D. This association of the second portion of Region D with schizophrenia is shown using both 2-marker and 3-marker combinations. The distribution of LR test values in the different regions was analyzed using a Kruskal-Wallis rank test, a chi-square test with r-1 degrees of freedom, where r represents the number of value sets compared. As shown, the significance of the association is demonstrated by a chi-square value (one degree of freedom) of 74.405 and a p-value of less than Ixl 010 for 2 marker combinations, and a chi-square value (one degree of freedom) of 228.72 and a p-value of 1xl10 for 3- marker combinations.

Another association analysis approach based on haplotype frequency differences, referred to as the Haplo-maxM test, was conducted using region D biallelic markers. For one combination of markers having h haplotypes, h differences of haplotype frequencies can be compared via a Pearson chi-square statistic (one degree of freedom). The haplo-max test selects the difference showing the maximum positive test value between cases versus controls (rejecting test values based on rare haplotype frequencies, i.e, with an estimated number of haplotypes inferior to 10); for one combination of markers there is therefore one Max-M test value. The results of the Haplo-maxM test using Region D biallelic markers are shown in Figure 8.

Figure 8 shows the distribution ofhaplo-maxM test values obtained for both 2-marker and 3-marker combinations in the two portions of Region D, demonstrating an association of the second portion of Region D with schizophrenia. The comparison of the distribution of Haplo-maxM test values oin the two regions was analyzed using a Kruskal-Wallis rank test, a chi-square test with r-1 degrees of freedom, where r represents the number of value sets compared. As shown, the significance of the association is demonstrated by a chi-square value W00058510 [http:twww. etthepatent.comLogin.dogSexam.supporFetch/Default.dooNVO05851 O.cpc?tromCache=l art=maintoolbar=botom]_Page243of737 WO 00/58510 PCT/IB00/00435 241 (one degree of freedom) of 34.839 and a p-value of less than 3.58x10 9 for 2 marker combinations, and a chi-square value (one degree of freedom) of 13.773 and a p-value of 2 6 x10 4 for 3- marker combinations.

The results from the haplo-maxM tests further confirms the association shown using the Omnibus LR test results.

Results of association studies discussed above using biallelic markers of the invention are further summarized in Table 13 below, showing a significant association of the biallelic markers with schizophrenia in both single biallelic marker and haplotype analysis.

Table 13 Single-point Analysis Multi-point analysis (Haplotype-based analysis) No. ofallelic freq No. Significant Omnibus LR TEST differences 10% allelic tests 2-mks 3-mks 4-mks Region D, Ist 0 0 0,03 0,05 0,06 portion Region D, 2nd 0 5 0,30 0,30 0,31 portion percentage of significant tests level of significance) Cases (N=213)/ Controls (N=241) Example Association Study Between Bipolar Disorder and the Biallelic Markers of the Invention Description of study design Biallelic markers of the invention were analyzed in bipolar disorder cases. As in examples above, single and multi-point analyses showed a significant association of the markers of the invention, of Region D of the chromosome 13q33 locus, and more particularly of a subregion of Region D with bipolar disorder.

A) Description of the Affected population All the samples were collected from a study of bipolar disorder undertaken in a hospital located south of Buenos Aires, Argentina, generally representing a population estimated at about 400,000 inhabitants. Patients were evaluated by four doctors in 1994 and 1995. The study design involved in the ascertainment of cases and their first degree relatives (parents or siblings). 514 individuals were available for the study. This group consisted of 158 subjects from 51 different families, and 356 independent subjects.

As a whole, bipolar disorder cases were ascertained according to the diagnosis of bipolar disorder established by the DSM-IV (Diagnostic and Statistical Manual, Fourth edition, Revised 1994, American Psychiatric Press); W0005851 0 [tqpL/twww.getthepatent.com/Login.dog/Sexam.support[Fetch/Defau I doAJOO05851 0.cpcfromCache= 1 part=maintoolbar--boftomlPage 244 of 737 WO 00/58510 PCT/IB00/00435 242 Available for consideration for each coded case were also age, sex, nationality of parents and grand parents, ethnic origin, familial composition, marital state, socio-economic level, educational level, professional situation, employment, receational activities, age of onset of phychiatric symptoms, age of first consultation, occurrences of obstetric or prenatal incidents, suicide attempts, other medical conditions, treatment for or occurrence of a neurological condition, familial occurrence of symptoms, previous or concurrent use of psychotropic drugs, other admissions to a hospital or medical treatments, and diagnostic reason for admission including DSM-IV diagnosis and symptoms first presented on admission to hospital.

Available for study were 226 bipolar disorder ascertained cases of which 203 were independent cases. This group consisted of 51 cases from 51 families, 20 cases in relatives thereof, and 155 independent cases. Upon elimination of 3 cases from the initial independent 155 cases due to discovery of a familial relation, the total number of independent cases was 203.

Cases were classified according to bipolar disorder type. The cases included 115 bipolar disorder type I individuals (including 1 rapid cycling case), 67 bipolar disorder type II individuals (including 1 rapid cycling case), 18 unclassified bipolar disorder cases, and 3 cases which remained unclassified due to lack of or inconsistent information.

The 203 independent cases were examined for a familial history of psychosis. 53 of these cases reported an occurrence of psychosis (characterized as schizophrenia or bipolar disorder) among first degree relatives (father, mother, brothers, sisters or children).

B) Decription of the Unaffected population Available for study were 201 controls which had not been affected by any psychiatric difficulties or reported any familial history of psychiatric difficulties. Available for consideration were also age, sex and ethnic origin of the unaffected population.

C) Case and Control Populations Selected for the Association Study For the association study, the case population under study consisted of 201 individuals selected from the 226 total cases above; the control population consisted of 198 individuals selected from the 201 controls described above.

The association data that are presented in the Example 5d below were obtained on a population size detailed in Table 14 below.

Table 14 Cases and Control Populations Selected for the Association Study Sample type Cases Controls Sample size 201 198 Gender W00058510 [h p/wwwetthepatent.com/Login.do/Sexam.support/Fetch/Default.do/W0058510.cpc?fromCache= 1pdart=maintoolbar=bottomPage 245 of 737 WO 00/58510 PCT/IB00/00435 243 Male 68 81 Female 124 117 Missing 9 Ethnic origin Causasian 182 177 Non caucasian 5 21 Missing 14 Familial history of psychosis (FH)* positive 54 0 none 147 198 close relatives (first degree) Both case and control populations form two groups, each group consisting of unrelated individuals that do not share a known common ancestor.

Genotyping of affected and control individuals The general strategy was to individually scan the DNA samples from all individuals in each of the populations described above in order to establish the allele frequencies of biallelic markers, and among them the biallelic markers of the invention, in the diploid genome of the tested individuals belonging to each of these populations.

Association analysis The association analysis included 30 preferred biallelic markers of the invention located in Region D of the chromosome 13q31-33 region. Included in the analysis were the 14 following biallelic markers from the first of two subjective portions of Region D: 99-26150/276 (A304), 99-26156/290 (A307), 99-26153/44 (A305), 99-25985/194 (A298), 99-25974/143 (A292), 99-25977/311 (A293), 99-25972/317 (A291), 99-25965/399 (A287), 99-25961/376 (A286), 99-25966/241 (A288), 25967/57 (A289), 99-25969/200 (A290), 99-25979/93 (A295) and 99-25989/398 (A299). Included in the analysis were also the 16 following biallelic markers from the second of two portions of Region D: 99-25993/367 (A241), 99-16047/115 (A239), 99- 15875/165 (A228), 99-16033/244 (A227), 99-16032/292 (A223), 99-25940/182 (A221), 99- 15880/162 (A218), 99-16038/118 (A198), 99-15870/400 (A178), 99-24649/186 (A108), 99- 5897/143 (A107), 99-24644/194 (A80), 99-5919/215 (A75), 99-5862/167 (A70), 99-16100/147 W0005851 0 [http l/ww.getthe patent. co m/Log in.d og/$exa m. support/Fetch/Defa uIt.dogiWO00585 1 0.CpC~fromCacJhe= 1 pa rt~ma intool ba r--botto m1 Pag e 246 of 737 WO 00/58510 PCTIIBOO/00435 and 99-7652/162 (A62).

A) Single biaflelic marker association results in bilolar disorder cases For each allele of the biallelic markers included in this study, the difference between the allelic frequency in the unaffected population and in the population affected by bipolar disorder was calculated and the absolute value of the difference was determined. The set of biallelic markers and their allelic frequencies included in this study are set forth in Table 15. The more the difference in allelic frequency for a particular biallelic marker or a particular set of biallelic markers, the more probable an association between the genomic region harboring this particular biallelic marker or set of biallelic markers and bipolar disorder. Allelic frequencies were also useful to check that the markers used in the haplotype studies meet the Hardy-Weinberg proportions (under random mating assumptions) Table REGON ONTG IPOSITION ISNPS GENOTYPED POLYMORPHISM 1FREQUENCY [RGIN ONIGION CONTIGj I N CONTROLS 168,02 99-26150/276 62,93 Region D first Half Region D second Half 173,29 99-26156/290 A/C 72,42 177,01 99-26153/44 A/C 52,66 186,41 99-25985/194 C/T 28,87 190,15 99-25974/143 M/G 31,79 216,43 99-25977/3 11 A/G 63,82 224,62 99-25972/317 C/T 72,32 236,64 99-25965/399 M/G 58,24 244,82 99-25961/376 A/C 44,35 254,70 99-25966/241 A/G 66,18 257,85 99-25967/57 M/G 42,44 261,23 99-25969/200 G/T 35,76 263,67 99-25979/93 M/G 67,15 269,39 99-25989/398 M/G 35,88 29,0 9-25993/367 -7 7,387-' 303,04 99-16047/115 C/T 69,01 335,02 99-15875/165 Cr1' 61,3 354,81 99-16033/244 CfI' 50,3 366,5 1 99-16032/292 A/C 62,87 367,14 99-25940/182 M/G 54*39 372,98 99-15880/162 M/G 62,72 375,28 99-16038/118 37,29 W0005851 0 1httppJwwwlgem ginlw.dg/Sexam.support/Fetch/Defaut.dogANV005S 5 1 0.cPcfromCache=1 part=maintoolbar-bottoml Page 247 of 737 WO 00/58510 PCT/IB00/00435 383,41 99-15870/400 A/G 29,65 394,16 99-24649/186 C/T 66,57 395,27 99-5897/143 A/C 52,6 409,93 99-24644/194 A/G 38,29 424,95 99-5919/215 A/G 60,63 441,62 99-5862/167 C/T 46,53 444,00 99-16100/147 A/G 48,84 445,84 99-7652/162 49,7 4 4

TOTAL

frequency in caucasian controls (N=177) of the first allele (alphabetic order) Region D was arbitrarily split in two halves (D 1" half and D 2 d half) for purpose of the analysis.

The present inventors have previously demonstrated significant association of biallelic markers located on the Region D subregion of the human chromosome 13q31-33 region with disease. Using a set of 30 biallelic markers shown in Table 15, D 1" half contained 14 markers and D 2 n d half contained 16 markers.

Table 15 also shows the physical order of the biallelic markers on Region D of the human chromosome 13q3 1-q33 region. The mean intermarker distances of the biallelic markers on the first and the second subjective portions of Region D were as listed below in Table 16.

Table 16 Region Mean Inter-marker distance (std) D I half 7.80(6.33) D 2 r half 9.79 (8.78) D 1 s and 2 half 9.58 (8.46) The analysis using selected Region D biallelic markers of the invention demonstrated a significant association with bipolar disorder for the second portion of Region D. The analysis was conducted using the sample population described above with 182 caucasian cases and 177 caucasian controls selected from the total case and control group.

One biallelic marker in particular, 99-15875/165(A228), located on the second half of Region D, demonstrated a significant association with disease at a significance level of better than 5% (corresponding to an absolute logarithm (p-value) of 1.3).

W00058510 [http:ltwwwqgetthepatent com/Login.dog/Sexam.support/Fetch/DefauIt.dogNO00585 1 .cc?fromCacr-e=1 1art=maintoolbar=boftomage 248 of 737 WO 00/58510 PCT/IB00/00435 246 B) Haplotype association results in bipolar disorder cases Haplotype analysis for association of chromosome 13q31-q33-related biallelic markers and bipolar disorder was performed by estimating the frequencies of all possible 2, 3 and 4 marker haplotypes in the affected and control populations described above. Haplotype frequencies estimations were performed by applying the Expectation-Maximization (EM) algorithm (Excoffier and Slatkin, 1995), modified by Nicholas Schork.

Significant results were obtained in haplotype studies indicating an association of the nucleotide sequences of the invention with bipolar disorder. The haplotype analysis as shown in the Figures 9A, 9B, 10A, 10B, I 1A and 11B was conducted using the sample population described above, using 182 caucasian cases and 177 caucasian controls selected from the total case and control group.

Using the Omnibus LR test which compares the profile of haplotype frequencies, and Haplo-maxM test which is based on haplotype frequencies differences for each haplotype in two groups, Figures 9A, 9B, 10A, 10B, 11A and I IB show the results of a comparison of the first and second portions of Region D which demonstrated an association of the second portion of Region D with bipolar disorder.

a Omnibus LR tests values For a given combination of 2, 3 or 4 biallelic markers, one likelihood ratio test (LR test) is obtained based on the haplotype frequencies values calculated using the E-M algorithm.

Figures 9A and 9B show a comparison of the LR test value distributions of haplotype frequencies in the two portions of Region D. This association of the second portion of Region D with bipolar disorder is shown using both 2-marker and 3-marker combinations. A Kruskall Wallis rank test was used to compare LR test values distributions in the two subjective portions of Region D. This test has an asymptotic Chi-square distribution, under the null hypothesis of no difference between the sets compared, with degrees of freeedom, where r represents the number of sets compared. Here, we compare the 2 portions of region D, so r=2, and the asymptotic Chi-square distribution has 1 degree of freedom. As shown, the significance of the association is demonstrated by a chi-square value (one degree of freedom) of 46.62 and a pvalue of 8.62x10 2 for 2 marker combinations, and a chi-square value (one degree of freedom) of 124.72 and a p-value of 5.86x10 29 for 3- marker combinations.

b Haplo-max tests values Another association analysis approach based on haplotype frequencies differences, referred to as the Haplo-max test, was conducted using region D biallelic markers. The haplo- W00058510 [http/www.getthepatent.com/Loin.dog/Sexam.support/FetchlDefault.doNVO0058510.cpc?fromCache= 1part=maintoolbar=bottom] Page 249 of 737 WO 00/58510 PCT/IB00/00435 247 max test selects the difference showing the maximum positive (maxM) or negative (maxS) test value between cases versus controls (rejecting test values based on rare haplotype frequencies, i.e, with an estimated number of haplotypes carriers inferior to 10) for one combination of markers there is therefore one Max-M and one Max-S test values.

Figures 10A and 10B show the distribution of haplo-maxM test values obtained for both 2-marker and 3-marker combinations in the two portions of Region D, demonstrating an association of the second portion of Region D with bipolar disorder. The comparison of the distribution of Haplo-maxM test values in the two regions was analyzed using a Kruskal-Wallis rank test, a chi-square test with 1 degree of freedom. As shown, the significance of the association is demonstrated by a chi-square value of 29.07 and a p-value 6.98x10 8 for 2 marker combinations, and a chi-square value of 98.63 and a p-value of 3.04x10 23 for 3- marker combinations.

Figures 11A and 11 B show the distribution of Haplo-maxS test values again obtained for all 2-marker and 3-marker combinations in the two portions of Region D, demonstrating an association of the second portion of Region D with bipolar disorder. The comparison of the distributions of Haplo-maxS test values in the two portions was analyzed using a Kruskal- Wallis rank test with one degree of freedom. As shown, the significance of the association is demonstrated by a chi-square value of 34.6 and a p-value of 4.05x10 9 for 2 marker combinations, and a chi-square value of 98.31 and a p-value of 3.58x10 23 for 3- marker combinations.

The results from the haplo-maxM and haplo-maxS tests thus further confirm the association shown using the Omnibus LR test results.

Example Confirmation of Associations With Schizophrenia and Bipolar Disorder ("SCREENING

I")

Results obtained above using French Canadian schizophrenia samples and Argentinian bipolar disorder cases were confirmed in larger screening samples and in several different populations using markers spanning Region D of the chromosome 13q3 1-q33 region.

In the confirmation studies, French Canadian schizophrenia samples (Algene) described above, additional United States schizophrenia samples and Argentinian bipolar disorder (Labimo) samples were analyzed in sub-regions of Region D referred to as sub-regions DI to D4. The schizophrenia sample referred to as the Algene (or French Canadian) and the bipolar disorder sample referred to as the Labimo sample (Argentinian) are as described above. The United States schizophrenia samples are described in Table 17 below.

W0005851 0 [http:hvww.getthepatentcom/Login.dog/SexamsuportFetcti/Defaut.dogNVO005851 0.cpc?fromCache= 1part~maintoolbar--bottom] Page 250 of 737 WO 00/58510 PCTJIBOO/00435 Table 17 United States Schizophrenia Cases and Control Populations (United States Caucasians) Sample type Cases Random US Controls Sample size 131 188 Ethnic origin European Causasians 92 (26 female, 66 male) Ashkenazi caucasians 24 (7 female, 17 female) Other Caucasians (7 female, 8 male) Familial history of psychosis (FH) positive 133 none 147 198 A set of 32 SNPs covering sub-regions D I to D4 (mean density of 1 SNP/25kb) was genotyped on the two different schizophrenia samples and one bipolar disorder sample. The 32 biallelic markers genotyped are shown in Table 18.

Table 18 SNPs Polymorphism Frequency in Algene Controls(141) 99-5873/159 C/T 22 99-30329/380 CrT 48 99-15253/382 C/T 37 99-15280/432 C/T 39 99-15256/392 C/T 99-15258/337 G/T 24 99-27345/189 GIC 26 99-26150/276 A/G 48 99-25974/143 A/G 23 99-25950/121 G/C 28 99-25972/317 CIT 28 99-25965/399 A/G 99-25966/241 A/G 37 99-25989/398 A/G 28 W00058510 Ihttpi/wwetthe patentco mLogin.dogexa m. suportFec lDefa ut.doaqMO05851 O.cpcfromCache= 1 part=maintolbar=bottom] Page 251 of 737 WO 00/58510 PCT/IB00/00435 99-16047/115 C/T 99-16052/214 A/G 37 99-15875/165 C/T 34 99-16105/152 A/G 46 99-16032/292 A/C 44 99-15880/162 A/G 44 99-15870/400 A/G 99-5897/143 A/C 39 99-24644/194 A/G 41 99-24658/410 C/T 39 99-5919/215 A/G 99-5862/167 C/T 49 99-24634/108 A/T 99-24656/260 A/G 46 99-31960/363 A/G 39 8-128/33 C/T 23 99-27935/193 G/C 21 99-27943/150 G/C For each of the three populations, the number of significant tests in each sub-region of Region D based on single and multiple point biallelic marker analyses were compared among cases and controls. For single point analyses, excess of heterozygotes and deficiency of heterozygotes (Hardy-Weinberg disequilibrium coefficient), allelic and genotypic association analyses and logistic regression analyses were compared. For multipoint analyses, the haplotypic frequency differences between case and controls were examined, reported as MaxM for the maximum positive difference, and MaxS as the maximum negative difference, and the Omnibus LR test. The HaploMax tests giving MaxS and MaxM results and the Omnibus LR test are known and otherwise described herein. As noted in Figures 12 to 17, the tests containing the footnote involved significance thresholds which were assessed from observed distributions, inferred taking into account the DI, D2, D3 and D4 subregions for each subpopulation studied relative to the number of tests performed; for tests containing the footnote in Figures 12 to 17, significant tests were defined as those having a significance level of or better.

The present inventors have found that samples from three different populations all show a significant association to the schizophrenia trait with biallelic markers located in region D, thus confirming previous association studies with different samples and markers. Furthermore, W00058510 [http:/twww.gehepatent.comlogin.dog/Sexam.supportlFetch/efault.dogA0005851 0.cpc?fromCache= 1part=maintoolbar=bottom]Page 252 of 737 WO 00/58510 PCT/IB00/00435 250 the inventors have found in all three populations that the association is most significant in the sub-region D3. Thus, it is likely that a gene associated with schizophrenia and bipolar disorder resides in the region. The sbgl and g35030 nucleic acid sequences described herein reside in the region D3.

In addition to results using markers in previous analyses, analyses with the 32 biallelic markers listed in Table 18 demonstrated significant results in single point analyses for several newly analyzed biallelic markers. In particular, markers 99-25974-143 (A292), 99-25972-317 (A291), 99-15870-400 (A178), 99-24656-260 (A48) demonstrated a statistically significant excess or deficiency of heterozygotes.

Schizophrenia: Algene (French Canadian) The analysis using Algene samples compared the total patients cluster of patients selected for analysis cases of the cluster showing a familial history of psychosis and cases of the cluster with an absence of familial history of psychosis to Algene control samples. Additionally, for further comparison, the number of significant tests in Region D and each of the sub-regions of Region D were compared among total cases and total controls from the screening sample of example 5b above is listed in Figure 12 under "first screening sample".

As previously reported, the original French Canadian (Algene) samples show a significant association to the schizophrenia trait with biallelic markers located in region D, both in single and multi-point analyses. Furthermore, results show that the association is clearly confined to subregion D3 and does not extend to D2 and D4. In single point analyses, a significant concentration of biallelic markers containing the sbgl gene presented an excess of heterozygotes for familial cases. Five of 13 (5/13) markers around sbgl were significant for allelic association analysis.

Figure 12 provides the results from a single and multi-point biallelic marker analysis comparing regions Dl, D2, D3, and D4 located in the chromosome 13q31-q33 region.

Figure 13 shows the sum of the results shown in Figure 12 over the larger Region D span tested (ie. Dl, D2, D3 and D4).

Figures 12 and 13 thus demonstrate that there is a significant association with Region D and schizophrenia in the Algene sample. Furthermore, these figures show that the number and percentage of significant tests was highest in sub-region D3 consistently across comparisons among controls and FH+, FH- and total cases. In comparing the number of significant tests in sub-region D3 among FH+ and FH- cases, the figures show that the association is more clearly observed in cases having a familial history of psychosis; single point analyses suggested a higher number of significant tests in the FH+ cases than multiple point analyses.

Figures 12 and 13 also show that a larger screening sample confirms the results of the smaller sample from the first screening of Algene samples, both for the larger Region D and for W00058510 fhttpJtwww.qettheDatent.comfLogin.dog/Sexam.suo rtIFetchDefaut.dogVO005851 0. cpc?fromCa che= 1 part=maintoolbar=bottom] Page 253 of 737 WO 00/58510 PCT/IB00/00435 251 the sub-region D3.

Schizophrenia: United States Schizophrenia samples As in the French Canadian samples, the present inventors have found Region D, and more specifically sub-region D3, to be significantly associated with schizophrenia in a first, smaller screening sample of the United States Schizophrenia samples. Further analysis in the United States Schizophrenia population using a set of biallelic markers covering Region D confirms that the association of sub-region D3 with schizophrenia is of high statistical significance.

The United States Schizophrenia samples selected for the analysis consisted of the 92 European caucasians. Two analyses were performed, a first analysis using controls consisting of 188 random US controls, and a second analysis where controls consisted of 241 controls from the French Canadian samples described above.

Figure 14 provides the results from a single and multi-point biallelic marker analysis comparing regions Dl, D2, D3, and D4 located in the chromosome 13q31-q33 region. Figure 15 shows the sum of the results shown in Figure 14 over the larger Region D span tested (ie.

D1, D2, D3 and D4).

As shown in the figures, the analysis in United States Schizophrenia samples also suggests a significant association of sub-region D2 with schizophrenia, when considering multipoint analyses. However, this association of the D2 region with schizophrenia is of lesser statistical significance than the association of schizophrenia with sub-region D3 because a lower number of tests were carried out in the D2 region. Additionally, one marker (99-5897/143) in particuar, localized in the sbgl gene showed a significant excess of heterozygotes in schizophrenia familial cases.

In general, the number of significant tests in United States Schizophrenia samples were lower that in French Canadian population. This may be attributed to the higher heterogeneity of the United States Schizophrenia sample in comparison to the French Canadian samples.

Analyses using the United States Schizophrenia samples were done using either caucasian controls from the French Canadian samples, or US random controls.

Bipolar disorder: Labimo (Argentinian) As in the French Canadian and United States Schizophrenia samples, the present inventors have found Region D, and more specifically sub-region D3, to be significantly associated with bipolar disorder in Labimo samples from Argentina. Further analysis using a more extensive set of biallelic markers covering Region D confirms that the association of subregion D3 with bipolar disorder is of high statistical significance.

Figure 16 provides the results from a single and multi-point biallelic marker analysis W0005851 0 [http:/twww.getthepatent.comfgin.do/Sexam.suppeul.do 0 0 5 8 5 1 O.ccfromCache part=maintoolbar=bottom] Page 254 of 737 WO 00/58510 PCT/IB00/00435 252 comparing regions D1, D2, D3, and D4 located in the chromosome 13q31-q33 region. Figure 17 shows the sum of the results shown in Figure 16 over the larger Region D span tested (ie.

DI, D2, D3 and D4). While results showed the most significant association for D3 in Labimo samples, some background signal was seen for D2. It is possible that this variance in the percentage of significant tests reflects the higher relative heterogeneity of the Labimo samples in comparison to the French Canadian samples.

Figures 16 and 17 thus demonstrate that there is a significant association with Region D and bipolar disorder in the Labimo sample.

Analyses of Labimo samples were also conducted separately in bipolar disorder I and bipolar disorder II cases, as shown in Figure 16. In comparisons of results obtained with bipolar disorder I and II types, the association of sub-region D3 with schizophrenia tended to be more clearly found in bipolar disorder I cases.

Example 6 Preparation of Antibody Compositions to the sbgl protein Substantially pure protein or polypeptide is isolated from transfected or transformed cells containing an expression vector encoding the sbgl protein or a portion thereof. The concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon filter device, to the level of a few micrograms/ml. Monoclonal or polyclonal antibody to the protein can then be prepared as follows: A. Monoclonal Antibody Production by Hvbridoma Fusion Monoclonal antibody to epitopes in the sbgl protein or a portion thereof can be prepared from murine hybridomas according to the classical method of Kohler, G. and Milstein, Nature.

256:495 (1975) or derivative methods thereof. Also see Harlow, and D. Lane. 1988.

Antibodies A Laboratory Manual. Cold Spring Harbor Laboratory. pp. 53-242.

Briefly, a mouse is repetitively inoculated with a few micrograms of the sbgl protein or a portion thereof over a period of a few weeks. The mouse is then sacrificed, and the antibody producing cells of the spleen isolated. The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall, (1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody W0005851 0 [hp:l/twww.getthepatent.com/Login.dog Sexam.s port/FetchDefau .dogAN005851 0.cpc?fromCache= 1 part=maintoolbar=bottom] Page 255 of 737 WO 00/58510 PCT/IB00/00435 253 production are described in Davis, L. et al. Basic Methods in Molecular Biology Elsevier, New York. Section 21-2.

B. Polvclonal Antibody Production by Immunization Polyclonal antiserum containing antibodies to heterogeneous epitopes in the sbgl protein or a portion thereof can be prepared by immunizing suitable non-human animal with the sbgl protein or a portion thereof, which can be unmodified or modified to enhance immunogenicity. A suitable non-human animal is preferably a non-human mammal is selected, usually a mouse, rat, rabbit, goat, or horse. Alternatively, a crude preparation which has been enriched for sbgl concentration can be used to generate antibodies. Such proteins, fragments or preparations are introduced into the non-human mammal in the presence of an appropriate adjuvant aluminum hydroxide, RIBI, etc.) which is known in the art. In addition the protein, fragment or preparation can be pretreated with an agent which will increase antigenicity, such agents are known in the art and include, for example, methylated bovine serum albumin (mBSA), bovine serum albumin (BSA), Hepatitis B surface antigen, and keyhole limpet hemocyanin (KLH).

Serum from the immunized animal is collected, treated and tested according to known procedures. If the serum contains polyclonal antibodies to undesired epitopes, the polyclonal antibodies can be purified by immunoaffinity chromatography.

Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. Also, host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low titer antisera. Small doses (ng level) of antigen administered at multiple intradermal sites appears to be most reliable. Techniques for producing and processing polyclonal antisera are known in the art, see for example, Mayer and Walker (1987). An effective immunization protocol for rabbits can be found in Vaitukaitis, J. et al. J. Clin. Endocrinol. Metab. 33:988-991 (1971).

Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall. See, for example, Ouchterlony, O. et al., (1973). Plateau concentration of antibody is usually in the range of 0.1 to 0.2 mg/ml of serum (about 12 pM). Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher, Chap. 42 in: Manual of Clinical Immunology, 2d Ed. (Rose and Friedman, Eds.) Amer. Soc. For Microbiol., Washington, D.C.(1980).

Antibody preparations prepared according to either the monoclonal or the polyclonal protocol are useful in quantitative immunoassays which determine concentrations of antigenbearing substances in biological samples; they are also used semi-quantitatively or qualitatively to W00058510 [_Eclp:lleww25of73epatent.com I7oindog/Sexam.supporFetchDefaut.dogMJ00585 0.cpcfromCache=7 art=malntoolbar=bottmlP ag f73 WO 00/58510 PCT/IB00/00435 254 identify the presence of antigen in a biological sample. The antibodies may also be used in therapeutic compositions for killing cells expressing the protein or reducing the levels of the protein in the body.

Example 7 Study of effect of sbgl peptides on behavior of mice Animals: Male C57BL6 adult mice (approximately 6 weeks old) Peptides: sbgl peptide: NH2-QPLERMWTCNYNQQKDQSCNHKEITSTKAE-COOH Control 1: NH2-REAHKSETISSKLQKEKQIKKQ-COOH Control 2: NH2-MHMKTILGPRLGLGE-COOH Protocol: I. Inject mice intraperitoneally with 50 pg peptide in 200 pl sterile physiological saline (n 4 peptide).

2. Place mice in clean empty cages containing no litter, and only a small test tube rack. The cages are covered with a plastic sheet to enable taking photographs and video-tracking.

3. Observe behavior for one minute from t 5 min up to t 45 min, as indicated. Any locomoter or stereotypy movements were recorded as positive over 1 min intervals. Locomoter movements include climbing, and rearing while stereotypy movements include grooming and scratching. At the end of the experiment, the number of movements were added up for each animal.

Results: 1. Mice injected with the sbgl peptide exhibited a decrease in the frequency of their movements over the time course of the experiment, shown in Figure 18. This is illustrated in the left top panel of Figure 18, where we compare the average number of movements in 3 separate time points and 15 min) with the average movements per min in the last period of observations (30, 35, 40, and 45 min). The sbgl peptide also increased W0005851 0[http Itwww.q ethe patent. com/Login .dog/Sexa m. supportletcfiefa ult. dog NvO005851 0.cpc?fro mCa che= 1 part= ma i Moo Ib r--botom] Page 257 of 737 WO 00/585 10 PCTIIBOO/00435 255 stereotypy this effect was most prominent during the last period of observations. However, because the onset of stereotype was variable, we presented the data as the average of stereotypy for observations over the entire time period.

-256- The disclosures of all issued patents, published PCT applications, scientific references or other publications cited herein are incorporated herein by reference in their entireties.

Although this invention has been described in terms of certain preferred embodiments, other embodiments which will be apparent to those of ordinary skill in the art of view of the disclosure herein are also within the scope of this invention. Accordingly, the scope of the invention is intended to be defined only by reference to the appended claims.

Throughout the specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other 10 integer or group of integers.

.o.ooi W0005851 0 [ttpJhvww.q etthe patent. com/Log in.dog/Sexa m. support/Fetch/De fautd OgVO005851 0.cpc?fromCar-he= 1 part= ma intoo lba r--bottom) Pa e 259 of 73 7 WO 00/585 10 PCTTBOO/00435 257 Sequence listing, free text The following free text appears in the accompanying Sequence Listing: Schizophrenia Associated Protein Biallelic marker regulatory region gene exon complement polymorphic base or allele deletion of basic protease cleavage site probe primer downstream upstream amplification sequencing oligonucleotide W0005851 0 (htJwww.getthepatent.rcomILogin.dogl~exam.supportJFetchIDefaultdo M000585 0.c-pc?fromCache=l1 art=maintoolbar--boftomI Page 260 of 737 WO 00/58510 PCTIBOOIOO435 258 The disclosures of the following references are incorporated herein by reference in their entireties: Abbondanzo S.J. et al. (1993) Methods in Enzymology, Academic Press, NewYork. pp. 803- 823.

Ajioka R.S. et at. (1997) Am. J. Hum. Genet.60:1439-1447.

Altschul et at., 1990, J. Mol. Biol. 215(3):403-410; Altschul et at., 1993, Nature Genetics 3:266-272 Altschul et al.,1997, Nuc. Acids Res. 25:3389-3402 Anton M. et at., 1995, J. Virol.,69: 4600-4606.

Araki Ket al. (1995) Proc. Natl. Acad. Sci. USA. 92(l):160-4.

Ausubel et at. (1989)Current Protocols inMolecu tar Biology, Green Publishing Associates and Wiley InterscienceN.Y.

Baubonis W. (1993) Nucleic Acids Res. 2](9):2025-9.

Beaucage et at., Tetrahedron Lett 1981, 22: 1859-1862 Bradley A.,(]1987) Production and analysis of chimaeric mice. In:E.J. Robertson(Ed.), Teratocarcinomas and embryonic stem cells: A practical approach.IRL Press, Oxford, pp. 113.

Brown EL, Belagaje R, Ryan MJ, KhoranaHG, Methods Enzymol 1979;68:109-151 Brutla$ et al. Comp. App.Biosci. 6:237-245, 1990 Chai H. et at. (1993) Biotechnol. Appl.Biochem.18:259-273.

Chee et at. (1996) Science. 274:610-614.

Chen and Kwok Nucleic Acids Research 25:347-353 1997 Chen et al.(1987) Mot. Cell. Biol. 7:2745-2752.

Chen et at., 1987, Mol. Celt.Biol., 7: 2745-2752.

Chou J.Y. (1989) Mat. Endocrinol.3:l5 11-1514.

Clark A.G. (1990)Mol. Biol. Evol. 7:111-122.

Coles et at. Hum. Mol. Genet., 7:791-800, 1998 Compton J. (1991 )Nature. 350(631 3):9 1-92.

Davis et at., Basic Methods in MolecularBiology, ed., Elsevier Press, NY, 1986 Dempster et at., (1977) i.R. Stat. Soc., 39B3:1-38.

Dent D.S. and Latchman D.S. (1993) TheDNA mobility shift assay. In: Transcription Factors: A PracticalApproach (Latchman DS, ed.) Oxford: IRL Press. ppl-26.

Eckner R. etal. (1991) EMBO J. 10:3513-3522.

Excoffier L. and Slatkin M.(1 995) Mot. Biol. Evol., 12(5): 921-927.

Feldman and Steg, 1996, Medecine Sciences, synthese, 12:47-55 W0005851 0_rhttp:/m~w. getthe patent. com1Login.d og/Sexa m. suportFech~efaut. dogWO00 5 8 5 1 0.cpc?fromCache= 1 part= ma intool ba r--boftom] Page 26 1 of 737 WO 00/58510 PCTIiBOO/00435 259 Flotte et al. (1992) Am. J.Respir. Cell Mol. Biol. 7:349-356.

Fodor et at. (199 1) Science25 1:767-777.

Fraley et al. (1979) Proc. NatI. Acad. Sci. USA.76:3348-3352.

Fried M. and Crotbers D.M. (1981)Nucleic Acids Res.9:6505-6525.

Fuller S. A. et al. (1996) Immunology in CurrentProtocols in Molecular Biology, Ausubel et al.Eds, John Wiley Sons,lnc., USA.

Furth P.A. et al. (1994) Proc. Nati. Acad. Sci USA.91:9302-9306.

Garner M.M. and Revzin A. (198 1) Nucleic AcidsRes.9:3047-3060.

Geysen H. Mario et al. 1984. Proc. Nati. Acad.Sci. U.S.A. 81:3998-4002 Ghosh and Bacchawat (199 1) Targeting ofliposomes to hepatocytes, IN: Liver Diseases, Targeted diagnosis andtherapy using specific rceptors and ligands. Wu et al.Eds., MarcelDekeker, New York, pp. 87-104.

Gonnet et al., 1992, Science2S6: 1443-1445; Gopal (1985) Mol. Cell. Biol., 5:1188-1190.

Gossen M. et at. (1992) Proc. Natl. Acad. Sd. USA.89:5547-5551.

Gossen M. et at. (1995) Science. 268:1766-1769.

Graham et at. (1973) Virology 52:456-457.

Green et al. (1986)Ann. Rev. Biochem. 55:569-597.

Griffin et al.( 1989) Science.245 :967-97 1.

Grompe, M. (1993) Nature Genetics. 5:111-117.

Grompe, M. et al. (1989) Proc. Natl. Acad. Sci. U.S.A.86:5855-5892.

GuH. etal. (1993) Cell 73:1155-1164.

Guatelli JC et at. Proc. Natl. Acad. Sci. USA. 3 5:273-286.

Hacia JG, Brody LC, Chee MS, Fodor SP, Collins FS, Nat Genet 1996; 14(4):441-447 Haff L. A. and Smimnov I. P. (1997) GenomeResearch, 7:378-388.

Harres B.D. and Higgins S.J. (1985) NucleicAcid Hybridization: A Practical Approach.

Hamres and Higgins Ed., lRLPress, Oxford.

Harju L, Weber T, Alexandrova L, Lukin M, Ranki Mjalanko A, Clin Chem 1 993;39(l 1 Pt 1 ):2282-2287 H-arland et al.(1985) J. Cell. Biol. 101:1094-1095.

Hawley M.E. et at. (1994) Am.J. Phys. Anthropol. 18:104.

Hen ikoff and Henikoff, 1993, Proteins 17:49-61 Higgins et at., 1996, Methods Enzymol. 266:383-402; Hillier L. and Green P. Methods Appl., 1991, 1: 124-8. Gu H. et al.(1994) Science 265:103- 106.

W0005851 0 http:twwwg qetthepa tent. comILog in.d og/Sexa m.su po rt/FetchlDefa ult. do AN0005851 0.cpc~fromCache= 1 part=maintoolbar--bottom] Page 262 of 737 WO 00/58510 PCT/1EB00100435 260 Hoess et at. (1986) Nucleic AcidsRes. 14:2287-2300.

Huang L. et al. (1996) Cancer Res56(5): 1137-1141.

Huygen et at. (1996) Nature Medici ne.2(8):893-898.

Izant i.G. and Weintraub H. (1984) Ce1136(4): 1007-1015.

Jutanet al. (1992)J. Gen. Virol. 73:3251-3255.

Kanegae Y. et al., Nuct. Acids Res. 23:3816-3821.

Karlin andAltschul, 1990, Proc. Nati. Acad. Sci. USA 87:2267-2268; Khoury iet at. (1993) Fundamentals of Genetic Epidemiology, Oxford UniversityPress, NY.

Kim U-i. et at. (1996) Genomics 34:213-218.

Kleinet at. (1987) Nature. 327:70-73.

Kolter et a. (1992) Annu.Rev. Immunot. 10:705-730.

Kozat MJ, Shah N, Shen N, Yang RFucini R, Merigan TC, Richman DD, Morris D, Hubbell E, Chee M, GingerasTR, Nat Med 1996;2(7):753-759 Landegren U. et at. (1998) GenomeResearch, 8:769-776.

Lander and Schork, Science, 265, 2037-2048,1994 Lenhard T. et al. (1996) Gene. 169:187-190.

Linton M.F. etat. (1993) J. Clin. Invest. 92:3029-3037.

Liu Z. et at. (1994)Proc. Natl. Acad. Sci. USA. 91: 4528-4262.

Livak et at.,Nature Genetics, 9:34 1-342, 1995 Livak KJ, Hainer JW, Hum Mutatl994;3(4):379-385 Lockhart et al.( 1996) Nature Biotechnology 14:1675 -1680.

Mansour S.L. et at. (1988) Nature. 336:348-352.

Marshall R. L. et al. (1994) PCR Methods and Applications.4:80-84.

McCormick et al. (1994) Genet. Anal. Tech. Appl. 11:158-164.

McLaughtinB.A. etat. (1996)Am. J. Hum. Genet.59:561-569.

Morton N.E. (1955) Am. J. Hum. Genet. 7:277-318.

Muzyczka et at. (1992) Curr. Topics in Micro. and Immunot.158:97-129.

Nada S. et at. (1993) Cell 73:1125-1135.

NagyA. et at. (1993) Proc. Natl. Acad. Sci. USA. 90: 8424-8428.

Narang SA, Hsiung HM, Brousseau R, Methods Enzymot 1979;68:90-98 Nedaetal. (1991)J. Biol. Chem. 266:14143-14146.

Newton et al. (1989)Nucleic Acids Res. 17:2503-2516.

Nickerson D.A. et (1990)Proc. Natl. Acad. Sci. U.S.A. 87:8923-8927.

Nicotau et a.(198 2 Biochim. Biophys. Acta. 721:185-190.

Nyren P, Pettersson B,Uhten M, Anal Biochemn 1993;208(l):171-175 W0005851 0 httrpiMww. etthe patentcomILogin do /Sexam.support/Fetch/Default.doPNO005851 0.qPq?tromCache= 1 part=maintoolbar--bottom] Page 263 of 737 WO 00/585 10 PCTIBOOIOO435 261 O'Reilly et al. (1992)Baculovirus Expression Vectors: A Laboratory Manual. W. H. Freeman andCo., New York.

Ohno et al. (1994) Science. 265:781-784.

Orita etal. (1989) Proc. NatI. Acad. Sci. U.S.A.86: 2776-2770.

Ott J.(1 99 1) Analysis of Human Genetic Linkage. John Hopkins University Press,Baltimore.

Pastinen et al., Genome Research 1997; 7:606-614 Pearson and Lipman, 1988, Proc. Nati. Acad. Sci. USA 85(8):2444-2448; Pease S. and William R.S. (1990) Exp. Cell. Res. 190:09-211.

Perlin et al. (1994) Am. J. Hum. Genet. 55:777-787.

Peterson et al.(1 993) Proc. Natl. Acad. Sci. USA. 90: 7593-7597.

Pietu et al.(1996) Genome Research.6:492-503.

Potter et al. (1984) Proc. Natl.Acad. Sci. U.S.A. 81(22):7161-7165.

Rayl et al., (1996) J. Bio.Chem, 271, 2225-2233.

Reid L.H. et al. (1990) Proc. Nati. Acad.Sci. U.S.A. 87:4299-4303.

Risch, N. and Merikangas, K. (I1996)Science. 273:1516-1517.

Robertson E. (1987) "Embryo-Derived StemCell Lines." In: E.J. Robertson Ed.

Teratocarcinomas And Embrionic Stem Cells: A Practical Approach. IRL Press, Oxford, pp.

71.

Rossiet al. (1991) Pharmacol. Ther. 50:245-254.

Roth J.A. et al. (I1996)Nature Medicine. 2(9):985-99 1.

Roux et al. (1989) Proc. Nati. Acad.Sci. U.S.A. 86:9079-9083.

Ruano et al. (1990) Proc. Nati. Acad.Sci. U.S.A. 87:6296-63 00.

Sambrook, Fritsch, and T.Maniatis. (1989) Molecular Cloning: A Laboratory Manual.

2ed. ColdSpring Harbor Laboratory, Cold Spring Harbor, New York.

Samson M, etal. (1996) Nature, 382(6593):722-725.

Samulski et al. (1989) J.Virol. 63:3822-3828.

Sanchez-Pescador R. (1988)J. Clin.Microbiol. 26(10):1934-1938.

Sarkar, G. and Sommer S.S. (1991)Biotechniques.

Sauer B. et al. (1988) Proc. Natl. Acad. Sci.U.S.A. 85:5166-5170.

Schaid DJ. et al. (1996) Genet. Epidemiol.13:423-450.

Schedl A. et al. (1993a) Nature. 362:258-26 1.

Schedl et al. (1993b) Nucleic Acids Res. 21:4783-4787.

Schedl etal. (1993b) Nucleic Acids Res. 21:4783-4787.

Schena et al. (1995)Science. 270:467-470.

Schenaetal. (1996)Proc. Nati. Acad. Sci.U.S.A. 93(20):10614-10619.

W0005851 0 [http:Mwww.etthepatent.comiLogin.dog/Sexam.supportJFetch/Default.dogNVO005 8 5 1 O.cpc?fromCarhe= 1 part=maintoolbar--boftoml Page 264 of 737 WO 00/58510 PCT/IBOO/00435 262 Schneider et aI.(1997) Arlequin: ASoftware For Population Genetics Data Analysis. University of Geneva.

Schwartz and Dayhoff, eds., 1978, Matrices for Detecting DistanceRelationships: Atlas of Protein Sequence and Structure, Washington:National Biomedical Research Foundation Sczakiel G. et al. (I1995)Trends Microbiol. 3(6):213-217.

Shayi.W. etal. (1991)Biochem.Biophys. Acta. 1072:1-7.

Sheffield, V.C. et al. (1991) Proc.Nati. Acad. Sci. U.S.A. 49:699-706.

Shizuya et al. (1992) Proc.Natl. Acad. Sci. U.S.A. 89:8794-8797.

Shoemaker DD, Lashkari DA,Momrs D, Mittmann M, Davis RW, -Nat Genet 1996;14(4):450- 456 Smith(1957) Ann. Hum. Genet. 21:254-276.

Smith et al. (1983) Mol. Cell.Biol. 3:2156-2165.

Sosnowski R.G. et al. (1997) Proc. Natl. Acad.Sci. U.S.A. 94:1119-1123.

Spielmann S. and Ewens W. J. (1998) Am. J.Hum. Genet. 62:450-458.

Spielmann S. etal. (1993)Ani. J. H-um.Genet. 52:506-516.

Steinberg N.L. (1992) Trends Genet. 8:1-16.

Sternberg N.L. (1994) Mamm. Genome. 5:397-404.

Syvanen AC, ClinChimn Acta 1994;226(2):225-236 Tacson et al. (1996) NatureMedicine. 2(8):888-892.

Te Riele et al. (1990) Nature.348:649-65 1.

Terwilliger J.D. and Ott J. (1994) Handbook of HumanGenetic Linkage. John Hopkins University Press, London.

Thomas K.R.et al. (1986) Cell. 44:419-428.

Thomas K.R. et al. (1987)Cell. 51:503-5 12.

Thompson et al., 1994, Nucleic Acids Res.22(2):4673-4680; Tur-Kaspa et al. (1986) Mol. Cell. Biol.6:716-718.

Tyagi et al. (1998) Nature Biotechnology. 16:49-53.

Urdea M.S. (1988) Nucleic Acids Research. 11:4937-4957.

UrdeaM.S. et al.(1991) Nucleic Acids Symp. Ser. 24:197-200.

Van derLugt et al. (1991) Gene. 105:263-267.

Vlasak R. et al. (1983)Eur. J. Biochem. 135:123-126.

Wabiko et al. (1986)DNA.5(4):305-3 14.

Walker et al. (1996) Clin. Chem. 42:9-13.

Weir, B.S. (1996) Genetic data Analysis II: Methods for Discretepopulation genetic Data, Sinauer Assoc., Inc., Sunderland, MA, U.S.A.

W0005851 0 [http:ww.getthepate nt.co mlLogin.dog/Sexam. .su pport/FetcIDefa ult. dogdWO00585 1 0.cpc?f romCa rhe= 1 part= ma intool ba r--bottom] Pag e 265 01737 WO 00/58510 PCTIBOOIOO435 263 White, M.B. et al. (1992) Genomics. 12:30 1-306.

White, M.B. etal. (1997) Genomics. 12:301-306.

Wong et al. (1980) Gene.1O:87-94.

Wood S.A. et al. (1993) Proc. Natl. Acad. Sci. U.S.A.90:4582-4585.

Wu and Wu (1987) J. Biol. Chem. 262:4429-4432.

Wu and Wu (1988) Biochemistry. 27:887-892.

Wu et al. (1989)Proc. Nat]. Acad. Sci. U.S.A. 86:2757.

Yagi T. et al. (1990) Proc.NatI. Acad. Sci. U.S.A. 87:9918-9922.

Zhao et al. (1998) Am.J. Hum. Genet. 63:225-240.

Zou Y. R. et al. (1994) Curr. BioI.4:1099-1103 EDITORIAL NOTE APPLICATION NUMBER 35719/00 The following sequence listing pages 1-436 are part of the description. The claims pages follow on pages 264-267 W0005851 0 http:/twww. etthe patent. co m/L.ogin.dog/$exa m. supportFetcIDefa uIt. dogAN0005851 0.cpc?fromCa che= 1 part= ma intoo lba r--boto m1Page 302 of 73 7 WO 00/58510 PCTIiBOO/00435 SEQUENCE LISTING <110> GENSET <120> SCHIZOPHRENIA ASSOCIATED GENES, PROTEINS AND BIALLELIC MARKERS <130> 53.WO1 <150> US 60/126,903 <151> 1999-03-30 <150> US 60/131,971 <151> 1999-04-30 <150> US 60/132,065 <151> 1999-04-30 <150> US 60/143, 928 <151> 1999-07-14 <150> US 60/145, 915 <151> 1999-07-27 <150> US 60/146,453 <151> 1999-07-29 <150> <151> <150> <151> US 60/146,452 1999-07-29 US 60/162,288 1999-10-28 <160> 231 <170> Patent.pm <210> 1 <211> 319608 <212> DNA <213> Homo sapiens <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> misc-feature 31. .1107 5 'regulatory region g35018 gene exon 1108. .1289 exon A g35018 gene exon 14877. .14920 exon B g35018 gene exon 18778. .18862 W0005851 0 fhttoplwww.g ettheDa tent. comLo i n.do /Sexam.suDortFetchDefault.doiWO005851 0.cpc?fromCache= 1 part=maintoolbar--bottom] Page 303 of 737 WO 00/58510 PCTIBOO/00435 <223> exon Bbis g35018 gene <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> exon 25553. .25740 exon C g35018 gene e xon 29388. .29502 exon D g 3 5018 gene exon 29967. .30282 exon E g35018 gene exon 64666. .64812 exon F g35018 gene exon 65505. .65853 exon G g35018 gene misc feature 65854. .67854 3 'regulatory region g35018 gene exon 94124. .94964 exon g35017 exon 201188. .201234 exon S g35030 gene exon 214676. .214793 exon T g35030 gene exon 215702. .215746 exon U g35030 gene exon 216836. .216915 exon V g35030 gene misc feature 213818. .215818 3' regulatory region g34872 gene W0005851 0 fhttp:llwww.etthe patent. comILog in.d oq/Sexa m. support/FetcI~efa ut. d oPWO005 8 51 0.cpc?fro mCache= 1 part= ma i Mod ba r--botom] Page 304 of 737 WO 00/58510 PCTIIBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> exon 215819. .215941 exon R complement g34872 gene exon 215819. .215975 exon Rbis complement g34872 gene e xon 216661. .216952 exon Qbis complement g34872 gene e xon 216661. .217061 exon Q complement g34872 gene exon 217027. .217061 exon Qi complement g34 872 gene exon 229647. .229742 exon X complement g34872 gene exon 230408. .230721 exon P complement g34872 gene exon 231272. .231412 exon Obis complement g34872 gene exon 231787. .231880 exon 02 complement g34 872 gene exon 231870. .231879 exon 01 complement g34872 gene exon 234174. .234321 exon 0 complement g34872 gene exon 237406. .237428 exon Nbis complement g34872 gene e xon 239719. .239807 exon N2 complement g34 872 gene W0005851 0 httJItwww.q etthe patent. co m/Login.dog/Sexam. su pporIFetch/Default. dogAJO0058 510 0. cc?fromC ache= 1 part=m a intaoobar--bottom1_Page 305 of 73 7 WO 00/58510 PCTJIBOOIOO435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> exon 239719. .239853 exon N complement g34872 gene e xon 240528. .240569 exon M1117 complement g34872 gene exon 240528. .240596 exon M1090 complement g34872 gene exon 240528. .240617 exon M1069 complement g34 8 72 gene exon 240528. .240644 exon MS2 complement g34872 gene exon 240528. .240824 exon M862 complement g34872 gene e xo n 240528. .240994 exon M692 complement g348 7 2 gene exon 240528. .241685 exon Ml complement g34872 gene exon 240800. .240993 exon MS1 complement g34872 gene misc feature 241.686. 243685 5'regulatory region g34872 gene misc feature 290652. .292652 3'regulatory region g34665 gene exon 292653. .292841 exon B complement g34 665 gene <220> <221> exon W0005851 0[http:/www. etthepate nt. comlLaq in.d og/Sexa m. sup ort/FetcVDefaulit. dog V000585 1 0.cpc?fromCacIhe=1 partmaintoolbar--botoml Page 306 of 737 WO 00/58510 PCT/iBOOIOO435 <222> 295555. .296047 <223> exon Ab complement g34 665 gene <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> e xon 295980. .296047 exon A complement g34665 gene misc feature 296048. .298048 5'regulatory region g34665 gene allele 8316 99-27943-150 :polymorphic base G or C allele 14726 8- 12 1-28 allele 14734 8- 12 1-36 allele 14852 8- 12 1-154 allele 14885 8-121-18 7 allele 14941 8-121-24 3 allele 14979 8- 121-28 1 allele 15050 8-121-352 allele 15062 8- 12 1-3 64 allele 15069 8- 121-37 1 :polymorphic base A or T :polymorphic base C or T polymorphic base A or T polymorphic base A or C polymorphic base G or T polymorphic base A or C i polymorphic base C or T polymorphic base C or T polymorphic base A or G W0005851 0 fhttp:ltwww.qetthepatentcomLogin.dog/SexamsuportFetch/efaut.dogNO005851 0.cpc?fromCactie= 1 part=maintoolbar--botoml Paqe 307 of 737 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 21672 99-27935-193 :polymorphic base G or C allele 25480 8-122-7 2 allele 25508 8- 122-100 allele 25679 B-122-27 1 allele 25680 8-122-272 allele 25734 8-122-32 6 allele 25768 8-122-3 60 allele 29403 8-123-55 allele 29537 8-123-189 allele 29545 8-123-197 allele 29655 8-123-307 allele 30169 8-14 7-2 70 polymorphic base A or T *polymorphic base C or T *deletion of CAAA *polymorphic base A or G *polymorphic base A or C *polymorphic base C or T polymorphic bas e A or T *polymorphic base C or T *polymorphic base C or T *polymorphic base G or C polymorphic base A or G <220> <221> allele <222> 49475 W0005851 0 http:/twww. ethe patent. com/Log in.d og/Sexa m. suportFetchDefault. d oiOOO 5 8 51 0.cc?fromCa che= 1 pant=ma intoo lba r--bottom] Page 308 of737 WO 00/58510 7 <223> 99-34243-210 :polymorphic base A or T PCTIiBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <2 23> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 64666 8-127-28 allele 64757 8-127-119 allele 64797 8-127-159 allele 64874 8-127-236 allele 64878 8-127-240 allele 64918 8-127-280 allele 65485 8-128-33 allele 65504 8-128-52 allele 65513 8-128-61 allele 65520 8-128-68 allele 65521 8-128-69 allele 65537 8-128-85 :polymorphic base A or G polymorphic base A or G polymorphic base A or C pQlymorphic base C or T polymorphic base A or G polymorphic base G or T :polymorphic base C or T :polymorphic base A or G :polymorphic base G or C :polymorphic base C or T :polymorphic base A or G :polymorphic base A or C W0005851 0 fhttp:/twww.g etthe patent. co m/Log in.dog/Sexa m.su portFetchefa ult. d oIWO05851 0.cpc?fromCa che= 1 part= ma intoo Iba r--bottom] Pag e 309 of 737 WO 00/58510 PCT/EBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 65596 8-129-50 allele 65607 8-129-60 :polymorphic base C or T :deletion of A allele 65857 8-129-311 allele 65947 8- 12 9-4 01 allele 75667 99-34240-49 allele 94534 99-31959-28 allele 95396 99-31960-36 allele 96956 99-319 62-2 5 allele 97156 99-31962-4 5 allele 106384 99- 442862-4 3 allele 106769 99-44282-54 allele 107158 99-24656-13 allele 107281 99-24656-26 polymorphic base A or G polymorphic base C or T '2 :polymorphic base A or T 1 :polymorphic base C or T 3 :polymorphic base A or G 0 :polymorphic base C or T 0 :polymorphic base A or G 9 :polymorphic base A or G *polymorphic base C or T 7 :polymorphic base A or G 0 :polymorphic base A or G W0005851 0 rhttpjMMw. gethe patent. comLog in.dog/Sexa m.sup port/Fetch/Defa ut.d og V00058 5 1 0.cpc?froMC ache= 1 part= myintoo lbar--bottom] Page 310 of 737 WO 00/58510 PCT/iBOOI00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 107609 99-24 63 6-22 allele 108499 99-31939-75 allele 108697 99-31939-273 allele 109451 9 9-4 428 1-4 18 allele 109612 99-4 428 1-257 allele 109792 99-44281-77 allele 112468 9 9-3 194 1-320 allele 115468 9 9-3 194 2-325 allele 155736 99-24635-79 allele 158172 99-16059-313 allele 160634 99-24 639-169 allele 160640 99-24639-163 :polymorphic base A or G :polymorphic base A or G :polymorphic base C or T :polymorphic base G or T :polymorphic base A or G :polymorphic base A or G :polymorphic base G or T :polymorphic base G or T :polymorphic base A or T :polymorphic base A or G :polymorphic base C or T :polymorphic base A or C <220> <221> allele W0005851 0 [tqED:/wwwg etthe patentcom/Lo in.dog/Sexam.supoart/Fetch/Default.dog/WVO005 8 Sl 0.cpc?fromCache=l1part=maintoolbar--boftomlEage 311 of 737 WO 00/58510 PCTLBOO/00435 <222> 160876 <223> 99-24634-108 :polymorphic base A or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 168974 9 9-7 652-162 allele 169300 9 9-7 652-4 88 allele 170746 9 9-16100-83 allele 170810 99-16100-14 7 allele 170858 99-16100-195 allele 170860 99-16100-197 allele 170906 99-16100-24 4 allele 171043 99-16100-38 1 allele 173358 99-5862-167 allele 174227 99-16083-101 allele 175800 99-16044-351 allele 180589 99-16042-420 :polymorphic base A or G :polymorphic base A or G :polymorphic base C or T polymorphic base A or G polymorphic base G or T polymorphic base C or T polymorphic base C or T polymorphic base A or C polymorphic base A or G polymorphic base C or T polymorphic base C or T :polymorphic base A or G W0005851 0 [ttD:/twww. etthepatentcom/Login.do /Sexam-suportFetchDefau.dogAN000585l .Pc-,fromCache=l1 art=maintoolbar--bottoml Page 312 of 737 WO 00/58510 PCT/IBOO/00435 <220> <221> <222> <223> <220> <221> <22 2> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 180978 99-16042-31 allele 189957 99-5919-215 allele 197163 99-24658-410 allele 198964 99-30364-299 allele 200256 99-30 36 6-112 allele 204588 99-16094-7 5 allele 204934 99-24 64 4- 194 allele 206197 99-16107-95 allele 206263 99-16107-161 allele 206485 99-16107-383 allele 211608 99-15873-303 allele 214669 8-124-106 :polymorphic base G or C :polymorphic base A or G :polymorphic base A or G :polymorphic base A or G polymorphic base G or T :polymorphic base G or T :polymorphic base A or G :polymorphic base A or T :polymorphic base A or G :polymorphic base C or T :polymorphic base C or T polymorphic base A or G <220> <221> allele <222> 214783 W0005851 0[httpJww. etthe patentcom/Log in.d oo/Sexa m.su p _ort/Fetch/Defa ult.dog/WO00585 1 0.cpc?fromCa che= 1 part= m aintoo lba r--botomI Pag e 3 13 of 73 7 WO 00/58510 PCT/EBOO/00435 12 base A or G <223> 8-124-220 ;polymorphic <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 214857 8-124-2 94 allele 214879 8-124-316 allele 214946 8-124-383 allele 215538 8-125-33 allele 215705 8-132-312 allele 215838 8-132-17 9 allele 215853 8-132-164 allele 215920 8-132-97 polymorphic base A or G polymorphic base C or T polymorphic base A or T polymorphic base C or T polymorphic base A or G *polymorphic base A or T *polymorphic base A or G polymnorphic base A or G <~220> <221> allele <222> 216028 <223> 99-13929-201 polymorphic base G or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 216538 8-131-3 63 allele 216702 8- 13 1-199 allele 216874 8 -130-23 6 polymorphic base G or T polymorphic base G or T polymorphic base C or T W0005851 0 htft tww.getthe atent. comLoin.dog/Sexam.su portFetchDefa utdog OU 5 6 5 1 U.cpc?tro M;acfle=ipa rt= ma intool a r--bottomi Page 314070?1 WO 00/58510 PCT[IBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 216890 8- 130-2 20 allele 216966 8-130-144 allele 216967 8- 130-14 3 allele 217008 8- 130-102 allele 217009 8-130-101 allele 217027 8-130-8 3 allele 217207 8 -20 9-3 33 :polymorphic base G or T polymorphic base C or T polymorphic base A or G polymorphic base C or T polymorphic base G or T polymorphic base A or C polymorphic base-A or'G allele 217250 8-209-290 :polymorphic base A or C allele 219540 99-5897-143 polymorphic base A or C allele 220836 99-24649-186 polymorphic base A or G allele 220942 99-24649-80 polymorphic base G or C allele 221741 8-199-84 polymorphic base G or T <220> <221> allele <222> 222048 <223> 8-198-138 :polymorphic base A or G W0005851 0 (ttnwww.getthepatent.com/Lo-gin.do /Sexam.support/Fetch/Default.dog/WO00585 0.cpc?fromCache=l1 art=maintoolbar--bottom1 Pane35o 3 WO 00/58510 PCT/IBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 222746 8-195 -34 8 :polymorphic base C or T allele 223595 99-13925-97 :polymorphic base A or G allele 225443 8-192-82 :polymorphic base A or G allele 226219 99-16090-225 :polymorphic base A or G allele 226282 8-189-340 :deletion of CTAT allele 226487 8-189-146 :polymorphic base G or T allele 226870 8-188-136 :polymorphic base C or T allele 226987 8-187-352 polymorphic base G or T allele 227589 8-185-319 polymorphic base G or T allele 227612 8-185-296 polymorphic base A or T allele 228006 99-16051-226 polymorphic base C or T allele 228068 99-16051-164 polymorphic base A or G <220> <221> allele W0005851 0 [httoilwvww.aettheoatent.comLoain.doaSexam.suooortFetchDefaut.doaMIO00585l 0.cpc?fromCacie=1 par=maintoolbar--boftoml Pacie 316 of 737 WO 00/58510 PCT/IBOO/00435 <222> 228134 <223> 8-184-119 :polymorphic base A or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 228226 8-184-27 allele 228254 8-183-4 01 allele 229069 8-181-449 allele 229168 8-181-350 allele 229259 8- 18 1-259 allele 229288 8- 18 1-230 allele 229308 8- 18 1-210 allele 229353 8-181-165 allele 229355 8-181-163 allele 229435 8-181-83 allele 229486 8-180-157 allele 229582 8-143-332 polymorphic base A or C *polymorphic base C or T *polymorphic base C or T *polymorphic base A or T *polymorphic base A or G *polymorphic base A or T *polymorphic base A or T *polymorphic base C or T *polymorphic base C or T polymorphic base C or T *polymorphic base A or T polymorphic base A or C W0005851 0 [http 6vw.getheaen om gin.dog/Sexam.suportFetch/efaultdo NVWOOOS O0.cpc?fromCache=l part=maintoolbar--bottoml Page 317 of 737 WO 00/58510 PCT/1B00100435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <M2> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 229587 8-143-327 allele 229603 8- 14 3-311 allele 229606 8-14 3-3 08 allele 229607 8- 17 9-2 68 allele 229608 8-143-306 allele 229669 8- 14 3-24 5 allele 22 967 2 8- 14 3-24 2 allele 229675 8- 14 3-239 allele 229682 8- 14 3-2 32 allele 229762 8- 14 3-152 allele 229961 8-178-199 allele 230037 8-178-123 :polymorphic base A or G polymorphic base A or G polymorphic base A or G polymorphic base A or C polymorphic base A or G polymorphic base G or T polymorphic base A or G polymorphic base C or T polymorphic base G or C polymorphic base G or C polymorphic base G or C deletion of A <220> <221> allele <222> 230238 W0005851 0 fhttp:/A~w#. qetthe patent. co m/L gin.doI eam soprtfetch/efautd ogWO00S 5 1 0.cpc?fro mC ache= 1 part= ma intool ba r--boftom] Page_ 318 of 7 37 WO 00/58510 PCTIIBOO/00435 <223> 8-119-404 :polymorphic base C or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 230256 8-177 -28 1 allele 230265 8-119-377 allele 230333 8-119-30 9 allele 230348 8-119-294 allele 230358 8-119-28 4 allele 230370 8-119-272 allele 230380 8-119-262 allele 230394 8-119-248 allele 230395 8-119-247 allele 230432 8-119-210 allele 230438 8-119-204 allele 230442 8-119-200 *polymorphic base C or T *polymorphic base C or T *polymorphic base C or T *polymorphic base G or T *polymorphic base G or C *polymorphic base A or T *polymorphic base A or T *polymorphic base C or T *polymorphic base A or G *polymorphic base A or C *polymorphic base A or C polymorphic base A or G W0005851 0 [1p llwww~getthepatent.com/Login.dog/Sexam.supporL/Fetch/Default.do AN000585 0.qpc?fromCacJ-l 1 art--maintqolbar--bottomjPage 319 of 737 WO 00/58510 PCT/BOOIOO435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 230447 8-119-195 allele 230517 8-119-125 allele 230522 8-119-120 allele 230545 8- 119-97 allele 230549 8-119- 93 allele 230604 8-119-38 allele 230684 8-138-2 34 allele 230700 8-138-218 allele 230755 8-138-163 allele 230864 8-138-54 allele 231070 8-175-75 allele 231118 8-142-386 allele 231134 8-142-370 :polymorphic base A or C polymorphic base C or T polymorphic base A or G polymorphic base C or T polymorphic base G or T polymorphic base A orf polymorphic base C or T polymorphic base A or G polymorphic base C or T :insertion of TA :polymorphic base G or T :polymorphic base C or T polymorphic base C or T W0005851 0 [httpi/Aww.getth~epatent.pqnikpgin.dog/Sexam.support/Fetch/Default.doqNVO00585 1 .cpc?tromCach~e=1 part=maintoolbar--bottom] Pa-ge 320 of 737 WO 00/58510 PCTJIBOO/00435 <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 231290 8-14 2-2 11 :deletion of CAAA allele 231372 8-142-132 :polymorphic base A or G allele 231669 8-145-339 :polymorphic base C or T allele 231677 99-15870-400 :polymorphic base A or G allele 231777 8-145-231 :polymorphic base A or T allele 231811 8-145-197 :polymorphic base C or T allele 231854 8-145-154 :polymorphic base C or T allele 231870 8-145-138 :polymorphic base A or C allele 231930 8-145-78 polymorphic base G or C allele 232320 8-171-247 polymorphic base C or T allele 232477 8-170-373 allele 232898 8-169-26 6 polymorphic base C or T polymorphic base A or G <220> <221> allele W0005851 0 Pttp:/vww.etthepa tent. cmLog indog/Sexa m.suport/Fetch/Defaut. do NVO00585 1 Ucc?tromCaclhe=l1 art=maintoolbar--bottom] Page 321 01737 WO 00/58510 PCTIIBOOIOO435 <222> 232998 <223> 8-169-166 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 233100 8-168 -3 80 allele 233453 B-235-349 allele 233620 8-235-18 2 allele 234120 8 -137-3 40 allele 234277 8-137-182 allele 234307 8-137-152 allele 234751 8-165- 18 5 allele 235315 99-16087-21 allele 238223 8-157- 17 7 allele 238789 8-155-2 58 allele 239763 99-16038-11 allele 239864 8-136-166 polymorphic base G or T polymorphic base A or G polymorphic base C or T polymorphic base G or T polymorphic base G or C polymorphic base C or T polymorphic base A or C polymorphic base G or C .9 :polymorphic base G or C polymorphic base A or C polymorphic base C or T 8 polymorphic base C or T polymorphic base A or G W0005851 0 [httpi/twww.getthepatent.com/Login.dog/$exam.supprtFetclVDefaut.dogAN0005 8 5 l 0.cpc?fromCache= 1 Dart=maintooIbar--bottom] Page 322 of 737 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 239885 8-136-14 5 :polymorphic base A or G allele 239950 8-136-80 :polymorphic base C or T allele 240044 8-153-32 :polymorphic base A or G allele 240497 8-135-212 :polymorphic base A or G allele 240543 8-135-166 :polymorphic base G or T allele 240597 8-135-112 :polymorphic base A or G allele 240772 99-16050-235 :polymorphic base G or C allele 240858 8-144-378 :polymorphic base C or T allele 241002 8-144-234 :polymorphic base C or T allele 241040 8-144-196 :polymorphic base A or T allele 241002 8-144-127 :deletion of TGGATAC allele 241217 8-141-304 :polymorphic base C or T <220> <221> allele <222> 241261 W00058510 http:lwww.getthepatent.com Part=maintoobarbottoml Page 323 of 737 WO 00/58510 PCT/IB00/00435 22 base C or T <223> 8-141-260 polymorphic <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 241360 8-141-161 polymorphic base G or T allele 241507 8-140-286 polymorphic base A or G allele 241620 8-140-173 polymorphic base A or C allele 241685 8-140-108 polymorphic base G or C allele 241752 8-140-41 polymorphic base A or G allele 241861 99-15880-162 polymorphic base A or G allele 242402 8-240-187 polymorphic base G or T allele 244313 8-225-281 polymorphic base A or T allele 247860 99-25940-186 polymorphic base A or G allele 247864 99-25940-182 polymorphic base C or T allele 248315 99-16032-292 polymorphic base G or T allele 253619 99-16055-216 polymorphic base A or G W0005851 0[httpQJtwww. qetthe patent. comIL gingdog/$exam.suportFetch/Defaut.doMIO005851 0.cpc?fromCache= 1 part=maintoolbar--bottom Page _324 of 737 WO 00/58510 PCT/BOOIOO435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 255848 99-16105- 15 2 :polymorphic base A or G allele 258573 99-16101-4 allele 260099 99-16033-2 allele 279789 99-15875-1 allele 288007 99-13521-3 allele 292680 8-112-241 allele 292766 8-112-155 allele 292876 8-112-45 allele 295491 8-111-301 allele 295716 8-110-404 allele 296031 8-110-89 allele 296068 8-134-94 allele 298969 99-7462-50 36 polymorphic base C or T 44 polymorphic base A or G 65 polymorphic base C or T 1 polymorphic base A or G polymorphic base C or T polymorphic base A or C :polymorphic base A or T deletion of AGAT polymorphic base G or C :polymorphic base A or G :polymorphic base C or T 8 :polymorphic base C or T W0005851 0 [httD:/Ivwwaetheoatent.comILoain.doa/Sexam.suD~oort/FetchIDefault.doaAM/o00585l 0.cpc?fromCaclhe=l1part=maintoolbar--bottoml Pacie 325 of 737 WO 00/58510 PCTIIBOOIOO435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 300365 99-16052-214 allele 312030 99-16047-115 allele 315928 99-25993-280 allele 316014 9 9-25 993-3 67 allele 317245 99-25101-151 primer -bind 7938. .7958 99-27943. rp :polymorphic base A or G :polymorphic base A or G :polymorphic base G or C :polymorphic base A or G :polymorphic base A or G primer bind 8446. .8465 99-2794 3.pu complement <221> primer -bind <222> 14699. .14718 <223> 8-121.pu <220> <221> primer -bind <222> 15100. .15118 <223> 8-121.rp complement <220> <221> primer -bind <222> 21365. .21385 <223> 99-27935.rp <220> <221> primer -bind <222> 21845. .21864 <223> 99-27935.pu complement <220> <221> primer-bind <222> 25409. .25426 <223> 8-122.pu <220> <221> primer-bind W0005851 0 [httR:/Mmwwgetthepatent.comILogin.dog/Sexams port/etchDefautdoANO005 8 l O.cc?fromCache=l1 pat-maintoolbar--bottomj Pag 326 of 737 WO 00/58510 PCTJLBOO/00435 <222> 25825. .25844 <223> 8-122.rp complement <220> <221> primer -bind <222> 29349. .29366 <223> 8-123.pu <220> <221> primer -bind <222> 29684. .29701 <223> 8-123.rp complement <220> <221> primer -bind <222> 29900. .29919 <223> 8-147.pu <220> <221> primer -bind <222> 30340. .30356 <223> 8-147.rp complement <220> <221> primer -bind <222> 49219. .49239 <223> 99-34243.rp <220> <221> primer -bind <222> 49664. .49684 <223> 99-34243.pu complement <220> <221> primer -bind <222> 64639. .64657 <223> 8-127.pu <220> <221> primer -bind <222> 64981. .64999 <223> 8-127.rp complement <220> <221> primer_bind <222> 65453. .65471 <223> 8-128.pu <220> <221> primer bind <222> 65547. .65566 <223> 8-129.pu <220> <221> primer -bind <222> 65856. .65874 <223> 8-128.rp complement <220> <221> primer -bind <222> 65949. .65966 <223> 8-129.rp complement W0005851 0-[http:ltwww.getthepatent.comLogindog/exam.suport/Fetch/Defaut.dogW0005851 0.cpc?fromCache= 1 part~maintoolbar--botom Page 327 of 737 WO 00/58510 PCT/EBO0100435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> primer Tbind 75629. .75649 99-34240.rp primer bind 76140. .76158 99-34240.pu complement primer bind 94254. .94273 99-31959.pu primer -bind 94 683. 94703 99-31959.rp primer_bind 95034. .95053 99-31960 .pu primer bind 95543. .95563 99-31960.rp primer bind 96707. .96727 99-31962 .pu primer -bind 97222. .97242 99-31962.rp complement complement complement primer_bind 106357. .106377 99-44282 .rp primer Tbind 106805. .106822 99-44282.pu complement primer -bind 107022. .107040 99-24656.pu primer -bind 107132. .107152 99-24636.rp primer -bind 107495. .107513 W00058510 [htt :/ww.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.doqW0058510.cpc?fromCache= 1 part=maintoolbar=bottom Page 328 of 737 WO 00/58510 PCT/IB00/00435 <223> 99-24656.rp complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> primer_bind 107613..107630 99-24636.pu complement primer_bind 108425..108444 99-31939.pu primer_bind 108916..108935 99-31939.rp complement primer_bind 109333..109353 99-44281.rp primer_bind 109848..109868 99-44281.pu complement primer_bind 112149..112169 99-31941.pu primer_bind 112720..112740 99-31941.rp complement primer_bind 115144..115162 99-31942.pu primer_bind 115617..115637 99-31942.rp complement primerbind 155353..155373 99-24635.rp primer_bind 155805..155822 99-24635.pu complement primer_bind 157860..157878 99-16059.pu W0005851 0 [ttpJtwww.getthepa tent. comI~og in.d og/Sexa msupporetch/efa ut.do NO00585 10.cpc?fromCache=l1part=maintoolbar--bottomjEage 329 of 737 WO 00/58510 PCTIIBOO/00435 28 <221> primer bind <222> 158296. .158316 <223> 99-16059.rp, complement <220> <221> primer -bind <222> 160279. .160298 <223> 99-24639.rp <220> <221> primer -bind <222> 160770. .160787 <223> 99-24634.pu <220> <221> primer -bind <222> 160785. .160802 <223> 99-24639.pu complement <220> <221> primer -bind <222> 161240. .161257 <223> 99-24634.rp complement <220> <221> primer -bind <222> 168813. .168830 <223> 99-7652.pu <220> <221> primer -bind <222> 169331. .169351 <223> 99-7652.rp complement <220> <221> primer -bind <222> 170666. .170686 <223> 99-16100.pu <220>, <221> primer -bind <222> 171153. .171173 <223> 99-16100.rp complement <220> <221> primer -bind <222> 173065. .173085 <223> 99-5862.rp <220> <221> primer -bind <222> 173495. .173514 <223> 99-5862.pu complement <220> <221> primer -bind <222> 173830. .173850 <223> 99-16083.rp <220> <221> primer -bind <222> 174309. .174327 <223> 99-16083.pu complement W0005851 0.[http:/Mwww. qetthepa tent.comILogin.dog/Sexam.support/FetchDefault.doQNVO005851 O.cpc?ftoMLaC-he= 1 partmailtoolbar--bottom] Page 330 ot 737 WO 00/58510 PCTIBOO/00435 29 <220> <221> primer bind <222> 175453. .175470 <223> 99-16044.pu <220> <221> primer -bind <222> 175881. .175901 <223> 99-16044.rp complement <220> <221> primer bind <222> 180464. .180481 <223> 99-16042.rp <220> <221> primer -bind <222> 180991. .181008 <223> 99-16042.pu complement <220> <221> primer -bind <222> 189753.. 189771 <223> 99-5919.pu <220> <221> primer -bind <222> 190187. .190207 <223> 99-5919.rp complement <220> <221> primer -bind <222> 197116. .197135 <223> 99-24658.rp <220> <221> primer Tbind <222> 197555. .197572 <223> 99-24658.pu complement <220> <221> primer Tbind <222> 198666. .198684 <223> 99-30364.pu <220> <221> primer bind <222> 199148. .199168 <223> 99-30364.rp complement <220> <221> primer -bind- <222> 200145. .200162 <223> 99-30366.pu <220> <221> primer -bind <222> 200663. .200683 <223> 99-30366.rp complement <220> <221> primer-bind W0005851 0[http:/twww. etthepatentcom/Lo-qin.dogiSexam.suportFetc/Defaut.dOgfVO00585 10.cpc~fromCache= 1part=ma intoolbar-boftoml Page 3310of737 WO 00/58510 PCTIBOOIOO435 <222> 204263. .204282 <223> 99-16094.rp <220> <221> primer Tbind <222> 204643. .204662 <223> 99-l6094.pu complement <220> <221> primer Tbind <222> 204741. .204758 <223> 99-24644.pu <220> <221> primer bind <222> 205222. .205240 <223> 99-24644.rp complement <220> <221> primer Tbind <222> 206103. .206120 <223> 99-16107.pu <220> <221> primer bind <222> 206548. .206568 <223> 99-16107.rp complement <220> <221> primer -bind <222> 211454. .211471 <223> 99-15873.rp <220>' <221> primer -bind <222> 211893. .211910 <223> 99-15873.pu complement <220> <221> primer -bind <222> 214564. .214581 <223> 8-124.pu <220> <221> primer bind <222> 214965. .214983 <223> 8-124.rp complement <220> <221> primer -bind <222> 215506. .215525 <223> 8-125.pu <220> <221> primer -bind <222> 215628. .215647 <223> 8-132.rp <220> <221> primer Tbind <222> 215749. .215769 <223> 99-13929.rp W0005851 0[http:/twv w.gettherpatent.com/Login.dog/$exam.suDartFetch/Default.dogAWOOO585 10.cpc?fromCarhe=l1 art=maintoolbar--bottom]_Page 332 of 737 WO 00/58510 PCTIiBOO/00435 31 <220> <221> primer -bind <222> 215924..215942 <223> 8-125.rp complement <220> <221> primer -bind <222> 215998. .216016 <223> 8-132.pu complement <220> <221> primer -bind <222> 216210. .216228 <223> 99-13929.pu complement <220> <221> primer -bind <222> 216473..216491 <223> 8-131.rp <220> <221> primer -bind <222> 216683. .216702 <223> 8-130.rp <220> <221> primer Tbind <222> 216883. .216900 <223> 8-131.pu complement <220> <221> primer -bind <222> 217091. .217109 <223> 8-130.pu complement <220> <221> primer -bind <222> 217119. .217136 <223> 8-209.rp <220> <221> primer -bind <222> 217521. .217539 <223> 8-209.pu complement <220> <221> primer -bind <222> 219408. .219425 <223> 99-5897.pu <220> <221> primer Tbind <222> 219882. .219899 <223> 99-5897.rp complement <220> <221> primer -bind <222> 220505. .220522 <223> 99-24649.rp <220> <221> primer -bind <222> 221004. .221021 W0005851 0_[http0Jtwww.getthepatent.com/Login~og/SexamsuportFetchDefautd~gANO05851 0.cpc?fromCache= 1 pat=ma intool ba r--botom] Page 333 of 737 WO 00/585 10 PCTIIBOO/00435 32 <223> 99-24649.pu complement <220> <221> primer -bind <222> 221384. .221402 <223> 8-199.rp <220> <221> primer bind <222> 221740. .221759 <223> 8-198.rp <220> <221> primer Tbind <222> 221807. .221824 <223> 8-199.pu complement <220> <221> primer -bind <222> 222167. .222185 <223> 8-198.pu complement <220> <221> primer -bind <222> 222696. .222713 <223> 8-195.rp <220> <221> primer -bind <222> 223073.. 223093 <223> 8-195.pu complement <220> <221> primer -bind <222> 223499. .223518 <223> 99-13925.pu <220> <221> primer -bind <222> 224013. .224033 <223> 99-13925.rp complement <220> <221> primer -bind <222> 225103.-225120 <223> 8-192.rp <220> <221> primer -bind <222> 225505. .225524 <223> 8-192.pu complement <220> <221> primer -bind <222> 225995. .226013 <223> 99-16090.pu <220> <221> primer -bind <222> 226211. .226230 <223> 8-189.rp <220> W0005851 0.[tqE:/Iwww.getthe patent. com/Llog in.d og/Sexa m.supporttFetch[Defau It.dogNV0005851 0.cpc?fromCache= 1 part= ma intool ba r--boftoml Page 334 of 737 WO 00/58510 PCTIIBOO/00435 33 <221> primer Tbind <222> 226510. .226530 <223> 99-16090.rp complement <220> <221> primer -bind <222> 226569. .226588 <223> 8-188.rp <220> <221> primer -bind <222> 226615. .226632 <223> 8-189.pu complement <220> <221> primer -bind <222> 226915. .226934 <223> 8-187.rp, <220> <221> primer -bind <222> 226988. .227005 <223> 8-188.pu complement <220> <221> primer -bind <222> 227319. .227338 <223> 8-187.pu complement <220> <221> primer -bind <222> 227468. .227487 <223> 8-185.rp <220> <221> primer -bind <222> 227768. .227788 <223> 99-16051.rp <220> <221> primer -bind <222> 227832. .227849 <223> 8-184.rp <220> <221> primer -bind <222> 227888. .227907 <223> 8-185.pu complement <220> <221> primer -bind <222> 228209. .228227 <223> 8-183.rp <220> <221> primer -bind <222> 228214. .228231 <223> 99-16051.pu complement <220> <221> primer -bind <222> 228234. .228252 <223> 8-184.pu complement W000 5851 0.([tqpjtwww. getthe patent. cmILoginadogSexa m. s pport/Fetch/Default.do NVO00585 O.CpcOfromCache= 1 part=maintoolbar- bottom] Page 335 of 737 WO 00/58510 PCTIIBOO/00435 34 <220> <221> primer bind <222> 228635. .228654 <223> 8-183.pu complement <220> <221> primer Tbind <222> 228898. .228917 <223> 8-181.rp <220> <221> primer -bind <222> 229442. .229459 <223> 8-179.rp <220> <221> primer bind <222> 229443. .229462 <223> 8-180.rp <220> <221> primer -bind <222> 229487. .229506 <223> 8-143.rp <226> <221> primer bind <222> 229499. .229517 <223> 8-181.pu complement <220> <221> primer bind <222> 229624. .229642 <223> 8-180.pu complement <220> <221> primer bind <222> 229739. .229756 <223> .8-178.rp <220> <221> primer bind <222> 229857. .229874 <223> 8-179.pu complement <220> <221> primer -bind <222> 229896. .229913 <223> 8-143.pu complement <220> <221> primer -bind <222> 230097. .230115 <223> 8-177.rp <220> <221> primer bind <222> 230141. .230159 <223> 8-178.pu complement <220> <221> primer-bind W00058510 [http://www.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.doNV0058510.cpc?fromCache=1 part=maintoolbar=bottoml Page 336 of 737 WO 00/58510 PCT/IB00/00435 <222> 230210..230227 <223> 8-119.rp <220> <221> primer_bind <222> 230517..230536 <223> 8-138.rp <220> <221> primer_bind <222> 230517..230536 <223> 8-177.pu complement <220> <221> primerbind <222> 230622..230641 <223> 8-119.pu complement <220> <221> primer_bind <222> 230705..230724 <223> 8-175.rp <220> <221> primer_bind <222> 230899..230917 <223> 8-138.pu complement <220> <221> primer_bind <222> 231084..231103 <223> 8-142.rp <220> <221> primer_bind <222> 231127..231144 <223> 8-175.pu complement <220> <221> primer_bind <222> 231278..231298 <223> 99-15870.pu <220> <221> primerbind <222> 231485..231503 <223> 8-142.pu complement <220> <221> primer bind <222> 231588..231605 <223> 8-145.rp <220> <221> primerbind <222> 231729..231747 <223> 99-15870.rp complement <220> <221> primer_bind <222> 231990..232007 <223> 8-145.pu complement W00810[ p:/lwww.getthe patent. co mILo in.do Sexa m.supportfFeth/Defa uIt.d og1VO005851 0.cpc?fromCarhe= 1 part=m a intoolIba r--bottom] Pag e 337 of 7 37 WO 00/58510 PCTIIBOO/00435 36 <220> <221> primer Tbind <222> 232147. .232166 <223> 8-171.rp <220> <221> primer -bind <222> 232405. .232423 <223> 8-170.rp <220> <221> primer -bind <222> 232547. .232566 <223> 8-171.pu complement <220> <221> primer bind <222> 232744. .232762 <223> 8-169.rp <220> <221> primer -bind <222> 232830. .232849 <223> 8-170.pu complement <220> <221> primer -bind <222> 233056. .233074 <223> 8-168.rp <220> <221> primer bind <222> 233145. .233163 <223> 8-169.pu complement <220> <221> primer -bind <222> 233314. .233334 <223> 8-235.rp <220> <221> primer -bind <222> 233461. .233479 *<223> B-168.pu complement <220> <221> primer -bind <222> 233785. .233801 <223> 8-235.pu complement <220> <221> primer Tbind <222> 234039. .234058 <223> 8-137.rp <220> <221> primer -bind <222> 234440. .234458 <223> 8-137.pu complement <220> <221> primer -bind <222> 234516. .234533 W0005851 0.[httpJfwwgetthepatentcamLogin.do lSexam.sup ortFetchDefaut.dogAN0005851 0.cpc?from Cache= 1 part= ma intool ba r-bottom] Page 338 of 73 7 WO 00/58510 PCT/1IBO0100435 37 <223> 8-165.rp <220> <221> primer -bind <222> 234916. .234935 <223> 8-165.pu complement <220> <221> primer -bind <222> 235081. .235101 <223> 99-16087.rp <220> <221> primer -bind <222> 235515. .235533 <223> 99-16087.pu complement <220> <221> primer -bind <222> 237972. .237989 <223> 8-157.rp <220> <221> primer -bind <222> 238381. .238399 <223> 8-157.pu complement <220> <221> primer Tbind <222> 238607. .238626 <223> 8-155.rp <220> <221> primer -bind <222> 239029. .239046 <223> 8-155.pu complement <220> <221> primer Tbind <222> 239405. .239425 <223> 99-16038.rp <220> <221> primer Tbind <222> 239606. .239624 <223> 8-136.rp <220> <221> primer -bind <222> 239651. .239670 <223> 8-153.rp <220> <221> primer -bind <222> 239862. .239880 <223> 99-16038.pu complement <220> <221> primer -bind <222> 240012. .240029 <223> 8-136.pu complement <220> W000 5851 0_[tqE./tww.getthe patent. com/Log in.d og/Sexa m. sup _ortFetchDefa ut. dgO00 5 8 51 0.c OcfromCache= 1 part=maintoolbar--botom] Page 339 of 737 WO 00/58510 PCTIIBOO/00435 38 <221> primer -bind <222> 240058. .240075 <223> 8-153.pu complement <220> <221> primer -bind <222> 240356. .240375 <223> 8-135.rp <220> <221> primer -bind <222> 240518. .240538 <223> 99-16050.rp <220> <221> primer -bind <222> 240691. .240708 <223> 8-135.pu complement <220> <221> primer -bind <222> 240810. .240828 <223> 8-144.rp <220> <221> primer -bind <222> 240988. .241006 <223> 99-16050.pu complement <220> <221> primer -bind <222> 241094. .241113 <223> 8-141.rp <220> <221> primer -bind <222> 241217. .241235 <223> 8-144.pu complement <220> <221> primer -bind <222> 241373. .241392 <223> 8-140.rp <220> <221> primer -bind <222> 241502. .241520 <223> 8-141.pu complement <220> <221> primer bind <222> 241700. .241717 <223> 99-15880.pu <220> <221> primer -bind <222> 241773. .241792 <223> 8-140.pu complement <220> <221> primer -bind <222> 242151. .242171 <223> 99-15880.rp complement W0005851 0 rhqD:/twww.gethepatent.com/L.ogn.do /ea~uporttFetch[Default.dogAN000585 1.0.cpc?fromCaqhe= 1 partmaintobar--bqttoml P~age 340 of 737 WO 00/58510 PCTIBOO/00435 39 <220> <221> primer bind <222> 242169. .242188 <223> 8-240.rp <220> <221> primer bind <222> 242571. .242588 <223> 8-240.pu complement <220> <221> primer bind <222> 244172. .244191 <223> 8-225.rp <220> <221> primer bind <222> 244574. .244593 <223> 8-225.pu complement <220> <221> primer -bind <222> 247513. .247533 <223> 99-25940.rp <220> <221> primer bind <222> 248023. .248043 <223> 99-25940.pu complement <220> <221> primer -bind <222> 248204. .248223 <223> 99-16032.rp <220> <221> primer -bind <222> 248588. .248606 <223> 99-16032.pu complement <220> <221> primer Tbind <222> 253315. .253333 <223> 99-16055.rp <220> <221> primer -bind <222> 253816. .253834 <223> 99-16055.pu complement <220> <221> primer -bind <222> 255697. .255715 <223> 99-16105.pu <220> <221> primer -bind <222> 256133. .256152 <223> 99-16105.rp complement <220> <221> primer-bind W0005851 0 rhtt:/twww. etthepatent.com/Login.dog/Sexam.supportFetch/IDefauItdogAN0005851 0.cpc?fromCach~e=1 part=maintoolbar--botom]_Page 341 of 737 WO 00/58510 PCTIBOO/00435 <222> 258138. .258155 <223> 99-16101.pu <220> <221> primer -bind <222> 258606. .258623 <223> 99-16101.rp complement <220> <221> primer -bind <222> 259885. .259902 <223> 99-16033.rp <220> <221> primer -bind <222> 260324. .260342 <223> 99-16033.pu complement <220> <221> primer -bind <222> 279626. .279644 <223> 99-15875.pu <220> <221> primer -bind <222> 280154. .280173 <223> 99-15875.rp complement <220> <221> primer -bind <222> 287977. .287995 <223> 99-13521.pu <220> <221> primer -bind <222> 288484. .288504 <223> 99-13521.rp complement <220> <221> primer -bind <222> 292501. .292519 <223> 8-112.rp <220> <221> primer -bind <222> 292901..292920 <223> 8-112.pu complement <220> <221> primer -bind <222> 295376. .295395 <223> 8-111.rp <220> <221> primer -bind <222> 295682..295701 <223> 8-110.rp <220> <221> primer -bind <222> 295777. .295795 <223> 8-111.pu complement W0005851 0 [http:/Mww.getthepatent.com/Login.dog/Sexam.support/Fetch/Default.dogAN0005851 0.cpc?fromCache= 1 part=maintoolbar--bottom] Page 342 of 737 WO 00/58510 PCT/IBOO/00435 41 <220> <221> primer -bind <222> 295812..295830 <223> 8-134.rp <220> <221> primer Tbind <222> 296102. .296119 <223> 8-110.pu complement <220> <221> primer Tbind <222> 296143. .296161 <223> 8-134.pu complement <220> <221> primer -bind <222> 298946. .298964 <223> 99-7462.rp <220> <221> primer Tbind <222> 299459. .299476 <223> 99-7462.pu complement <220> <221> primer -bind <222> 300153. .300170 <223> 99-16052.pu <220> <221> primer -bind <222> 300660. .300680 <223> 99-16052.rp complement <220> <221> primer Tbind <222> 311615. .311632 <223> 99-16047.rp <220> <221> primer Tbind <222> 312126. .312144 <223> 99-16047.pu complement <220> <221> primer -bind <222> 315649. .315668 <223> 99-25993.pu <220> <221> primer -bind <222> 316129. .316147 <223> 99-25993.rp complement <220> <221> primer -bind <222> 316925. .316943 <223> 99-25101.rp <220> <221> primer -bind <222> 317378. .317395 W0005851 0 [http:/twww. qetthe patent. comILagi n.d ogJ~exa m.suprporIFetchDefa uIt.d qgIWOO 05 8 51 0.cpc?fromCar-he= 1 part=maintooIbar--botom] Page 343 of 737 WO 00/58510 PCT/iBOO/00435 <223> 99-25101.pu complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <22 3> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> primer -bind 8297. .8315 99-27943-150 .mis primer bind 8317. .8335 99-27943-150.mis complement primer Tbind 14707. .14725 8-121-28 .mis primer Tbind 14715. .14733 8-121-36 .mis primer Tbind 14727. .14745 8-121-28 .mis primer -bind 14735. .14753 8-121-36.mis complement complement primer -bind 14833. .14851 8-121-154 .mis primer -bind 14853. .14871 8-121-154 .mis primer -bind 14866. .14884 8-121-187 .mis primer -bind 14886. .14904 8-121-187 .mis primer -bind 14922. .14940 8-121-243.mis primer -bind 14942. .14960 8-121-24 3.mis complement complement complement W0005851 0 [qhtJfwm.getthepatent.com/Loqin.dog/Sexam.suport/Fetch/Defaut.dogNVO005851 0.rcpc?fromC ache= 1 part--maintoolbar--boftoml Page 344 of 737 WO 00/58510 PCTIIBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <22> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer bind 14960. .14978 8-121-28 1.mis primer -bind 14980. .14998 8-121-281 .mis primer -bind 15031. .15049 8-121-352 .mis primer -bind 15043. .15061 8-121-364 .mis primer -bind 15050. .15068 8-121-371 .mis complement primer Tbind 15051. .15069 8-121-352.mis complement primer -bind 15063. .15081 8-121-364.mis complement primer -bind 15070. .15088 8-121-371.mis complement primer bind 21653. .21671 99-27935-193 .mis primer Tbind 21673. .21691 99-27935-193 .mis complement primer -bind 25461. .25479 8-122-72 .mis primer-bind 25481. .25499 8-122-72.mis complement primer-bind 25489. .25507 8-122-100 .mis W0005851 0j [tp/wwgetthe patent.comlLog in.d ogL$exam. .su pport/FetchDefa uIt. dog NVO005851 0cpc?fromC ache= 1 part= m aintoo Iba r--botto m] Page 345 of 737 WO 00/58510 PCTJIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> '<220> <221> primer -bind 25509. .25527 8-122-100 .mis primer -bind 25661. .25679 8-122-272 .mis primer bind 25681. .25699 8-122-272.mis primer bind 25715. .25733 8-122-326.mis primer Tbind 25735. .25753 8-122-326.mis primer -bind 25749. .25767 8-122-360.mis primer -bind 25769. .25787 8-122-360 .mis primer bind 29384. .29402 8-123-55 .mis complement complement complement complement primer Tbind 29404. .29422 8-123-55 .mis primer -bind 29518. .29536 8-123-189. mis primer -bind 29526. .29544 8-123-197 .mis complement primer -bind 29538. .29556 8-123-189.mis primer-bind complement W0005851 0 [hqtE.//www.getthepatent.comILogin.dog/$exam.suportFetcIDefaut.dog/WOOOS 8 51 O.cvc?fromCache= 1 part=maintoolbar--bottoml Page 346 of 737 WO 00/58510 PCT/IBOO/00435 <222> 29546. .29564 <223> 8-123-197.mis complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer Tbind 29636. .29654 8-123-307.mis primer -bind 29656. .29674 8-123-307 .mis primer -bind 30150. .30168 8-147-270.mis primer -bind 30170. .30188 8-147-270.mis complement complement primer Tbind 49456. .49474 99-34243-210 .mis primer Tbind 49476. .49494 99-34243-210-mis complement primer Tbind 64647. .64665 8-127-28 .mis primer -bind 64667. .64685 8-127-28 .mis primer -bind 64738. .64756 8-127-119 .mis complement primer Tbind 64758. .64776 8-127-119.mis primer -bind 64778. .64796 8-127-159.mis primer_bind 64798. .64816 8-127-159.mis complement complement W0005851 0 [http:/Mww.ehe patent. comLog in.d og/Sexa m. su pportFetch/Defa ult. dogAA/0005851 O. cc?fro mCa che= 1 part= mainMod ba r--bottom] Page 347 of 737 WO 00/58510 PCT/EBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> primer -bind 64855. .64873 8-127-236.mis primer -bind 64859. .64877 8-127-240.mis primer Tbind 64875. .64893 8-127-236.mis primer -bind 64879. .64897 8-127-240 .mis primer Tbind 64899. .64917 8-127-280.mis primer Tbind 64919. .64937 8-127-280.mis primer Tbind 65466. .65484 8-128-33 .mis primer Tbind 65485. .65503 8-128-52 .mis complement complement complement primer -bind 65486. .65504 8-128-33 .mis primer -bind 65494. .65512 8-128-61 .mis primer -bind 65501..65519 8-128-68 .mis primer -bind 65502. .65520 8-128-69 .mis primer-bind 65505. .65523 complement W0005851 0 [http:/wwwgetihepatent.com/Login.dog/exam.supportIFetch/Defaut.doNVO00585l O.CPc?fromCache= 1 Dart~maintoolbar--boftom] Page 348 of 737 WO 00/58510 PCTLBOO/00435 <223> 8-128-52.mis complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <22 3> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <22 2> <223> <220> primer Tbind 65514. .65532 8-128-61 .mis primer -bind 65518. .65536 8-128-85.mis primer -bind 65521. .65539 8-128-68 .mis primer bind 65522. .65540 8-128-69.mis primer Tbind 65538. .65556 8-128-85.mis primer Tbind 65577. .65595 8-129-50.mis primer Tbind 65597. .65615 8-129-50 .mis complement complement complement complement complement primer Tbind 65838. .65856 8-129-311 .mis primer Tbind 65858. .65876 8-129-311 .mis primer -bind 65928. .65946 8-129-401 .mis primer -bind 65948. .65966 8-129-401 .mis complement complement primer bind 75648. .75666 99-34240-492 .mis W0005851 0 [http:/twww.qetthepatentcom/L.ogi.dog/$exam.suportFetchDefauIt.dog/0005S851 0cpc?fromCarhe= 1 part~maintoolbar--botom1 Page 349 of 737 WO 00/58510 PCT/EBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer bind 75668. .7568 6 99-34240-492 .mis primer -bind 94515. .94533 99-31959-281 .mis primer -bind 94535. .94553 99-31959-281 .mis primer -bind 95377. .95395 99-31960-3 63 .mis primer Tbind 95397. .95415 99-31960-363 .mis primer Tbind 96937. .96955 99-31962-250.mis primer Tbind 96957. .96975 99-31962-250 .mis primer bind 97137. .97155 99-31962-4 50 .mis primer -bind 97157. .97175 99-31962-450 .mis primer bind 106365. .106383 99-44282-439 .mis primer bind 106385. .106403 99-44282-439.mis primer -bind 106750. .106768 99-44282-54 .mis primer Tbind 106770. .106788 99-44282-54.mis complement complement compl1emen t c ompl emen t complement complement complement W0005851 0 rhttp:/Ayw.qetthepa tent. com~o i n.dogSexa m.supportfFetch/Defa uIt. d ogMV005851 0.cpc?fromCaclie= 1 part~maintooIbar--botom Page 350 of 737 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> primer -bind 107139. .107157 99-24656-137 .mis primer -bind 107159. .107177 99-24656-137 .mis primer -bind 107262. .107280 99-24656-260.mis primer -bind 107282. .107300 99-24656-260 .mis primer -bind 107590. .107608 99-24636-22 .mis complement complement primer -bind 107610. .107628 99-24636-22 .mis primer -bind 108480. .108498 99-31939-75 .mis complement primer bind 108500. .108518 99-31939-75.mis complement primer -bind 108678. .108696 99-31939-273 .mis primer Tbind 108698. .108716 99-31939-273 .mis primer Tbind 109432. .109450 99-44281-418 .mis primer -bind 109452. .109470 99-44281-4 18 .mis complement complement primer-bind W0005851 0 [httpJlwww.getthepatent.conI~ogin.dog/Sexam.suDportFetch/Default.dogMO005851 0.rcpc?fromCache= 1 part--maintoolbar--boftomj Page 351 of 737 WO 00/58510 PCT/IBOO/00435 <222> 109593. .109611 <223> 99-44281-257.mis <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer Tbind 109613. .109631 99-44281-257 .mis primer -bind 109773. .109791 99-44281-77 .mis complement primer Tbind 109793. .109811 99-44281-77 .mis complement primer -bind 1124 49. 1124 67 99-31941-320.mis primer -bind 112469. .112487 99-31941-320.mis primer -bind 115449. .115467 99-31942-325 .mis primer -bind 115469. .115487 99-31942-325 .mis primer -bind 155717. .155735 99-24635-79 .mis complement complement primer -bind 155737. .155755 99-24635-79 .mis complement primer Tbind 158153. .158171 99-16059-313 .mis primer bind 158173. .158191 99-16059-313.mis primer bind 160615. .160633 99-24639-169 .mis complement W000585 10f[tt0:/Iwww. etthe patent. om/Logi n.d og/Sexa m. supportFetchDefau It.d ociNVO005851 0.cpc?fromCa rhe= 1 part= m aintool ba r--bottom Panqe 352 of 737 WO 00/58510 PCTIBOO/00435 <220>.

<221> <222> <223> <220> <221> <222> <223> <220> <221>.

<222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> .5220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> primer Tbind 160621. .160639 99-24639-163 .mis primer bind 160635. .160653 99-24639-169 .mis primer -bind 160641:..160659 99-24639-163 .mis primer bi nd 160857. .160875 99-24634-108 .mis primer -bind 160877. .160895 99-24634-108 .mis primer -bind 168955. .168973 99-7652-162 .mis complement complement complement primer Tbind 168975. .168993 99-7652-162 .mis primer Tbind 169281. .169299 99-7652-4 88 .mis primer Tbind 169301. .169319 99-7652-4 88 .mis primer Tbind 170727. .170745 99-16100-83 .mis primer-bind 170747. .170765 99-16100-83 .mis compl1emen t complement complement primer Tbind 170791. .170809 99-16100-14 7.mis primer -bind 170811- .170829 W0005851 0 [http:ltwww.getthepatent.r-om/Login.dog/SexamsuportFetcI~efaut.doNVO05851 0.cpc?fromCachie= 1part=maintoolbar--bottom] Page 353 of 737 WO 00158510 PCTF-BOO/00435 <223> 99-16100-147.mis complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> primer -bind 170839. .170857 99-16100-195 .mis primer bind 170841. .170859 99-16100-197 .mis primer bind 170859. .170877 99-16100-195 .mis primer -bind 170861. .170879 99-16100-197 .mis primer bind 170887. .170905 99-16100-244 .mis primer -bind 170907. .170925 99-16100-244 .mis prime r Tbind 171024. .171042 99-16100-381 .mis primer -bind 171044. .171062 99-16100-381 .mis primer -bind 173339. .173357 99-5862-167 .mis complement complement complement complement primer -bind 173359. .173377 99-5862-167.mis complement primer -bind 174208. .174226 99-16083-101 .mis primer-bind 174228. .174246 99-16083-101 .mis complement W0005851 0 [http:/Afvww.getthepatent.com/Login.dog/Sexam.suportFetcJ-Defaut.dogAA/005851 0.qpc?fromCar-he= 1part=maintoolbar--bottoml Page 354 of 737 WO 00/58510 PCTJIBOOIOO435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer -bind 175781. .175799 99-16044-351 .mis primer bind 175801. .175819 99-16044-351 .mis primer bind 180570. .180588 99-16042-420.mis primer bind 180590. .180608 99-16042-420.mis primer bind 180959. .180977 99-16042-31 .mis complement complement primer Tbind 180979. .180997 99-16042-31 .mis primer -bind 189938. .189956 99-5919-215 .mis primer Tbind 189958. .189976 99-5919-215 .mis complement complement primer Tbind 197144. .197162 99-24658-410 .mis primer -bind 197164. .197182 99-24658-410.mis primer -bind 198945. .198963 99-30364-299 .mis primer -bind 198965. .198983 99-30364-299 .mis primer Tbind 200237.. 200255 99-30366-112 .mis complement complement W0005851 0 [httpQJtwww. qetthepa tent. co mLog in.d og/$exa m. su pprtfFetch/Defa ut. dog V0005851 0.cpc?fromCache= 1 part=maintaoobar--bottom] Page 355 of 737 WO 00/58510 PCT/EBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> primer Tbind 200257. .200275 99-30366-112 .mis primer Tbind 204569. .204587 99-16094-75 .mis complement primer -bind 204589. .204607 99-16094-75 .mis complement primer -bind 204915. .204933 99-24644-194 .mis primer -bind 204935. .204953 99-24644-194 .mis primer -bind 206178. .206196 99-16107-95 .mis complement primer -bind 206198. .206216 99-16107-95.mis complement primer -bind 206244. .206262 99-16107-161 .mis primer -bind 206264. .206282 99-16107-161 .mis primer -bind 206466. .206484 99-16107-383 .mis primer -bind 206486. .206504 99-16107-383.mis primer bind 211589.7.211607 99-15873-303 .mis complement complement primer-bind W0005851 0 [http:/www.getthepatentcomiLogin.dog/Sexam.support/Fetch/DefaultdogNVO00585l 0.cpc?fromCar-he=l1 part=maintooIbar--bottomj Page 356 of 737 WO 00/58510 PCT/EB00100435 <222> 211609-.211627 <223> 99-15873-303.mis complement <220> <221> primer-bind <222> 214650. .214668 <223> 8-124--106.mis <220> <221> primer -bind <222> 214670.. 214688 <223> 8-124-106.mis complement <220> <221> primer -bind <222> 214764. .214782 <223> 8-124-220.mis <220> <221> primer -bind <222> 214784. .214802 <223> 8-124-220.mis complement <220> <221> primer -bind <222> 214838. .214856 <223> 8-124-294.mis <220> <221> primer -bind <222> 214858. .214876 <223> 8-124-294.mis complement <220> <221> primer -bind <222> 214860. .214878 <223> 8-124-316.mis <220> <221> primer -bind <222> 214880. .214898 <223> 8-124-316.mis complement <220> <221> primer -bind <222> 214927. .214945 <223> 8-124-383.mis <220> <221> primer -bind <222> 214947. .214965 <223> 8-124-383.mis complement <220> <221> primer -bind <222> 215519..215537 <223> 8-125-33.mis <220> <221> primer -bind <222> 215539..215557 <223> 8-125-33.mis complement W0005851 0 [httP:/twww.ethepatent.com/Login.dogl/Sexam.supportFetch/DefautdogM/O0058510.cpc?fromCache= 1 part=maintoolbar--bottoml Page 357 of 737 WO 00/58510 PCTfB00/0O435 56 <220> <221> primer -bind <222> 215686. .215704 <223> 8-132-312.mis <220> <221> primer -bind <222> 215706. .215724 <223> 8-132-312.mis complement <220> <221> primer -bind <222> 215819..215837 <223> 8-132-179.mis <220> <221> primer Tbind <222> 215834..215852 <223> 8-132-164.mis <220> <221> primer -bind <222> 215839. .215857 <223> 8-132-179.mis complement <220> <221> primer -bind <222> 215854. .215872 <223> 8-132-164.mis complement <220> <221> primer -bind <222> 215901. .215919 <223> 8-132-97.mis <220> <221> primer -bind <222> 215921. .215939 <223> 8-132-97.mis complement <220> <221> primer -bind <222> 216009. .216027 <223> 99-13929-201.mis <220> <221> primer Tbind <222> 216029. .216047 <223> 99-13929-201.mis complement <220> <221> primer -bind <222> 216519. .216537 <223> 8-131-363.mis <220> <221> primer-bind <222> 216539. .216557 <223> 8-131-363.mis complement <220> <221> primer-bind <222> 216683. .216701 W0005851 0[ttoJtwwgetthepatentcomLogin.do /$examsu porFetchDefa uItdoNVOOD5851 0.cpc?f ro mCache= 1 part= ma intoo Iba r--bottom] Page 358 of 737 WO 00/58510 PCTIBOO/00435 57 <223> 8-131-199.mis <220> <221> primer -bind <222> 216703. .216721 <223> 8-131-199.mis complement <220> <221> primer Tbind <222> 216855. .216873 <223> 8-130-236.mis <220> <221> primer -bind <222> 216871. .216889 <223> 8-130-220.mis <220> <221> primer Tbind <222> 216875. .216893 <223> B-130-236.mis complement <220> <221> primer -bind <222> 216891. .216909 <223> 8-130-220.mis complement <220> <221> primer -bind <222> 216947. .216965 <223> 8-130-144.mis <220> <221> primer -bind <222> 216948. .216966 <223> 8-130-143.mis <2 <221> primer -bind <222> 216967. .216985 <223> 8-130-144.mis complement <220> <221> primer Tbind <222> 216968. .216986 <223> 8-130-143.mis complement <220> <221> primer Tbind <222> 216989. .217007 <223> 8-130-102.mis <220> <221> primer -bind <222> 216990. .217008 <223> 8-130-101.mis <220> <221> primer -bind <222> 217008. .217026 <223> 8-130-83.mis <220> W000 5851 0 [http:/AMww etthe patent. com/Lo i n.d og/Sexa m. suport/Fetch/DefaultdogiWO00058510.cpc?tromCache=l1part=maintoolbar--bottom] Page 359 of 737 WO 00/58510 PCTIIBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer Tbind 217009. .217027 8-130-102.mis complement primer -bind 217010. .217028 8-130-101.mis complement primer -bind 217028. .217046 8-130-83.mis complement primer rbind 217188. .217206 8-209-333 .mis primer Tbind 217208. .217226 8-209-333.mis complement primer -bind 217231.-.217249 8-209-290 .mis primer Tbind 217251. .217269 8-209-290.mis complement primer -bind 219521. .219539 99-5897-143 .mis primer Tbind 219541. .219559 99-5897-143 .mis complement primer -bind 220817. .220835 99-24649-186.mis primer -bind 220837. .220855 99-24649-186.mis primer -bind 220923. .220941 99-24649-80 .mis primer -bind 220943. .220961 99-24649-80-mis complement complement W00581 P~p/Mw~etheatntcoI~gno /Sexam.support/Fetch/oefault.dog/WO005851 0.cpr mace 1 amiEola~otm age 360 of 737 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> primer Tbind 221722. .221740 8-199-84 .mis primer Tbind 221742. .221760 8-199-84.mis complement primer Tbind 222029. .222047 8-198-138 .mis primer -bind 222049:..222067 8-198-138.mis complement primer -bind 222727. .222745 8-195-34 8.mis primer -bind 222747. .222765 8-195-348.mis complement primer_bind 223576. .223594 99-13925-97 .mis primer -bind 223596. .223614 99-13925-97 .mis complement primer_bind 225424. .225442 8-192-82 .mis primer_bind 225444. .225462 8-192-82.mis complement primer -bind 226200. .226218 99-16090-225 .mis primer Tbind 226220. .226238 99-16090-225.mis complement primer-bind W0005851 0 tqp:Itwww.getthepatenlt.com/Login.dog/Sexam.support/Fetcti/Default.doqNVO005851 0.cpc?fromCache= 1 part= m a i Modbar--bottoml Page 361 of 737 WO 00/58510 PCTIIBOO/00435 <222> 226468. .226486 <223> 8-189-146.mis <220> <221> primer -bind <222> 226488. .226506 <223> 8-189-146.mis complement <220> <221> primer -bind <222> 226851. .226869 <223> 8-188-136.mis <220> <221> primer -bind <222> 226871. .226889 <223> 8-188-136.mis complement <220> <221> primer -bind <222> 226968. .226986 <223> 8-187-352.mis <220> <221> primer -bind <222> 226988. .227006 <223> 8-187-352.mis complement <220> <221> primer-bind <222> 227570.-227588 <223> 8-185-319.mis <220> <221> primer -bind <222> 227590. .227608 <223> 8-185-319.mis complement <220> <221> primer -bind <222> 227593. .227611 <223> 8-185-296.mis <220> <221> primer -bind <222> 227613. .227631 <223> 8-185-296.mis complement <220> <221> primer-bind <222> 227987. .228005 <223> 99-16051-226.mis <220> <221> primer-bind <222> 228007. .228025 <223> 99-16051-226.mis complement <220> <221> primer bind <222> 228049. .228067 <223> 99-16051-164.mis W0005851 0 [http:/twww.getthepatent.com/Login-dog/ Sexam.suportFetchDefaut.dogMJO5 5 0.p]rmaci=1prtmitobaEotm age 362 of 737 WO 00/58510 PCTJIBOO/00435 <220> <221> <222> <223> <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> primer Tbind 228069. .228087 99-16051-164 .mis complement primer -bind 228115. .228133 8-184-119.mis primer -bind 228135.. 228153 8-184-119.mis complement primer -bind 228207. .228225 8-184-27 .mis primer Tbind 228227. .228245 8-184-27.mis complement primer -bind 228235. .228253 8-183-401 .mis primer -bind 228255. .228273 8-183-4 01 .mis complement primer -bind 229050. .229068 8-181-449.mis primer -bind 229070. .229088 8-181-449.mis complement primer -bind 229149. .229167 8-181-350 .mis primer Tbind 229169. .229187 8-181-350.mis complement primer -bind 229240. .229258 8-181-259 .mis primer -bind 229260. .229278 W0005851 0 [http:]Awww. getthepa tent. rom/Log in.dog/Sexa m. support/Fetch/Defa ult. dogAAWO00585 1 0.cpc?ffomGaclhe= 1 p art= ma i MOO ba r--botoml Page 363 of 737 WO 00/585 10 PCTIBOOIOO435 62 <223> 8-181-259.mis complement <220> <221> primer -bind <222> 229269. .229287 <223> 8-181-230.mis <220> <221> primer -bind <222> 229289. .229307 <223> 8-181-210.mis <220> <221> primer -bind <222> 229289. .229307 <223> 8-181-230.mis complement <220> <221> primer -bind <222> 229309. .229327 <223> 8-181-210.mis complement <220> <221> primer -bind <222> 229334. .229352 <223> 8-181-165.mis <220> <221> primer -bind <222> 229336. .229354 <223> 8-181--163.mis <220> <221> primer -bind <222> 229354. .229372 <223> 8-181-165.mis complement <220> <221> primer-bind <222> 229356. .229374 <223> 8-181-163.mis complement <220> <221> primer -bind <222> 229416. .229434 <223> 8-181-83.mis <220> <221> primer bind <222> 229436. .229454 <223> 8-181-83.mis complement <220> <221> primer -bind <222> 229467. .229485 <223> 8-180-157.mis <220> <221> primer -bind <222> 229487. .229505 <223> 8-180-157-mis complement <220> W0005851 0ft oL/Aww.g efthe patent.com/Log in.d og/Sexam.su pporIFetch/Defa uIt. d OgMV0058S 1 0.cpc?fro mC ache= 1 part=m a intoojba r--botml Pa e 364 of 737 WO 00/58510 PCTIIBOO/00435 63 <221> primer -bind <222> 229563. .229581 <223> 8-143-332.mis <220> <221> primer -bind <222> 229568. .229586 <223> 8-143-327.mis <220> <221> primer Tbind <222> 229583. .229601 <223> 8-143-332.mis complement <220> <221> primer -bind <222> 229584. .229602 <223> 8-143-311.mis <220> <221> primer -bind <222> 229587. .229605 <223> 8-143-308.mis <220> <221> primer bind <222> 229588. .229606 <223> 8-143-327.mis complement <220> <221> primer -bind <222> 229588. .229606 <223> 8-179-268.mis <220> <221> primer -bind <222> 229589. .229607 <223> 8-143-306.mis <220> <221> primer -bind <222> 229604. .229622 <223> 8-143-311.mis complement <220> <221> primer Tbind <222> 229607. .229625 <223> 8-143-308.mis complement <220> <221> primer -bind <222> 229608. .229626 <223> 8-179-268.mis complement <220> <221> primer -bind <222> 229609. .229627 <223> 8-143-306.mis complement <220> <221> primer -bind <222> 229650..229668 <223> 8-143-245.mis W0005851 0.[http:/Mwww. etthe patent. com/Log in.d ogISexam.suportFetcIDefa ut. d q9WO00585l 0.cpc?fromCar-he= 1 part= ma intoolba r--boftom] Pa-ge 365 of 737 WO 00/585 10 PCTIIBOOIOO435 64 <220> <221> primer -bind <222> 229653. .229671 <223> 8-143-242.mis <220> <221> primer -bind <222> 229656. .229674 <223> 8-143-239.mis <220> <221> primer Tbind <222> 229663. .229681 <223> 8-143-232.mis <220> <221> primer -bind <222> 229670. .229688 <223> 8-143-245.mis complement <220> <221> primer -bind <222> 229673. .229691 <223> 8-143-242.mis complement <220> <221> primer -bind <222> 229676. .229694 <223> 8-143-239.mis complement <220> <221> primer -bind <222> 229683. .229701 <223> 8-143-232.mis complement <220> <221> primer -bind <222> 229743. .229761 <223> 8-143-152.mis <220> <221> primer -bind <222> 229763. .229781 <223> 8-143-152.mis complement <220> <221> primer Tbind <222> 229942. .229960 <223> 8-178-199.mis <220> <221> primer bind <222> 229962. .229980 <223> 8-178-199.mis complement <220> <221> primer -bind <222> 230219. .230237 <223> 8-119-404.mis <220> <221> primer-bind W0005851 0 [t~p -/tww.g etthe patent. co m/Log in~do /SexamsupporIFetchDefaut.dogAVO005851 0. cpc?fro mC ache= 1 part=maintoolbar--boftomj Page 366 of 737 WO 00/58510 PCTIBOOIOO435 <222> 230237. .230255 <223> 8-177-281.mis <220> <221> primer -bind <222> 230239. .230257 <223> 8-119-404.mis complement <220> <221> primer -bind <222> 230246. .230264 <223> 8-119-377.mis <220> <221> primer -bind <222> 230257. .230275 <223> 8-177-281.mis complement <220> <221> primer bind <222> 230266. .230284 <223> 8-119-377.mis complement <220> <221> primer -bind <222> 230314. .230332 <223> 8-119-309.mis <220> <221> primer -bind <222> 230329. .230347 <223> 8-119-294.mis <220> <221> primer -bind <222> 230334. .230352 <223> 8-119-309.mis complement <220> <221> primer -bind <222> 230339. .230357 <223> 8-119-284.mis <220> <221> primer -bind <222> 230349. .230367 <223> 8-119-294.mis complement <220> <221> primer -bind <222> 230351. .230369 <223> 8-119-272.mis <220> <221> primer -bind <222> 230359. .230377 <223> 8-119-284.mis complement <220> <221> primer -bind <222> 230361. .230379 <223> 8-119-262.mis W0005851 0[http:/lwww.gettIhepatent.rcom/Lo in.dog/SexamsuportFetch/efaut.dogNVO00 5 8 5 0.cpc?fromCarhe=l1part=maintoolbar--bottom)_Page 367 of 737 WO 00/58510 PCT/IBOO/00435 66 <220> <221) primer -bind <222> 230371. .230389 <223> 8-119-272.mis complement <220> <221> primer Tbind <222> 230375. .230393 <223> 8-119-248.mis <220> <221> primer Tbind <222> 230376. .230394 <223> 8-119-247.mis <220> <221> primer -bind <222> 230381. .230399 <223> 8-119-262.mis complement <220> <221> primer -bind <222> 230395. .230413 <223> 8-119-248.mis complement <220> <221> primer -bind <222> 230396. .230414 <223> 8-119-247.mis complement <220> <221> primer -bind <222> 230413. .230431 <223> 8-119-210.mis <220> <221> primer -bind <222> 230419. .230437 <223> 8-119-204.mis <220> <221> primer -bind <222> 230423. .230441 <223> 8-119-200.mis <220> <221> primer -bind <222>.230428. .230446 <223> 8-119-195.mis <220> <221> primer-bind' <222> 230433. .230451 <223> 8-119-210-mis complement <220> <221> primer -bind <222> 230439..230457 <223> 8-119-204.mis complement <220> <221> primer -bind <222> 230443. .230461 W0005851 0 httc,:/twwwgetthepatentcom~o i n.d og/Sexa m. supo rtFetchDefau it. dogAA10005851 O.cpc?fromC ache= 1.pa rt= ma intoolba r--bottom] Pagae 368 of 737 WO 00/58510 PCT/IBOO/00435 67 <223> 8-119-200.mis complement <220> <221> primer -bind <222> 230448. .230466 <223> 8-119-195.mis complement <220> <221> primer Tbind <222> 230498. .230516 <223> 8-119-125.mis <220> <221> primer -bind <222> 230503. .230521 <223> 8-119-120.mis <220> <221> primer Tbind <222> 230518. .230536 <223> 8-119-125.mis complement <220> <221> primer Tbind <222> 230523. .230541 <223> 8-119-120.mis complement <220> <221> primer Tbind <222> 230526. .230544 <223> 8-119-97.mis <220> <221> primer Tbind <222> 230530. .230548 <223> 8-119-93.mis <220> <221> primer -bind <222> 230546. .230564 <223> 8-119-97.mis complement <220> <221> primer Tbind <222> 230550. .230568 <223> 8-119-93.mis complement <220> <221> primer -bind <222> 230585. .230603 <223> 8-119-38.mis <220> <221> primer -bind <222> 230605. .230623 <223> 8-119-38.mis complement <220> <221> primer Tbind <222> 230665.. 230683 <223> 8-138-234.mis <220> W0005851 0 [http:/twww.getthepatent.comfLogin.dog/Sexam.supportFetch/DefaultdogWO05851 0.cpc?fromCache= 1 part=maintoqIbar--boftomL Page 369 of 737 WO 00/58510 PCTIIBOO/00435 68 <221> primer -bind <222> 230681. .230699 <223> 8-138-218.mis <220> <221> primer -bind <222> 230685. .230703 <223> 8-138-234.mis complement <220> <221> primer -bind <222> 230701. .230719 <223> 8-138-218.mis complement <220> <221> primer -bind <222> 230736. .230754 <223> 8-138-163.mis <220> <221> primer -bind <222> 230756. .230774 <223> 8-138-163.mis complement <220> <221> primer -bind <222> 231051. .231069 <223> 8-175-75.mis <220> <221> primer bind <222> 231071. .231089 <223> 8-175-75.mis complement <220> <221> primer Tbind <222> 231099. .231117 <223> 8-142-386.mis <220> <221> primer -bind <222> 231115. .231133 <223> 8-142-370.mis <220> <221> primer -bind <222> 231119. .231137 <223> 8-142-386.mis complement <220> <221> primer -bind <222> 231135. .231153 <223> 8-142-370.mis complement <220> <221> primer -bind <222> 231353. .231371 <223> 8-142-132.mis <220> <221> primer -bind <222> 231373. .231391 <223> 8-142-132.mis complement W0005851 0 [http:/AMww.getthepatent.romfLogin.dog/Sexam.support/Fetch/Default.dogAN000 58 51 0.cpc?fromCar-he= 1 part=maintoolbar--bottom] Page30o3 WO 00/585 10 PCTIiBOO/00435 69 <220> <221> primer -bind <222> 231650.. 231668 <223> 8-145-339.mis <220> <221> primer -bind <222> 231658. .231676 <223> 99-15870-400.mis <220> <221> primer -bind <222> 231670. .231688 <223> 8-145-339.mis complement <220> <221> primer Tbind <222> 231678. .231696 <223> 99-15870-400.mis complement <220> <221> primer -bind <222> 231758. .231776 <223> 8-145-231.mis <220> <221> primer -bind <222> 231778. .231796 <223> 8-145-231.mis complement <220> <221> primer -bind <222> 231792..231810 <223> 8-145-197.mis <220> <221> primer Tbind <222> 231812. .231830 <223> 8-145-197.mis complement <220> <221> primer -bind <222> 231835. .231853 <223> 8-145-154.mis <220> <221> primer -bind <222> 231851..231869 <223> 8-145-138.mis <220> <221> primer-bind <222> 231855. .231873 <223> 8-145-154.mis complement <220> <221> primer-bind <222> 231871. .231889 <223> 8-145-138.mis complement <220> <221> primer-bind W0005851 0 fhttp:/Awww.getthepatentcom/Login.dog/$exam.supportFetcIDefaultdogAN0005 8 5 0.cpc?fromCar-he= 1 part= maintoolbar--boftom] Page 371 of 737 WO 00/58510 PCTJIBOO/00435 <222> 231911. .231929 <223> 8-145-78.mis <220> <221> primer -bind <222> 231931. .231949 <223> 8-145-78.mis complement <220> <221> primer -bind <222> 232301. .232319 <223> 8-171-247.mis <220> <221> primer -bind <222> 232321. .232339 <223> 8-171-247.mis complement <220> <221> primer bind <222> 232458. .232476 <223> 8-170-373.mis <220> <221> primer -bind <222> 232478. .232496 <223> 8-170-373.mis complement <220> <221> primer -bind <222> 232879. .232897 <223> 8-169-266.mis <220> <221> primer -bind <222> 232899. .232917 <223> 8-169-266.mis complement <220> <221> primer -bind <222> 232979. .232997 <223> 8-169-166.mis <220> <221> primer -bind <222> 232999. .233017 <223> 8-169-166.mis complement <220> <221> primer -bind <222> 233081.-.233099 <223> 8-168-380.mis <220> <221> primer -bind <222> 233101. .233119 <223> 8-168-380.mis complement <220> <221> primer -bind <222> 233434. .233452 <223> 8-235-349.mis W0005851 0 [httpJtwwwgetthepatent-comILogin.do /Sexam.suport/Fetch/Defaut.dogM'O005851 0.cpc?fromCache=l1 art=maintoolbar--bottomlIEage 372 of 737 WO 00/58510 PCTIIBOO/00435 71 <220> <221> primer Tbind <222> 233454. .233472 <223> 8-235-349.mis complement <220> <221> primer -bind <222> 233601. .233619 <223> 8-235-182.mis <220> <221> primer Tbind <222> 233621. .233639 <223> 8-235-182.mis complement <220> <221> primer -bind <222> 234101. .234119 <223> 8-137-340.mis <220> <221> primer -bind <222> 234121. .234139 <223> 8-137-340.mis complement <220> <221> primer -bind <222> 234258. .234276 <223> 8-137-182.mis <220> <221> primer Tbind <222> 234278. .234296 <223> 8-137-182.mis complement <220> <221> primer Tbind <222> 234288. .234306 <223> 8-137-152.mis <220> <221> primer -bind <222> 234308. .234326 <223> 8-137-152.mis complement <220> <221> primer -bind <222> 234732. .234750 <223> 8-165-185.mis <220> <221> primer-bind <222> 234752. .234770 <223> 8-165-185.mis complement <220> <221> primer -bind <222> 235296. .235314 <223> 99-16087-219.mis <220> <221> primer -bind <222> 235316. .235334 W0005851 0 rhtatPJwww.g etthe patent. com/Iog i ~o/Sexa m. suporFetchDefa uIt.dogAN00058 5 1 0.cpc?fromCar-he= 1 part= ma intoolba r--bottom] Page 373 of 737 WO 00/58510 PCTIIBOO/00435 72 <223> 99-16087-219.mis complement <220> <221> primer -bind <222> 238204. .238222 <223> 8-157-177.mis <220> <221> primer -bind <222> 238224. .238242 <223> 8-157-177.mis complement <220> <221> primer -bind <222> 238770. .238788 <223> 8-155-258.mis <220> <221> primer -bind <222> 238790. .238808 <223> 8-155-258.mis complement <220> <221> primer -bind <222> 239744. .239762 <223> 99-16038-118.mis <220> <221> primer -bind <222> 239764. .239782 <223> 99-16038-118.mis complement <220> <221> primer -bind <222> 239845. .239863 <223> 8-136-166.mis <220> <221> primer -bind <222> 2398657.239883 <223> 8-136-166.mis complement <220> <221> primer Tbind <222> 239866. .239884 <223> 8-136-145.mis <220> <221> primer -bind <222> 239886. .239904 <223> 8-136-145.mis complement <220> <221> primer -bind <222> 239931. .239949 <223> 8-136-80.mis <220> <221> primer bind <222> 239951. .239969 <223> 8-136-80.mis complement <220> W0005851 0 http:/twww.qetthe patent. co mIL gin.do /Sexam.support/Fetch/Defaut.do NVO00585l O.cpc?fromCache= 1 0art~maintoolbar--bottom]_Page 374 of 737 WO 00/58510 PCT/IBOO/00435 73 <221> primer bind <222> 240025. .240043 <223> 8-153-32.mis <220> <221> primer bind <222> 240045. .240063 <223> 8-153-32.mis complement <220> <221> primer -bind <222> 240478. .240496 <223> 8-135-212.mis <220> <221> primer -bind <222> 240498. .240516 <223> 8-135-212.mis complement <220> <221> primer bind <222> 240524. .240542 <223> 8-135-166.mis <220> <221> primer Tbind <222> 240544. .240562 <223> 8-135-166.mis complement <220> <221> primer -bind <222> 240578. .240596 <223> 8-135-112.mis <220> <221> primer -bind <222> 240598. .240616 <223> 8-135-112.mis complement <220> <221> primer -bind <222> 240753. .240771 <223> 99-16050-235.mis <220> <221> primer -bind <222> 240773. .240791 <223> 99-16050-235.mis complement <220> <221> primer -bind <222> 240839. .240857 <223> 8-144-378.mis <220> <221> primer-bind <222> 240859. .240877 <223> 8-144-378.mis complement <220> <221> primer -bind <222> 2409837.241001 <223> 8-144-234-mis W0005851 0[httn:/M Nw.getthepatent.com/L gin.dog/Sexam.support/Fetch/Defaultdog/WO005851 O.cpc?fromCache= 1 part~maintoolbar--bottom] Page 375 of 737 WO 00/58510 PCTILBOO/00435 74 <220> <221> primer -bind <222> 241003. .241021 <223> 8-144-234.mis complement <220> <221> primer -bind <222> 241021. .241039 <223> 8-144-196.mis <220> <221> primer -bind <222> 241041. .241059 <223> B-144-196.mis complement <220> <221> primer.bind <222> 241198..241216 <223> 8-141-304.mis <220> <221> primer -bind <222> 241218. .241236 <223> 8-141-304.mis complement <220> <221> primer -bind <222> 241242. .241260 <223> 8-141-260.mis <220> <221> primer -bind <222> 241262. .241280 <223>*8-141-260.mis complement <220> <221> primer bind <222> 241341. .241359 <223> 8-141-161.mis <220> <221> primer -bind <222> 241361. .241379 <223> 8-141-161.mis complement <220> <221> primer Tbind <222> 241488. .241506 <223> 8-140-286.mis <220> <221> primer -bind <222> 241508. .241526 <223> 8-140-286.mis complement <220> <221> primer -bind <222> 241601. .241619 <223> 8-140-173.mis <220> <221> primer-bind W0005851 0 fhttp:llwvw~. etthepa tent. com/Log in.d og/$exa m.suportFetch/efau itdogWO55 Uccfmahe1patmiolarbtm]Pge 376 01 737 WO 00/58510 PCTIIBOO/00435 <222> 241621.-.241639 <223> 8-140-173.mis complement <220> <221> primer -bind <222> 241666. .241684 <223> 8-140-108.mis <220> <221> primer -bind <222> 241686..241704 <223> 8-140-108.mis complement <220> <221> primer -bind <222> 241733. .241751 <223> 8-140-41.mis <220> <221> primer-bind <222> 241753. .241771 <223> 8-140-41.mis complement <220> <221> primer -bind <222> 241842. .241860 <223> 99-15880-162.mis <220> <221> primer -bind <222> 241862. .241880 <223> 99-15880-162.mis complement <220> <221> primer -bind <222> 242383. .242401 <223> 8-240-187.mis <220> <221> primer -bind <222> 242403..242421 <223> 8-240-187.mis complement <220> <221> primer -bind <222> 244294. .244312 <223> 8-225-281.mis <220> <221> primer -bind <222> 244314. .244332 <223> 8-225-281-mis complement <220> <221> primer -bind <222> 247841. .247859 <223> 99-25940-186.mis <220> <221> primer -bind <222> 247845..247863 <223> 99-25940-182.mis W0005851 0[http:/twww. etthe patent. com/Lo in.dog/Sexam.supportFetchDefaut.dog/WO005851 0.cpc?fromCactie= 1 part=maintoolbar--boftom] Page 377 of 737 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> primer -bind 247861.-.247879 99-25940-186. mis primer Tbind 247865.. 247883 99-25940-182 .mis primer Tbind 248296. .248314 99-16032-292 .mis primer Tbind 248316. .248334 99-16032-292 .mis primer -bind 253600. .253618 99-16055-216 .mis primer -bind 253620. .253638 99-16055-216.mis primer bind 255829. .255847 99-16105-152.mis primer -bind 255849. .255867 99-16105-152.mis primer Tbind 258554. .258572 99-16101-436.mis primer -bind 258574. .258592 99-16101-436 .mis primer -bind 260080. .260098 99-16033-244 .mis primer -bind 260100. .260118 99-16033-24 4.mis primer-bind 279770. .279788 complement complement complement complement complement complement complement W0005851 0 [httpJ/Www.getthepatent.com/Login.dog/S a suport/Fetch/Default dogNVO005851 0.Ccctrom~aChle=1 part= mai Mod ba r--bottoml.Page 378 of 737 WO 00/58510 PCT/IBOO/00435 <223> 99-15875-165.mis <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> primer bind 27 9790..27 9808 99-15875-165.mis primer -bind 287988. .288006 99-13521-31 .mis complement primer Tbind 288008. .288026 99-13521-31 .mis complement primer -bind 292661. .292679 8-112-24 1.mis primer Tbind 292681. .292699 8-112-241.mis complement primer -bind 292747. .292765 8-112-155.mis primer -bind 292767. .292785 8-112-155.mis complement primer -bind 292857. .292875 8-112-4 primer -bind 292877. .292895 8-112-45.mis complement primer -bind 295697. .295715 8-110-404 .mis primer bind 295717. .295735 8-110-404 .mis complement primer Tbind 296012. .296030 8-110-89.mis W0005851 0[ (ttp:/twww.getthe patent. com/Lo i n.dog/Sexam. su pport/Fetch/efa ut. dogNVO00585 1 0.cpc?fro mCar-he= 1 part=m a intoolba r--bottom] Page 379 of 737 WO 00/58510 PCT/EBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer -bind 296032. .296050 8-110-89.mis complement primer -bind 296049. .296067 8-134-94 .mis primer -bind 296069. .296087 8-134-94 .mis complement primer rbind 2 98 950. 298968 99-7462-508 .mis primer Tbind 298970. .298988 99-7462-508.mis complement primer Tbind 300346. .300364 99-16052-214 .mis primer Tbind 300366. .300384 99-16052-214 .mis primer -bind 312011. .312029 99-16047-115.mis primer Tbind 312031. .312049 99-16047-115 .mis pr imer -bind 315909. .315927 99-25993-280 .mis primer -bind 315929. .315947 99-25993-280.mis primer Tbind 315995. .316013 99-25993-367 .mis primer -bind 316015. .316033 99-25993-367 .mis complement complement complement complement W0005851 01 r!Jp:/www gehe atent. comLog in.d o /Sexa m.su pportFetch/Defa uIt. d ogwO005851 0.cpc?fromC achie= 1 part= main tool ba r--bottom] Page 380 of 7 37 WO 00/58510 PCTIBOOIOO435 79 <220> <221> primer -bind <222> 317226. .317244 <223> 99-25101-151.mis <220> <221> primer -bind <222> 317246. .317264 <223> 99-25101-151.mis complement <220> <221> misc binding <222> 8304. .8328 <223> 99-27943-150.probe <220> <221> misc binding <222> 14714i..14738 <223> 8-121-28.probe <220> <221> misc binding <222> 14722 14746 <223> 8-121-36.probe <220> <221> misc -binding <222> 14840. .14864 <223> 8-121-154.probe <220> <221> misc binding <222> 14873. .14897 <223> 8-121-187.probe <220> <221> misc binding <222> 14929 14953 <223> 8-121-243.probe <220> <221> misc binding <222> 14967. .14991 <223> 8-121-281.probe <220> <221> misc binding <222> 15038. .15062 <223> 8-121-352.probe <220> <221> misc binding <222> 150506..15074 <223> 8-121-364.probe <220> <221> misc binding <222> 15057. .15081 <223> 8-121-371.probe <220> <221> misc binding W0005851 0[http J/ww.getthepa tent. comL gindogSexam.suportFetchDefaut.dogNVO005851 0.cpc?fromCache=l1 art~maintoolbar--botom Page 381 of 737 WO 00/585 10 PCTIBOOIOO435 <222> 21660. .21684 <223> 99-27935-193.probe <220> <221> misc -binding <222> 25468. .25492 <223> 8-122-72.probe <220> <221> misc binding <222> 25496. .25520 <223> 8-122-100.probe <220> <221> misc binding <222> 25668. .25692 <223> 8-122-272.probe <220> <221> misc binding <222> 25722. .25746 <223> 8-122-326.probe <220> <221> misc binding <222> 2575Z. .25780 <223> 8-122-360.probe <220> <221> misc -binding <222> 29391. .29415 <223> 8-123-55.probe <220> <221> misc-binding <222> 29525. .29549 <223> 8-123-189.probe <220> <221> misc-binding <222> 29533. .29557 <223> 8-123-197.probe <220> <221> misc binding <222> 29643. .29667 <223> 8-123-307.probe <220> <221> misc binding <222> 301571..30181 <223> 8-147-270.probe <220> <221> misc binding <222> 49463. .49487 <223> 99-34243-210.probe <220> <221> misc binding <222> 64654. .64678 <223> 8-127-28.probe W000551 0[htt:/Mw~gethepaentcmI~oinAdg/$exa m. suporLFetc/Defa ut. dog NV0OD851 0.cpc?fromCach e= 1 part= ma intaolba r--bottom] Pe38 f 3 WO 00/58510 PCT1iBOO/00435 81 <220> <221> misc binding <222> 64745. .64769 <223> 8-127-119.probe <220> <221> misc binding <222> 64785. .64809 <223> 8-127-159.probe <220> <221> misc binding <222> 64862. .64886 <223> 8-127-236.probe <220> <221> misc binding <222> 64866 64890 <223> 8-127-240.probe <220> <221> misc binding <222> 64906. .64930 <223> 8-127-280.probe <220> <221> misc binding <222> 65473. .65497 <223> 8-128-33.probe <220> <221> misc binding <222> 65492 65516 <223> 8-128-52.probe <220> <221> misc binding <222> 65501. .65525 <223> 8-128-61.probe <220> <221> misc binding <222> 65508. .65532 <223> 8-128-68.probe <220> <221> misc -binding <222> 65509. .65533 <223> 8-128-69.probe <220> <221> misc binding <222> 65525. .65549 <223> 8-128-85.probe <220> <221> misc-binding <222> 65584. .65608 <223> 8-129-50.probe <220> <221> misc binding <222> 65845 65869 W0005851 0[http:/Myww. etthe patent. comIIogin.d og/Sexa m su portFetc,/DefautdogAN0005851 0.epc?fromCache=l 1 art=maintoolbar--bottoml Page 383 of 737 WO 00/58510 PCTLBOO/00435 82 <223> 8-129-311.probe <220> <221> misc binding <222> 65935. .65959 <223> 8-129-401.probe <220> <221> misc -binding <222> 75655. .75679 <223> 99-34240-492.probe <220> <221> misc binding <222> 94522. .94546 <223> 99-31959-281 .probe <220> <221> misc -binding <222> 95384. .95408 <223> 99-31960-363.probe <220> <221> misc binding <222> 96944.. 96968 <223> 99-31962-250.probe <220> <221> misc binding <222> 97144. .97168 <223> 99-31962-450.probe <220> <221> misc -binding <222> 106372. .106396 <223> 99-44282-439.probe <220> <221> misc binding <222> 106757. .106781 <223> 99-44282-54.probe <220> <221> misc binding <222> 107146. .107170 <223> 99-24656-137. probe <220> <221> misc binding <222> 107269. .107293 <223> 99-24656-260.probe <220> <221> misc binding <222> 107597. .107621 <223> 99-24636-22.probe <220> <221> misc binding <222> 108487. .108511 <223> 99731939-75.probe <220> W0005851 0[http:/twww. etthepatent.rom/Login.dog/exam.suporFetchDefaut.doJIWO005851 0.cpc?fromCache= 1 part=maintoolbar--boftoml Page 384 of 737 WO 00/58510 PCTIIBOO/00435 83 <221> misc -binding <222> 108685. .108709 <223> 99-31939-273.probe <220> <221> misc -binding <222> 109439. .109463 <223> 99-44281-418.probe <220> <221> misc binding <222> 109600. .109624 <223> 99-44281-257.probe <220> <221> misc binding <222> 109780. 109804 <223> 99-44281-77.probe <220> <221> misc binding <222> 112456. .112480 <223> 99-31941-320.probe <220> <221> misc binding <222> 115456. .115480 <223> 99-31942-325.probe <220> <221> misc-binding <222> 155724. .155748 <223> 99-24635-79.probe <220> <221> misc binding <222> 158160. .158184 <223> 99-16059-313.probe <220> <221> misc binding <222> 160622. .160646 <223> 99-24639-169.probe <220> <221> misc binding <222> 160628- 160652 <223> 99-24639-163.probe <220> <221> misc binding <222> 160864. .160888 <223> 99-24634-108.probe <220> <221> misc binding <222> 1689Z2. .168986 <223> 99-7652-162.probe <220> <221> misc binding <222> 169288. .169312 <223> 99-7652-488.probe W0005851 0 jtq0:Itww.gefthepa tent.com/Log in.dog/Sexa m.suppo rt/Fetch/efa utdogNO005851 0.cpc?fromC ach e= 1 pa rt= ma intoolba r--bofto m Page 385 of 737 WO 00/58510 PCTJ/iBOO/00435 84 <220> <221> misc -binding <222> 170734. .170758 <223> 99-16100-83.probe <220> <221> misc -binding <222> 170798. .170822 <223> 99-16100-147.probe <220> <221> misc binding <222> 170846. .170870 <223> 99-16100-195.probe <220> <221> misc -binding <222> 1708i8. .170872 <223> 99-16100-197.probe <220> <221> misc binding <222> 1708-94. .170918 <223> 99-16100-244.probe <220> <221> misc -binding <222> 171031. .171055 <223> 99-16100-381 .probe <220> <221> misc binding <222> 17334Z6. .173370 <223> 99-5862-167 .probe <220> <221> misc -binding <222> 174215. .174239 <223> 99-16083-101.probe <220> <221> misc -binding <222> 175788. .175812 <223> 99-16044-351.probe <220> <221> misc binding <222> 180577. .180601 <223> 99-16042-420.probe <220> <221> misc binding <222> 180966. .180990 <223> 99-16042-31.probe <220> <221> misc -binding <222> 189945. .189969 <223> 99-5919-215.probe <220> <221> misc-binding W0005851 0 [http:/Mww.getthepatent.com/Login.dog/Sexam.supportFetch/DefauIt.doANVO005 8 51SlP 0.cpcfromCactie= 1 part=maintoolbar--boftoml Page 386 of 737 WO 00/585 10 PCTIBOOIOO435 <222> 197151. .197175 <223> 99-24658-410.probe <220> <221> misc binding <222> 198952. .198976 <223> 99-30364-299.probe <220> <221> misc-binding <222> 200244. .200268 <223> 99-30366-112.probe <220> <221> misc -binding <222> 204576. .204600 <223> 99-16094-75.probe <22 0> <221> misc -binding <222> 204922. .204946 <223> 99-24644-194.probe <220> <221> misc-binding <222> 206185. .206209 <223> 99-16107-95.probe <220> <221> misc binding <222> 206251. .206275 <223> 99-16107-161.probe <220> <221> misc binding <222> 206473. .206497 <223> 99-16107-383.probe <220> <221> misc binding <222> 211596. 211620 <223> 99-15873-303.probe <220> <221> misc binding <222> 214657. .214681 <223> 8-124-106.probe <220> <221> misc binding <222> 214771. .214795 <223> 8-124-220.probe <220> <221> misc -binding <222> 214845. .214869 <223> 8-124-294.probe <220> <221> misc binding <222> 214867. .214891 <223> 8-124-316.probe W0005851 0 JfhttD:/www teaencm~gin~dog/Sexam.suportFetchDefautdogAA/00058510.cpc?fromCache=l1part=maintoolbar--bottom] Page 387 of 737 WO 00/58510 PCTIIBOO/00435 86 <220> <221> misc binding <222> 214934. .214958 <223> 8-124-383.probe <220> <221> misc binding <222> 215526. .215550 <223> 8-125-33.probe <220> <221> misc -binding <222> 215693. .215717 <223> 8-132-312.probe <220> <221> misc -binding <222> 215826.-215850 <223> 8-132-179.probe <220> <221> misc -binding <222> 215841. .215865 <223> 8-132-164.probe <220> <221> misc binding <222> 215908. .215932 <223> 8-132-97.probe <220> <221> misc binding <222> 216016. .216040 <223> 99-13929-201.probe <220> <221> misc-binding <222> 216526. .216550 <223> 8-131-363.probe <220> <221> misc-binding <222> 216690. .216714 <223> 8-131-199.probe <220> <221> misc -binding <222> 216862. .216886 <223> 8-130-236.probe <220> <221> misc binding <222> 21688-216902 <223> 8-130-220.probe <220> <221> misc-binding <222> 216954. .216978 <223> 8-130-144.probe <220> <221> misc binding <222> 216955. .216979 W0005851 0 [httpoJtwww.g etthe patent.com/Log in.d og/$exa m. su portFetcIoefa ut. dog W0005 8 51 0.cpc?fromCache= 1 part~maintoolbar--bottom] Page 388 of 737 WO 00/58510 PCTIIBOO/00435 87 <223> 8-130-143.probe <220> <221> misc binding <222> 21699 217020 <223> 8-130-102.probe <220> <221> misc binding <222> 216997. .217021 <223> 8-130-101.probe <220> <221> misc binding <222> 217015. .217039 <223> 8-130-83.probe <220> <221> misc-binding <222> 217195. .217219 <223> 8-209-333.probe <220> <221> misc binding <222> 217238. .217262 <223> 8-209-290.probe <220> <221> misc-binding <222> 219528. .219552 <223> 99-5897-143.probe 220> <221> misc binding <222> 220824. .220848 <223> 99-24649-186.probe <220> <221> misc binding <222> 220930. .220954 <223> 99-24649-80.probe <220> <221> misc-binding <222> 221729. .221753 <223> 8-199-84.probe <220> <221> misc-binding <222> 222036. .222060 <223> 8-198-138.probe <220> <221> misc-binding <222> 222734. .222758 <223> 8-195-348.probe <220> <221> misc-binding <222> 223583. .223607 <223> 99-13925-97.probe <220> W0005851 0 [qqp/Mww.getthepatent.comIogin.dogSexam.support/etchDefaultdogAiO005851 0.cpc?fromCache= 1 part~ma intoolbar--bottom] Page 389 of 737 WO 00/58510 PCTIIBOO/00435 88 <221> misc binding <222> 225431. .225455 <223> 8-192-82 .probe <220> <221> misc -binding <222> 226207. 226231 <223> 99-16090-225.probe <220> <221> misc -binding <222> 226475. .226499 <223> 8-189-146.probe <220> <221> misc -binding <222> 226858. .226882 <223> 8-188-136.probe <220> <221> misc binding <222> 226975. .226999 <223> 8-187-352.probe <220> <221> misc -binding <222> 227577. .227601 <223> 8-185-319.probe <220> <221> misc -binding <222> 227600. .227624 <223> 8-185-296.probe <220> <221> misc -binding <222> 227994. .228018 <223> 99-16051-226.probe <220> <221> misc -binding <222> 228056. .228080 <223> 99-16051-164.probe <220> <221> misc binding <222> 2281'2. 228146 <223> 8-184-119.probe <220> <221> misc binding <222> 228214. .228238 <223> 8-184-27.probe <220> <221> misc binding <222> 22824Z2. .228266 <223> 8-183-401.probe <220> <221> misc binding <222> 229057. .229081 <223> 8-181-449.probe W0005851 0 htt:/1www.getthepatent.comII~agin.dog/$examsupportFetchiDefaut.do NVO005 8 51 0.cgc?fromCa cte= 1 part=m a intool ba r--bottom]_Page 390of 737 WO 00/58510 PCTIIBOO/00435 89 <220> <221> misc binding <222> 229156. .229180 <223> 8-181-350.probe <220> <221> misc binding <222> 22924Z7. .229271 <223> 8-181-259.probe <220> <221> misc binding <222> 229276.-229300 <223> 8-181-230.probe <220> <221> misc binding <222> 229296. 229320 <223> 8-181-210.probe <220> <221> misc-binding <222> 229341. .229365 <223> 8-181-165.probe <220> <221> misc binding <222> 229343. .229367 <223> 8-181-163.probe <220> <221> misc-binding <222> 229423. .229447 <223> 8-181-83.probe <220> <221> misc binding <222> 22944-229498 <223> 8-180-157.probe <220> <221> misc-binding <222> 229570. .229594 <223> 8-143-332.probe <220> <221> misc binding <222> 229575. .229599 <223> 8-143-327.probe <220> <221> misc binding <222> 229591. .229615 <223> 8-143-311.probe <220> <221> misc-binding <222> 229594. .229618 <223> 8-143-308.probe <220> <221> misc-binding W0005851 0 [httpltwww.getthepatentcom/Loqt.doq/Sexam.support/Fetch/DefauIt.doqNVO005 8 51 0-cpc?fromCar-he= 1part=maintoolbar--boftom] Page 391 of 737 WO 00/585 10 PCTIIBOO/00435 <222> 229595. .229619 <223> 8-179-268.probe <220> <221> misc-binding <222> 229596. .229620 <223> 8-143-306.probe <220> <221> misc binding <222> 229657. .229681 <223> 8-143-245.probe <220> <221> misc binding <222> 229660. .229684 <223> 8-143-242.probe <220> <221> misc-binding <222> 229663. .229687 <223> 8-143-239.probe <220> <221> misc-binding <222> 229670. .229694 <223> 8-143-232.probe <220> <221> misc-binding <222> 229750. .229774 <223> 8-143-152.probe <220> <221> misc binding <222> 229949. .229973 <223> 8-178-199.probe <220> <221> misc binding <222> 23022 6. .230250 <223> 8-119-404.probe <220> <221> misc-binding <222> 230244. .230268 <223> 8-177-281.probe <220> <221> misc binding <222> 230253. .230277 <223> 8-119-377.probe <220> <221> misc-binding <222> 230321. .230345 <223> 8-119-309-probe <220> <221> misc binding <222> 230336. .230360 <223> 8-119-294.probe W0005851 0 http:/Mwww.gettIhepatent.rcomILogin.dog/Sexam.supportIFetchIDefautdo AMIO00 5 8 5 1 0.cpc?fro mCach e =1 part= ma intoolbar--bottomI Page 392 of 737 WO 00/585 10 PCTIIBOO/00435 91 <220> <221> misc-binding <222> 230346. .230370 <223> 8-119-284 .probe <220> <221> misc binding <222> 230358. .230382 <223> 8-119-272.probe <220> <221> misc binding <222> 230368. .230392 <223> 8-119-262.probe <220> <221> misc binding <222> 230382. .230406 <223> 8-119-248.probe <220> <221> misc binding <222> 23038 3. 230407 <223> 8-119-247.probe <220> <221> misc binding <222> 230420. .230444 <223> 8-119-210.probe <220> <221> misc binding <222> 230426. .230450 <223> 8-119-204.probe <220> <221> misc binding <222> 230430. .230454 <223> 8-119-200.probe <220> <221> misc binding <222> 230435. .230459 <223> 8-119-195.probe <220> <221> misc binding <222> 230505. .230529 <223> 8-119-125.probe <220> <221> misc binding <222> 2305.0. .230534 <223> 8-119-120.probe <220> <221> misc_binding <222> 230533. .230557 <223> 8-119-97.probe <220> <221> misc binding <222> 2305357. .230561 W0005851 0 [httplhwww~getflhepatentcromfLogin.dog/Sexam.supportFetch/Default.dogVO55 0._~rmate ar~ana~a~otmEae 393 of 737 WO 00/58510 PCTIABOO/00435 92 <223> 8-119-93.probe <220> <221> misc -binding <222> 230592. .230616 <223> 8-119-38.probe <220> <221> misc binding <222> 230672.-230696 <223> 8-138-234.probe <220> <221> misc binding <222> 230688. .230712 <223> 8-138-218.probe <220> <221> misc -binding <222> 230743. .230767 <223> 8-138-163.probe <220> <221> misc binding <222> 231058. .231082 <223> 8-175-75.probe <220> <221> misc binding <222> 231106. .231130 <223> 8-142-386.probe <220> <221> misc binding <222> 231122. .231146 <223> 8-142-370.probe <220> <221> misc binding <222> 231360. .231384 <223> 8-142-132.probe <220> <221> misc binding <222> 231657. .231681 <223> 8-145-339.probe <220> <221> misc-binding <222> 231665. .231689 <223> 99-15870-400.probe <220> <221> misc binding <222> 231765. .231789 <223> 8-145-231.probe <220> <221> misc binding <222> 231799. .231823 <223> 8-145-197.probe <220> W0005851 0 [httpl~tww.getthepatentcom/Login.dog/SexamsuportFetch/Defaut.dogAN0005 8 51 0.cpc?fromCache= 1 part=maintoolbar--bottom] Page 394 of 737 WO 00/58510 PCTIIBOO/00435 93 <221> misc binding <222> 231842. .231866 <223> 8-145-154 .probe <220> <221> misc binding <222> 231858. .231882 <223> 8-145-138.probe <220> <221> misc binding <222> 231918. .231942 <223> 8-145-78.probe <220> <221> misc binding <222> 232308. .232332 <223> 8-171-247.probe <220> <221> misc binding <222> 232465. .232489 <223> 8-170-373.probe <220> <221> misc binding <222> 232886. .232910 <223> 8-169-266.probe <220> <221> misc binding <222> 232986. .233010 <223> 8-169-166.probe <220> <221> misc binding <222> 233088. .233112 <223> 8-168-380.probe <220> <221> misc binding <222> 233441. .233465 <223> 8-235-349.probe <220> <221> misc binding <222> 233608. .233632 <223> 8-235-182.probe <220> <221> misc binding <222> 234108. .234132 <223> 8-137-340.probe <220> <221> misc binding <222> 234265. .234289 <223> 8-137-182.probe <220> <221> misc binding <222> 234295. .234319 <223> 8-137-152.probe W0005851 0 [ttE.twww.getthepatent.comiLogin.dog/SexamsupporlFetch/efault.doMJfOO05851 0.cpc?fromCache= 1 part--maintoolbar--boftom]_age 395 of 737 WO 00/58510 PCTJIBOO/00435 94 <220> <221> misc-binding <222> 234739. .234763 <223> 8-165-185.probe <220> <221> misc binding <222> 2353063. .235327 <223> 99-16087-219.probe <220> <221> misc -binding <222> 238211. .238235 <223> 8-157-177.probe <220> <221> misc binding <222> 238777. .238801 <223> 8-155-258.probe <220> <221> misc binding <222> 239751. .239775 <223> 99-16038-118.probe <220> <221> misc binding <222> 239852. .239876 <223> 8-136-166.probe <220> <221> misc -binding <222> 239873. .239897 <223> 8-136-145.probe <220> <221> misc binding <222> 239958. .239962 <223> 8-136-80.probe <220> <221> misc -binding <222> 240032. .240056 <223> 8-153-32.probe <220> <221> misc -binding <222> 240485. .240509 <223> 8-135-212.probe <220> <221> misc binding <222> 240531..240555 <223> 8-135-166.probe <220> <221> misc binding <222> 240585. .240609 <223> 8-13.5-112.probe <220> <221> misc-binding W0005851 0 [htto:/Iwww. getthe patent. co mII.o i n.d og/Sexa m.supporIFetch/efa t!dog/WOOO585 10 rcpc?fromC ache= 1 part=maintoolbar--bottom1 Page 396 of 737 WO 00/58510 PCTI/EBO/0435 <222> 240760. .240784 <223> 99-16050-235.probe <220> <221> misc binding <222> 24084i6. .240870 <223> 8-144-378.probe <220> <221> misc binding <222> 240990. 241014 <223> 8-144-234 .probe <220> <221> misc -binding <222> 241028. .241052 <223> 8-144--196.probe <220> <221> misc binding <222> 241205. .241229 <223> 8-141-304 .probe <220> <221> misc binding <222> 24124Z9. .241273 <223> 8-141-260.probe <220> <221> misc-binding <222> 241348. .241372 <223> 8-141-161.probe <220> <221> misc binding <222> 24149 5. .241519 <223> 8-140-286.probe <220> <221> misc binding <222> 241608. .241632 <223> 8-140-173.probe <220> <221> misc binding <222> 241673. .241697 <223> 8-140-108.probe <220> <221> misc binding <222> 241740. .241764 <223> 8-140-41.probe <220> <221> misc binding <222> 241849. .241873 <223> 99-15880-162.probe <220> <221> misc -binding <222> 242390.-.242414 <223> 8-240-187.probe W0005851 0 [httpitww.getthepatenltcomfLogindog/Sexam.sup~portIFetch/DefaultdogNVO00585l 1 .cpc?fromCar-he= 1 part=maintoolbar--botomJ Page. 397 of 737 WO 00/58510 PCTIIBOO/00435 96 <220> <221> misc binding <222> 244301. .244325 <223> 8-225-281.probe <220> <221> misc binding <222> 24784Z8. .247872 <223> 99-25940-186.probe <220> <221> misc binding <222> 247852. .247876 <223> 99-25940-182.probe <220> <221> misc binding <222> 248303. .248327 <223> 99-16032-292.probe <220> <221> misc -binding <222> 253607. .253631 <223> 99-16055-216.probe <220> <221> misc binding <222> 255836. .255860 <223> 99-16105-152.probe <220> <221> misc binding <222> 258561. .258585 <223> 99-16101-436.probe <220> <221> misc-binding <222> 260087. .260111 <223> 99-16033-244 .probe <220> <221> misc binding <222> 279777. .279801 223> 99-15875-165.probe <220> <221> misc -binding <222> 287995. .288019 <223> 99-13521-31.probe <220> <221> misc binding <222> 292668. .292692 <223> 8-112-241.probe <220> <221> misc binding <222> 292754. .292778 <223> 8-112-155.probe <220> <221> misc binding <222> 2928Z4. .292888 W0005851 0 [tV-.Itwww.getthepatentcom/LgiEdog/exmsuportFetchDefauIt.dogNO005851 0.gr.?fromCache= 1part=maintoolbar--bottoml Page 398 of 737 WO 00/585 10 PCTIIBOO/00435 97 <223> 8-112-45.probe <220> <221> misc binding <222> 295704. .295728 <223> 8-110-404.probe <220> <221> misc binding <222> 296019. .296043 <223> 8-110-89.probe <220> <221> misc binding <222> 296056.. 296080 <223> 8-134-94.probe <220> <221> misc -binding <222> 298957. .298981 <223> 99-7462-508.probe <220> <221> misc binding <222> 300353. .300377 <223> 99-16052-214.probe <220> <221> misc binding <222> 312018. .312042 <223> 99-16047-115.probe <220> <221> misc binding <222> 315916. .315940 <223> 99-25993-280.probe <220> <221> misc-binding <222> 316002. .316026 <223> 99-25993-367 .probe <220> <221> misc-binding <222> 317233. .317257 <223> 99-25101-151.probe <220> <221> allele <222> 61595. .61598 <223> deletion AAGG <220> <221> allele <222> 75217. .75221 <223> deletion ATTTT <220> <221> allele <222> 75367 <223> polymorphic base C or T <220> W0005851 0 p[tqpj/www.getthe patent. comILog in.dog/Sexa m. support/FetcWDefa uIt. doQMW0005851 0. rpc?fromCa che= 1 part= ma intool ba r-bottomL Page 399 of 737 WO 00/58510 PCTIBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 88634. .88637 deletion CACA allele 90113 polymorphic base A or G allele 93698. .93701 deletion ACAC <220> <221> allele <222> 94209 <223> <220> <221> <222> <223> polymorphic base C or T allele 94331.-.94334 deletion AATG <220> <221> allele <222> 95396 <223> polymorphic base A or G <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 95810 polymorphic base C or T allele 96956 polymorphic base C or T allele 97156 polymorphic base A or G allele 98748. .98757 deletion CTTTCTTTCT allele 104314. .104315 deletion TA allele 104455 polymorphic allele 104699 polymorphic base A or C base A or G W0005851 0[http:/twww. etthepatent.com/Login.dog/Sexam.supportIFetch/DefauIt.doqNV000551g0cpc?fromCache=1Ipart=maintoolbar--bottom] Page40o3 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 106253 polymorphic base C or T allele 106272 polymorphic base A or T allele 106350 polymorphic base A or C allele 106384 polymorphic base A or G allele 107158 polymorphic base A or G allele 107168. .107169 deletion AT allele 107609 polymorphic allele 108032 polymorphic base A or G base A or G <220> <221> allele <222> 108668. .108816 <223> deletion

ATGGAGATGGCAACACCTACATGTGACCTTTCCAGCATGGCAGTCTCAGAGTGGATATGGCAACAGCTGCACATGAC

CTCTCCAGCATGGCAGTCTCAGAGTGGATATGGCAACAGCTGCACATGACCTCTCCGGCATGGCAGTCTCAG

<220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 110222 polymorphic allele 111978 polymorphic allele 112468 polymorphic base G or T base A or G base G or T W0005851 0 [http:/Mww.cletthepatentcom/Login.dog/ exmsuortFetchDefaut.dgNOU585 1 O.cpc?tromCacrie= 1 pa rt--m aintoolbar--bottom] Page 401 of 737 WO 00/58510 PCTIBOOIOO435 <220> <221> <222> <223> allele 117324. .117327 deletion ACTT <220> <221> allele <222> 118972 <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> polymorphic base C or T allele 119160. .119161 deletion TT allele 119316 polymorphic allele 119321 polymorphic allele 119526 polymorphic base C or T base A or G base A or G <220> <221> allele <222> 120573 <223> polymorphic base A or G <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 121527 polymorphic allele 126105 polymorphic allele 129789 polymorphic allele 130777 polymorphic base A or C base C or T base C or G base A or G allele 136942. .136944 deletion ATT <220> <221> allele <222> 143839 W0005851 0 httpjltwww.gettheoatent.comLogin.do /Sexam.sup ortFetchDefau t. d ONVO005851 0.cpc?fromC achie= 1 part= m a i Modba r--bottom] Pa ge 402 01737 WO 00/58510 PCTIIBOO/00435 <223> polymorphic base A or T <220> <221> <222> <223> <220> <221> <222> <223> allele 146668 polymorphic allele 147281 polymorphic base C or T base C or T <220> <221> allele <222> 147505 <223> <220> <221> <222> <223> polymorphic base G or T allele 148183 deletion T <220> <221> allele <222> 148372 <223> polymorphic base A or C <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <22 0> <221> <222> <223> <220> allele 149012 polymorphic allele 149113 polymorphic allele 151637 polymorphic allele 151748 deletion G allele 151769 polymorphic allele 151847 polymorphic allele 152691 polymorphic base A or G base C or T base A or G base A or G base C or T base A or C W0005851 0.[httoi/Awwgetthepatent.comL gin.dog/Sexam.supportFetch/efault.dogWO005 8 51 0.cpc?fromCache=l 1 art=maintoolbar--botom] Page 403 of 737 WO 00/58510 PCTi'IBOO/00435 <221> <222> <223> <220> <221> <222> <223> allele 152766 polymorphic base A or G allele 153046 polymorphic base C or T <220> <221> allele <222> 153123 <223> polymorphic base A or G <220> <221> allele <222> 153925 <223> polymorphic base C or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 153977 polymorphic allele 154502 polymorphic allele 154677 polymorphic allele 154879 polymorphic allele 154918 polymorphic allele 155602 polymorphic allele 156446 polymorphic allele 157238 polymorphic allele 157897 polymorphic base G or T base C or T base A or G base C or T base G or T base C or T base A or G base A or C base A or G W0005851 0 lhttDJtww-aeLheroatent.com/oaindo/Sexam.SUoor/Ftch/DefautdoaMO05851 0.cpc?fromCar-he= 1Dart=maintoolbar--bottoml Paae 404 of 737 WO 00/58510 PCT/IBOO/00435 <220> <221> <222> <223> allele 158172 polymorphic base A or G <220> <221> allele <222> 158302 <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> polymorphic base A or G allele 158512. .158513 deletion TT allele 158803 polymorphic allele 160172 polymorphic base C or T base C or T <220> <221> allele <222> 160634 <223> polymorphic base C or T <220> <221> <222> <223> allele 1612 36 polymorphic base C or T <220> <221> allele <222> 162810 <223> polymorphic base A or G <220> <221> allele <222> 163007 <223> polymorphic base A or G <220> <221> allele <222> 164877 <223> polymorphic base A or G <220> <221> allele <222> 166844 <223> <220O> <221> <222> <223> polymorphic base C or T allele 166911. .166914 deletion TCTC <220> <221> allele W0005851 0[(tqpL/twwA.getthe patentcomLog in.dog/Sexam.su port/Fetrh/Defa uIt. do NVO00585 10.cpc*?fromCar-he=l1part~maintoolbar--boftomI Page 405 of 737 WO 00/58510 PCTIiBOO/00435 <222> 167754 <223> polymorphic base A or G <220> <221> allele <222> 167787 <223> polymorphic base C or T <220> <221> <222> <223> <220> <221> <222> <223> allele 167894 polymorphic allele 168346 polymorphic base G or T base C or T <220> <221> allele <222> 168414 <223> polymorphic base A or G <220> <221> allele <222> 168453 <223> polymorphic base A or C <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 169300 polymorphic allele 169451 polymorphic allele 169627 polymorphic allele 169984 polymorphic allele 170199 polymorphic allele 170746 polymorphic allele 170858 polymorphic base A or G base C or T base A or G base C or T base C or T base C or T base G or T W0005851 0 httwJM'ww.getthe patent. com/Log in.do /Sexam.suportFetch/efault.doNfOOOS 8 Sl 0.cc?fromCache=1 part=maintoolbar--bottomlPae 406 of 737 WO 00/58510 PCTI-BOOIOO435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 170860 polymorphic allele 170906 polymorphic allele 171309 polymorphic allele 171413 polymorphic allele 171504 polymorphic allele 171539 polymorphic allele 171728 polymorphic allele 171898 polymorphic base C or T base C or T base A or G base A or G base C or T base C or T base C or T base A or G allele 172125. .172126 deletion AA allele 172295 polymorphic allele 172298 polymorphic allele 172336 polymorphic base A or G base A or G base A or G <220> <221> allele <222> 173145 W0005851 0" tg/Wwww.getthe patent. com/Log in.d og/Sexa m.supporttFetchtoefault. d og1W005851 0.cpc?fro mCa che= 1 part= m aintool ba r--boftoml Page 4 07 of 7 37 WO 00/58510 PCT/LB00100435 <223> polymorphic base A or G <220> <221> <222> <223> allele 173304 polymorphic base C or T <220> <221> allele <222> 174227 <223> polymorphic base C or T <220> <221> allele <222> 174397 <223> polymorphic base A or G <220> <221> allele <222> 179154 <223> polymorphic base C or T <220> <221> allele <222> 180233 <223> polymorphic base C or G <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 182552 polymorphic allele 182733 polymorphic allele 182773 deletion A allel1e 185759 polymorphic base A or G base C or T base A or G allele 186307 deletion T allele 186976. .186979 deletion TATC allele 188755 polymorphic base A or T W0005851 0 [httpoJtwww. etheipatent.com/Logindo /$exam.suportFetch/Defaut-dogNV0551Occfo~ce part=maintoolbar-bottomI Pag~e 408 of 737 WO 00/58510 PCTIIBOO/00435 <221> <222> <223> allele 188991 polymorphic base A or C <220> <221> allele <222> 189002 <223> polymorphic base C or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> allele 189154 polymorphic allele 189177 polymorphic allele 189604 polymorphic allele 190063 polymorphic allele 191164 deletion T allele 193880 deletion A allele 193897 polymorphic allele 194441 polymorphic allele 195306 polymorphic base A or G base A or G base A or G base C or T base A or G base A or T base A or T allele 226323. .226326 deletion TATC misc feature 4222,11245,27205..27206,27212..27213,27240,27347,27378,28258 108818,128283,137062. .137063,164757,172148. .172150,180820,184929 W0005851 0 [http lww.gettliepa tent, com/L og in.d og/Sexa msup prtFetchDefa ut.d ogIWO005 8 51 0.cpc?fromC achie= 1 part=maintoolbar--boftoml-Page 409 of 737 WO 00/58510 PCTIIBOO/00435 1944 60, 200104, 207061..207062, 20794 9, 239085, 24 9787, 24 9806, 250156 250189, 250841, 251114, 264 938, 265019, 265078, 274 640, 277770, 314 308 318680, 318731 <223> n=a, g, c or t <400> 1 cgggcgaat t tctgtgaaaa ataaaataaa ggtaagtgtt tccttctcaa tgctgagctg tacctagcct aaaacactaa actgtacctt tccgcacaat tcatatccaa atgcgtccac ttcatcctcc tatgtctagc atccctgcaa atattttata ggaagagtta ttttactgct tgacggtaat atgaagggga aagtactgag agcttctcat tatatttctt ggatatataa ctattcacat atattgttaa t tt ggga gg c cgtggtgaaa cctatagtcc gcagaggttt accctgcttc tatttaaata caacttttat agtcacttat acattcacag tttaaaaaaa gtttacttgt caatgagagc gatgtaagaa ggaggctttc tcatgtcatg tataaggaaa ttgtctttcc ttcatgtgta atcattttag cctccagaag gtaactaaaa ctgtgtaaac ttataagaac tgtatttgat tctgtcacct aggttcaagt ccacccccgg tttcttttct gctggtctca tacgggatta ttcagttgaa cgagctcggt gtgactgatt aaacatcaca ctttaaacaa gt ccggaata gtaccactat tt gtaaagct gctgttgagt ataaaattta tttgcaatgg attcagtatc tcccctgaaa agagtgagaa cctttatagg taataaaata cgtcaattct aaagaatgtt ttaaagtaat tcttcttgta aatgggacta caccttgatt aagcctgctc tattagataa cattttatat gtttatgtaa taagtatctt cgaggtggga tcccatctct cagctactag cagtgagctg aataaataaa tatataaata ccaaaaacct agatctatct acacagaaat atggatctac ttgtttcggt agtctggaca cacgctttag tcaggacatt gaataaacta ttgtcatagc atatatttat gtcattaatg ccatttgttt aaagaaactt ttagatggca agtctctcaa caagatatgt agaccaccaa gggctggagt gattcttctg ttaatgtttt tttcttttct aactcctgac caagcgtgag catgtgtttt acccggggat attgacaggt ttccatgtat cttcaatgga aagcaaggtc tgggctgcta cagattccac agattaaatg aaaccaaaat acccttcccc accagggcat cacattgtgt tagactgcgt tcgattattt cgggactaaa ttaaaagggg tgagaagaac tataattttc cttacaggtc tttaccaagt cctgcagata cttcaaaggg ttttatttca tat cat ttat ataattgaac catggctggg ggatcacctg actaaaaaca ggaggccaag atatcgtgcc taaattaatt tttacattta atttttttca tacttcaggg cttttacatt agatccacca cttaagggaa ttgaatgaat agtaaataac tgggtacctg tgctttaaag tttgaaatta ctagaagaaa gtcggatagg ttaataaatc aatacctttc gcttgaggga ctgtctagag atgtaaggac ttttatttta gcagtggcgc cctcagcctc tttcttttct ttttttagta ctcgtgatct ccactgcacc tgaagtaact catctttgtc agccttgggt t ttcaaaaaa aaaggagttt tacagagaca agcactgcta agctataaac aaattattta gtaaattctg ggcctccag agagtaagtg accttcattc gttggagagg gaatgcttga gtagctcgta aaattctttc atgtctgagt attgcaggat attattacaa gtatctgcat attatttaag tgagtagttg aatctagtct gtcatcaaga acctctaaat cgtggtggct aggtcaggag acaaaaatta gcaggagaat actgcactct aattaattaa catatgggaa aagttcctcc cctatgtttt tctaaaataa tagactaaac tcttcaaact ggtgatgtca atatttggct gtccttcata aaatgctgcg tgtcaaatat atttactgga cagttactat tcacttgtga ctccatcatt ggaagagatg ttagctgtac aaacatcctt ttttatttta gatctcggct ccgagtagct tttcttttct gtagacacag gcccacct cg agccctgatt ccatattgaa atagattgta atgcagctca agcttctggc cttccaaatg aagtataaat agcattgcct tgagatgaat tgtagagcaa atttttaccc aagctgaata ccaactgtga ttggagttga tcagggaaat cagcatctgt tctctagtgg agagcttcag attacctact ctattaaaaa tgaagggaag agactaaagg aaccataaga acatgatttt tattttttct atgtagattt gacagatact cacgcccgt a tttgagatca gctgggcatg cgatcgctca ggcctgggca taaagtatct gagagatctg aacatctata cctctaccat ataaaacatc gaccaaacat accctagagc ttaaatgagc tctgaggtat ctcaggaggt tcagcagaaa cattttaact caaaataaat aaaatatgaa ttgatttatt atgaaggcac atgtagagat gaatctgttg aatttgctta tttttgagat cactgcaaac gggattacaa tttcttttct ggtttcacta gcctcccaaa tttaaaaggg caggggaatc gtaaaaataa agtaggcatt ttactcaaaa cttggagaac aaaaccatgg tcagatgagt aataatacac atagaacagt aagggtcaac tcgttgtgta ggccatagct gtctttgcat tatgtctttc ccacttatct gagagtgcat aaaatatcac agcattacaa ggcttttacc aaaggaagac agacaagagg at tct t tcct acatcccatt gaaccttctg atattctttt atcattttat atcccagcac gcctggcgaa gtagcatgcg aacctgggag acagaatgag t aat gac aa a aaattttaag aaagaagtaa acaacactgc caaacttcag agtcagaggt ctcgtgtatc tatggagcaa aaaaagggaa ttttccatct gtgtttcaaa aagagagcca atagaacaac taatctaaaa aaaaacaggg tagtactgac ggtgtgtaat ttggctccag gcaagtcgta ggagtcttgc tccatttagc gtgctcaaaa tttcttttct tgttggccag gtgctgggat attttagaat agagtaagta 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 W0005851 0 [http:twww. getthe patent. co m/Login.d og/Sexa m. su pp rFetch/Defa uIt. d ogIO005851 0. cpc?tromC ach e= 1 part= m aintoolba r--botto m] Page 4 10 of 73 7 WO 00/58510 PCT/EBOO/00435 aaccactaca ggaaaatcag gaaggcagac tccaatttat tttaataaag gaaaagtaag aaaggaccca cctcttccca agagaaaaca ttctatcctt cagctgcgag tcagaggcca ccaaaattat aagtttatga aaatcatctt aaaaggctaa ggacatatca catcaaaaga atcacttgga tcagggttcc cccacaaatc tgtattttac ggcttccacc ggagttcgag aaaattagcc ggagaatcgc actgtattcc gtgaaaaaca attagatgaa acaactaaag tcttagttgt gaaagatata aaaattatta aaaaaatcta tcaaattatg ttcttagaag tatgatgtga ctatgataat tataacctct tagagatgtg gaggcaggaa aatggcaatt aacactttta gcgattcctc tatataccca tgcggcacta ctgggttaag tgagttcatg atagcaagga gggaacacct gaggggggag agcacaccag cctagaactt aaaggctgca acaacattta ttgaaaatat cccaggctgg aacaatcctc acagctaatt aactcctgac tgagccaccg ctaagagttc atagaaagta gctggagagg tttatttcaa agqtattgag aattaaaaat acaaaggaaa cgtggaacag attcaccgga cagtcagctt caggattgtg acagaggaga aaatagttca gcctgcctat gtttcccctt caagagtaat taaatgctgg aaaaacaaat ggttcaatgg accacagaaa atggatgttc cataacccaa aacatacccg tgtaatccca accagcctgg aggtgtggtg ttgaacccag aacctgggcg aagtaagact atagggtata aaatacaaat aacaaataaa caggaatact gaaattgtgt cagagaactt atattttata attactttag gatacagaaa agcaatataa gaaagaaaaa acaaaccagt ggaaagggga attaaaaagt cactattggt agggatctag aaggattata ttcacaatag aaaatgtggc tcctttgtag cagaaaacca ggacacagga ggatagcatt catggcacat aaagtataat tacaaatgaa cttagctacc ggttaatctg agtgcagtgc ccacctcagc ttatattttt ttcaagtgat tgcccagccc acaggggagg ctgcctaagc attt cagtca ggtactgaaa ttgtcaagaa cataagagta tctgacctca ctggcaactg gaaaacacag tgcatacaat aacagagagc taaagaatgc aaataattgt atttcagttt ttaaactttg ttactcataa tgtaaataag anaataagaa aaacctaatg ataccaacag ttcttagatg gtttcatcat t tcaggccct gcactttggg acaatatggg gtgtgggcct gagccaggag acagagcaaa aaggaactgt cagtttagaa aaagtctatt atatcattat ttgtattatc cagaaacact cttttcaatc atatgagaat gatgtgctat aatatataga gaatgtttag ttaaataaat atgttgaaag aaaaaagaaa caggaaacaa gggactgtaa aactagaaat aatcatgctt caaagacttg acatatacac ggacatggat aacaccacat a ggggaacat aggagatata gtatacatat atatatatta atactatatg acactgaaat gtttttcttt tgtgatctta ttcccccagt agtagagatg ctgcctgcct agaaatgtgt gatactggac tgaagactga gaaaaaacat taaattgaga atacagtttg gttttatcta tgccagtgtc aaactcatct ccagctttgc atctggtgtc caaggcatac tgaacattat gttaatcatt tgaatgtgtg agaaaagacc aaagaaaaga attaagggag attttcagag caatgaatgg aaaaatctgg agaaggacac gagcaagcct ttaaaaatgt aggctgagat gaaaccccaa gt aat ccca g gtggaggttg actccatctc cagattagag ttatagaaca ttagttaata gtaagatggc ttagaaacta ggatgttaga tatcatcata aattctgaaa agtcaaacag aacaatttag attggaatag aaaaaaattc gtgatgacag gaaatgaaag caggtgctag actagttcaa accatttgac ctataaagac gaaccaaccc catggaatac gaagctggaa gttctcactc cacacaccag cctaatgcta gtaactaacc tatatatata accattattt tactattcat ttttttttga gctcactgca agctgggatt gggttcgccc cagcctcccc ttagtagttt ttagaccttc acactgacca ttgagaaggt ttaaggggag agaggtaaag gttttctgtg gtggcctaga tggaagcctt tgtcaatttc atacagtgtc agaatgacca aaccagtatg gggtcactgc aaaagtagaa gagatcagaa ataagaaccg actcatgata gacaaagatg ct tgaa tat a gacaattaat tcacgtacaa ttcactttta cagccaaaga caaagttggc gggtggatca ctgtactaaa ctacttgaga cagtgagcca cccccaaaaa gggactgagg gaaagcagga ttgttgtacc aacttcagga ttatgtcaat agacaatgga gcatcaatca atttacctta aggaataaac aaaaataata a agat gaa tg tgacaggata aaagagagaa gcgattctca acaggatgtg ccattgtgga ccagtcatcc acatgcacac aaatgtccaa tatgcagcca accatcattc ataggtggga ggcctgttgt aatgacgagt tgtacgttgt aagaaattcc ccttcttggc taattttaag gacagggtct acctctgcct acagctgtgt tgttggccag aagtgttggg gaaggggcaa ggaatcaaga ggctgaatga ccagaagaaa tgaagagtca gccatattag tataacctac acttgattat acaggaactg aagtgtagtc tggtgtcacc aacgattggc cccactccgt tttgaagtat gaagtggaag atttaaaaaa gtgttttagt ccgtgtaaac aaggaaagca caaacaggca gcttttaaac gagataagag tggcattgtt aaaattgaga caggcaccat tttgaggtca aaaagataac ggctgaggca agatcatgcc aagcaaagtc aaacatgaaa catcagttga aatactaatt aaagttgggg attttaatat ggaatgcctc agtatgagct taccaatatt taagaaaaag aaaagtagtc ccctcaagag cctgatcaga cggaaagaga caccagttag gagaaatagg agt cagtgtg cattactggc gtatgtttat caatgataga taaaaaatga tcagcaaact attgaataat 9999tg9999 taatgggtgc gcccatgtac aagaaaatca tttttcaaga taaactggca cgctctgtta cccaggttcc gccaccatga gctggcctcg attacaggtg gtaccaggtg aaagctttct aagatgtagt aataaaacaa aggtctggag gaagtaatat 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4620 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 5640 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 6540 6600 6660 6720 6780 6840 6900 6960 7020 7080 7140 7200 W0005851 0 .htwww. getthepa tent. comfLog in.d og/Sexa m.su pport/Fetch/efaut.dog NO005851 0.cpc?fromCache= 1Dr~ano~a~otm ae41o 3 WO 00/58510 PCT/EBOO/00435 atttttaaac tgcagttatt ggcattattt agaggagaac aaagcataag atgaatactt ctagaggtgg gggaattcaa tagataccat tcttttgaga atcagtaatt tcattctcaa agggttcatg aattccccaa aaacctaggc ataaactata acctacactg ggattacaaa cttaccagtt ggaagtcggg gctttcggca attcgacttc cgtatgatat tgaacctccc gtttggaaag tcgatttgag aggaggcatc acaaagtcat gatactagga tgttaagaga ctagtaattt aagttttgtg ctttttcaca tgaaataggg ccaaaaaaag tgtttatttc gqcttgattt aagtttggga aaaataatgt gaataaagag aatgagatta gtgatgatgg aagataatga gactaccatg acaggtgcac tgggaatagg gggaattcaa tcacagttca cagagaccat tctagggcag gcagcaggca attttaggcc aaatgagata aaatttaaac gcaacagcat ttcccttgcc tcctggtggg gcctggaacc cat gtatgat ataataaaat ctttctttca ccatgcctat ggtggcctac ttttgaagct ataaaacttt tacgtaataa agggccagta taagacttaa gagtcacttt ttttggggaa ttaggctatg ctgataatga gctgtatcct tagaagtttc accatgcatt ctgacagaga tataagaatg agaaatagtt tcctattaca aagttgtatt aaggaaatat gcctgggttg gagaggctgt gtgttcctta atcatatcta ttattgaata ttactttaac gtccaataag atttacgtga gtgatctgga atgagagaag agatgaagaa taagttaaaa gatgtaagaa gagacaatga ggaaacatct ctatggtaat agtttttaaa agattcaacc atgtaagcaa aaaggctggt agatgtggaa aaatgggtca tgaaaaaaag catacctcag atccaatttt tagacagata tcattgagtg aagactcaat gaagatcttc gccatggccc ttgccctcta ttgaaggaga agtttgcact agaagtcttt gttggcattt agcaatattt attaaagctt ctggtgggag atatactccc atgaatggta aaagtttaat agaataatta aaatatctta gtgatgtgat tattgaccta tattctaagg cagaaagatt aaatatttat aggaagagga tgataattta gtagatagag gctaaagact atttcaagtt ttagtgattg tccgtagtta tataaagaaa aaccacctat agacccacat cagtgtgctc caattgattg aatttagatg taagctatct catacacctt gctgctgtgg cttctatatc aatttaaata atctcctaga acaatatgct ttaactacta ggaattaaca tgctgggtga aaggagggag cagagacaga tggactgatt ccattaaaaa atagtgagaa aataaataaa aagaaactgt aaattgttac caaacatatg attttaacca agatttggat gggctttgtg tcctgtaaca acgtggatca aggatgagaa atagaaatga gaacacattg accaaataga aaccagtaca gaaggcaata tttggcttcc agaatggtga ggagcaactg gagtaaattg tttgaggaga gacatgctag ttggcatttt agcacaaaaa tttcttcttt tatgtcctcg tcttatccta ccaagcccta ttataaatta taacaatata ttgtactgta gtgatgaagt ataagcaggt ctaataacaa tatttaaatt ttgttgtgta gaaatgcata aacttaagga gcaccaatca ccacttttag caaacaagag aagccatggg tctgatgggt gttcggctac taatgtgttt aagcaaacct tgtgggaata ttatttcata ctttgggcca gtctggatca ggaagaactg taaagsaata ttacatttgc tcttttcctt atattattaa ctgatactgc attaattaga gatgagaatt ttagtgataa atatttcagt cagagggcag tgtaaagaaa atattgggag atgctcttga atagcatatt taaaagggac cattccgaag aagatataca caaagaacaa ttgaggcagt agacaaagtg atggcaatta tttttagaag attatgtttc attattttaa aattcaaagt atagaaacac gataaactat a ggggaagtt ataagatcct tgaccgaggg atggagagaa taaaccaaga aattctagga agagaaagat tggcaaagaa atgcttgtca cctgcaatag cttatcctgg gtgggacatg cacacactat ggcatagtta ctgtaataaa ctcacccttt aaggtgaatg tgtgtctgca agtggtgtag aattggaatt aaaaataaat gatataaagg acaaggaaaa ctcaactcag atctctggaa aaacgggatg aatggatatt tttttaaatg aaatacttat agaaaaacag cgctataata tggagaaaca ctgagacaaa tgggtcagct cttggttcac gctcattagt tcggttggaa tatgtctttg ttggactcaa cctgaagtta atatgaaatg aaagaacctt taagagtacc gaacagaatg gaataattga gagtcagtgg ttgagaccca atcctgaatt tgttgtgtct tagatcaaga aaggtttgag attatcaaat atataataaa aacaacct ca gaatatagga accatgccat gtgatgaagt gaaaagcact caaggtttat aggaaaccag gacaatccgt ccaccatata attgtagggg aaaaagaata agactgtttc cagggccatg taaattgggg atgccatagc agggatttct ggattttttt agatttcatt aattcctgct ctgatgttca tgggaatatg ttccaagact gttttcatca gagataaaca agttgtctga tttgatgatg agaaaggcat gcatggagac gcaggaaagt 7260 gagaaagaaa 7320 agtttggcct 7380 gtgttaggat 7440 tgaaggagta 7500 acagagtaga 7560 tatccaagat 7620 gagatatttt 7680 ttgtcaatgt 7740 gcgtaaaata 7800 cctttctctt 7860 taagtaattc 7920 caaggagcta 7980 aagataagga 8040 tttgccaagt 8100 ccacggcgac 8160 aaaaatgttt 8220 caagatgctg 8280 agccggggct 8340 gaggaaagat 8400 gggtatgttt 8460 ttgtcagtat 8520 aaataacaaa 8580 cactcaaggg 8640 tgaacccatc 8700 aagtcagctc 8760 gaggattcag 8820 atatgagaat 8880 agttatactg 8940 gctttcaagc 9000 gtttcaggga 9060 ggctggtttt 9120 tgttagaacg 9180 tatctcccag 9240 taaactagta 9300 actgagagca 9360 ggcattggaa 9420 gagaattgtg 9480 ggtgacatgg 9540 gaaactttgg 9600 tgcaaaagct 9660 tttttagaga 9720 catccatgca 9780 taataaaacc 9840 ctctcacatc 9900 agataaactg 9960 taggaagcag 10020 gtttggtgct 10080 agagaataaa 10140 taaaagggaa 10200 ccacatttcc 10260 tttaatgaat 10320 ttcaagacca 10380 gaatttgaaa 10440 cgatacagta 10500 ttccccttta 10560 cccagtggat 10620 tatacataca 10680 ataatagcta 10740 tgtggtctct 10800 tgagaagata 10860 catgacgcag 10920 tctggaaaag 10980 W0005851 0 fhttprJtwww.getthepatent.com/Login.dogISexamsupportFetchDefaut.dogWOOS 85 l 1 .cpc?fromCache= 1 part=maintoolbar--boftomI Page 412 of 737 WO 00/58510 PCT[IBOO/00435 ggatgattca gagcagtgca ttgaaaaggc aggactactg aaaaacaaat aaattcacaa atggtgtaga gcaatttaca acaatcatga agagagagaa tagtcactac caggttcctt ggggacacag aaaattactc tacacctaat attgccaaaa cccctctctc gggactcagc gtctcagagg ttgcctgtcc aaaacccttc atcataggtt tcagctttac gggagaagaa actttgattc ccactgggaa atttatcata aaccccaaag agaattatat attatatact ttacatgttt taaaaattgt tataatacat ttatatataa caccaatgtg ttccaagaca tggtgtcttg aaaaatgaat ttctatagct ctttattgag ttattaaatg tctggtgctc tgtgtgtgca tgcctcataa taataaatca tcataccgtt aggaaatggc tccttccttt tgaattattg attgagtgaa atggaattag aatttttggt ctaaatgatg tcttcactat agaaaactac ccaatcagat ggattttttt t gtga agt cc actggaaaca cagaaccgtg atgtgttttg act caga tt c agccttgggt tgtcaaggga caatttaaaa agtgtgccac tattcttaga tagatcaaca ctttcaaaga tatatattcg aaagaaagag tggaaggcaa cttgtgcagg cataagaaaa ccacaacgtg ccaaaccata ggtttattac gccaaagttc agttacaggg tttccttgct ttccatgatg agaagaggga attgctcctg agaaaagagt caacccaaat gaattttatt taaaagaact ttcctttata gtcagagttt cttgtattca cattagagac atataaataa atatatggtt ataatttata gtatattata aatatatatt tatataatgt attttaaaag tgaggacatc gaaaggcaat acaataaaat gtaagctcag tgttttctat cagtcctttt catgagatct tacgtacact aagattaaaa gttctcatca gtatacctac ttagagaatt catctctaac actggcataa gatggaataa atacagtatt tggtcttcct acaaaataat ctatattaaa tagaatttat gtt ctcttaa tttttgcacc atgagcttga gccccagaaa atcaaattcg cggcctccat ttggcttaga atagtaacag agaattgaat cttatgaatt aggtaattga gcaattgtat tgggntggta aaaatattgt tctgttttca gtttaagaga gaatgagcaa gaaactcctg gcacaggaaa tgggaattgt tcaagatatc tgacattctg ttacagttca agagcctcag cttctctctc ctgcctcaga ggccatctgg cttcctgatc aacagagaaa cttgtttcag catgcttcag actccgaaaa aatacaaagg atctatatcc gacatgatgc agatagatag aatttcttta gtataaaatt attatattat aaatatgtaa ataatttata attatatata actaccataa agttggaata ttcctctcaa aggcgcaaag agagacaatg gtatcagaca cctgttcagt aatctccatt gacacacatc tggaagatta tttgaagaac tctttaaaaa tgcatgattt gggtgtagaa atagcaactc aaaaatgcag tgtgagtgtg tgtccattta gaagcagatt tagatgaact tgcactttaa aggactatat acaattcaaa aaagcccata gttccagcca gtcattgtga aagatgttaa gagattattt ggagtwcata

III

gggacagcac gtttatttat aaccacagaa atcattggaa ccattaggaa gagtctctgc tggtgctaac cgcacagttc atcacgtctt tttgttaaaa gatccacccc gggagttaca agcagaaatg atgtgcattc aactctagga tgtttgtttg catcattctt ctttctatcc agaaggtaca cctgccaggg actcaccaaa gttacagata aaagttgcta tctgaaaaga atttatggtc atcttcacat tattattatt atagatagac tataatgaag atatattata atataattat tatataattt tataatacat tgatgtattg actcactgaa acgtttcttc atgggtaaag aatctcacaa atcccatgat ctgtgtacat gtcaccattc aatgtgacat gtttgcattt gactccattc tatgaggtgg aaagatgcaa gggcacatga aggatacaaa acactaaatg gaaaagtcct tgtgtatgtg atgtttgcag agtaagaaaa aaaaggtaaa aaatatcatg tagggtattg taatgccaga gtgttcacgg gtaatgaaag gtcttctggc aggaacactg accccggggt gaayagtcca agattttat c agaattttcc agtgaaactg tattattgat agatggtaga tatgagatag aaagacacac cacgtggctg acacggttgg ccatcagatc at gat tca gt gttcaagatg agcaaaaaat cttaagagat gcaagagctg gactctccag cccagccttc atacggtatt gggcacctca gcacacctgg tacaagccat gagaattcca aacagtgtaa gttaaaataa ttttgcatca ttattacaac tt cca ctggc agagatattt aaattcatat cattatatat ataatttata ataatatatt aatatataat tatatataca aagaaaacat catagaatta t gt ttgt act cttaaaacat tttatgggag tttgctatgt ggaggttttt atatgctgat gtaatttttt agagtttgac aacaaaaact tttacacatc agccatttta catatttttt cttcagaaat gttctatgag tgtgccatag catttgttga cctacaaatt tatggatttt tagtgtgttg taaatagttt attgccagct ggatcagtcc atggtgcaca cagcgtcgat aatcattggc gcctttctaa actcatatga acattactca atttaatatt cagatgaggg agtttaatga ttttcaattc atattgagaa ccgagactgg gggaggcctc cagcgggcaa tgatgagaca tacctcttac agatttgggt gagtgatttt aattacattt cccaagaacc ctcctacctt ccaggttctg attgcactgt gcagtgtctc agaaacttag tcaatgtgcc gtgcttctta atgaatattt att ccagtgc gccagggtgg cacacacagc atggctttta atacaataaa aaaggaatat tatatgtaat aaattatata ataatttata atattataat tacatatttc aacagttggt aatgcatctc aatactgtat cccatcttta tagaaaaaca tgtcccgatt ttcaagacac attatgtaag tttacccagt aatgcctcaa gatttgagat tgcaaatctt gcacataaat gcagatgatg gtgtttttta agctgaagat ctaatattat tggattttta gtttactaga tacctactaa taaaatgaac tcctaaaagt ataaaccaaa ctttttttac atggctgtga tttctaccac aatccataat cataaacact atgcaagaaa 11040 11100 11160 11220 11280 11340 11400 11460 11520 11580 11640 11700 11760 11820 11880 11940 12000 12060 12120 12180 12240 12300 12360 12420 12480 12540 12600 12660 12720 12780 12840 12900 12960 13020 13080 13140 13200 13260 13320 13380 13440 13500 13560 13620 13680 13740 13800 13860 13920 13980 14040 14100 14160 14220 14280 14340 14400 14460 14520 14580 14640 14700 14760 W0005851 0.[http:/twww.getthe patent. co m/Login.dog/Sexam.suppo rt/FetclI~efa ut. d og/O005851 0.cpc?fromCache= 1 part=maintoolbar--bottoml Page 413 of 737 WO 00/58510 PCTIIBOO/00435 ttataatgtg gtgaatgtat actgmagtga kttttcatcc taattatctt ayatatatrt atatatacac acatatatac tctatataca ctaaatggat gagtaaaaat gaaatttgta aatagctcca tatatccata gcaacatgga ttctctgtaa aagtcagtgg ggtgatgaag aaaattcatc cttgattgta aagtgaggaa tggttcacac gagtttgaaa aaaaaaaaaa gagtcatgag ctacactcca aacaaacaaa aaaatgcctg aggacattgt gtggatagta tcaaattaac tgtttttaat tatgtataca ttattttagg gattcattca tacactaagt gaagtcctaa aaaatataca tacttaactg tttattaatt cttaagtact agatctctaa cattaatatt attatatata aaacaatgct ggaaattggc tcagaaaacc tatattttca gtcccacagg acgggagccc tttctttgtc ttacctatag acagtagttt atatcaatag gttttataac gtgtataaaa tagttgtgaa ccaaaaaaga gtcagagcat cggctaagat attttgtaca caatagcata tctgactgca attaattttt ataggaaatt atcaaactat tatcaccagg ttctctcttt acatacacat atatatacat atgtgtatgg cacatacaca ttagtacaac gaatgaacta aatatgtgta aatgggaaaa gaatggaatt tgaaactcaa gaacttttat ttacctttgg atgttttaat aaggtgacta tgactttgga gagaatgctt ctgtaatccc ccagcctggg ttagccaggc aattgcttga gcctgagcaa caaacgaaaa gagtgtgtgt gggaacatct atttttatta cagcagttaa tgacaaataa ttgtggaatg aactacgttt ttcttcattt gtcgggatta aagagagaac caacaaaaca gtttagaaat atataattaa tttaagtatt aacattttta gtttacatgt aatatattta acatatatct cagcatttca agtgtggaga ttttcttttt ccactgggta atggacccct tcacagtcta caaaagatgt ttagtacttt gcattaatgc ttactgcggg caccttgaaa agtttcaaaa gggaaataca tgtgaatctt taaaatgtaa tatatagctt tgtgagtttg cattaggaaa t tgg tcatt t tagaaatatt tggattataa acctgcacag ctttccccaa atatacatgt gtgtatgtac gcatatacat cacgtacata ctaatgatat aattccaaga ccatagattt agcccaaatg ctagaccaca aactccttga tcaaatttca cagttagtgt tcctgatcta tgcactttct tattactttt acctctaagg agcattttgg caagatggtg atggtggcat acccgggagg cagagcaaga gattagatta tcagtattta gttaattacc ataacacctt gagctatgct aattgtgtgt gctaaattga ccagaagtct aacccaggaa ctaacatcaa atagacagac tataagataa gttttgaaga cttttaatta cagttcagtc tcttgcaaaa taacacattt taaatataca aaggcttcta gtgtgaagga agatgcataa catagtcaca atagcgaact ccccagctcc gaagagtgac acatgtaatc tataaattca cagtttttta gtaaatgaga taaaagtttg tgacagatgc gctcaaagag cggctttgat caatatcagg gaaatgcata aaatgtaatg tttactgctt caatttattg awtatgtttt ttccatgaag tatgagtamc ccatgtgtat gtatggatgc atactcacgt atatataata caataaataa gccacagatt tcttttacaa atacaaaacg tcaatcaaca gttaaaatga gtggataaag aatacaagca acccaggctg atcctagctt gtaggtttac cttttctgtg attgacatca gaggcagagg aaaccccgtc gcgcctgtat cagaggttgc ctccatctaa gcaagtagag attgtagaaa gaacagtctt tatatgggct tcttcttttt atttatcttg gttaattaac gtaaggtaga ttttttgagg ggaacagtta acataaaaac acacagaaat aatgtatgct tgataaaata atgttcacta ctgagactct cattatatta tgaaatttgt gtcctatatt ggaaggatgc taggcttgac atgaaagtga gtgaagggtg tttgctcca atttcaaaaa acattatgac aacttagcaa atgccagtga tatttagtta aagatgtcct attttaatgg taaagcagat cttgagtacc ggaaatgcat tgggaaatgt cggatatata aaaatgacta aaggtaattc tatttttttc gtaagaaaga tggtgcataa acatacacay ataatcacat acacatatgt catgtgtatg atggttgaat tgtcaaagag cctatgattt ttaatggtgg gtagaatgga gtagattatt ccaggctgtt aaactattct gggcaggagg tactgatggg atgaaaattt ccttaatttc agattagtgg caggcagatc tctactaaaa tcccagctac agtgagctga aaaaaacaaa tatgtgtaaa cagttacctt tttaggaccc gaaatcacaa gccaatttac cacaacaagg atatgcatta t gga t tga ta gtcagtttca ctgacacaac atagtataac gtttggagca aatatgtctt cataatataa tatttatatt acaccctttg taatgtatta atatttgaag ggacttacag cgtgttctct gcatttttta aagcaaagga tggagtggac cagcaatctt ttatagcagc atactacaaa ttttccttat tttttaacct tacttttgaa atgagttgct cagagtagga gcagagaaca tagctagata ttgagaacag aggtggagat atctaaaact aatctcaggc agttggctct ctctaggtta gctccagatg caaactttat gcacacacac acacacgtgt gtatatattc ggcacattcc ggcaaaatga ccctggaatt cattccagca cattatttgg tggattttgg gctacaccca tacgattaca acagtgagac gaagtttcta tttactttga caatgacaca ctcaattgaa ctgagcacgg acaagatcag aaatacaaaa ttgggaggct gatcacgcca acaaaacaaa accacctgga cataaacaac cctggggttt tgatactgtg ttgttttatt tgttttaaaa cctcacacag tttttaacct gagcatgcgc aaatcgatgt acaatatatt atgaattaga ttgttcaaaa aatttattat gatgtggaac aacaaccttc tcgataacat tattagtttc tggaaatctg cccatctgtt taatgatgtt aagagctaat tcactgggag ctcccttctc agaggtgttt acaggtaaaa ttcaacatta gctgaaattt agtattgctt gtgaaaagag gttcatttat gcaaacaacg ttactgtcaa taaaacattt ttttagtagg ggttctcaat ccaactgcag 14820 14880 14940 15000 15060 15120 15180 15240 15300 15360 15420 15480 15540 15600 15660 15720 15780 15840 15900 15960 16020 16080 16140 16200 16260 16320 16380 16440 16500 16560 16620 16680 16740 16800 16860 16920 16980 17040 17100 17160 17220 17280 17340 17400 17460 17520 17580 17640 17700 17760 17820 17880 17940' 18000 18060 18120 18180 18240 18300 18360 18420 18480 18540 W000585 10 (ttDJWwww.getthepate nt. com oA in.d og/Sexa m.suportFetchDefa u ItdogVVUU bbb 1 U.cpc?trom(;a cfe= 1 part--ma intool ba r--bottoml Page 414 of1737 WO 00/58510 PCTIBOO/00435 attgattaaa ttaaaattta tggggatgtg cgcctgaatt aaaaaaaaga aattagtgtc tgagaacatc tgccctttca ctcttccatc ggacccagga gtaactgcag tcacacagct caactgttgc gccccttcgt gtgctgaata gaagatggaa ttttggcaat tatttgaaag atcagatggc aagtttgatg tcaattgaga caacagagca gctgtaaagg atttttaaaa acatatgaaa t gt t ttgcct aggcaaataa tctttgcact tatggccatg tgccactcat taggactgac atataatttt ttacatagaa cattacatat tgtattgaca tcaaatgaat at gct acacc.

caggaatttt ggtcgttgtc gcaagtgtca aaaagatgaa tatttttaaa agtaacttac tgtgtctttg ttcaaactgg caaatagtta tgagttttgt attaggtggc catcctattt cctatttctc aaaggagggg ttaggaggct gccagtgctt tcacagagaa catatttagg ttttaattta gctttaagag ggagcaaagt tcgagttcaa tccctgggtg gaaaataatt ctttagaaac tcattacaaa agtgatgtcc cagctagaat tgactaagct ctccccaggc aacgtcatca tagagagtgc tgtagtctgg ctcagggttt aggtgaaaac gttgagggtc gcttctagag tagctctata agacagtacc ttctatgcca ccaagagaga ggaatctgag gtcacgaaag aggggctggg ataggaggaa ttgccaaact ctaataatat cttagatttt tgaacaaaga cgacagccat tataacttca agtccatttt cttacccttt ctctcctgcc catcatgact gaaaagaccc ataacataca aacatagtta ccctaaaaca ctaaagagta gcatgtcaaa caattcaagg gaaatgaatg caggaatcag tttaaactgc aacagttaac tttgcttatt ctgatagtga tccatctcaa attaatggta tgaacaatta tcacagagtc ctatgtccac ggcaagtgct tctcttcttt aagaatttgg gaattaccaa cacaaatgct aacaagtaca ctttacagtt gscttttcct gtagaaaaat cagtccacaa ctccaaacat aaaagcaagc ttcaaatcta atcttcttgt ctccaactta acatatgtag ggggtgaatt ttcaagtgtg gattataaga t tgt gtgggc aggttgttcc gcaccagagc tggtaagcac aggttttgtt atcctcagtc tctgcttagc gttctcagcc ttcattaaat agcctctgcc aaatgacctt catgtagagt gcttcttccc gcatcaatgc taaagaattt cttttaatga caccgagact tgatagctac tataaagaga ctctggtaat taaagattca tggtcagaat taaagaaaac caggtgttct tcagtcctta attcaacatt tctatcatga cttacaaagt tat tt aagaa actattttaa tattttattt tagaattcaa tacaaaatga tagttatttc aatcagttat ctgaaagttt tttgtcttgt taaatcaatt acaaccccac tccatgttac atggaacaca tatactcttt aatccatggc tcagtgatat ccttcccttt caatgtgtca gactggctgt gtctcaggtg ggaaaaacag ttcgtgctcc aaaaaaaata gaggcaagtg agtttgtctg tagcagtgca catttaatag ctatcctaag aattatttct gcaaaacgct ctctctgatg ttatatctcc actcaatgat aactgccagc tgttgttgga tcttcttgtc accctgagcc catctagagg ttcccagctt aaaggccaca tgcttcaggt atcttcagtt attcctcatt tgctgcagta taaaagatgt ttaaatgt aa gagaggaatt aagtgaagaa ggatttatta aaagtagctg attgatgtga tcaaggaaga gaaaatacag caaaagaagg gaaaatgggc gtcaatttat attaattgtt ctcccttaag aagtttcttt ccattgaagg aatccattga catggttgaa ttatgaagag aaaggtaata aactctttaa aattcaaaat tgcaaaactg cagggacaaa ctacaattta ctcctgcact tcttttttaa tgtgccacat atgcctacct atgactttat cacacacacc tctattgtgt ataaacgccg ctgtagcctg tcttttgaat gttaatttca ttccattgat tgactgaagt cactattcca ttcatattct gtttgcttta aaaatgaatt tgacatcatt gacgggaaaa gaatgaaaga gagaacactg taaaatatcc ttttggaaaa atttgacttc caaacagttt agtaaagggg ttttttttca tttggaaact tggatgagaa ttctatttgc cagtggactg aggcatagag cctttctgct gctgcagcag caagggatga gattccccta ggttaaaaag acataagaag aacgaggtgc gaacggaaaa ttagtggtgc atgaagggtg aaaataagac tgctctatct gggcaatata acacaaagaa aatgtatacg ctactacaag catagccact gtatcttttc tcactgaagc ccttctcttg aataccactg attaaatgct ctcttcacaa atgaa tctct gagcattatt tcatgatact ctaatgaaga aaacacatat gctttttcca attcatttgc tggaatcgta aaatgagaaa tttcacaata ctcatggcat caacatgagt acgtgttctt cagataggaa catataatgg gtaaatttac aagagaaaag ttcctaaaac tcaatgtaga gaaattaaat tgtgattgat aaatgcagaa t actt tgat g cagtttacaa aaaaaaaaaa gtccttccaa tgcagtgacc gtcctgctat tgcaagataa ttccagacaa aggaaagtgg atccaagaat ttcataaata agaacctaat ttaaaaaaaa gctggcctac caaggatgga ccttcagatc caccagtgga agaaaatcag gggtcaaggg gtgcacctct tgaggtctcc aatcctgcct tagtgacctt agttgtggct ccagggaaag atatctgttg gctaacaaaa gttatttgac atggagctaa ccagcagttg catactcagt ttaagtcttg aataatcaaa caatgatata attggcaaga tgaagtctgg tctgagttca agcacttatg gactataaaa atgttttaag ttagatgctc gctgtaacgc gaaaacaaaa cat at gaat a aatgggtatg atacataaat tggagattgg atttctatgg accactttaa gaagctcagt tttgactgac atcagctttc tttatctccc cactttacag tgggaccctc tgacaattca agattctccg ctaagttttt aaaggaagaa ca aa gtt aa a caggtaaatt tggaaagtac caaaaccaca tatttctgcc agtaagatat aaagaatcca acaaggagct aaaatcagag aaatactaca tgaatatcat agcaatgaca aaggacattg cgtgtggaaa tcattttatt tcctgacaat 18600 18660 18720 18780 18840 18900 18960 19020 19080 19140 19200 19260 19320 19380 19440 19500 19560 19620 19680 19740 19800 19860 19920 19980 20040 20100 20160 20220 20280 20340 20400 20460 20520 20580 20640 20700 20760 20820 20880 20940 21000 21060 21120 21180 21240 21300 21360 21420 21480 21540 21600 21660 21720 21780 21840 21900 21960 22020 22080 22140 22200 22260 22320 W0005851 0 [http:/tww.getthepatent.com/Login.dog/Sexam.supportJFetch/Default.doqNVO00585 1 .cpc?fromCache= 1 part=maintoolbar--bottomi Page 415 of 737 WO 00/58510 PCTIiBOO/00435 tgcatgagat cgcgttagcc ggtttagaca atggatgaac ttctctgcca caacactttt tgatctctaa taaacttaaa gaatttatat tttaggaatc ggtctctcta aaatcagatt ggaagttttt gtattctcat gaaaattcct aacattctta ttgtattgtt ccagagcttt atagaagcct ggtgtgcaca acacattaca attacagata tagtgctatc tgtgaaaaca ttcgtgttat tctgttaaag ctgatgctat ccctcaattt tgtataactt aaaaaacaac ttaatgagta ttaaaaatat ataatatgac ataaataaat gttaaagata ttatttcaat gcacttctag agctgtggcg aggcgggcgg gtctctacta tactccggag ccagatggcg ccaaaaaaac ttgggcactc tccgattttc attgtacctt attcattgca tattatgaaa ttatgaacta atcgaaatat accctcccaa ctggtggagg ccttcacatt aaaagtaytt tcccaaagga ggccgctgcc aagacaaacc gtaagtgtca gcaaatacct tcccgaggta tcttggtttt taggaatgat acactttatc gttggtcttc cttttctgtt attgaccagc cctgagagga ttatggactt attaattgct tttcttgaga tactgtatat aaggccatcc ccacagaccc gtttttattt tacgatctaa agtttcttat tataaattaa gaaataagta ttaagagttt aaatgaagcc gctcctccaa aaaacatttt aataaatact tattaatgct caatctcaaa aaaaccatac ggattatatt.

tcatgttaaa aaaattgttc attttaacct tagtaaaaaa acttattagt agaaatgagt caaatactca tttaatgtat aatgatatat aaataaaaat aggcttggga taaactagtt cttctctttt aggccgggcg ctcacgaggt aaaatacgaa gctgaggcag ccactgccct aaaaaaaaaa tttacttcct t t tgat t tgt tgtctgtcaa aaaacttgat taaatttagt aaaagaaaat ttaaaaacat tttgctgata acaacacccc ttaatcatta tacaatgtat ttgttatatt tctgtctctc tgtgtaaact taatctgttc ttgtctttca tatttctgga caatgcttaa tttaatatca aaccaaagtc agtgttgcca agataatttt aaactatttt gacaggaaaa ataacataat tcttttttta aagtctgtct tcatatttaa tctgaatcca atcagtaatc attcttgtag gttgagttaa atatggcaat gtacatttct tcaaaatgca tctttattga aatgaaattg attctgtcgt aaaactacat ctgtcacaca tcttctagga gcttgtcata catcaggtta cctactattg tgttaatctg aaatagcttc acagcttaca gaaccctact cttaactttg actcatgata ttcagctctc ttatttgtga gagacacaat aacataacct actttgccag gctttcagtt caaaatgagt cggtggctca caggagatcg aaattagccg gagaatggcg ccagcctggg acaaaagctg tgactctact gctattgttt aatttagaaa atcctaagct aagatctatc tctcattgaa gttggcaatg tgggccctgc tgtttctccg gcttatcttc tgcatttact tttctatttt ctgccttccc gaagcaccac ccccttgyac ccaagaaatg tttgatttac agtcccaa at attcccgaga accttcacaa gttaactgag attattcgca tttttgaaaa cagcacctaa aaacatttag caaatttgat tactttaata atctgagatt tattcaatta aggcaagtac tattagcaga atctcagaga attttgtaag cccttaagct agattgtaaa taagttatac atcaagggtt gttagaattt aatccgtttt aacatgcaca cagagattaa.

tttctacaag aagaagtggg cctggtgaca ttaatttaaa tccctaaagt aacaaatttg tttataactt ggagagaaga aatagtatat aaagtaactc gttacacaaa ttattttaag aagtatacct cacagt gtgg taaaaagtag tcaggccttc cgtctgtaat agatcatcct ggcqcggtgg tgaacccggg gaacagagag cagcgaggcc cctgcactct ttcttatagt aatgaaaaat agtgtgtcaa accaatatat ttgtttttta atgagtctat ctggttttgg gacctgagag aaactttttw atgtttgaat agtaagttta cactgaatct aaaactactt tgtagcataa gaaattgttt tgaattcaaa aacttttctt ggtgtagaag gcatcctcag aaactatgtt attctctttg tgaccacaaa aaatagtaga ttggttcact tttattattt aaatgacata attgggacat aactaaaaaa ttaacagcca tgatttctat atcaaactcc a tat t ttcat ttttaaaaaa atacgttttg ttctatgttt aggttttaga t atttt t tga taaaattaca cagagcataa taagtagtag gtaaatatat taaatattat tagtactcaa ttaaatcaaa tttctttagt ggtcttttaa acattaaaca ggtttaagta gcacctaaaa tcccaactga tccattagtt aatatttata tagaaaaact gtatcatagt atgattttac ccatcctgac cccagcactt ggctaacatg cgggcacctg aggcggagct agactccgtc gtttctgaag gagactgacc taagggaaat agaccaaagg aagtgtacaa aagaaatagg atcaaattaa aaagcaattt gggccttgaa tttttctttt aagaatgatc aaaacattat ttgaagacaa ccagcccaca ttatgaaagc actttatcga ggtgtaattg gttgaatgat aaaatcagag tagctactgt gatgaagact aataatcagc atgggtatta catgttaaaa agga tat tat tttttagtat tgatacctac cagtgcattt aatgatataa ggatgtccga tcctatcatt aatgttgatc at tgtggaat aactaacaaa aatgatttta ataaatcaga ataaaatatg atatttctgt ctacaggagg catgtaaaat acacatgtac agaaaaaaga atctcagtga cagaatttaa cacatttttt ttaaataaaa tcaaaagatt aacttccatt ttggaaataa cgtattttaa tatactaaaa ataaacacgt taatatttag taataaataa atggggaaat gtaggtattc atacaagttt accttgaaaa tgggaggctg gtgaaacccc tggtcccagc tgcagtgagc tcaaaaaaaa atggcgggta gtataacatt gtgaaatatt tgggagtata tttcgagcat atacaaagtt atgaagctac agtgggtata tctgcaatcc aatctaattt ttaacaaatt tttgccacta acaggcct tg ttcacaaacr agamtggaag actcactgca tgccttacct tcaccaaact ctgccaaagt gctatttctc tcaataactc 22380 22440 22500 22560 22620 22680 22740 22800 22860 22920 22980 23040 23100 23160 23220 23280 23340 23400 23460 23520 23580 23640 23700 23760 23820 23880 23940 24000.

24060 24120 24180 24240 24300 24360 24420 24480 24540 24600 24660 24720 24780 24840 24900 24960 25020 25080 25140 25200 25260 25320 25380 25440 25500 25560 25620 25680 25740 25800 25860 25920 25980 26040 26100 W0005851 0 [httpflwwwgqetthepatent.comLogin.dog/Sexam.suppDort/Fetch/efautdoqNO00585 1 0cpc?fromCar-he= 1part=maintoolbar-boftoml Page 416 of 737 WO 00/58510 PCT(1BO0100435 ttaggctgtc tttgaatcaa tgtagtactt tggtccttcc tcagacaact tctgctcaga ctcagtgtca ggcagatctc ggtcttatac ttccagatca ggacagctgt cttgtgagga gatgtcattg gaaaaccaga caatactctg agagaaaacc gccacaaaaa cccaccattc gaacactaca caaatggaag ctcaccctct ctccttgaat cctggaggtt tgtgaccagc taaacacagg ctagtcccga ttt tat taca tgacaccact ctcgtcctac tcttgaagca gcttctgact gcaactggtt tatttatatt agacaacact gaatgtcagc ccagtcagaa agatcaaata gtgttgttct actttggagg ttgggcctcc tggtattact taaaataaca aaatcctgct ccatttcctg tcaaacaggc ttaaactaac aagcaactac attggtcttc ataaagaact tct gca ggc t aggctaaggg aagggggaag caagaataac cccgacacat taacatattc cawttcctac gacctttgtt tggggaggct atagtcagac tgtagaatca ttttcaacta ttctggggag agtctatgaa catttctcta ttgatccatg ttcattttta cccaggacag ttgtccatgt ccagtgcacg taaaaaggag tctgattctg ttttagagcc acggccaaat ttgctgtaat tctactaaag gtttatacgt cttctctaaa acaccatctg ccacgggatg gagtgccagc ccacccctcc cttactgatt tggtgcacag ctgggggcac ctcttttngc agggggtata cctatcctga tgtagtagaa gggttttggt ccactgctgt ctccgctgcc tttccctttc cctctcactt cttcctgctt taaatgataa gctaagaaat agtcaggcct ttgagctatt gcagtctact aggcaactgt ataaaagcct tgcccaattc atttactttc gtcttttttt taagaattaa aaaataatt t acagtatctc caaggatgcc catatgggca taagaccaga taaaaatcc acctgagact taacaggaag gaagcaagca tgccacacat aagggagaag ggggattaca taagacgagg attcaactga actgcctttg ttgaggygtt ttgattaaat aattstccaa tctatacagc tcagtgagaa attaagggta atgcacattt ttttgcccac aaaacaatta tgtgtccagg ccctttgcag ctgaagctaa attccattat tattttaaat aaaagagaac agttacgtgg atgggaatag aatacccata gtatcctgat agctcttgta tgtggacagc agggcccaat cttcctggtc aaatgtgaca ttttnnggtt gacgggctgg caccctccca tcacgagttt gctgaagatt agctatacag aggggcttat agttctgtgc ccatactggt ctgtcacttc atgagcacaa tggagacttt tgtctccttg tttgatatac gtgctaaaaa cataagtgac tcttgtaaat cacttataat ataactgaaa cctctttctg atgaattgct agataacagt tttttttttt cccaaaatgt ccagaatttc cactagtaat cataaggttt tctttgagtt gaataaactt tatgattttc gagtaattta catgacttag catcttacca tttcaaacca tctgcctcca gttcgagatg aaactgacca atcctttaaa atcctgagac tactycacac gagaattatt ttatatccta agtttcataa tcagatacat agatttgctt gtggttgtca cagaacaaca ctagaatccc tggactgccc aggccctggg tgagtcattt ttctctttca tgatttttga gttcacatca gcttgaacaa gaatgtcatc aaagtctttt tccactcctt ttattatttt agttcaattg gccacaagat tcctgccagg actttttaga tnnattatga gtatggggta gcacatccat ttataaccca tccaacgcct agggccgcac tatgaataac caagaacagg taccagcatt cctgaacagt gaagtagtca aataccacaa gagatatatt agatatatgc gtggagacaa ctcaacct tg gcctgtat tc cctataactg ccaaccaaat tttcctcagt tgctcaaata aattatttgc tacaatttaa gcattcctat actgaaagga aaaaataata gacctgatat tattctgtag atgactagga ttttctgtat tgaagaatag gggtctcagg tggcagagca ccagatctct tgattcaatc agatttgggt caagaaactt ttgactgagg cttctgagcc ataatgtcaa ttcaaatatg ataaaaagga aacattagga ttcttaaatg caaatcttaa gaaaattttt gaaaccaaat ctgagtcttc ttccaaccct cagagattcc tatatggact aatacagccc atttaaattg actggagatt ctgtcccagt tccccctgcc aaaaaggtta ccatatcatt ttttttttcc gattctaact tgcccccata cccactacaa acaactcata aggacagttc ggggaatgac gtgtttngcc atctctaata aatcaccatt cctaggttac agaaggcact ggaaaaagat ttctttggtc tctcttggtg agcggtgaac cctgcttgtt agtgagagaa attctccaag ggcctgaaga tttgatttgc aaaacagaac gggggacttt gctttctctg aaagctcctg aactattctt atgcctatgg gttctaactc caagtcagat cacctagtca ttgaaagaaa ttacatagtt ttcttaatca gttttcaaaa tagttcattt aggtttaatt aaacttacaa ggagacagag tgagaactca acctcccacc ggggacacag tctccagcag cacatcctgt aggtacttgg acgtgtttta atactaagta agacagattc aatttagtaa tttcatttca gaagaaagca tttatattga gtattctttt ttttgttctg ctcctctctt cgccgggagg tggtgatgat tagctgctga agagatttca agggttaatg tggcctcctg ttacaggact gagaacagaa gtctcttcgt aaacaccaac aaccagagtt tcacatgcca acacagggtt gaactcagga aggaccagtn tgggagcgtc agcttggaag ccctcctttc tggtctttgt ctcagtggca cccat ttot g gaagtacaat tctcctcaaa attttctctc cctttatcgt ttccttccat gtaaaatgtt gcacagaatg atccctgagc aaacataagt ttaagcttaa ccgaaggflat atttacttct aaccagttct ttaaaattta aaggaaacat tacagaattg aatcacccag tttcttttgc attcttaatc gcagaagaat atgaattatt gaaatctttg tcacactgct gactcacagt tcatgccaga cgagtgaaca ctcactatca aggccccttt agccaaacca atttcacctg accaaggaga gtgcttttcc taatagtggg aggtcttgag ttagtggacc accttattac tcaagagcag ctttgatata 26160 26220 26280 26340 26400 26460 26520 26580 26640 26700 26760 26820 26880 26940 27000 27060 27120 27180 27240 27300 27360 27420 27480 27540 27600 27660 27720 27780 27840 27900 27960 28020 28080 28140 28200 28260 28320 28380 28440 28500 28560 28620 28680 28740 28800 28860 28920 28980 29040 29100 29160 29220 29280 29340 29400 29460 29520 29580 29640 29700 29760 29820 29880 W0005851 0[ ttp:lhww~q etthe patent. com/L gin.do /exam.suprortFetchDefautdogVVO005 8 51 0.gpc?fromCache= 1 part=maintoolba r--bottom] Page 4 1 7of 737 WO 00/58510 PCT/EBOO0435 tatcttttaa cttatgtagt .ct Cagtggct aggtcaggag caaaaattag caggagaatt actccagcct aaataaataa ctgagagttg aagtataaaa ttactgaaga aactacctgt tgtcagaatg gtttggcaat ttctggacct ataaatgaaa atttggagat actgtgatca ggagcatgct tcaaggagag cccctagaac attatggcag tagctgagga ggtaatttaa cttaaggtga ttttcttaat ttgggcactt caaaatgaca tagctctttc acacagaaaa ttacacaaaa aagggaacaa tgttttagat ctatactctt ttcctcgaaa gtctcaatca aattaagaac tggtggccgt tgatatagat gtatgtaaac agttactttg taagtaacct tattgacaga cacattgtgc tgcagtttga attatattta ttatataatt taaaggtttt aaaaatgtat aatgtacaac tagtgtatgt atatctat~c tctagtgtat tatatgtaca gaacatttat ttagagaact atgcaaaaat ttctcaattg tacgtcatct aaagccaaat agcaacaaaa gttaaatatc taagcaattc aactaaaaac tcattcctgt cacacctgta ttcaagacca ccaggcatgg gcttgaacct gggcaacaga ataaataaat gttaagtaat agttaaagtt caaactgtgg agatgacaaa gagaagaggg gtttctcctg tcccatgaat ttgtgtcctt aagggctttg taagaacccc tacaagaaaa agaccttaca tgtgagaaaa ccaaagagac tctttcccaa gaaatatagt aagaataaat ttaggataca atttaggata tcaaaatatt caaagctaga attattcaag gattaaaaaa gcacatcaaa taatatgtta tcatattctg gacaaaaata cccatttgat ggatgtcata gtcatccatC gtatcccaag ttaaatttat ttttctaaga aaggaagtta aaaggtttat agaaataatg ctcttatcat gtgtggcttt tgcctaataa ataagaacat atgttgggtt tt gat gt tgt atctattaca acttagcaaa ttaaagtatt tttatcttta atccactaac cacagcctga ccaatggctg atttgagctc tttattcaac tcctaattgc caaaatatat tat tgccatt aggaggtcca aacattgatg tctcaggaac atcccagcac gcctgaccaa tggcaggtgc gggaggcgga gtgagactcc acagtgtcct atcaccttag gctggtacaa tgtgaatctt gactgaatgg gaattctcta tgctgggaat tatataattt gaagttcata tggaggtaat aatatgactg ggcaatgtga agaaacctac taggtttatg taatacaata tttaataatg gcacatcaca ttttatgaaa atcttagaaa agatcatgga ttaaagtaaa aaatgtttta tgggataCag tgacttttca aacagagtga ttaacaaaga gaaagatctg tacacacttg taagcttatt cagtatttac ctttacatct agatagtctt atttagtagt attctccaat gaaactaagt cataataata ttagttttta catgagaaaa atcagaaaaa tggaattaga ttttaatgtt gatgcaaaac gacatacata taccatggtt ttttaagtat agt ttat t tt aaagccaatt tgaggtcaag tatcttccac agatctcaaa acaa g taaa a agacagtaga ttcctccagt agttagtagg tgataccctc tttcttcagc gtattctaca cctgctttta t ttgggaggc tatggtgaaa ctgtagtccc ggttgcagtg atctcaaatt ggaaagcctg caggtgatat acatttccac acatcagtat ctgtggccaa tggggtgtag ta tca tgt ac ctaaaatatt catcaaattc gaagtttgaa gtgtccttat ggacatagtg ct tgCCagca ttgttcaagc atatttttct cttgctatgc aaacataatt tctcaaaaga gccaaaatct tacctaaaaa cttagaagtt tttttagtaa aatctctatc cattgtaggc aatttgccaa caaaattcaa tcacttttct tgtttccctg tcatagaaaa tgtattacca gcttgccatg ctggacagca caaggactca tttaagggta taaagctgtc atttaattta tgatcgatag gcaaccaaaa acatatagac taaacttgga ttccaacttt agcaatt act tacactgtga atctttgtgt acaatacact tctttttttt agaatagtac acctttcaca ttcagccacg gagaagttca caaaatagac cctacagaga ggaaaataag aaacaaagtt tctgggaggc cccacagttt atacttgcat agaggaaggt cgaggcgggc ccccatctct agctactcrg agccaagatc aagtaagtaa actcggtaga tacataagag aaggctctaa ccaacatcag tttattataa taggcaacaa agccagagta tatattaata ctaaccacga tgagatcgta aagaagaggg agaaggtggc ccgtggtctt cacccagaca gtttaaattt agctctcacc atttgtagca gatgtagaca aaataattgt acagtggttg tccacaatta tcaaagatat acctattatc aagtcacgca aatataaaat tttctaagtt aaaatacaaa actctattat aactgggtta aaggtcacag gcaaaaataa tataaaaata actgttatac tttaacatta acactgcaac atgcaatttt accactataa tagagtgaat tttttaataa atttaaaaat attggtttat tttacacaaa cgtgacaatc gtttgtggtg attaaagatg gaatttggaa ctctttaatt attacagagt agtcaagaat gtttcccaat aataagaata tcatcgaat t ccatcagcta aaagaaacag aggaaaattg acctgactct tttcctctca cttggccagg agatcacctg actaaaaata gaggctgaga acaccactgc ataaataaat tggttaccct accattctgg gagccctctt agtaacgaga taaccagtga ttccataaga ctggcaaatc atttatatta ataggactct agggcagggt agagacacaa catctgcaaa ggatttccag gtgttatttt tatctagcaa atagtgtcga tcactctttt tttgattcat tggtggagat gt ta at tcat taaatattct atgaaagtaa agaattttga tcattaaacc attttagttt ttgtttttca actaattctt ccttagtaga atgggggaat gaaacacacc atatactcat acaagcacaa attcattaga gtcaaggtct acatagttac tcatatttta attcagaaat tgtaggtcaa atgaaattat gcttctgaac aat 'taacata ccaaatattt acaaacaact aaaactctta atatttttaa aaattggatt aaagagatag cacaaacgtg acacacaaag gtgcataaaa ataagccgat ggcagatcat tgtcttactc agtgaacaag ttcatgggct aagttgatga 29940 30000 30060 30120 30180 30240 30300 30360 30420 30480 30540 30600 30660 30720 30780 30840 30900 30960 31020 31080 31140 31200 31260 31320 31380 31440 31500 31560 31620 31680 31740 31800 31860 31920 31980 32040 32100 32160 32220 32280 32340 32400 32460 32520 32580 32640 32700 32760 32820 32880 32940 33000 33060 33120 33180 33240 33300 33360 33420 33480 33540 33600 33660 W0005851 0 [httDpltww.getthepatent.comILogin.dog/Sexam.supor/FetchDefaut.dgNVO00 585 1 0.cpc?fromCactie= 1 part=maintoolbar--boftoml Page 418 of 737 WO 00/58510 PCT/BOO/00435 actagacatt taaaatcaca cagtttaacg ttttcaacca atctggatgt tttccaaatc tgttgaatta ttcacctgcc tacctgtatc ttcatctgga actacctcaa tatgataatg aaacaaaaca caccattttt caaaccttat ctctcaggat agttacccta ctcagccttc gtataattta tgctgcctgg ttttccttga cat tgt aat c gaggcaggtg cgcctttact tactcgggtg tgagctgaga aaaaaaaaaa cactgcacag ctgaatatta gagtgaatgt atactagata aaaaaagtat gaaagttgta accagctgtg gtctgctcaa aattactgaa ccaatgacag catttaaaag gttcaactac gtgcaaaaca taacttcctg attgggagac ggaggggaaa ggggaaggga accataccag taactttgcc gaaatgagca tttgagggca acttctcatg aattagaaaa tctcatttgt t tgaacccag tgcagtcatt ttaattgcaa ctccacattc atcaattaaa ggccatagca cttctatctc tagtttttga aacaaagtcc gcaaataaat atacactgac aaaaatctaa ttggcagata attctcatgg aaagaaccag agaactcccc tttaaaggcc tctttccttc tttacaccag attacatgtt tgcttctaac ccatatcact gcatcttctt tattctacta ctatgaagcc gtgatagaga aacacttcat agagacccaa acttcctctc cttaatttct tttatttatt ttcaaaccta ctgttcaggc ttggccaggt tatcacgagg aaaactatga gctgagacag tcacatcatt aaaaaattgt ttaatttcaa tgtagttgac aggacttgct attagttcca taaataataa gtagtttagc tgagcacagt gaaaaaaaac ttaatgcatt tttcctgcag tcatcagctg tcataacaga ttcaggggtg cagtggtttt tttgatgtac tgaaggtttt aaaaagtttg ttaattaggg gtaattgtta ttattttctt agtaccaatt tttgaactgt gagagaggaa taaaataaaa ccgcctctag gcctttttgt ggacaacttt ttgccaagga catacagttg atttagtaac accactctgt aataggaaaa aaaatatgta aaaaattatt tgaatattta ttattttgtt atctacctct aaatatcaaa taagatgttg actgacacca tctcaattca tcttggggtg aaatctaaga tattaccaaa ttaaccacgt tagactaaac atccctccag ttagaaatc ccattgatct ctcaaacact ctctcttagg gccctctatc ttcaatattg tcataggttt tatttttact tgattatcca aagaccaagt gtggtggctc tcaggagttc aaattagcca aagaattgct gcactccagc aatcttacat gagggcaggg atatattaaa gtcatataac aattttatgt agagagttaa ctctgaatca tatatattta aggaatgaga ca a agaatt c tatcttggat cttttgctgt aaatgttact agcatttggg agcaccttca gtatcactgc tgcctccaca gtccatcata ggagatgagt ctaatacacc ttaatacaag cagagctgct gtaagcaagt gatatttcct agaggtaata aaaaaaacac tagctctagt tgaaatctat attgctttat tataaggata taccacgtta tatatgaagc tatgaaggac ttatgaaagt tgctcaatat tgactatgta ccttttctta aaacccatta taaacatatg aaatcagttc accctatcaa ctgtgtccaa ttcactactt ctaataaatg ctctgttgat tcatccatac cattagccat ttttgtccat gtaatgattt taggataggg gtgatcctcc ataaagacca tggagtacaa tcatgaacca ctcaacttct ttcaatattt agtttatctc tatacccctc acgcctgtaa cagaccagcc ggcacggtgg tgaatctggg ctgggcgaca tgaattttgt ccatgtctaa taattttaat atatttctaa atatacgtta tgtgtcatat gatggggtta cagatcactg atattacctt tttcagtact attattcacg ctccatgttt gtagtggctt gagaataaca ggcgggaaag ccagaagcaa at ctct ata g tatcctaggt agatcctcat cttcaaaatc gtcagacctt gtaaagtagg ctttatttat tttctgaagg agctaaagta t ata aaagt g tatctttcaa tattgaatac gaattaaacc gacatatact cagggactgg tatgattctc agactctaga gaattatcat agatactcct tgagcagaat ataaatgtcc acacataaca tcaaatgtta tcagaaattt aaattgccat aaaggaattc ctggcaatga atactttatc tttactttct catgacacca atgtttttct atatcagcca cctattgctc acttaaactt ctcctcttat aaatctatga ggctctctta ggattcccct catcactgca ttctcttaaa atttttattt tcctgatagc tcccagcact tggccaatgt ctcatgcctg aggcagaggt gagcgtgact ggttcagttt ttctacttat ttaaataaaa gtctgattct taatgtgatt cacaagaagg taaattaact aaacattttt tcacacaggg gttcaagcac tggacctata attgcagcat aaacacaaat ccaagaagcc tcaaagaaga tcatttctaa t aga agc aga gtaggtattt ctcttccaag accattttga cagaatgatg cattttcaag tttttgaatc ctgccaagaa agaatacact aagctaagtt gttttattga ctaggacact acttggggaa actttacatg aacttttcac cattcagaat aatatcagaa gtttgactca tatatgcctc aatgagaaaa cgtttcacag ttcccacagg t t taact cat gttggttttt ttgacatttc atgactttct tcccactttg tcactacact aaatatctct ccatcaccat cattggtttc gagtgataga ttgggataaa tcttattctc aataaagacc taccctgctg caatgctgct cactttctgg tcttagaagt tctcctactt tgtcagggcc acttaaaaaa ttgggagacc ggtgaaaccc taatcctagc tgcagtgagt ccgtctcaaa ttttctctac tatattccta tgtatttatt atcttctact agactcccat ccagaagtag tcttttactc ttgaaattca attctttcaa ttcaatatta gagtgttagc ttaggactag aatttatctt agaccctttg gaggagtgac cagtgaaaaa caaggcaata gagggtgatg tataggaagc aaggttttgt aataaactca aagaaggaat ctgaaacagc taaatcctat aaccttattc cagtaatttt taataaaaca catgatgtct ttaaaccact caaaaattta tcctccactt ataactacat tcacttggac atatgttgct aatattttat aaacttacta ttataacact 33720 33780 33840 33900 33960 34020 34080 34140 34200 34260 34320 34380 34440 34500 34560 34620 34680 34740 34800 34860 34920 34980 35040 35100 35160 35220 35280 35340 35400 35460 35520 35580 35640 35700 35760 35820 35880 35940 36000 36060 36120 36180 36240 36300 36360 36420 36480 36540 36600 36660 36720 36780 36840 36900 36960 37020 37080 37140 37200 37260 37320 37380 37440 W0005851 0 [qqJ/www. getthe patentcomLogin.dog/SexamsuportFetch/Default.dogNOOO585 1 o.cpc?rom~ar-he=l1 art~maintaoobar--bottomI Page 419 of 737 WO 00/58510 PCTIBOOIOO435 ttctggattt aaattaacaa atatattata tatatcccgt tcattattaa atatatatac tccaggatac gtttcttagg attttgtaaa ttagggcttg agggtttata ggtagtattt ttttagctat tcttttttat tgtgtgcttt tcaagatgct tccaaggttt attttacagc ttactgattg catgggtatg atccatgtct atggatatac atttgggaca ggatataaat ataatgctac attttgagtt ttattttcat tataagtaat ttttattctt cacatctatt tcctgggtca acatacattt tttatttatt aaaactattc atttctgtac tagttcccat gtgaggtttt tataaggggc atgccttttt ttgaacatct accgatgata atatcatgct tcttttgact atttgtatga tttttgtggt tatgtcttct catcaatgtt tgagtatatc caaatctttg gtaaccttgc tgaggtggtg tttcactttg ataggagata tttgctattc gtagaatcca gtacctttgt taagtaattt caccaggaaa cacacagcac actaagactc ataaggagga gcctgtggta cattttcagg ttatttttat aaaaacacac tatacacaca cccctcccct atatgtaaca acatgtaaaa cacagaactt attttcttat atgttccttt tggggatgga ctattgacat gtcaggattc atcaataaga ttttgctcaa tgatgttatt ccaggcttat tgacaaactc ccgagaacag cttactggct tagcttttac ttgtgtatgt catggtttat attataaata gttcaaataa atttttcctt ctgatcagca tatgttgttt t tat taga ta tgaacaattt tgtttaattg gacagatttt gtgatccatt tatttatttt tctttttctt aataatcata gattcccacg ccctatactg acctctttca ccttccacca ttttctttgt tctgtctttt atcttgatta ttcttcttat aat t taga at tacattgaat aatgcataaa ttatagtttt atttattgga tctttcatgt tgtattcact ctttatcqta tcctgctttt aaactgaaag atatgtgttt cagataaaca atgtacccca tacacctgct aacttcctag agtagagaat aggcacgcac aaaaaaccag tttctcttcc caaagcttta tctgacttta agagattaca cacacatata agaaatcact aatatatatt aaatatatat tcactaatct ttttgatgac cttgtaattt ctgtcacaga gacttaaaac tccactgtaa actcatggac attgttccag gcagcttggt cttgtatatt atagtgtcat ccctgtgatt ctaaagtttt agactgactt t gat agccca ttgttcattc aagttgccac gttagttaaa gttaagaaac gtggatgaaa tctttttggt tgtgttttgc attttataaa attgtgctat ctattatgtt ttgatttaat tgtatgtgga tcaaqctttt tgatgtggct tgttgtggga tcctgtggta ctcggttccc ggattgtggg a ga t tgccca c tgt tctgt t ctgtagcttt tcttttttac cagtttgttt ctacagatta catgaaatat caacatacaa tgctattgta atgagaaagc tattattcca taacttctat ccttgtaaga tccacacatt tttaaatgtt caattagcaa caaaaaatag ttctcttttt caacctctga tgaaaaattt atacacatac cattacaaga atttgaccag ggaagcacat taaaataaac gaatgctcca tttaaatacg gaattgttta atatatttat atattttgcc tgtctctttg cttcacagtt ttctgatttt ggtaaaatac tattgatgtt a gt taat ttt atttctcttg ctttggtcat ctgtttagca accttatgta gtattcacca cacccagtca gctctttaca ccttcattta tttttaaatc acctattgaa atgtataaat cacctggtag tgacaaattg gttcccatta gagttttaaa aaatatctcc acataagttt tggtgttatg tttgtctaga tttgigtaag tgttcaatta tgaccctttt gtgtcccaac gggaccctgt gtgaataagt attttctctt cctccccagc gtttctatca ccattgatct gcagtaaatc tactgtattt ccatctacaa ggttgaagga tgctccattt atcctgtgca aattataagg catggacttt cctaagcgga tctctgatgc acaggaataa ctgattttaa tatgcttgag atgtaagcta atgtcaacaa tttaatgaaa tgtattcctg gagaaaaaga caaagtgatt gtgagacagt aaatggcaaa gat t tcca ca attattttta tatatgttat tatattatat ctggctctaa atacaatgta tgctccagaa ggtgcttctt ttgaggagtg ttaccatgat attctcatca aacactgatc ttccctgttt tactt tgggt cggacacttt ctttcttact gctccaggat ttacagtatc acctttccct gaatatcaca gtaatatgga actgaataat aggcatcttg atgcatgctg tctgattgct tcttctaaag ctccatttca atggctttgt ttttagtctg ttaattttga tttaaaaact aatttcatca gtataaggtc atccagaatc gtcaaagatt ccaaatctca gaaagataat ctcatgagat ttgctgccgc cacgtggaac ggagcacaaa aagtgtttat atgaaggcta gtttttccag aatagcttgc aattgacatc attgagatct tattttgtta ttttttttac t tat attg cc tctcagctgc atccaataaa tgaagtccaa aaaatcttct gtttgaattg taattcttac tttggaggct cccagttgca catctagagt gtcagttgtt agcaccttag ggcaggttac ttctgttgaa tagaatctgg gaatagtttt acatatatat atatatttta agttttgctc tataaaataa ttccattcca ggctataaca ctggtcagat tagactggac cagcatatca acctggttga ctatattgta tataatccaa aagtagctgc ttctaaaatg taaccatttc atacagaata cccttagaaa taaatgaact tttaagattc atttcatcac attgtttcca ct t tt tgtgt ggattatatg cagttgtgcc ttgtcaacaa atattttata tggattgtct taaagtccaa catcaccaaa t t tgtat t tt tttttctaag atttgttgaa aaatgatggt tcttgaattg tgaatcatgg ctgatggttt catgtgggac tgtgagtcca ataaactaat tgattggcta ataggacaag gtcttgtgcc cacgattttc tcaacaatgt ttgatttttt gatttatatt* attttaattc ctgatatcct atctgctgga' at tca ttga t gctttcacac attcttttgt tttatgtaat agttttaaag actttttatt gttctttgaa agaaacacag ggccacattg ttgagctcaa tactagccct aagaatggcc cctttgtcag 37500 37560 37620 37680 37740 37800 37860 37920 37980 38040 38100 38160 38220 38280 38340 38400 38460 38520 38580 38640 38700 38760 38820 38880 38940 39000 39060 39120 39180 39240 39300 39360 39420 39480 39540 39600 39660 39720 39780 39840 39900 39960 40020 40080 40140 40200 40260 40320 40380 40440 40500 40560 40620 40680 40740 40800 40860 40920 40980 41040 41100 41160 41220 W0005851 0 fhtp:/wwgettheatentcomLoin.dogSexam.supprtFetchDefault.dog/WOOSB8l0.cpc?fromCache=1 part~ma intoolbar--bottom] Page 420 of 737 WO 00/58510 PCT/T1B00100435 acatggtatg taaaacctgc tttgctgcct gggggacatg agtttaataa attaaacata acctttgata ataatcatct tttaacaatt tagagtgatt tgctatataa ggatttcgtt gtcatgctgg cctcccat ta gcagcaatat aaattactct gctgtgttag gtaagtattt gacggttctg ccacctgtag attggcagaa actttcccca ttgacctggt gtcactaagg aatgatataa gttaaacctc gaattattgg ttgcatcagt aatgcatgtt caccctcctc agattttgtt ttaattatta ataatgaatc gaggctggtg cccgtttcta gcaactcagg agctgacatt taataataat tcagaattat gtgtttttgt gcttctgcag gtccttggta aataagatca ttattttcaa tacttttcat aatcagaaaa tattaactaa agtatataat gttaataata tctttcttct caatctgtgc cgcttggtct atgactaaat tttccactat cctttttttt ctcggctcac agtagctggg acgagatttc ctcggccttc ttt t ttat gt aagtgatttt atggaaatac tttgcctgca ggactgtaaa aagccatgcg ttgcttccat aataagtgtg ttgatttcta gctataatta atattcatgt ttttttggac atatagcaat ggactatcgc ataaagtatg gcacgtgaga ggatgtgagc ctgagagtgc aatgaactgg gaatcttgga ttaactattg gttatctctt gcttgggatc gtatgacagt gatatccact gaatgggaga cttagacgtc gtggtcatac aaaaaagggt gctgaacatc ggctgttcag gtaaagttga gaggaaatct tcaaaaaaga gtaatcattg attaaattat aggtgcagtg gatctcctga ctaaaaatat aggctgagac gcaccactac aatttgttaa ttatcttatt ttgttttccc cagcgcagtt ccttctgcct aagcacaaaa ataaatt tag ccagattcac ccaacattca tagtatcatt attaaataca ttaactaatt ggttccacga cagtccctca gttattgtgt tgaggttatg atgatagcat tttaagacgg tttaacctct attacaagca accacgttgg caaagtgctg tttgtttgtt tttttaaatt tctgtttttc gtgactactt aatgacttat ttgttctctt ttttggactt tgtgcacatg taattattaa ttaaatatta gtgcaaaata aaacaaagaa acagtggcta aggtataaac ttctaaaaca atttctctgc cctgaagcag tgattacaaa tttatagttt tcaaagaatc ctgtgtaaca acagatttga tttcatgagg ggctgcagca c ct cact ggc tacaagaaag acaagtcacc t tcagagcaa gtattttcat agtcttctcc taagatgatg ttgaatgtaa tgtttagtga agcatgcaaa agaataataa tatttaatta gttcacgcct cgtcaggagt aaaaattagc aggagaatcg actccagtct tgaaaaatgt atttttggtg atatgacaag ctgtgagcca gctccccttg aaaaaagttt acttttggaa ttaaggataa ctatgagcca atttacttat gcaatgtagg tacaggcctt ttcacaatgc ctcttttctt atagaatgcc cagtttttca gtgatgtatg agtctcgctc acctcccagg tgcgccacca ccagaatggt ggattatagg tgtttgtttt tataacttgt atcatacact atgtagtgtt tccaagatga attgaagttt gagagagaag cgcacctgtg atatagcttt attattttat tattcttctg aacatataga actatagcta cctagcaggg cttgcatgat ctgttcttcc tgacaggaaa gctacaatta ttcaagaaga cgggttccaa aattatccca tgggtcaagc ttacagtgat tcggcatccg agcttgactg agagggtgag atttatacac gaaaactagc accaccatgg acaaatgaaa catctgacat tgtcagtgat cttccaagtt tctttgactg tttaattatt tatataaata gtaatcctaa tcgagaccag caagcatggt cttgaaaccc gggcaacaaa taatttccaa gattgcctaa aggctggaga tggcccctct cagcactgat gctgaatatg aaactgtaaa cgtcttttat attggtatta ccacaataca atagtaatga attaaaatat atttatgtgt gtcttttgcg cctcagtttg aaactgcggc agatgtaaac tgtccccagg ttcaagcgat cccccagcta ctggatctct catgagccac gatttctatg aagtgtcttc tgcccactaa taatgtgatg gaacacatgg ggtagagctt tgttaaagct aggcatcaag tggatatgtc actaattgat atgtttagaa tcctggtaac caaacaggat ctctaattaa ataaaatctt ttattccacg tattaaccac tatctgcaaa catgtggatt aagcatctgt tccagccttt agacttagtg atttgggaat gatgccagtc aggtatctta gcctcacttt aaggaaacca attcagttta ctcccttgta tggccatatg ataacaatat attttgtaaa gttttgtcat aggcagacac ttaaagtata tatatataat tataattatt tcccagcact cctggccaac ggtgcatgcc aggaagcgga gcaagactcc agaatgatag atatacagac ctggcaggca gtttctgggt ccttcattcc ccctgtttta gatagtagaa aatcatggta gttacgctat atgatgtaat tagtactact tttcagtttt catgtcacca aacttgaaac ggttagtctg agatgtgatg acggatcatt ccagagttca tctcctgcct atttttgcat caacctcgtg catgctcagt ttgtctgtca tgggaagata ttttagcatc atttctgtag gttccagaca acgtctgcag aaaataataa agctataatt aaaatcctat tgctctgttc taatataaaa ttacctgttc tttatttata aatactgcat taaatgttat atggcaaatg attcatgttt agtatagtaa gttaccagta gcttaaaaca ggctaaactg agggcagcag tttatgtggt ttagcagctg taatgccttt ttggaagtga tgaagtgagg agcttcagta ctacctcaaa atgtaagcta agacatcacc tggtactgtg tagcattcaa taattattgt taattattat ttgggaggcc atggtaaaac tgtaatcca ggttgcagtg atctcataaa agtttaaata tttgtttttc ggcagcatga aatcaccctc aggcagatgg ttttaatttc agtttttgta tatttattga aactaattat aacaaaatgt gctagtttta accactaatg ctgttgtctg tcatggagaa atgttttcac atactgtgct gttttctttt gtggcatgat cagccttcca ttttagtagg atccacccac ggatcatttt gatgtctttt t tt t taggct aataatggct ggatatataa 41280 41340 41400 41460 41520 41580 41640 41700 41760 41820 41880 41940 42000 42060 42120 42180 42240 42300 42360 42420 42480 42540 42600 42660 42720 42780 42840 42900 42960 43020 43080 43140 43200 43260 43320 43380 43440 43500 43560 43620 43680 43740 43800 43860 43920 43980 44040 44100 44160 44220 44280 44340 44400 44460 44520 44580 44640 44700 44760 44820 44880 44940 45000 W000 5851 0 [tqp:Itww.g etthe patent. co m/Lo in.d og/Sexa m.suDLporIFetrch/Defa uIt.dociAWO00585 1 0.cpc?fro mCache= 1 part= ma intool ba r--bottom] Page 4 21 of 73 7 WO 00/58510 PCTIBOO/00435 atgagccaat tcattggcaa atgagtagtt aactaaatat aaagcaatac tga tagt tat atggcgtaga aagctgtgat tactagggcc gtaaaaatat gattttctgg agccacaaca agggctgctg acttgaaaga atttattttt atgaaaagtc gaggctatgc cacccctcgg attagcctgt ctcatttgca ccccagtatg gtacatgacc actacagggg agagcaggag t ca aat cat a ttaacaaatt ataaatatat cagtggcttt tcataatttt ctcaggcctt ctgaatatag agtgttatca tagataaata ctgggcactt tgtacaagtg aattgctgga ttccttggct gggtcctgca agacagtaaa tattatataa atattaaaaa ggaagtaata ctgggataaa taaaaaatat act ttgtaga tgaaggatat agagctacgt atcttttgaa cagaaaacta gctgccttta taacattcaa atggatatct ctaaatgtgc taaactttta ttccaattca caactagtat ccttcttgcc ggacatctca cattcactaa ctacatgttg gactgggcgc taggacgatg gggatttctg gagaaaccac attttaaaaa tgaatttctg atttacaaca agccaagttc gtacttttaa catcaataca tctttattta tctgatactt atggcagctg agt gtctgt c aagagtgttt gtgttaattc agtgagtgag ttctttgaac tgtgaatcaa tggaccccgt catggggcaa gtctccttct agagcagatc ggcctctctc actgggaccc tgtgtgtgtg gctttc-acaa ccaaaaggta gtttcctttt acaaaaccta aagttcattc aaacgaaaca ggtaaccatt tggacacatg agtttcatcc atatttcatt gacttgcttc tctgcttgag tcagacagaa ttcccttata aatattatta tcaatccttg atgagaaatc aaaaatccaa gaaatataaa aattaagcct tgtatgacta aattctttgt cagaaagaaa tagcagtgag gcttatacag gcatgagcta gggaaagctt ttgttttttc tccccttgct tggtgacaga tttcaaaaca taggtcattt ccatccttat ccgtaaaaaa cttctctttg ctaagtagtc agtaacttgc taacatgttt ttttgggcat aaaggtttaa agacatcaca gttaagacaa gtcataagga ggaagaacta tatttgcagg aactggaaag tgatcagtca ttcaaaatca attggaagat tccaacaaag tgtgcacaag aaacaaacca tatatggatt ctcagagacc tggtgaagtt tcacaggacc actgtagagg gaagtccaag gcacaatgct tcttgcttgg cagcaagggg tccaaggtgt tgtgtgtgtg tattccagat taaggagtta ttatataaag cataaaattt atgatgttgt tttgttccta attcttcctt cagtgttttc atgttgttgc gcatgtgtgt catgttttaa tccctgtttt actgtatgtt ctatttgcac gggacaggac taaatgttag tgggtttcca atcaagctgt aagaaaactt ttaaaatttt gcttcttttg cttaaatcat tgtgaagaaa acccaattta tgttctgatc aatgtcttta ttaatcagaa acactgctct tagcacggtt cagagaggga atggagagca ttttgaaatt ttctagaggt tattttgtaa ttaaaaattc ggaaactttt tcacggttac ttcccaagaa a tgtt t ttcc attaaatagg tttctagctt t tt gg ttt ca tagtattctt gatatacttg tcgagatctt agatgggaaa agttttactt ccatcacttt aaagttaagg tcaataatcc tttgtcagca atctggatgt aacaccacag tttttttttt ctctctactc cagttctgcc atccccactc aacgccataa ttctgcggct attcatgttc atgaggatgt ggcaggctag tgtttgtgtg ggaagacagt agagaagaga taattttagg accattttca acaaccatcg ttaaacgcta ctgctttcct cctttatgtc gtgtatcagt accgcatatt ctacagtgaa caattttttg taacattttg atgtagcatg gtgacagcaa tctttcactt tcagtgttca tttgtggtat gatcttctga tgaggttcat gaaggtaaaa atagcttaaa gaagaaaagc aagagtttgg cctaacaacc tgtttgaatt tgtctcttca tgaaagagcc tatgtcaaga tgatcattca catcccatca gtattttctg atcaccgtgc gtattcgtat cttatgttta gagacagctt atgatagtta aaataaacct aagcatctgg atttcccttt aattctgaaa tcaggagacc ga tcttct ta caaaattcaa ccaaagaaat ggtacaagtg ct tgt tt taa tttctttaaa agagaaaagg actttaggga tttgagagaa caaaaggtta ccgtttctta gtaggaagtc agtgcgactg ctgagacctc ctaccctctt gccaagggaa cttccttgca ttgtggtcac tgtttgatcg gcaggaatag t gt gtgta gg gaaatccgcc ataggatata tggtaaaata tcatttttca gtactatata acttcccaat gcatttgcct tagcttcttt acttcattca gcttatccat tatgctgcta gggtatataa aagaactgac cagatctcca ccttatggat tttttcactt aacttggaaa ttcagatctg ggttttcttt atatcaatgc aaactcagtt aaatgagcct acaaattaaa gtccagccag catattcttg agagaacagg tcctggcttt tgcggctcta ttttgccctt aaagtagtct ctgctacgaa attaaaaaca atttcgcacc gtacccacag cagcttttca tgcagaacaa tgtaagat gc ccattgcatc tagggacaga aaaattttga ggtaaacgtc caaagaaaaa atatggaagc agagaaaacc ggcagtattg gatgttcatc tgagaagaaa atagtcagac ggtgtataaa ccccaaaata atgactgagc tgtgccgcag aaatagaaaa tagatgagac gtgaggttgc aaggagagag gtggacaatg cgtacacaca gagtgtggag accacaccat tggggctaat cagagaattc taaggaatat aagcctaaat ccttacttgt tacagaaaat gtgtgaaatt cagaacattt cccctgtacc attctagatc cctgtagcac cataatttta tcattagttg tgaacattgt ttaagagtgg aagttatcgt ctgtagccct ct at aca tgt ttgctttcca cttttgtgtc actgaaacca accaaagtaa cactgatttc ctcctacaag tttaaaactg agaacgaaca agcttttcaa aaaaattaac gaaaggtctt tga cct tt cc agaaagaagg gtaaaagcac ctgcttttgt aagttctaac catatttctc ccctaaataa tccataatta aagggctttg gacacaacaa ttggtgatag tagtccacac tcaggtctaa tagagaaatt 45060 45120 45180 45240 45300 45360 45420 45480 45540 45600 45660 45720 45780 45840 45900 45960 46020 46080 46140 46200 46260 46320 46380 46440 46500 46560 46620 46680 46740 46800 46860 46920 4 6980' 47040 47100 47160 47220 47280 47340 47400 47460 47520 47580 47640 47700 47760 47820 47880 47940 48000 48060 48120 48180 48240 48300 48360 48420 48480 48540 48600 48660 48720 48780 W0005851 0 [tqtAitww. etthe patent. com/Log in.d o /Sexam.sup,orlFetch/efault.doMJO00585 0.coc?fromCarhe=l1 art=maintoolbar-botoml Page 422 of 737 WO 00/58510 PCTA~BOO/00435 tagaaaaaaa ttatcaggga cctcattttg acatatccag cacatggtcg gtactcagaa atatcgagca gtaatcctta tcaatttaaa tatttttatt tacagaagtt gcttacattt taattgcacc agaattgaga a tat gt caa a tctctgcaac ttctgtcctt aatatgcatg aggttggtaa attaaaatag ttgtccttga cccataacag tacagagaag aatgacaccc tcctccttct tctgcgtgac tttattgtct tctattaatc tagctgtagt actgatttat taccagoact gaattttcac acctctttca gagaagttca atcaatgaat ctgaagcatg gatccgttaa gtgtgagacg atagtgtggg catgaaaatg aatgcttata gttctaaaaa agccttacac atctagctaa ttgggaattt t ta agca agc attttttgtc tatttagtga gaaacttttt tataaccatg acatttatca ccataaaact ttttaagtgt ctgattttaa ctttgggtat gt tat aa tct gatctcaaaa ttgccatttg tatcttttta tctcagaaga aagtgaaatg ctatcataga attttcttta aggaatcaaa acttcttaag gaaagtgttc tggtctttct gagatggctg ggcctcccca gccaccataa acctctgaga cctttaagct ggtggatcca cacattttag atcttttcag aagatactga agtgagaaaa catgaaaatc tgtagggaat aatgttaaac cat at at tta tcatttacat cactggggga acaatttgca gcttccatgc tgaatttaca tgctcccttc caacacccta agttcccttc tcagtctttt ttttattaaa ta agat tgt g gggtagttag atgtcaggta aaacttcaat cacacacaca ggtatttcaa ggttaataag ttgttatggc gct ccaagcc ccagtgtaga aaatcaggtg caaaccaatc attttaccac gtatgtcttc aatagctttt aagaaaagct cgattataat atagagagac agggaccata attgtacatg ctccacttag taattttaat atgtcctgcc gaaaccatcc ttatcattat aatgagactt atcacgtcaa gattgttgtc cctcagtagc actgctgctt caagatacct tctgcttgga ctgaacctga atgatattgg cacattttct tgctaattca gtcagagttt aggactttta taaagattat aggcttaaga cctctcttgc tatgtgtgtg ttctcactgg gttttgcttC tatgacaaag ctacccgata tggatctatt aggtagtttt tttcaaagat aaagtcagct agttattgtt ttcatatttc ccacttatta ttctgacaca caacctgaaa aatatgttcc tttatgcaac aaagacatac tcttaccttc acttctaacc act tgacaag atttccctta gtttattaga attattcatt ctccaaaact ttaagtttaa gttactactg cgcacacatc tgactgaatc aagattaaga cagaggctca tgttcaatta gccttcaact aattttggct tttagaattt tctaccactg ttggacaaca ctatatatgt ccacatactg acacttaatt attttggtgc tatttaggta ttaactctaa tattttttat gcttgggaaa ttatctctgg tcatttacat ctcattatat ttgaatttct a tat acat ta tttactaatc atctgataaa cacccacatc gataatgaag agagacatgt tcagtggctt agtcatatat cagaatctag gaaggtattg cactatcaca ggtgcagttc aaggacttag atgctgcaca acctgtgatc tgtgattaat atattaagga tgatactatt tgaaaaggag actgtaaaaa taatwgaaat tattgaaaac acacatgcct gcttgaaatg ttctaatcta ctacacatct catgggaaga aaactgaagg actgtgactc cttcttttcc taatgcgtta ctttcacatc cctgacacca tgcaactgaa ttttaaaagt ccttttaata aatagaatgc atactgatat gaaggaatac tccatgagca tgtttatgct tatacatggt acaaaaatat agacaaatta tgagaggaaa tttaagtcac gattttcctt gtgactagat gaattccata tgggatgcat tccaaagtag atctatatct atagaattat gaaaacaaaa ttacaaggat cagatcatta gggcaattaa tataaatatg catctgttag ttatctttgg ttttcctctt aatctacaga acaataaata atgagcagat aagataccta ggttgctgtc acctgcactc gagagaagga tacttctgct attgtttgaa ttcaattagc agtaaaattt agaacaggaa ttctagcttc tggacacctc cagcaaatta gca tcctgag ctcatcttgc caattattac tcttaaaaat ccatgtctta gagggttttg caagggcaat agaaataaaa ttgatcacta gaaagcagaa tgggcdtaat gcacacattt tttttaatgt aacaattctt catggttgag cattctgata caaatatgtt tgaattgcag atgttcacct cacagttcac gctcacagtt caactttctt aaaggattca tgaatagaaa ttttcttata tatgatattt gagtgcaat t gaataaatgg aacataggct gttattgatc caaggtcaca aggtgtggct tgagacaaag ggggaggttg ttgaccaaga aagcaaaaaa gccacgagat accacatgca acatctatat ataaaagcaa caaaaatatt ttctgggaat acaatgcttt aacccataat gctagcattg aaaaactttc tttattacat ctaaatttgg aataataaac gaatataacg agctttaaca atttaactga tcacctgtgc ccaaactcag acatggtgaa gtcatttcct cagtaataca cattatcaat aaaaaaggaa aaatattagc ttcagtgcct acatgtctga gtctgttttt gtgattatta ccttttccaa taaaggatca aggagaataa gcattcaatg gaaaaagaga tctgtattgg cacatatcaa aggaattgac atcatatctt aaatcttgaa tagtaaactt taattatttt aagtctgaga aattagaata gaaggagtca cccttctttt ctctgtttct ttttcacctc catcagctct gtgcttagta tgtcttacag gtattccatt ataggaagtt ttgtttttga tcaacactat tcaagatcat tttctttggc aaagcaatta tcatttgtta gcccattcag aagaacagaa tagatgtgga acctgactta tggagttttc ttcttacata tttgtgagta cactgaaaca ttatatctgt atactaacgt ttttaaagta acaagcaatt ct t taatat t tataatatga aatcattggc cctatagaag tttatgataa ggaaattata agcagcatac aactctgctt tgtttatcat agtatcaagt cacatggcca cctggctgga cactatgcag tggccagagc acctactgtt gtctctcata agacagataa 48840 48900 48960 49020 49080 49140 49200 49260 49320 49380 49440 49500 49560 49620 49680 49740 49800 49860 49920 49980 50040 50100 50160 50220 50280 50340 50400 50460 50520 50580 50640 50700 50760 50820 50880 50940 51000 51060 51120 51180 51240 51300 51360 51420 51480 51540 51600 51660 51720 51780 51840 51900 51960 52020 52080 52140 52200 52260 52320 52380 52440 52500 52560 W0005851 0 [tqp.llwww. getthepa tent. com/Lo i ndo/Sexa m.su DortFe tch/Defa ult. dogNO005851 0.cpc?fromCache= 1 part=maintoolbar--botoml Page 423 of 737 WO 00/58510 PCT(1B00100435 atgctctcat aggtagctca tat att gat t g taca caca c cacagttaaa gggaaaacta tctgatcata cacagggaaa tagttatttc tctttaatca agaattattc ttttttttgt tgtatttttt ataacatcat tttttagact atgtatgata gatcattatt cagtagtgaa aattacctaa ctctccttcc cccagaacac attacatgca ctttgaaggt tcagagacaa caaacaaaaa ggcaaaatac taaatacata ctttcaaaac ggctgctggc tagaagtgta aaaggtttgt attccattgt ggccttacat ggttcaactt tagtgtcttt agtattttat ttattcactt cataagagtt cctttattcc gtactacgtt gaaaaacttt tgttttaatt tgattacatg cactgtttaa t ttt cgta tg aattccttta taatgttcat ttgggtatca atattttgga gcaaaaaagc tctcctgact ggctttgcgt attactttcg ctatgttcct taaaggtttt cctattattt gctagtttcg gatgatttaa ttcattatgt tttctaattt ccacaaattt ttgatcagaa igacctaata ctccaaattc gattttaatg atttggaaga acatcggcaa ctatgatttc ttgaactgcc gtgtcatcag atagtaaatc aaacttagtg ttacctgcca tactaccgaa aattctaact cca tt t ttt a ttccagagtc tcctaaaatg cggtttcctc ttttaaagaa ttcagaatgc tttgtaattg ctccccggag ttagcaattt ataacgatac ttagatacga gtcagagaga acagatttta acatgacatt tattacattg tgaaattcta aaacagttct atcatacaga ccatgttgta atatataaat ttgggtcttt cattccgttg ttcccattaa tctattggcc attagttctg gtctacatat aacatatgtt aaatagaagt ttaaaaaatt atgaaaggtt tcttttttct tttttgtgtg ttgaaccat c atatgttgca acggaatatt aggtagttct aattattgaa catcaggcca cttaaaatgt ttctagaaat taatactctc tttttttttt ctaaatttgt tacattctct ggt tcagt at gatctttctt cccatatgtt ctcatgtaat gtaaaagttc aaatgttttg tatgttctat agtgtcctaa gactagtcac aaaaagagcc cattagagag aaagtttttc acaattctgc agcaattagt tgtcctactg gaagaaatat ggaaacactt agctcaagat tttcaggtac tggaattgta atcaattcct tcttgataac tatataatgt actcaggaac atagcagagt cagctattca ctcctccttc ctgctccgat attcaatgtg ttgactgtgt gagagagaga agaactgagc tactatctta tgtagacatc cccattaaac acttattgtc atttaccttt gtctatgtca cacattatat gattcatatt catgtggaga atgatcttgc aacatgtttg aattcattta atgattatat ctctcttttt gaggaaagca gtgatgaggt attgaatttt tcattagtgt ttgaaccatc tttgtattcc aaattcagtt gatctttagt ggcctcatag aattggggtg aggacttttg ctattacaat ttgtccactt tgctgatctt tttattttgg tactattttg attttatctc attcttattt gttttttgta ttgacatatt ttattatttg tcgtttttct tatgatattt ccaggaaaat attccactta t t ttgtct Ct ccctcaaCCt gttgacctga caagcaagtt tggtggtttc tcatcccaaa actgcagttC gttgttggta tttatttacc gtatttgtgc t tt tct ct tt aggcatattt ttgtcaggac caaaacacag gtcacataga aagaaataag gtgcaaagta ttgcacttga ccagcgtttg ttgctctagc aaactacaat caaccataag gattgacaaa cctaattcat accattttta accatcctcc aattcctcat tgtatgattt ttgtgatggg gacttggctt atgttatatt cagttaattt ttcagttttc cacccttgtc ttttacgcca ttagtttcat catctatgga cttgcctaat gacacccttg agtttccttc ctcaagtgct ggtgtattcc tttgtattcc aggcataaat tgctagtact tttctatttt aatgtgttag agccttctt tttgtcagga tttctatttg catccaggt t tgtatttatg taacttgagt aagaaccaac agctgtaata ttttagttcc atgtatgcat gtttgttcat atccattggt tctgttactg tttaccgtaa gttccatgtg ctttaatcag t ttttt t tgc tccagagcgg aagtgtttta atatgtcaga attggcaatt cttgttttgt tctaaaatgt gtggtcatcc agtgcatgag tatagttata agctgtttta ggtggttcta atgacattat agggttatca gtattttatt gatgcactca aagcaaatgc ttctttcctt tatggcagct ttcaaaggtc ctgtgtaact cagaataata caaacaaaca ttttttttct aatgaacagt atcttcaggg tccccccctt tgatcactgt cttatttcac cccttttaag ctaagcattt ttatatggag tcagcatctg aaaaataatt gctgatataa atgggatttt cagagataag tgCtCtagct ctttgttcct tatcctagta tttactgcat attgttaatg aggcataaat cctacttaga tttttgaaga ttgtgatgtc gaagtgttcc taaatgtttg tatttttgat tttgtggttt attcaatttg tagacttgga ctttcttctt ttttggtttc tttattattt ttaagttgta ctaaattttc tttcgtttat aagagtatgt atttcttact gttttttgag tacttaaaat tataaaaatc tatcagcgtt acacacacac aaaactatga atatgagtag ccaattatgt attgccactc ccttaaagtt ttgctagtac agtttaggtg aatatagatt ttttagtata gtttacaact gtttttccat ttatacagtt tccagccaaa cacaaataga atccatgccc caactccttc tcgtaataaa tatggtcatg ttgtatttct attcctgtgc aacaaacaaa tttttattgt ttagtgatat ttctttccac cccccagctc aagtacctca ttagcatcct gctgaatgat tatattttta gttcatataa ttgttaaaaa tggccatgta ccatatgtaa ttggtggaat tttacttctt aggatttcca gatCtgaCag tactgagtat caataaaaga tggtatattc cctactttga aatggtgtat ttgttcccat tttgtctgac ctcttctttg gtagaattca tagtaatcta agatttagta ttggcatatc agtaatgttc tctttctagc atttattttc catttttttt aagttaggtt taacagtgct ctccaagtat tgtttaattt ttatcccatt acttaatttg aatgtgtatg 52620 52680 52740 52800 52860 52920 52980 53040 53100 53160 53220 53280 53340 53400 53460 53520 53580 53640 53700 53760 53820 53880 53940 54000 54060 54120 54180 54240 54300 54360 54420 54480 54540 54600 54660 54720 54780 54840 54900 54960 55020 55080 55140 55200 55260 55320 55380 55440 55500 55560 55620 55680 55740 55800 55860 55920 55980 56040 56100 56160 56220 56280 56340 W0005851 0 [http://Aww.qetthePatentcom/Loindog/Sexam.suportFetch/Defauit.do3/WO00585 0.ccfomah=1prminolrbtomPae44f73 WO 00/58510 PCT/IB00100435 ccatagaaac cattcaagtt gtggggtatg cactttttgc atatcttctt aatctacttt aaaatatatt tctattgtag gattggagag atttgttttt gtgtttagtt ttctttcttc aacattctaa agctctgtcc gttcgaaaac aaaatgtgga tgttttagtg tactagcttt attgtctagg ggtctagagg cattttagat tattttgtat aactctgata tttattgttg tcaggttttt acccatatat aaaaagagaa ccacctcagc gtttctttgt tgttatctgg ctgctccagg gtgctaatag gagtttgaag tagtaacatc ctagtgctac catttctggg cctgctttaa at gaaaacat aaaaattgag tggactgtct ttatggggtg gtgaggtgac aaggatgtca atgagttgca ggtagttttc gtgagggaag gctgttctta attattattt ccaaatcttt ggcaattgtg tgt ggggaag aaaatttaga gtacctcagg agacttgggt cttcagcagg aat ccaagct t ctat t tgaa tgtagctacc gaaactgact tctttcttat tgaggaagtc ttggtgctca caaaatttgg tgggtagagt ctctgttgcc ataactacaa ttcatatatt gctacattaa gtctgatatt ttttcatcct actgggccta cttaatccat tatatgcctt catctagttg tatattcttt tttgaatttg ccacctcttt ataaactaat at tgcaaacc tcttaaatga taaaattgcc gtcctttaat taataaactc aacagttttg gccttctgat accggat tct cagctgtctc ttctgaactt acagttgctt aaacaaaggg caggggagag ctgcacctct caggcagggt caccgctgcc ctaaaattga tgcaagtctt agacagattc ctactccacc gttgtaagtc gttttcaatc ttggctctaa agtaaaagaa gaaacagttt tcattaattt attcataaat tgtagatcat gccattttaa tgatagtaat actgttttta ttccatagca tcagaagtct ataatgctgt cagtgggatg agtaaccagt tgttatagta tgatactgtg attgacaaga ggaaatacag atataaagag ttcaggttct agccttgaag atggtgaatt tcatagtcta cgctgtggtc atgtcatgag cgaacccttg gttccgtatc ttacttatat caattattat ttatggtctg accttttaat agtatagcca ttaactttca catcattttt ttacacttaa atagctttct atttttcagt gttgttacca tgccaactta cagctgttca aattctttga aaaattacaa agtagaaaac tatttttaat ttcatcccaa ccccagcttt ctgaatctag tttcacttga ctttctttct tgtgccaagt gtatcttccc gtgaatgtct agaaaaaatg gggctgacaa gggatcagaa tgtttgttgc tgcc aca gag ccacaattaa tccctggaac tgtcagggca atctttctag aacaatctgt cagttagccc gtgtggttgc cgtgctatta tttgagagac gtttttgt~c ctgagtattc ataaaataac tattttgtcc ttccaattcc tatcattcaa tcttatgtag tggtttttcc tgccaacttt gatatgtgaa ctggattgaa gttcttatat atagctataa acttggaaaa ttatgttcct acataataac aagcagtatt ttacctgaac cttaccccaa tgattggtgc ctaaagctgc tactaagatg tcttttgggg tgtccattag tctgtctcat agaactgtat ttattagatg aatatataat ctcttgctct gtgtatctgt taaaatccat aatcattgct catacctcat taaatattaa tggtgattat attttaataa tgctataaaa tgcattcatc taccaacttt aa aat gaa gt tcagatttaa ataactcccc tgtttacctg tattgttggt aaactgagca gagggtttgc attagcatga actgtgtcta ttatcttcaa aggcaccacc taattgagga gcagtgatca ccaccctagt ttgagaggtg ccacaactga tt aat tt caa ttattttttt aatattctcc attttaacaa tctctatcct catttaattt ataattcatc acttagaaaa aatttttgca atatctaaaa tatagaaata atttttatat tctcccaaaa attttatcag gattgatctc attggcaaat gtgtctttaa tctgtgtgaa ttgaatgcta aagaacatta ttgtttatga ggatcaagca gggtcactgg tatgatcaga ccccaaagag tttggtattc atgtattttt atcttctcta acctgtgtgg attctgagta aagaggggca acctagtcgg tgttctattc gtttctgttt cataaatatt gtccttcttg tcttcactta gtctttgggt tttactaacc gataagcaag tttctacatt aagtct ttt t attcaacatg tacactcaaa ttatatctta tctcaaatta tagcataata tatacagcgt tttttgtata tgagcatttc gaatgcctta tgacagtatt tttgaatcta tgttttgttc ggtgtaaact catggtgact tgt cagccgt ctctttacat ggagcataac gtgatcagag ttctgcaagc gggaatgaat cagtctaagc tagtttccag ctatgtaggg tccccaataa tttctctagg caatataaaa atgttccaaa tgtaataata aattatgctt acaaaatttt acccaaaagc ttgaatccat attctatgca tggactggac tccttttctg ttccttgtgt gttcaaataa ataaagtcca aaatgatatt aattggcttt aacatctcac cggaaatatt gcaacatata actcttgtta actttgtgaa atctgatatt tattattccc ccctagtaga gctccctttt ctgttgtcta agagtcctaa gaattcttca tgtattgtgc attattgaga tcaattctgt tataattttt tatgttttaa ctatttggac ctaaagtgag tctgtcttct caattttgct tctgtgtttt ttctgctatt ctaaagttat tattttttac tacatttcat tgtagaaaac attatcttaa gttacaataa gct tt tagt t ttgcagggaa atttctccct ttacacttag ataatatgtt ttgacttttt tattctctcc tcctaatttc ccaaaagagt tccctgggaa aatggccact cacgggtctc tgtqtggtag aggtgctatt catctcctgg aattccaaaa atacatattt t.ttatatcat tgtctctttg caaaagcacc ccagaaaaaa tatatgaacc tggaaatttt gacttctata atttttttct aatatgtcat tataatatat agatttctta tgggtcccct tagagtcaat aactttataa attgccatag ttaaatgctt acatttggaa tctaaatgaa cactcttaga tgaaactgtg tggactgaac atatgaccgt gaatcaatgt ttagcttgta tgaactataa ttagatgtgc atgtcccgtt ttaatgccac cgatatgcct 56400 56460 56520 56580 56640 56700 56760 56820 56880 56940 57000 57060 57120 57180 57240 57300 57360 57420 57480 57540 57600 57660 57720 57780 57840 57900 57960 58020 58080 58140 58200 58260 58320 58380 58440 58500 58560 58620 58680 58740 58800 58860 58920 58980 59040 59100 59160 59220 59280 59340 59400 59460 59520 59580 59640 59700 59760 59820 59880 59940 60000 60060 60120 W0005851 0 [http:/AMw.getthe patent. co m/I.ogin.dog/3exa m. su portFetchDefa ut.dogAN0005851 0 -cipc?fromCachef1 part=ma intool ba r--bottOmL Page 425 of 7 37 WO 00/58510 PCTIIBOOIOO435 caaacctggc aattttattc tgcttgttcc tgcgtcggac tgtgtgactg cgtgctttat acatgtttgg aactacacaa ccctgatgac gctaatgcaa tcctaatttg agtggagctt aaaaataaat ggttatataa tcaagtaatc tgagaagaga atgaagaaat atcatgtatt cagctataac tgtttttttg gttactaaaa tttctgtatc ggatgtaaag ttgagtctat cttttgatat ggaaggaagg ggaaggaagg gggagggaga gatggaagga gaaggaagga agggaggaag aatatttttt tgagcttgac tggctgatag ctaaaatgaa atgtgcagag agatgtcaaa acattgacat tgtccacatt aaaagaaaag tttaatctct accttgtatt gacattctat tat att gt gt actaaaagga agtgactatt aattgcaacg aggtataagc aaatgaactg ggccaagct a aaatcatttc agctcagcta cttctttgaa tgtttatgaa ctttttggat tatatctaga agtatagtga tggggtgtgc atttaaaata aatactgatc tcactgcatt ttaccaatgc ctacttaagg ttcttcactt atagatgtaa tgctttgatg a agt at gaga tagaccgtac caacatgata tttagatgtg aaatcaccct agcatgtttt aattatcttt ccccttagca agcatttttt gagcatagct agtgaaagga caaaggtatc aggtcctgat attgtaataa ctgtacacaa tttagaaagg gtggaaagag ctgaaaatta agtgttagac gagtaagcaa ttatagtaga gcatacattt aaggaaggaa aaggaaggaa aagggaagaa aggaaggaag aggaaggaag ggagggaggg aaaaagaaac ctggatctgt tcttaaaaga tgttgaaatt atatgggaat gctctttctg acgtgcatta ctcagtt tt t ctaactgtga atgactttca ttaattagga gggtgtgcgt aagagcagat aagcgtacca aaaagagaat tttgcaaatg aagtattttt actggccttc tgaattatta aaatagtgaa agttttttaa ataatatctt ataagaataa atgtacttca tgtagacaca aactgccaga caaatcccca ttaagatcat tcggacttct catgcgtgtg cacttttata gagtgcaggc ctgtgtacga aattttggca cgctacttat agacatgctt ctccatgaac tcaatgatgt acctttgacc aaaagtaatt tgtagttaga actagctgga ctcacaaatg attctgatag tcaaacattt atttgggtaa aaatgttcaa gagtggctaa aatttttgaa atgtattctt ctgattgtta agatttaaaa gggaaatgta cttttatggg agacactaag atcactagaa tccctgaaag ggaaggaagg agaaggaagg ggaagaaaga gaatgaagga gaaagatgga aagaaggagg tctttgatga aactcttgac cagaatccaa ataaaataaa acatatgtgt catgcatcct aactaatatg tcatcataac aactcaaaga cattcttagc tctttcagtg gaaagagagg gacaaccttg gtttggatta atataggaga ggcttgtcac catttttaag tacaagtatt aaagaatatt atagtattat tcaatgttta tgaaaccaat acagcctgta acttaaacta tcccccaaaa ccacaagcga caccttgttg cctctttagg tgtgagtttg cttgaagctt agattttgcc aagatgacct 124 gataatttca ttttggctaa gttgtgtttg acagtcacat attacaaatt ggatatttta atttctgtat ttccatgatg ccttgggaaa tctccttgga tcatctcccc aagagactgt ctttaataga ttaatatgaa tgacataaaa gtagtgatga agatactcag tccattttat ttctttggct taaaatggaa gaaaatataa tgaatgaggt accagagcat agtggtgacc aaaaaaggaa aaagatggaa aaagattgag aggaaggaag aggaaggaag aggaaggaag gagggaggaa ttcaacatca atttagctct cataataagc atacaatata cttatgtgtg tgcttagacg agaatgtatg tttttctttc aagtctttgt ttcagtaatc tttgtggcct accaaggt tg agattcgatt gatacattaa aaaaggtatt ataccatcat gatcattgca tacttacaac gacattttgc actaattaaa tttcagttag gtccacattt attttaatat catatatagc cctatagaaa tgttttgtat tcaatattag atctacttgg atgtgtttta gctgccttgt tgcagtgtgt accctgagtc aactgctttt tttaatttca aaacatagta aaaaggagaa tctgactgcc cttactttct aattttaata cattttaaag gacaacaagg ctggtcattt aaagccatag gtccatgcaa aacttagcct gtcaaacatt tacctctcta aagtctaagg agatatttct tttcagtgat tttctccctc gcaagtggta actaatatca taaatgtgtg gactttatat acacagagtt ggaaggaagg ggaaggaagg gtaaggaaga gaaggaaaga gaaggaaaga gagggagcaa ggagggaggg tggagaagtt tg aaaataca ctgcacatgt tgttcacaaa cttatttcta ttttgtctga cattaaacta cagagtgcat tagggcctga cttgaagaga tgaggagcga ttttctttgt tgtgatatga atcagtatgt agaagttgca gtaagtacta aagatagaga cacaattgta tatattttta ctttattaag gggatagttt ctttacagat caccaaaact tatagatata tgtatttctc ttatagatct tttaacaaaa agcgctgaaa catttgtaat aggagacaat caatgtgact atccaaagaa ctca ct ttt a aatttgtatt gaaaagaggc taaaaatatg atctagaaca attttgttat aaatagattt gtcatgtttt agatctgaga atcctctgaa ctgagcagaa ttatgacagt ttgggtttaa aaaagattcc gtccttatga ctaaatttct tgagatcatt tttccatgta a at ta aatca ttaattcaga agctaattct ttagtataaa ctatatcagc gcattttttt aaggaaggaa aaggaatgaa aaggaaggaa aggaaggaaa aggaaggaat ggaaggaggg aggaaggaag attattatat tctgttttct atccccatat tattaaaaaa tgaagtcgtt aattctgttc gct tgaa tga gatgccgcag gtattttttt acagagtcaa gagcaagaaa gactagagat aaccaaatgc catgtaaatc ttttttaacc gtgaagtcta atttgacaat atttttccat aattatcttt tacattttca tgtttttttt aaaagagttc attttaatct tagatatgtc aaatgtgtaa acttgcaatt ctaaaaggaa aaggtgtgaa gctattctct gcaacaactc cttcagtacg tatttctcta 60180 60240 60300 60360 60420 60480 60540 60600 60660 60720 60780 60840 60900 60960 61020 61080 61140 61200 61260 61320 61380 61440 61500 61560 61620 61680 61740 61800 61860 61920 61980 62040 62100 62160 62220 62280 62340 62400 62460 62520 62580 62640 62700 62760 62820 62880 62940 63000 63060 63120 63180 63240 63300 63360 63420 63480 63540 63600 63660 63720 63780 63840 63900 W0005851 0[http:/Mfww. qetthe patent. com/Lo in.dog/$exam.suportFechDefaut.d AN0005851l0.cpc?fromCache=l1 art=maintoolbar--bottom] Pacje 426 of 737 WO 00/58510 PCT/iBOO/00435 gttcctgttg tgtaactggg agtctgcatc aacagggatc atctttctcc aataaaactg ttttaaaaat ttgagaggcc agtgaaaccc tgtagtccca gttgcaatga tctcaaaaaa tgcttttttt acagaatata aaatcaagaa gtctggaagc gtaccactca cccccacctt ggtttagtga gccaagctqc ctgagatgtg agaagacctq tggatgtcct acataggtta atagcaaatt cttagacatc ctttctgaga rttccttggc tccatcacgt tctattggac acacacagaa ggcattgatg catatagaaa tagatagaag agaaaaygcc acacacacac ggtagattta aacaatactg aggatgtgcg agtaatgaaa attcaagaga aaagttgctg gcatatatta tttgtacatg attttaaaaa aaaaataaca tttcaaaatg aaaattttgc tcttacagct taacgttcta tgagaggaat atgttccctt tgactgagac agccttagga gtcagatggt gaaaactttg tgaaatttcc tcatgatctc ttttcaatca aaagattttc gggtaatttg atagcaccga ctcacatggc gtcctgtgaa ttgattgtgt atagcaaata attaaccaag acacagtgct gcatggctgc gaaactattg aaggcaggca cgtctctagt gctacttggg gcagatatca aaaaaaaaaa taagtttatg aagagacagc gaaaagrcaa aggtactcac taaygtgrct gcaaaataat ggtttactta ctgttgqatt gctcaggatg tgtgactagt cttgttaaaa agtatcttcc gccacaaact caacatgggg ctctagagaa tcttggmtgc tggctytgtc tcacctggat aatcacctct tgtctaccac taaatttgtg agtttccaga aaggaatatg acacacacac gagactccga aaaaaagtaa tgtctcgtac ttgtagcacg tgtattttac agtagatttt attagcttga ataaatacat ttggaaggcc attaggcctc ctttggcaaa actcagataa cagttttcct ttatttgtgt gaagatactg gca tggcact tacatttaca acttccattg cgaaaaatta tggttcttta ttggaatcag aagttattgt ggagccaatt tttagtgtgt taaaaagaga catctgctcc aggagcagga ttcctaatgt tgcatgacat cgttacggga gctgacacaa ccaggaagcg cacatagatc tcggccaggc gatcacgagg aaaaatacaa aggctgaggc tgccactcta agaaactatt ttttgaaatc ataaatgata tgataaaaag agtggcattc ggccagcaaa gctgaaataa cagaaaataa tgacatatcc ggagaccaca gagaaaagca taaatgtact aaaaaagaca tagtagctta cccactgggc aaatygtttg ctctccatct gctcacattt aatccaagat gttatgtaaa agcatccaca gattcaggaa ctagacatcc cgaaggaatt acacacacca catataacca ggaattttcc tgagaaaaat tcaaaatcca aatagggtaa aaatgctctt tgtagccatt agtcaaaata atattcttaa tctagaaacc aacaaaaaac agcattaatc atctggatta gtccaaacat atgacagaaa cttcagttga caaattaagg caaaaaagga attggcaaac ttaaacgaaa gaataagggc ttctcataca ctaatcacac taggttgttc ggtttaattg tggggagtct gcaagagtag ctttataata taagtaaacc gagaggggca tt ct ccagt g attcgacatg ctattttctt gtggtgactc tcaggagatc aaaaattagc aggagaatgg ttccagcttg gtcaaccaat ctctctcaat gaaaacaaaa ggctgaagcc ttgggcactc atttactgct aaggtgttac aaaagcaaac tgcaatcaca gggcaggcag agagtaagag aaaacaaata cagcattcat acacaacatg tcaaatccag ctttggtttt tcaaagtgca ctacttctct aatcttcatc gtaacatatt aagggaacaa aaagtgragt aggaaagaat gcatgcatgt catagaaaag tgaggtttac acaattgaag aaatgaaaat tattctcttt ctacagttaa actataaaaa ctacagtata atttaagaat aaactaaaca taactcttaa caaataacag aagatgaaat actttagttt gcatatttat ttagagcagg caaaaggaca agttgtgtaa gtttaacatg aagttgattg acacttcgga ctttatatat tatcagagat atcagtggca ttgtgttgct gctcacagtt tgaaaaagaa ggagaagtgc aatggccacc taactgccgc cgtcctccct agaacagatg agtctgtact ttgcctctta acgcctgtaa gagaccatcc tgggcgtggt cgtgaacctg ggcgaaaaag gagtgtaaag tgcagraaaa taagcatgtt ggaggcatcc tggggcaccg taacataaac tgatcattgt agtcatacac gggaaaaggt gaaggaggca aaaggaagaa ga aca atat g gtgagcttca cat tcattac gtgttggcag tcarctctgg tcactgcagc cttgcaagga ttaaaatcct tccatatcct aaaatattgt catggaacaa tcacccagga acatgcgcgc aacaattcac aataaaaaga aaaaacatga aaatccgcac gggtttgaca taatatttat tgataagtat taagtatttc ttttaaatga tgagaaaagt aaacagacat ggaaagagct acaaaatgaa tgcaatagta ccagcaacta gaatcagaag tgtgatccca cattaaataa gagctgttgt cataagctgg tattgggaag tctactcact gtgctaaaat acttggagcc at aa a gcaat cttcaggccg ggcaaagggt cacactttta taaaaattaa aacagggtgc cagcgcccac taaccttgga ggcataggaa ccaagagtta tcccagcact tggctaacac ggcgggcacc ggaggtggag tgagactgtg gtgttatttt aaaataagat catgagccag caggccmtgg aggtctgtaa aatgtctkgg ctgggactaa ccaagattgg tggtactata aaagcaatct agagagaaga aaaagaccct tattgctact tttacagcag agctgctttt agsctgctgy ctgcgcttca cccttgggat taatttagtc ggaggaaggg ccaataaatg aaatatttaa tgcagcttag gcgcgcacac agat aggagg ataaaggaga gccttcagat agaggcacaa ggaggaataa tatactcttg attaaataat aaaacaacgt taaaaaatac attaccaaca tacagaatac ctatgaatta gtacatggtt tttcttgcag attcaaggta agagaagtgc agatttctct ccaaagtcat taaagggagg aagtactgtt acagcaacag gtctacatgg ttgaaatagg ttgagtttgg atctgagact tacaggtagc cagcaggtgt aacaatcaga 63960 64020 64080 64140 64200 64260 64320 64380 64440 64500 64560 64620 64680 64740 64800 64860 64920 64980 65040 65100 65160 65220 65280 65340 65400 65460 65520 65580 65640 65700 65760 65820 65880 65940 66000- 66060 66120 66180 66240 66300 66360 66420 66480 66540 66600 66660 66720 66780 66840 66900 66960 67020 67080 67140 67200 67260 67320 67380 67440 67500 67560 67620 67680 W0005851 0.httr:/www.oetthepa tent. comLg in.do /exam.suportFetchDefaut.dogiWO005851 0.CPC?fromCachie~ 1 art=maintaoobar--boflom] Page 427 of 737 WO 00/58510 PCT/iBOO/00435 tcccttaaga catgagaaat ggattacatg tccaagacaa actgaaatag ctqataaatg ttgccaatct gaattctgac tctggtggct gaagtaaagt gtttaaaaga ttgaataaat ttcatattta ctaagtttca tcgctttaaa tatcagttga ttaggcaata gaatccaata ttcaacaatc ttctaactcc gtgcaagcta agagaattgt taacattatc gcaagactga tccaccatgt gaatcctttg gccaaaattt aatcactaaa agattgaaca cacaaatgat tttttaaagc tatttgatga ttaagtcaga acttacagtc tccttttcta tagtttttcc actgtttaaa aaataagtat ttcaatattc tatccaccaa tatccatcca taagaaagaa tgtggatgtt ttttctaaga tctactgaca a aga ca aggc acgtccatca ttaccatgat gtgttagtca acatttattt ttgaggacca tagcagcgac gagctaatca aatatgaact agtagcagaa tcaacgctta atacacatat catatataca ttttctctct ttttttcttg agtgttaaca cttgtactat ataggaattt actcactcac ctatcaccat tcagtgtgag agt ctact aa aaggaatggc tttaacaata ccctgatata cacagctgtc taatgctgaa atgggtgtga aaagaatgga tggtgtgttt tggaggtttt aatcaagata aatattttag tccagtttct aagataggga gcaatatggg accaaccatt agaagtcctc ctctttataa tgaccagatg ttaaagtatg atatcttctg taccaaatat cctaaaatgt gcaattcttc tgttcaggga gacaaccatc gatggattag catcaatttg tctcctaata tactatctct a ca aaaat ga cgatgaaatg tttccaaatt aacaatgtct atttttagag aattttattt ttcatccatt ttcacacatc gaa aaa t tta tgtaatttta cttatacatt ttttattggt cat ttgacca ggctgaaaaa aaaacatatt gttctgtcta ctcagccagt tccttctggc ttcctggagt cccaaagtct ttggggcaca atctttcatc gagtctgtct acacacaaac ctgcatctag aactcataag caaataagag atattcacaa atttataaca ttttgtgaag tattgcaagg ggtctaatca actcaaagaa agtctgagat cacagaggt c ggttttcata aatattccaa tcttgctagc act ta gtat t gaaaagtttc aatggctcgt tatcctggag ttttttttga aatctagcct aaaaaaatgt acactttaaa aggttcaagg aaggcaggaa cctgctcccc ttgaattttt tattgcaatc aataaaaagt cttctcagga cacctgtttt gattggcatt agat t tt t tt tataaaatta aatctctagt tgttcaactt gtaacttcat catgaagctt tgtgctaggt tttttcagat agtacgctta tagcttcatg t t tagt ata g ttgatttaat ttcaaagggg attttttata tatctacctg cattatttca ttcaggcttc ttattgccat acctctgaaa caaagcacat ggaaacacag atgtggtata taagacaaag ctctaacaga tctgatggct tgcacactgc gacaagggct ccacctccta caaatattta tcttctaaaa tggagagcag atttgtttgt cacaataggt ggagagtttt tggaatagaa gtgtttaaag tgacctttgt aagaaacact 126 acagcaccaa cctcccacca gacacatatc caattaattg ttgtaggttt gqtggtcagg ccatggatga tggtgtgagt taaagttgtt agttagttta gggtcgcata aggagggagc cagaagatgg taagtattcc actgtataaa tcctgctggc gaaaacttct ctattttacc cacatgtcat cccagcctgt tgttcttatt tggccaccaa gggcatttta cattggttca gtgttaaatg t ttt gctat a ttttttgtct gagaaaaata aaaacatttg ttcatattta atgagtgaga gctttatatg aaagaaattg tacaatctga taggggagta atgaagaaaa atatggtaaa aggaaaatat atgaaatagt tccatctatt tcctgcattc tatgtagatg ttcctttcca tgcttcctct cacatagtca gagatccaga aatattaata gtttttacta ataccataga ggaagtctga tgacttctcc tcaatcccat ataccaacac gtccataaca ctaacactag gaacagatgt atgtgtgtgc aattgctatg ttaatcagct agattttcgc aaataattag tctatttata tgataatatc ggggatgatg agtctcacct tgaactatat tagatatctg gtggcttgtg gaaggcctta tttactcaca cagctccaga atcttttgtt gttagtattt attgagacta tggagagtga ttcccagtta cctt tcctat gaatgctttc cttttacact gaggccaagt caataactct tcatcacact cctgtcaaat ccactttaaa tttgacatta agtcatttga atatgaaaga ttcttaggtt aa aaaga cat aaatcttaaa aaatttatag tctcaaataa ttaaattatt gatatacaaa tatgacattt agacttaagg atctactgat taacatggaa agacattctc tattaaatat cctttgtaag cagcactcca catccatcca atacatccat gaagtgtttt aatgtatgcc tggaaatgat tgcctgagcc aatattggtg tttaagacac agagcaaaaa ctgggtggct gatcagggtg ttgtatgctt tcgcgagggc cttgaggatt gccttggagg tggaaaacat attatattac t tat gtgga t tcagggcaca ggtaatatca tgttgagaat gttcatttca tatacaagta ccaattccct ttacaacact ccaacattgg cat gt acaa t tcattaggta caggtgtctg tttqtagcat agatggaact acctcaggag cacctgtacg ataagaaaga tgaagagtgg tttaataatc ctttccatcc ccaataatta ttagattggt atatgtaaga aatccaatag agctagaaat gcttcatgaa cgctggtcta taaacagagt tccccctaac agttctaaat ttatactatt taatcactct t aga gt cta t aataacttaa ctcacagact cataataact aacccaactc aaaaacttaa taacaaatat taaataattt ggcttcaaaa ataaggcagg aattatcaat gtggtcgtga ctggggcatt accatccatc aacatctatg aactactctc gatactaaaa aatcatacat gcacgtcact tatcctcagg aacactggta aaagaggtat cataaacttt ttaacagcag acagcttctc aagtggcaga tccgcctcat agaatttcaa taaaattcta aatctttcat atgtgcacac atctatatgt tttattatag tatatttcag tgtgccctta ttctatcatg atatattcta aacagaatta 67740 67800 67860 67920 67980 68040 68100 68160 68220 68280 68340 68400 68460 68520 68580 68640 68700 68760 68820 68880 68940 69000 69060 69120 69180 69240 69300 69360 69420 69480 69540 69600 69660 69720 69780 69840 69900 69960 70020 70080 70140 70200 70260 70320 70380 70440 70500 70560 70620 70680 70740 70800 70860 70920 70980 71040 71100 71160 71220 71280 71340 71400 71460 W0005851 0 http:/twww. etthepatent.comIILogin.dogisexam.suport/Fetch/efault.doIW0005851 0.cpc?fromCar-he=I1part=maintoolbar--bottom].Page 428 of 737 WO 00/58510 PCT/IBOO/00435 tacaatagtt gagatcaatt tcttgtccta ccttagacaa ttgtaaaaat gaaaacaaat tat tatttac attctaaata agatctttgc t ggt taa ta c aatgcctaaa atcaaagagt ctaatttatc atctgggttc cctcagtttg actcaataat gaatattgac tcagtcacgt cattctcaca tgatgatttt ca ggcacgga atgacataat tcggagctgg cctttggatt caaatagaga tgcagggcca tggactggct gaaaacacag ctcactactg ctaaattggc atccagcagc ccaaatgaaa gaggaaattg actccaggga gtagacgccc tgtctctttt taatttgtgc tgcttatttt gtattcttca tgaaatattt tgttgcttcc taatagaata tatcacaact agaacagata ctaatattga ttaattgctg cagtttttta atttaattgg ttccaacctg caggtctgct ttttaaggca ctttcaactt ggagtgcagt tcctgcctca tttttttttt tagtctcaat caggcgtgag tagtttcatt attttctatt atatttgaat aaaattgtca acaagaccct tctccttttc cctcaatgac tcctgatgct tcatttgatg tacagtcact tgcttttttt tttgggcaag aaatatgaca tgatgtgaca tatgcagttc acacatgtaa tattatgttt acattaatag ctcttataga agtaagcacg tactggaatc gggattcaaa tggcacttca ggggatgatt agtttttaag aaaggtaatg gtctgcgtca gaattatatt tgagagtttt ccttgatcct atgtagagaa acatgaaaga agtgtcgggg tgatgcagat tgatcataca aggctttttt aaataacatg atgagtcaag tgagcagggt a a aat gaga a gttacggttt gagtttataa ttttttctat ctaatatagg aattttacct cctaatttcc ca aa tat ttg ccattatagt tgctttgtgg aagtgtattc tattgttgaa aaaaagcatg aattgttaca aaatttttgt gtatttttcc ccagacgatt ttgtctcagg tttttttttt ggcgcgatct gcctcccgag tttttttttg ctcctgacct ccactgcacc catcttatga catgtttggt gtatttactg cccatgt tct taacgtaaat gtttttattt cttaccttgg cagtttatat gaaacgattt tcaaacagtt ttttttggtt aatagtggca tcaaacatta aagttaactc tgaacactgc ctctacaact gtagttgtcc aaaattaacc aaaatatttt tgtttcgagc attaatgcat tgctgccctg gaagtcacca tttttggcaa cccaggacag tcagcctgag tcttagtccc taacttttcc aataaagtgc cctctgcact gtaaagtgct agggcagaaa tttcagccag caatatatac tttgggcttc cctaacaact catgtccaac cattcttttt acaagaagct gtgttgaaca ctccatgtat gttcccatca ctttaagata cattt a a aga ttcaaaattt cttgtcagtt ggaattttta cagagaaaaa ttgagatggt ttcaattgtt gtcttctagg tttaatgtct tttatgtagt tgttttaaaa tcttcagcct cagatttttc atatttgcta tttttttttt cggctcactg tagctgggac tatgtttagt tgtgatctgc cggccatctt gcacaatgcg tttcatcacc tttcttatat cttcaaaaat ata t ttgat g tattttattt gaaaaaatta tcatcatgct ccatgtgttt caactctaca cagagtattc tacacattac gtggttttat cgaatttcct catgctttca tgatct tagc ggagcatctt aaaactgaat cagtgtttat atactttgag aatctgaagt tttgatctgc gagtattctg agagcatttt tctccattcc aaacagtgaa taactctcac tgctgctcat ttagcatcac ttatgtaatg tcatgcaaga ggtt ccggac aaccttcctt cagttttgtt ccaacttttt gtgaaatgct ggcgaggat g tctttaagca gcacatgcct agcagcactc taaattggtt atattttatt aaagcataga tgaaagtttc tatagggttt ccacttttac cagatatatt tgtcatgtat gatctacctg gaatataatg tccttattaa gtgattggag ttaaagcttt atgtttaccc gaagaagtta tggtgaacat tcatgtttac gagacggagt caagctccgc tacaggcgc ggagacgggg ccgccttggc tcaacaattt tgttttttat gatttgatga atgtgagttg gtcttctacc gcataatatt tattttattt aatgaaagac aagctatcca tatgattcaa gttggctggc tatattttac agagtgattt ttcattttta ggtttttgtc acttttcaac atttcatgta attttcactt aagaataaaa atttatgtga atgcattgtt tgtgattatt attaactgtt tagccttcag gcactctgag accacttgta atatgctgaa cttagtgaat gttttgatat ctgagggtaa agtgaccttt gggcatcact acaaagggca t agaa t ttgg acagatgttg ctcttgaatt agtctttaga gctccaaaaa gagcaagatc aggaggtgag ccagaaaata tataacattg tcctttactt tgataactga ctcttacaac atttttatta at acaga t ta atactattgt tatttcaatc agggaatgtt ttctatatgt ttttttatct tcttttctgt gtgattatat t tt ctggggc cctcagcatt ataaaaa tat agtcttttat ctcactctgt Ctcccgggtt cgccaccgct tttcacagtg ctcccaaagt aaaaacattt Ctcctccagc tcgtttgcct atatatttca tcattatctg tt ct aca cat ttgagaggag acctgcatta aggacacctt ctccattctg tgactttgcc ctaagaagtg ca cat t tca a tatcagaggc agt tt a accc aagaaacagg atactttggt t tt caatt ct cctcacttcc taccagccgc cct tggcgca gagatttttc tggaattcca agggtaaatt tcatcacaca ggtaaactgg gatatggaca tgttccaaca ttgtcatcaa atttctatat ctatctagtt gatgtcaaaa gggcactgcc aaactatgga aagaaggtgg aaacatatta aattttcagc agagagaacc at tct tat ca agttctgtct acacattgta tctttttgtt attttgggtt ttttagactt tgatttagct ttgttcaatt tttaaaatta ttgtgatttc cttttaaatt ttatatgcat gtcatttaga attagttata aattctcctt ttatccacat tttttcttcc ttttatagaa acagaaatgc cttctactat cgcccaggct catgccattc cccggctaat ttagccagga gctgggatta tatggtcttc ctcttt caag agttcttgtt tctaatttag tcctcttttt ctcagatggc tctcactctg 71520 71580 71640 71700 71760 71820 71880 71940 72000 72060 72120 72180 72240 72300 72360 72420 72480 72540 72600 72660 72720 72780 72840 72900 72960 73020 73080 73140 73200 73260 73320 73380 73440 73500 73560 73620 73680 73740 73800 73860 73920 73980 74040 74100 74160 74220 74280 74340 74400 74460 74520 74580 74640 74700 74760 74820 74880 74940 75000 75060 75120 75180 75240 W0005851 0 Itp/Mww-getthe patent. com/Log in.d ogSexam. suportFetch/Defa ult.do/WO005851 0.cpc?fromCache= 1 part=maintoolbar--bottoml Page 429 of 737 WO 00/58510 PCTJIBOO/00435 tcacccaggc tcaagtgatt gcccagctaa cgaactcctg catggctctc ctccctcct t gtttactgat catctcwata ttctctgcta tCtgaCatat tggaactgcc cctataatgt ttaacagggc ccagctgctg acccagcctt cttgagtgga tctacccagc ctgctcccag ccaaacttgg ggt gggtgca aagcttttta cctCctCCtc ggaagagatc ttcattggct tcatttgtag tgtttataac gaccagaaaa cactgaggct tttgCCttCC aacacctgta tcgagatcag aggtctggtg ttgaacctgg gcagcagagc tggaagaagt gaatctttat ttttaaaaca ggttttcaag gataattatt gcaaggaaag ca aa gaatt t tctcaatatg tttaaacaaa gattagCaaC gcctacattc aagcaaaaag aactgggtca tgttaggcca atcagttgtt tt at ttgaa a tgttgccttt cagtaatatt taatttaagt tgtaaaatta gaagtattgt aaaatataag agaaaaatta ttacaatctt attctttaga gttcactgaa tttcttttaC ttgaaaaatc ga at taga ag tggagtgcag ctgCtgcctc ttttgtattt acctcagatg ctttCCttct ttttttttct tcttttcttt ttttattttt aaattcttca cta ttat at t tctatttctc atatatatat atgagatcta actccctgag ttcacaactc ctcagtgaag tttccgcaac cctcaagtca gtgCattatg gagctgcctc aaatgtgttg ttcccatcac atgactttct cttataaact ttctcttatg atggtccatt aaattgtaat gtgttgtttt aggggtatca atctcagcat cctggcca'ac gcacacgCCt gaggtggagg aaaactccat ttatgaggta gtcttatttC tttgtagatc gaatttatat tgttaatgta acccaaagaa ggtgatatga aattaggaaa tgatgagtct aatggtgtca aaaacaagaa ccttcctaga tgtgtccgtg attgtatttc atcactctac agttatttga aaaatgataa aactattcta aaggaaaagt tcaatgtttc taacatccgt cacatttcaa ccaaatagca ataataataa caa a atat cc taaatgaaaa ttcagtatga tggcataatt agttggtctc tggtgcaatc agcctcccga taatagagat a tacacccac tctcttctgt tatatttcaa ggt atgCCag tttccctatt tt t tt ttt Ct t a atat aaa a tttcttccct agcttcttca agcaagggag tccgggcttc agatttctac tccccgggag agctttttgg gctatataag tccatgtact tgatggagct a aa at tgga c tccacctagc agattttctt gtgttttgtt gctttctaat tgcagtttat ggcagatgtt taatcttact tccatataaa tttgggagat atggtgaaaC gtagtcccag ttgcggtcag ctcaaaaaat tcctaagaca gtccaCagCt aagctatctgtaagattgat gatatttcat agcatgtaag taaaatccaa gccttcagct tttctttttc aggactgaaa gagggta gga agcctcttgg tctaggtgtg atctcttggg ctaagtgttc tattCaatag atagcaattt ttctcataaa agagtttatt tttcttgaac ggaacttaga atttatgtga tattgtatta cagataattg aaagacatca tattaagaat aaagcatgca taaaagcaac tgtttcttga tcggctcact gtagctggga ggggt ttcac cttggcctgC atttttctcc tgtgggtgat tttactaata cttgacattt gaaaaattgt ctcctctctg tgcccatatg tgtcttgtaa agcctcggat cagtgaattc gctttgCtgC ccttggaggt ct tagagggt cctccatttt aaagtaaagg tcctcaggga ttgtttctca atcagggaag tcagttaggC attgttgttt tcctaaccag aggggtggta atgttgtctt gtgcatggca taaactgctg gaggcaggtg tcgtctctac ctactcagaa ccaacgttgc aaaagtgaat tgtacaaata ccccacccac gttctaaaaC tttcaaatcc agagacttCa tagatatcct tttctaaata acacgtaaaa cttaaatctC gctagtgatt tacagcgtca cagtcatata agagagggat aatgggggga ctctgaaata ttataatggt aatatctaga tcttgtatca tcccagtcac cactgcacct aaaaatacca a tt tta aa ta agaatgaaat tatacatgca atgttttcat t tggtt ata t a aaa tgata a tttccatctg tgtgaatgat gaaacctcta ctacaggtgc catgttggtc caaagtactg ttcttcctct ttctattgat gacct gtC Ca ggctttttag ctaaaaatag ataatttcaa gcatagttat ttttttacga ttctctttgg tctttgctgt tcagctctga gtttCCCaCt tttctcatgg tcagatcccc CCCCCtggga cctgagtcat catccctttg cacttCattc tttttttgca tcaagttatc aagtggaaac tatgaatcaa aagccttgct CCttctcatc gaaggccagg gatcacttga taaaaataca ggctgaggct tccactgcaC aaaaaataaa Ctagtgtaag aCCatggatt atttgtagat tgtgtgCtct ggcaaacaca aaatcaaatt atgagttttt gaaaatctaa CtggaatCCt gcttttgctt ttcattctgc cttaacacct ggaaggtggg ttgatattgg tattacttga aatccaatac gtaatCtCat tttttttgtt a aat aga agt tgaattttga gtgctaacca atctgttttc gttctgtaat atattaaagt tattaaagag taagaataaa ctacattttg gCtggtgcag tgtgattagt CCtcctgggt ctgccaccat aggctggtct ggattacagg ccatctctcc ctatCttCtt attaattccc ttgtgtttat tgttagatta catctatatt gtttatacat tcccttccat gctttataac ctggttgctc gcctttgagg gCtgtcctac Ctct CCt gag tactgtgccc Cagagaggtg cacacttcat ctggcaaatc ctctCtCata tctccagctc catcttgttc tgctagctat gtgtggaaag ttgcttttgc acactagtgt cgtggtggct ggtCaggact aaaatgagcc ggagaatcac ttcagCCtgg aataaactgc acccaactgg taagaaagtc caagctatct agtctaggag tgaatgagga gttatttgac ctgttaaagc ctcatagagt gttgacattg tagacttcat atCat cagga ttttggcaga aacatggagt gtagacaaaa ttctggaaCt aaaatatata ctacatttga aaattgtcat aaccggttgt ttaaagagtc ctCa Cat Ct tttggcttgt caagatcaaa atatgagcat ttactttcca ctctaagatg tt at ga tggt taagcaagtg ctgatttctt 75300 75360 75420 75480 75540 75600 75660 75720 75780 75840 75900 75960 76020 76080 76140 76200 76260 76320 76380 76440 76500 76560 76620 76680 76740 76800 76860 76920 76980 77040 77100 77160 77220 77280 77340 77400 77460 77520 77580 77640 77700 77760 77820 77880 77940 78000 78060 78120 78180 78240 78300 78360 78420 78480 78540 78600 78660 78720 78780 78840 78900 78960 79020 W0005851 0 fht:tw~ th aet o/oi~oC/eam upr/e~/eautdqV055 0. cpc?fromC ache= 1 pant=m aintoolbar--bottoml Page 4 30 of 737 WO 00/58510 PCT/EB00100435 tggtttgctt caggatgaca ggatgtgtgt tcttggcagc ggggtaagtc acaacctagt ggtttctttt tcatgtgtgt ctagggtgac gataagacag gcctccaaac aacatttagg gtgtgtgtgt atgtagatcc ttgtcacaat taatgtaaaa ttaagctgtt tagatatttt aatagatttt gaatgcttgt cttcttcttt aaaaatctga tataatattt acacatggtc tctagtggcc atgagcatta tatgaacaat gacagaaaga accttgagga ttgattttga ctcaaattta cttctacaca cataaaatta cccttccctc agagaaacta tcaggaaatc atgtttgtgt aaaaaaaaaa tcattgcaat tctatttagg ct at tagga c aatatgcagt tataatactg gaaaaatgtt cagagctcaa atgtccttca t gct aggtt t atatttgata ttgacctggg tgcaacacag gctcctctcc gctcagaggg caccattcac t ta ctgt tgc cattgcataa taaaatatat tttctaatag ccaatgaata gtattattga gctatcacat ttaaagaagt ggagtgcata aatgttaggt ttattactgt tttctatcac gtatttttgg ctccttggta tcagtcatcc tctgtcaagt ggcaaaagaa acgtaagaac ctggtgagaa aatacatttt ca atat aat t gtttttttcc gtgtgtgtgt tagtggtgat aaatttatat gagttaaata aggcatgaag tattatttgg aatcaatcac aaagcatttt taatcgtttc attcatataa taatgtcaat gttcttaagc ccgagctgca acccaggcat t ca cagt gct gaaacaaaat gactgctact catagccttg aacacatttc ctaaaccttt gaaggggttt ttaccatccc atcaaaagcc atcatcatta attcagatc acgtgcaaag aataaattat aaagcgatct ttagtaatga gt att a aat c aaccagttgt taaagctctc aggctgctct gtttcacctt taactaaata aagggaaaat tggcactcca agtaaggtcc attgctcacc taggagctga cccaacaggt tgtgaagttt ttcctgtact taatagaaca atatgtttat acatgcttaa atatctcata ttaaacctaa tgagcctcct tgtgcacaat ttctagaatt tttcacttct attatggctt a ga cggt at t taaccacgca gaagccagtc ggaaagtgaa agagaggggg tggaagttct cagacaaccc ttctcactgt agccgtatgt cagtgatcaa gtgtgtgtga cttaaatgtt ggagagatat atatagttct gaaaataatg tattgtcatg tctctttatt ctaccaatat taaaataaca ttttacctaa gtgtgtacat gjacagagaca ccccataaac t cga aggt cc ataatttttc ataggtgcac tggggacatg gtgttgggaa cttttctgta gagccttttc tgatgtcaga at acaga tga tccaacagtc tcatcaaata taaagagggc gtacacaagc ttttaaaaga tataattaaa ctatcaaact tgaaacaaat ctctgttaca ttctctccca caaatgttca ccagtcaagg aagcaattta ttgccagtcg gtctggactt cacgtcatcc ttcacgagaa cccagcacct gggaaacaat tgatttggcc at agt agta g tacaatggta tctatttcct atattttagg tttgaaagga ttacatttca ttacgataaa tacataaata tatccaaaca tttcttggta aacaaataaa tgttgcctac tttacggaag ttggtaatcc gagagctgtg gaacagttct catgcccact ttgagccacc taaactcttt aaatattctg aaatacagca tat tat ta ca gagtatttga tttaattata gttgataatg ttgtaagtaa ttgtttcatg ccaaaggttt attaggacca tttccaaaaa tgtggaagat ctgtaattaa tagaaatgta tctttgatag agataaatca ctaagttaag tctcctctgc tactgattca attcttccct atcagtgagg ttcagaataa ccatcctttt gcaaaaccat acacattcct gcattttcct cctagaggcc atcactaggc cattccagaa gaatatatcc caagtctaat ccatactaag aagtgtgtat ttctggctcc aaactcccca aattcccaat attgaaggta aacatgctgc caccttacct attcactcct gttccctgta gcagatcctg ttgatacaca tcctaaagta gtactatcta ttggcataca aaacgtattc gaaatggtaa aagaaagtga agacaagaat ctgaactcaa atttggttta tcatgatgat tatgtgtgtg acagaaaata tcaacagtgt atgacgttac cagcagacta ctgggaggct ttttcttctg gagcatgggg ttaccctagg tttattattt aaatctctgt tctcaagcaa taataattgg ctttttttag gaaactcatt atattttgta tcagttttat cctcataata aagcagataa tttctggata cctcaagcaa tgggagagca t aaa at ta gt acagcacatt ctcttaacaa ccatgctctt actagactaa tcattatagg ttttctgact caaagcctca gaagagcagc atgatcctac tctgccttta cctattttta ctgatgagca aacacccaca cagaaaaggt tctttgcaag a ctccagggg attcattttc gaccaaagat gttttaaaat gtattgaggg t cct ttat gc cccatggctg ttctgagtat agccttccct ttgatgcggt ttaattgctc tcctcttttt accgtgaagg aagggcccct ggct caaaa g gaggagccaa gcaagact tt gctcttttta aagacttaaa aatggtaaac ca ct tgct gc atttatcatc atgtaagcat agaatcaaca tgactattta gatatgcata tgtttacttt tctttttact cagcagccct gcaagggaac tctcagaaaa ccggacaagg agagtcctgt aactcctggt gtagctgggt caattcaaat tattgtgtgt aagacttttg catttaataa agtttgtcca atagatattt at agggt t ta gctgattaca agaatacaga aggtccttga aaccacttta gtgactttaa acaattcaca aaaatcctct atgcaaatta caggaattca tgttgagaga gttctcttcg ccttttgtcc atcgctcatg t ggtcaccat ttcttagaat gacaagacta aaagagatca accct tactt tgtgcaaaat tggaaaaaga agagtctagt attttcattt ttttgtttaa tgagaacata ttgcaacacg gaattgtctg tcctggagaa gaatggct ct tactgatttt taatttataa ggggggga tt tgccagggga gggtttctca ttatcacaag aatctaaata tttgttttga tttgatattt act gcaaa ca ttttttatct attttcacta agctctatta tttctcatac tttttttctg ctctaattct aaactaaata ttgccgattt 79080 79140 79200 79260 79320 79380 79440 79500 79560 79620 79680 79740 79800 79860 79920 79980 80040 80100 80160 80220 80280 80340- 80400 80460 80520 80580 80640 80700 80760 80820 80880 80940 81000 81060 8112b 81180 81240 81300 81360 81420 81480 81540 81600 81660 81720 81780 81840 81900 81960 82020 82080 82140 82200 82260 82320 82380 82440 82500 82560 82620 82680 82740 82800 W0005851 0 DttplMwwgetthepatentcomlLogin.dogISexam.supportpetchoefault.do NVO005851 0.cpc?fro mCachie= 1 pnr= ma intool ba r--bottoml.Pag e431 of 737 WO 00/58510 PCTIBOOIOO435 tcctattgta gatctcgtat cttttaagat ctaaaagctg tacatggaaa tgtcccagca gccaggcctg aagcaca ggc ctgtttcaga attgtaggcc tttaggatgt ttgaaataag ttctttgtat atgacaatac attattacat cttaatgtaa atcaatattt gaagtatatt gttcatgatt agtattcaaa atgaatatat atattgtcat tctttgaaaa caatttgtct aatcctatta tcattgtaaa cactaaatgt aacagtcaat ccgatgctag gaaa ctggaa agtaacacag ttatacccac aggtaaggtt aaccctcctt attttattaa aaagagttat tccaatacag gacctttcgt attcttctat agaagaacaa gaaggagaag gaaacagaaa gcactttact acatttgtgt tcatttccca tgagcatgaa tataattatg atatttctag gtttgttcac aacaatattt attagggttt aagctgtcct agtactccag agaatcaatg tggacaattc tgtagtggat ccaaaactga tgaaaatttt tctctcacat tcttttgagg aaacagtgtg ttcctcttcc tgtgttgcca a tat gca ga a ttccacagag tttccgatgt cacttaatag tattacttcc gcatccagat agctcaagtc gccagctgcc ttgcaaagga tccataaaca aaaggttaaa acatgcggaa gggtaagtag gccataatca tgcagagata tacacttcta ttgattcata gaataattca aggcaatttg agaaactggt aggaagttct tttgattgta ca gt tt caca aagtatttga atgagcataa ttcaggtagc ca at caa at t tctgtttcat aaccatcctt ccctaggttt aaattctgtg.

accaacaaaa ttacgattca taaagggatt tcaaatccat ttcacaagca gtttaatcct gaaacatgtt acaatgacac aaaggtcact aggccattta aacatgcctt gttccgttat tataattatt aagtcttgca atct gt tt tt aattgaagac aaatgatttt ttaaatgcaa tccaagatta cttaatcttg gtgcattgtg gttgtgacat gtctgtatta taaaggttta atactggtac cacattccag cttagcttat ttt tgcacat atgtttatat caaacatact cctataaatt tgtgggaaca gtttcaattt ctactctgtc ttatctgttc cttacttacc ctctgtgcca tttatgaata tcaaggctga ccacctccat gggtctctga aaaataaaat tatatatgta gcaaaattca tatggctaag ttgtccttat tgagacttaa tcaggaatag tgaatcatta gaattaatta gaaaagacta aagttcatga tgtctttgag tt tca at tt c aattaagaac ggtaattttc atggctcccc atccatagtt catcagcatg tgttatgtaa gaaacagatt ttcttaggca gt cagctagt ttgtatctaa gtgccttagt taccatcacc aaggcagtca gatgaagaCt ga att ttc cc gctcagaagt atacctggcc cttaccattc tcattatagc taacatagca ttcaattaac tcctttgaaa gctgataagt tttttccatt taacctttat taagtgattg accctctgag tttgaactta gcatcattgg ggatttgggg cctcaaatat atttaactgc ccataaatta aggacatagc gCatCccttc tttgcatctt cttgcaagtc agcaaacatc tactccccat cctttgcccc aaatgttgat t a aga tata a attaagtgta tctgtatcag gaattagtaa cagactgggc ccatttccga tgttgttaat ggcacagccg cttctgtttg gaaatcgaat tctatgaaga tttttctttg tagtatgttt ctattaacta gacttactca tacagaattt tttggatCag gtttccattt tataaaataa gtataattgt aatacatggt gttatgtgta tttaaacaag atcctcatct a agt gtaa at gatgacagaa atacttttac atttatgctg agatgattgg cttcttaaat ataatctttt aa cat tggt a ccccttaagt tcttgtaaaa atacattact acatatgtaa attttgaaag gacatcaaac ttcaaaatag ttgaggattt ctttttgatg gctgatatta actcataatg gctgaggaca gatggttcta ccattgaagt ttaaattagt atgagtaaaa ttaaaatttt gatacaatta cttttaagtg catcctgccc ctttagaaat aaagacaagt gcagaggcat tatctaagct taatcttcct cccagcatat aggcactgac cttggaaatg tatagaacat ttgtaaatta actctggata tcgttatgtt cctaaattct tctcgatcac tttgggaatt tttgattact tgctttgctt atcaggacag tcatggagcc Cttttgtgct tacaacttct aatgcatgtt tatgggtaag tctttgtatg aacctcaatg aaaaatttta tatctgagat attttgatcc aatcagttca tattctattt ccaagtgagC ttaagtgaat aacggaagca cttttatctt ttttatttgt atttgaaggg tgacgggaag atgtctgcac at actcaa tg attcttttta atttatggtt tcaagcagtg tctaacctag catttcggcc actggatttg tcttttggaa ctctacttcc gcttgccaag gtgatcctaa agtaaaCtaa cgaaaatcaa tcaaagaaga gtagctttag t tgtt gt tca ggagggtcaa ggagtctatc gtgtatttac gcaatcagac tgaagggtaa ctcaataatt ctgaat ttag gaa taat tat tctacttacc t gccaa at ca gctgtttcta taatctttta aattctatat ttgactcctc cttcactggg cacctttttg aagaatcatt tcaggttccc ttgttttaca ctgctgttac ctccttattt tctccatagc tgtcttcact accgtatagt tcgatttcaa aaagttaggg gcgggttcaa agccacaggt ctaggaagac ttttaaccta aaaaagtggt tagtatgttt ggtaagtagt agaaagataa aaggctattc a tttgt att a aaataaatgt atccttctga gaactatgga tctgtaatct tctattatct atggatgtac ctatttaggt tatcttgtcc aaagattggg aaactttcCt agctggaaaa taatcaacaa atataattct atccagcata tatgctattc gaaaaat ctc acagccttaa agcaagatgc tgaaaaagga ctcggtaggc tcagttctca tttttgacag aactcactga tgatcctaca aaaagaaaaa aatttacaaa gccagtctta a taa ct tgta tccgaaagat taactgggta tatatccaga aatatttttt atgtagttca gcatatatac t tgt ttt agg agatgctaac tacttaggtg a atat ta ca C atgatagtat atacagtaga ttatctagag agaaaattcg ttctggattc tctgcctgtg taagttcagg tgatcctctt taaacttttc 82860 82920 82980 83040 83100 83160 83220 83280 83340 83400 83460 83520 83580 83640 83700 83760 83820 83880 83940 84000 84060 84120 84180 84240 84300 84360 84420 84480 84540 84600 84660 84720 84780 84840 84900 84960 85020 85080 85140 85200 85260 85320 85380 85440 85500 85560 85620 85680 85740 85800 85860 85920 85980 86040 86100 86160 86220 86280 86340 86400 86460 86520 86580 W000 5851 0 [httpJtwww.g etthe patent. comI1.og in.dog/Sexa m.supporIFetchiDefau It.d ogNVO005851 0.cpc?fromCafe= 1 part-maintoolbar--bottoml Page 432 of 737 WO 00/58510 PCTIIBOO/00435 ttgatctctg ggatacattt ttgttgtttg gtgcaatctc cctcccaagt tagtagagat tctgtccttt acatatatca attgaaagat aagcatattg atagacatca tgaaggcttc tgggtgttaa ggaaatggaa tcaagtatgt tatattatat ataaattgct atatctaccc ttagtagata accccaacac tctgagagta agggtggctt tggccaaaag tttcttcggg gcccaagtat ttcaggatgc ccagtcggtg ctgattccca ttgttcggtt gqagaataaa tcccagcact cctggctaac tggcgggtgc gggaagcaga agtgaaactc ataaaagaag attactcatc gtcaggtttg tttatagata atatatatta ctgtggtatc attttaagga aatgtagaaa aaataaagta gtgtctgagg aattctgtaa aagtcaggaa tcagtgctat aataaacaga tgtagcattt ccctaagctg aaataacctt gcaacaaaaa gtgaccatta atcaattgaa ttttgattct gatggctctg tacagtcctt atgtgcaatt ctctcagttc aggacagcag gctctctaag ccagtggtca tcccaggagt tttgttttgc tttgtttgtt agctcactgc agctgggatt ggggtttcac gaaatgaatg ttttagtata tattcctgag tctttttaaa caaaagttgc cttttttaag ccttaccact ataagatata atagtttcat atatgtatgc attattagtg tacatgaaga acttattgac aaagcttggg gcactccagg gatactagtt tgttgcttac aaaacatgcg agagtgactt gtggactcca aaaaccaccc t acact ga at ggttgtttag ttgattaaaa ttgggaggcc atagtgaaac ctgtaatccc ggttgcagtg catcacacac cacgatcatg tatgtttcat tttaatagtt cttagaatga tctctagcct tgactaaaaa agcacttcca aattgtcaat aaataaaaaa tcactgaaga gtctgaaata acagtctctt ggcattgctg aaaagggtca tcttgagaaa ataaatactt tgtgaatcaa acgctaaact aagttgtaaa atgccaacgt agctttttac aattggaggg tttctcttca caatcgagtc tctatgatac ggacaggata agctgccaac gatggtgggt cttctcattg cagaaaggca tgtttttatg aacttctgcc a caggcgtgc catgttagac acaaattaca tccttataga gatgtcatcc ggaaagctga gagttactgc ccaacctcta gatttattac tattaaatat gccaacctcc gccaacatct gagtgggggg a ga tca cat g acagggatcc aaagtgatgg agcatttgga ttcaacacaa tctggaaatc ta aatga tt g cactcttctc tattccacaa tctccacctt tgaccctgga t tga ttga ga tttcttaaaa gaggtgggtg ccagtctcta agctgctcgg agctgaggtc acacacacac cagagcgtta tattttatgt aaattcatct cattaaagat aaaatggaat aaattat cat tggaccataa attgtcagtt atgatcccat aactgggtcg tat ggt at tt ggcttgacgt at ca ca atat gtcatttcag cttttaagtt aatgaatttt cttgtataaa aaactacaaa ttttctcatt acttctgagt gagcatgagt ctaccaaaat gtagcttttg atcttttccc cctttatgac tgctgctgtg tccagtgcgc ggatggggca 131 cttcctacta aaatccccag cagcctcggc tcctggattc accaccacgc aggctggt ct tgctatttat ttatctcaca actctatcac tttttaccta atttgcatcc gcagctgcat ttttctactt aggtgtgtgt atattctata taaaaagttt aagaatcaca atctttggtg cagagatcct aatggactag gaattcacaa gctctggccg cctaagcact aatataaatt tggggactga cattgtgtgg ctccactcta attcatggac gaagtgaggg ggggccgggt gatcacctga ctaaaaatac gaggctgagg acgccattgc acacacacac tgctggctac gagtttttag acaatcaatc tttggtagct gttgtcattt agtatagatt tctcagagtt attaatgatt ttaactggta gttaccatat tcaatgcttt ttgagaggca atctatgaca agaggtgatt tttctttgat cagtaatagt tcacaacaca gaagtcttga aaattgataa aataacatc atattcttta ctaaagggat cttatctaaa agatacagga cattcagaca ataacaactg ccaataactt ctgcaaggca gaattcatgt tccttctcat gctctgtcac aagccattcc caggctaatt cgaactgctg gccccaaaat tgaaatttct ttattgtttc aacaacagtt tgcctatctc aatatcattg ttaaataatt atatatatat tataaatata a cat aga aa g tgagcaatct tttctcattg cagggaggaa agtggcactt ggatggtaac tcctaagaaa ggccattctt caaagaattt agtggaaaga cagcatcaga tctttctata attgtggttt gaaatgataa atggtggctc gatcagaagt aaaaaactag caagagaatt actccagcct acaaaattaa ttttacattt atctacttag ttactttatg aaatctggcc atgagttcat gctatttttt ggacaagagt tccagtgata cttctaggaa ggtgtaatct ttttttttga gtgcaaaaag ttctgataca ccattataaa ttttctctaa agacaact tc aatagtgaaa gtgtttggat caatgtaagc cttccatgtg ttttgaaggc tctttgctgc atgatgaact atggttatta caggcattca aaccaatgac ccaccccttc ctgctttctg at ccat at ta tactatgttt tcaggttgga tctgcctcag tttgtatttt accttgaaaa gctaacttcc ttttgcaccc ctctttatat tcatttcttt ttttaggaaa atagtaatgt gggtatctga atatatatat tattacatat acatcttgga aggtagcaat agtatccggg agtgattgtg gacaaactat attaataaca aggctttttc gcatgaagtc taattgttga ccaagtgtcc agccactgcc aacaggatga ttgtttgttt tatcagatgg acac~tgtaa tcaagaccag cagggcatgg gcttgaacct gggcaacaag ttaaaaggta ttacttttac gcatttgtag catatatgta agtacaaaaa tgttacctga a ga atga at t tctaaaacac taacacaact attcaggtag aatctctttc gtattacatt ccttctactt agatctgaga ggtgggtatg gttttaagag cattagtatt acaaaacaaa ctgacccaaa cattctctac gtctctgata tgtgttgata ttgtcatggt ttctcagtag atattctgcc tacctcactg ttggcttcat actacttggt ctgttctgct 86640 86700 86760 86820 86880 86940 87000 87060 87120 87180 87240 87300 87360 87420 87480 87540 87600 87660 87720 87780 87840 87900 87960 88020 88080 88140 88200 88260 88320 88380 88440.

88500.

88560 88620 88680 88740 88800 88860 88920 88980 89040 89100 89160 89220 89280 89340 89400 89460 89520 89580 89640 89700 89760 89820 89880 89940 90000 90060 90120 90180 90240 90300 90360 W0005851 0 http:/twww.getthe patent.co mfLo in.dog/Sexam.suporIFetch/Defaut.do/WO005851 0.cpc?fromCarhe=l1 art~maintoolbar--bottom1 Page 433 of 737 WO 00/58510 PCTIBOO/00435 ctaactcctg gaacttttgg agtcaccaaa tacctcgcct aagctgtata caaatttata agttacaaat atctacctgg gatgtgttac atgtataaga aatttgtggt ttcatggaaa a atttct ga a ttgtttcctt tagcaagaat attttatgtt cca ggt gact gtatacatat tatatttata gtaaatatat gagcatcctt tggtaaaaac tcttcttatt tttttttttt gaaaaattta tttgataaaa tctgtttcct tgggttttca actcagtcaa ctgactaaac acatatgcat acataggcat acacacatac acacacatat acacacatac acacacacat ata caca cac aaatatacac aaatacacac a ca ca cata c acacacatac tat tatgtaa ggccaatata tatattttaa agataacttg ttgtttccat t gaaggtaat gaattttccc at tgt taa ct acaataattt t acgcat tt t cgtagcacat cagcatttat ttgtccataa gagatgaagc gaaaaagaac cacacatatg caaatctgaa cgcttccagt tttttctctt ctttaatgag cttagtctga gtctacacag accagatttc gggaatactt cacattgaag Ctttgttttc ccacagccaa gaaacaaaag tttgccacat ctacatctct cttttctatc aaatcagtaa t tca ccgt ag gagaatgttt gaatccagag ctgtttagca actatgtagg gctccattac ccattatgaa atatatgtgt cagtaaatat atatgtatat cttcctaaaa agttattatt ttttaactgg catgattcta aagtaggaca at aa agagt a ttcaaagcaa ttttctattc actttcctga ttgtgtttat tcgtgtttat tcgtgtttat gcattcgtat gcattcgtgt acacatatgc acacacatac acacatacac acacacatac acacacccat atatgcaacc atttgtgttt ataaaattat ca tagat tt c t tcat gga at agatagtaca agacgtttca tgtacccatt atatacagtt tgcttttgct acgcagaata agggact ttt agggaaagca tagaccagtg agagagagtg gtgtcgggag caataggatg a atga gaga c atattcagga ccaaaggcag aaggctttca tct act gat t ggtttaacca aaaggtactg acaaacagcg tgcacagccc gttctcagta attgctttca a at tt caat t tataataaat ttgctttttt gtgtctgtct cttttctatg taagttaata tttgctttgc atctgtgtgg gagttatcat gcaagtaaaa tgatattgtg tgatgatgct ggtgggtatg gtgtgtatat atacatatgt gatacatgat attttcatcc atgtattgaa cattctttga agttatgtat tgttttataa tattacataa tttttgttaa caactaagaa gaacctgcct acctccactc acctccactc acctccactc ttatacctcc ttatacctcc atttgtgttt gcattcgtgt acatacgcat acacatacat ttgtgtttat atgtttatac ttacctccac atatatttat tcctggctgc ttaaataaag taatatgttt ttctacaaag ctgcagtctg gctaatatag taatattttg atctaataaa gcagagatac cagatcctgg acttggtcaa gt ggt acat a tctgatgcat tgtatgtata atttaattta caggcaggca tctggaggca actgattaga tcgatgtgga catttctggg acatttgtta tgtgctagct tcaaccagtt gattttcttc gattctttat ttgaaaaaat actagtaaat ctccctcatt ttgtgtctgt tttactctag ttatccaata tttgttttgt tgacttggtt tagaatgttc catttcttct cacttaaagc ggtttaatga tgt gt gta ta atgtgtgtat atatgtatca aagtgaagaa agtagttttt aaaaagatga aaattacctt ttaaggtatt ttactgtgat actcattaaa aggtaggaag gtgctgtcca ccatcaaggg atgaaatagg atgaaatagg atga aata gg actcatgaaa actcatgaaa atacctccac ttatacatcc t cgt gt ttat ttgtgttttt acctccacta ctccactcat tcatgaaata ataatataca aggtgaccat ttttaacatc aaaaagctaa gttcaaaata ttagcagctt aagaaaaata gcatcttttg ggatatttat aaacacttgt agtgaaaaac gttgcttagt atagatattt agtacttcta catatgtaca aggaactggg ggtct ga aga gaattccttc taagtcacgc tctcatctga tgctacagat aaaccataga ttaccatcca ctttcctaaa cttctgtctt ttatagaagg tccaatctac acctttcaat atctctatat atattacaca aaatcatgac catagattta t tct ga tct C tattttggtt tgcattctga gttaagcagc atttgaacag cttggttatg tatatatgat atatatgtgt cacaacatta ttgtggcctt atcatctaat tatttctaat tctctttata ttaaatattt ttcttatata gtc ttaa at t gagtaaaatc cagaaatgta acttcgttag aaatatacac aaatatccac aaatacaaac taggaaatat taggaaatac tgatgaaata acttatgaag atctccactc acctccactc atgatatagg gaaataggaa gaatatgtgc attttctaat gtcacttgca agagactttc tttttttctg taattttaac ttgattagat tcatctcctt gtaaatttct agcctatgtg tctgtaaaat ctacagcttg ttctctgaac tgacaggctg ttaggcaagg cacacacaca tcatgtgatc caagggaggt ttcctcaggg acattataaa aaaatacctt aaaattagct attctattta caaatgcaga atgtatgtga tcagtttggt gaaaggggaa agaaaagtt t taaattcacc ctatccatct tacacacaca aatatagatc cttatactgt tatattctct tccgtaactg atttgtctca aagtaaaaca gaggcacata atggtgactg gtaagagtgt gtgacacacg tatttatacg gtggcaatgt aattggtcct tttgtcatat tatatatata taagcatctt aacatcacat tatacactta cactgtgcct tcattcagcc ctgtaaagtg acacatacac acacatacac acacacacat ccacacacat acacacacac ggaaatatag taggaaatac at ga aat agg atgaaatagg aaatacacac atacacacac atataatata atgggctgca ttgattataa acagagattc tgaatattgc taacaaacta tctcatagca attggattat ggaatgaata aaaataaaga atttgttaaa aattccactc atcaatttac ttaaaagcta tttttcagag cacacacaca atggggctgg tttaacactg aacctcagtc ggacaacctg cgcagaaaca atcacagaac catgaccaac 90420 90480 90540 90600 90660 90720 90780 90840 90900 90960 91020 91080 91140 91200 91260 91320 91380 91440 91500 91560 91620 91680 91740 91800 91860 91920 91980 92040 92100 92160 92220 92280 92340 92400 92460 92520 92580 92640 92700 92760 92820 92880 92940 93000 93060 93120 93180 93240 93300 93360 93420 93480 93540 93600 93660 93720 93780 93840 93900 93960 94020 94080 94140 W0005851 0[http,:lhvww.getthepatent.com/Login.dog/SexamsuportIFetcIDefaut.do NVO005 85 1 O.cpc?f romCache= 1 part=maintoolbar--bottom] Page 434 of 737 WO 00/58510 PCTIIBOO/00435 cagaatgtgt ttggatagcg ttcataggaa atgagtagat tctcccacac atgaaaacag tcctcaaatt tctctcgagg atcaatgtac gagatgaatg taaaaatagt attataattc tttaattgca atcgtctttt tggcatcgta gtcattctgg gtcactttgc aatgcaggct tat cct gcat ttcagataaa aaatatttta tttgtacgtg aattctaagc tatggtttct t acat ga aa g ttattaatat agtgttggag ttggtgctgt ccctttcgcc gctggtgcca aaactactca ca taatgga a caataaaaaa cagaagattc aagtgtgtaa aataaaaata cggtt ctacc t ccca ggaa c gacaaaagtc tagtttttcc tctgaactga tgggagggaa caagtctaga tcgcaacaaa agaagtgaga atgtatttta ctctcacatc tatatcatta aaaaa tagag cactggaaat atattgagtg taaaagaaat tttacttgca taaccctgat ataaacactt gatgatttca gttatgcaga aagaaaaaaa ttccaatgta tatttcttac tatatacctt agctctttta agaactcacg ctagagggct tctcctattg cagtcctgtt aatgaatggc ctgtgcctta tgacttcaac ga ga agcaa g tgcactaaat agaggaatag gttgcatatt aattctattt actaaaaaga gaatccagat tttttttcat agaaaccctt ctggtattac tgtttttgtt tgcatggaag aacgtcgtct actgaatttt acataaatgt gtacctcttt ctccaggtgt taaccatttg gaaaatctct tgatatgatt gtggagtctg ccttccccac ttctgccatg tgcttgtaca gtcttaggta agtgagccat aagaaattat ccctatctgg tggagcagca tga agaggga tcgttaagct tcagactcaa ctgga cga tg ataggtgctt actgagcttg aattgctttt ttccttacaa acagatgagc atgtggtatt tcctattttc agtagaaata gaagagtgat ctgtctaata aaggaatgag ggaacrcaga acagctggat gccaaagttt tactgcagtc tagaactgtc tataaaattg cacagaataa acaatttgga gttcatgttc ggacttaagt ctctcttgat ggtcacctga cggcttccct ccagtgcccc gctgctctta ttagttaaaa aagcaatacc aggtagcact ttctaattta gacgagaaat tcctttgtct ttcctttaaa ccccgga gcc attttacaag cctgat ttt g ttcctccaaa caaatgcttt t cct att tt c aggttcatgt tccactgtat aaattct cat ttaaacaata ctaccaccct atctttattg gtttttttgt cttgcttata cagttttgct gtataacatt tggctgt tcc ctgagaggtg tctctcttgc agcaaaagct gtctgcagaa ctgcttggta gccatttgtt atgcagtttc aagagagaaa ttcttctgaa gcttttctat cctttcaaat aactcttgca gccttgaaat accagccaca atagagttct tctcccattg cttctgttag tgtccctcaa ttaaattctc ttaactctgt actgagctag aatgactttt atgaaccatg ccagtggcca caaaataacc tgcctatcaa tgaaatctta agcaaattaa a tct gtat ta aaataatttt aaacaagtga aaaaaatctc agtatattag atgtttaagt tactctccag aaacttctta tgaaacgaat tgcagatttt ctttctgtct gtgccgctgg tgatcccata gtttatttaa gcttttctcc gctycat cag tcaactgatt tccaggagtg aattctagtt tgctatgtaa ctgcacaaac ctttatctca tattatcatg tttcatgttt ttttgggtac tctgaaaagc gccgggtctg gaaagcaatg gaatattcac tctttgtcct ttgttggctt aaaacgattc aagaggaaag ctatcaaaac ctccaaatct ttcgggtcat tcctgctctg ccctgaagct ctgtgagcca gcaatgcaac cctttgaata tgactcgggt gtcttcctag acacattttt ttaaggtgtg gctgagatgc ccagaaacaa caattccttc ttcttggagg gtgctcatat cagtaaaaaa tttcctgcac a attgt tga c aagactgact atgtatttga agtttgcttg attttggtga tgtttaaaaa tggatcacag cccaaagtct aaagatccag gtagagcgtt actcaagcct agcagctgta gaatattcct accaaaaaaa gatatcggca cataatattg aagagcatat ttttggggaa ataaactaag acatcactgg ctatttgtgc ttccattgtt ctcccagggt cagaagaggg cagacttgca caattcatgc ttaccttcat ctct cctct c catgcaacta gagctcaaat acagagaggt ataactaaat ttccagtcag tttgaagctt ttcttgacaa at tca t ttat acccacagaa ctctgtctcc gctaaggata tccatattta ggtcttcCaa ctactatttt tggattttct gagaatctat tgtaataaag ca tgt tga ga tgggatggat gctgtatgac tcccgagaag attaaacctc aacagcctaa tat tt gga ca tccttgaact gaaaatgcag gcttggaagc agaagagggt catcgacccc ctagatggag atgtctttag cgagCtggct tcccagcaca aaaaaaaaaa tccatggata ttgtgcctta tcgtgtatcc at aagggcga ttgacaatgt aataataaaa agaaaagtta atataattgt ttgctaaatc ggcagtggat ttgctttaaa gtattatgaa a aaaa gca gt catggtgatt aatgttattt ctaatttaac attgtattag ccattttgat atcactttgg tggtacacta gaattctgag tggcagtttc tctttgaggt cccaaagcca aaaaccct tc aaaatctacc tcaaaccaat tacagtcgta ccaacaggag agcaacttta gatatattct a agt acca gc ggctacaccc gaaaacagct t tgat taa gt gcctgagt cc catggagtga acatgacaag ccagtcagtc aaagaatggg atctgaagcc tagggragtt cttaatttta acttttaaaa aaagtatgtt tgaaaattaa tgtgatcccc ccctcatggC gtgcctgctc ctgagcagat tttcctttat tacaagtata attaaaccaa taagtggtag gagctgtttc ctaacatata gtcgggtgcc tgattctgtc aaaactacct agggtctctg aaagtaaaat gtctccatgt a gt ca atga t atcaaattcc ttaggttggt atagagaata tttaaaagtt ataggyacaa aaggaatcat actttctcat aaagattcct tatggtcata actaactttc tttaatttat atattatgaa gtcaagCCtt tgtatgtttt aaaaatactt tttgtaaatt aggggctcag taatgaggtc tagctgcatt gtaaacaaaa aaaccaatta 94200 94260 94320 94380 94440 94500 94560 94620 94680 94740 94800 94860 94920 94980 95040 95100 95160 95220 95280 95340 95400 95460 95520 95580 95640 95700 95760 95820 95880 95940 96000 96060 96120 96180 96240 96300 96360 96420 96480 96540 96600 96660 96720 96780 96840 96900 96960 97020 97080 97140 97200 97260 97320 97380 97440 97500 97560 97620 97680 97740 97800 97860 97920 W0005851 0 fhttp:/Mwww.getthepatent.com/Login~do/Sexams pprtFetchDefautdogVU5b U~~'rmate art~maintoolbar-bottoMl Page 435 ot 7:37 WO 00/58510 PCT/IBOO/00435 aaacagaatt cctacatttc tgagaatagt taatacattt aataaaattc ct ttct t cat t t tt tgct ta agttgccaat cttaactagc cactgaggag taacataaat aaaaaaatgc aaggcattac gagt tattt c tctttctttt taacaaaaac cccatgtttt aaaaaaaaaa gtaatgccta gtcagatcct ctatgatgta atataacgta attatcatca aagaattcta atctggaaat tcttgaacag atatctactg aataaacatg gcatttattt tattcttact aaaatggaaa attttataac tcaaatccac ggctttctga tcttccccct tgaattatga gccaaaactg tgaattttta tcaaaagttg ctttcaggta cttgggacgt atcactaacc cataggcttc tcaccaagca tttacagata ggtaagtata gatcaaagga aaattaacag gaaattatac gctttatatt tgaagaaata atgattggaa caaaacacca aaattagcat aagatgaaag gaatttcttt agcaagaata tcaataagta ccattagaaa ttttgcaagt tagattttgt atgaggtgct accttttaaa attgttttga tttctaattt catcagatta ttttaactgg aaaaaagcta tatatcattc atataaaatt ttaaacatag acacatggcc ctctaagagt ctgagataaa aaatgtcctc ttggggcttg ctttctttct tctttctttc ctttaacata tcct tgtggt aaatgtatat actatttctc ggcttatagc gaaatgataa tcatgcataa ttttattata tttaagaaca aaagtcaaca atattaattg ggattatcta ctcccgtttc ggttcagcta ttctctccta attataataa acagaccaag cattttagtg gctggcttcc acacattgct cagagaagga aacaaagaaa tatagagtga gagaatataa tgtttgaatc tcagctaccc tgagtgtgac agcttattca taggcagtga ttgaaatttg taaactcaaa aacttctata tacattagaa agaataaaac gaatcagagt gtgcctgaga caatttttca aaatcaactg gataggagaa a gaat ga aat cacaattata cttactgcag ggcatttcga ggaaaaggca gcatagccat ggt aatct ct gaagaaaagC tcttgtttcg atgaatcatc tattacatta ttttaaaaga aattataatt a acat ta act tctctatatt ttaggcaatt ggaagcaaaa agtgccactc t gat t ttgaa ttcttgactg agcataataa caaattcatg ttcctttctt tttccttctt taaacagatt agtctgctcc atttggcggt tcatttgaat t gga tact at atcccacagc ggcctcttat gccaataaat tacatataga caaaactttt t cca cat tcc catggtgcca tat ggt gttt tgtaagggat attacagtaa aaaataagaa aaaatattcg ctctatattc ttggagtgca tgtaaatcag gtagatgaat ctggtcttgc cttgtcagat tagaagatta aaaagcaaac tcaaaccatg agagacaagt aatcagtttt tttatctgtg tagacacagt caagggacta aataaaatct ggagatgaag agaggaatta ccttgaaaaa atattccaga gtagtataaa aaaattttta atatttaaat aacttcacaa ttgtctaata ccttatttgt taataattat attcttaaaa ttgcatacag ggagagatac agccaaggtt catgtactat 134 agagaattct a attt a a aga ttaggctaaa agtcataagg gctgaagttg tttgaatgca agatgcaaaa cagcccagga agtacacaga acgtagtgga tccgtactca tctaggataa actga cat tt ccctccttcc tttttatttc gataaattac aaccatacca gtgatatttt ctgagttgca agagcatgtg agaatgttca aaaaaacaca tgccagggat taaaatatgc ctatcctgct ctactttctc gacacccgtg atcatataat ggtaaaggga atgttcagag agttatccaa catagaattt tctttctgtt gacattagta ttattattta ttaggtagaa catggggtta caggaggata tacccaaatt cagggatttg aattttgctt caatcaat ct caaacatgat aatgggaa ta ctacaaaaat tgtattaggt aaaaaCctga atagaatgag agagacaagg aaagaaaaaa gctgaggaaa tacaaagaaa atgtaacctt cagtaattga gctgaaacat atccaacaat attgctaaaa gagatagcag atccacgtgg aaaatgtatg tcaagaaaat ggggggat tc tattcatgaa agtctaaact tttttttcaa atatgcaaaa ggaaagtcat ctttttgccc tatatttcca gtgtagtaaa gttaaagttc cacacaccca aattaccttt aaatattttt gtagttaatg gatgatatcc ttccttcctt taaaggaatg tgagcaaacc gcaaggccta cttaaacaaa atttagacac ctgtgttcct aqtgaaaaag gattccaaaa tttaaaaact attcaagatt gctggtattc tctcaagttt aaggataggg ggaggacatt atatgttcat gtatgggaat gtccacagta ggtatgcttt tttaacatat atacagacaa tttatatgtt agataggaag gtctccaact gaaattaaag aagcagaaat caacacaaga aagggtctca ctggaataag gggcagcata aacagaaata act atgt tt t tatctaaaat aaccataaag cgagttagaa aggacagaat ggatgggttg gacacctgca tgttggtgat gaaaagaaag tttctcatca aataactgaa ca cat tagaa g cat aga aat ttcattgaaa agttgtattc tgtatgtgcc aattgtcgtt atactttttc ttacatatat cttctaaaaa act ttt tgaa ttcccttcag tttagtggga tttgcaaatt aagaaattac gcaacactaa tgacagctat ttttcacagt tttgggaaaa ttccaaaatg atgctacatt caggttagaa tctttctctt tgtaaattaa aaactgtcca gaaagagcaa gatttttatt aaatcctgag gactcctcat aaataggaaa tgacatggtg atcattctct ttgtaacagg aattttctat act ta aa aa a tagtggagaa cttggcttgt tacagaaaca ggtcaaacag aaactataca ccttgcccca gtaacggcgg cttctattcc tttaattttt gaattgctga cagaataaat ctagaagccc tcaggatctc tacacattgc ggttggtaat gcaatttcat tactacaggt acccattaag tagggaaaat atttaaaaca cctatgggtg gaaactcaaa gaatggttag aaataatgtt ctcagattca tgtaaaactg agaacataag acagcaacgt tctaatgctt attaaatagg agcatccagg t gt tgggca t cagatgtaat gacacatgta gtggagagaa taccccttgt tttttaaggt 97980 98040 98100 98160 98220 98280 98340 98400 98460 98520 98580 98640 98700 98760 98820 98880 98940 99000 99060 99120 99180 99240 99300 99360 99420 99480 99540 99600 99660 99720 99780 99840 99900 99960 100020 100080 100140 100200 100260 100320 100380 100440 100500 100560 100620 100680 100740 100800 100860 100920 100980 101040 101100 101160 101220 101280 101340 101400 101460 101520 101580 101640 101700 W0005851 0.fhttp:/Avww. getthe patent. comlLoginadog/$exa m.suportFetcti/efa ult.d OgAN000585 1 O.cpc?fromCache= 1 part= ma intool bar--bofto ml Page 436 of 737 WO 00/58510 PCT/IBOO/00435 tggtttgatt acagcacaga agttctgggg ccaaatctct ttaaacagtt gttcactcca catgagggca tcccttgctg aggaagtgat gtaacttcca ttatagcggc ggatctaatt accagagttc ctaccagcac tgtttatcag tcccccaaaa tgaataagtg caattgcagt atttataata t atgtaaat t gaagacatcg ctctaggata caatgatttt gcaaaagcat tgggcatggt attccattct actggctgta ccgaagtgct ttaaattata gtttatctac attattcgac ttgtaacagg gtgttctctg agtgaagcaa tttaatggat aaatgtcaag caatgtctgt attgtctcaa atgatgctat ttcagtaatc ctgttgccag gcatccttaa ttttatgtcc taccgttatg aaattctcat tccacct ccc aggattacag tttcgccatg ttctgcatac ggtagagaaa cattcatgaa aagcacatat atttagaaaa actagtaaat ctcaggcttg ttggaagaaa cacgtgttta accattatga gcactgtgtg cctgcaaaag acattctaaa ttttgtttgc tcttgaactc ttagttttta ttaaggaata act taaatga ctacaaaatc ctatacattt acattcatac gagtcctcat cgtccttcca ccctctcctc gaatcttgaa ccatacatac gtttcattaa tctccttcca cttgatcttg ccacccaatt caaatcaagt aataaaggta atgatactga tggaaatatt cccaaactaa atctcaaatt aaagattaaa tactgtgaag gt cgcagagc tccaaaaaaa aacccaagtt cagtcctcac aaacctttct ttagatcaaa cgcatt aggg gtctctgcag ctggtggcaa attcttgtgg cgacagggca ttctacatat aagaatgttt aggtgggcta atgaaatata a atca ag ta a cat catccac aattaaaatt ttttttccag aggtactact gtttcacagt gctgtcaccc tggttcaagc gca cct gcca ttggccaggc aaatttcaga agtaaaacat tttacctaca ttaatggaga ttatgacaaa gttaagtcct tttaagacaa tgaggcccat tccagcccct agattcttac atgaatgctc gtagctagta aaaagaaata ttgtttgttt ctgagcaatc at ta aa a aca gtgttgtgaa ccttt t tcat catcctttta ggtactatat gtgtttttca gaatgaggtg ccatgtgaag tccagacacc tgtatatctg caaaagctgt aatttgatta ctgtgcgagc gaattcccag tatgcttttt gactggtaca ga gtgaa tgt attcacttaa tctcaaattt aaagacatgt acaatattta tgtttgatat gtgtagccac caaatgcagt cccatatggc ctttccctta tcttgccaaa ttttactagc ggctgaaaat atgtgcaatg tgcagcatgg atatgaagtg tgctctgtct a tact at aa a ttggaaactt ttcttcctaa cggtaaagac aacaaggaac tttttaataa tcccagatat tcctagtaaa attattttgc taaaaatgta agataactaa aggctggagt gattctcctt ccatgcctgg tttaacataa aaaattcact tgaaaaggta atttcttgga aatttgtttt aactcgttca gcattatgca atagcactga atataattga gcaatatagt agtcatggga tggcctgtgt aaagcttcag gtttgaccaa gtttgacaga tgcctgtctt actaaaatac gtgtcttcat accatccaaa tttttactgt aagttgtatt acctatgggg agtgccctca gcccagcaag aagtgaccct t tta taa gcc ggcactaaca tgaatctttg ttacaaattg cctccagagc cattagaatg tgcctatagg gtattgcctt gaattatttt acagaaattt cttttctctc actgtattaa ttttaagcca atgacattac tcccagtgcc aatgtgagtt aatagcacct gtccttgtct ctgctctgcc tatatgccat tttttaaagc cttacttcct gcatattcag aattggaaat agcgactcct ttctaatttc tggagtttgc cagtggaatt tgtgtaccca atatttgatg acattgagat gttgaactat aggctataaa ttttagatac aattatatat gcagtggtat gattctcctg ctaactttcg ttgattatgt tggaaataag actgtttgct agtagaaata ttatagtgtt ttcccttttt caggggttaa taggctgttc atatatcaaa gcattctgtg tgacaagact gga taaaat g agaagatagg agacatggaa gatagggttt ggcctcccaa aaatatctcc tttaggggtg taccgattga ttaatacctc gccat caaat tcctgggtag tataggagac aggaaggcca gcaccttgat aaccagtctc aaatccagca ctacggccta gccgctaaga tgtaagcaat gcccaaaaca ctcagtaata tgaatgtaaa tacatagttg gataaatatt actgt ccatg attgtatata gatcctatta cttcagaaaa aagaaaatag gaacatcttt cttttatttc gggatgtgca aaaatccatc caaaagcaga acttgatgtt tggagtagtt tatgtgttta aaggtttacg gccaccagca tccttaaaaa ttgccaagct gaagtaattt ggcttcaaag gaatttactg tacaaaatta tatataacct catgttaacc aacaatcata atatatatat gatctcggct cctcagcctc tatttttaat ttcaaaaaat ttttattagc ttaacattta tat tctcaat atttttaaac tggaaaaacg taaaatttag cataaaactt gttagtaaaa ctacactgtg tctgtaatgc ctttagaaac acttctgaat atttatttga ctccatgttg agtgctggga acagttatca attgtgttaa gaatgtaaat ca cat attt t gaatattcat atgattaggt cccagaacac tctatgaacc cttgggcctc tggtattcca aagaagagtt aacagcagag gacaacaaat aaatttctgt agtaagaaaa tttttttgaa cctttaatac tgtagaagca atatttattt taagt tagtg tagatgcaga ttaaaatcat cttcaaagca ctaatataca tacagcagca ctgtagtcaa tctccaggaa ttgacacacc aagataaaat tgagtgagac gatagatata ggatgtttat tggtgagagc ctccatttct ataaacccat ggctttgttg ttaaaggaat tgataaacag aagtccatat acaatttgtg tagtattttt tttaggacta caatattttc ttt t tgagac cactgcaacc cagactagtt aaagacaggg aagaagcaat ttacactgtg cctgtaaaaa gttgttttag ataattttta atacttaacc gatgacatgg gttatattgc agacaaccac aagatcgcta aatgattaca atgagagata ttgggtctta.

atttgacata ctcaggttag ttataggtgt 101760 101820 101880 101940 102000 102060 102120 102180 102240 102300 102360 102420 102480 102540 102600 102660 102720 102780 102840 102900 102960 103020 103080 103140 103200 103260 103320 103380 103440 103500 103560 103620 103680 103740 103800 103860 103920 103980 104040 104100 104160 104220 104280 104340 104400 104460 104520 104580 104640 104700 104760 104820 104880 104940 105000 105060 105120 105180 105240 105300 105360 105420 105480 W0005851 0 [tqpL./www. getthe patent. com/Login.d og/$exa m.suppo rt/Fetch/Defau It.dog NVO0058 51 0.cpc?fromCache= 1 Da rt=m ain tool ba r--boftom]_Page 437 of 737 WO 00/58510 PCTIBOO/00435 gagccaccat tagtgcaatg gttggaggtg cttggtccca gttgttaaaa cttcccttcg tggtatgctt attacccagg ttgaagtgta aaagactttg aggaagaaca aggataattc tcagtggtca catgggcagg ggaacaatct caartggaat tt taaaggaa agtcttccct acagggtatt aattttcagt tcagggaaaa tcaggggggc agagccaaga gagagaaatg cccatgagga cctgctgcta a gca aga ta c ct tgccaagg tccctacata gagccattca rgggggcttc cttctttttg tttcctacta tctcctttga agagatgcta cgctagactt gttacttaaa actgtataat ctgtcctctg ccagt ttact gctgttgagg caacctaagt ttacagaaag ccctaaggtt ttttctttct ctatgctaca atttgcttga t t acat gat t ccaacgttta tttactgcta catttctcaa acggggattc ccaaggatgg cctgggaatg gatatggcaa cagctgcaca tgacctctcc ggcatggcag tc tca gagtg ctggtacttc agcactgctt caagtagatt gactagcaaa gcatggtctt gtttgcacat gggcctagtg ccctggcctt agagcctggc ccttccacca cttgtacagc ctcatgtatt agttttatgg aacgttttcc ggtgcagcca tgctattaaa ttgtgaaaga attttgtggt gggcagtgat ccaaataaag actaagattt aaaagtgact tggcttaatt tgtttattta ggaaagtcca acaatgatgg gggtgagtct ctggcaagag aagtcaggaa cgtgggagct tgcatcagtg gtgtgatcca gtttgcctcc tccaggtaaa atcatgggtc atgcctagcc ggctaggtct attcttccca tgtctatgat tccaaactct ttaaagagta cccagtgtag attttatgaa tgagtccaag aggattttaa atttcagagc ttcagtttct ggaatcgctc cttcagttct gtgtaaggtt cttgtgatta tcccttttcc gaa tt tga aa tcttacaaat ttttgtggrt acagcgttca catcactcgt gagatggcaa cagctgcaca tgacctctcc agcatggcag tctcagagtg gatatggcaa ttaggtctca atgtgtatcc ccagtggaga aaaatctgca gaatttgaca tggaccgctc ggaggtgttt aatgagtgaa acctcacccc tcattgtagg ctgcagaact tctttattga aagagattgc aaatgtatgc aaattaattg agagtagatt ggacttggtt caacttgaca gtcagtcgaa taaaattctc ttaaatgcca taagcaagaa taaatgatct tttttggacc gacacagaaa aagtgcagyt ctcaaagcca aactgggcca ggagt tact g ggtgtcttcc cattcccatt aaactgagtg tgaaaacctc ttggagctgg ctggcctgag atatttctga tacttcgcag agttctctcc gccaacccaa aaaacatcra at tga t ttgc ttataattct t tctaa gat g taggctgatc gccctccact tgctagtgaa gactcaccct tctctctctc tcattcttgg atttagacgt gcttgcctga ttaaatttgt agcagtgttt gaccacagca cagaaactgg ctcagagaca gtgtctggcc cacctacatg t ga cct ctcc ggcatggcag tctcagagtg gatatggcaa cagctacaca gctgaggact tgaagtccca agggagtcac ccatctctca tattttgata caaacctcat gggtcatgag ttctcacaat tctctcttgc tttcctgaga gtgagccaaa aacataaatg caaggatgtg caatacatct gaaaagtgat gcaatagaga tcatggagct tcgggatgat atttgggcag aattatgaga aagataaaag aaaaaaacag ctccagcaga atacagtaaa ccgctgagtg aaggttgttt cagt tgagaa caaacacagt caactcaata tgtaaaatat gccttgtaag ggctgatatg ctttggtatt aggtaggggc tgcaaagata ttttcttgtt ttcttaaaat acgcctggga ttacaaaaca atctcctctt tgttaaatac gtgtggctaa ctgatttaat cacagaatca agcttcctgg atgaatcttt gattttgaga tgttggttag tctagtgctt acaatttcat tcacagacaa tgtttctgta ga at gca ct t catggtagac cagcactcag gatagctggt cttgacaggg tgacctytcc agcatggcag tctcagantg gatatggcaa cagctgcaca tgacctcacc ccagtgcagg tgtgtatcct caaggctgga tcgcacacac tttgggtaag gctaaaattt ggtggattct gtcagttctt attctctctg tcctcaccag taaacctctt gactaaaaca tccaaatggg agactttact a ga ttgca tt gagtcaagaa gggggaaaga gtacaaagaa atcgttttga attca at ta a ctgaaagtca tatatttttg tattcctttt gggttggaca ggcagaagca ccacgctgtc ggaggtcact ccaaagggag gctgctatca actccaccta tccgccttgc aattgggtgg tgggccacgg tgagcctctt gcatctagta tat taaga gt gtgttaaacc agttgtggag caagcaaaaa tgaccctatc attatttgcc ccctgtgttg ttaatttttt tattcaaaga catcagttgg cttacagata aactgtttct tgccctgtaa cagtttccaa gatttctttc tagtaacttt ttagaagcag gttacctggt ttaaagaaca ctgagagact gggcaggccg atgctggagg agcatggcag t ct caga gtg gagatggcaa cacctacaca tgacctctcc agcatggcag tgttgcaaga gaagt cccag cagtcattta gtgggtaagg gggagaagat gatccccagt tcatgaatga ggaagtgatg cacacatcag aggcagatgc tcctttgtaa tttgatgtgg gtggtgggta tttgagctag ttgtttgaga gacaccagtt ggtcagagac aaggcaaaga tagaatggat ataattttgc ttataacttt aaactagtta gtggtccata ga ga taa aa a ctgtccgaga ctagatgtac tgagtagcag atcacggaag t a aa aacaa c attatcctac cttgtcttgc tgctttcrat taatgcaaag ctggggcctc tcacagataa gagaactaca tatttgtggt ctggtcctct caaacagcta atgaaagtga aaataatttg ctctggaatt aaaatatctt attccaatga ctttgagaac t tacagaggg tagggtcatt acactgacaa gtctacatga ttctgggatt ttaaccattc gaaaaaaggg aaaccagtca attatttgca cttctgtttt gtgtcaggga tctgggctca tctcagagtg gatatggcaa cacctacatg cgacctctcc ggcatggcag tctcaggtta cagcaga cgt aaagctgctt tccatggcag tttggactgg 105540 105600 105660 105720 105780 105840 105900 105960 106020 106080 106140 106200 106260 106320 106380 106440 106500 106560 106620 106680 106740 106800 106860 106920 106980 107040 107100 107160 107220 107280 107340 107400 107460 107520 107580 107640 107700 107760 107820 107880 107940 108000 108060 108120 108180 108240 108300 108360 108420 108480 108540 108600 108660 108720 108780 108840 108900 108960 109020 109080 109140 109200 109260 W0005851 0 fhttpi/tww.getthepatent. com/Login.dog/Sexam.support/Fetch/Defaut.dotNVO005851 0.cpc?fromCache= 1 part=maintoolbar--bottom] Page 438 of 737 WO 00/58510 PCTIBOO/00435 tatgatcttt accaatctca ttttcatttc attatttatc aattcttgta ctgtctatac tttgacttct tgaaggcctt ttttcctctc tattcatcac ttgaatcctg gtttgttcat gggctgggcg atcacaaggt aaaatacaaa attgcttgaa agaaaagaat agtaggggtt aacaaaaaga tgactgcttg tttttaatga tagatttctc ggacattatc ctgtgatgtc cttcagaaag ttgggctgag tgggcacttc atgggtttga agaaccagtt cgataattca tagccataaa gaacatttct atttcgtaat aaatgcgagt gatatttgtt ttttgctgac ggtgttgatt gagttttatt atgcccgcaa taaaaatatt atttaatgaa cccctacccc actcagagga aatcttacca taataagtaa ttgtatttga aaagaacaga gaaactgatg accaagctca cctcagaggg tcaggcctgc tttccgggag gtttcttgag aagttagtaa tctaccaccc tgatactcag ataaaaaagc tatttatatg atctctgttg ctttctcacc ggacaccagt gccttaaagg agggacacaa ttccataatc cagaattgtt ttattaattt kttctgaatt ttatacctca tgtcccctgg ctctccagcc tggacttcct tctctttcat cctgtgctaa ctgtaggctt tgcatgtctt ccgcggctca caggagctca aattagcctg ccctagaggt gttttccttc ccataagcca gctaatttaa taaaattcaa atataactga atcttattag tcagccatac aacaggctgt caacaccctt caggctgcat ttgggatttg ttcttctatt cat ttaatca cctttttcat ttaaaagtaa tcacatagct tttttttttt gatggcaagt ttctcagtgc ttgttgcatc gccctataaa aaaaaataaa t tct ttca ta gttatggaaa tgagtttatg tccgatttct gatgctcttt gacttcccga tcttaggtgt tct taccagg gaggacatcc actatgccag ccaaaacaac tgcagagatg ttgcaaatga gaaaatgaga agtctctgaa cttttgcata tcacagacac tattaactat tttctctttg gat ttctaaa ccgtcagggt gtgtcccaga cctatcagat ccctatctcc ttaactcaat tcattttcgt atgaggaatg gttcccattg tggatcccat aatttaataa gtggaagttt cctgtgagaa atttttccta tcagaactct ataacattgg ttcttcagac ctccacgtga cgtctggaat agaccagcct gcttctgtaa ggaggttgca acctctgaat atcaaataaa ctgctaaacg tttcattgaa actgcagatt cca tca ct ga cctcagaatg tgaatgctga cagattagtt gtcaggcaga gataaggaaa tgtatacaga a ga cat gct a tttcaaatta tgataattag attagaCatg tttggaaaaa cccagtgaag ttttgatctc agtgctaaag taggaaacta cagtgcgtgg tacttcatta ctgaggcctg tttgaaaata tttattttga ttatcaaaaa acataaagaa gtgcatgctt atttgatgta ataaagccat gcatacagca ttaccattcc aatttagaag gtggctctgg gcactgttca gttagttctt cttcagtktt acccaggatt cacatggtcc accccgaaag atattgtgag tggtttctca atggaccttc tagagtccct aattgccttt aacagtgaca gatttcttaa cagaaactta aaattaatgt cctcaagttt aatcctttta cccatcattc acatgtcctt tatgaaactc gctagacaat tactatgctg acttaccatc atggaaactt cccagcacat gaccaatgta tcccagctac gtgagccgag ccctagtgta tgaCtgaaaa attattctat tgggacatat gcaatcaaga ccctcctcta gttgattcag gggcaatctc cagcagggtt gctgtcagtc catttgtctg gtaagccaaa gtggttagtc gtttttggtt ccacatgttc tcagccacat tgagcaacag tggagaatag agaacaccta atgaaaggaa cccagttaac cgggtagcag aaatgtgcag ttatcatagc tcccctgtga cacatatgga tcactgaaca atctgatact ttcagtggca agaagacttg agagacagga ccatctcttc tctttccgcg gaagtttgaa gactgtcttt gaagtactgg ctaattttta ctcatctgta aatactttgc ctgaaaattt tttttctctt ccccaggaac ttagggcact caagatctct ctcttatgac ggggctagga ttttaaaaac ctgagaatat atcaaattac tat gtct ggt tcaatgcttg atcttgtctt taattacttt tctgttacac tcttctttca catcttacca ggctgagcta accaggcgta catgacaaga tgggaggccg gtgaaacccc tcggaggctg atcactcaag taggggagag agagttaagg ttaggccaat ttcaaacata tgttccctcc gtggttaaat tggttcgttg atatttggct caactttgtg tgctccagcc agcagtttta ttaaaaaatg atcttttata gttttgtaga ttcattatgt gtaggaaaag aattttaagg catgctttat acaggactgg acagtcttca cttgcctgtt aatgtgggat gagaacttca ttcagtgatt taatatgaat agatgctgtt gtaatgagat gaggagtgca gt at tcatt t ggtagctctt tcccaaccac agcctaagag tgattggaac gagcccatgg ccacatctcc a agga acct g gtaccctgac aaattggggt atccttcaat tattttattc tttgttaaaa tctggttaat tctgggcttg ggt ct cctt t ttcatttagc aatcaacata tacaaaataa aatagtaaat ttaattgtta ctcattttaa actttttatg caccctagca trtacacaaa agggagtagg gatatcagaa graagatttt ctatttttcc at gtgaa tgt atgtgttcca aggcgggcgg gtctctacta aggcaggaga aaaaaaaaaa cctggaacag gacaaggtca tggtaaccca aacataggtt ctttctcatt gcttagtttg cccatgtgtg aatgatggtt gtgaccacag aagagtggag ccaccttaat aaaagaaaaa acaaccacat cagagagcct tgagggcttt gaactataga cagaaacgtg gtgaatgtct ggcagaagct tattcgccgt gtcatacgga ttctgcttag gagccatgaa tgcaatgatt ttatcgctcc ttgttttgac tttagtgaac cagtgttcta ttcacgagtt gtgtagacac agtgtgagga cagggggttt tcatcttcct tgtccagaac aggagcctat ccaacattga aatttcatgc aatgataata ccaatcaagt tgatttggga tatattaaaa gtgcctgatg tagagggcca cctcttaaaa cttaattatc tgaatcttag gggaaatatc 109320 109380 109440 109500 109560 109620 109680 109740 109800 109860 109920 109980 110040 110100 110160 110220 110280 110340 110400 110460 110520 110580 110640 110700 110760 110820 110880 110940 111000 111060 111120 111180 111240 111300 111360 111420 111480 111540 111600 111660 111720 111780 111840 111900 111960 112020 112080 112140 112200 112260 112320 112380 112440 112500 112560 112620 112680 112740 112800 112860 112920 112980 113040 W0005851 0[http:/Iwww. gefthepa tent. com/Log in.d og/Sexa m.supportFetch/Defa ult. do AN0005851 0cpc?fromCarhe= 1 part=maintoolbar--boftoml Page 439 of 737 WO 00/58510 PCTJLBOO/00435 atagtttttt tcattttaat catttactct tcctagaaat tatttttgtt aaacatacat tgcaattgtt tctaggaaga tgatagacca atcaaaatcc aggtggtatt gaggacaact aatccatata aagagaaagc agttaatact gtctgtgagg ccacccttaa aggcagaaca ctgaaggctt ggctctcctt tcatacttaa tatatatata aataaaaatc atgttcaatg ccacaaaagt gtttgagaaa actttctcta tcagatctca tgtacctcaa ttattaactt tgttaaagtc ataaactctt attataccct ataatacagt gaaataaaaa aaatgtgtga ggcactggtt gggaaattac gttaaggcat atttaatagc tttttttatt gcaaaaaaaa tttaaaaata ggcaaggttt tttctctgcc cgtccaagtt tgtgagacac tt tgt ttgt t gtggcgtgat ggcttcctga tttagtagag atccacccgc tgcaagtgag agtgggggct ggagctaggg ataccagcct ccatctgttt aaatgtgaag ttcttagtga ttccatctct cctgctcatt aaaataaagg aaacacaata tctttacttt tgaaaccaga tatattaatg tgactaatat gttatctaat aagaatacaa tctgttttgg atatttgctg ctgagacatt cacaagggaa gaagccatgg tacccatcgg aatattttaa ttttttattc gagtgtcaac gtgtagccaa tctggctggg acgtgaaaag cctgccctca tctcctcaac atacttaata tatatatcta tattaaattt ttgatatcaa tataatgaga aataaatacc tgtctttccc gaaggcgaca ttacatttat taatgtttaa tctttaaagc gaaaaaggct ctct ta ata a aaaaggtcaa aaaattacaa cgaatgatta ttctttgcac catctcaatt tgaaactatt tgcatatttt gtt gt tgt ta tgaagtatac tcattttcat atgctgaact gtagcttcct tagacacgtg aaggtgggta tgttcatttt ctcagctcac gtagctggga acggggtttc cttggcctcc tttttaatga atgcacagtt caagctatgt agctcatact aaggatgcat caagagtgag gtttaaatca ttgtgattgt aattttacat tggaaaaaaa cacaaaacct cacatagata attatattgg tattagcaga ttttattttt agtattcaat atgtatcctg caaattggaa ttgggtcagg taaaagatgt gcctgacctg atgaaattgc gcacatt aac tatattttaa tcaaatcaaa ttgattggat aggagattga caccatctaa cctagactgg aacatcggac ttgcagatgc aactcctata ccatattcgt ttgtctgaaa tatgatgcca ccctgatttg tacacaagtg ataccccaaa tgaaggagat aaacttcttt taaaccagtt acacacctct gcacatatct aagaattatt aataaaactt catggactat ccaacatttt ttttagagtg cactttcttt gcaaaaccct gatgcatgct tgaagggktt taaaagctat ctgcttcttt ctaagtaatg catttttaat a ccct aagt t tggactgcag ttgagatgga tgcaaacttc t tat aggt gc accatgttgg caaagtgctg atgcatggac ctgtgggtta cttatgtctc aacactggat ga ca aat tt c cacaaggctc tcaaccatgc ggaaaagtgg tccaaacctt tggatccctt gcatcattta 138 ttacatcata aataaggggt agacaagagt actttctcag ttagacaatt ctttcagcat ggattatggt catgctttca tcagaaggta tgtacagaca taactaaagC cacagttcct caaaaagaaa ataaaattaa tgaaggat gc cattgagtca tcagctgtca cctagcct cc tccaagttca cctattgtgg tacatatata tctgtcactc cagaaaaaat gagCCcaatg acctagtttg t ttga aaat a tatcaaccat ccctctgctg ctttcatgcc tctatagcaa gtcaatatgt caactttcaa taatagaagg accactctcg actactttcc aaaatctatg ctcagtcctg cttctttgct cattattttt tttggctctg ttttttattg ttcaCCcaga gggaaacatc catgttgtca gtggactaag gctctatcag tcaaaggcaa gtctcgctct gcCtCtgggt atgacatcat tcaggctggt ggattacagg ttgaggacag aaggttgttc ccaagagtca gaatacattt atttagaaca ttatttgttc ttcaggaaga acctttaaga tgactggtga ttcatccgtg cctgggacaa ttaaaagata gaccaatatg tcgatatttc atatattcgt tggagaacat cagagataat tga tga act g gtttttatgt ttgaactttt t t tgtga at t atactcttgt ggggctcaca aagaaaaact attttcagaa aaagtattga gtggactcag gcatggccag cagcctacat tcatctttgg gaccttggga tatatatata tagagaactc aaaatattta aaaacaaaag gaaatagcaa tcccaggtgt gacatttttc tgagattgct agcctaagtg caatcctatg tattttgaac gctcacaatt ctgatgagct agaagaaagt tcaatgttaa tgcatttttc gcatatgtag atttcttatc tcccaaatta gtttcctttt cttttttgtt gaaacataat agaaataggc cttgcagcca actccacttt ggatctctag gtgaggtttt t tca cca agg tcaagtgatt gcactgctaa cttgaactcc tgtgagtcac aagaggagcc ttcctctttc aaacctttgg ccacaacaga acagtatgag cttaagaaaa aaaatgtagc tttcactgaa taaaatgaac agggccctca tgttatgggc gatcatttct ggtttttcaa ttaataattt tttaataaac ggatgcctat ttagggttat aggtaagtat atgtagagtt ggaaaggcag gtctgcatat gagaa a aga a a tat tt taga ttcagggtca accatgtgat tcctgactgt aaaggcagac gatattaagc ctctctcatg gacttggact tcgtgtgagt tatatacata t aat acata c a cct t ta aa a tacttagttc cct t taa aa g ctaacaactc cgctgatctt attttcctat gt tt t tgaat acagatgttt atttcaaagg tgcattaata aattttaaga gtaaggtcaa ttactttaat tccaatgagt gtcactgacc tgatctcgaa aaatggtaat tttatgtgtt aaagaacgta ttgttgggtt actgagggat gtcactgaac tatatcacca gccttcccta t t tttgt tt t ctggagtaca cccctgcctc tttttgtatt tgaccttgcg cgcgcccggc cgaggtttct cctgagctgg ctccttctaa aactcaaaat agtcatattc aaaaatttat ctggcctcct agattacaga aaaagaattt ggctatatac tactaagtcg 113100 113160 113220 113280 113340 113400.

113460 113520 113580 113640 113700 113760 113820 113880 113940 114000 114060 114120 114180 114240 114300 114360 114420 114480 114540 114600 114660 114720 114780 114840 114900 114960 115020 115080 115140 115200 115260 115320 115380 115440 115500 115560 115620 115680 115740 115800 115860 115920 115980 116040 116100 116160 116220 116280 116340 116400 116460 116520 116580 116640 116700 116760 116820 W0005851 0.[httopllwww.g etthepatent. com[Log in.d og/Sexa msu porFetch/Defa ut. d oJO0058 51 0.qpc?fro mC ache= 1 -art= maintoolba r--botom] Page 440 of 737 WO 00/58510 PCTIIBOO/00435 at cct t ttag aaaaaataaa gttaatgttg agggctgatg tggcatgaga cagaatatag cattacactc accctgtata tataccttct tagatccata attgtagaac cacttacagg aaattccaaa gacttaactg atttctgcat acaactgtgc acaagaaagt gagctgttag gactctgggc ggaatgtatt tttaagttta ctgaaatcat aataaccact acaagttgat ttccaacttt gtgagcactc tgcattcatt tgtttaacta tccaactcat ggagtcgatc gctttaggca gggtagaatg gtcatgtcgg ct gct cacct agcctgcccg a gctct a agc ccccaaggtc ctttctagcc gccatttgtg tttttttttt tgtggtccag gttcaagtga atgcccggcc gtctcgaact aggtgtgagc attccgttta tattccactt gttagggtac aatgtgattt agaatatgca tcctgtcatc cgacaggccc cccacctgtg aatgatggtt gtgccgtcca tcttccttaa tcctcaagag attatatgta tcagaaagag agccccgagt gacttggaaa tgactggccc catgtaggcc aagagcagtg atggggaaaa tggctgatca gggcatcacc gatacatttg tagagctgat ttttatttta tacatatata ccaaagggga ataaataatt tctaagcctt gatattcttg tgtgtgtttc tcattataat atttgaaaac cccgctgagc gtcctatcat ttgttaccct tcacccctgg ctgtatgtct tgatgccacc tcaagtttat tttgatcaag ccaattcaat ttcttttttt attctttctg gatcagtatc ttagccagct tttctatgcc taaaaccaga tcggtt tact tgaacctctg agcacagtaa gagtcatgct agctagaat t tcttttcatt cttcgccaac tttggacaca ttcctaaaat gttgttgttg actggagtgc ttctcctgc agtttttgta cctgacctca caccacgccc aaatgtcact aaaagaaaaa acagcccact cttttattat ggtt tgt ta c tacattaagt cagtgtgtga agtgagaaca tccaacccgg tgagtgagt t gcataaaaag tggCttatct ttgattaagc ggtgacactt tagactaact gtgctgatt t cattttgctc aagctggcta agttaatgga tatttttatc gctgttacat gaccagctat caggatgagg tgacctgttt tattcttact tatatgtttg aatactttga atattgtttt ttggcttaga gt at tat tat gaattactgg taagtaattg ctaataaaaa a gt agt t taa tgacattagt ggaaactatt gattccgctg gaacatgctt tctctttttc tctcattttt agattactgt agctttttct gaaatatatg tattctggtt tcttttttta atttaacttc tttgattcgc gaaccagaat tgtctctaga ttctatacag atgtcaacta gctttcagaa cgatgagaac ccagaccaat aagaagcaga gtttttaggc agcaaggggc ttgtttgttt aatggtgcaa tcaccctcct tttttagtag ggtgatccat ggccctagaa ataaatctat caaatcagag ttgggaccat tattattatt ataggtatac atttctccta tgttcccctc tgt'ggtgttt atgaagcttg aggatgtttt atactttatt aaggcctcaa ttcatctatg cctgatggac tgtgaaagag tgaagcccca ctaagcccac cgggtggaat ttgttttcct tggcttttaa ggtgcatgaa gtgatctatg agcaggaatg caaaattaag ctgaattcct catttcctag aatatttttg aaaagctggt aaatgagagc a taaat tt ta cagaaaaatg tctccaccaa gttttattaa aaccaaatca aatgtttcca caaaaggtct cctttcagac tactgccatt cctatatttc tatatctcag acccttctga tatattataa ttaggttttc cctactacat aatgcagaaa ctaacactat cttatacact cccttactcc gctcaagt tc catgttgatg gcagtgcagc gagaaggcac cctcaggtta ttcacattta tatttactca aacaaggaaa tataacccaa gttttgtttt cctaggctca gggaacctgc ggatggggtt cgtcttggCC ttctttttct ttcatttatt aaatcagcaa at tca atga a attatacttt acgtgccgtg atgctatcct cctgtgtcct ggttttctgt atttattaag ctgtgacatg ggcatgtatg agatcataat taagctctat ataactgaaa cccaccttag tcatcgaagc ctttaggtaa ttggtttata gacaatattt atgttatgtt tattgactgg ttctcccact agagctatcg aaatctgttg tcatgaaatg cttttaaaaa gaagagaaat gcaaagtaac aatattcttc ttttcattaa ttggtaattt aatgtttgtt agctgttcac atgaatttgc ccaagttgaa agagctgctg catctaggat ttagactgat taaactttct gactagtcac tacaacttaa ttcatgccct ctggttctca cttttatcag aaatagagtg ctgatatgct actaaggaca cacagagaga acaagcacca aatgcattac accggaacac tggtttaaat atagctttgc catactacct ctaaagttaa ataatacata agcctagaat gttttgaaac ctgcaaactc aattacaggc tcaccctgtc tcccaaagtg taaagacaat actgcatgat gggggcaata gaataagatg aatttctggg gtggtttgct tgccctagtc tgtgttctca tcctgtgtta accaatagta t ga gaga aag agtaacagtt cagagtctaa acttaagctc ccccagaatg aaccaatcat agtga aa agg acggcttttg gtttcacttt gtagtacagt ttatggttgg attctccatt ggctcttgct attgtagaaa ccatatcttg cacaaactcc tagtttaaag tgtattagtt attttcttat tgcttttcat atataccata tttccagtgt taggcaatac tcaaaaatag tattatgtag cgtgatgagg aaaaacagaa ccaaattttg tgtatctaat ggaagacgtt tcaatcttta gatcataaaa ggccgaataa atcaatctac tgtctctttt tgcttataaa tgttattaaa gaagagcaat ttgcctgtgg gtagccccat t tct gcct ta gacatgcaat ctgcatggca tctttgagag gtcactaaag tgtcccagcg tgtataaatg tct t tt tcgt agtcttactt agcctccctg gccagtcacc gttcaagttg ctaggattac tataatggta tttaatctat acaaatgtgg agagaaagat atacgtgtgc gcacccatca cccca ccccc ttgttcaact gtttgctgag attacagagt cccaattcaa caggagtaga tttaactcat cagttcctac gggtcacaaa ga tgcccaaa aggcccggca cttatctctg aaagcaaggt 116880 116940 117000 117060 117120 117180 117240 117300 117360 117420 117480 117540 117600 117660 117720 117780 117840 117900 117960 118020 118080 118140 118200 118260 118320 118380 118440 118500 118560 118620 118680 118740 118800 118860 118920 118980 119040 119100 119160 119220 119280 119340 119400 119460 119520 119580 119640 119700 119760 119820 119880 119940 120000 120060 120120 120180 120240 120300 120360 120420 120480 120540 120600 W0005851 0.[httpJtwww.getthepatent.com/Login.dog/Sexam.supprtFetch/[efaut.doqNVO005851 0.cpc?fromCactie= 1 part=maintoobar--bottomIag 44 1 of 737 WO 00/58510 PCTIBOOIOO435 ttgtaataat aagaacatta cagtccactc gatttcaact ggatggttct gtcagcttcc tatgggcttt ccttctgttc cagaggagat gatcctgggg atacttctag aggagcacat ggcagacatt gaaacatata aagcaggagc cagaatagag cattcttctt acacttaaaa tcaaatttct ggagtttact tttcctttca ggagtctcgc tccgcctccg gactacaggc ttcaccttgt tccctaagca tgagaaagag gcaacctcca ttacaggtgc atcatgctgg ctcccaaagt ttaatgccgc ctcttccact gatcccagaa tgccttttct gcaatcacat aaatcaggag tctttgctga cactatttag ttggactcag ttcacttttg ctgataatgc tcaagagata gaaagagtaa gaagcaatta aatagtagac tgctgatgtt gagtgtggat gttagtgaat taactagatg gtggtatcaa gaccttagtg ttcaaagcaa ttattaacag gagatatatc tcacaaacaa gtaggaaata ctgcttagct gatgaaaatg cattactctt tattttccta ttccattgcc ga aat ta cat tccttcccaa ggttaaagat cattggaccc ccttccctct ttaggacact ttgctgcaac gaactcagct acacctgtct ggtgcgttcc ctaacaaaac ttccgttagc ttttggagca tatcatagca ccaaaaaatt ttagaaacaa aatgttgctt tgaattctcc gtattgttct tccttagtcc taagtcaatc t t tagct tag tctgtcaccc gggttcacgc gaccaccacc tagccaggat ggggtgtctt tcttgctctg cctcccaggt ccgccaccat acatgctggc gctgggatta atcttcagtg tatccctggg aaatctgttt tagtttttcc ga ata a atat cacagactca ccctgcctga cccatttgca t tggat att c taggctaaga agctcttcaa tatgtttgtt cataagaaat t tgat aatt t aagatagaaa ccatagcttt atttgaatcg cataaacaat agtctcggtt aaacataaag aaaatgcagc gggatcccta ttccaatatt ccagtaaaga gtttctgcat cgtttgaact gttgaataac taattcttga ctagagtatg acttgtttac atctttttaa tcatgaagct aactaaccac tataagagca tcattgctgc ttcctcttcc aatcttccat atcttgtctc acatgtctcc ccatctcccg ctcaagccat atcaaagcct ttccagccaa cttagtatag gttgtgtaag ttaagtaata gcttgtctga gaaaacatag acctagattt tttaaggaca tacaatttct aaccttcact ctcaaagtct aggctggagt cgttctccta acgcctggct ggcctcgatc tatttattta tcgcccaggc tcaagcgatt gtctggctaa ctcacgacct caggcgtgag cctaccatag ttaggcccaa tctctgcacc aggtggtgaa tgcctacaat tgtttatgcc aagtggagtt gataggtatg tgct ccggca tattctattc atgtaataaa gcctga t tga aaacaacact tgtatatgat tggtcccttc tttacacatg gccagtgcaa atttgaaggt ttacaagtaa tttatgtata tatttcttgt atcaacttag tgactttttg gcagctgctt gagcctgaat gatgcatacc acaacttttg gttacttctg a aa agat ta c taattacaga at gatga tat gacaattatt ggaggaaaca ttgtgacctg ccagatatat ccaaacttaa cttctcagtt t tgact t att aagtctgtga gggctggaga atgtgaattt attatagata ttgtcaatgc actagatctt taattataat ttgacaaacc ctccagagac gttcaaatat gggatatttt ggcaccttca attagcctCt tcaaaacttc atgcagtctt gcagtggcgc ttctcctgcc aattttttgt ttctgacctt tttatttgtt tggagtgcag ctcccacttc tttttgtatt cctgacctca ccgctgcgtc agcccggcat ctcctccagc caggctttta gatgtggaac ggctggattc tt tgtcccag aactaaatct atattgttaa gatcaggttc gtacttgact tttcttttgt gtgtctaagt gggacaatga tttagactat cttcatactc ttgttttcat aatgcagtga ccttcagtgg ccaggaagta aaaagcattt cagtttaaaa ctcacaggta ctcaacctaa ttgttttgtt ctttacaatg aaatttccaa cttagtcaag aagaacaggt caaatttagg gtcatttaat ttccagaact cagaagtaag aga agggcgt accaaggatg gtggtcattg atgttcctaa tgcttgtcct tgctgt tgtg aaatgatgtc tgtagtcagc cctgttgcca atatttaatt cacttcataa atgttaaatt tgtgtcttCt ca cat agcca tqcagctttg at gtt tca cc cttctatagc gagcctgtca ttttctatgt ttccctggaa ttttttcttt gatctcggct tcaacctccc atttttagta ctgatccgcc cat tt tatt t tggcgtgatc agcctcccga tttagtagag ggtgatctgc cggccaaagc gcaatagaag tatagtagta agtcatcatg aggaaaaacc aactgaagaa gcaccaactt tgtgtagatc aatgatgaaa taactggaat gagcattgta aattgactgg aaagaattaa actgagactt aactaatata gtggttgaaa ttgtttcaac cttggaaaga tttattaact atgcaagaat gaactcaaga gaaataaata atttcaaata attcagcaat ttattttgtt tgaaagctgt aagttcacct ccttctttca tggggaaatg ttttctggtc tagattatca gctctattta tttcctatgt acacataatt aagaacttca gttgcctCgt aattctatta ccaaaataaa tggcaagcag ctcttagagt ttgacctatg taagaagatt aaatctatgg a aat ta aga c atttagacta tagagctgag gtgagaggag cttataaaga acttagtagc taatgcctaa gaagttgcga cagttactct tctttttcct t tt t tgaga c cactgcaagc gagaagctgg gagacggggt cgcctcagcc tattgttttt tcagctcact gtagctggga atgacctttc ccacctcggc agggatgtct tgtgcgctaa gagtcaagga agcaagactc acataaaaat cttacactct ctcttgaact tgtctcatat atgccccacg cttggttcac ttgatgatcc ccatgcccac at gaat a aat catttattaa ctccaaatgc tacattgtat taacggtaag gggaatcact tcaaataata cctagcgagg at t tgacat a atttgttaaa aacataatgc gcaatgtgct ttaatttatt ttggattcag ttttatctta ttttcttgaa caaataagag agtaaaatta tttcttcttt act gt tca gt aactctccca 120660 120720 120780 120840 120900 120960 121020 121080 121140 121200 121260 121320 121380 121440 121500 121560 121620 121680 121740 121800 121860 121920 121980 122040 122100 122160 122220 122280 122340 122400 122460 122520 122580 122640 122700 122760 122820 122880 122940 123000 123060 123120 123180 123240 123300 123360 123420 123480 123540 123600 123660 123720 123780 123840 123900 123960 124020 124080 124140 124200 124260 124320 124380 W0005851 0 [http:twww.getthepatent.com/Login.doq/$exam.support/Fetc/Defaut.doqNVO005 8 5l 0.cpc?fromCactie= 1 part=maintaoobar--botoml Page _442 of 737 WO 00/58510 PCTIBOOIOO435 ttcttcatat ttagaaataa gcagaacctt ttccatgtga tttacaacgt attagttacc ttaatttctc caggcacagt ccctggttaa tagatgaaag gtgcaactca tttacagact tggaaggcaa ggttgaaaaa gctggaagag aagtaattgt agtagaattc gtaaaggatt caaagaaggt tcttttttac ctcaagaagg ttt ct tat ga cacattttct aattggaagt tatttaaact ctgggaactc t tt caggct t agtctaaggc tt Ct gCtgca tgagggaggt aagctaagag agtagtgatg agct cactga cttgCaagat ttgatagttt aaataagggt ggCaaCttag actt tggggt tattgCtttt aacactggct tagagggaaa aaaattgagt gacactttgg cataatgttt gacaagtcac atctttatag tcattagcca taagttggtg gttaaCaaag tttcacaagg gcttcttgcc aaggtggcCt ttatcagagt aattttgaac aataaaaaat ttcagagttg tgattggcaa cttagatacc attctgatgt atctttgtta ggaaggtaga actttgaaag attattagag tctttgtttc ttaactgtga tttcacattc tcagtacaaa Ctttgtttaa tttagtgtct attgtcattt gttaccacac agtggtaaca attgtgggta gttctcctta gggattagtt tgtcaattca cttagtacca ccttcttgca gta ttat cat atcctatcat tggttgagca atttaaggct agctgacttt gatatgatat gtttgggtaa tttgcttata tttcctgtgt ggccatccta agccggggat ttagaatttc agaaatgtgt gtttactgat gaatcaaaga gcttcatatt attCagggCa gaaagttctc ccagttactc gaaaatgact gttttttccc aaactacttt taaaaccact gggtgaatga gtttcagaac gtgCtggtaa gtgtgaacca ttatacaact a aa tgggt ta ttaaattttc agagttgttt tgagtttagt t tga tgggaa ggcaatgctg aagcagaggg ggcaaagctt gtCagagggg gagaatgtga attttacagt aaatatattt atattttaaa ttctggaaag acctaagtca gttcccagat tgaagtgtCa acttgtgagt agtagcctcc gatggaattg taatttatat cttcttattt ttttaacaac taaacaaact aatctttcat tcattttcgt tatggtaatg aaatatgtga gtaggacctg gtcatgctgg agcaacacaa ctacagttag aaactttata gaaaatctat ttatctggtC ccccattcat ttgtatcctc gaaacctggg gccctgtgaa tcttcaccac taccaagaga gttagaaaga attgttgagg gtctggcaga tggcttcttc gacaagtgga ttccagtggc ggcttattta cacaagagag acttgttgga caagggaaga agaccagtga tggtaatggg acttgttttc acagtggaat caggagaccc taggagaact ctgcttttgt cattttgggg agcacatgtt ttagcagaaa agcacatttg gcatgataat tagatcaaat tgatactcag cagtgagtgc aaatatttcc ataagcaatg tataagtgca ctggctttca tctcgctctg gtaaaatata gtagaaagca at ta aca a aa tatgttatgt ataataaatg gactcagaaa tcattaatag cctactgggg cataacttgg gatgaaattg ttcctctttg ttaatcaaaa ttgggtctga tcagaaacat caaatcattC gacaagattt aattcatctt ttaaatgttc aagcttctgc ctcctcactc gcctgattCC tatt ct tgcc gagaattttc aacaaaagga aaaacttcag gaagaagaaa t agga t tctc tccctgtcat ttccttactC gtgggaaata atcataccag attttaaact aatacttgct aggtcaaact aaggaaattg tgttggctag atgtggctgg tcacctccat tggcatatac taaCtagttt ttactaagat caggttttag aatactttaa agtaagagag ctgcaatgtg tcaattccag atttacacca agttgCtgaa ggactgtctc aaccttttca gataatCtaa gaagcaggag ttacaggaag agtttCcaga ttatcattta gcaaatattt attcttcatc tgtaagatta cagtggtgga attaaacaaa aaaaaaaagg ttcatgcccc acagaaggca tagttttgca gagattttaa atgtttagaa atgaataaca ttttgttcta gtaaaaaagg ctattggtag agaatgggat ct gagt tgt g tatatttggc ctgctcctag ggaaagcaaa aaattgataa aaatgagggt ccaattttct gggcagttgg cagcaatggc aatgatcagg cacttatcac ttcacacact agtttaaatg ccttgtggat gtctccatta aatatctttg atagaattca gtgagtcagt cagccacaaa atctctgcct ctgggaaaca gggagcatat tttcaaaatt tgttctttat ctcaataacc tagtagctta gaaagggcta tgctgcaatt tggtgaatgg gt gtct t tgt ctgaaagaa t tggaagttac tgatcgagtc acctgtcata agttctccag gctgggacat ctggagttag ctctgagttc cattaattgg tagttaccaa atagcaattC gtaaaatttg tgtgattctg CCtgatgCag ctctgtactt gaaggaatga cagtatactt aaatattttg tctaggaatt aaaagaaaaa acaccaattc ggaaaatcag ggaaaaccac actccagcct agcaaacccc attgt at aa t taatatgacc ctttagaata taaacaaatg gtccatttaa agagtaggga aaatatgggt tggaaaatgg ttcctgtcct tgcagcactt taaaatggga acttaaatat agttactagt gCacttctcc ggtgtgtaaa aacccattgt cttcctagca at aatta ga a aagcatcctg ggtt tat ggt tatgccatat ggcattctat gtctgggtgt tgaatgaaga ggaaagcaaa gaattctcaa aaaaaaaaaa aagcaattgc tttagatagg ctaggtttgt agaaacttga tctgcatttt ccaacctcat aagaaaaaaa ggcagggcag atgtggagtc tggctgttgg agcacagcag gtcccaagag aatgagacat tctaCCCatg gagtgtaaaa ggatgaggCt gcattgaaga tcCacaatgg agtgatgtca cagactctac ttggtaatgg tatgttgtga cgaggtt ccc aatttgagtC aatacgtcat caaagacttt agctccagtt ttatgtacct catgacattg agctgaaagt taagagacca caagtttatg gagaaagatt agttttttga cagttccatt aagaggcccc attaatgttC caaggaagtc tatttaactc tttggattag ttatgggtct aagcctcaag ggtgaagacc agaaaagtct gatattttgg tctaaacaac gaagagaaaa ctggaaaatt 124440 124500 124560 124620 124680 124740 124800 124860 124920 124980 125040 125100 125160 125220 125280 125340 125400 125460 125520 125580 125640 125700 125760 125820 125880 125940 126000 126060 126120 126180 126240 126300 126360 126420 126480 126540 126600 126660 126720 126780 126840 126900 126960 127020 127080 127140 127200 127260 127320 127380 127440 127500 127560 127620 127680 127740 127800 127860 127920 127980 128040 128100 128160 W0005851 0 rhtto:/M w.aettheoatent.romLoain.doa/Sexam.suorortFetc/Defaut.doqfWQOOD851 O.cpc?fromCache= 1 part=ma intoolbar--bottom] PaQe 443 of 737 WO 00/58510 PCTIBOO/00435 cttagtctat tgaccaaagg ccnagaccat atcgcagacc ccaccacgac accttggtag agccaccaca ccctgagacc gcacacatct caggggttcc ccagggtgct aagaagattg gcctctttcc gcctgtccca tagggaacaa tgatatttag cttttggggc gggctaggga tt tga tt tt c gccctcatga tccaacatgg ccacaccaga t aa ga aata a ccagaagagt tattgttaca tgtgtatgag aaagaaaatg agggttttca actgtctttt at gact ttat tcagaaatgg aaataattgc ttcttatatc ttattttcaa tggtcaaaac tgtgaaacct tat ataca gt agt ccatt ct aggtttaatt tggaagggga aagaggggaa aaacagcagc acaacacatg actatatcat tcatgccctc aagtccaaag aaagcgagtt tatcaattgg ccaatagggc tccaggtcat gctttgcagg gcctttccag gggtggccct ctctgacccc cctgtagcaa agaggttccg agctgcca ag cgtttagtca acagagcaag gcttgtgatg ttttcttggt aatttctctc aacttttatg cc-atattgta acaatctaac ggaaggataa caaaatgcaa cccgtgctgc ccccagattc gtgaacttct tcagacctgg ccaatccatg cagagccttg cagaagggac ttattgagac cctttcctct tcattgtatt tttgcctcaa atgagatttt tactgggatg cagaatgctg caaagtgata at gggat ta c gaagatgtag ctccaaattt atttctgttt ccaagacgtg aatggcaaac taagtttaaa aacaactgag aaaataatga agatatccta tttcctgcac ccattgtgta ttatagtacc tttaaaattt attataaaag acttatattt tttagatatt ttttttatat cactctgcta gactcacagt aacaaacacg agccccttgt atgagggtaa gggat aat ag ttcatccctg ccat ca gt cc tctcatctga agt tact ta c gagaaattgg agtcattaaa attggtgcaa gtacagtCc atgcacggtg cttctcaaag acatttcctt acttctccct aaacctccaa gcttggggct cagctggcat ggggccctgg ggagcggctg gattcacatt cagaaaatgg ctctgattac aaaaatgagg agaattactc tcctaaaagc aagtcggggc ttcacattgt agttctggtg aataggccaa agagccacgg agagctgcat gaggtccaaa ttttccccaa ttatgctata ttcctgtttc ttggaagcac aatgaatctt ggactttgaa gaacgaatgt tggtctgaat gtattaagtg tgcacttaca gtgaaatatg cctggtgcct ttaatgaagc gtcctacaat aaaaggtcat acaacaattt agtaataaaa gttggcttca aaatatcatc agagaaagga aagtatgtga tgattttttt ttacaagata tatatagatt ttatataata tgcattattg tagcttgaat ataaagactt t cagcgt ggc tcgttcttca aataccatca ccagccccat gaattacact ccctctttca ctcaaagtct gacaaggcaa t aga ta ca at caaaaacaga ccttaaagtt gaggtgggct cctccccgct caagctgttt cttcaatagg tccacactgc ggatatccca tcttgtcttc tgcactgtct tgagccagtt ttttggttca ccatgaaggt tggcttcttg gtttttcttt tcttgaatgc aagtatcttt agtcatttaa aattcaaaaa agcagggtgg ggatctacct aactctggca tgcccagcag gcataaaatt tgtaagttgc ct ctgggggg agtgggttgg atgttttctc tatgttttag ataacttgtt accttgagtc ctattgagtt ccttgcttgt gttcatgtcc gtggggcttt aaagaagccc acatgctttt tgatcgcaaa tgtgcaattt gaagttagag tatgcttaca tttttaatat cctttgttct gtttggaatt tgttttgaga gacctaagaa gagcagattt aagttattat aaatgaaaat tcaaaatgtt cactatgatt ttaacaaaga ttcttaaaat acctgagact ttgggaggcc catggcaaca gatcttatga gattcaatta caagatgaga agtctcatgt taactcattc taccctttca gagggtacag gaggccacag ccaaaatgat cccacagcct gctttcatag ggtggatcta cagtgcccca cctagcagag gcat t tcca t tgtgcatcca gaagcaacag gggactcagg ataaggcatt ctctgacatg ttacttatgc tttattgcgt cttgttgctt gcaagagaag cagaatctag ctatcagaac tttccaattt cccttactct gggaattgtt agccacaaga ct tggctgga atctggcaaa caaagctaag aagggcagag tgttgggctg aatggggatg tgatttcata t cat tcata c gatgttggac gagaaagaca cctcaaaata tagaaggtga aaggaaaacc ctgtgaacct ccttttagcc atgatacttg aattttttta cacacaataa gaaagtccca tgttttgaca agggaattac tacacaacat ggattatttt gaatatttgc ttcatccata tgaactaact tattgaatac tttagcattc agttagtgaa cagcctttac gggtaattta tcaggaaact ggaaggagaa gaactcattt cttcccaccg tgtgggtgtg cctcacattt cagcattaac gctatgggcc gcaatgggta gccccatgcc ctttgactcc tgggcagctc gctggcattg ccattctggg gtggggactc ttcttcatga acatcctctg ctggcccaac actgagctgt gcaccatgtc ttttcatttt tcctggagac aaattcctgc cttcaggctg agaaatttat accaagggtg aacctgttgt tgccacccct aaagaaggga gttaccatgc aggggggcag gtagggctgc agatccacag gtcatgtagc ggagtaccac catcaaaccg tggacttagg catgttctgt ggttcacagc ctaacttaga caagttaaga tgaattttga tgtataaaaa ttatggtgga CCtttctcct aggtaaggat tccagaacta gttatagcag agtgtctgtt atgtgtacaa gttagtttta gtgatgggga ctaccataaa ctaaaggcca aggtttggat catagtgcag atatatcttt tagacaaagg ttatgcacaa tgagcaaata acatgtcaca caggtatatt t aa agaa aa g tacatcatgg gtgctgagca gctatcatga ggt ccct ccc gacacgccaa caaaacgcaa tacaaagtcc tgtaaaatca aatacatcca agtccaaaat acgtttcacg cacccctgtg agttcctgca atctgaagga tgtgtggggg gggctccatg aaacctaggc accacgt gga accttggcc ttgaagctgc aggccttcag attttcccca agtgtgcttg caatttttta tctgccagat 128220 128280 128340 128400 128460 128520 128580 128640 128700 128760 128820 128880 128940 129000 129060 129120 129180 129240 129300 129360 129420 129480 129540 129600 129660 129720 129780 129840 129900 129960 130020 130080 130140 130200 130260 130320 130380 130440 130500 130560 130620 130680 130740 130800 130860 130920 130980 131040 131100 131160 131220 131280 131340 131400 131460 131520 131580 131640 131700 131760 131820 131880 131940 W0005851 0[httpJ/twww. etthepatent.comLogin.doglexam.supportiFetch/Defaut.dogNVO0058510.cpc?fromCache=l1 Dart~maintootbar--bottoml Page 444 of 737 WO 00/58510 PCTIBOO/00435 accctaaatc ctgccagtct cctcatcttc agccattcaa cct cca agt c ccgaat tgtt atccttatag aataaagacg tcctgaggct tccttgttca aaaaccatca cccatgattt acaattcaag taagtt gcct tatgtgtgtg ttaagtgttc aggtgaataa acttatcttt gtaact tttg tagcaaattt aaacagtttt tctctgatca attaccagga ggagcctaca cctgatt tat cat gt gtggc tcttcttaga aggcttctcc tgcctgcaca tgttgtttgc tatattagga aaatgtggtg tcattatgcc taaactttaa aaacaccaag attattgtaa cct gaaaagg atgtagtttg cccttactaa taccactata tatctttagt taaccagaga gctcaagtaa ttcctaaatt ggaaaggaaa attgatcaat ttttaacttt tatatttgga gaaattgaag aaaatttcca gcttatatgt att aacccac aaatgcatga ggccaatgta taaggaagag tacaagcaaa cttgtcacaa atattaaaga tataaatgcc tatttttaaa caagtactct aaaatgtagt ccctcctcca atctctctca ccttgctgaa atctgagatg caagtttcta tctagaaagt ccaacctgtt ccccactCc caccccaaac gggaatgtct catggcagca gatctcacga aattacctgc atgagatttg cactttaata tgtgtgtgtg catgtactac atgagcggat gagaagcatC tatatgttat tattgagaat tatagctCtC tgaagtacct tggctgcccc gccttgtaaa gttttcttgg tcaggctgac agatgtttgt ttgcacaatg ttctgaaaaa taacatattc aaacatcaat aaaatagagg aaaattattt ttaaatttat ccaagctctt tttttaaacc accattcttt t gct gtct gc ttgccagcct ggcatttaaa ttatcctaaa aagtaaaata tgaatcagga ttaagctttt t tat cat tt a ttataataaa cataattaaa aacaattata ttcacaataa tggcaccttt ctagactcta tctcgatttt gctacctggc aagttatgtt aagaagccaa aacccatttg aaagtgtaaa ttcaaagcag ccaagaatga gtcaacaggc gatgagttct tcacaattta tccctctccc ggttcaaagt gcatagcaag accacttcac ggaagttcca tccaaacttt cttgttaccc ttggtactaa tgggtaattt caggaagctt agaaggagaa ggactcactc taccgggttt ggtggggaca acaaggttga tgtgtgtata tgtattgagc aaaatatgga ttttgccttt tatatgtgtt atttttttct ttttgaacta gcaaactgct aaattgttgc aataggaaca ttgtttgcag tccacaatca tctgacataa atctctattt aaaaggaaag agaacacaat taggtaccac ggcaatgata tgtggtt cag tgtagtttaa tcctagttct accgagttct ctggcactga cacagattta at tgct ga ta ggatagctga gtagcagcta tcacagagta tgctattaca aacaaaagca ctgtctttga ggtaagagaa atactgggta ctttatatac tgactgaaca ctctttccat cccctcattc tctgttgcac cgagtaatct gtaactacct tcttgaatca attgaacaag gggaaagtaa ggatataagg attcgatgtt tgcccatttt ggagatgcta gccatggagt agaca cccat tccacagatc agtcaccttt tgtccatatc aattttccca tccaagtttt agttccaaag tttactgcat ataaaggaaa acattcatgg atactgaata actatcataa ctcccttgac tggccaaacc gttacatttt tatatataca acatagaggt ccaacttagc ctccatattg taaattttgt caaaatagca aatactaaag tcccataaat tggtatcatt tt taaatcca gcgcagtcaa gagtgattat tgactgacat ctctcaatgt caattcccta gcaactttat cagttatttt gaattcatat gggacatttt atgcaatcac ggtcccctat cagggtgatt aaattaagaa tgttgtagct cctagctaaa tacattctat ttatattcgc tat ttgaaga tcctccacat aattttatac ggctataatc aatactacca tactgcaaga tcctaatcca aatgctcaaa attggggtga cttctgctag aatcaatctg aactagatta catagttttg gttagaattt caagcttatg aataaggagg aaattcaagc tggtcgatat tgcctcacac atgcaaaaaa tatggcaagc tgtcctcttt tctaggtcag gctccagttc actatcagca catcttccta cttgtcttct tggtttccat cagtttgttc gaggtttaat cagatgggga aagagagaaa gaacagcctg acgtggggat atatcaccaa aaaattatta tatatgtctt gctcagtaaa tggtcagtga agattgttta atatattttg tccctttaaa aataaattgg ggcagaaaag aaaatagtca tactttagtc cagcagtgga gtggaaatca tccagctaat tattctgtgt cattttattt atattagagc agacaggtat gtgaaagagt aaactttaat aaggaaagac aaaccctgaa agttatgcag gagt ga tt aa tcagtgattg ttagcatgtg ataaaatata ttcttgatta cataaaagtc gacagtaaat tggactattt tatttagcca catatatgtt tgtcaatatt ttgccttgtg gctggtctgt tctgcctaat tgtgttgttg tagcctgaat gcctgagtat cagaggcaag ccttggacat cagttaaata gagcatgaag caaaaataag t ccaa cagat tctgactgca gatataaaat atcttgtctt ctcaccacat gggcaaaaag ccaacaagtt ttttggtcaa tcttctgagc tctgagccct atttttgggt tcacactgct tgaatcacag agcaaacacg agccccttac aggaaccacc tattggaact gatataaaat ttaaagtata taaagttatg tgtcaatgtt gtttatggtt attgagctgt tctaccttag ctagaaaaaa tcaagttctt gttaagagac acaaaaatgt atttcctctc agagctggct atcagaattt ttttattcat ctttcttgct tgatacttaa acttataata ctct t aggt a caattggcca ttttaagaat tctgaactgg agttaatgca caatagatag caacataaga cttcaaagca ttagttttga attattttcc gctttataca tttggacaaa atattttata caatttctag ttatttttat gtttatataa tataatagct tgtcattgaa ggcagaacca ttgactttct aaccctt tct gttgagtccc atcactttaa aaatagaagt agaaaatctc tat ca aaga t aagccagctt gaagaattct ttagtaatgc tgtaat ctgt ccttaccttg caattttagc ccaccccctt 132000 132060 132120 132180 132240 132300 132360 132420 132480 132540 132600 132660 132720 132780 132840 132900 132960 133020 133080 133140 133200 133260 133320 133380 133440 133500 133560 133620 133680 133740 133800 133860 133920 133980 134040 134100 134160 134220 134280 134340 134400 134460 134520 134580 134640 134700 134760 134820 134880 134940 135000 135060 135120 135180 135240 135300 135360 135420 135480 135540 135600 135660 135720 W0005851 0 fhttp:/twww.getthe patent. comf~og in. dog/Sexa m. su portFetchDefau it. dogiWOOSS8l0.cgc?fromCar-he~jJ art=maintoolbar--bottoml Page 445 of 737 WO 00/58510 PCT/IBOO/00435 ttttgtcctg ggtagtaaga tggtattaat tactggtgaa tagctgttct ga ttt tgct t tcagttaatt caaggatttt tttttctttt agatgttatc tgatcagcta tatgtgaaat actttcatgt aaacacttga ggatgatcag gttcacttgc ttaaccacag tgcttggaga caaaggcact gccatgtgtt cttctcctta aaaataattt taaaaaaaaa atttaggttt ctaaattttc ttttaataga gcaatgccaa accagtattg gaaagttgca ttttttgata tcactgcaag tgggactaca ggtttcaccg gcctcccaaa agtataattg atttatgctt tcaaacgttc acgtccagag ag cga agta c cagaattata ttcaccatct tcttaaatcg ca aca aggaa tggattgtaa ctacacttga tagataccgt catgttctaa gtggggagag aaccactttg gcacaaaagg tagaatcaag aaacaagccg agagtatatt ctctaattgt ttagcttgtc cacctggaat ttatttgaat cctaaataca tctaacaaac caataacaag tttggcatat ccaagctatt tatggaaaaa tctttggtgc acatcagtat tcttgtttat cattacttta ctccttgtag aaattaaaat t agt tt ttag tgggatatta ctcttcaaag attaaacatt gtagaggttt ctattgcttt aagaaaaaat cca cat gtt t tcctcatggc cttgtcagtt ttaattgctt aaatgcatta ttcaacagtg caatctagta gagcttaatt taggagt gct aaaaagacta taaaaatgta tctgaaaaca ttttttatgt tgaatcctca aatatattgc catacaataa tggagtctcg ctccgcctcc ggcgcccgcC tgttaaccag gtgctgggat ataatcaggg ttcagtgctg tttgaagtct aaacaagtat aataagcatc ctaagaaaaa ttttcccgtg acttaagtgg aatatcttga ttacccatga aactttgagt ccagacaggg taaaacaaaa gggcatgtat tggttttgtg gaaatct cct gtaatagcaa atggtgctgc tttttaacca attcccatc cacacctaac gcagttgccc gtcacctttt cttcctgtct atattttact gatgtctgct aatagcacaa tactgtactc cgtatgaatc actatttata ggagacccct tgaacttgag ttaatgatta cctgtaaact taatacatca aaatctttta aaattgtcac tgttgggaga tcagaaaatg tggtgaacat tccaaaagaa aaaaacataa gagtacccca cttactactc aagtttctaa aatagactct tatattttat gccagggcca ctttgggatg cattattatt ttggcaaaag gnnt tttttt tttcctagcc tgagacgcac ttgaagagat attccattgc ctcttcctgc aaacttaggc ctctgtcgcc cgggtt cacg acca cgcccg gatggtctcg tacaggcgtg caatatcaga gaagcattat atgaccttaa attggcaatt ctattcacaa ccctatgaag tccctgcatc atactggttg taataaaaaa tccccatcct gtttctaaaa tgaactgaag aggccgcacg gacttcttgt aatccactgc ggttgatagt gtcgagttat tgagaattgc aagcagctag tctgccttca tatgcttctg aagatatcct caatacaact accttctccg tattttattt tgttttgttc t aaa tat ggg tggtctctga aaagcaaaaa attcttctca taatcctaac gcattgagta ggttccactt ttctatggat agaaaatact caaaaaacgt agatttaata gtgaattctc cacactat cg atagtaactt agaaactttt tt ttagcaat aaaattgttc tccatttctg atcagatgag gtctacacta tcacatctac atggcgacag tggatataaa attattatta tttaggtaca ttaattaagt aaggtctaac gtacagttat gccaatcgct ttaaatataa tacactctaa aatttattta caggctggag ccattctcct gctaattttt atctcctgac agccactgca aaatcttgaa agaggttgtt gtaaagcatt gtaaataatt ttccaatgta aaaataaagc tatgccctac tttaaatatt agccaaagga attcctttag atatttcctg caagagtccc ggtgctccta tgattattag t gt t ttcagg ttggtaatct cagaaatgtg acgtgtagtg aaagatgaca ttctctgatt tctagggcct catcaattat tgccttgccc attcgttttt attgcctatt actactctct ttagatgcat gaaaatttgc actccatcat tgtctaccac taatatcaac ctacaaaaat ggatgtttgt gtcacaaaaa atgcctcaaa gatatttaat atacgtttta taagtaaaaa tagactgcgc ttatcaacaa acacttcttg ccaaaccata ctgtgtggat tcccactgag ttatgttttc actgaaaaaa agtcatccag cggggccagt gaaaatgagt ttattatttc atttaagaaa ttttactttt accaggtatc ttaaaatttg tat tat agt a gtgaaataat catattcact tttacttatt tgcagtggtg gcctcagcct tgtatttcta ctcctgatcc cccggccggt taat tt gta c tcaactatga taaaacccaa tt tgaagtat aaaagagatc ttgtttgtta tgtttctgct tcttatctgt agcttttaaa aactgttaga ctttgagctt tggctcgaaa aaagggaata aagaacattg atacactgcg agacagaagg gaaattggtt agggagaaca ttgcctttgt acctttccca tgacacttcg ctctcatatt cccatcttag ctccatagcg tccccagtaa ctccaaagcc gaattaatgc aagcaggaga ggtgtatcca aactattttg tctatctgtt tataatacac cat tcgtatg gagttttaag caaaaaataa aatctttatg ttgtataaaa ctgaagagta actgtgaaaa gtaatgtgaa gt aaa ga ta a ctaaaatcat tcttcttcta gttagccaaa tataattgag aagaattaat gccaaagtga gcttagctca tataaatgaa tttacataag atgccatttg aatgatttag tgagattttt ctgcagccat agctatgata aaaggaaaag acaataaatg ttttatttat cgatctcggc ccctagaagc gtagagacgg acccacctcg aatttattta tctaaaatga aatcattttg tggtttagaa ttagcaaaac tggtcatagg cctccaagat tcctcattaa atcacaagtt aatttaccca taagagtttt accaagttga gtgtgcctgg aagtcagcaa agaaatgcaa aggggtaatg tggtgttggc ttatattgag aagggactca acccttcatt acaggtagct cgat tcctt c tttcaagttt attgtatccc cttatcccaa aaaggcagct tggaatagta agggaattag aagattgctc gatgaaagtt 135780 135840 135900 135960 136020 136080 136140 136200 136260 136320 136380 136440 136500 136560 136620 136680 136740 136800 136860 136920 136980 137040 137100 137160 137220 137280 137340 137400 137460 137520 137580 137640 137700 137760 137820 137880 137940 138000 138060 138120 138180 138240 138300 138360 138420 138480 138540 138600 138660 138720 138780 138840 138900 138960 139020 139080 139140 139200 139260 139320 139380 139440 139500 W0005851 0 [http:/Avww.getthepatent.r-om/Login~do /$exam.support/Fetch/Default.doMIO005851 O.cpc?fromCache=l 1 art=maintoolbar--boftoml Page 446 of 737 WO 00/58510 PCTA~BOO/00435 gtttattgta ctagtagtat ctttctctaa aactcctcaa ccctctaccc tagcccattg tgaattccaa tacagttctg tttattcttc taataatcat tgaaaaatta at tacaatta agaaacatat ggtgaatgaa aaagt tgaag ttgaaatcac actggaaaga ttaattgaaa gcgtatatga ctggtacaga ggatgcaatg acccaaattc ataaacaagg cgcttgattc gggattaacg gttgactttt ggcttgtcaa atgaatctat ttgatgagca caaatatgtt agctcagtgg tgtacaaatc atgcaaagtt atatacgaga tttatttatg tgacatgata tgatgctgtt tctagaacta* caggggtgat tcggtttaca tcaagaaaag gcaagcaagt gaagaatacc gt at at atag agccatgtaa cttctcatgc ttggcctatt gcaagtggaa tcagaggaaa aaagaaagct tggccatgtt acagt aaaag aat aggtagc tggttagaga gacgtttatt gcttaatgag ttcactcaag caattgaact gtctttctc tttgaataat taagcagcta tcagtgtagt cacaatttgc atttagtttg cagatcctca cttgggggaa aatctagcag agctgacatt ttcatggata cttctgtcat taaaccaaac ctagaatagc ttatagcagt attgctccct ctggttcaca tctactttct tgattaatat ttaaacatta attgagaaag tttcccagag tagaggtggt aatatatggg gagtctggtt tcaatgatta caatttgtga cagatacaca aggctttaag aagacattta ttgttgttgt tggggaggt g tacacagaat gtacactgca attcatattt aaagatatgt tgtttttaac tggaacttgt ttttaaaagt gaaggggatt taaattggtt ggagcatagt gatgggtttg ttttgacttg atctttggaa ttgtttttaa cgtttttgtg tgagtttagg aaaagtgcac ctagcatgcc ctcatcccaa ctcttgaaca tttgccttct tctaagcact ggaagttgat gttcctgcca tttaagtaat aaattttaaa tctttatata tttaacaatt ttcttactgg ctattagcag t tcact tgga cttttcctta ctatgattat ccaagtcctt cgatggtatg tcattatcaa tgataaagtc gagaagagct tggttggccc cctggaagga tctctcccat atgtccaaga ttttcttcgt atcccttttc ctttcttatc tcttcattag tattgatttc catctgaatt ttgtataaaa taacaaagaa gccatatgtt tcgtctcttt aaaacaagac acaaagacaa atgaacatcc gttgaagtat ctaatcgaga atagatttac gaacattttg tgttagcctg tttcagaggc tcttccctct ttcgttcctg aaggaaatac acatagctca gctgagagtt gtttatctga attgatatta ttcacatttt ctatagggat gcttgatcct tagagaaaac aataacgtaa tcctggatca tataaaacca atgtgtattt tgctgctctg ttttacttgc accatacatt aaatcagaag aataaaataa aggtaattgc caactcttca cccactagtc ttaagtggtt aaagtgatcc caatgtttcc gccatattc gatcagagaa tcaacatatt agtattctat aaggggacta gaaagattgt tgaaacaaga tgctatttcc tttccttctt aagctagatg accctgttac actctcataa 145 ttcatcataa aataagctga caactctcac tgaatgcaaa ccttcatttc atgtacaatg gcccccccat cccaatttta tcatatcttt tgaaattcct cca ttga t tc ctgcttggag tggacttatc aattgtcaaa ttctggaaaa tgctactttt cacaaatgtt gaaatatgac atacaggttt ttaaaactca caaatttgct tcatcgtgac cagactatgg aacactcaga tactttgttg catctgggat ctttatctat atttagggct gagttttcaa gcttttataa attagctggc atttattaga tttaatggtt atcttagtac ccaggtggtt aaattattct ataaatctag tgcctctgaa tggaaaccaa acgtagacca aacagcagac ctgccttata ct tt taggta cctacggctc cacattgata tattctgcct atgcttgtaa agtctttaac ttgccgtgac atgttgaaag ctgcactatt actaacatat aaaggaattg gaaagaaatt tctctataat t ttcgggaga caggaaatat agtttgtcaa ccctcgtctt aatagcctga ctatgtttat aattgtgcaa catccacaga ggaggatgaa gctccttaac tgagt ctgca agaacagtaa cttaccataa atatacaaga atccagtgat taactaaacg gtaaatttta gatacatttc taatagttat ctgtgaagaa acataataat attaggtaag ctgagcactt gtttactgga ttgaagtagg atgtgataca cacaggactg caatcaaagc caagatcatt ctagctgata tggctgcaag acgcgattta ttgttgacat atttcccttg tfgcatatctg gactaatgta atttattata atttctgctt tctaatccca caattagaat tgtactcact atatttatgc ataaaactgc aaagtcttta aagatggaga t t tagtct Ct gagccatcat tgaaataaaa caaaaataac aatatggaat aaattttatt aatggatttc ga gca t tacc tttaattatt gttccatt tt caggagatat agcatccttt tacagattgt tttgcccaat aacaaaaaaa tgacatttaa aattcagtca catgttccac gtataatggc tgttactttt tatggtatat cgccatgtgt gaagaaaaat attatctcaa aatggagttt aaataattga aacaaaagcc atgactcatg cactgaggaa caccaatatt ccctctgtgc tcatgataat tctgaactgc cttttacttt at tcat cct t ccaccctctc gaaatatttt tctgaaggca ggctcattag cttcttttaa tctgatgtgt atgaagggta gaaaaatatt gtagatataa aaaggtgcaa tctgatagta gtataattac acatggaaag aatagctttt t tgt tggaaa ttttgttgtt ccctt ctgac tctgcttaat aaaatactct ttggctcttc tggagcatac aatgaatatt atggcaaatg cccctccccc agattacttt tatttcattt gaaaccaaaa tttttatatt gatttttatc aaagcaagaa aatattttgt atttttaaga gttggaccca gaaaattaaa aagtgaatat cgacccgggc acatattagt agaagatctt caagatggaa gt ga ttact g gctttgatag attggattta tggaattaga gaattacatg gttcaggcat agtttaaagt ctttaatcac gttataaaat aacctccaag tattgattca agcttctaac ttaatcccac caggaagata aacacaaagc 139560 139620 139680 139740 139800 139860 139920 139980 140040 140100 140160 140220 140280 140340 140400 140460 140520 140580 140640 140700 140760 140820 140880 140940 141000 141060 141120 141180 141240 141300 141360 141420 141480 141540 141600 141660 141720 141780 141840 141900 141960 142020 142080 142140 142200 142260 .142 320 142380 142440 142500 142560 142620 142680 142740 142800 142860 142920 142980 143040 143100 143160 143220 143280 W0005851 0 fhttp:/tww.getthepa tentcomLog in.dogSexa m.su potFethDefa ut. dogNVO005851 0.cpc?tromCa che= 1 pa rt=m a intaoolba r--bottom I Pa ge 447 of 731 WO 00/58510 PCTLBOO/00435 catatgactc gatataatat tttctcagtg catgagagag caacagtgac tgaatatcca atatgcatta gactgtgtaa atttatcttt catcacgttg acggtggctc ggt caggagc aaaaaattag cgggagaatc act ccagcca aaaagaaaaa ggatcttgtt tatttggaac cacttttaaa ggaaaactca ttcaaagtag catgatttaa t gt ggat tt c tccagaaagt tgaacacaat gttatttgct cacctgtcac ggactcgcaa cgtgcacttt acggaaaata agtgtgtatg gtatttgtat atttttaaca tcacaacagt gat gagacac tgctgtaatc attgtgttaa tccacacccc act gaagtgg atcactgcac aaaaaaaaag gctagatata ttgagaagag gagggcacac gcttttgcag aatgccaaag tggatcctga tgcatttttc tggcctgact tggaggaact ttcatgtatt gtaaataagg atggaagata aagtcaggaa ccagtctcca agaggtaaaa cttcacttat gcagataatc gaaaaatgat tattatccag gaaagatggc tgccaccacc ttctgttctc ttaacctcta attggctggt aaaatagtga tcagtgtagg atctgtgagt agcatgcgat aggtttggga gtttatattc ct gga tct ca ttttcagaat acgcctgtaa tctagagcag cctggcattg gcttgaacct ggaaacaaga gaaaagtggc ttcataatac cttttctttt aacgttgtgc tacaaatata atgcaattag caaacaaatc at ct tgtga t gggagaacat taatttaata ttgtagatac ctgtgggtgg aggatttgag tggggggatg ct tttgt tt t tcagagcata tgctctttat gcattctaga acaagggaga ctcctcagat atttaattag cactcacgtg att agccagg gaggatcact tctagcctgg aaaacaaaaa tatttttttt aaaatcctgt gtgggactct atctcctctg ggt tgctggg agccactgcc ttgcctgtat ctgccagtga gctactgttg aaagccctaa tcatgagggt tgatctttct gagagccttc gagttatgaa tatatagtgc atccttagaa agagaagaag aacatgatcc cttctctaaa tctccaggca atcaccacta taacatttcc ctgaaagatg gaagttttat acactattca tagttcagtg ttgttacaca ccaggaaatt accactgaca atgttctgtg gtcttcttca tgttgaacac tt ccagcact cctggccaac tggcagcagc aggaagcaga gtgaaactcc atgctcatag aaattaatta aataataaag attattttaa gtaaattgca tgcttcaaat agagaagaga aagccattct aaaagt tgag catacacagg aatatcagtt gtaatcttaa tgaggagcca tgcttaaata ttctagctca tgtgaacaaa caatctaaaa ctctagaagg atttcaatga ttttgtttca aatttatatt ttaaatttgt cgtggtggtg gagcccagaa gagacagagc ggcgcaacac ctggtcagag tctattgact gcgccaggac cacctgaagc cttaggaagc ctttgtctgg gcctgaggtc cttcacagtg atgaagagtg ttcctaatgt agagccctta ctccaccatt accaagaacc aaataaattc t tgggccact aagtttgtga agtagagaca attcatataa gaatggtgc gatagcagga tcatttatgt aatcagataa cttttatata cttttccaaa gattcaggtg ggtctcaaag cacacattca ctattttaat tatttcttaa aaatactagc tttatgaaac acatagaaaa ttgggaggcc acggtgaaac ctgtaatccc ggttgcagtg atctcaaaaa caagtactat at gatat aa a tctagtaaat aaatatatga ctgtttttgt tagaaactgc aaaagtttct caggagaaag aacagttatt catttgactg tcgatgagat tacctgtgat ctgatgctgt tcttcagatt tctgcacaag tgaaggcgaa aggtacatta tgttttctaa gaccaggtca aaattttt gt ttaataaatg aattatgtcg cacatctgtc gaggtggaaa acgaccct tt agagagaagt aattacaagt tagagagtta aggcacaact gccgcctgta acgggctgca atatctgt ct t tgat tt agt cagttgcaat ctttggacca gatgatgtga tgaatgagac tgaggacaca ctctctgtca ctgcatttta cgtttgttat atgcagttga gggtgcaggg atgcactttt tgtacaggac gagacattcc tgatatcaaa tttaaacatt gaatctaaaa acagaacaat atgatatctt catagtacct tgagccctac aggttctcga aagcacgaat tatgtgacat ttatacaata gtgtcatgct aaggcgggtg tccatctcta agctactcgg agctgagatc aaaaaaaaaa gttagtgata gcattcatta gttgttattg atcagaaaag gaagatgatt aaatgatgaa gatgaatttg catgagatgt gcataagcaa tatgagaaaa tcatgctgca gacaagt aga gtaaatgcca tcacagaagt ttgaacacac aagtcaatag aacaataaaa tccactctct cccagcaa ta tctgcctact aaaactaaag gtaaataaaa tgtaatcgaa ctgaagtgag gtccaaaaaa gatcttatcc ctgtctaggt aagaccctgc gtgggggacg gaagctagat tagggataac ctttgtgtgg cacactggca gtcatttagt aatattttat ggaagtggga tagtgtccat gcaagaaggc gcactttgaa ggccacccag taaattcact at gggtggag gaaagtaggt gttcaattct agggtgat ct taattgattc actgaaatgt ttactctaag tgttatgtta 143340 attttagtgt 143400 tgattatcct 143460 ggacaagcag 143520 cttaaatctc 143580 gatgattctt 143640 tgcggaaaca 143700 tgaacaatta 143760 atcatatctg 143820 agggccaggc 143880 catcacctga 143940 gtaaaaatac 144000 gaggctgagg 144060 gtgccactgc 144120 aaaaagaaag 144180 gtaaatgcat 144240 aatatctcaa 144300 aatagaaata 144360 gaaaggtgat 144420 ttatgcagaa 144480 ttcacaagca 144540 agtttctaca 144600 tattcgtcat 144660 gaattatcaa 144720 agcatttcat 144780 cggatggtta 144840 ccacggggga 144900 gagccgtgac 144960 tagggcatca 145020 attgttagat 145080 ccatacattt 145140 tgacaattca 145200 taagccattc 145260 tggtgacaca 145320 atgccataca 145380 agtttttgca 145440 agagtttaaa 145500 gttttagaaa 145560 ctatgattgc 145620 agaggaaaaa 145680 ttatccttat 145740 aggctcacat 145800 cataagcaga 145860 cttcatagca 145920 gaaacctcac 145980 tagatcttta 146040 ccttataqjgc 146100 gggtacaaac 146160 taccttccct 146220 gggcccaaag 146280 cctctgggag 146340 gtaagaagag 146400 agccttctgc 146460 ctcagactcc 146520 tctaagacag 146580 atgtattcag 146640 aacggtagtt 146700 cctttaaatt 146760 gctccagctg 146820 ttaccctgat 146880 caggagggaa 146940 caatgatcat 147000 agtttttcaa 147060 W0005851 0[htlp:/twww.giettheoatent.com/Login.dog/Sexam support/Fetch/Default.do-qNVO005851 0.cpc?fromCache= 1 part=maintoolbar--boftoml Pag~e 448 of 737 WO 00/58510 PCT/EBOO/00435 ctcaaatgtt cccagttttt ttttgccaaa tgctaaggga agtaatctag tggcatctta ttgcaatatt aagatgttgt tatgtggata aaaaccaaac tgaaaacctt tatggatt tc atcatacaac aacagtaggt tgcgtggctg gtataatttt ttgtataaat gttattaata ttgtcacatt aagtctaaga taaacttaaa aacttattag gaagcattta aaatcatggc ttgtgaacct tttcatagag tttcattttt tccactgaaa ttgtctaact aaagattgag ttcagtggta ttttctcttt tcttataatc tgtacaat cc aacactgtgt tgtagtgtga cctccttgat accttgttaa agtaaatggc tttgtttttt ttcactcaca tgtgaatatc gacagctgtg cagttt cagc taatgttcaa ccatattaag ttttcacttt ctttatgaga ataatttcaa tttcagacta tagtaagtat ttcacaccgc tgactcacag gaagcaggca agccacttat gtggaaacca at tacaa ttt agggagtatt ggaactaacc cattttttac agaagacaag agctgaggaa aaaagagaat atgcttcctg atacatcact gtgagtatta atccaatgat aagaaattta atagctgttt aaagcataac aattgcaata aatccactta cctcctcttc tatgatgatc ttaatagcat atacaaaata tgtcagtagt gggctggggg ttagcggaag atgtgtaaaa gctaatattg gtcatgagat ggagttaagt gccgagtctt tcaacctgaa tattatgagt atttagaggc gacgagtacc gtactgggga tccttgtgtg acaaaacaaa caagttgttc ttagcaatgt ccacaattct tgcatcatta ccatgcttct aaataacact catatctgtg ttcttcttct atttttcagt cacctggaaa atcatctctc ttctgcctgc gcattttcaa ttaacaatta taacagaatg tggcctcctc gtatctggtc tgtttttttc ttttacctgc tttcagcttt atgtctgctt ctaagcaata tcaagaatac tat aaagaac ttctgcatgg tgtcttacat aaagctatca ctcccatgat ggattacaat ataattggta tatatttgtt ttatctttcc aattaaaaaa gtgagtagta gagcattggg ttttgtgcat gtatagcttt acctagtttg ttttgttgat aagaaaattt attttattcg agatgagcct acct taatgt tctgcagatt ttcccccttc cacttccact tttcttttct tgtgttaact caagcttttg agttggcagc tgtaggaatg ttaagactgt atttagctct caggattttt gatttaccca tgcaattcta ttctgaggat ttctaaaatt aaacatattc atttagtaac aagttaagcg tatacttaag acagaagatt tgatatcatc tccctcaatt tccatgctgt t tt taca t tt aatttctagt ttcttctctt gtgtcaccta tgtgtattaa tccaggcact ttctccatct atagctttta tgcttcttcc gaacatcccc tacaatacac ccctggtgca cct taggtaa ttttctgcta ctttaccaga caaacttttt ttctcttgga aaattttgaa gaaatatgga tgaatacttg ttcccgagac ctggggaggc ggcagcaggt gatctcgtga ccaaacacct ttgagatgag aagaatgact taatgcaaat aagtctttgt gaagtagtaa atctaaaatc tccaaaaaac ttgtattatt gatgttaaca atcacacaat agtaacccat aatcagattt aggtgcatcc aaaatgttca ggctaaccct tgctgccacc tcagcctact tcatgaatag gcagctttat tactgcttgt aggagtctaa cataacctcc tttagtatga agaactaaaa gtgataataa atttgtcttt gtattacatg aagtccatgt ctcacaaaaa acaaattctt tatttagttc ctcaactgtt a gagaatat a gggaaattta aaaaatacaa catttctgtg ccagattgcc aatagaaact tgttgtcaaa cagtgacttt ctttcattta tcagtatgca caccaatgct ctgccacaca ttgaactatg ttccccaatg ctcattaagc tcttcctctt tttcagtgtt gactgggggt gagatagaaa tagttttccc taaacaattt gtgtctttac ctgagattga gcataatttc tacaagacat gtggatattt tgcgtaattt ctcaggaaac gagacagaga taactcactc cccactgtgc atttgggtgg gtccctagtg ttgaattcaa taagttttaa gccacatggg t cagagaggt aaggcgaata aactctagtt tgatt ttgag ttggttattc caattctatt tacgttttct tgagtcttgt gtggttaatt tgaataacat tcggttaCc cagtatgaag taaatatatt tgtaagaata tatctgtgag gttacataaa acattgttca tacaaccatg ataatacact attgacatgc catttacaaa gcaaaaaaaa tcttagctac gttacgtgct ttatgtatga ccatttgtgc aaggtgtgta tgact aacaa ggactgccta acatgttgcc taaccacaag ttctctacca ttgaaattat tatttatttt ct tga ttct t acaagtaata gaacaccaag ttcttggcct ctctcatggc aaagattagt ccttctattc cagccacatc tttatcttca cctagactcc ccctggatac caagaatctt c cat a aatc t tgtctccaga gtactcaatt gaacctctct attttatgag acacgggacc ggtgagtgta ataaagaaaa t taga at aat gagagagaaa actgtcacaa cccttcacca ggacacaacc cattgaaatg gatggcagac acggattata aagtatgcat t t tgggtt ca atggaaggtg tcatgggagt ttaacataat tttattctga gactgtaaag gt cgct aat t aatgttcaca tgtacagatc aggtggaaac cagacacaga acgatgagga ttctcttccc cagaatataa gttttcattc aattgctgac atggtcaact gagaaatatt tagttcatta attacctcat tgaggaaact agtcagagtt tgcctttctg aattattttg tagggaggta tacttaacag aacaagttca aaaatatgat cttgttatct cttgtttatt cacagttggt tctaatttct attttgctat ctgcagaata at tcc tc ta a atttaacgtc ggattcccac cttaacgctt cacacacagg atctgcaatc agccttgaac attcgatccc gt cact ct gg tgttgttaga cgagggtctc agtattattc tgatttttag ctttctgcca taaaatcctc ctgggctcca aatacataga acttggggca ttaggccgtt gaggtttagt ggtgaaaggg gaaaaaaaac gagaagcaag acaggtgaag aaaccacatc taagtctcat ta a acat at g taaaagagca gagagttaga taggtgtgca aatagttgaa 147120 147180 147240 147300 147360 147420 147480 147540 147600 147660 147720 147780 147840 147900 147960 148020 148080 148140 148200 148260 148320 148380 148440 148500 148560 148620 148680 148740 148800 148860 148920 148980 149040 149100 149160 149220 149280 149340 149400 149460 149520 149580 149640 149700 149760 149820 149880 149940 150000 150060 150120 150180 150240 150300 150360 150420 150480 150540 150600 150660 150720 150780 150840 W0005851 0 [httpiltww.qetthepatentcomfogin.dog/Sexam.suportFetchDefautdoqNVO00585 1 .coc?fromCachie=I1aart=maintoolbar--boftomI Paqe 449 of 737 WO 00/58510 PCTIBOO/00435 cagttgcgct ttttggccaa agagtcaaga ttgacagaag gttaggtaat ggtctctttc gtatggacaa ctctaattgt agaatt cagc tacaaagact accttctttt tgggaggcca gtgaaatctt agtcccagct gcagtgagtg aaaaaaagaa taacgttagt agaaaaatac agaaaaatag ctagtcaacc aacctacaaa ttatactgtt accttgtgga gagttagcac ctcatacacc gtccagctgt taaatttgtt ggctgcccaa aaattttcct gattcagaga ggcagagaaa agcaggctct tacaaatatc cat ttccttg ttccactatt ttaagtggaa tccaaaggag aaaaaagaaa ttataattat gagaa tat at acagtgcctc tagaagccga ggtcattctg atgacatact atatatacaa aacaataatg gtgtgtgagt ggttgtacac aatgtttctg ttaaaatttt atctaatttg tttaaagtca taagtagtga tcaatggata agt aatatga acactttact gaggacccat tgtaacataa tagatcaaat caaagaggat cacttggcag atgcaacagt gtacaagcat gatcagtcta atactatagg ctgttagcta agaagtgctc ttttagtaat cctgcaatct aatcaattgt acacagcata ttatcttatg tggatgacat gaaacaatag aggcgggtgg gtctcttcta actcggaggg gagattgtgc aaaaggaaaa atttcttcaa ttttggtttt atggcatgtt atttccaggg atttattttt aaagcaaact tgaaccgcaa ttataacaat gctgagtatt ttctgtacct ctgaccacaa ttcatgaatc tttaacaata gattgttttc ctggtatagc tatgcaatgg aatctgtctc caatatcagc tttcccccaa gtggaacttt tctgtatctg aaatccttgt aagaactaag ttcagcaaaa ttaccccaga atgtataaaa attcttgacc a gcc acgcc t ttattttatc tagataaagt ttgttcatat agaacattta cattttataa tatattagga attactatgt taatgatcat ataaacgaga actgcgtggc ggaaaatgaa attaaacttt tccagtttaa gctatcaaag aaaggttttc gcccttgtag tgagtgcgtg cagtacatcc gcacaccaca gctttgcagc gttgtctgtg tgttttgaga tacat gtgcc atcattagcc cagacagaat actgagtata aaatgttgac gtcagatatt cacaaagtgt aggccgggca atcacgaggt aaaatacaaa gtgaggtagg cactgcactc ataggagtac ttaaaatact attaaatacg tttacctttc tgcacattct ttaagatcaa aaatatggcc cctaaattaa agctgggtct caaactgtgt cacttctgat ggcatccctg gttcattgct ccatctctcc caaaagatag tgtacttcta aagaggacaa cctttgcatg tctctgttgg attattaagg cttgctataa caaaagttct ttaactaaat gaaattgtct caaggaaaaa gataagtgac tatatcatgt ttgatctgag ttattttcat ttcctaacca atcttatgaa ggtctt atag aaaaagttct tcattaaaaa tatcgtaggt aggttatgca cagatgaaat caagagtaat tccggttctg ccacattttt ttttcaaata a gga ga ct ca acattaactt tatcaacatt ttagtactaa ggcgtacgag aggaaaagga cagt gcacac tcattgtcaa atatttaata ccccaaagta ctgacttaag ttctatatgt tctactgtac atgaagtcca tcaagccaga tgcactaaaa tcaggctctt tggtggctca ctagagatag aattagctgg agagtcgctt caacctggtg atatggaatt t ttt aaaaat ttatttaacc cttgtttcag taatatttct agaatgtcaa tgagaaagac taggcagaga tggtaaatcc tcaaataagg tcctgtatgt gagtctctct ccattaaact tgggagagtc aaagtaaagt ccatattcta aggtggcctc ccctgtcttt attcaagaat tattagtaat cttttgaatt gagggaaaat tatcattcta ttatataaat ataacacggg atgaggtccc aaaatataac tttcaatgac tacatacact ggcaataagt agtagagaaa gaaataacaa acctaatctt caatggaaat tttgccaata ctgtgactca atggccatct gtaaaaatgg atactcagaa aggaaacatc tgccaatgcc agagacatta ggtcaattca ctgt ttcctg gggttgtagg catgcacacc t tta tggcag gagggtgacg agaagagatc gtaactgagt aaccccttgc cttatttttc agagttatgt atgcaaacat ggt t ctctgc gcacaaaata taattgaatc gaacttccta tgcctgtaat agactatcct gcatggtggt gaacctggga acagagcgag ctaggcatct tctaaccgct aacctctggt gcttctgatt caaaatttat atattagcaa tttgtaCttc aaattttaaa cagcagccat caaatgccaa cacgtcactt gaatctgctg cctttaaatt aaactcatat tgccattttc tcagttacac atcttccctc cct tggatt t agagatgatt gctctttcat agcaattcta aattgtgaag aaataacaaa gtctggagaa gatatactgg agaatcattt gtgacacaga gaaaatagat ttttactcca tacttgccca tgtagtcagt acataattta aaaaccatgg tttgttgagc gaattctaaa ttagaatata ttaaagttat t tga cat tat ggaaaccaca acacaaactg atgaaaaaaa cgaccgaat C taaaactgaa aaacggtagc gtccgtgtgt acacagtgca Ctccgagtga taacagtcag aagttggaat gagcagcctg attttatcag attcgtaagt gagaattaaa gtattatcaa cttttatgtc ctcaaaggac agtgattgga ggtccttata cccagcactt ggccaacatg gtgtgcctgt ggcgggggtt actccaaaaa.

cacaaatct t agaccactag ctcatcagag agaattccta attaggctga gtcacatggt tgtatttgag cttaacttag acttcagcca tctgtaacca tatttgtcta tgattctggg agtttggctg ggcaggtgag ttaaggtcta actgtcatgg catgctctgt taggctattt ttgtagtatg gttccatatc gactctagac ttaaaattct aaatgatatt atagatttct gactgaagta taagcaggct gggcacttag tggcCaaaga tactgcacag tcttcttatt tatttgataa aattggtaca atttttactt ttaatatgaa acttaaatat tgatgtgttg ctcatagatc caatgaaggg tcacttaagt taaaccaaga acaaagagct ctctatgtga atctggaagg ttgtggttaa cagtgacttg cacaggggtg gtgcgtgggt tacacccagg 150900 150960 151020 151080 151140 151200 151260 151320 151380 151440 151500 151560 151620 151680 151740 151800 151860 151920 151980 152040 152100 152160 152220 152280 152340 152400 152460 152520 152580 152640 152700 152760 152820 152880 152940 153000 153060 153120 153180 153240 153300 153360 153420 153480 153540 153600 153660 153720 153780 153840 153900 153960 154020 154080 154 140 154200 154260 154320 154380 154440 154500 154560 154620 W0005851 0 [http:ltwww.qetthepatent.romf~ogin.dog/Sexam.suportFetch/DefautdogAN0005 8 5.1 0-cpc?fromCache= 1part=maintoolbar--boffom]LPage _450 of 737 WO 00/58510 PCTTBOO/00435 aaaaggattt acggagatga attgttgcaa cccaggaagg ttgaaagtta taaacttaga gttactacac gttggttttg tttcatgact cacataagtt gtctcactct aattcctggg tgagctacca aacagaagtg aaaggattga tatagactgt ttggccagcc cttaatatca gattttattt aattggtgtc tt gca ct taa agttgaattt aaatgtgtac tgtagactca gattgattca atggtacaac tagttaagca tctaaaattt accagaattt tttaatagta gagaacatCC t tagct t tcc ttttgtcttt taggaaatct agg ta aa gca acatatccaa aagtcataat taccttgcct atatgaatcc ctgagggata tggaaacagg atcttttgat ttagaaaaga agccaactaa ttatgactgt agacagcaga cctttgaagc agtacaaaat tcacaggtgg ttttggctca aatatttatg gctgtggggg aatgtgctct ct ttat cat t tagtaagtgg ataatatttt ctaaacattc aaacagtaaa ttttacaaaa cacctacgtt agtgtcaaag tgtcttctta aggggagctc tgcaacagtc tttttctgta attggcacaa ctggaacacg cgtaagtgta agtttccttt aactacttgt ccttcaaata at tagatt ct gtaaccaaga ctcaagccac tgctgagcat atcattataa aacaataaaa catctaaaca tagataattt cagacaactg tctgatgcta tttgtatctt tgagctcact cttcaggagt attacaagac tactgacatt aaagctcagg atgatgctca atgtgcccct ttttaagcca atttgacaaa gaattctgtc agatgttatt aacttgtcca ggttgagtaa aagcatttga aacattcaaa tcgacattga aatatgcaat gccccagtgt ttaaaaaatg gcactaatat attgtaggga gaaatgcatt taatttttct acctctatag taagagcata gctgtgagaa agagaattac tgtgtcagca tataataaat gccgaccatt tacagctcca gcatggaaaa tggcacggga ttcttttttc tgatactgcc ttattagctt ttttgccttt attaaccagg aaaaatactc crtctttctc att taatgct tttatcaaat tgagtgtgtg agtacatccg agcttgaaat cattatttta ctgattacac agaacccagt taaatggaaa agcccttcct cggaaactat tttaaaatta ctggagtgct cttcttgcct acaaattatt gttaaatatt tattattggc ctcaaataga ttcttgcttc aaattcatct ccacatgaaa gctaattaag tgttgtatta ggctttggaa aaaaaaatca ttaaataatg caat cacaat taccagaaac tggactctaa gtggccaggc aagtggaaaa gttcatcagc gattccaatt atatcatcag tggattccac tgtcaaaaat attcaaaata aattgtatat atttcaggta tagtaacatt caataactac ttccaggttg gactgtgagc ggggtaaaac cctacatatt ttattggttt aaggggaaga gactgtttgc aacaggaaat caccaaaata gaaatcagca agttatttgt gaatccacct tatttactct ggtcctggaa cttcaactga agactcatcc act tgt agag gtagaggaat tat tgaattc aaggagtaaa tggatgttag gcaagagaaa aatatctagc gatgtacagg ggaaaagcac tgtcctcaaa gatgaatact atttgggatt ttaagttatc tgaaatacat tagaaaacta gaagatttat ttattattat gtggcaaaat cagcctcctg tggtctgatg tacagtgtga ttggaatttg agacattcaa ctcagccccc gcactctact aaaaawtttt ttctagcaac atttataaga agtgcccctt cttta aga ag tgatgatcag tattttggtg ctttgcaata ttaccatttt agtattaaat atcattgacg agttagggaa ttctggtcca aaaaggcaat ttgactggca acacatcttt tcaagctgta aatgaacaag ttctttgata gagctttcca tcctccagga tctgctttac tcaacagtaa ctcttcccag caagaagaat tgttctgact gaatgcccag agaaaatatt taggaatagg tttcactaga atccttctac aagctggggc tcactaattt gggagccctt ctcttggtag atataaaact tataagaagt tccctcctca aacattctga atactctcat gaaacataaa atttggaatg t catctccaa gaccgcactt cttgcacaca ttatgggagc taaaagtgaa tcgaaaactt taacccctct ttgagaagca ttcaagtcat aaacaaaaac gtcttatgaa tatttatttt catatctcac agttgctggg aaataattat tttagagaac tatagaattt atttacaaaa tttttactta tactatgtgt tttcctgagc accttctccc taattagata aaatattcaa aaatatactt ggct tat aca taagcaaaac tttaagcaca tatttgcatg tctttgctgt tacagtgaaa ttgtggaaat actcaaactc ggcatctctt tatatattct taaaatactt aatgttaata aaacaataaa gatgtaatga gctaggatta gaggatgctg atcaagactt gattagtttg tgtcattagt cagaaccagg caaatgctaa ggaggcaact cttcccatgt ctggtgtagc ctgcccttcc atgtctcgct ataaatacag gtctacttat aaatgtaatg gtgttgggtc gaaaagccgc tagctaaatt gagcccaact gactcctttg taaagtcatt aattgacact tatgcataga aagaatatct ttcttttgtt cacagcacac t ct gtgta ct aaaatgttac cct ttat t tt gccttaagta caaaatttga actaatatat tctcttttaa gtttatttta tagagacaaa tgcagcttca attacaggca tgataaaatc atacctgtag tgcccttcaa tggtgcttta ctcctgaggg aaccagctgt tatagatgtt tcttcctcgt aaacaaaaaa acatggataa aatgttagcc aaaaggaaga aggatcacat acaaacaaat ttcatttttt ttatcatgat ctgatcattg tgttttgagt atttgggcca actgctctat ggctgccctt cttaatattg c ta aaca gga ttaaagtgga cagaagctac gagcattttt tccctgcttc tgctttagga tctccatttg agctcatgaa taattgacat cttgaatccc ggagagacag gtggacttgg ctcataaaca cctaggaggt tatatggtta acactagttg ggggaatata catgaatatg cctactgacg ttttaacagt ttatccagac aaacgtggtg ttttttcacc gttaccattc aaaacaatat aaatggtctt cctttaattc ccttttgtat ctaaaatttg 154680 154740 154800 154860 154920 154980 155040 155100 155160 155220 155280 155340 155400 155460 155520 155580 155640 155700 155760 155820 155880 155940 156000 156060 156120 156180 156240 156300 156360 156420 156480 156540 156600 156660 156720 156780 156840 156900 156960 157020 157080 157140 157200 157260 157320 157380 157440 157500 157560 157620 157680 157740 157800 157860 157920 157980 158040 158100 158160 158220 158280 158340 158400 aagaaggaat tatagcggtt tgccacatta gagtacttta aaagtgcttc W0005851 0 [httD:/Iwww. getthepa tent.comIILag in.d og/Sexa m. supportFetchDe a uIt. d odWO0U85 1 O.cpc?fromCache= 1 part=mairitoolbar--bottom1 Page 451 of 737 WO 00/58510 PCT/IBO0100435 gtagagaatc ttcttaaaat gagatggttt ttccaggctt gtgacacagc agttaaatta aggaaaactg aaattctgca tcaagccgtc cccttattag tgctcagaaa tgattaaatc gggagttatc ataaagcaca ccagtgattt tgaaagtaat ctctcaattt taaaaagaag aacatgcttt agtgatggag atcatgtttc ttattgtttt aaatcattta aataccctta ggtaatgtta tttaaattaa aggccttaaa aatagctatc ttaaatttat gagatggaaa atgaagaaaa tgaagagttt aaaaaaaaac cctcatctat aatggccttg gaaaatttca gggtcttgtg gttgtggctc agtagcaatc cagtcacaag tttcttaaaa gaaagagttg cagatacgat actattctga tgtgctagaa atctgcatcg agactgtgat tcaaataaat ccaacatttt gggaggctaa tggccaacat gatgaaatgc gggcacctgc aatctcagat aagtggagat tgcagtgatc agactccatc tcaaaaataa aaaaataaac ctgaagttag ttttcctgtg tttttgaggg gcccttcaga agtcgggaca atagaggaat gagccatata aagctaattt agtaactaat ttgatagaat gcagagggca tatatacctt gatttattag cttgcagtga taagttattc ttcaaaaatt tcayggcttm ggctgagttt tggctactct caagctggct gagcttggct gaagcccagg cagtggcatg cttaactaca taagcwcact caaccatcaa gccatggtaa atcattcagt ctttcacaaa tacaaaaacc tacttaaaac gaatttaagt tataaggact tttggtcatt gggaaagtgt aaaaccaatg acttccaggg acttggaatt gagatagaga tcatggaata cactcattaa tttgatgtat aattggttct ttatcttcag gtattataag tttgtttgtt tatttgtttg ccaggctgga gtgaagtggc gccatccttc tgcctcagtc tttattttat ttttttagac tggcttcaaa ctcctggact gacctttcaa agtgctgaga tatggggttt tctatgcttt atgtttgggt tacttttagt atttattttc aactgctact tatgttgtgt cacagagtct cggttggctg acatagagcc tttactccac agattagttt catcatgagt aaatgaccta aaggtaaact caacaggctt gatactgggc tccctgtgat tttttttttt aagaatctgc cctgtataaa aactgtttac acgaggtact tcatattttt gttagctttt agaaatattt atgtgtgagc tggaatgaaa agatcatggg atagtaccaa ttaggaatga aaatggtgtg ggaagaaata aatgtgttta gccaggtgga catctctact actggggaag tgagatagca ataaataaat gcagtgcaga tttctcctgg tcatcacatc caacatacat attgtagttt ctttaaatca agatagatta tttttcaaat gaacaacaaa tgacttggct catcacgttt ttctttaaag tgatgaagtc agctgtcgat acactggcaa ttaagggtgt ttcactgcag ttttcaggta taggctggaa cgctaaactg ttatcacaga taacttctct gcttttaaaa ttttgtcttg ttcatcatag tcccaagtag atggggtctg caagtaatcc ttacaagcat cacatataat aaaccgtatg tcccttctct gaattgacac ccactcactg cctgcatctt tctaaatctc ttagCctgga tatttaaggg aggaatcata gccaacagag tctgcctttg tctactgaat ttttcagttt ttttaaatgt gt taga caa a aatatcgttt gagtgcttgc aaaagaaaca actaatctta tttggaatat gacataaagt ctaaat ggca ggtgatggca acatagactc gagtaaggat ggggtt t tgt ttttttgcta ggccaggcgt taacctgagg aaaaatacaa cttgaagcag ccactacact aaaaataatg cttgaatttc aaagtaaaac attttacctt aggagtatga aatgtaatga gagagacqat aaaagttcgt atcatgacga tattactctg gagctgggag cattacgagg gcactgagag aaaatgcaag gtactacggg aatgcaggtt attagctatc aaagtatgca gaagtgaatg agagaattct agctactcct agccacctat atgtttagca tgacattttc tttcttagag ctcactgtag ctggggctac gctatgttgc tcccacctga gagccgctgg acatacttag t gct ttga at tttggaggtg aaaagcattt atggcactgg tctggatatc tcagctttct ctctcttgag tgaaggaatt aaataatata ttgtaccgta accttctggg ctccacaaat aagccattta attaaaacaa taggatattt gttatatttt tgaaactaac tcaataattt tcaggctaaa cagtgaaatc cacactttgt gcacatcact aactcttcca acagatgagt gtgcctcgat gagggatgcc catgttacaa ggtggctcac tcaggagttc aattagctgg gagaatcgct ccagcctggg tttttataat tcattctcaa aattcaatgc taagatattg agaaagggag gaaataaaac ttgaaagaaa ttaaaaaacg taatgctgca gagctctctg gatggatctg cacagactga gagcttatga gactgggaag ggagtggagt attcagacag tgtctccaaa ataatgaaga cagaaacaac cttaatagaa gttggggct t gtactctgca ttttgcttag ccctctagag acagggtctt ccttgaactc atgcttggct caaggctgat aggtgggagg ttacaagaca gt ttt ct cga taataaaaaa ctccgttaaa ccaggcatta ggaaggacag tatcactcct tttatctcaa tcccccaaga aagagacatc tttgaccgag gaattgccaa tagataaatg cttgtgtaac ttcaaagtca attgatagga ttgaagttat tatcttctgg tagaaatctt ttatatattt ctgagtaata tctaaaaaga tgaaatgcaa tttccagatg aaggaaaaat aatatgtcag tacaataccc aaccacacat at at gcct at gcctgtaatc gagaccagct gtgtggcgac ggaacctggc tgacaggatg t tt t tcat ag ttcccattca tttatcttct gactggattc acagccttca tagaagatga gaaatatttt tgatcaagaa taatcaccca ttctgtggtt cttcaggctg agtgtttgga atgaatgaag tacatgccac gctggtacga aatcgttaaa tgtacttttt agataattgc ca ttcca agc aagaaagagc tgctgatcct ttcattggga aagttagcac gaagtatgcc gctctgttgc ctggactcaa aattttttat ctcaaactcc ccagcacct t t ggccagaag tgatgaaatt gttgtgattc agattccctt ttcttgttcc agcctgttgg 158460 158520 158580 158640 158700 158760 158820 158880 158940 159000 159060 159120 159180 159240 159300 159360 159420 159480 159540 159600 159660 159720 159780 159840 159900 159960 160020 160080 160140 160200 160260 160320 160380 160440 160500 160560 160620 160680 160740 160800 160860 160920 160980 161040 161100 161160 161220 161280 161340 161400 161460 161520 161580 161640 161700 161760 161820 161880 161940 162000 162060 162120 162180 W0005851 0 fhtt~tw~eteaetcmLgndq$xmspotFthDfutdqV055 O .cpc?from Cache= 1 pa rt=ma intoolba r--bottom] Page 452 of 737 WO 00/58510 PCTIIBOO/00435 a caaa ccaac ctgttgact t tgtaaaaatg aaaactatat tttacctcac caccttittaa atagaatatg aattatatgg aatgcagttt ctgatacaat atgcaaccct aacgtttgga aagtcatgta gtagtaaaat atagataaaa attttgatga agttaataat tgcacagctt gatttgttca ctcatttgtt ttttcttctg ctgatttagg ttttgtggac a cca ctat ta caatgaaaac tcttcattca aacagcagtc gacagcacaa aacaagacaa atttcaatgc tgtagggctg gttcttcctt tgggt att ca ttaactggct aagaaaggga tgggaatgca gccct caata cattaaatgc tttgaacctt t tcca tcaga cagatttata tgcagatgat taaaacagca agagagaaga aaaagctgaa gcagcatttt gggaacagga gcctttagtg tgaagaaggc aggctcttac catgacctgg atcgtacctg atgtgtacga agccctgtag cagtcaaaac gcaaatagaa ctgtcaagga gtgat cagcg gagct tcaaa ttttgaaaga aggtctccaa acctattcaa tatttcagtt cctaggcatt ttatgaaact acatgaattg aaaattataa ttttagaatc acatttgatt gatgctccag ttaaaatgtg ctaaagtttt gtcattacaa agtgacattc aagaacaatg aattggaagt aaaaatgaaa ccaatgagaa attacttggg tccactttaa ctatattaat gttgttccta tt agt tt t ta agatgccaat caattaccat atgatcaggt ctctgattac cagaattcag gtgccatgct atattccttc gtcaatccta acatttttgc agatagtttc gctctcctca ggcatccact gtcgcatgtg cacctaggat ggattggttc tgttgagagg ttttcttttc attgcccttg tagccatatt gtaaaatact ggatgtggtt ggagaaagtc tagatgttca ggcaatgatt gatgtatttt taccttattt agaatatatt aggcaatgct agaagtaggt gactgggaga ttttctgact aaggaaaatg gacatttcgg aagaatctag aataagagtg gacatttgga gctgaagaat gtaaaattga ttagaaattt tgatttattg gtctcctcta ggttacacat catctgaaat agtatcaaat gagacaaaaa taagtttcct tttttttctt tcgaattcta cttataactt cagctggttc aagcctgagt caagaagtgt ctgagaattt tcattacaca tttaaatatg gcaaaaactt gtaaatatgg tgggcagcac aaatctggta aaaattcaca gtgacactgc gagggtgtgg tcttttaaat ctaaatctgt ggttagtaaa catctttttg ttttatactg aggaaatgta cacctggaag agagaatttt atgtctttgg caatgtcatc tgtccagctg taaact tgag gaaaaaagag cattcttaaa cctatacttg ctctacctca caaacagtaa tttgccatat gataaaagcc catgtctacc tcgcaagagc ttctcatccc ttcaaagaga gagaactgca ggtagaaatt atcacgaata atatgagaat attgccttta gaggctatta ttcttgaggt taattaaatt tagtgtcata cttgtagagg tgggcaggtc gcattcagtg gct gagatca tgctgcccaa gaaaggtcag atgaacagac tttaagaggc attctttaat ttttcacaga ttggctgaca aaatatcctc 151 ggacaaaagg tggtaagaaa a.cactgtaaa aatattggca ttgggagtgt t tcct tct ca aaaaaatgat caccgaaaag attagattta tctcaccaga tgtagatcag aaaaatgatg tacaggagaa ttgcctaaaa taagagtaac ataatcaggt cagaaaagga tctgagtaat atacatccag tgggggaaaa tatcttatta caagaaaatt aggtatctgc tccccataag a cct tct gaa aaataatttg cacactaaaa atcatgaatt catcaatcaa tctgctctcc atggtcgcta tggatatctt caatcactgt tagacagttt agaaaaatta acacaacaaa cagaaaatct attggtaaaa tacattatgt cagccatgtt aactcttgaa agtgaagatc agaagcctca agatcttcaa gagtaccaac tccttctggc gtgaggcaat ccaaagtcca gaaaacagag tagtggatgg gtgtgtggaa aaaagagtca taacaggtaa tctgctccag t ccagggaga tatttaatga agaaatagga accaagaaag attcttaaat cactcaatat tcaaaattct actgtgtcaa caaacataaa atcctaagac tttagataaa ttagaaaatt tttttatgtg attattttca gga aa act ga tccgtagtaa ttaggtcatt aaagagactt attcttgaaa aaaccaagaa tgactcatga at cta tga ga cacattaaca agagaagttt aatatgggag cagagtatat taaacaccgt gacattcagc tgatgtgtta aacaataagc accctaacaa cttttcctgc tagtggagtt t tct tatt gt tcaaatattc acaactatta tatctacaga gtggcaaagc atcttggatg gcaccttgta tttcttagga tgccaataga ca gc caaat a aatcaatgtt atgataaatc tctatgattc taaccaacaa atatttcttt ctaggacata ggatgaatgg aattctaaca ttgcttaacc ggatcttgta aaaataattt cagagtgtgg gctgaggcta ggctagaaat tcaggtcctC ggaaatgaga atgcattaag ttttaaatat cttacaatac ggtcatcagt gtgttttgaa atgaattaaa gcatatttga ccaaagccag gaagactgtc tgcaactggg caggtgcaga gactaaaatt ccataaactt gtttagacaa tatttccttt taaattatat tactaaggta actcataaat acctatattt taatcacatc taatttgttc gaaagggaat gtactgaagg gtctatgagt ttgaaaaaga ccaaaaatag aatgaaacaa gacccaggca cagcatgatt atggaagaca ttccaggaaa ttcatgactt ttcactgatc aga t tt tgt t tggaattagg at tcat aat a ctcacttacg gcaaatttcc ttgccaacca gttttacgct tttcagaaga agatgtgtgg ttggttttgt agggtatgca aattcatagt aaacaatata caaagatctt gatgcaagag agatctgctg agagctcact gtcatcctcc gctt cccaca tggacatgaa ggatCatcca agacgataac caaaagnatg ttagcacaga tcatagatga catatcactt ttatattatt gaaaCCCaaa cttaatacat agtgggggag agaaaCagaa gataaatttg atgtgtgcag atgcacgtgg tgagaagtaa gataCagagC ggagaagaga ccatgtagaa ctttattttg atttcttcag gtatgtcagg tcatgatcgt tatgttttaa 162240 162300 162360 162420 162480 162540 162600 162660 162720 162780 162840 162900 162960 163020 163080 163140 163200 163260 163320 163380 163440 163500 163560 163620 163680 163740 163800 163860 163920 163980 164040 164100 164160 164220 164280 164340 164400 164460 164520 164580 164640 164700 164760 164820 164880 164940 165000 165060 165120 165180 165240 165300 165360 165420 165480 165540 165600 165660 165720 165780 165840 165900 165960 W0005851 0 1ttJMww. etthepatent.romILogin.dog/Sexam.supportIFetch/Defaut.dogIWO05851 0.cpc?fromCache=l 1 art=maintoolbar--boftomi Page 453 of 737 WO 00/58510 PCTIIBOOIOO435 gagcacatac gtatcacttc tatcataaat tcatttctac gctccatcct tgccatctaa tcagcatttg tccaagctct tcaatactat tttacatcct ttcaaccttg atctccaaca tatttttaga tcctactcct gttgccagca acagaatatc tgtgtgtgtg gaaggtcatc gcacctgcca tagtccacta actgatatta taagttagtc catgccatca aaaaatcttt ttggctaaac taagatgtgc ttaaccacaa aacacagcgg ttctatatta ttaaagtata atcttattaa atgaataaat cagaaataaa gcgttggtca gaaataattg gaggagcctc gccagctggc tttgtctcat gcctgaatca actgtgactc ttccagggtg acatagacct taaagagcaa tagagtttcc atgaaccaat tgatacagct taaaggaatg ctcattatgt catgatttaa aattagccct ccccagatat tctctattgg taaatggttt tgcatctttc atctttcaca aattctcatt ttttaataca tctgaaaaac agtatttgat aactgaaaga ttgtgatgat attttcacag aacatggtga acctctttac ttcagacatc acctatcatt ctggccctaa tgtattgaac atccttcctg acgtgctttt cctttcctgt cagctagtag cccttctcct gctactgctt tcttacctct tgatgtaaat cctcttatag gaaaacaata cttgatactc tgtgtgtgtg aaaagttaga aagtgttttc cacagtgttc acagagtgtt atataataat taattgttgt actgagtgaa cctattagtg tatatattac gcctccaaat tatgaaataa aaagatagat acaataataa tgatttcaca atgggatttc tacggggtaa gaatgaaact atatcagtgt tgaaatcctg atgcatgggt gtactagttt gcagttctta caagatttcc tatattctga ga tgacatt c aaatatgttt tggaaactca atagaactac ttttaagtgg aactaggata catgtctaca gcactcataa cct ctaatag tgaracctca agatgctaat gagagtctta gtctgcactt ct tt tat tct tgtaatattt ggtttctaac tgaaatacaa tgcgtaacag gtataattgg ggatatatgc gcagaggacg aacccgtctg atgaagtcct cctctcttca tctctcttgt aacctacaca acaatgctgt agcccacagt tctgtagggt gtattcagaa ggcatacaac tccactttat cagacatctt gccaaatctt ttctataatt tcgtgtattt tattaacagg tgtgtatgtg tgtgtgaaga aatttaaatg tcatagttca acctttaatg atacagcagg atacttaaag acaatcctga t tctatct ga atgtgggttt agatggactt gaaattttta tgcagtatca atgtaacaaa aactaaaaaa atgatgccta ttttcaaaaa agtttaataa ttcacagagg ctctaaagta agaatggatt ggttggcgag aatgtgccgg gcaactacat ctgaataagt atatattctt agt at tcgag taattatttt agtcacggct actgctttat tttttaaatt gctattcagg ttcttgctgt aatattacta cccaatagaa atccgagttt agattgtaaa cttttattct ctgctctcca acatctaaaa atcaaaataa atgagactga tatatacgca gtgacaacag attgtttgta ccccatacaa gtggatcact tactaaaaat 152 ccagctttgt gtcattcctc tgtataattg tcagatcaat aattatgtga gctgtagaga tatacatt cc tatacctcac tgtggccctg tccccttttc gcattgtcag ttcccttcat ttatgttagc aggtcacaag caattatcaa tgcttgtgtg caagtttatg agaatacgcg tgtgaagaaa taggtggcat tgctgtacta ctttaatttc attaaagaac ccctcccagt ctgactgctg tgggaagtga tgctggtgag at ggt ta agg cctgcacgtt aaaaacaaaa atataattta atataagtaa ttaacaaata ggagagtaaa agaccgagga caacataagc aagtct ccag caggggggtt gaggggatta tatatcttat gatatattca gt cagataac acaagtactc gttgttgatt atgtataata gagacaactt tcatttgaat ttcatataac aagaagcctt tacataaata taaaaactga ctgcatctag gggt cagcca aataatcccc ccttgacagg attagtttcr aatctaaaat catataatat tcgacagtaa atacaaagca agtgctgtgc tgaggtcagg acaaaaatta aactcctcca tcttttcttc actccatcat cc tat gtt ct attggtctaa aaatatgttt ctgattatta atgctgcttc tcatgcctaa t t tgt acaat tcattatcct cagtaaccat tctggcttat tacactctta gtatgaactc tgcgtgcgtc acaagaagga tgaaagtaat taccaatagg gggcctaaac agggctttat atggtgggat ttttcaagat caaaaggctt ccgtaacatt ctgagggtga taagaaatac aagcttccta gtgcacatgt aaactttgat gtgtcttggt tttttaatga ttccagaagg agtgaagcag atttgaattt aaaatcgtat tgagcaggtc gctgtgaggg agacatgtaa tccaacgcta agattcaacc aatgtaactg aacatattaa ttattaatta ggtcctattt gacatctagc attttgtgca tcaaccctcc gaggctctaa attttctccc cctatactag aaaacattaa actttagatt tgtaacagtt atttgttaat agtaactata attatcatca agttacagtg tatattgtac aaaataaatg ct catgcgt g agctcgagac gcagggcatg ttcttatcag tcagcctgta cttttgttct ctctttttag tttgaattct ctattctggg aaagtttatt acagagacag at ca tatca a gtcaatctgt tctcttgtgg aatcagactg ccctctttct aacaataact cgaatttcca tctctctgtg gagactcaca tttctagcct ttgttgtcgt aaggat ggaa gaggaagggt agttcactct gttattaatg ctactcaaat tatttggaga cagaaattaa aaatttctga ggttttgaag accctaaaac aagagagtac aatttaggta aaataatatg ccagtagtct ataaagtaat tgtaggcagt tttggaagca attgcaggtg aatttaagaa aagaaagtca ttttgaatat tgagtaagtt aattctcctg ggaacttatc ggaagtttac ttgaaatggc ttttaatatt aattctcaca ttttgaatat gtaacgcaat actatttcct gtactagaga accagtattc cttttgtgaa atttttttta ttatcttaaa tcttgatgtt tccaaaataa aataaaatct attttaatag tttgtgatgt ttatcccagc cagtttggcc gtggcaggca 166020 166080 166140 166200 166260 166320 166380 166440 166500 166560 166620 166680 166740 166800 166860 166920 166980 167040 167100 167160 167220 167280 167340 167400 167460 167520 167580 .1 67 640 167700 167760 167820 167880 167940 168000 168060 168120 168180 168240 168300 168360 168420 168480 168540 168600 168660 168720 168780 168840 168900 168960 169020 169080 169140 169200 169260 169320 169380 169440 169500 169560 169620 169680 169740 W0005851 0[httpo/Aww. etthe patent. co m/Lo i n.d oo/Sexa m -support/Fetch/Defa uIt.dogiWOO05851 0.cpc?fromC ache= 1 part= ma intool ba r--bottoml Pag e 4 54of 737 WO 00/58510 PCT/EBOO/00435 cctgtaatcc agattgcagt oacctt aaaa tat gtatgt a caacatgtct agatttaaaa aaatoaaaac cggtcaggtg ccataaggaa atttaaaaga atatatttcc gcgtatttct ttttaccctt gaaaaaagta tccttggcca ttcctatagg agatatotgt tgcattattt caaattttac tatttgttta aactttctga ctaaaaataa tattgatttg tttattaaag gatcatggtg cagaaagaaa tggactgtag tgttaataat ggtgtattag agaaaggaag gcctcaggaa tgggagcacg ctetatcaca caatcacttc gtccctacac acaaggctgg tggatcagga ctaaaaatac ggotgaggga actactgcat aaaaaaannn tggaccatat acaatataaa ggcccaatgg ccttactgtt ttcttacctc tgacagcttg ttgggagtac cctctgttcg gcatcttcat aaataaacaa ttggtgcagc cttccatatc aaatgccatg tttttaaatt atgtctcctt catgagagaa tcggttttca tcccagagtg atttatcttt ctatcttagc tcctatatcc aagatagtct oagctgt tog aggtggatat atatatgtat tttatacata tcaaactgaa tttcttcctg ccatgttctc tctttgggga atcccactgc agggggaagt atgggtttac cactcccatg ttggatccag ggagtcatat atgcaggtca acaggggagc taaatctatg gtaatgttaa ctgttatctt tttatttttt gttttaaagt ataaatttgg ggtgttttag aatcttttgt tcatggtgtc acaaggagct taacacatct gtaaccactt tcctttctca tttaattggc acttatgatc aagggtgcgt agacaacact coacoaggc acagccaaac gcatggtggc ggtcaggagt aaaattagc agagaatcac tccagcctag gagcaaaacc ggactot at C aatgagtggg tggccggtag tcttcaaaca tgtttcatgc gggcaagagt atttccgttt gt gaaaot at cgttaagaat gaa t ttt tt t cctttggcaa attttggctt gacaatgctt ctttattcaa aggtatcctt gctgggaagg ttaggaagaa acctgtgcag cgacttcttt atgacacrta atctcctaag gaaagtaatg ggaggctgag tgagccactg acaaatatat taaatacata taattttagc ggaagtaaat cataaattaa gtttagaatt attacttggt ttaagtaata acaaagtatc a aa agttct c gtggaaggag gatggttctt catggtcaag aaatactttc tttcttaaac tacataaaac ttctctatta a gtt ayt gaa catggaggaa tgttaaatcc gagttttagg tagaacttcc cttactaatc tccaacttcc aocccgtcca ctctcatttt tactgttata ttacgtttct atggcagaag gaggtgocac aaggagatgg tcatotcoaa catatcatat tcacgcctgt tcaagatcag aggcatggtg ttgaacctgg gtggcagagt ttcccctgat acaattactc cataactttt attgctgact atctgcttaa ttgaaaactc ggctttctga ggctctcctc ccacccttgg gcatttaact cagatttcaa tgtggccaga ttgttctcat gtgtgtctaa tgaatcagaa ggcctgaatt ttcatatttc agatgagtta gatatttctc ttctgttaaa aggtgctgat gggtttcacc ctgtttcttt gcaggagaat cactccagc at acat atat tatttacaca catcttgtca attaattaag catcataaaa acctgatacc atgtgtttct tcaggattaa ttcatctgtc cactggtcca tcccctcttt aaagtaatag cctgatgtca aatctgtcat acacatgact atgaaggaga tcaaaat kcy taatgataat aaactataat aagcatattg agcatagaaa cagacagoat acttttaata catgtacco acacatotac tctgcagttt aattaatacc gcaggctgta gtgaagggaa acacatttaa tgctaaccat cactggggat gtcaatgttg aatcccagca cctgatcaac gcacgtacct gaggcggaga gagactctgt gotctatatc aactatgtga ttcaataaaa cctctgctat aaaaagtttc tgcaatttga ctgagtctga actttagact ttctcttcca gtaggagatt acctaacatc ggtctaagca gtttgttgcc gaoaaaaaaa aggaaaagtg at gccaga cc tagccagggg aatggatatt ctcccataac ctgcatgcaa gctcaaattt ttctggtttc aaccggctat cact tgaaoo tgggcgacag attatacaca cacagagggt tataaagcct gaaatoocaa ca ttt ttt gt tctgttcttt gtaggcctct tgaaataatt agtgactctt ctgactgtga gtgacactga acatcctttc tcagggtggg aaaacctgaa gtct ayacag gtgtgtctcr ggtagtcttc ggtgtctatt gaaataaaat t tinttaa cag tatatcatac t tt tggagat ggatatttaa atca caaat o cccatcctct ttctccattc tgaaactggg caggaagcat agcagacatg acaaccaggt tagaaaccac tacaattcaa ttctctccct ctttgggagg atggtgaaac gtaatcccag ttgcagtgag ctttaaaaaa catacatgtt ttgcaatgaa ctttattcac agtctttctg tatttctcat cot ttat aco agoattatct tcttacooca gtatgtgagg caaaaacgoa tggagttaag t t ttootat t ttatgggaac aaaggacaaa tcootaagac tgaactttgt caotgoctgc ggct aaacaa tcggtgttag ttootgtgoa ttotaactoa ccoaogtgta ttctcataca caggaggtgg agogggactc catataaatg cattatgtaa otaaoaccao ottcttttao toatgtcaag tatatcaact ttagtgtaaa ttcaagtaaa aaoagcagat totttgtgto agtttoocta tgotcaoatt aggtgtgatc tgaaatagta ggttcotttg ttctoatgat taatgatott toagatotac ataattttat gtaatacttt otgtgtttao ggtaacotga accccottto atcottocto gaggtcattg ctgtaagtgt taattoataa ggttggggcg tottacatag ctootgagaa ccccatgatc ogtgagatot gaaaaoaaga ocaaggoagg ooogtctct a ctactoagga otgagatcao aaaaaaaaaa tttggctctg aacagotatg agaaacaggt ttaacotaoo ggtttccaga oaaagtttto gtgaattatc tggatactct tttottotca acaataacoa gagttcaagg tctgotoogt ot oaggt tt g attagtttgt ootggcagcc cagttcagtg ttctcoaaat ttgacatgtc tgttotagga gtctcattca gattttagta tttcaaataa tctotacctt 169800 169860 169920 169980 170040 170100 170160 170220 170280 170340 170400 170460 170520 170580 170640 170700 170760 170820 170880 170940 171000 171060 171120 171180 171240 171300 171360 171420 171480 171540 171600 171660 171720 171780 171840 171900 171960 172020 172080 172140 172200 172260 172320 172380 172440 172500 172560 1726 172680 172740 172800 172860 172920 172980 173040 173100 173160 173220 173280 173340 173400 173460 173520 W0005851 0_fhttp:/hww.getthe a tent. comLog in.d og/SexamsujortFetchDefault. d ogAWOOOSO5l0.epc?fromC ache= 1 part= m aintoolba r--bottomlPag e 4 55 of 7 37 WO 00/58510 PCTIIBOO/00435 gattgtaact caactgctat ggctattaac t gtat tat tt attaatactg cttcaacggc tatcccaggg gctttatttg actgaaatca tttagaagat gattttcttt atcctattgc gattacagcc aatcttttcc gctacgatta gaagtccaaa agataatgct ccacactgag tgtaactgta cttctgatct ggccagtctg tctcatccca agcagattca ctgcttttgt ctgagaaaga gagaacgacg aaccatattt ctgagatttg ccatcatatt atgctagcag t tct cct cag aatgcatgca aatgctactt ttaaaaaaat ctttttcatt gtatgtgtgt tggatattca agtaactaca accctaaaat ggtgatctca ctttacaaat ttgaatttta ttagtgtaat agtcataatt tattttgtgg gtcatgtggt tagggtctga atgcaagcag gagcaatcag gatgacacag ggaa ctct t c tttcctcgtc aaaataataa cagaaaacgt tttacattcc tattaacttg tgagcattca ggttaCatCt ttgtcagata cttagagaaa tagcacttag tatcttatcc t tt tgagt ta ataaaaatga actcaatcaa gta tt t tcat ctcactctgt ctatcagaac ttgtcataat tattgctgag gtttacaaag ttaccttcaa gttttgtcaa ctcctctgct ttcaattCtc ttacttcagg atctgttcgt tattattcac cttcttacca gcaggcaggt gatgCtgggc attggaagat ca acca tga t tgcccttcca tcatccccca gtttgggtct tacactgctt gctttaaggg t tt caa atag aacccagagg gggactattc tgaagatttg agaatgctac atgtaaatta taggtctctt atcactccat agttttgttc ttgtatttca ccctaaaggc actttctgga attgcatcat gttgctcctt agatacat ct aaaaatctgt gaatatgcat atttttaaga tgtatacaga acttatgtat atgcataaat gattttaacc aagacacaaa catgagcatc agggcccaga attttaagat cctcaaagtg aaagtaggag gtggtattag cat tagcaac aatttccttg tatgtccttt tcttattttt tgtgcactgc ccttttgaag tgcttttgta tttcttttac tttttgtgta taatcaagaa ctgccaagtg accCactgtc ctattgaaga actctctctg t aa cagcagg gacttcttaa gatatttacc ataacctcca caactccatt tcatcactaa ttaatgcctc ctactgtaat taaaagaatt ttcttcaaat tagtttagaa tgtatctgtg actgcatggc tacatgtcct gttcttccta tgcatggatg tcgctgcact tgaggccttt gaaggattgt ccgttgcatg aagctgctct tgaaatgcaa cacagcacac aattcaactt cttcttccca tgagcttgga caaaaaataa ttaccatgtc tctccattcc tcctggcaat aacagatacc ccattccaga tttgctcttg cacaaattaa caaacttaac cactacaagt tctcttgtgt tttgtccaca tataccaact ttatttttct tgaaatacga tacttataag acttctgggt atgtttgact tgggtggCtg aactggtgag gCtcattgca agtttgatac gagaga ccca ataggaaaat aagaataatg tttgcaatgt cagttttaag aaatattttt aacaaaattt ttctaagaaa aagtttataa tggtgtgagg actgaaactc ccatttaCaa attctcatga ttacattCtc aaatagaaac taactcatac tctttcactc tgatatctac tatctatact cct cctagaa ccagcctcct tcaaatatac tacttgccta tattctagag aattcaatat agcttttcca aacctgtcat ttcccctatt aatcctccac tgcctggctc actgattggg tgactcacta gcactttgtc cacctttcaa gtttggctgt ttcaatctgg tgtcagtgag tccaacctag ctctctggtC cagtaagaaa tt tcctt cct aataaataaa cctagtgcta cattttgtga gcatgtaaac ctttccgttc ttttataaaa ttgctttgcc catataactg atccccaaaa tacgtttcag cgggctttga ttgCatcaga gaat ccagtt tagggaaatg aatgcagaac ctaacatgtt cagagaaaca tggctttttg aagattacag caa~acctaaa atcataaccc tagatacttt tggaggacga tatttaattt gtactgaaca gtatgttcag ggttct t tac ctctcagtct tatcttggtg tgtttcccca tatgatt t tt tggtggtatt aacttctcct agtttcttaa ctagtttctt acctggttat catttttcta agtccctaaa agttcagact caggtatctc ttgtccttcg gttttgtagt tttttctgat tcactcygct aaatatgacc gttttatttt cttaccatta gagctggaca cacctccctc accatcatca cctttcatca tgtgtttggc atgtcacctt gcgttttctc ttctctctgt aacaggagac ctcccttttc tgaaacggca aaaaaagcta ggaaatctga tcttagcctt agaagaagaa gtataagttc atagctaaag aacaactgtt gctccctcca accctttaat ccaatttatc tgtgaccatc tctgcttcag aatatgcaac caaaatatca ttttagaaaa aagacacaat tttgcccttt atataaaatt tttaacagtg tttctctaag agtttattaa ggactttatt tatcgtccac gagaggaaga ctttgtcttg tgagaaatgg tctagatatt tttcacaaca cagtaattct tcttttcttt aattgtttct atattattaa gtggcttaca aaatgtaatc ccccacaagt gcttttttgt taccttttcc ctcactcctt catctcttga ggttaaaacc tctgcttccc ggttaaagcc caatcttatt cactcttaca aagctgcaag tgttcccttg aatcatccct cagccacaac ctagtgtggt agattctttt ctacaatgga ccctctaaat catctatcat tttgtactta tggtcctcac catcatgggc aaatggtaag tgctcctatc ttccctaaac gtgcaagcct ttccgcatgt ccttttgcct tgaggagaaa ccgtgagcca caaaaacaga ctatcaatgt atatcctacc tatcagcttc atccttccta tataatcagt gcttctcaac gttattagtc agaagactca atttgacttc attgatctcy attttcactt taatttttgc tcataagaaa gttttgtgtt tttattgctg catctacaat gggttttctg cgactattgt tgccttatgg atccacagta gt cccacagg gtgatcttgg gataaaaaca cccaggttaa ttgaagtatc gctgagtaat agtaggtgta tcttgcttat ttttaaattg tacactttct ttttcatggt ttttattttt ctgaaatttt ctatatttag aggtggaatC 173580 173640 173700 173760 173820 173880 173940 174000 174060 174120 174180 174240 174300 174360 174420 174480 174540 174600 174660 174720 174780 174840 174900 174960 175020 175080 175140 175200 175260 175320 175380 175440 175500 175560 175620 175680 175740 175800 175860 175920 175980 176040 176100 176160 176220 176280 176340 176400 176460 176520 176580 176640 176700 176760 176820 176880 176940 177000 177060 177120 177180 177240 177300 W0005851 0 [tqgj:llww.getthe patent. com[Log in.d og/Sexam. sup ortFet,/Defa uIt. d ogAN0005 8 5 0.cpc?fromC achie= 1 part= ma intoolba r--bottom] Page 456 of 737 WO 00/58510 PCTIBOO/00435 aacttgttct ttatgtttgt tgtgcatttc cttgagtgct cattacattt ggtaggctag tacaatttga tctcccattg Cttcttgtcc ctaggtcata acccgagatg aggtgttctg aagaaagtga tgtgaattct ataagt ggga attccagtgg tcccagcaga ggttcgaatt tctgtcattc ctctgctgcc aaaataggga cgtaaaaaat atgaggactt atgccagttt caacacagcc gcttgagttg caaaacaatt caattgcaaa ctaactacag ttgtgcagt c acgttttgct ctatatttgc tcctatgcag ctaccttgca tatggcaatt cat ggt at ca cacgcagtct agact cacct acctacactg agagagtaaa gtaaactttg taattcatct gaatgggttc gtgagtttca atatactccc atggaaagga gtacctttcc aaagttttag tggaaaatta gaaattagaa taaatgctgt aaactggaca aagctagtat gctgccccag gaaggttaat gaacctgatg gctttgtgat ttcacctgac acacgagtct gatatttgaa cataaggaag ttgacctgga attttgctta accaacattt cctttctccc cagttttggg gaa tat ttaa attattatta tcctgtagca tatttttctt aaatagggaa aacagaaggt tgaatccttg ctatgtaagt atggacagtt gaatagccct agaaatacca taccagaacg aagttttcag ggtgctcagc cacaaatttc agctttgtca taaacactgt tagtatcacc ttgatgttag gatgaaaaaa ccttcattct tcaagaagct tagttgtttt ttgctcgtag gaagttagca aataaaccat cattgatcag acaaagaacc aaatcatcat aaaggttttt tagaaacacc ttgataccgc atgcacagca gcatatcagt gaaatgcaaa cagttcttgt ggtgaagcca attttgttta ccattttaat ttacgttctg agccaatctc tggagcctca ccaggttatc t ggact t gag ttgctatgag tcagaaatgg aatgcccaga taaaaaaggc caatgggaca caaaggagat gcaaattgtg aacgtaggaa caatgtggta tatgttatat tttaacagag gtactagcag gcctgacaag ggggtacagg gaagaatstg tatgctgaga atttaaaaga actgaattct ctctcaataa attaagtact ttataactat accattttgc cctttagtaa gcaaattcac gggacaaaaa aagcttcttt ctaacaacca cctgcctagt cttggatctt tgttgaaagg gctgttagca tgtctctttt atactccaaa catttataat tctctccata attaatgtta t tcctctgga gcacagagga aggtaaaagc tttcctttta catgattcac acaaaatgta agattttaaa tcaccttttt gggcggtaca gcaggcagtg tagtctaatc ttttttttct ttatttattt aaactataga tacctacaat cttagagcag caatctgctt gagagaggtg tgatgaccat gtccctatgt agaaccaaag gccacccttg gacactgtgt taagtcaaga ggctgttgcc tctgatccat aacttatagc actggcatat gtataaagat aagacatcaa aaagagt cat gggcatggaa gctgtgaatt a cat at ggt c atgaattgaa ggcagaattt gcatggcaga ggaggtgatc aagca gaagg gacttgacat tggcctctaa tgttaaacaa agacatcatg 155 ttgtcctatt gatatttctC tgttctttCt ctagccagag aataataatt cataactaat attggagatt ctcaccttga aaaaaacatt ccagctctct cctcactgct ccagaattcc ccaga ccagt aaagctccat gctgtcaggt ccttataggc gaactctgac ctgtataaca cagaaaaata agtggctt cc tgcattgtga tttgcttaat atgtatttat gggcactttg tggttactta aaaattattg ttctgtcatt ttttttacca gtacaaaaaa gtggggagaa agttccattt ctaaaaataa tgctgagttt at gcacaaat tcacatttac gctggcagtt cctgatatgc gaggacgatg ctaatgcaaa taacaaacct cttcaacagc catggacgag cttcattt ca gtttatttgg tgttcacctg ttggggtgtg ctaataagag aaaagtacag ggcttcatag agagaaggat gaaatagaca tacaattaag ct aa tct tga tccctaggca atggctgctc tgttcactat agggacttgc ctgggtggtc cagacagatn ggtattaata aagctgatga gtgtggatgg ttaggagtga cctgttcttt aaaaatcaaa ttatgccaat gtatttgatg attaatggtt agtgtgatat gccagaaatt atgtgggctc atgttattgg tggaacactt gtactgggga agatttcctg tcatctgccg gggtaaatac ggaagtggtt ttaggatgtt tttgatatcg ttaaatcctg cccacccaat ccatgctatg aaagtcaatg aaatgttagg cacataaaag aaaatatgga tacaagtgat agataataat aaaaagaccc aattcgaaaa t gt tct tat g caaagccaaa agaaatgcac tatggagtgt caggaaatga ttagcacaga tgcatccatc cacaagagtg tttaagaaag gcccatgttt ctgtcccaca caaccttatt ttcaggaaaa ctacat ctcc gttattgata gagttgggtt tttccttttc taaatatcaa aagacaggaa ggacaggaca aggaggtaaa aggctgaaag atgaatttct tgacctctga aatagcacac taaagttaat tgacacacrc gactttcacc agttgtaatt caggtgggcc agggaaagag gttttgaaga tgacctctgg tgatgataat ttacagataa tctgattgaa taataatatt atcacactgt ggttccaatc gtttacagaa tctgtttact ccttactatt attttattga acttccaaga tctcagtgag agacacatgg ccaagatgct ttagtgttag gcttctgcta ctcgtgtcag tctctactgc tgccaatcag ttccaatgtt gtcatcccac cactgtctat tgaccatcca tattattcac ggtcaaataa aaactagtta cctaattatg tagttattta acaagcctct aagcaataat tttttaaaag cactgaatac tttcatttga ggaaatgctt agcttagttg gtctgccacg caattacacc caacggatgt cctgttcctc cctcttgtgt aatctttcaa tcagcagatg catgtgtttg tgctccaggt cctagagttg tccttttgaa agaccaaatc gaaggataag taaaaaaaga aagaaaaaaa ctctgtctga gtggaaggca agaaactaga tttaatgttc ataaaccaga ggtatagtca tacaaagttg cccggtgcca aatgttgcta cagtgtaatc gcaggacaga tggcggggaa ccaacagctg aatgaagatg tgcagcaaaa 177360 177420 177480 177540 177600 177660 177720 177780 177840 177900 177960 178020 178080 178140 178200 178260 178320 178380 178440 178500 178560 178620 178680 178740 178800 178860 178920 178980 179040 179100 179160 179220 179280 179340 179400 179460 179520 179580 179640 179700 179760 179820 179880 179940 180000 180060 180120 180180 180240 180300 180360 180420 180480 180540 180600 180660 180720 180780 180840 180900 180960 181020 181080 W0005851 0 thttp:/www.gethe patent.co mILog in.d og/Sexa m. su pporttFetch/Defautdog IWO05851 0.cpc?f ro mCache= 1 part= m aintool ba r--botoml Page 457 of 737 WO 00/58510 PCTIBOOIOO435 aaggagcaaa tccttagtca gaaacagatt gccataaaga gaaaagctga tatggaacaa ttgtgccctt acacatgtga tgtttgttag ggctcatgcc ggagttcaag attagccaag gaatct cttg aggctgggtg tccataaggt gaatgggata gaaagcatgc gttcagcagg tagtgaacag gattaaggca tcccaagggt taaggccatc gcataagctc acactcatca ctaccatcaa ctaccattcc aaagaatata gtaattagta cagctcgcca ggcattatgc gttaaaagct taaatacatg attagtgaat aaaggcatag attaaatttt tggtctttct tcaatgcacc tgagaagaaa acttgcaaat ctaaaaagat actcttagca taaattgtcg aacatacaca ccctccaatt aaaacccaga ggagaatttc ctcaccagca acacaagagg tggaatataa atcatggaaa aactttcaga gtgccttagt gaaataagtg atatctctca ggattat tga aaccaggat a ggagaacacc tcccagagag gaaagtagag actattgcct actttgggag cacagtgaaa cgcctgtagt gtgttgaggt ggcacagtgg ccttttctca tcacatgtgg agcaatagga cgagaaacat tcttgacatt gaagaaggtg tggggaccat tgtaattcca accagcctgg tgtggtgatg aacctgggaa acagagagag agtggaaatg cccaaaagca taggggtagg acttggacac atgctttgaa ttagtaaata ttctagcctt cataatttca ataataaatt accacaaatt tggtatgaat ttgagtatgg ttctgtatgt tattctgatt ttaaaaaaaa agtgtgcttc gtgtgtgtca aattatttcc agaaataagt agcagacaaa ctcaacacaa actaattaaa agaaagaaag gaagaattct ttgtttgcac gtgagttgat tagctgtgag ataaacttga caaacctccc tacacttaac gtttatttta agcttcatta gatttcacta catcagaaag aatctatatt aagaaaacat tataaaagaa gaactgaggg caatgaagga ctggagttct tgactgatg& gttaaattaa aaagtaaaaa tgacagttat t ga tgt tt gt gtaaaactta gccgaggcgg ccccgtct ct cccagctacg agaggtgaga ctatacattc gatgcccatt cattttaagg ggagatgcac ccctgcagta ttagactgtt ggtctagaag gaaggcgaga gcactttggg tctaacatgg ggcgcctgta gcggaggttg actccatctc ggatctgctg gaggagct ca attgcagaat t gggcat t tg tgtgggagac gcttcagtag catcctcagt cacctatact acctgatcca aagattaatt gaccatgtta atagtcaata ggagtccata tataatctac aaaactgtta attattatac ctcatacagg aaatgtgagt gatttatttt ggctaaattt ttttcctctt aacacctaaa taagaattct gaaacaggtt agcctctcag cataagtact ccgaaactaa ccctgaatgg atcaaccctt gcatggtaga taggcaattt ctaaactcat aagaatcaag aaggctgttt taatatcttt aagaataaac ccagtggtcc acctgaataa caacctagca gaaaacagaa atgatgacaa aataaaacac gagcattgta atcaactgct tctgtattgt caagaggccg gcggatcacg actaaaaaac cgggaggct g 156 gaaggggtga cttttcattt cattaggggt cagaagct tt catacaat cg atagttgaac cattttcaca gaagaaagtg tagatttcaa aggccaaggc tgaaacccca accccagcta cattgagcca aagaaaaaaa acctcctgag tggaggacaa agagctcaaa cagtgact cc tagaataaat aactgtttac tgctttctta tatcatctca gataaggctt acatagatta aaggaatttc ttttgtaaag ccaaatctgt catataaact aattgatgga acagattctt atacttacag taaattgcaa aatagccaaa tatggagcat ctagtaat at aagtcttggg catttgaaaa tgaatttgag agtgcaggaa c ttgatgagc agacaactcc aaggtaaaca taataagaaa tacagatata acatacggca ctctagagaa aaagaaagaa agtaagaacc aa *aggaat ga atgatgattt tgggtatgac attacccgga caggtggaag gtggcaggaa ttaatacatt tcacacttta aaaatagtca aactttccaa tctgaaagaa ggcgcggcgg aggtcaggag acaaaaaaat aggcaggaga gctcaagagg caggcaggaa 181140 ctccttggac ggccatgtga tcccttctcc aaggaagcag aaaaacacac gctggaccac agggaagcta tttcctcggc gggcaaatca tctcaactaa cttgggaggc agatcatgtc aaaaaaagat tgtgtaggag gaactgtgag cttccaggtc atgtctcaat gcatttttat ttctttctac atagttacca aggcaagcct ttttttttgt cttggtctgt ctaagtgcaa ctataaatac tcaaaatgcc cattaaaaga aatctggtac ctcactatag agcgttttta gtcacaattt aaacaagctt ttgcacattt gggagactag aaatttgttt ctaaatagag gatatcaccc acaggaggac tggaatgatg tttctccagc cgtaaataca gaaaggaaaa gacatggata aaaagaatac tgttactaga ccatgaggaa cgtaggaatg aagactagtt ttaaaagaag cacagcaagg aggcagtgca aaagaatgtg aatataaaga catgaaaaca acacacctta gcaagaaaag gagcaaaagt aataactgcc ctcacgcctg at cgagacca tagccgggcg atggcgtgaa ttgcagatgc ctgaattcca cagcagaatg agaccctcaa tcccattgtg tgcaaccatc caaatattca cgggcatggt cctgaggtca aaatacaaaa tgaagcagga actacactcc ttctattttc tggaggtgga gact ggaaga aatgatgagg attgtctgta aaagattttt tgcaaagata tgaatatacg tgttagacag ttccccaatt aaacatttaa tagcagagta gggaat ctgt tatgttaaat aacccacaag ttatttttta tatcgtttct aagcagt aca agttaagtag aaagcaggtg gcaagatttc a tat tct aa c tat a aatga a aaataaacct aaaaatcttg atccaggtcc agaaggctac tgatacaagg cagagataca agctagacct tatatcacaa aaatcttttt aaaatgagca gaacttgcaa taatcacaca ttaaaatatg aaccaagtag acagagctga gacaagcaag aaggatgaac ttgtaactga tataaatact tgataaaacg acagattaaa gacattagca aacctacaac taatcccagc tcctggctaa tggt ggcagg cccgggaggc 181200 181260 181320 181380 181440 181500 181560 181620 181680 181740 181800 181860 181920 181980 182040 182100 182160 182220 182280 182340 182400 182460 182520 182580 182640 182700 182760 182820 182880 182940 183000 183060 183120 183180 183240 183300 183360 183420 183480 183540 183600 183660 183720 183780 183840 183900 183960 184020 184080 184140 184200 184260 184320 184380 184440 184500 184560 184620 184680 184740 184800 184860 W0005851 0 [http:lwww.getthepatent.COMI~gindog/Sexam.suport/Fetch/D faut.dogN0005851 0.cpc?fromC ache= 1 part=maintoolbar--bottoml Page 458 of 737 WO 00/58510 PCT/EBOO/00435 ggagct tgca tccgtctcna gattttgtcc cttagagagg ataaaaatca gatagactaa tcctaaattc ggtaagttaa tataatgaaa atcaaccatc aactaatatt aatactccag gcacacttaa gatataccct catgcactgc acctgaaaaa atagacatgc tccaacaaca cataaggcat cttggccaag ggttaaacat taatattaaa aaattctaac at caaggt at aagctgtttt ttttctagag gaagcctgct ttatcttaac ttttttattt aataagttct actgtaccca caaagtccaa gtgagaacat gtctcaaatt tagtatatat tatagtatat atactatata tattatatat tgatgggcat gcatgtgcaa tgggattgct ttgtactagt tattatgttt tgggtttgat gccattttta attgggggtc caaactatat cattatttat tatataatat tataataata tataaatata caaatccata agatttatgt acaaaaggac gaagaaccca taagcctagt tactaaaatg ccaaagacag gagggacctg tgagtgagtt gctgccatgt ggcctcctca ctagcagcgt gtgagccgag aaaaaaaaaa aagtcaatcc actaaaatgg aaataataca attatgccat cctgtattgt ctgtaataaa atacaacata tgaatctata ctaaaaataa gtaagaaatc ctaggacaac gttttataac caatgaaagt cgtaataccc ttattattcc tgaaaatagt atgaatcaag agtatctcaa gcctccttat atagagatca ctgagtctgg atatagtata ttgtagagga tctgacatcc acctggagac tcaattgttt tttttttatt t tagaggtga gtgtgtagtc tgtatcattc atgatatttg ccatccaagt gccacaaata aaatatatct ttatatatac atacacacat tcgggctggt gtatcttttt ggatcaaatg ttacattccc caattttttg ttgcagttcc tattttcttt acatttcaac aagcaggatt atatttatat atatattata ataaatatta aatatataaa ggacacctat tatgcagata aactagttta aaatagatat aacttacagt aataagcttg aagtaaatct gtgggaattg cttgtgggat gaagaaggac gtcatgctga gcgaatgcac atcgcgccac aaaaaaaaaa tgattaaatt aagtggggag aaaataatca atcgatacaa ttagggagaa aaaattcctt taattcccaa agtaagaaca gtttagtatg atcgatatac ctggtgacag aataagaaga gtaaactgtg t taggt cct a atgatttata atttaaaaaa aataaaattc ggaaacccaa acccttccct gaagactgac tatagcatca tcaaatgtat aatttgcagc tttaaggtat ttcatccaca ctttcttttc ccaataggtt tttctgagat ttttatccct ttatgctttt tttggttttc tgttgtgaat tatacatata aaatatagta aaacatatat atatatatac tccatatttt tgtataatga gtagttctac accaacactg gttatggcca ctgataatta agagaattgt atgaaatttg atatagatac atttatatta tatataataa tttatatata taaagtatac aaaattgaca actgcctctg cagatcaatg tagaaaatat cagacagaaa gcatgtattg catggtgaac aatcatgggg ctgatggttt at tttt gttt actgtgagtc taatacatcc tgcactccag aaaaaactta aaacccaaaa ttgagagcaa tttatcttgg tatagcctgg ttaccagttt gggtaaccga aaaagtaatc t cat ata aa g tgaataatta agcctccagg tacaatagag ttctcagggg taaactttct agaaaagtga attagcataa ttcattaata aaagaactcc aaaactagtt ttggagttca aacacagact catgacagat ttctttgaca ccgtaaataa gataggaaat taacaagaac ttttcttttt tttggggaac tttggtacac caccaccccc gcatcctcat tatgactgaa gccattattt ctaaatatac tataaatata acacatatag acaccacatt tgcaattgtg cttattttct ttttagttgt ttcccttttc ttcttgcagg gatgttgagc ctatacctcc gagtttggaa aataaagttc tttatatata tatatataat taaatttata tccacaattg gatataaaat aaagcagaaa aatgccctct ttttaaaaaa tggatttaat aagaagttat.

tgtagttccc gcaattacct tataaccttt cctcctcctc agttaaacct catatctcct cctgggcgac caagacagga t aggagtaga aaatctgttt gataaaacaa ggaaaatgtg t taaat tat t gtagttttta acaaattaat gtgggataaa gaatatgtat gtcttagaag aaaatatttt agggtataca gaaaacaata cactaagaaa atgtagcaac gcatggggca aactgattaa cagaccacaa ggcatacaac ttttgtaaca agcagcaggc tattttgaaa tctccttccc acatatgatc cttggtttcc tgaatttcag agctggtgta ctatcacctg tattctttcc agcttagct c ttacttcact cattcttttt a tact atat a taaatataat tataatatat ttctttatcc aattgtgctg tctgggtata gtaaggaatc actgcatcca agtgaggtgg atttttccgt ccttaggctc acatgaagtt aatgtatttt aaaataatat atataatata tatataaatt cctaatacag gtgtttccat cattaatttg taaaaaagtc tagataatga gcagatatta aacaagacaa ataatcccca ccttgctgtt gct ctgcact catgatcgta cagcctcagg taaaatgtac agagcgagac gaaacccaga gaaataagaa acatgggtaa aactaaacaa aagataaatt tttaaactta aggaactgaa gagaaaaata tagaaataaa aaattaaata gaaacaaaca taaaagtata aaatatacca caccccaaaa atatgtatct tacttaaatt atactcattt atagactccc taggaagcgg tgactgacat agaagatacc tttgaaggaa tgaccctgaa ttactagata tattgtctct ataatccccc gctaagttta tggttacatg agcagtgtac cccaagt ccc tgacacatga tagaataata tatggct gag tatatataaa atataaatac atactatata acttgttcat ctagaaacat tacatagtag tccataatgg cgccaacatc tatcgcattg atgcttgtgg cacttccaat tggaaatatc tcaaggcact attatttata taatatataa taatatgcta atttctttta ggtatttaaa caaataaata ttgggtcaaa aaatatatat gaaaagaaaa ggaagaaaac caactagtgg ctcatgatag tctctttgct agtttcctga aatgccttta aaaaccaagc 184920 184980 185040 185100 185160 185220 185280 185340 185400 185460 185520 185580 185640 185700 185760 185820 185880 185940 186000 186060 186120 186180 186240 186300 186360 186420 186480 186540 186600 186660 186720 186780 186840 186900 186960 187020 187080 187140 187200 187260 187320 187380 187440 187500 187560 187620 187680 187740 187800 187860 187920 187980 188040 188100 188160 188220 188280 188340 188400 188460 188520 188580 188640 W0005851 0 fht:tw.ath aen omLo n-o/eam-umr/ec/eaut oAO 01 .cpc?fromC ache= 1 pa rt= ma intoolba r--bofto ml Paae 459 of 737 WO 00/58510 PCTTBOO/00435 tttgcgctga atcc t ta acc tgttttacaa tgtgccactt aatattctta taaaattacc acccgaggtg ggaataggaa aaattatttt ggaaacaatt tgtgtaaaga gttgggataa gtgaaggctg gtgcagtggt ataataaaaa gtgtgtattt attatttcac ttcatatctt ttacttttcc attgaattcc t tcgt gt taa atgtcagact tgattttaaa tctatgaatg caagctgttg gcaaaattga caatagagta tctctctctc gatttgcacc catgattttg tacaaaagta agtttttgga aagagacctt ggatactggg taatgaattg aaacccctgg catgagtttg tgcagtcaat taactttagg gctccacaag tcttctaata cttgattgta ttgttttttt taaggaacca taaatggtgg aactttagat tggcggctca atcaggagtt aaaattagcc ggagaatcac ttcagcctgg aaaaaataaa caacagggct ttccaaaaga cctggcctta ggagagattg tgtgcatccc aggatgagag aattttattc tgtgagacag gaggcgatct cagcctcagg tggataacca ctaccttggg tttgcaaaat attacctttt actcagctag ccttgacctg tctgaatggt ctttctaaaa gtgggtggaa tggttaaatg ttaggaatat ctgaagaggc gaaaggaaga ctgcaattca tcacatgtga atatatattc ggatgctatt gagttctcaa tcttctcctg tcaaggccgt cagacatatt cttgttttcc ttattctaat gctgaatttt ttattgtcag cctgaatcgg gcagcacgta tacaaacacc tctcttttgt ttcaccttct gtagaggcaa ttgctaagaa tggtgcaacc tctatagatc atgggttgga tgtctctaag actttgatct gtaaagtact gtgttggtgg gcattgccgg gtgttgtcca aggacattag tctgcaaaca tttttttttg actaaatata ttttctttgt aataaatatg cacctgtatt tgagaccagc gggtgtggtg ttgaacctgg acaacaaagc gtgaatccca ctttttgact aggcaaagac ggctcagcat gatggatgct tggacttaca gcttgcaaag ccccgatagc agcttagcca ctgcagaaag agaacagctg ttcgtgggca cacatgt cat aaactttcta gttctagacc aaacgctcct tcaggccctg ctttgtctgt taaggggtgc tattttaatt taatagagaa taaaatatcc tgttgagagt aaggagtcat ttgagaccag aatgtcctac ttgatgtcaa ctcatgctct tttttgtcct cagtttccca t tt t tctct t cgtcatcccc tgactcacag gatttctcct caagatgata ctgtcagggt tttaagacaa tttaaccact tgtaatttcc tttttttttt gcatgcagtg tgatttcctg attgcaacaa cttaatttct ttcaggcaga ggcaacatac atatattttt caagcaaaac acagaaattt ggttggttcc caacccttga ctgtgtctgt ctatatgcac ccccatttcc gtggagggag aatgccactg ttctattgcg aaggagtaaa cacagcactt ctggccaaca acaggcacct gagatggagg aagactctgt cagatttgct aactttatgg ttgctttgca ccccccgaag gagtgctcat gggacaaaga aggcccagag aggccagatt gggattatct cagctggaag aggttgaggg caggacctcc aattgattga actcacaaga tagcttttcc tacttaagaa aaaatggaag cttaaaagtc agggaggtga ggaatttgat caggcttgaa tagatggaaa tgatggggcc agcctttgaa gaaacataaa aactaaaata tttttctgga tctgttt tta tgtcttccaa gactacagca attttcatcc aaatcacctt agttgccccc tttcatatct gtgagatggt agtcattact catacttctt agtgagcaca t tgcctcagc t gccatggct gttgtagaaa gctacttgca gaaccagcag caggcttgtt tgtttaaata accagaatga cttttcccta gttctctcac ctctggagaa cttgtagatg gtccagtgtc t ca ccc ta at aaataaagtc a a agga agga tggtaagatc ttttttgctc tcattaaaaa tgggaggccg cgatgaaact gtaataccag ttgcagtgag gtcaaaaaaa tatattcttt ggatatacaa ggacttgcaa gttatgaagg cttcttcccc agtgtccgat caaaatcaaa gcatctttct tagatcttgt tgcatcatcc attcattcta tgaggctgtg gacttgtctc gtgaccatgc tctcactggg aagaacagca agacatggag gtgttgaagt tgtgattgaa acagtgggta tgaacgtaga agacaagtgg atgtttcaga agatagataa agtgaaagga taaatatttt aaaaataata tcagataaat atttatttca atgcagattt cccaccaccc ttcctgtata caaaattgta atattttcac acttgatact aggctgtaaa agctctccaa gctcccaggc ct ctcgggct agttcccctt aaagggcagc gtttatgtat gtgaaagatg ggcttcctaa agtagacagt tactatatag ttatccctcc agttctggaa tctgttctgt catcacttca tttgtccagt taagtatgat acttttccta agtgggcaca agcttgacca atcttatcag tttaaagtga aggcgggcgg ctatctctac ctactcggga ccgagatcat taaaaataaa ataactagat caggtgccaa agaggtgtcc aagagctgtg ttccctgaca ttattccaga gaaggctata tatcactctc caaagaaggc cagatcccag cctgggaaaa agtatgccct tcatgggtac agatactttc aaaatggaag aa tga aagt c tgctttgacc aggcgccggc ttgtcttcct tttgtttata ataatgaaga gatggagaaa acggattagt aggtttaggg gcatgcttgg ggagacaaat ggagactttt caa a acaa aa gctaataact catcattatc caattctgcc tgccattttc catttttagg ttctacrgtg aagcttttct acattctttc ctgttgctct cactt tgagt tctctctctg ttatttgtgg.

acatttttgt aacataggat gattactcac agagaagaat tatttcggtg tttttaaaaa gaatatgcgt ctcttaagtg actagaagtc gct cctgcct atctctgcct gtctgctttt ctcattataa gggttaggat gttcAattca tgtagatttt aaaatttgat aggccaggcg at cacctgag taaaaataca ggctgaggca gccactgtac aataaaaata taagtgtcta ccactccaca aaaatgtttt gtctcccctt gacaacttga aaatatttaa gcctgaaaat tggtggacat cctggccaat gttgagagac ctgcatgtga gaagaattca 188700 188760 188820 188880 188940 189000 189060 189120 189180 189240 189300 189360 189420 189480 189540 189600 189660 189720 189780 189840 189900 189960 190020 190080 190140 190200 190260 190320 190380 190440 190500 190560 190620 190680 190740 190800 190860 190920 190980 191040 191100 191160 191220 191280 191340 191400 191460 191520 191580 191640 191700 191760 191820 191880 191940 192000 192060 192120 192180 192240 192300 192360 192420 gggatctcaa agaaccccca W0005851 0 http:/Mwww.gett1eatent.comI~ogin.dogISexam.supportIFetchIDefault.dog/V0005 8 51 0. cpc?from Ca rhe= 1 part=ma intool ba r--bottom] Page 460 of 737 WO 00/58510 PCTIiBOO/00435 gcacccaacc ataactttac tgagccatag gaagaaagtt ttggatcaaa gacaattctt ctttatgaga tggttttaag tgctcatttt ttcataaata tactgaatgc aaaaataagc ggacagggca ctattagacc ctttggctga ctgtttctac tgatattcgt gagttgtagt gagaagtatg ttgtgaaata aagtcatctt acctaaagct atagctcaca ggtagggttg atttaaggga tctaaagaat tggatcatct tactaaaaat tccagctact gcgagccaag aacaaaaaca catcctcttg ctgctcccct ctagtttaga ttttttttta agggctccca agtagattaa ttcaagagtg attagacata agcataaata gcataaaaaa gttgggtcag agagacttct tactaattaa ttattttctt caaagagttt ccataacatt ttaaacccta ggattagtaa tctccttaat tctttattat taaaaacatt aataaaataa taaggaaatg gaaatttttg agccacaacc attccaggtt taaaatattt ccctacacat acatttttaa tttttctgca aactttgcac tctttatttt tcctattact tagtgccgtg tgtttcaagg tactacaagc gttggcatCt gagaggaagg aatgctctat taggcagtct ccaggttacg gtccaatatt cctctagcct cagctccagc ggaaa tgaag aggtcatttc aatcttttat att taccatg actaaatatg tattgtaagt ttccattgaa aaccattcaa tcacttatgt caatgattgg agaaaatttc atagacatta tttgccccca attcaaaagg gaggtcagga acaaaaaaaa agggaggctg attgcaccac aacaaaaaga aggaacacag ccttttggtt gtttttctat atctcctgga agaaatgtgt taactaagaa ggaactgatt taaaaagata tgaagttcaa ttagcatcat agccattctt tctttatgat acagctaatt ttctgtttgt caggcatggg ctatgagatt ttttaaagta tatcattacc ttccaagaac cttattttct aaaagccagt t ttat tct at gacaaaggaa tcacgctaca attttatctt atggttataa aattgagact a cagg aaca c tttaagtttt aatgaggaca tgttaatata ctaacagctt ttcaaaggaa ctctcccttt gtgtgtgatg ggcctgctga tgattcttat gtgattagag atttgattaa gtgggggcgg taaatattaa aaaagt tgat tactacaaaa cactttaagt aaattaaagg cttggctggc ttatcctcca ctggatcagt taaatgttta tgcatcgcac atttgattgc tctggactgc tttaatatgc acacttatta accaaagtca gcattctgac aattaatcag tcccgggcac gttcaagacc aaaaaaaaaa aggcaggaga tgcactccag ataitcaaaa gtgact ccag ctagggactt tacaccacct tcacaatata aataaaagtg aataaggcac agagtggtag tctagattct gtataaactt gattattctg tattcagtta aaaaaagata ggaaattgga ggaagttttg ttataggact tcgtgagcaa cttacttttt tatggaaaca attaatcttg atgaagaaaa ggataactgc t ga taa ttcc gaaaaaacag at tat tct tt ctgacttact ttactaactg acagtgtgtc tgagggtact gactttaatc ttaagctaaa aatggataaa gtatgagaaa tcaaacaacg ctctgtaaca aagcgatgga ttaaagtggg ggagtacaca gacattttgt gtaacaggga ggtaagaaaa gaacattgtt taaataatac agaatgcttt gacggaacac caagggcgcc aactggacag catttgtttc tttttccctg ttattgggtt taagctttaa acacaaagct atccacattc cata tt tcta ttaatgattc tcttatatat atcagaattg tccatgataa agtggctcac agcctagcca tagctaggag atcgcttgaa cctqggcgac aggtgcatgg accacaattc gattcctgaa ggtct ct tat atcgtttgaa gt tggtggga acacaacaaa aataaataca ttgaaaaatt accaaacaac tattgtttac tcaaaatggt attgtaaatc agatttgttt gaaagcaaca ggaccatgca ctacctctta gctttctcaa aaagatataa aatttaagct taatccaacc aaaagaaggg aaactctcaa cttttcatgc gatcatgaaa a agcagtot g caaaaatcct t gcacacagc tttaacaata t tctccgtga acaaatgaac tctttaatat gaagaactgg gtttccaagg cctctcactt agcct caggt cccaaacttg gaattgcaac tacctgggag t ttgcct ct c tggatttctg aatttacttt ttttggaaat gcaaataata actctgtaac tcactgaggt ggctcctatt at ttgcaggt attttatttt ttagctgttt aaatgtattt tgacatgagg atctgaaact ttaaattaat tttgcacata ttctcataat gagacagat t agccagctct gcctgggagg aaatggtgaa ttgtggtggg cccgggaggc agagcgagac -ggcaaggaga tcctagatgg gaggggtcat attaatttgt tttttgttgt aaatcttgct aggttgtgca tgtgcatgtg aataagaaac agagaagtga atagatctat agagccattt aaaaaagagt ctccaaactt ttttattctg tacttgaagt ttgataaaaa atataaggat aaatttactg taaacttact tatctactag cttttaattt ataatatctt ctttcctgaa aattctttta agggtgaata attgcctttc gttgtaccat aaacagatca ttaaatacct cataaagtga gtattaacca tgatgcagaa gggcatgcca cagtcctccg ctggaaatag t gaa gaa aa c caataaaaga tgaacagata aaagtggggg attttatctt aataaagaag acatgaattt aaagctaaat ttggggatgg atatcaaatc gtcttgtcta aattctattc taagttacta ctataataaa ctccactgta tttattctct tgaaggaaat ggaaggttag gagtgcatgg aatcctaaga cttctgtctc ataatattac ccgaggcagg acctcgtctc t gcct gtaa t ggaggttgca tctgtatcaa ggtcatttca ccgggggccc gcgccaacat ttccctgatn tgtgtataca aacagaatcc tggctgcaag ttctgaatcg tttttttcta taaagtgcta caagtcaaat ggatgagt tc ttaaaggcta ctactatttt tgattagcat gtacttcaaa gaattgctgt gatgtactat tt cactcact ttaaacatta tatgccactt tatataaaat gctgcagtgc acaattgcag aagacacgat gagagtttcg attaagtagt gcataattat tcaaaaaatt atctctgcat cgggaaaaaa ttgcactatg agtcaaatac 192480 192540 192600 192660 192720 192780 192840 192900 192960 193020 193080 193140 193200 193260 193320 193380 193440 193500 193560 193620 193680 193740 193800 193860 193920 193980 194040 194100 194160 194220 194280 194340 194400 194460 194520 194580 194640 194700 194760 194820 194880 194940 195000 195060 195120 195180 195240 195300 195360 195420 195480 195540 195600 195660 195720 195780 195840 195900 195960 196020 196080 196140 196200 W0005851 0 [tqpL/fwww.getthe patent. com/Log i n.do /Sexa msu portFeth[efa uIt. dogANOOO5851 0.cpc?fro mC ache= 1 Part=ma intool~ba r--boto m]Page 461 of 737 WO 00/58510 PCTILBOO/00435 cgccagctta aaaatacctg tacttatctc ttttctgtgc atatattagg ttctattatt gaattaacca ctgaaattat attctttaaa ttatccatca tttatgaaca agattatgct agtaacttta gagacgtaaa gggaaataat actatatcag ttratgatct gagacagaat ttttgaaatg cggatggcac aaagtggatt ttgaaaagat gaaaaccaag agcttctagg ttgtcactat catccggggc aattactgtg gatggaagta agaagatgat tctcttccat agtggtttct cagctgtgtt ttccagttaa tgattattgt at ttttacac aagagcttat catttctccc taaaataagc aaataataac tttaaaaaaa tccccaagat agagataaga gcaacat taa ggaaagatgt ctacttctca accatctaca aagractcaa gaatgcaaga attctgttga acttagactg tatttatttt agaaaccaat ttgttaattt gggaagatat aatttatctc attagttatc ctaggaacta agaaaatctc agcccctata aaagttcctt taactacaca ggtcaagggt tcaatgtatg gcgggtcagc gatgcccttt tctgaccact aaatctcttt aacctgaaaa ggaaacggaa cttgctactt tgaaacaaaa cattctcttc cttgtctaac gcattcttgc ttgctctctc gctcttcaat ttcaaatctt aaaaagctgt gtataactcc attactatgt tgccacctat taatactttg cctgcccccc cttagttata gttgggagtt agcacgaacc gaacaacgcc ttcctggcat tctctttatg ttgtatcttg agaagtacca ttcttaggaa attcttggga atactatatt aactgagtct gtctactttc taatattatc acccactgt t tcatcttcca tcctttcacc cagttacaga gcttattcaa aattgagaga ggcatattgt agagtaaagt aagaaatgct agtaatataa aaagagtaag ttaaaattag tatgtttaac ccctcaaatg atcactcaat aaagatactg ggaactcgtt ttaaatatca tcagactcta tattactttc aagacacaga cctttccaat ctattgcagt ttcttaagag tcctcagagc ccctcctcct ctaagtgtga tgaaaagaat tcaatgaact atcctctcct gctccagcct gggaaactgc gaaaattgcc taaaggaaag atatggaatt atgttaatgt ataaagtatt aactttatat tggaaggcaa tttgttgcaa tgccaggtac caacacatcc tattcaatac ataattagag gcaaaattgt gccaggtgtt gtggggcctt atctgaattt accctggtgt aacataaaga catttatctt aggcataatt aggcacgact tgccagctgc ggggcatcca ggttttctca cat ctgagag aagaagtgag atttgagcca tgatgatgtg ctagaggcag agagagccat gtggtaagac gtgttgttaa taataaaact tctgcaacag aggacacata atacacggtg gatttgcttt tgaagccata gtggtataaa ttatcttggg aaagatttca aatttaactg gaattttctg tctattttaa ctcaggaatt aatggttatt cttacaatta ttaatgcaga tgctgattta catagctatt actttacaaa gctggttcat tctgaagtcc tggaactctg aggttttaat tcccagcatc gccctgtgtt aagtgattgg taggggatta ttattgaaca cccacataag cgtgctccca taaaagagag acctccaggt tttgcacatt ctagaaaaag gacgtggttt ttcccctgga ttcaaaattg gcatttttat ttacaaacat caattgtcaa agtattaaga gcaagaagtg tgtcaggatt agatggttgg ctgtctgaaa gctggggtgc tactcctgct agtttgttaa actatcaccg cagggattct caaacttcac gcctggaagt agaggcagct cagtgggagg atttatacaa cggaagaggc tttgggaaat tcacttatct gatctgataa atctcctgag tattgaaaga cacttaatgt ctataggtgc ct gt accat t aatgataaac ttgcatgatt ggatttttac agttgatcaa gtgtgtgcac aaagagaaaa ggagatcctt atacaaggaa ataaggttaa agaatttgta acaggaatgg atcaagtaaa atttaggata taggtgggaa ataatcctag aatagtataa tttgtctctt tgggataact ggtagagcta tctgggaagt aggctttatt aaacaaaata acacctttta atttttccaa agtgggggaa ttacagttct gccgccatat cagagatcgg caactttgct aaacttgaaa tagcttttaa gaaacatcac aaatgtcatt aaaaaagctg atctaagtaa cttcacagta tgttttagtt ttatttccat tagaaaatag aaaaaaatac taattgtggg tacaccctcc caactaatcc cagcatggga agaaattttg taaggacacc ga aa tgact t gctagtaaga gcagatgggc aacagtgagg tgctggttac aactaacaga tagtgggttt caaatgtata actgtaatca atattagatg ctgatgtgcc cacaatattc aattgtcagt gaaaagtt tc gagatctatc aatgttgcac actgttgaac ctggagagca ccacttatat tgggaaaaac aattataagc aggtgttgaa agtgctagaa tggccaaact ataaagaaat ttattataaa ttctttttgt ctgcctatgt gtttatgtta tgcaaaagtt ataccataaa cgctctattt ataataaaaa ctattcttat gagaactcaa tcatcagaaa gtcagaattt tgggagtttt agtcggggat taagaacagt aaaacaaaca ggcaagctgg agttcgaaga actagtaacc agcatgagat tctgacagag aggattggac gagaagccca ttgctaatag atggggttag caggaagttc tgtaagtgaa atttcttatg actatttagc agggatggaa agccaactag attgatattt agattaggtt actggaagct ttgctcacat agaggaatca tttctcacat aagatgaaag tagttctatg aaggatttta agagagacta gtaccagaac gggtgcttga gccaggggtg tgatgcagga catacgttca cccatcccaa tattctcctg ttgcttgaga aaatattttc tgtgtttatt aacagaaaga ctgttagcac agcagacttc agcaacttgc ttatgctaaa gaagtatcta gctcgctctt taccggaaac taggcccttc tgcagtcatt atttcaactt tgcatccgtg attaactttt cctttcaata cttgcagttt agaaactagc aatcacaaaa atacaacctt agtaacaaga tgacaatttt gaaatattca taaattgtat tctcacgatt acactcctca tcctgattac attaccagat atagaaaaac aacaaaaacc ggctgtacca caaacacttt ctcttaggtg 196260 196320 196380 196440 196500 196560 196620 196680 196740 196800 196860 196920 196980 197040 197100 197160 197220 197280 197340 197400 197460 197520 197580 197640 197700 197760 197820 197880 197940 198000 198060 198120 198180 198240 198300 198360 198420 198480 198540 198600 198660 198720 198780 198840 198900 198960 199020 199080 199140 199200 199260 199320 199380 199440 199500 199560 199620 199680 199740 199800 199860 199920 199980 W0005851 0 [http:/twww.getthepatentcom/Login.doq/$exam.supportFetchDefaut.doqNVO00581 0.cpfromCache--1 part=maintoolbar-bottom] Page 462 of 737 WO 00/58510 PCTIIBOOIOO435 tgttgtacac aaggtgataa cgangcgggt agccctggat ggttagaaat aaattcccaa cttaaaatat tcaagtttga tctgttttga gtttcatgaa cttcatcata tagagccaga ttattatttt tattttaata gcaaagtatt gctggaatgg ggccgggata aaggactctg cagacaaaat agtcccagtg caaacgccga cactttacct gagtctgctg cctttaaatt ccttccagcc aagttcttca ttgtggggtc ctattagttc gaaaatctat caatgttgta tacgatgctt t caatttcat aatcctgaag atattttaaa attagagagg tatttcaaac agccagcttg tggtcctatc aatctcatcc gcat cat tt a tataaggagc gtgtgtaaac gttacctatg ttgaaatcta gctcaattga tgttcactga gagagagaga cagaaaataa attctctgaa tattaattca gtcatttaat ttgtgctatg gatttcctag tttccatttc ga aaact gc t aattccaagt tagcttgatt gagaatttaa t tat gtca at tatggcactt tcctgtgctc ggcacttcta caaatetcct ttacacatcg tgctggcaca ccgtatttct gcttagctgt acacctctca gtgattctca tgctatggga gaaacaggag ttggtgtagg tggcaatgtt ttgcagatgt cttaagctta acaggagagt tatgcccatg gatgctgttg cagacacacc taaagaaggc tacttctata ttaaaaccta ggattcaacc gctggaacca tttttgtcta tggttctggg aattcagctg tgcacctttc gttttgggac ttgtgttcgt tgtccctcta taataaactg gagaattatt ttaagttgat attgactctt gttatacttt cacattttta ttaattcgat gcatctctct acagcccgtg tcttaaagac cagtggacaa ataactaata ctggcatgtg ttggtgtcga ttcatcgcct ggtctgtctg tcctttcaag tgggctatgt agacccataa attgtatttc gggccacttt ctggaataag gtgcagccat attgatggca gttctccctc taacacgttc gttttaatgc tctgctactt tctttgtata taaacaagaa tgtcaaagca taatggcctg ttcctttcct acataggtgc tttaaatttt aaaccagggt gcacacatgg acacacctgc gtgatctgtg ggcccaccca tgcaccttaa tacaggcttt atttaataaa gtgtaatctg tgggaacacc gggaactgag gacccttaac tctatattgc atggataata tgtctttgaa ctttatctgg agaaaatcat ggtgagtcct atttaatagt actcatagac atctcactgt taaatttatt gactgccgga aagtttttct tcccatgctg t cagactggc gtgagttaat gagaaccctg atatagtcag ttattgctct cacattcaaa gcctttttca.

atttttccat aaaatgaatc gacgaactct tccaaatctt aatggctact agagcaacag ctgggaaaac catactgaat tttcctgatc gaattaaaat ccaactcatt cttatagggc gctccatcac tccagaagtt atat tctgaa caaatatata cttttctttc aatcacacta ttacctggtc atgcagtcta agagtttcta ccaggcgatg ttacatgggg aacagctgtg atgaggaaaa atttcttata catgtctgaa ttctctctac gagggaaccc aaggaggaaa aaaaatcaaa ttcccagatt acagtgtgac caccagctgg aaccggcagc gacctkctga agctttagaa agtaaattct tactgatgtt gcattaacat tgctttaagt acgttataag t cactta t tc tatgtttaat ctgagtgt cc ggtgttgcca gtgggcagca gatggttaag tgtggatgaa atgcactgta tgcttttgtt ttctgtacct ctgaccacaa ttcgcgaatc t tta tcaa tg gatgcttcct ttccttgctc acttaatacc actaatacaa agcccctcaa aaagacatca gatgtgtcct gcagtgatca tttgaacctt tccagaagtc tagaaacaat agcagttgaa cactaaaggg aatatttgga ttggaaacat taagtagtta tttggtgttt ttgcttaaca gaggctcatg ctttttccaa gtttgagcta gcaagaaaag gtatatgact tttctgaatt taatgctcta attggcacac aagtgaatac gggttaagtc actccataga ctgaagcttc tagcatgagt ttataatgat taatcattcc atgcctggta ttatagatga ccatctctag aaccacatat tttcaagaaa acatgtattc t ct tatgat g ggaaggagac acggctgt gc atcagcgttc atcagaatct acactgttct caggatattc tggatcccat ttttaaattg taagccatga gaaatccaat tcaaaactgg acattagtat acttgattgg aaggagat tt actaaatcag caaactaaat ctgtaaccta acaatggctg caaactgcgt cgcttctaat ggcacccctg gttcatttct aaaagactag gcccttgaat ctcagcttgc ctctccttta tgtctccatt gaaaaatacc aaataattac atccattcat gtaaaaatta gcccttgaaa taatttctca catcattaga acaatttcac tccaagcaga attaaataga taatcctgct gcaggattta t tagagttaa gttctagtgt atgctaaggt cttcagggtt cagcaaatca taaaggggga aatctagtat ttttggtatt tgtccttaca agtcccaatc ttgaaaatta ttaaacgtaa tttgggggtg tggtccaggt tagttttgcc taagttatgt cttttacata catagtaatc gagagaaata ccgtacctta actgcctaaa ttatgacaaa atatcccatg aaacagatag caattaagga tggaagtcta ccagggtgct gctgtttcca aattagtgtt taccatgtac ccatagagat cccctggtga gctaattgtt ttgcgagtgg tctgtgctgt catttaaata attgaaggat gagtcagtgg ctaccagctc atggcctgag gcttaatagt aatgttgccc tcaaataagg tcctgtacgt gagcctctgt cagttaaact actggcttag atcagactcc agatgcccta tatatacatc gaaaagaaaa aaagaaactc atgccttgtt gtacatacat tctaaaaatc gatcatttat tgctaaccaa acttgggtat aggttaaacc ggcaaaatga actggactta gaatatttgt caacactgtg tattatgaca tctgtacact gaattctgga tcctgctttt tggtgtccac taaaagaaga aatggaagct tgttattggt aaggaatgac tgcttggcat aacagttttc tcccttatag ggtcccagaa accacacttt tggggctttt gatgtctctg agattattgt actcaataag ttgtgaattc cactggctta gcactctttt ctacaagact gcacatatgg 200040 200100 200160 200220 200280 200340 200400 200460 200520 200580 200640 200700 200760 200820 200880 200940 201000 201060 201120 201180 201240 201300 201360 201420 201480 201540 201600 201660 201720 201780 201840 201900 201960 202020 202080 202140 202200 202260 202320 202380 202440 202500 202560 202620 202680 202740 202800 202860 202920 202980 203040 203100 203160 203220 203280 203340 203400 203460 203520 203580 203640 203700 203760 W0005851 0[http:Jtwww. etthe patent. com/Log in.dog/Sexam. supportIFetciIDefa ult.doaNVO005851 0.cpc?fro mCac-he= 1 part= m aintoo lba r--boto mlPage 463 of 7 37 WO 00/58510 PCTf/iBOOI00435 atgaagatat ttttttttgt caaaatattt ttacctagag atatttagtc atataacaaa caaaacccaa taatgcactt ttttttttta ttacagagag tagtttttta aagagtggtg acttcactgt ggttgccttt cacgttcaga tgtaattatt attaaattaa aaattgccac caaagttgtc tatatt taac aacacaatta attcaacctg cttttttcat ttttgatttc tcgaactctg ttctgtttgt cataacggtg ggaaatttgg caggattttt aagaaaaaca tttggttgta t taat ttg'aa gaatagtggc taagttcatt attaggcaac aaaaccatga catgaaaaga ttaattgatt tttgagttat ttatgaccac aagataatca ttcctaactt ggacatttta taatattaaa cccccggagg gctactaagt agtaaatttt ttaaaatatt aacagtagct tttgttattc tttcaattca tctatccctt tacttttccc gatacgtcaa atatatatca nrttctaact gggttgatca ggtagttttc catacctttc ggtaaacatc gatacaaata actttatgga ccccagatag tgtttttctc aaatgtccct gcctttaatt gttttatcac ttattttcat aatttgtatt ggaaacaatt taatttgggc agagatctgt aagcctgggg tgcatgagtg gaaatggggg tgtcctccaa agcaaagctt tgcagccaca agtttctgat ggaaatcgta aatgtaaaac ctaggttcct acactacaag ttgctactac ccctcggctt ataaaaataa aggaagtatg tctcagtgac tgtttcacct ttcccaccag gagagaggaa agaagggaat aatttttctt gagtggtctg ataagagctg ttttacaacc aatgctgggg ctctcaagaa ataggcaggt gaaatattat aatatgattt cactttaaac taaagagcac tattggttat aagtcttttt ttttcctttg ctctagtcct tgagatacat cactgccacc ggttgggaca tgaagatata cttctaaatg aactttatat aaataagtat tataaatgaa ttcccccaat ttttgttatt gcacaaatta cgtgaaataa taatgtcttc aatcggattt ttctgccaaa acagtctgaa a gat ttt tt t aatgaattca atttcttcca agttaatatt tatcaggcta tgtttcttta catacgctta cattcactta ttttctatcc ttgcctggaa cccttctcct ttggaaaacc aaagaattag cttgtcattt taaaactgca catgcgccct taatttaaaa gctgttttta gtagctgaag cttttcacct tttgagcctc gatctattcc caattaccat tgattaaaca tctaaaaatt tttcgagttt aaaaattaag agacagtttt gtggtccatt taatgtaaga aagagacata ttgatttgca gaacatttat gggt tgat tt atatgcaata atggtgacaa gaaaatatgc tgtaggaaag aataaataat aattttaact taaaaaatta ataggtaata ccatgaaatg gtctgcttta ggtcttttct tacaacagta aatacattta ttctggatga acctygttag catggcaggt ctttagcaca aaagctttta aaaagctgtc ttttatgttt taaaggaatg taaccccaag tattttgcct gcaggcccac actaccatgc attttagtat atggggcatt aagaagtgtt agggaactat aaagtagaca caagataata catctgtatg ttagttttgc ctgcagaatt aagcaaatgt atttaaactc atttaatata tccatttgcc aacgtgaagt cggtagtcta taccaaaaca caggaatttc ggcagaaatc agttaagact caaagtacca tagtcacagg ttgatctcag atacatatct tcaccctctt atttcatctc aatttaatag gtgrcaatta ttgttaggac gcctttttgc cttctatacg tatacacaaa ggattgtaga cactgtattt agaaacatgg attaatgagg aggtacccag ataaagattc taaattggaa ttgtagggga cattaactgt atagcaacta aaatgtaagt agaaattgat tgagtgctct tcatgaattt tcaagatatg gaagtgttaa tagtaawgtt tctatttgtt tttgcctgac cttacctaag ggatctgttg ctaaacatac gataatagag ttttaataat aaattgcatg cagtgatttc ttataaagtg aactcaagtt caaaaatgta ctactcctat caatttctta agcacggatg cccctttagg atcgatagta tacaaaaatg cttctttgaa catgttaaat atttgaattt cct t tcagt a tt t tgt gcca gcacaaatac aaaactacaa atataaaaat attcttagtc ctaaatctcc ttgattagtt gaatataaac agacaaactc tcaacgggtg aattgttctc gctctgaatg cttggctggg tgacagckct ct gcat acac cgaatgccta tggtcctgct cccccactag ttactgacat tgaatttaaa tttgaagaat tcttaaaaat cataaaatat agaattgcgg cctcactttg gatgtgttgc aggaagcaag agagggatca aacatggcac ctttgggaaa aaacacagtt gttggttgac ggatcctctt atctaccaat caacaagct t tttttctgtc agaatactgg aaaaatattt tttctgaatt cagcaatgtt attgttgatt ctragagac atttactctc gaaatcggcc agaagttgag tctgtgctca gttattagct tattgagact taagt caaaa aaatatgtac attaaatcac gtttctattc ttgactttga ttcccataca ctcttggatc atcattcaaa ttgacattat agtctacttg tatttgacca aggattaaag catggaacag gacaaggtga aagttggtta gagcct tcct tgaattgccc tgggttatat agaattagtt cataacttag ttaaacaaaa ccacctacct tttttttttt aatgatttcc ccgctgctac tttacaccac tggattcaac aattaaaaag attatttttg acccatt tgt tcaaggctaa ttgctgcagg gagtgat ttc tttttccctg aattaaaaaa aaaaaagtga gcatgtacag tttcagctat catgacccgt ttttgcgtat aaaacaatgg taagggtcta agaagattgg acaaaat tgt atagaacaaa ttgttttttt tttttagtca gacgtcttca atttgagaga atacaatgta cagtaaagac gtttgttttt tctccattac atatatttaa ctgttgtagg gatttgcctt ct gt tca aag ctctaataaa ttgtgatgga catttgttca ttccttcatc gcaatgctta gtcccttagt caaagcatta taacatttaa tttattgaat tattagcctt cctgagaaga tatatgggac cagtctgatc ttacagctta t tat taa aaa atacattgca aatactttac cctccagata caaaggggat taattaaagt gcatattaac 203820 203880 203940 204000 204060 204120 204180 204240 204300 204360 204420 204480 204540 204600 204660 204720 204780 204840 204900 204960 205020 205080 205140 205200 205260 205320 205380 205440 205500 205560 205620 205 6806 205740 205800 205860 205920 205980 206040 206100 206160 206220 206280 206340 206400 206460 206520 206580 206640 206700 206760 206820 206880 206940 207000 207060 207120 207180 207240 207300 207360 207420 207480 207540 W0005851 0[http:/twww.getthepa tent.co m/Login.dogSexa m. su portFetcIoefau t. doMIO005851 0.cpc?fromC ache= 1 part= ma intoolba r--bottoml P~age 464 of 737 WO 00/58510 PCT/IBOO/00435 tactgctgga caatttgtat actccattat aaatattcaa tatcttcaat aatattatgt acagccaaat ccagagaaaa aaaaaatgta ctaattctct tgagaaagca aagtgtgccc ttatctataa cgcagagaga atgaagaaag aaacaaatat tatcacaatg aactgatatt aaaaaggagg atacagaaaa ctaattactt cggagagagt tatttgttga cacaatctgg gcaaattaca ctctcctctg tcatctagaa cttctgtgtt tcacgaggtc ctccatggag gactcagctg agcagaacat acagtagaac cattgtcatt actttgacct ctaagtgaac ttctacccgg ggagatttta tttcttattt ttaatgatac ggaaaaaata aaaattaatt tagacattga tgtctatatg atgtctttaa atcttttagt actgtcaaac cagcgacaaa cat aaccagg aagtaccatc aatgcagtct ctctccattg acaaaaatct gtt ctcacct gccaaacact ccaatatttg aaatactacc tgggttagag ggaaggaagg ttctttttcc atttgttaaa atttcttcta ggtaagaaat gaatacagaa aataagtgta agacatttt t gacatttaag gctttctagg actaggatat aaacaaataa attgaggttt tatatatata tattcataat tgtttaatat acacactgta caggaatatt tgtgctatca actttttgaa tattctcatg gacaatgcag ctctattagg atcatttgag catcttcaca ttgcaccaac acacaactat acatggccat agaagactgc ggtacattgc gagaggaatg atacacctta ttagaatttc aggcacagct cagccccttc tgtacctatt ctggcctatt aaaatggatt ttttctacct gtgccatcct atgcagagtc gctagcttcc agaacaagtc ccctgcaagt t gaatgacat taactgtata ttgataatca cttttaaaaa cataaacaca tttatttcaa atatatttca tctcccgtca ccctcgggta gacttgcaaa catctcatct ttcttcattc gagtaactgg ttccagttac accattccta tttgcagctc gatatattga tttttccata gaaaaaaacc aaggaaggaa ccccaggaac tattgtaaaa ggaaaccat t ctgtcaaagg aatattcatg acaaaatgca agagcaaacg tatgaattac gctaacaaat gtggatatga ttagtgtaat gctgaccaga tatccactac tgagtttcat gatgataaga ggcactgaat ttccgtcata catcccatct gtgcagcatc gttttgaata ggacccttca aaggttagct accaacttta agtccacttg ctaattgtaa aaaagcaagt tttgacaatc tcttgcacac tgcacaggtg cagcacattc gttatcccct tgttttatgc aactgttgat caagaaagtt tctctcgtca atataaatga ttttttccta tactcagaac tgtgaaataa cttcagagac tccagagccc ttgtgacact gtgtcagatt caggactcac agcaatgtac tatatgtaca tcttaatcgt aatctttcta ttttgtgtat ttgtgtttta tgactatctc atgcaaattg catgttttta ttaaccagcc tttcacccgt actgaggatg tactggaaaa gagtctatct tcgtatttgc ggactggaag gaggcagct t aaaatgggtt ggaaggaaga atggcagttt tactttcctt tacccttctc cacttcacca ggatgtaaaa gtgcatacag tgggatcctt cactttttgc tcttacttca acatatatat ctatatgtat gaagaagaaa atttctaatt agtacattca aactgtatga gtcacacttg tggaatttaa atggaaaaaa acctgcattt aaattgtcac gcccatagtc agagtaggag atgtgaaatt agaaactaag gttatgcttg ggaacaagaa aagggagaat aagtgaaagc tcagatcgca tccacaggcg tggcaaat ta cttttcattg tttcaccaaa tcccaagaaa gccattagag atattagttt cacaggaact atgattttcc gtgatatgtg catctgtgcc agtctcaggt tcctatgctt ctggcaaaac tcttctcttt tttttttctt aagtgtttaa tgctattttc ctcctatctg tttttttaaa ctgaaaattt aggtagctga gcatatccga ggacataaac tctcctaatc ggctccatta gactcctttc tttctgcagt atctatttac attgtagggc taaagaaaga gaatacatga atttggttat aaggaaggaa gagaaaatcg at tgt tagta cccttctctg ggaatctggc ctgcaaatta ttattcattt tgttacacaa gaggtaccaa atatgacaat ttttgtcttc aatttaaaag aaattttgtt aatgactaga atcattttta ttatacacaa atatatgtac taatattgnt atattttcct gcatcaatgt gtgattaaaa tgaaatagtg atcctgcata -ttttaattta gacatttata aattttggga aagaactgtt agaatgtccc tggtcctagc agataagaaa tgaatcacca caaatgaaaa aaaaaaaaac atgatatttt cagacatata ttttaaaatt tgacatggga aacaggtgat caattgtgaa ataaaaaaca acatgattac gtgtagaaat gggggaaaag ttggtgcaaa agttattgca aagaaactta aaaggagaga gtgaaaatga ccaaagaaca agtaatttaa agtacaatgc tctcatcggt cctgtctgat catagctggg ctggcactgc actggaaagt ctggattctg atgggaaaac aacctcttca tttcatgcaa ttttattttt ttaccttgtt attggcttgg ctatgtactt cttctacttg tgttccacta atatagtcaa tgaagaagat atctttggag cttggttttt cctcactgcc ctcaactgca cctttctgta atttatttta atttctcctt tcctgctgag tctctgtgtt agatctgaac cacacatgga tgggtccaaa aactattgat tagcttggag tttactgagt tcattttttt gctatgagtg aacgcaattt aatctttact ttttgttact ttttaattct acccctgact ttatgcccag tttagcaaaa tgtaaataaa tttacttgcc tgggttgagc gacttaagac tcagtgtatt ggtatcactg acagcataag caaccccaag ctaacaagat tcatcttaag gttttactta tttgcagaat tgtccattct aacgtttttc tgcaggtagc ttaagaaatc cagaaaagca catcatacat gtatcattag ctctgaggtt tcttagatta cttggctgag actagatctc ctgccacttc acacctatgg ttaggaattc actgtgactt atagagaagg aaggaaggaa ggaaggaaga gaaagatcct ggaataaaac aagtcttata gaattccatc ttggcagact ggcactacat ttctctttct tcttataaaa tgcagtaaaa 207600 207660 207720 207780 207840 207900 207960 208020 208080 208140 208200 208260 208320 208380 208440 208500 208560 208620 208680 208740 208800 208860 208920 208980 209040 209100 209160 209220 209280 209340 209400 209460 209520 209580 209640 209700 209760 209820 209880 209940 210000 210060 210120 210180 210240 210300 210360 210420 210480 210540 210600 210660 210720 210780 210840 210900 210960 211020 211080 211140 211200 211260 21132.0 W0005851 0 httpltwwA,. etthe patent. com/Logi n.d og/Sexa m. su porIFetch/Defa ult. dogMO005851 O.cpc?fro mCar-he= 1 part=m a intool ba r--boto ml Page 4 65 of 7 37 WO 00/58510 PCT/EBOO/00435 ctgcaggcaa agtttttgag aacaggatga atgtcgactg tcaacagaaa gattggcctc cccaaatgag agcccatccc atggctgttg aaaacttcat attaaaggca gctggatgca aaagtcagaa atcagttggc ttttataggg gccataatac cacccctgaa aggacaaatt tgcctcttaa gagtttttct ttcatgagat gagtttagta atcctttgat ccttaaaata atacattaag tcatttatgt gaaataatag tagttgtatg tcatttagat gctaaattta tgaaagtctt tgtataattt taatgctgat ttacatgtag tccactcatt gagagagaga agtacagtgg ctgcctcatc tttgtatttt aactcaagtg ggtgcccgga gaattataaa ttagtataaa ataaaattag tttaaactta tattttgttc gttgccacat ttataggagg tgatttaatg atctatgttc ctatatctct taagtataat tgcatatcca acttaagcaa tccaccattg ctctgataaa gaaaacaaaa ctcagaattt aacgtctctt atctggagtt atttcatatt accttataag tacttgcttt tggggaaatg cagt tctacc ctgacacgtc cacattttcc tgttgcagac ctgtgcttct aagatgcatg aacagaccca ttgcaagcct aaatacaaag tgtagagtga gcctagcagt caaaaaaacc tcactgaagt attcttagaa acaaagggac ggctgaataa caaccttcta ctcataataa actgactagg aaattatttt gttacaccaa agtttttctt aggtgggagc gagaggtgga aatttatcta acaacaggga aataacattt tatattatat tacattacta acat gaagaa ctacttcagc catatggaaa taatattagt aaactatgca gagagagaga cacaaccttg ctccccagta tagtagagac aaccggcctc ctattcttgt gtgattcaca ttaattctgt ctttggaaat caaaagcaat cctaatagac taggctgaac gatgacttct acaactttgt caataaaact ggattatatg atacatgtct tattgcatgc agttgaatag ctaatgcaca attattgttt actcctaaga tactctgtta cttctaaagc cagtactcya ttcctttcat gaa tcat aga gtctaagctg accattactg tgatgaccag tcctctttgt ttggccagtg ctaacatgag gccatttgtc cagctgatct gagtgagccg ttgggtttcc ctttctgcat aagtctgatt tgtgctgtgc cacaaagttt tcaagcagca atacctaggg acaggctatt gtgtgagaca agcacaatgc atagcatata ctgcgccaaa actatcttga aatccagcag tatcccttct cagcatttat gaaaaaaaga tgtatataaa attgtattct ttgagtatat ccatgtatat aaaataaaaa tattagaaac aaatcttgaa ct gga tca ac ttacttcaat tatacatata gagagagaga gctcactgaa gctcagatta ggggtttcac ctcggcctcc actt tgggtg ccctcttatt atatttttat aaaaagaaca taagaagcag tacacaccgt tcacatttat ttttacaatc gctttatcta tccaacataa gatttacata gagtataata agctatgtag ctctcaagta caaaaaaaac attcagaaac gaatgaatag ctgcaaaatc tcatgaaact tttcattcct gggggwtaat tcaacctaaa cttaacaaca aaactccttt cttactatgc catgtgacct gctctggtct cagaggctct ggagcaacat agacttaagc aaatcttccc tggttatgta gagtttctat ttacctgaat catgggaagg gagtgtggaa actatgaaaa agagaaaccc ggtatttagg cctggtttat aaagtagcat gcaatcctgc atatttttca ttaaacaact aagaaaatga ccttacatct aaaatatatg aagatcatat tgacttacaa tggggtgaag tagcttatct aaagaataat gtgtcatata atagggatta aagcactctg ttgcaaactg tatctttcct tatatatata gacaggatct acatccgcct caggcatgtg catgttggcc caaagtgctg tctttttttt ctaaatgtgt ttaattttaa gatacggtta tatcacaaga caatagttaa tatttctgtt atttaatatg aaaggtagca gtaaggctct cttgtatgcc tatacattct atagactctg ctgatatatg taccaattta ctaatatcga aaattttctt tcatgcaaag gctctctgat ggacatttag tgtaagttaa gatttcctaa acagaaaaaa ggagacggct tcatctttac tgcagagcct tggccattga aagtaaaygt tattcatgcc tatagcctag agcagtttca taaagcagca tctgtgccct tttaggaggt gacagcatgt aagtgctaca agttgtggga cataaaaggc cattaaaggg atttatataa atccaatcta cacaggcgct ggttttaact aagtaaagtt ctgtaatttc gtgactaaca catatagaga ataatcattt taaaaatgag tctacaatgg tcaaaatgtg gatattaata tttgagcctg cgtatcttga atatgtcatc gat ca act tg aactctcacc tatatatata agctttgtca cctgggttca acaccacacc acgcttgtct agattacagg tttttttgag tcagtctaaa gagtggagag tagttccttt tttaaagttt agttcactaa attagcttaa acaaataata ttatttttgt gtatgtatgt agtacatatg tactgtacaa acagcataga tatgtgtcca tttttcttat ccattaatrt aaggaattat atraccaagt tcctctagcg cccattattc aggtgaattt aaatatacct acaagcaaac tagcttatga ttcctcctgt tcaggaattt cttgcatcag gtgtgatttg gccacaggtc aatcacatcc agagcaggga ttactcacta gcaagctttt cagggccaag gcccccaaaa ggcttctgga catattagca tagattttct aagtttgacc atttttgcac ttaagcacca aacatttatt catttactgc ttgtttagaa ctatataaca cattatactt aaactaacac atttttatgt tgtattccta atagatggaa cttggtcttg tactcttact aggacttatt ggatgaaatc tattgcctaa caaactaata ttgaaagtac tatatataga cccaggct ga agcaattctt aggctaattt tgaactatgg catgagccat tagtcataca tgcaaaagtt atattagcta ccccaaatgt ttaaggatat aaat ccagaa cttatattta tattacattt gtgtgaatta tatgttcttt tacatatgtt actatgcata aaaattttaa atattatgat ataattatat tccagtttca aaagaaccat acggtatgtg ttgacaraga ttgtatccat gttgactcaa acatattgaa aaaaactcaa 211380 211440 211500 211560 211620 211680 211740 211800 211860 211920 211980 212040 212100 212160 212220 212280 212340 212400 212460 212520 212580 212640 212700 212760 212820 212880 212940 213000 213060 213120 213180 213240 213300 213360 213420 213480 213540 213600 213660 213720 213780 213840 213900 213960 214020 214080 214140 214200 214260 214320 214380 214440 214500 214560 214620 214680 214740 214800 214860 214920 214980 215040 215100 W0005851 0 ft tItwwwg etthe patent.co mtLogn.d og/$exam. .supportFetrhDefa uIt. d ofOU5851 O.Cpc?fromCache= 1 part=maintoolbar--bottoml Page 466 of 737 WO 00/58510 PCTIBOO/00435 aaacaaaacc ttaattattt acataggaga gg'agggcttt tacaaagctg agaagtggaa taacgcattg gcaagtaact tatagcatca agaagacttc gaagrattaa tcatctgtgt ttaaaacttg gtgcatagaa cctaaaaaca agtcagtttt ttgctttacc gaaattattt aatttataga tagaaattat atgtatcaga tttggataaa cttcacagga gtatgtgtaa tttgattacc tcataaaaat cacgtgttat cagactacat tttggtagaa ggtccacatt atagtttctt agatcyrgtc catcacmttt aggggttata aactgccaca aattgtrgga taaacaagtc gggagaagcc tctctgcaaa acctgatgtg caggtgagga attttggagc atattaaact catttataaa taatagagtt tgtaatgcaa agcatgactg gaagaaatta aaaagtatct tggggactcc gatcctaacc cagtggagta caaaagcgaa tggaatattt atatatacgt tacccaataa agaacgggat gagttatctt atgtgaggag cagaaggcag attagttgcc tcccaaaata tccattagtt aaaccaaatg aaataacaaa gagtcttatg gtgttaagca agagagatta cttgatcaca attttgagcc tatttaaytt cat tctcagt acttcatatc ctgaaattca tgt ttgacag aagcacawt t atggcatttt aggaaacaaa gcttctgagt ttactagaca tctctttttg aaaaataaaa aaaagtaggg tacataaatc ttaatatact cttttgaatt ctttcaataa tatggtatta tatatttcat cagctgggtc tgtcatcaga gttatttcct cgttctagag gccatgaaga tcagttggcc cccatgttcc caaatgtgtg actacatatt attgcctgag tagcttactg atttgacttg acaattcctg aacacagaat aactgaaaca aggaattcaa tgacatccat agccagctca aatcacaccg taggtgtgtt tgttgtgtgt atcttgatgg tctcagtttg atattgagga taatccttta agcagggttt t t tgtt ct gg tgaaataatt aagatgttat tgtaccaatt gaaaaagatt ttcataaaat aatgttttca gcaggttggg agaaatatat cagctgttta ctgccttttt aaaacctgat tatgaggaag taaactaatg ctgtgaatac tgacagttga ggaagtcact cagcagcatg gagtctcaga actaagtaag tacacgacat tcccaagatg tcacgggtag aataaaaaga atcacttact acaataataa aggtattkta ctgagttatt ttaataacct gtaatgcttc aagggtccat cataaatcca tga ata ttt t tccgttgttt taatttagtg gtttatatca aaaaatattc ccagacacag aggattggct tgtggttgca gctgcctgcg cttttccaac aggtcttgtg attggttaga accaccaaga tggatataat aattgaggac agaaagtttt tctttgaggg gaatatgatc gctttgaaat ctggggttaa attcaggcag cttacatgca gatgttactt tcctgtaagt cacactgttt cccattatcc ctttcaagtt agagattacc cattttcttc gaaggctaga tattgtgctt aaaataatgg gtaaagcaaa gtgcctgagg acaaatagca ataatcacgt tagatactgt tgttaatcaa ggttggagga ctattgactt cagtgattga cccctgttaa ggcccaaact aaaggcattc ataatgaata tttgttccat ccaagattac tctaaagact tgaatttatt tacatccaaa ctatctataa ttcattcttt aggcatcttg ataaatcata garattctcc gaccagagar gaaaactttt aaataaactt attttttgaa taggacataa cattattagt caatagtatt taacaatggc cccacataaa gttttactga atgaaatatt ttgtgtaaca ataaaaatat agtccgtcag gggaagaatc tgactggtct gtcyttagag atggctgctt aaaggtaacc agtcccagct agtcaagatt t tcaaagaaa gttcatctgc aaaaaatggg gaaaaataat taacagaaaa gagtaaattt gtatcttttg ctggcttcag aatgttactc ccaaccaaca actacccaca gtctctcctg ttagtaaata ccaccccaaa atcagagtat ataggattct gaataaaatt cttgaatcat gttagaggcc acagataatt t tgaacaaaa ttgtgtgtac taataatttg gttatttcct tgctgacaag cagacaaatg tttacatttt taagttcccg aaatctgaag tgtaaagtgt tagtgaatct tgttcggagg ttaaacgcca acaatgagaa caacatttga cctatcagga taaaaataaa tgatacaatt ctttctattt gctgaggtga tcactaacaa cagtcacaca ttgcaaatac ttttttaatt atgggttctt ggaaagtgaa gaaatacata attctcccta gattgaaaat aaagggagac ttcactaact ttatgacagc accaaacaag aatcttcata aattttataa aktccagtga tgctt ccaaa ttttgctggt gcctcatagk acttcttcaa tcatcacykg cctgcccaca atgtgggtca gactgtgaaa aatgcctgtm tttgtatgac ttaaaaatac gcccagcaga aattattaaa cagggtcaca acctcatgct tctctatcag aatttcctgg gtatccgggc gtgaatcgtt atgtagtgcc cagtcaagcc ttgaaacaag aaggtctaat aaatatgttt tgtcacacta tctgtggagg gcgtttttaa agataaatag atgtcctcta atttgcttca tctggaaagt aatattacac aagaagacca tagaagtacc tgcttttaag ctgtcacatt attttcttgg gctttaaatt gtttgtatgt ccttagactc agtaagagat ccctggtctc taaatgaaat tgccctcatt ccattgaggc gttttttcta gatatgcaaa aagtcagttg ggccaggtgg aatcccatca tttaatagaa ttaacttttt ttataaatca tttccagagg aaactatagt gtaatgttac atcattacta attcaaaaaa tcacaaagca aggagagkat aaaatataat aacatattac agatgttggc ctcattcagc tgtagttgca caaggaactc gcctgtaagg agtcaagtgt ttcaagggta cttagggtct aagcataaag aggcttacat tttacttatt agatatactc cctgattcaa cctaattttt cagctaaaga attaaacctg gaaaataacg acacactaag tctaccacat aattcatcag ttgtgcatag atgttgattg attgtatcct gacttggcct ttcacttttc gtaatctctt aatacagtag gctctttgaa ttacagtcat ttataaaatc ttcatctttt acaatggtgc ttaaaaaaca gattgaaatt tctgttagct cttattcaca gaagtagcat 215160 215220 215280 215340 215400 215460 215520 215580 215640 215700 215760 215820 215880 215940 216000 216060 216120 216180 216240 216300 216360 216420 216480 216540 216600 216660 216720 216780 216840 216900 216960 217020 217080 217140 217200 217260 217320 217380 217440 217500 217560 217620 217680 217740 217800 217860 217920 217980 218040 218100 218160 218220 218280 218340 218400 218460 218520 218580 218640 218700 218760 218820 218880 W0005851 0 jt~ p~rmale 1ormanolrbtomPge 467 of 737 WO 00/58510 PCTJIBOOIOO435 gatcagctaa aatctcaaag atcagaaatg tctataaata ataaaacttt tagttttcac tgcaaaccgt cttaacacat gatttctaaa cttacagagc tgctccatca cttagtacag tggggagcag aattgcatat tctaccctct ttaccctaat aggttaccca aaatagaagc atctcagcac gctgggccaa gttgtggatg tgggaggcag gagtgaaact agacct ggaa ttattcatga aggtcaacgg tggagaggtt caggtgggtt agcaagggtg atgaagaaaa gacagcat cc ccaatttgct aagcacgata ggatgggagt aaaataacag ctctaaagac gcaatccatg tatgtcttca caaggacccc tctgcaaata aatatatctt gataagggtt tcaacaggac ccaggtttct agtggtgggt tttttatgtg ttgagttgga agtagataac acattaaaca agactaaccc atggttttag atcccaacaa atatttctat aaaggcatcc actatataaa aggtttcaaa ca atat gta a cagataaatc aaaaattaat atattcttaa gctacattgt ttacagctgt ttattagcat tgttcctgcc aaatggcttt ttgaaataaa ttttatgttt tattttaaaa ttcaaataat tttttttttt ttaggtatat atgtaaattc acagaactca tcagaatatt aacaacagca aagccagtcc atgtgagact gctggctttc tcctgaccac tggaattgtt tgtacgaaaa tatgggatgc catggtgaaa cctgtaatcc aggttgcagt ctgtctcaaa actgagagcg tacaaatcaa ggtgagagag tctctgaggc tggggaaaaa attagaatac gggt ggagag ttaaaataat tttttacaag ccaggtggca ggatttgttt aaatctattc t ttaggggaa gagctccttg ccttctcttc agtcataatg tcctatttct tcttggggat agtggaaaga ttcatgatta tccagatgat tgagcatggg gagctgtaga gagataagtg tttcctcaac ttttaaagaa tgccataaga agacaaaaaa ttgcctgaga ttaatttgat aaattgtata taactatgaa attcaaattt ttgaatttta tgacaaaatt gattacctaa gatgtcagtt ggaaattgac aacacttttc taagatagac agattcaaag ttaaatgttg tatcaggcaa agcccaaaca tagtatgtag gattatttac tctttttttc tttgtaggaa caaagacagg gatgctctta attatatgat aaagcctggg atttgactga ccgggtattt acgggttctc tgtaatccaa tggaaatgta tagtcaatac cgaagtgggc cctcatcttt cagctactcg gagccgagat agaaaaaaaa ttcatgaatg gcaaataagc ccacccagaa agtggcatct agtattccaa tt tgatgaag cagattattg aaggagccac atcactctga cataggagct cctaggctgc tstcccagtt aatctgttca cttgttggaa tccgtgtatg gaatagagcc aaataaggtc atagtttaac aaccatgtaa agtctgagtt gatgccattt ttcatttttt tttggtggtt tgggagtcat cagataatgt caatgtggac aaaaacaaac catcaggcag ttacctaagt attgaaattt ggaggaaata acatacaaaa aatatataac aaaaattgta tgtgaaagtt ataaatgcag gtccccaaat aagctgaatt taaaagaaca aaatcaatag 166 catgtcccca cctgttgaca ttatagaaac aaagaaggca tatattttca tctattccct tttttcctgt caaagggaaa gaatgttaaa taaagataca ttagatcact gaaggagagg tttggttcgt tcaaaaccag tgttctctct taatctaagg gacctgtaat tgaggccagg agatcactgg agtaaaaaat ggaggctggg tgcgccattg aaaaagaaag ctgcatccaa acactctgtt acagacacac gaagaatata ggagaggggc tgaaaaaaac aggtccattt taaaagtttg cttctgcctg *gaagtrgctc tacaacagag tgggatggag atgtccttct tatcactcca tctgcctctg actctaatga atattcatag cccaaacagg aggttttaaa tagggatgga gttgagacac tgacatgcca aaaaatgcct ttctattcaa ttagtcagaa tatttcagac cgtcaagaaa ccaaggacag tcaggtaaaa gcattcatag aactggtttt aggtataaga at taaaatca cttataatag tcacacagt t aaagatacat tcatctatag taaaattcct aaactgggaa gataaaatag ggggtggcaa t tggt cact c aggactttga tttggaattc aaattggtta ctagcattag aatagtttta aggtatcagg agtgtt tgcc ggataaatca tttttaaaaa agtgcaccat gtgcaaaata ctggcaaaat ccttttcctc ttttaggatt ggagagggga taccgtggct aggtcaggag acaaaaatta gcaggagaat cactccagcc aaagaaaata agaatatttt gttcacatat aattttgtta cagatgttaa agggtgtagg actccaatga agatcatgtt aagaagggca gagtagcata ttgtcaaaat aactgtgaat gtttcagcag cttagcttcc tcatcacggt tacctcttct cc tcat tt ta gtattgcaga ggat tat tga atatattttt agcagagtcg aaaatccaac agtttgatct ttggaattca attatcatca kagaagaaac taatatgaac cagacaggac aaaaataagc gacaatattg tagtaagrca atctgtagac gctaatgcat cttgatacaa caaaaaatat aaaaatagaa ttttaatggg cttccctgtt atgtaaacgc taagtatatt aaagtaaaaa aagtattcaa 218940 catttgctgt 219000 tgatcaattt 219060 actattttgt 219120 attaattttc 219180 attattttct 219240 gagtttctgc 219300 gagaggaaat 219360 agtcctgttt 219420 catcatttcc 219480 agaacatggm 219540 gaggagtcaa 219600 attgctaaat 219660 tgtgttattc 219720 cattctcctc 219780 tggatgacta 219840 gaaaatgaag 219900 catgcctgta 219960 tttgagacca 220020 tccaggcttg 220080 cgcttgaacc 220140 tgggcaacaa 220200 gtcgatactg 220260 gtactacgtc 220320 gacactatat 220380 tcagatattc 220440 ccaaatgaag 220500 acaactaaag 220560 gtgagcgcgt 220620 ttagatcctg 220680 atgacatgtt 220740 taaagggact 220800 aaggtgatgg 220860 ggagtagctt 220920 gacatgctct 220980 agtgttgctg 221040 gttcttcctg 221100 cctcttccaa 221160 actgattaca 221220 ttaagactgc 221280 aaggaagtga 221340 ggtggtagac 221400 tggttgactt 221460 ggatcaagta 221520 gtctgtgaaa 221580 aatgagagat 221640 aagctatgca 221700 cttgacatca 221760 aaaaaggacc 221820 atttgaaacg 221880 aaatacattg 221940 tctgctttca 222000 gcaataaata 222060 aatatcataa 222120 gattttagtg 222180 gagcaaagaa 222240 aaaatatttc 222300 aacactaagg 222360 ttggaagata 222420 atcccagcaa 222480 aaaagaattg 222540 tttaagacag 222600 aaaaatagac 222660 W0005851 0 [http:twww.getthepatent.com/Login.dog/Sexam.support/Fetch/Defauit.doPNO005851 O.cpc?fromCache= 1 part=maintoolbar--bottoil Page 468 of 737 WO 00/58510 PCT/IB00100435 ctatacatat'atggacaact gcaatatcat attttcaaca aatctttgat ccatatttaa tttaactata aaattcatgg taaagatgta ttagatgcaa ctggacttca taaaaattaa gcttctgctc tttaaaaatc agaaaagatt tacaaaggtt cctcaatgtt caataagaga aaaaaaatgg gtagagaata aatgcaaatg aaagcataac aatgctgacc atatcaagtg ctgtaggaat gcaaaatggt ataaagggtg atctatccaa tggaagtaaa agcatatctt cagcagctga aacctggaaa aaactgtgat gcagtggaat taaaagaatc caaacaaaat taaatgcaaa ctaatacaca agagggaaag gggtagataa gagaataata ggtttgtggt taaaaactta tccaattata tgtaaagttg attttaaaaa aaaaactggc caggagcagt aggcagatca cgaggttagg ctactaaaaa tacaaaaagt gaggctgagg caggagaatt gcaccactgc actccagctt aaaaaactta caccaaggtc gagtgataga gaataagaaa ccttcctcat gctacttaga tcagaagtaa cattatggac gaaagtaggt tgactgagaa tccctaccca tatctcatct ccctgggagg taactgaatc ataagtctca tgagatctaa cttgactgct gccatataag ccttctcagc catgtggaaa ctttattagc agtgtgagaa cttctaaggg aagagaggag cttgttatta agatatcaga gagagagaaa atttgaatca aggtttgata gaggaatgag ctggatccta agggtgggat gatcttggca gcaaggatgt taatgaataa aaacatatat ttagtttaga ccagagtccc ttcacctgtg gtactgtgaa gtgggatgat aatggcatgt gttcaactat tttcacaggt gctattataa agcaaaatga aatactaaga agaaaagtat agaacttgct caaagaggag ctggattatg gaaataccca tgtttccaga agactttggc cgtgggcagg tgccgtctca atgtgtttct ctccttctta gaactccact ttttggactc ttactcctta gatcttggtc tgccaggatc tccagcttrc agccaattct cctaacaaat tctatctatg tatctatcca tattggttct atctgtctgg gattttggcc aatgaygttg aatttaactc aagaaaacat cagaacaaaa acaatcgcaa attattaaga atatctaata aaaaaaataa tgcatatgag aagatagcac ttggtgagaa taaattactt ctactattag cattataaga caactctaat acgactcaac agagcaaaca atgaaaaaaa agaaaagagg aaacattacc cattttaaat aagttcctat ggctcatgc agtttgacac agccagacgt gcttgtacct gggtgacaga aaagcagagg tgagagctcc agttaaaaaa taatgaaaag atgatgaaat tgaattgtag atgggggcag tggttttata tccctttgct tgtgagtcaa cagactaata agtagagaga gcctagaaca atagtttgtt ttttcctcat attaagggag ctgccaagat gaaatagcca tgragttata caatgacaga tcaccataga cctgacactg aaaaacacaa tgttggaaat gctggtttag gagaactggt atctgcgtca tcagctgatg gggctggaac taggtattac tgagagttac agatggcttg gctatctatc tccatccatc agaaccctaa 167 aaggggcaaa gaacatctgg aagttgaatt atgagactaa catgatccat caacaaaaaa aaattaaaag taagatttgt aaatgagcaa aagatgctca tgccctcttt tatggagaaa tgaaaaacaa atctattcaa cttctacaca gcccrtcaac gaagatgaga ctgtgccatc ttacttattt agagattaaa gtggtaatgt atgtacagtt ttccaagttc tgtaatccca cagcctgaac ggtggtgggc gggaggcgga gtgagactcc agctggcaaa cacggaagct aaaaatgaga gaatttagtt agaggtagca tttccacaat gtctttcctg agggggaatt cttccttcat ttaaacct ct cagcaagtat gagagattgt tatttaaata tccactacca tggagagata tctgtttttt ttaagggttt cttcagagag ggggtttgaa accaagttaa cttcttggga ggttttgaat tggcccaatt ggaaatccac atgctgtgat aaagcatcat gt ggactgag gcccagat gg ttactcttca actagcaccc accattggct tctggaggct tatctatcta catctatgta tacagatgcc ggaaacttgt gtattcatta atagatgttg cagtgtcaat gcaagaataa taacaaagaa acaattctcc atccagaaag aagctttagc atatcattag tttaaaagtc ctagaacact taatgaagca ttgatctagg aattatcaca agaggaatgg ctaaaaataa ctgtttatac gagaactggg aggagcataa ttttagggta tagtgtgtca acaatttcat gcactttgag aacatggtga acctgtaatt ggttgcagtg atctcaaaga agagactgag aagggcagga gt taaa aaag aaataaggca agtaatatgg cccacgtatc tgctgttctt tttctacaca cttctgccat ttcctttgtc aaaaaacatt tagctgaagg ct ga tga gaa cagaaaagga agagcagatg atggctttta ggacaggagg tggggcagac ttcaaatcct gaccccaaat gtaataaatg aaattgtgcc aatatgtttc attactagat aattttagat ttttggtgtt tgaggaagat aataagatag ttccctgctc cacttcccat tccagggcca tttcagtctc tctatctatc tctattatct agcaaaccaa tgggagaata caaaacggtt gtgtaaaatc tagcgttaag atgtgataaa atgaaaaaga atggtacaca tataaagaaa agaccactga tcat taggaa taaaactaaa catatcctgt gattccttaa tatttaccca tctttactta atggataaag ttatactgag cttactccag gagaggaagg gaaaacct ca tattcacatg gttatgcctc ttgaactctt gagcagaagc aaccctgtct cctgttccag agccgtgatc aaaaaaaaaa aaaaagagca accacacagt gccattcgtt tgagacaaaa tttggctgtg at gggaggga gtgatagtga ggctctctct aattgtaagg tcaggtatgt aaatgtttgt gtaaagtatt ggatacaagg tgagatccag ggtttgaatg ttttctcttt atcatagttt agtatgtgtt agctcctcca cttctttaaa aaatacttta caggactatt caaggagttc taacatgtgg gtcaaatgga tctgcgagga ccctccttac aggaaggaat ttggacaaca agccgagttc cactactcca tataatcacg tatctatcta atatctatcc aaccaagtgg 222720 222780 222840 222900 222960 223020 223080 223140 223200 223260 223320 223380 223440 223500 223560 223620 223680 223740 223800 223860 223920 223980 224040 224100 224160 224220 224280 224340 224400 224460 224520 224580 224640 224700 224760 224820 224880 224940 225000 225060 225120 225180 225240 225300 225360 225420 225480 225540 225600 225660 225720 225780 225840 225900 225960 226020 226080 226140 226200 226260 226320 226380 226440 W0005851 0 Dittp:/Mww.getthepatent.com/Login.dog/exam.suportFetch/efaut.doNVOOu585l o.cpc?tromCache=l1 art=maintoolbar--bottom] Page -469 of 737 WO 00/58510 PCTIiBOOIOO435 caaatgtcta tgtaaaattc acagctcatt ctccaaaaga cagggaattt tactaaaatg ttctgaccta taaagaagay cttgactcca gtcctakgcc aaaattcacg tccagaaccc agatgaggta gaagaggagc atgtgcctgt agcctggcac ccctccagaa tagtgtatta gtcaggaaat taatgtttkt ttgaaaaaac acctcaaatg taaagagata ctaagtatat atgaattgat tgggttagtt tgctayttgc actgtcargg tccgccatta ataaagcaag gcagagaagg aaaccctatg cctttctctt aaagtacaaa agcactcctc agtaaaccac gaatctgaag acaatcattt ttaaaatttc gaccaagaaa tgcacagtag aaagtcttaa aatgttcaag aaaaactatg atctcacaaa tgtttggctc tcctttctgg atgcaccaac tggttggtct gattacaagc tatgtgactg cagaagtaaa tctatctgat tgggaaaaac tsatttccat gcctgattga aaagtaagag agaaagttgc tatgaaaacg gggctctgta tgaggcaggg tactctaact tggccccaaa ccattgacat catgtaatac tcactaccac ctaaaatcat taatcttact ataaatacta ttttattttc atcagagaaa actgtattgc ccttcttcta aaagtagtct cagaatgtgc atactagagt agagccacag cagccaagga agattctctg ctatgagaca tgtcagccct atagatcaca tgctctttcg caagaaacaa gaaagatggg aagataaatg gttagtgccc gagataatca tggctaaaaa caggcatggg aacatagact aaawaaaatt ataaatcaat ttcyagtcta ccccaaaat g tggaatttta tgggtgagta gataccaat t acaat tgcag aaaaggtttt ttcattgaag ttataggctg ccaaatatat agatcttttg acataacaag acatagaatc tgcctatttt tcatgttttt tgtcacccag gttcaaggga atatctggct tgaactcctg atgagccact gcatttgtgt tcactaatta agactgcact aagcaccaag ctgttggagg aagatgtaag aagagtgacg tgaggattcc ctcatgggtg gggggtgaag actggaatcg caatcatatg tttcatgccc tcctctcct t acaagccaga aatctaccat cagtttttac atttcaattt tgtgttatta aggggtactt atgtcttcca aatgaaaaat aattccaaga ctactggttt ccttatttgg agagtgggct ggaatggtga aggtggcgca tccagtggga ataaattgcc aaaaagctaa gacaataatg gtctctccta tacgaacaga ggctgtgttc gtcctgtgca agtgaatagt atctgtgaga ttgaagatca tattggtgtt cttggaattt atttttaatt tggtttaaaa aatgtaggca tgtaatcaag tataagcccc tgcatctgct gactattgaa aaatcctcta t tagaaaagt tgcagctgta ctttggctta ttcatagtat aaaaatattt ttaaataaat atgccttttg taggaattaa ctgtcatatg gctggacwgc tcctccctcc aatttttwaa ggctcaagca atgcctggtt aggattattt atctgcaccg gmaggtragg actgaccttc tctcagcttc csaccaggtt ttgttcttcc tcagaacaat ctgacaggag gaactgtgct tgctgagact ccttgggtat tat ttat agc ccttaatgac aaaggtaaaa tattcaaata ttagaagaaa ataagatgtg aatattttgt ttagataaag attgatttat aat tt tt t ta gtctatgtga aaatggtgtc aaatagggtc ctacatccaa ccatgtgaag ttgccggcca accagcctgt taaaactgtt tacaaagccc ataggacctt twtgctttta aacaaagcta taaaaggtga ccactgaatt tgttgaatga caaaaagcaa cccatttttt tggcataatg agaagaaggg gcaatacagt tatctttcac act ggagact tctattcttg taagaaaagc c tgt tcagt t tgcgtactaa attaaagaaa acat ctgtat ttgttagatg aaataattgc taactatcat taaatgatag tt t taat gaa gaaatgactc attgctctgg taaatttttt agtgctgtga tcagcttccc ttctttgtag gtycycctac agtttctaat t tataaccaa gaggaagtat tgtcacagcc cagatccaag tgacataaag agagggagaa actagcttgt ttacagagat cccctggtgg tgacaccaat caaacgtttt aaggaaatta catt cat caa tcttagkaac tattgtatct ctgatttaga aagaaatgaa actggctgaa cattgaaaaa gagtttataa cttgctttgt aatggcagag actctttcta ccctcaaaat attgtggatg tattgctggt acagaggtag ccatcaggaa gtgttaattt ttaagccact tagagaattt ctagcattct ttgtgattgg tgtacttgtt ggagaaattt ctgagaactc atggatgaat cacaaatgag cagccaagta aaatagcaaa gcatgggaca tggagtcaag actacmcttc cccttttcct aacagaaaag tgctattgtc ggaaaattag gggaagcttc cacaccataa aaggtacatt ttgttctaag ctaactggat tacagagt gt attctatttt attttacaag tcatgatatt tagataccyg aaatgtttta tctcggctca aagaagctgg agatggcwtc tttggccttc ttttacattc tatgtwttag aatttaggga t traa rmrcc gtctggtakc gcctgcttta ctacaggagg ggctactaac aactgtaagc stggtgggtt caatgggagc gagttagagt ggaataattg atttagaatg caaaaacaca gctagttcac aaatgacagc attttaatga tattgttatg tgacctatta aggcttctgc ttctgagcat actctgattt tgagtttctt ttatgtcatt tacttagtta gtctttctag agattgactg gtcggagaga cagacttcta cagtttgcaa caataaaggt tacacttctg caaaaatccc ttgggaagca atagcgaaga tgaacaaaac caacaaataa tagacaagag ggcaggcatc acaaagtcct aatcagagtc atgctcagaa catggaaggt atattccttt aacacagtgc ctagtttgta tacaggtt tc tgtacagacc tcttcctggt tgtgtaaaaa aaaactcagc ggtcacaaat taaataatac ggtttgaggc tgaaataatt ctattatttt ataaatatct gtttataggt ctgaatactc gactacagrc taggtttccc caaagtatgg agt tyat t tt gtatgtaacc gagtagaaac tcagtgactt argayggttt tacaaaatga cagacaggag aaatttcatc tgcagagggc gggaatacag ctggagaaac actcaccagg gaactgtggc aggtaaagga 226500 226560 226620 226680 226740 226800 226860 226920 226980 227040 227100 227160 227220 227280 227340 227400 227460 227520 227580 227640 227700 227760 227820 227880 227940 228000 228060 228120 228180 228240 228300 228360 228420 228480 228540 228600 228660 228720 228780 228840 228900 228960 229020 229080 229140 229200 229260 229320 229380 229440 229500 229560 229620 229680 229740 229800 229860 229920 229980 230040 230100 230160 230220 W0005851 0 [httfl:/twww.getthe patent. com/Log in.dog/Sexa m.su portFetiDefa ut. d ogIO00 5 8 5 1 0.cpc?from Cache= 1 part= ma intoolba r--bottom] Page 470 of 737 WO 00/58510 PCTIIBOO/00435 aggattcttt caoogagagg tttttttktt gcttttttgt agctaattat groatt tgga tgagaaattc gttcaagttt ttaaaatgtc taaaatttta tttaatagtc tgcattoata aaatgtgaat attooaataa atat taaaok aatattcttc aaatacagcc cattacagca tctgtggtca cctctgacaa aagatccttt tccacttgag gaacagttta tgccctccaa agtggataya gtttctaagg ctttacctca atgacagtgc tgttcgttca tcttttactt aggacacttg ggcttttctc caatcttaac taaatttatg ccccaaacco tatctgactt tgccctttgc tatgtattac cactoacact aaatcgaaac ttgaaggact attcagtata ataacctagt agtttaaatt tctagcatga aaaggaaagt atttaagtag gaaaatgagt ataaactata caotgtggaa tgacttttoo ttaggaatat aaattatttg ttttaactta cgttaagcot tgaacacata gtagct tggt ttttaagtgt actctcacgt ggcaggctta aacattatca gatgatatga aacaaaattc ttattatytt gagaattagg ttttacasat tgttgttttt tgtatcttta aatgacttto cagtgcctgg cagatgagaa tctgaaagag ataaactaat ctctcoota aaaatttagt aattgaagcc agacactacc ttttaaataa accytaaatc tttgattaat tgccatggaa agttoctctc grgaaccatt cctgaattaa ctatcttttg ataaagcttt ggctctgoat t taaat raga ctgacttcac gtgtctcctt aaaytgccat gaacgggaaa tttaaaagtc tgaaaacact oaacttcctc tttttccatt catgtcagat ttaaaotgat tattttaaaa cttgagataa aaatgatcat ttctagtaat aatttctgtc tgggaaacct aataaataat aaataggatg agaacacctg aacttcaoac ttgataagga otttcctkta agaaataac gcctctacta ttactctgca attttctagc ggtaaatgac gttaaacatt atgtttatac aacatgaaaa attaaataat agagottcag tttatattta aggcagtgtg tttttcaoat cccaagatgc ggcctggaaa aagaaaaaot ttaaaataoc cctgtggacc tcatgttttw attototata catgactcta tcctytcakt atgwtcocag tttctttttt tctgaaaaaa atgagaatga tcataaccca gtgcagttct attacacaga aacatcttac aaatgattgg aoccagat ta ttagcggaat tgaaaactta cttttctaaa ttagcaccaa atttaacctc ggaagagaga gtgagatttc tcatggatcc gtgtggttta ttotgctttc ccataaagtg ttagaatcam taoaatctts atgagatttc ccttcaacta tottccccaa ctggagtatt tttgttttag taatttcacc tgoaagt tga ttttgaagaa gttcttaaaa aagoagtgtt ttootatgtg catagtccca ttcattactt tcatagaaat ttatagaatg aatcatacct agttgaataa gtacaaaaag tcttatagaa ctttatagao atagtcctgt tgcttggcta aaatttaaat at tt t agaa tattctaaaa taaaagcatt tatoataaga tactaggggg aaaoacotac aaatttacat atttccctct ttgacaaaga tctgaaaatt actgcatgaa 169 cacctyat tt tccctttttg tggtacaagw amaatacmtc aatttggtct actgaagttg gctaatttct cttctctcat tatatatatt gacctccaa tttaaaaatg tagtttttct catttttcct tttgtcttaa atttcaaatt tttctaattg ttatcaatct ctttgttgct tttgcttaga cactgcaaaa tttagtactc ggtatctggg aagatgaaag aattacgttt agaatgaagg ttatctcact yccagcaaat cttggaatgt tgcttaattt cagaagagga ttctttattt ttcccaattc ttcttgcagc atgcacgttt gtgaaataat tagaacattg gcagaatagt taoacaygca ttgagtaaaa atgcctgcaa ttggcattat ataataataa attcaacacg gtacagtcta acaatatrtt tttagcttoo attaggcago cacgtctaaa agattatagc tgctatgtct tacttttttt agoctoagat caattttaaa aggtaaaaaa at t tagggga ggcaaaaaaa toaaacagt k acacacaaac tgttcctttc caatagcctt tgggtatttt taacaaactt aaaatgtgaa tttayaccca tagtacctca gaacgtttta trggtgmaaa atttaaaaag agagggagaa agacaagtga tggytttcco aatgtggaga taaatattgt tgggtatata ttatgcaaaa got aagt tot atataattga gccttaaaga tttctttatt gagatatttt caaatgtatc ggatot cat a gcttctgtgt ccatttagcc aacaataaca at aa tgtgt a tttgtcatgg cccaggagtc aggggtatgc atctgagaaa ct agaaaaaa cagatt tato atgacatttt ctcaccaaaa caaottgaaa cgatttgttt gctggcttta tgattacgaa tcatttattg gocat tagta cacacacacg tcttttgaaa ttatatggtt tct ca aca ta aagttatcat gataaataaa actctctggc cttgcctaat ttttagagat tctgattgga tttaactttg tcatcagtag ataaatataa gcgtggcaaa aaaacatgaa aaataatatt aatgcaatgt aaaagtccca gatagatagc gaaaataatc acacacacac ccatgttatt ggggttctaa gagggtgatc tcctagtaat gaagccagtg catcataaat taygtaattt taayraaaag ttgttaagaa t ca aaa ya ta ggaaaaaaag gttttgataa acatcgtgar attayttaca ttagagttat tatatgtgtg cacacaaaat gtaaatagat gagtatttcc t toat aaygt ttgccttcat taoottoooa aaacaoagtt aaacgtaaot tootaaggga aootgataaa ottoottttt atgotgatag taaaagooao tggagatotg agottawoat ttottttaaa atgaggtgaa atoaagtttg oaaagootta ttttgaotot agagtaattg oatataattg gtoagtoaat tttgtagoay attaatotat agaoaatato cgoatgoaoa gatgtttago tagatattta toaaagatto ggaaaatttt atatatacat oaggtaagot toottgttoo ggtagagott actotagatt ottoaoaoor gaotaaaaat tttoagtgag otaaagggot agtoaaoatt ttgoaaotga tgyttattot tttaattatg atcagatatt tgggaaaoag acaoaoaoao gttgtgtatg agagagacac oagatttaot ttttataaaa gatactttta 230280 230340 230400 230460 230520 230580 230640 230700 230760 230820 230880 230940 231000 231060 231120 231180 231240 231300 231360 231420 231480 231540 231600 231660 231720 231780 231840 231900 231960 232020 232080 232140 232200 232260 232320 232380 232440 232500 232560 232620 232680 232740 232800 232860 232920 232980 233040 233100 233160 *23 3220 233280 233340 233400 233460 233520 233580 233640 233700 233760 233820 233880 233940 234000 W0005851 0 [http:/&vww. getthe patent.co mLgin.d og/Sexa m.suportFetchefau it. d oNO00585 1 0.cpc?fro mCa che= 1 part= ma intool bar--boto ml Page 4 71 of 737 WO 00/58510 PCTAJBOO/00435 aaaaagtgtt caacatgaag attagcattt agggctgagg tttccaaata ttccttmttc tctatcacat tccattttac atgtcatctg gcttctctct caaaatggca gcctatacca aaatagtcct gggcctttcc gtattttatg atggagtgtg at tact aaat agctattttg cagaaaaatg ccagtt t tac ttctcttatt ccatgtcttt ctttcttatt tttttatatg catatcaaat taccatttat attcggtttg tttaaaaatt aggccaaggg gaaaccctgt aatcccagca catggctaac gtgggcgcct gaggcggagc gt gc cat caa gtgtgcctgt cgcagaggt t gactctgtct gtgtacatgg taccgtctag tgttgtttgg agggcatttt gccagcatgg atatgaggac t tgt tat tcc aagaatataa ttaatccagt ttaggaagat aatcatccaa agtgattctc tgctttggaa ttcagttggt aatttagggc gaatttactt gagtttgtaa gtcccctata aatgtttaaa gtgaatacct tcattattag gaaaaatttg tggttaagac tt tgaattta tatctaatga aaaatggttc tataatctaa agctttctcc aaggtaagag gccgt cctca tgtctccttt cttttaacat ttaatttttc ttgattgaaa ctggatcgga cgaaaaaat t tacttaaata ctcgtccctt tccggtgttg agttcttaga atagtgaatg cacctgacta caactttgta caaagagagt ctgtagatga aatcaagtaa aaatgcctta ttcaagtaag aaaggatgaa ctgtgctaat tcgactctta accaatatta gaatggccag gggcggatca ctctactaag ttttgggagg acgatgaaac gtagtcccag ttgcagtgag aaaagaaaaa agtct cagct gcagtgagcc caaaataatt gtgagctgct cttctataat cat t ttgt ta aaaattatta ctacacagag agtgtgctta ttaagcagtt ctctagtctc aaagaaacat taaccaagta gaaataaaaa tttgcattca agtttggaaa tccccacaca ttttattagt taattatttc aatctgtaaa ataagctcat attttcacca gaaagaaata aaaataaagc caagttgaag agtgtggatg gtgttctgcc gatgataact ctatgtaata tattaaaaag tg.gttaaaag acccaaggac tgccttctct gct gcaacag acatgttggt agaggttttt tatacatctg ctatactttg aactgtggtg acatgtgcat ccctgtgtga accacaaggt tagggt taaa t gggaaaaag gcagagtctt aaattttaaa gtccagtgaa ttttaaattt aatctttgat tcatgttaac tagcaaacac catttcctag atgttatttg tatccttcac ttctctgtat gtgtggtggc cctgaggtca aatacaaaaa ccgaggcggg cccatctgta ctactcggga ctgagatcgt agaaaaaaga gcttgggagg cagatggcac taaaataaac ttattttatg ttataaatat gttggcttaa gccatggggg aaattccagt atacataaca atttttaatc ttcttgcaaa gtccagcctg aaaatccatt actaaaaata atagagactg tatgatgaaa tcacaaaatt gctatgacag agagtaggga ctctcacaac tacttcataa ctggtacatt aaataggatt ccaaataaaa aggagaaaat gtgataagag tagtatgaat ctctcctacc gacaaataat cccagagaag tttaaaatga ataatgatct tccatcyttc tatttaagtg ttaatgactg ggttaagaca tgttttgaga agt cat ttag cct aat tct t agcctttcca stgttgggaa agttttttga taattcctct ttgtgaaaga ccaagatttc aatatgatat aatgctaagg gcctttgaat tcatgttcat ataacctact ttatttgaaa aagccctctt tcctggaact cttgatcaat agtggcttta tcacatcttc ggagttggag aattggccgg cggatcacaa ctaaaaacaa ggttgaggca gtcactgcac aaagaaaaca ctgaggcagg cactgcactc aaataaataa tatgtagaat gtaataaata aaatgagaat t aaaaaagaa t tccccaaaa aagatagctg ttgatagttt aaaaaaaaaa gggacaaaaa agctggaatt gccctcaata agaaaacaca gtaaattaga cagcttgata aaagaaggaa aacgataatt gatgtgaagg aatatatatc atttttgggc ggataatgtg tatgacagag gcagccagga aacataagga attattgaac tgtagaaaat ctctgagcta ttgctttcgt agaagataca ctgtaaatgc tttccttgtt gatatataat tggagcgatt aaattccctc ttaagcccaa ttacagtaaa tgttcctcat aagctccaaa gattcctttt ggggatct ta tactttggcg ctgtgaaatg tctgcctttc aaatgcaatt at tat tgct c tggttgtaac gatacatctg tt ctagacaa tt ctgagccc ggtatcatct ggttcttagt ataaagtgca actcaattat tataatccca accagcctgg gcacggtggc ggtcaggaga aaaattagcc ggagaatggc tcgagcctgg aattagctag agaattgctt cagcctgggc aaatagaata ttctaaaata gtagataatg gataaaaaag aaaggaaagt ctggaaaaga ctatatatta attctggtta aattccaatg aaaagtagat tattgtaaaa tggaataaaa actgtcagaa caattgctag ccattttctt tgctaccaaa ggaaagtagt cagagaaagt cccttcat ct cttacatttt aatttctttt cagaattagt actaacggta aaattctgcc cctatggtat gtagatgcct gataaaagtt aagttccaas tactctgcat ctctgtgcca accgtctctc acatattaac gtaggaat tg agagactcaa acgaagggtg acaaaaatat gaaatggatt cctcacgatg ccctgtcaag agttgtatta tggaaagaga agctgtaaag atcatctttg gactttcttc tgtgaatcga atcttattgt tatgagctta atagsactcc atcaatttat aggtaaactt ccaaatttta tttgccacac caaactgtat gcact ttggg ccaacatggt tcatgcctgt tcaagacc at aggcttggtg atgaacccgg gccacagagc ttgtggtggt gaacccagga aacggagcaa ttttggttgg attgtgcttt ttaatgagtg gcatggtatc gagacaagtt atagcatttt gaaattatgt gatatataac agcaagat ga caaattttgg gccaataaga aaagacat ag tattaaatat aaaaatatcc tttcttgaca aagaccattt ttataacctt atcaaactca atgtgtcaga tgtggatttg acactcattg tttaatacag cacacctagg ctccagctac ggtacttaac tgtctacttc 234060 234120 234180 234240 234300 234360 234420 234480 234540 234600 234660 234720 234780 234840 234900 234960 235020 235080 235140 235200 235260 235320 235380 235440 235500 235560 235620 235680 235740 235800 235860 235920 235980 236040 236100 236160 236220 236280 236340 236400 236460 236520 236580 236640 236700 236760 236820 236880 236940 237000 237060 237120 237180 237240 237300 237360 237420 237480 237540 237600 237660 237720 237780 W0005851 0 http:/www.g ethepa tent. com/L ginqdog/Sexam.suDIport/Fetch/efault.do/WO00S5510.cpc?fromCache~ 1 art=maintoolbar--botom] Page 472 of 737 WO 00/58510 PCTIIBOO/00435 tgcttatata ttaaagtaaa acatttcatg ccaagatctc atattttact catggccatc aggctaagtg tttgcttctc gtcactctca aatataatta gtaatcatca agactgacca atcaatgttt cccaaaaatg tcatagatgt ggtccaaggt agggggatgc gcaggccacg actcagccct taagatgtct actaaatttg gcatgtcaga ttgtctcttt gggctgggtg gcact ccagc aagaattaaa cgcctataga aattcccact aaaaagagat ctgtaagtgt attttcttcc agtattatgt agataaagag tcytttgaaa aaaatatcag atcartggag agccaaatay tt ttataaat ct tactggct actgcaaaat caaacaatta tctgcctgct gcctatgtct gaatatggga ttccacttcc acattgcact gakaatcagc ttgtgaagca atcatataca gcaaaagatc gtatccaatg cagcaaattt tgtagttaat agaagtttgg cattctagac actgttgaag acatcttgtt tttttaggat ytacatattt gtttatagca gtctgatctg ttggctccag acattcrtgg catgctgaaa gattgatttg ttcatgtcta gcttcttttc gt gat tcca c attagaagac gaagaaatta aaattattcc gctaacattt tcctctttaa atcttggtca tctgcacctt taattatgct tccagttctt aattaatgtt agtcacaggc tggaagaaga agccaaggca ggagcctcca gtcagcctga tgcttatttg ttttaagtta gaaaaaaaaa ttgtggctga ctgggcaaca cgttgacaga tatttaaaag tcacaaaaat atcgatctct gaatggttgc tgtatcttac agctttacca taacatacca acctatgaag tcgtgttcag catataacat gtcttatttt tgctcagtca ctcaaacctt aagcacaaag gcacaggcag gtggattaaa cctcctcatt gaaagtaagg tgtctccagg gaggccrcca acccatcagc gagatgagac ctagtaagct atcagaacac actactcaca taagaaayga ctctttgtaa ttctttaaat atgaaagaaw tt tggtt t tt caggtttcta atatatytgt tgccaggaga tccaaatgag gcctgagggc gccacaataa gaatatgagg catactgatg ataaaaaata tttacagcta atgtctggct aaaccagaga aataagcttg acatactgca acmaggcat t gtaatttttt taaaagtaaa g aa at taaa a tgaggcaaaa at caagggct aatcctgaaa aacgaccggg atctttataa gtggtcagag tgcaggaggc gaaggcatgc tgagaactat ttatagcagt tctgctatag aaaaaaaaaa cacctgtaat tagtgagacc ttattaagtg ttgatccagg aaatcatgga tcataagtta taacactcca aaattaattg ca gt t ttat c atagagttta tagattttac attcctttat gtatggttta tttattttta tacagttggt tgctttttaa ttatcccagt atggagtgag gattcaaact aacatgagtg ctgaaccata aacattcacc tgctgtaaaa ttttccagca ct cctgccat tttactttaa tgccatgcag cacacattac aaatgttatt atggtaaaat gaaagaagtt gttgaagaca tgtggatact tgtttttaaa atatctgtgt gactggataa caattgctga aacactctta agagccctga atgacttgtg tctgctgtct tgcacttgga acaagactag tctccctgtt caaatctctg ttttcctt~c tgcctttcaa gattagactt aattgttgtt taaaattact gtaagatgag taaaattcag gtggtaggca acctgtggaa aggtggagag tcagtgaagg aagcaacatt ct ccagaagc agccctgccc gaaataatga gatagaaaac tttagaaaag ggatcacctt cctagcactt ctgtctccag aggcactgtg ttttcacttg ttgagggaaa tatatgtttt gaaaccaaga aagtttgtct taacttctag gagagttttc ccaatgtata accctgcaga gcactttcat tagatgaaga aaatagctga aaatctccaa tctacacagt ggggaggtgg ctttgatcct atccttggct tactgggctc ctgggagctc aaccccaagc ttttgggt~c gccctttcca gccactaatt gagctgataa ttgcttcact cgtgggaaat attaaattat tgggtctttt aagaatgttg ctgcatatag atgataactt gaactaagga tgtaagtctt catacctagk ctgagtgtgt tgattctctg atcttcagga t ct taat tt t aaaattattc cacgcaaata tacccacaat aagggaatag aacattctta tgaaaattgt tttaaattca aaagagaatc tgggtagcca catctaaact tttaggaaaa gaaacttctt tcttgtgtaa tgacctcggt tctccctgct gctgactcya tggggcaggc attccttgct atgtgcttgt taagacaagg cccanagaag ctaggggatt ggggaggccg aaaaaaaaaa tgagacctag aaagcagaac aatttacttg acaaggttgc ggtacatttt acgcttgaaa aagaatttaa agatttgctc tctggatcta agaragaaag atttttaatc tattgaggtt cagragagtt actagcgcct gctaaacaaa tttataacaa cctcccaggg aggttctcct aggct tccaa tgtgctgcca tacctacctg tcccagctaa aatcctggac tggggtgtag acttgctcac ctactttctg taactcaaga tgtgagtcat gyggatactc aagaaatata acattctaga gacacgccta aaattcagga tatatttttc ggatttctct tcctaggcac agcaggccca cttagataga acactaattt tgctattccc gatatatgct tattttcata tgttccaagg gctttgttga ttctaattat tttcatatct tat taat tga acatattcaa tggcactcaa ccttatgaaa tgctccaccc caaagggact tatcctggtg gtgcttagag aagacagagg aagagaatgg tttagccagg ttttttcacc ctatatcttg gagctgcaat aaacattaat aggcgctgct aaaaaagaaa cttgggtttg tactgcctta tttgctttat actgtttgaa aactggaaaa atatgtcaaa attcatataa agaagaatgc aaaattaaag aataagcaac ttaactattc tgcatttttt cactccaggt ctccctttta ttcctgtgag tggaaagctg ataggtgagg t tgactgaca ccctgacatg tgcaaatgtc aaaagctgga atcatcrgca caacagaatc ctcttttgca tsttatgtat gctttccatt tcaatattgt ttttatttaa tgcatataga gacatgaaag ctggagtgat ccaatgccaa atgattaaac acaacttcaa gcaggttcaa tccttggcag acttccattc ctctttcagt 237840 237900 237960 238020 238080 238140 238200 238260 238320 238380 238440 238500 238560 238620 238680 238740 238800 238860 238920 238980 239040 239100 239160 239220 239280 239340 239400 239460 239520 239580 239640 239700 239760 239820 239880 239940 240000 240060 240120 240180 240240 240300 240360 240420 240480 240540 240600 240660 240720 240780 240840 240900 240960 241020 241080 241140 241200 241260 241320 241380 241440 241500 241560 W000 5851 0.[httiltwww. etthe patentcomf~o in.do /$exam. su pporIFetch/Defa uIt.dog/WO00585 1 0.cpc?fromC ache= 1 part= m aintoolba r--bottom] Page 4 73 of 7 37 WO 00/58510 PCTIiBOO/00435 tggtgtaggg tctgtgcagg tggas tctcc cttactcagg aatttttcac rtgatagcat tatccaatat tagttcctca catgt tggac agtccacctc tcagagcagt agagaacttt tcaggaactt accactcatt t kcagacact acattccatg aggaagtttt tgtttgcttg tttattgagt agcacaatta taatgaatca taattttaag ctagacaatg aaaattaata ttaaatgtat aaagaataaa acccagaaat aaccaaaaat ctttttcttt caataaagaa atataatttt aaattagatc ttaggatctt tcaaagtcca tctgggaatt ttaactaaca gttaatgtta aagcagataa aattttatgc aaaaaaatgc agtttttttt tttgcaaaaa ttatatattt gaccctgttt ggcattcact tttcctgatc tgaaatattt ttggtgtggg gatgagttca ctgaggaagg ggtatttatt gtagaaatac tgtgcatctt agaaattcag ccagcagtca ttatctgaag acattaaatg attagtattt gtttaagtga tttacttttg atgtattata tgtapactat ttttcttgtg taagctcagc tggcacagga actgagggag grgactgaga aggacatgac cataagataa ggtaacccct gtgccactag agcactgaca tggaaccaat actctgctta aaaggcagct ggtgttctag tat ccattca gaggcactgt tggtgatgca atgaagaata agaatgaact acctgttatt aaacacaata gagtctcgag gtatagccag agaaatcatt atagcttgga ttagataata aataaacaaa tttcaacctc act acgagaa attttggatg aaacatgatt agcctcccac caacttctta ttttggaact ataaaacagt gagccagact ttattaaata acaaatgttg gatattctct aatccccttg catttacaca tttctttcgc caaacgtagt atggaaacat taagtcatat ttttgattca agagtagacg gatctctcct gtcctgatct gacaagaaga aatagtttga cttgaaagac ataccatgac gaagaaaatt agggttttaa aaaaaccagt ttcttgactt ttaaagaaaa tgttaccaac ggaaaaaaaa gcagtgttat aaggttgtat aaatgcagca tgtagggctc tcatctctag cagccagaga gtagacaagg ttttgctcta tgccatagcc ttttgaatat agcaacct aa ccatatttca tagaccattt ccggagtctt atgcttagtt agttcgtagc tggtgacttc gaaagtattt ggggaacaaa gactgtaaaa tttcaaaagg gttcatacaa agcaggctac acatttgtta gttatggtcc aatagagagg aaaatgaagt gaggaaagaa gttacagagg aggacttaaa atgtctaaga gtaggttgtg catgcttttc ttatgccaga ataatccaaa ttacagttaa tgcagtataa aaactggact t t tcaaa t ta aaagcacata aagatgtgtg tgagcatgat gctgtgggct gttgcctaaa ctccttttct ttaaattgta ttgtgtgtgt ttcatttgct ttattaaggc tttaggccac tacccattct tcccagtgac aggtgatgat ggctggagag agtgtaaagt gtgcttcaac ccaaaccctc ataagaagca gaaaagatat ttaaagtcca acataagaaa accaaagaca aaacacgtta ttgctaatca cttctcattt agaccaggtc tccctcccac agacttccca caggcaccta gagaaagcca cacatcataa atgatagggt gaggagagaa ggctacttaa agtactcaat ccattactgc tagggaccta aaaAgacttg aactatgttg tcttttatct cagaagtccc acaaacaaag attcacacac ggtgtggggt agaatcaata tttattaggt gaaattcaaa agagactggt acaccggcat aaatattttg ggtaaattat gacaaaaatg aaagtaagaa gaatgatgat ttcacttgtg ctttttctga aaataagata atatatgtgc agataaaaag aaatactctt aaatatat tc tactatcatt tacacatgca tgtgtgtgtg tggattggaa acacatttat acaaaattga taatgaatgg ccttagttgt tcagaaagtc acactcaaat attattttga ctatctagac agggttttgt ttagcagcac gacaagagag atgtgctacc gtctgaaatt tcgtttcctt attgtgagga attattctag gattaaaact caggcatttt tattataaaa aacagagt at ttattactgc gctaacgcat taagggaata aagtgaaact ctgctacctt cagtggagct aggagtgcac ggtgtccaca aacgtggagg ccctggctaa gaataactct actaattaaa aaccacacac agaaagtcct aaagactgag ct aat ctat a ctggaccttg accatgttca tatgatttac tctcctttct agaaga tact gggagaggtt attcatttgt tgccagagca gacccatgtc gtatttaaaa tcttcctgaa attgagattg aaaagacaat agtaggatct taagaaagaa gctatttagc atgttgtaaa agttctgaga ggaacaattc agcaaattgt aaaacaaggc tcaaaaaaca gtatattagc atttacagaa taacaggaaa tgtgtatgtg atagtagcta tgtgttatac aattatacat cagataatga ctatgaaata catattttgc tgactaaagg ttgattctgc aaatatccca gcatctctaa agtaatttgg cgtcacgggg cccgccactc gcagaagcaa aaaggttaaa gtaatccaat gcaaaaagca gagatgtaaa cccttaagaa aagataatta ttttcaatga tattatccat ggtagtggac ttttaactac tcagtgggcg gactttttag catgcatgam t accagcagg tggagcaggc tcattaatgg t ct ttcaat t agaactgcaa attaaaactt acttggctac cctatttgac gtgctaaatc tagttgatct aaactgtatg cacttttcct caggtgctat cagggatctc ttcatacagt gatgttcagg tccacaaata gggttttctt cactcttgca atcactgaag actcaacaca ttttggcttc taagaatctc gtgataacag gtcaacagta aatatatcca tttataatta catacaaaaa ctcatgctca gggagtttcg tttgtctttt taactcaaca ttgacctaag aaaggaaatg caaaatgaat tgtgtataca tgccagggga aaatatgcca tagtigtttaa aatttaggag caaatacatt attcaagatt cagatacttt t taaggtagt ctwtcctatc gatgatcatc ctgaaatgtt aaattctgcc tttctcaaat agtggttgct gaaagaaaaa atttcaattt aatataaatg aaatagatat aagaataaaa ttcagaaaat ctggaagcca tatt t ttat t ttgatctttt attgtccaat agtctctttc attccctgtt 241620 241680 241740 241800 241860 241920 241980 242040 242100 242160 242220 242280 242340 242400 242460 242520 242580 242640 242700 242760 242820 242880 242940 243000 243060 243120 243180 243240 243300 243360 243420 243480 243540 243600 243660 243720 243780 243840 243900 243960 244020 244080 244140 244200 244260 244320 244380 244440 244500 244560 244620 244680 244740 244800 244860 244920 244980 245040 245100 245160 245220 245280 245340 W0005851 0 [http:/Avww.getthepatent.com/Lo in.dog/$exam.suporJFetch/efaut.dogWO00585 0.cpc?fromCache=l1part=maintoolbar--bottoml Page 474 of 737 WO 00/58510 PCTAJBOO/00435 CCcctggt ct tccttcatta tagattctaa ttgtctatgc atatcgttgt aattaatcac agtgctttag ttcaccacct aatgttacaa tgcccagact aagataggga cataccatct cttctggaat aaggtctgga gttctgaaaa gattaatagt ttgctctgct ggagagtgaa acagttatct tgctgcttat actttttata aaaaaagtaa caaatagtat caagtgatgg tgggggt agt ccagtatttc cctacgccag aatgcacatg aatctttcct aaatagcaac tttctatttt tcctggctga tttattggta tttatactta tctaaaatga aatattgtta aattttgtag caaaatgcat ctgataaatg ataccactct ttttaaataa ttaaaatgtg ttayaaaact tacaacatat tgatcaaaac gggaaaatga taattattct gaagcctttc ctgggcttgg gaacttcttc gtgatgctat agggggaggc cttgcaactc acgcatttcc ctggggggaa aaatatttca caaccaaata ggttttaaaa gcctttggtt gtctgctttt tgatactttt aacacaaaga tctcactgag gtgcttgtat tttttaaatg tattatctta tgatgcaaca acacagattc tcgtaagtgg tgagcatcta tcttcttcca ataacatttt taa gccagcc acattcataa ctccaaatct tgagatttat ggagcctcca tgctgcttta taccattttt tacactgaaa acttagtgaa aaacagaatg aattgcagag aaacataacc ctgaacagca ctcaaaattg aagaggttgg gt ctggagct gcaaatcata gtttggtgcc agtgcacatt acttagaagt aatttttcca ggacatggaa tctcttttac atgcttaaat atatctaatt cttgttcagg ccatgctcat ttgaggagca tttatcataa tagttttatt gtctttatga gtttcagaat tttgtaacaa tataagcaga taagtattta gatttacagg taatagtgaa gaaggaaaga caaataattg tatgggggag aat ggagaga agaagccaac attagaggga tctctcaggt agtagtccag gaagtggggt aagcaggaat tcgtgggaga cactttcatg atcagatagt aatagtagtt ccttgttagt atagtgcagc tatctggaaa aatatacaag gttataatat ctctctgaaa tatgggcagg attcatttct ctagtaattt gccatttctg caaatagact taacgcaata aaatgtgtgg caaatgtaaa ggttttaaag ggaaaagaga ggcacaggca gcaagcacac ttcttctctt tctcctgctg gaaatgattt agtctaaagt gaacattttg ttttaagaga agggattgta at caggttct a agt gaa taa gagcatgatg tgtcacgtca agctctaatt ttcatatata aataaaaaac tttgaagatg actacagatg ttaattcttc aacaaaagtt taacgcttgt gctccttttg ccaataacac ttgaaaatat tttaaaattt tgtttgcttg ctcatcggtt taatacattt gagtcagcac gtttactctg tcccatgcaa tttcaagaac ataattacat cacctacatc ttgatgggat atacaactgt agttcctgag cacgtggcta tttagtgtgg tgcagcatgg gagagtggca aacaacaccc gctattccag ctgacgaatc tctatgtaaa cagactttta ttctcttctt aagcaaggcc caaacccgga gctcattgtt ctgtccttga actcttaaaa ttaagtagtg tctctctctg ttaaatgggt aatttgttgc tatctgtcta acacatcctc gttcccttaa aaataaattc catagccaag agattgtaac ttatagctcc ctttgtttcc atttgttcca aggaaagaca actttgagag gaacctttgt cagtataaag agatagaaaa ggtcattctt gccataatgt ggagaatcta ttttatgtgg gagcctagat aaattgtaat agagcattga agggcaaagg aat act ttga tgtgtcttaa aaatttaact taaaatctaa actttaatat gaaaatatta ggattttaag t tcat agat g cacctatatt gatttaaata cttttttttg atttataaat aactgaataa ttataatgaa cttacagaag tcactgtcct cctgctcaca taattaatat aagagagctg tgaaagacaa cagtgggaaa tgagkagaag tgcaagcaga agagtggtgg gggatgatgg tgtggcatga tatttgttgt acatttaaca agaatgaaca caaagt aaaa gtagtttata cccccaaccc aagttaggat aaatattgtc tctcaattat cat agcacgt acaaatttga atgtatattg ggcctatatg atataatatt tacttcctcc cttattgatt ttcatgagag gctcacactt catttgtgta gattcattga ataatttcag acaagattct atgctgaaga ctggtgttgg acctgtaggc ctgagcattg tgatctaata acctgtgtct ttttatccct ttgaaaaatt tcttgaccac ttgaggttgt tattatgtga ggggcagcct gacaaagctc tcatttctct acatt tcaaa aatcttacca ggtctgttgg tactcaaagt agtaagaata gttacatgtt ttcagtattt tgagaaaaac gttagccatc tggatttctg caaacctctt cagggaggga gttatcatcg atcaaccaat aaatataatt ggcaaacatt aggctttgag tacagcttac atacttgatt gcttaaattc ttgtgggatg gccctggaga gcaggtgacc aggaatttat tgacaagat c gatgagccca actgtgtgag tttgcttctt cctggaacag tcagctctgc atgttaaaag ttttattgca cattacatta tatcagaaag tgttttgcca ggttatttta tcctcttttt atattactaa tgttaaacgc tatttgtttc tcagtgtata caagatgaac tatgcatata tctacacaaa gtaatgtttc ttaaatatca aacatttcca gaataaagac agggatgcaa ttcaatgtgg attttctatt acagaaatca gattttgatg cttctgtgat ctccatgttt ctttcaagtg gtctgaatac tttagattga atggagtaac ttttttttgg tctaatgctc acagcagctg ccccttcatg gtttggatgg aatgttaaac atctttcaaa tacacagaac attttgaaat tgaagtttca ttttttcttt tctatttcat tctaaaatta tttaacactt tatagaaaac tattcccttg tttttctgat aatgtcaaac aattaagagr tgttatttga tttatagtga aatcctatgt caaatgtaaa ggggatcaag agatgaccac tggggaagaa acagtgtgaa ccaaaaagaa agatttgcaa gagtggactg gaagggggag acacttt gaa gaataagtac atggcagtat attattttac gtctgatgag aaat ggcaaa tcaataccta agaggaagca ttagttgcca 245400 245460 245520 245580 245640 245700 245760 245820 245880 245940 246000 246060 246120 246180 246240 246300 246360 246420 246480 246540 246600 246660 246720 246780 246840 246900 246960 247020 247080 247140 247200 247260 247320 247380 247440 247500 247560 247620 247680 247740 247800 247860 247920 247980 248040 248100 248160 248220 248280 248340 248400 248460 248520 248580 248640 248700 248760 248820 248880 248940 249000 249060 249120 W0005851 0 OhttD:/Iwww.aettheatentcomILaain.doo/Sexam-sunioortFetch/DefaultdoqtNJO005851 0.cwc7fromCache=l1oart=maintoolbar-botom] Paie 475 of 737 WO 00/58510 PCT/EBOO/00435 taactcagct caacagagta tctcatt taa actaaaatct caaataggat aatatttact acaagtaagt ccagcacttt ggtgaaaacc gtaatcccag tt gcagtgag tctcaanaat atcaaattta tatttgaaat tttctttctt tctgtcaccc aggttcaagt ccacgcctgg caggatggtc gacgtgagcc attgatacgg aaggtgtaat atgttttaag tgttaactat aggtgtggtg ctgaggtcag ctacaaaaat aggcaggaga tgcactccag gaacttatag ccactctcag atgagatcaa tgtctggctt cataatttca tgatggagat gccagtgctg tcgaatttct tttgttcata tccctgtacc tggggtaagg tgagcatctt tctactcatg tgaggttgtt tcccttgtat ccattcaaca caaacccggc gggcggatca ctactaaaaa t cgggaagct gattgtgcca aaaaaaaaac aaaacacact catggatgaa tcaatgtaat aagtttgtat aaagctttag atggtgttgg aaaaccccat aaaggatatc gaaactggac aaacgtaaqa ttgttctagg t aa at aaat g atagtcataa aatgctgttt atgtatttca ctgcaatatc ctgtttatat ggtaggaatt ctttaaagac gggaggccaa ccgtctctac ctactcagga ctgagattgc aaaaaaaaaa ggagataaat gaagaaactg tctttctctt aggctggagt gattctcctg ctagcntttt ttgatctcct actgcgccca aatattttac tatcatcacg aacatttcac agtcactcta gct cacacct gcgttcaaaa cagctgggcg attgcttgaa cctgggtgac cttccaacta ccatacacac catttttaat atttcactta atgntttttg ataggttgat gtctcccttt ggatcatatg atggctgtac ctcaccagta tgatatcaca ttttatatac tcctctcatg ttttgtttgt tttctggata ggttgtttgg caagcacggt cgacgtcggg tgcaaaaata gaggcaggag ctgcactgca cctaggaata gacaaaagaa gagacttaat ccctat cgaa agaaccaaaa gcatcacact tataaaaaga atttacagct ctctttaaaa ccctacctct cctgaagct a caaacatttt gggctgtatt t gt aac tga c ggggtgcaag agttgacatt taatcaatat tttagttaag tggtttaaac tacaattgga agtgggtgga tgaaaataca ggct gaggca acca tt gca c aaaaangaaa ggtaaataat agatcacaca tctttctttc gcagtggcac cctcagcctc tgtatttttt gacctcgtga gcctattttc atatttatgg gttttgggga attctctctt ttctgccatt gtaatcccag ccagcctggc tggtggtggg cctgggaggt aagagcaaaa actctatgtt ttcccagcct tcccatgtat acatagtgac tgcacaatta gctatatctt ggaacaccga gtacttctat taatttacat tctgtcattt tagtggtttt ttggtggtta tcctttgcct ttgtttgttt ttagtcacct agattctctt ggctcatgcc agatagagac ttagcctggc aatggcgtga gcctgggtga aatgtaacta attgaagagg atgattaaaa ataacattat aagagcgcaa acctaacttc c acat aga ga agctgatttt aatgtttgca caccatacac taaaaccact atgggggaga aaactacaaa cagcaccgat aaacatcatt ttgtatatat actgaatgat aaatgctatg tctccctgtt gaccgggcac tcaggagttc aaaattagcc ggagaatCc tccagcctgg aaaaaagact atgtttgtat acttt t tgag tttttttttt agtctcagct ccgagtagct tagtagagat tctgcccatc tttcttttac agtacatgtg tatatatccc ctcgctactt gaacattaga cactttggga caacatggtg cacctgtaat ggat gt tgt a gtctgtctca tgcacccatt ctggcatcta gagtgataac ctccagttcc gtattccatt tgcaatggtg tttattttcc ttttaatttt t tccaccaac ttttgttttt gattcacaat tgccatttgt actttttaat gtttgttttc gtcagatgaa taaaatagct tgtaatccca catcctagct gtggtggCgg acccgggagg cagagcgaga aggaggtaaa gtgcaaacaa tgatcgtatc tttttcacag atagccaaaa aaaatacaag ccaatggaac tgacaaaaat ggaaaattgg acaattcaac agaaaaaaac cctcaaaagc gatgaaatca tttatctaag tgttaataaa atgctctccc ccattttatt attcagctgg ggtggctcat ga taccagcc aggtgaggt t ttgaacctgg agaacaagag aaaattggag atgaaaatat cgttgagttt tttttgagat cactgcaacc gggactacag agggtttcna tcggcctccc ctatatcatt atattttgtt cttcagtatt tgaaatatac acttaaaata ggccgaggtg aaatgtttgt cctaactact gtgagcccag nagaaaaaaa gatcatcttt tcattctact atgtggtgtt atttatgttg ttgcttatct aatagtgcta tttggataaa gctcagaaat agtgtataaa t ttagtaata tccctgatag atgccttttt aggattattt ttacagttga tagcttgcaa gcaacaaaca gtacttaggg aacacagtga gtgcctgtag cggagcttgc ctccatccaa atatacctac atggaaagat atccgaagca aaaaaaattt ctatactgag gctatagtaa aaaacagaga gccaagaaca atttccatat tcaacatgga agggaagaca acagaggaca ataaccacta tgaaagtaca cttcaatttt cttttgtgct atattagaaa gaagtatatt gcctgtaatc tggccaacat gcaggcgcct gaggcagagt cgagatttcg agtttaacgt tttaatacaa atacatttat ggagtctcac tctgtctcct gtgtgtgcca ctgtgttagc aaagtgctgg tcattttttt acatgcatag tagcattttt aatacattgt ctttccagcc ggcgggtcac atttgtaaaa caggaggctg attgggtcat aaaaaaaaaa tcttcattcc gtctacctac t gtct t tct g ctgcaaatga atttgttaat cagtaaatat tacctggtag ctccatagta agctcctttt gccattctac ttagtgatgt ttgagaaatg gtgagatttg gctatttgag atattttctc aacaaacaaa aggctgaggc aaccccgtat tcccagctac agtgagccga aaaaaaaaaa aagttgcact atcctatgct atccacacat aaaaatcctg caaaaaggac caaaaatagc atctagaaat tacattgggg gcagaaaaat ctaaagactt cttcaggact aaaacaaaaa 249180 249240 249300 249360 249420 249480 249540 249600 249660 249720 249780 249840 249900 249960 250020 250080 250140 250200 250260 250320 250380 250440 250500 250560 250620 250680 250740 250800 250860 250920 250980 251040 251100 251160 251220 251280 251340 251400 251460 251520 251580 251640 251700 251760 251820 251880 251940 252000 252060 252120 252180 252240 252300 252360 252420 252480 252540 252600 252660 252720 252780 252840 252900 gctgcagagc aaaggaaagt attttcttaa W0005851 0 fttp w.etthe patent. comfLog in.dog/Sexa m. sup po rtFetch/Defa ut. dogIWO005851 0.cpc?fromC ache= 1 part= m aintool ba r-bofto Pge 4 76 of 7 37 WO 00/58510 PCT/EBOO/00435 tccttactgg tgatttggac agtgactctt agaaatttgt ggactttaaa ggacaagcca gct tccaata at gta t ttt g tttatatata gtacatctca ttaagtttca ggacatgtga ttgtgatttt gagagagact ctgacggaat ctgaatcatt catttagaaa at taa cac ca tctatttatt acaagtaaac caaagctgct taatataaat tggagcacag acctgacaga taaaacttat gccagaaaaa atgccaatat tggtttgttg aaagcaaaaa gtgtatactt atttgaagtt tctctttatt tggagatatc ctggcagagg tacaataaca gaggccgagg tgaaaccccg atcccagcta cagtgagcca caaaaaaaaa tagcactttc tattttatct gttgttgcac gcaaaataaa atttttgtaa cctacttact ggaacattct tatccatttt ttactttgga cattttcrtt tatttctcct aataatgatc ggcttgaggt tttctctgag taaaatgaac gcaaaatcaa atagtccatt tttgtctagt gtaagctaag tcagaaaaca ttcattcaaa tct ctgcatg taaagtagtt ttcttaaaaa atgtcaagct tctaattcta gtatgagcta atggtggaat ggttgtacac atgggtcaaa gtgcctataa tctatttgtt aattatcctg atcaagtagc ttgctataga ggagtttaag gacaggaaaa aagatccagc ggacagtttt gtaacgaata aagcaatttt taacacacat at ccgtctaa t ta aacact a gaataaatgt gaaagaaaga cgcctcctcg aacattgttg gtaagtccac tgagaagat t gaaacacact taccagaatt tatatattgc tatgcccact tttcctttct ccatttccca aagatt ccca gactattaag agtgtggatc tctctactaa cttggaggac agattgtgcc aaaaaaaaaa tcatatccct acctactctc agtatgtgtg gccattggtt ccgaaaaagc tgaatttgga gtaaaatttc gccaaattat tattggtttt tttcttcttt caataattga aaggcaaaga ccagctggtt atgaaaatga tcattttgga aatgttcagt attgatttta tctagaactt aatatatttt gctatctcat aaatattggg attagagatg agtatagctg gttttggatg tgtcaggata tttttctatt gggaagatgt caccagt aga catgatatat aaaaaaaaaa tttatattct tatatcattt gttaaatgtg aagtgctgtc ttattctgct agggcaaagt ggtaaaaatg aggaaaggtg gctgaatcat agaatattca agatgagcta tggttatagt gaatccattg taccaacagt ggccttctgg agtccacttc aaatgcagtc aagaagcaac aattggaaat attccagtgc aaaccactgt ttatgtttac cggaattgac tttataaata tatttcagtc acctgctccc gggaactatg gctggtgcag acctgaggtc aaatacaaaa tgaggcagga actgcactcc accacaaaaa tgtttgctta tgacttcctc tgggtaaata ataatgaaga tcatgattt gtttattccc cttgaggaca ctgcaagtag cttttgaagg ttaaatataa tatgctacat gtgtttcctg attaagccgc acccaaaaaa tgcagaagac ggtCtctgct aatcttgatg ccatagaata gtatgcattt aacaaaagaa gaaaggtgtc aatcacttaa cccccatctc ttgaccaaca tgcgcaggtt tcttaaacat tgggttgggt ggacaacacc gagttgtgat agaaaaaaag tatcaatacg gattaaaata aaagtatgaa aagatggtat gtcttaagag aaattgcctg aatcatcatc tgtgactacc tgagcataca taattatctg tcaataaaaa caacaaggta tttagtaggt tttaaataca aagaccctag ctgcataaat ccatttaaaa taattctaga ggcccaaggc aaaaggtcca tccataattc aaatgtgagt ttatcgaatg aaagaatcat tacaactact tgttcagtta aaaggagata tggctcacgc aggagttcga attagccggg gaatcacttg agcctgggcg acaaacaaca agaatagtat tggtttggag gggtcccttt ggaaatcaga atgtgaatat aacactgcag aatatccgct aaatatcgaa acagttatta agcaatgtca taaaggaaca ggaactaatg aggaaatgct aggcaaaatg ctttatgtag ttttgtttaa caactaaaaa ttatgtccaa aacattgaaa tacaggcatt tcattaaaag ccttcttaaa tgatttgtag catct at tat gcccccttta agctgactat tgagattcaa gtgtaccaaa gctgatgaag aaaagcatta gatagctcca tggcattgac gaggctgtga atccaatcag ataggctgtg ctgaactcac tacaactggc attcctggaa agttttgagg ctactt ttca tattaaaaaa atgtgt tgtg attactgtac aaagcccagt agagacaaca ggcggcggca cattttttga tatttttata ccccaggatg tgtaactttc cttttttttt t t tta ataga ataatttaac tttggttgtc cccccttctt caaggaggga gtgactactg ctataatccc gaccagcctg tgtggtggtg aattcaggag acaagaggga acaacaacaa ttgaataata gggggtgaat tctctactca ggggaagagg tccattggct cttacatgca ttgttgtatt ataagaagct aaatagcttg tcactttttt caaaatggtc gttgcctgag gcaggccaag ggtttttCtc aaggaatgta aalzatagtat tatcatgcaa caattgtttt atggttactt attttctttt atgcgttgag gaaactgcct taggattatg gataattaaa ggaagagcac aaaattgcaa ggaaggagtt aacgttcaca gacatagtaa atattaggca tattgatctg cattggaaag ttataagcat atattgtgag gatattcara agtcatgttt tggattggac ctgggttttg gatacatgtg tagcccatgt gaaatcacag ctgcaataat gaatttttaa ggtcaagctc ggacacagag actctgtttc ttgttttaga attttaagct taccttacct attaacacta ccagttactc aacatgcaca aagattgttc ttcctctctt ctggcccatg gggaagacat cagagcttgt agcacttcag gtcaacatgg agcatctgta gcacaggttg aactccgtct aacagactat taacggccta catcagaggt tcttttctat tctattttga gcttagcttg ccaaggtttg ctttgttatt ctt tagcaat taggattact ccctgtatta ttaattatgc aggaggtgat atttgtatta cactaatggg ttccataaaa agcacaaata cacttgagtt gatagctttt ctgaaaatat ttttctggag atttgtggtc aatcaatttg caaagcagag 252960 253020 253080 253140 253200 253260 253320 253380 253440 253500 253560 253620 253680 253740 253800 253860 253920 253980 254040 254100 254160 254220 254280 254340 254400 254460 254520 254580 254640 254700 254760 254820 254880 254940 255000 255060 255120 255180 255240 255300 255360 255420 255480 255540 255600 255660 255720 255780 255840 255900 255960 256020 256080 256140 256200 256260 256320 256380 256440 256500 256560 256620 256680 W0005851 0 httpitwww. etthepatent.com/Logn.dogSexamsuportFetchDefautd gWOO05851 0.cpc?fromCache=l1 art=maintoolbar--boftom] Page -477 of 737 WO 00/58510 PCTIIBOO/00435 tattttgtag catcttaacc acatggggta gaaaagtttc atgtttctga gtttattctt gcagagccta ccgaaagggg cttgacaagt ttgtgttaaa ggtgctttgg taataagcat tgtgtagcag agatgtttgc agagaagatt cacagtagga tttgcaagat aacaaatgct atggtgggga agcactagag gagttcaaac gataacccat gtaatcatta tctaggatat ctatccagga tattatggtt tgtccatatt gtctcttgtt tgaaaagttg tgcaatggaa taattcttat atccttaaat ttt cactcac tattataatg tttatcattt aatgacatat atcaaacata taaactatat aatcttttca gaccatattc cacagggaag tgtacgataa cttattgacc atttttcctt tttgtcacag cttctattaa cagaactttg ctaacacggt cgcgcctgta tgcagtgagc t caaaa aa gt ctgacatgaa ttcaaggacc aggccaaat g gcacaagtga acagtctata gcctatgtct ctacagcctt gagtcctttt aaaaagaggc gaaatgctga ctagtttgaa tcatggattg atattaatat aagtgaaaca tgtcacaggg agaacaaaat attcattttg gcatgcagaa actctcattc tgaccaaaag ttatcgcaat ctttatgatg aggaaacat t atggccacaa gccttgcaga tatacatgag tgtatctctt actcactcaa atgactttgg aaagaaacta ggggaggtaa atagtgggtg cgtggttttt gaggactaag tgtaaagata agttgcagac gagaaattgc attaattcaa taaaaacttg aaaaaaataa atagccaagt aaattaacac tttgacaata tgctgtatct ttgggcttta ttgtttctga aqatttctac acaaaaagtt tttattattt attactttta aattgtgtgg tat caaggac gccttagcct gtagaagagg ttaacttcct ttttcttatt atagatttta aagattggtg ggaggccgag gaaaccgcgt gtcccagcta tgagattggg aaataggata taagggcaga tttcattcga tttgaaatcg tctacagtga acttgtattt gctatctcct tcactgtaat agctttcact tctagagttc cttccttaca taacacataa gaggacagtg tactaatata atatatttta catagtagac taaccagtag atttaaatga gaatccagat ctggacagca attgaagaaa gtttagaatt gatatgggtg atcttttgtc acttaaatgc agatttgtag gattttttaa gtgttcagct tttttgttga taataaatgt gtttccaggc ctacaagatg ctattgatgt ccacctgtaa ttggttaatg agctattatt attgcaatac aacacagatg gacctataaa cttaaaattc caaatcagtg aacaaatgaa agggatttta tt taaagcca cagggtacta ttgaagatat agaacatac ttttagtgta gaagatgtgt atcttaggtg cttgtcacca cttcaacttc acaaatactg gccttttgga aagaaataca caatcaacta tatttgtttt acagcttgca taaagaaat t gtgggcggat ctctactaaa ttccggaggc ccact gcact attatattct gacggta'gca gcataggaag tgaaagcttc ctttgtggga gtttcttttc ggaccctccc aaaccattac gaatctaata gt cagctggg aaaactaaaa caagttttga gcagggccac aaaatgtagt tcatattttg aactgaaaga tattagatta atgacagaat aatttatgtg cagagtgact gatcaagcag ttgttatatt tccttcttaa tgccactata attatgttgc gaaaaatcat aaagcagatc gaattatagc aattattcaa agcacactta acaaatgact ccaccctgaa tatctagcaa atgaggaaca tagagtactt aattttaatg accaaagtca tgcaggcacc atagcatgtg ttaaaaatca taaatgaatg attgttaagc tatttgtaat aatattggca aaycaaaatt tattgcttta ataattaatt tttcatgaag taatgttctt aagttt aa at tcttttctct caacttgctc tattccttct cttccctatg tcaaaagaag aaagtatctt tcttttttct ttgtatgttc aggggtccag cacgaggt ca tatagaaaaa tgaggcagga ccagcctggg tatattcatt agttaagatg aaaaataaga cttctgtatc gcagttggca acttacatgt ctagtacatt taagagtgtg tttgtgttag acattcaagt gctttataat gtgaacgctt acacgtgccc tattactata ccatttttgc gctcctaata taacccaaaa acataagtca gatgccctgc tccttccaaa ttatcatgag caatcgagga tagagaaagt aatgtgacta caagaaaata aaaacaaagt tagtagaata atctaacaca cgaat atttt attcattgaa tgcttaatag ggagtcactg gactgagggg acgataggac agatagctgc gtcataattt tttatgttat ccactatcac tcatttataa aaaagttaat acagtttaat agggttgaaa tattgattaa tatattaaac ttctaaaacg tcctttagtt aatgttaatt gacatgaaac ttattaggct aataaagtct aagcctggtt accttctctg tcccagggca ctttaagatt tttcgctgca tctacatcat tttctatcat attttcctaa gcggctcatg gaagattgag tttagccggg gaatcgcttg caacagagca aacatatttt ggccagttgg gtatacatat tcaaagagca tctgaaaaac tatgaaagaa tttccattgc ttagtgtttc gaccccccca ggccaggccc tttcaaaaaa agcactgtct tccctgtagc tttactttac cacccctgtg gtcaaaactg tacaaaataa atgggggaga cttcaaagag gagtacagga taaagcaaac ctttacaaaa tcaaaagccg aaatagtacg tgttggcagg acatagtgtg tgatttactt gcctgtgcca attttaggct cactaaagga cacaaggcac tttcatctgg ccaactttct tggcctcaga ctaaaactat aaatgaacat aatttatatg cccaaattaa aactctcaaa gggttttgaa atcaaaaaga aat ta cca ag cttcttctat tgagaaccga ttgaaacaaa agaatgatgt ccccatttct attactattg gatggaagta tgtatactat tagaggtaaa ggtaagagtt tttatatagt tttttcttta attcaactac tcatttcagc ccatttgact aatattagag cctataatcc accatccttg cgtggtggca aaccaggagt agact ccat c gatggatccc atttcatgcc ttataataca atcaactctg atct taaaaa gagaaataga taactttart taaattcttt cacaccccta aatatattca aaccccaaac caccatgagc caaatgtagg 256740 256800 256860 256920 256980 257040 257100 257160 257220 257280 257340 257400 257460 257520 257580 257640 257700 257760 257820 257880 257940 258000 258060 258120 258180 258240 258300 258360 258420 258480 258540 258600 258660 258720 258780 258840 258900 258960 259020 259080 259140 259200 259260 259320 259380 259440 259500 259560 259620 259680 259740 259800 259860 259920 259980 260040 260100 260160 260220 260280 260340 260400 260460 W0005851 0fhttpi/twww. etthepatent.comLogin.dog/Sexam.su~potecheautdgWOSl -hp~ro~ce= 1 part= m aintoolba r--boftoml Page 478 of 737 WO 00/58510 PCTJIBOOIOO435 ccagtttaca aaattcttcc cccgtggaat aaaatcagat ttatagtgat taccagagca ggaccttgaa cactttcagt taaccgattt caatcacgtg gtagggtgta tcactgtact ctggaaaaga tctcctctgt gtattattaa ctccttcatt aatgccttct ctttttcata ttgtttgttt tcccagcact tggctaacat gtggtgggca cgggaggtgg accgagactc acagctatca gtgctggatg ttttaataat gccacttaac actttaataa aaagttaaaa cgattcatgt actaagtctg ctgaatactt atattattqt tgaatcaaat tgtgaagttg tttggaaatq ctaagatgcc ttqttaaatttctttaatqt ttatttgaga tcactgcaac tgggactaca gtttagccat agcctcccaa tagaattcaa agaagatgtc ctaagaggcc gaaaggagaa gcatctttta gttggaaaaa ttacccttag tcttatagaa ttctagatga aacttttgtt atcatcaagc acaatcatca ctacttttaa taaagaataa ttaatttcca ttatgccagt ttatgggaaa qgtgtgacag gacatcaqga agttaaaaat attttaagtc tatttttctt tgatggagag gacagctatg agctgggaga ttcactacta ttaacccgcg tctacactag aactgtcact tgaggcagta gacggctttg ttttctatag tgatcaattc ctccactatc tcatatatct agagttgtgg tccttaaaaa ttgggaggct ggtgaaaccc cctatagtcc aggttgcagt cgtctcacaa cttctagatc gatataggag gactgaaqat tccctagttt cattaccatc tgtgaagaaa atctttcagg aaaaaactta ttaaagcatt tttcacttgc gctaaccaga tgttctggtt cattcagttc ctcctttatt tttctcaaaa attaaaatct tagggtctca ctctgcctcc ggcccacatc gttggccagg agtgctggga atgttgccag cccaatggca agagaagcag ggaagagaag agtcaggatt ataaggacat gagaccttaa cagtgatgtt ctgatactac gagagacttg ttgagttaat tgtggtaggt gtaatgacat gatagagtct gtttgtctaa aagacttgtg agtgatatta atattttgtt agttgccact ttatttatgt tcacagaaaa caaacatcag aagttatttt agctgtcaga gaaaggcaca gctgccccta ctgagtcttc atcaagtgca aaggaatgtt ttggagaact tttcctttca aacccagt tc atctactcct tacacagact tgactagtct attagaaaac attaatactt gaqgcgggcg cgtctctact cagctactcg gagccgagat caacaacaaa taaacattct tggacttact gacattggga tgtttttcaa atcatctcaa ctttaqaggt attccatggg ttgtgtgtca ctctctcttc catttgttta ttaaactata cccatattac caacttgtag atttttctga gtaaaatttt tttatatcca ctctgtcacc taggcccaag actgcgcctg ctcgtcttga ttacaggtgt actttaagtg gggccttgtt aagatttttt gcatgaacag ccgtctactg tccttggttt tgatcaacac attatgcaat agaaacctga agtcatactg atcaatgtta tttaccacgt taaaaatcat actgaaccta tgctggaggc atttttgttc ataaaaactt tcttcacaac gcgatgcagt ctacaagcat gtcaccttta atataatttc ggcataaaag gagaagaact aaaacagcaa cagagtgatt cat gta tct t ccatctacca tgggtcaatg tatgttttct tattaaatgt agggctgtgt caccagactg acgtataaat atatgttgtt tgtgaaggga gcggc cggqc gatcacgagg aaaaatacaa ggaggctgag cacgccactg aaataataat tcaagatgag tggttgtcat ataaataaac attagttgag ttgtggcagc ggtttggtgt attgcactct ttactgaaat tccgcattat atatatgaga tctaagagag tgccattgtt cccctaagaa tcaaatattt tatgtttaaa gtttttattt caggctggaa tgatccttcc qctaattttt actcctgacc gagccatata tgqgtcacta ataaaggttg ttcatcagat catatgtgtg ttggccaaaa tctccaaaaa tgtatcaaca gtattcacat gataatccct aataccttga tgttgctatg ggcctgctga attttccatt tagaatgtta aattttacct tcccccaaca tctggaacaa attcattctc cattcttgac cctctttcaa ttttagcatg cattaaggaa gaaaatgtgc tgtggggagc tgcaagaagt gtgattaaag agcttgattt aatcaaacac tccacctata atggaagact caaggagagg ctcatcactt caaagttttt taacaatgaa agcattatat ttgtttgttt gcggcgggtc tcaggagatc aaaaacat ta acaggagaat cactccaccc aatacttgga tggagacaga catacggttg atagaccttt aggtgatact tacaatqtca ggagaagatt gtcatcaatt actcagcagt accataaaat atatattaaa tgtgtctttt caatattttg atgctcccta aagaaataag atatgacaat tattttattt tgcagtggca accttaqcct atatttttag tcagttgatc ttcagttttt tctgatggag gaagagagat ttcacgtcag aagtagaatc taaatcatta ct tat ttt gg gagaaagtgg aattatttac gcttccatta attactgcca gagaggat aa actccatgct tatctgtgga ctaagtatta tctcctacca catgcttcta ttatagatag tgagtattca ctctgtgaag atgcaaccac aaatggctta atagaagtct ttgggtggaa agaggagagg atattttaac aaactcttac tttttgccct tcgtttttaa gatactgctc tagagcatta cggtaaagcc actatcctgt gaggaaagaa taaatgaaca ttaaatacca gtttgtttgt acgcctgtaa gagaccatcc gccgqgcgtg gacgtgaacc tgggtgacag caggaagacc ggtagagtgt taccatttct gagtttcata tatagccata agaaactcac gatgttgata tgctctaagg ggtttggttt atatcttaqc gcatatgcct caaaacagat ggacttctat catctaaagg cttcaaatat ctaattgtca acttatttat caatcttggt cccgagtaac tagagacggg caccctcctc agaagatcat qgcttctctt aatcctctga taggaagaca ttaatagtgt ttatctggtg tgtttcttaa aattttattc agttcttcag gtttqggtgg agagctggtg ctgcaggaga caaactccaa aqctagtgag ggtgttgtat gtgaaaaagt tataaattta agtgtggtct ccatggatca 260520 260580 260640 260700 260760 260820 260880 260940 261000 261060 261120 261180 261240 261300 261360 261420 261480 261540 261600 261660 261720 261780 261840 261900 261960 262020 262080 262140 262200 262260 262320 262380 262440 262500 262560 262620 262680 262740 262800 262860 262920 262980 263040 263100 263160 263220 263280 263340 263400 263460 263520 263580 263640 263700 263760 263820 263880 263940 264000 264060 264120 264180 264240 W0005851 0 fhttp:/twww.g etthepatent.co m/og in.d og/Sexa m. sulort/FetchDefa ut. d oiWO00585 0.cpc?fromC achle= 1 part= m aintoolba r--bofto ml.Page 4 79 of 737 WO 00/58510 PCTIBOO/00435 gatattctgt aggttagcta aatgagagca ttcaaaaaca cagtgaatgg gtttttgttt tctagtgaag ttaatgatgt ttaatgtgcc gacagaattt aatacgtgag ctttcccaca tcctctgtg actcacaaaa ctgtggttgt tccttttcag cacctacaaa atacacatga tgattaaqat ctaaagacca taatctgcca tataaaaata aggttattta cacagttatq tggctccgtc aagcagaaat catacatgtt tggaccttat cttctctcta tacctttttt gctgacagag ttaattatga aataattcca gtaggacctt caaatgtata tttctctgta tatacataca ttgctgttgt tt act ttt ca taaaacattt gtatcttaag ctgatctttg catttgggag tgtttaaaat acacatttcc tttgtttcct ttagttttga taggcatata aqggtctctc ttaacttccc actcctggca gagtcaagat tactttgtgc tccaaaccgt ggaaaqcgtg attttcctac tgctgtgtcc t qtaa tgaa g t tt caatcc a ttgagaaacc agtttgctac aagatgttaa cacacacaca agtttctgta gattaatagt aatactaaag ttggtgagac ataaaatgtg aatttgatat aaccagccag taattgcatt atgggctaaa ctgtaataaa aactggaaaa ggctgatgag tqtttattgc tctgacatcg gaattatgaa cttcacaata aacacacaat agatttgttg ctataacttc cgaatatgat tatttcaaat gaaatacatt gaggactcat tqqagaaagt ctcgatcact ctctgtactc ttatacagat catgctattt aaaaatatac aggccttgat catccaccat cataatgaca aacttattat aatttatagt catagtttta ccttctacta tctgtctctg aacagactac gtatttctaa tatatagaga tgatcttgaa ctcatttgca aaattcacta* atctatttct aaataagtaa gtcttctatg accataaaaa gttqtcagta tctgttgccc aggctcaagc aatttttgta gtagatggca catgatataa acacttacaa tgtgtgtgtg gagtatccta tttccacccc cctgagatgt caaaacgaaa ctgacaccag tatttggtga aggcatcatt cacacggttt gtagatacaa gagaggatac tattgaatta caggattgtg tacacagtga tttctcttta gcaagttcca tgqatctcca gaggcagtat agtgtagtca tgtataatct gcctgggata ttcgcctgca ttttaccctc caaatatact tgtacatata acacacaaac caacacaatt tcagggttga gggtgttgct attccctgtt tgtgactttc gtaagacaga aatctgccac tttatatccc ttttgacatc gtgggcttgt tagttatcag aaaaatcaat ctcacaqcct ccaaaggcag ttaataactt tataaccata ttaaccattc ggggtccatt agtaacctgg aggactttta tgctactaat agagcttttt ttcatataca atcaacatta ggagcacctt tacaacaatc ctattcaaac aaacaaaatt ttttgattat taactcattc atctgatttt aggctggagt gatcgtccca ttttttqtag cattagttca gcaaggtgct gtgaggcaac tgtqtgtgtg gttgatcctc acccttccag tgttagaatt attagatctt atctattaat tgacaccacc ctcttatttc ccatagtttt aagctttaca atcaaagaac agtaaaacaa gagggcacct gaagagaaga cctcgttcta cttcttaggg tccagatatt tttttaaacg agagtgttga taaacagtac ctaatatnaa gtgcatgaca tgacacgtca ttctaagaag cagaggttgc tttcaaacgt cattctcaaa tttatttgtt aaaataaact gaaatataaa agagctgtca aaagaactac aggtcaccca tttcattcca ctaactcctt cagaaaaatc ctgctgaqct agaactttca gatccttaac cgtagacaaa ttaccttatg aacataaata acatttgagt tttatttctc ccttattcca atttcatttc actactgctg aaaaatatgt tattgaactt taacaacctq atataagatg tgattctgag tttcatttta caccaaatct ttcttttaaa aaagtcatca aacccaacag gcaatggcac agtagctggg atgtqqggtt cgttatttca aagtctgtgc aaaggtatat tgtgtgtatc tgccaccatg agggatctgg taatgaataa gacctacaca acctttccta aactaggatg taataattaa tttttcaggc aggtgtattt atggaaatga gaaaaatagc tggcaatggg aagtgtctac gtcaagatga ccgttaaatc tgccctacct catctgtaag tggaaaatta acattatttt aaaccaaaat tcttaattct aaatcagggc atggattttt ctgcqatttt aagcacacag tctatttcct ttgtacgaga tctcaagaga cataaaggaa ccqaatagat gcacagatca gacagggagt aagccaaqca ctgctaccct acaaaatttt gttttctatg gtgcacttgc tcatctactt ggttcaatga ttttatgttt tttgtatcat ctttaatccc tccacatgta ttatatattt attggtcaat aattactatt cattaagtta atgtttttat ataaaataga taaattaggt actccaaaga tttgccgcat tgtatctttt tttttaaaat aagtaaaagt actatataca aatcatggct gactacagqt ttgccataag gttaaggttt tgcaaacagc aggggttcqg aggcagaaaa ctctttccat atgtggatgc ggccaagtat aaatgtggct tggtcacttt aatataaatg ataataaatg aaattcgcta ttccacaaag tttttagaga tcctcccacc ccttgtagct acagaagtta cctgaagcct ccttctctta taatttcatq tttcatttat gggtgacata tattatctct tagaaacttc aaagctctna ctaattgntc catttaattt aatatgctca atctgtaaac qttatgctta ctgagtaaag catcaagttt ccattaatta attggaaqgc ccgatgatga gggaaagtga tgttctataa catttaccct aatgttagaa tttgagttcc aggtgggttt tccaatactg gtaggaactc ttggagacaa taataacagt tgctcaattc gtgatttatg agtttccata gtatctgttc attattatta ctgttttaag tttcttgcat gtgaaggttt aaacgtttaa tcgtttttta ctaatatctg aaaatgtatc aaatttgtqt aatcatctct tatttaaqac cactacagcc gcatgcttcc acgaattgtt cctgagcctc agtcatccta gaaaaactac ttatcctcac ggqtgccctt ctatgctgag gctaacattt agctcctctg atgttttgaa ttcattttca tggagataca aaatctcata 264300 264360 264420 264480 264540 264600 264660 264720 264780 264840 264900 264960 265020 265080 265140 265200 265260 265320 265380 265440 265500 265560 265620 265680 265740 265800 265860 265920 265980 266040 266100 266160 266220 266280 266340 266400 266460 266520 266580 266640 266700 266760 266820 266880 266940 267000 267060 267120 267180 267240 267300 267360 267420 267480 267540 267600 267660 267720 267780 267840 267900 267960 268020 W0005851 0 rhllD Jtwww.gethe atentc mLg in.dog/Sexa m.supporttFetchDefa uItdogNVO005851 0.cpc?fromCactie- 1 part=maintoolbar--boftom) Page 480 of 737 WO 00/58510 PCTIiBOO/00435 aacattataa taatttaagt tatacttact tgatcttatt tagattcacc attaagactg tttattctta aagtcaaaat cataqctttg gaaatgtggt ctgtattttc ttcaaggcca agtatataaa aatctaagat gactcaaqtt ttttatacca ttttaataat gatacacagt atttttttta ctctcttatt tgtgtgtgtt cctaagttta ttttggtaqa ggt taat ct g gctgcctata tcaggctact aggacctatt acagcatggc aatqcctatc ggttttctca tgtggcactt tgatagagtt gggtaagaat agcaatagqa tcttttgttt atttaatggc tgattttgca taattcccat tcatccagga tttttttttt ggagtgcagt tcttgcctca t tt t tgt att tgacctcata cgctgtgccc agtggtggtg gattaacatg tgtaaagaaa gcaqaagata gactgaatga tgtctcataa acagttataa gqtgaaacag taggacgaca cttaatcaag aggtggattt gcaatctqct tctgtgatgg taaaattaaa taaaaatgca aaatgtagaa tgttgtacaa tccacattcc ttattattaa agacacattt cagaataaat ttgctttggt tggaggtctt qggtgggctc gt agatct t c ctctatcgca ggacctaaCa ctgttctCtg tggccagaaa agttccaata attgaggatt cattctgtta gaattttgaa tgatttttat gtgccaattc tgaaatacag aagctcaaca aaaaaatgtg ctgtgtgtgt caagattcta gaaatcttaa cttcaaatga gtctccctta gtacatcaga cagaaatgtt ttaagtgagg ttaactcttq gacatgtgaa gtcagattaa tcaagttgag aaaaggtgtg gctaaaggca tcattttaac aagttgcctt taaataatca caagagcgtg agtCtctttt tttttttttt ggtgtaatct gcctcttgag tttagtaqag atccaccacc agcccttgtt aagttgtatt tttttaatca gaataCaCtg tttaaacaqc qttacaaata ttgtatatgt cgtgcatgag ccactctagt ttgacatCag agagacatqa ggtgaagtCC cacagatcca aatatcaatg aaaatatata aagcatagtt gaagcaatta atcaattctt aagtaaattt ctcctaggaa aatgatgcaa aatgggaatt tttagctttC atttcataat aagaatttgc tcattaaaaa ggattcaaca ttactcttgt aatataccat gcCttCCaC aagtttcttC gaggaaatCC atgttccacg t cac aaa gt g gtaatacatc acaaaagaat atagtttaga tttcctagag ttaatttaaa ttgtgtgtgt aaccttttca tgaagcttaa tggtggatgc aaggttaagg gcactgacaa ggtttataga aatttttact aqatgtggcc tttggggaga caaaaggagt aacagtataa tgagccatag ctctaaaagc tttctgcttt taaaatgtat cagagaatgq aaagctacaa gttatctaat tttttttttt tggctcactg tagctggatt acggggtttc cccctcagcc ttgttaggtg atgttttgaa tttatgcact catgtaacac ctggattaat aacaagttcc attgcattta caaaactata tatgtaaagt catcagttat cacctgqatt aggtggggaa caatattcgg cttccatttt tatagccagt tctgtctttg taagcaggat gtgcctaggc actaattcaa taatatctac gtatggatac ccacatggaa tgagtaaaca gtatccaggg atttttcaca taagtgtaac gagggatgac tttacagcag tctctttggt ctttacagtt taagaagagt caaaattcca tgcttccaac tattcattgt atttgtgtct ttgacttaac taggaggaaa attttacttc ctattataat gtgagagaqa cttataaata aatqcaagtt accatcatta agtgatatat aacttcctca tatgccatta cccaggtcag agaattcagg taagaacaga gggaggcttc tgttcatatt aaacagaatc tcacttgaag tttacaaaaa ctggcctcat catttcttaa tttaggtgat ctaagtcact gagatgqagt caacctccac acatacacgt accatgttgg ccccaaagtg agaaaatgag aaatactgaa aatattgtat agtaaggtat tcactcatct ccaaattgta tcacaaaagt gtgagccata gataggaaat tccaataact cgctgcatgt agcagagtaa ctgctttata gggaaaagtc ttgtattttg agaagttttg ttgaatccta caaaataaag tggtactata atttaaggaa ctcatgcaaa gcttatgaga agcccctaca ctttagccct aattccaagg cctctgcaat aatctggccc tagttctqcc atctttgcac tagaaactgg gctgcctatt gtacatttgt ggctccacga ccacctgaca ctaagagttt acttctgagc agtcagtata tcatatctaa tttatcagat gaqatgatct gatagttcag tctgtgtaga cccaaatggg gggtgctaaa ggaaatcacc caatggaact gaaattctaa ttqtttttct atagcatatt atacaagtct ttacatcctg tgtttctttt gccacaaggc aatctatatt cacagaaata qttaattgtg ctttcagacg ctagctataa cttactctgt ctcccgggtt gccaccatac tcaggctggt ctgcgattac cctgtttcca agcaaacagg acaatgtgtg tgtatttata tgtttgtact ttattgtggt tatatttgaa tctagcgatt aaatcaatcc gcataatcaa gagaagggag atcaqcagca gaacacagct taacgaattc tattttttat aatcttgttg cctgtatcac caaaaaaaga aaatgtcaat agagtaattt caaatgcctt aggtctttaa cactgagtat agacatgctg tgatattgat taacaqaata aaccaccttg attcgtaagt tttgatcttg ccacttaccc tccaaattta ttcataatgc agtggtatga tcttttttta ttcacgtgga attattcatt aaggaatgaa tggtgtaatt gctgatttcg gatgtgtatt agggtgacat ggtaccatct tgaaaqcctg gaaaggctta aaatgaaaca catctaaatg ggcaggaact actgtgtgct agctgcaaca ccattttccc atggqaaaat cactttttat cttgcttttq ttgtcccatt ctaaggtatg tctttctcac attagtgtag ttcccccttg tgcctaggct caaacaattc tcggctactt ctcaaactcc aggcatgagc catggagggc gagggaagca tgtgtgcctg tattgctcaq aagaaacaaa ctcatttgaq cacaaggtgg tagctttcca catcttagcc tatttatggg ggcaatgtca aagtcaacaa ttattctttg tttagctttt aaaaggcata gtgagtcaag taatttgttg ctacactggc gaatatattc 268080 268140 268200 268260 268320 268380 268440 268500 268560 268620 268680 268740 268800 268860 268920 268980 269040 269100 269160 269220 269280 269340 269400 269460 269520 269580 269640 269700 269760 269820 269880 269940 270000 270060 270120 270180 270240 270300 270360 270420 270480 270540 270600 270660 270720 270780 270840 270900 270960 271020 271080 271140 271200 271260 271320 271380 271440 271500 271560 271620 271680 271740 271800 W0005851 0 http:ltwwN. etthe patent. com/Log in.d og/$exa m.sugrport/Fetch/Defaut. dogNVO005 8 S1 0.cpc?fromCa ce= 1 part= ma intool ba r--boftoml Page 481 of 737 WO 00/58510 PCTIIBOO/00435 cagaaaataa gaaggcttgg tggagaggtg aacacaggtg ctggaaatgg gaaataacag gactcagaqa gcaaqattaa attaaacaaa cctgaaattg gttgcttctg ctccccattg catagatgga tctcatttag atcaatatac gcttacacac taggcatggt cttgaqgcca aatttaaaag taagatggga tgtactccag taatactttt atatgacaaa gtatacacag catgcctaca aaaatataat atatattgaa atgttagttt tattaatgaa tgaacatgaa actaggtact atgatatqta taactcttaa gtactgctgt tacatgatgg aatcccgaga tgcttcaatt gcaaggttca aacaagtcca gatttggttc ttctctttct aqcagaataa gaaaaagaag agcatatqga tgaaaattta tttttggagt cttgccaatq atcttttaga ctaaaattag atatacttgg aaatataatg caaaaaagac ttcaaatatt agatacctta gtttctgaat aaccttccaa aaaatcaaac tattaattaa gagatgacaa aagttcgata ttttattcat atcaatagaa ttagaatatt gagtgaaaaa attagcaagc gggaggagtg aaaaatgagc aagttttgca ggctgggttt aaaggggtgt actggtagct accaaatgct caaagatctg ctttccatgg tcagcctgga caagtgcttt aacaaacatg taataattga gaggaagctt ggctcacacc ggagtttgag ttagcccaat atcacttttt cctggatgac gaaagtcctc ttaaaaatat gttgacccag ttacttttga atgttcttaa tgttgactgg ggccaactga ataatatgtc gagctactaa agtttagttg gctgactgtc gtgaattgtg gcttaattca gtagatttaa taggaagatt gtctattaaa aaatcacgtt caatagttta ctgtttattt catgtatcat tctgtatgca tttccagcgg gacatgctta tatcttgact gaca cat gag attaagccat gtagttgggn tgtaatgagc tttaacgaat catatcttta attctqctag tacccccaag taatgaagtt tat cga gta g gatgacattt ttctttatqa aatgtaatgg gtgcgcacag tcaccataac actgtaatat tcagttaaaa atgttgattt tttcaagaat atttgattga agggttatta atgaggggat tqgagagcat gaagctgttg ttggaaaatg atcatttcca aacatcagca gtagaataga ctctccttat acagaaaggt aggaaactac gaaaggaag gactgagtga aaaaatattg tqtaatttca accaacgtgg gtggtggtac tcctggagtc aaagtgaaac agatagaaga taaatttaag a aaaga aa ca gtacacatat taacttacat tcaagagttc aagtaaatat tgaaggtctg atgtaactga catggctgaa aaatcatatq agtttctgca aaaccaccta aaaatagttt gcttcaaaaa agttttgaag tccagtaaac aacagacatt tctgagttgt gtcttatttc cagtgggaga ttgatacatt aggatcaata gaggatatgt aaatqqagga ccttttgcct ttctatatat ttaagttaga ttcttaaqat tttatttgtt ccttatgttt gcttatttta tcctcttctt acctctgaga tccttagaaa aaaaatatac taggaatagg ctgaggaacg cttttgatgg tgcttttaaa tatacagaat aagacttaat gaaggaaaag tattaaaagc tagaaaaaaa cacctgggat caggtcagtt aaaatttcaa ttcatctgaa gatatgaccc ggtccacaac tttcacatgg ctccacattg gtttgcatca taccgaggtc attgtatgtg actagtctag tttgtgtata gcattgtggg gtaacatgga ttacctataa taagactcca cctgtcttac ctcttacctg tgtttatttg aatgctaaat ttcttctgta taaataattc ccttttttca gcttggtaga gtactaatgc gtttagactg tgacccagct ctatttatta aatcagaaaa atgagtgatt tacattgttt ctataacaga tataataaac tttgcatttg cacagcaggt cttggatgct a act att ctg gagaggcaga attctcccta gggagaactt tttqatagta aaccataatg tataaagaca cttgagaatt ggaaagcaag atatccatga tttttaacct tactatqttt gatgtatcag tttcttatat actcagcagg atcccagtat atcattaaat aaaaagtgtt ttccttatat gtcttagtta ttcgtcctct ataaagtaga tgcattctgt aagagtcaga aaggataaga atgaagagaa tgagaagatg tacagaacgc tcaggaatcc qcaggqqggc agtccgtaga aaacagaaga caatagttgg ttgtgactga gagatcacta tcatcctgag agttttgttt gaggcaaagg ttaaaaataa aggccaaggc gagactccat ttctagccta gtgagctgtg tccaaggaag cttcatttta ccacttactc ccaaaaatat acccattata agtggtaaat taaaacagat aaacagtcta tggatcacga ggaaactttt atttgccaga tagttatatt ttgtttatta tttgaaatca cttatttcgt tttctgaaat aaaaaaatat cagtacattt gattccaaga ctccttccag acagcatgtc ccaaatacac gcaaagggct tgaaatatat taagtaatat t aaaa agca c ttgattttca cctatgagaa ataccctgga ggatatcatt cagagcttct ccataaatgc ctaagggaga tcgtaacaat tgattccaaa ctaaccttac tgtgaaatca agtgtgcqtt ttccaaggtc ataaatagtt tcattcatgg aaatacagcg gaaatttagg tgtggtgaaa atttgctgaa taggaaaaca acatcaactg catggacact tttcctatct ggqgcqqgga atgtttgatt tttacaatct cagaagctaa agctggcctg ctgtagqgac atgagaaggc tgaaagcaga agaggaacta aataaatgcc gggagaatcg ctctacaaaa ctagagagtc actctgccac aaaatqaaaa ttagtataat aaaattttag tgtcgtgctt aggagttttc acaagttata ttcaattctc aqtgagacat atataatttt ccagtgatcc ggagagggaa ttgtttqttt atgtttqttt acccaattca ttagaactgc tgagtaaatt attaagtaaa atgtagacaa ccatgggaag ttatgtcttc aagcattagc attgaataag agatttgcta gcccatcctg tctcataaaa atgttaagtc ttctatcctg taaaacacag tcttggataa ttccttacca agggtagact taacatttct gqagtcagaa ccgataaatg tcaaattcac caactggatt aatatagctc gtaatagaaa tctgtgtcag cgttattata ctgtctttaa tattttctgg tttaatcatt 271860 271920 271980 272040 272100 272160 272220 272280 272340 272400 272460 272520 272580 272640 272700 272760 272820 272880 272940 273000 273060 273120 273180 273240 273300 273360 273420 273480 273540 273600 273660 273720 273780 273840 273900 273960 274020 274080 274140 274200 274260 274320 274380 274440 274500 274560 274620 274680 274740 274800 274860 274920 274980 275040 275100 275160 275220 275280 275340 275400 275460 275520 275580 W0005851 0 http:/twww. etthiepatent.comI1Login.do /Sexam.support/FetchIDefault.doQM00565l0.cpc?tromCache=l1part=maintoolbar--bottomL Page 4B2of 737 WO 00/58510 PCT/EB00100435 ccacaaaaaa aataatattg tctaaaaacg gaggttgag tgqcqaaact ctqtagttcc tgttqcagtg acaaatgtaa tgatttatat cagagaggga catttccttg gtttcaaaat attatattqa qttgttttgg tctttttttg ccaacaagtg tgcgtqgatc tctactaaaa tcqggaggct gatcgcacca aaaaaaaaaa tttacccctt ggqttaaagt aaaacttt tt agtatctcat tataaattat tttacatcta acatccttaa tattaaactt aatgacatct attactgcag tctgaccatt atgaacagtt aaaattattt tatatttatt tcttttcctt ttttgttttq ttaatctaag actgcaqatq agtcagaatg tttttttccc tgcttttatt cactcaaaat tttatgtaag gtgatattcc tttaccccca ttaacaatga aatcaagcaa gagtcagatc aaactgatg ctcatacaca agatactctt tctttttaag tcactgcaac tgggaataca ccatcttggc ccqaagtact agaacagtta gatgaaattg tqgctttgca ttattacaqa atccccattt aatatttgta acacttttag gtttagttga gaaaataagg tgggtggagg ccatctctac agctgctttg agccgagatt tcacataatt ttaatcataa atgaacatat gttttgaact atttgaaatt aaaaatgtat catgtgtctc agattttact gccgggcgct acgaggtaaa atacaaaaaa gaggcaggag ctcactgcac aaattaccaa tggtattaca taattcgtat ataatacttt caataatttg ataaaagtaa gct tact gt t aaaatctgag aaqtaaccag ctctgagttt ggtagatggt ctctqtaaca agacataatg gctqaaaact atttagtcat catttgggga ttttgttttt aaattccagg atctgqcttt tcagtgctgt cagctgaaaa ctcatattag aatcaatata ccttgttgc ttccagttqt acttttacta cattaaaatt gttcccaaag agtagccaaq ctacttaact cacacacgca tcaggtgaca cagagtcttt ctccaccccc ggcatgtgcc caggctggtt gggattaaag aqttttaaaa tgaaattata tttgttatat atctagaagc gccctatctg ttttaatatt aagcaaaagt caaaataaaa ctgggcatgg atcccttgag taaaaataca gaggctgagg gtgccactgc tttttagttg tttattgatt attattttgg tagccatgct atctaatggc taatattaca ttttatataa aaattacaat ctgtctcacg gaagtgaaga ttaqccgggc aatcacttga tccagcctg caagttgata gctgtttatc ctataattta aatgaaaggc gcagatatct cagtattcat ttaqtaataa atttcttgat gatgtaaact ttatgtccaa aatcctagac cagtttcagg tgatctaaag ttaaagtcat ctgcctttct ccatgagaat agcgttactc ggaacattac tgctaaaatt tacaaggcaa ggttcaatat ctgagagctg tatttgqaat aatcatccac cgcatcaact tcaaaatacg gtcacagagc atttgatttg t aat t ttgt q cacgcacaca attggctagc ctctgaaacc ggggttcaag accatacgtq tcaaactcct ccttgagcca gcaaatgaga gctaactac ttaatacttg cctaagcaaa tattttcaaa tacctagtca gatgattaaa tgttgttgtg tggctcactc gtcaggagt t aaaaaattag catgagaatc actccagcct ccatagtggg atattaaaaa ctaactatat atgaacaact tcttagatta aaaccttaca aaatcagaag gccctcaata cctgtaatcc ccatcctggc gtqgtggcgg acctgggagg gagacagagc atttcctaca atgtacataa taqaqtaaaa ttattcacca caactcttat tgctaaacag aaatgttctc tttctgtaaa tttatcgctt aattctggat tttggaatac gacttgaacg gtagagtatt atcgtatctt ttccaaaaat tttctctttg ggcagctctg tcaaccatga cagtaacttt tctggtttaa acactgccgt cagtggatgg gtagccttac gtttttctac gtttctatgg gcatgccagt catttqagat ccaataagaa tgtgatcacc aaaagaatga cacagcatat ctttttaaaa caggctggag cgattctcat qctaattttt ggcctcaagt ccactccagq aatactctct attgactaga actcaagaaa tatatcactc ctttggggct attttctaag gtattcaaca aaagcctttc ctgtaatccc tgagaccagc ccaqgtgtag acttgaaccc gggcaacaqq tttattacac atagagacac tttatgagta gaataatctt tacaataaaa ataaaacata gagaaaatcc atatgaagac cagaactttg caacatggtg gcgcctgtag cggaagttgc qagactccgt gaattaacgt ctcccttttt ttatatttgt aagaaaataa t tttt ct cg t taaaacaatt aattttcatq tttggcattt ttttttcatt acttctaaaa aaattaaatg acctgatttg tatgtataat aatatatata gctgaaaaat agaaatatgt tgagctcaaa aagctttttg caaagaattt acatgtttct tcaaaaacat aagtaaaata tttgagttct ctgatacagg tgtaaagtca tactggctga aqggataaaa acacaaacag at a atat aga acacagagag ttaactgcat ttacttaatt tgcqgtggcg acctcagcct tcagtaaaga aatccgcttg actggctggc ttttaaaact caaaactcca accttqtaaa tttttctata tcaaatgttt aaattcaact aacataattt ttacccttgc agaactttgg gtggccaata tggtgtgtgc aggaggcaga gaaaataaga aagcatgtgg aatggtctca actgcattta tattgttata attataaaac ataatacagt agttatttgt atacaattta ggagccgagg aaaccttgtc tcccagctac agtgagccga ttcaaaaaaa caccctgaag attttgagag taacaaaata taaaaattac attttaagac tttttctgtq cattgcagtc tagtctgaat taaaattaag ggatgtgagc agctgttcta aaaaacaagt cttaagttac accttattta aagtcagtta gt tttt t ttt tttcttaggt ataggagtga tcttcatgaa ttttcttttt taaaaatcct gtgtacacat cacttctgct aaatqagaag ctgtattcct gttcttcaca atggcagaqa aataacatag tcttaaacca aaagatgggc tctactaaac aattattatt ggatccggac cccaggtaac agaggtttca ccttggcctc ctttcttgat ttccctttgg actgtgtttt gtgtcttttg tattaggaga gaagtaaatt tactaaatgc 275640 275700 275760 275820 275880 275940 276000 276060 276120 276180 276240 276300 276360 276420 276480 276540 276600 276660 276720 276780 276840 276900 276960 277020 277080 277140 277200 277260 277320 277380 277440 277500 277560 277620 277680 277740 277800 277860 277920 277980 278040 278100 278160 278220 278280 278340 278400 278460 278520 278580 278640 278700 278760 278820 278880 278940 279000 279060 279120 279180 279240 279300 279360 W0005851 0 flhttD:IlWWW.a ettheoa tent. comlLo in.d oalSexa m -su o nortFetch/Defa ult.d oalwOO0585l i .cpc?frarnCa ch e= 1 part= ma intoolba r--bottom] Page 483 of 737 WO 00/58510 PCTIIBOO/00435 ttaatgtcaa acagagagtc tatttttcaa aggtactaaa aaaattctat cttatttctt agcctttata aatccaaayg aaaggtaggc tctatccaag ctacaactaa agctggctga tccaaataat atatcaacct tgcttagctc gtgtgtgtca caataggtat acttatactt accgtatgac tatatatatt ttatataaca gacttttagt taacaaattc tctgaaaaaa gatggttcat ctgaagacca aataaatttt gataatttta aaatttcaga aatgatctac ttttactccc gaatcatttg atccaatttt tctagcctct agtcacaaaa taaactgatc caagttatat taattgttaa gttgcaagtc cttccttcac attcctgcca tqaatctatt atgtgatatt tcttagtaac gtgatggtta gtgagggtgt cccttaatct tcgaaaaaaa gctggatgct tqqcttcctt taatattctc tctatctata ccacaqtatt tatgatgcag gccatttgct taaaatgtta agactgggat attacgttct tgacaagaat attttgatag ttacccctct atgattttcc aacacacatt tgtcattcaa atggaaaata aagqgaaata ataaatataa atttttgcta ta tggagctg tgatattata t att cttt ga acctggcaca tttcattqac aatttaaccc agaagtaagc tagaatcaga tgtggataaa tgcgaatctq tgtgaaacac cagatatcac tgaaatacgt ggttqtaaaa tgttttctga aagtacacca aatataacag tgtcctgttt aaaaaagaaa gcctgcaatt ggagttggac aatttgaagc tgcctgattt aqtggcttca atggtaatta caaataaaat atatgtttat attctqcatt aacatcctgc atattcatta attgtactct tttataagtt gttagtattt tcaaatccta tacagagtat tatgattgca cacagttttt ctcaaattgt agtttctaca atagtgtcaa tgccaaagga gggtgggcac tgtgaaaagg tcctgcactc gctcctcagc taataaactc ttctattact atttacccac ttgttatttt tgagagtttt tttttgttaa atatqtgaaa tctcaggttg atttgggctt taaatattgt gtqattatag atataatgac tttattgact acacaaagta taactcataia tatatacatg tgtaacttac tactaattca tcagagctag cttaaatcat aacatttgta atccatctct ctttagtcta catactgata ctttccaatt ggaagagcga tagagggtta ctaattctca ttcgtgcaag tgcacaqtta cactatatga atgaagttta tatttattat ttgaacttca cattttagga taattattta aagaaaaaga ctaataccct ctgggcgact aatqgtctga tgatttttct cacttaattt ttttatgtgg atqgatatat gctgaaatag acgaagtgtt aaactggcat aaattaaaaa actttccttt cataaatgag atcacagggg cttagatata atatgctgat ttttacagta atatatactc cattgattat tcctggaatt cttgattgaa gattaacatt catctaatca ctagactggc gaacatcgga ttgcagacaa tcctattatc tctqtccctc atataqtaac ccctcatata tagctaataa tattgaatct tgatttaccc ttacttcata tggctgaagt gtccaagggt aagacttata cattagcttc acaaaccata tatatactac tttataattt tatacataca t aat aaa at c actcttttgt tttactcagt atgcaatata atgtgtattc tagcccttct agctcctatg aataattggt aataataaaa gagagaqaga tagaaatgaa ggagagtaga gtaattttca gctgcaccta caatggtaaa ctacttttaa cgcatatgaa tgaatatgaa ggaattatat agtcacagtt aaaagaaaaa gggaagctaa tagtgagacc qaaaqtgaga aacatttctt tcatgatcat.

cataattctc agctctttgt aaccttaatg taaataatat cagaataatt cattacatct tttgtaatcc gagtaaattt gaaaggcctt tattacttgt ggctttat tt taatacgaac catgaaaatg tctggtccat cataataata gtatgcaaag tgcatcagtg gctgccagca ctagcctccc ctccaagttc tctaaagcgg tatctatcta tagagaaccc cattagctta aacgagaaat gtgaccagga cagctatagt ttatttatat aacgqtataa ggaaggactt gcccatcctt tcctgtactt tcaaaggaac atttttgatg acttaattaa acaagtctca tacacacaca aatgtattgc gccacattat aaaatactct attcatatta agtaaaaata cacgttgtat gggaatttca ggtcaataaa attaaaattt gagagactga ttgacaaacg aaagacttga ctctttattc attatccagc ctgtagcatt acattccatt tgattttata atcataatct tatgagctga ttactagtag caaaagatct ggt tggaggt ccgtctctac aattgtcgac actttaaaaa tttcaatgtt taqttgagga catatgagca actcatttat ggtataatat tacttttcct ggaaatacaa gaatggtaag tgttttataa gat tcaacaa ttgcgtactt tttagcactt atgttcataa ttatactttt tgttgagaga acaagagaca tattgttcct ggctgggaaa cagccaggac agcttacatc ttcagctttg gaccctgtga tctatctatc tgactaaaac tttaagccat ctgaggatga cagaaattata aaacaggata tccaggaaag ctttttattt gggactacat taaagtatgt qataatggga taaaaaagtg gtctcataat ggattcattt acattttgca tttaqatatg atgaattgtc gttagagtca gtatgtttac tgtgcaatgt tactgaaata tgaaatgatt taccatqctt tatttgtttc tatgggattt gatctcaggc tgctgtaaat catttatcaa cttttagtac taatttttct ttcaaatttt t taat t tata tgtgattaat ggtatacata gtggcaagga tagaaacaat ggtcagatgt tgtagaattg aaaaaataaa ttqtaccctg ttatccttga tcttccaaaa gacacgatgc catgttgcaa atttccttac attgtttgag aagatttaat ctttgctgtt gtataattta aaacaaacaa tccctgccaa ttaaatgtgc acattcatag agatttcatt aatatcatatt tgttcctcac tttagatagt gggtgtgtct ggcagaccca attaagcagg tttctcccgg ggacttggac tcatgtgagt tatctatcta acatagtaac accacaaacc cagaagttaa cttatctcta ttttatgtac aagaaaaatg tgggatatta gtcaaatttt aaattcaggg aattaactaa ttaatgagaa caatttaaat 279420 279480 279540 279600 279660 279720 279780 279840 279900 279960 280020 280080 280140 280200 280260 280320 280380 280440 280500 280560 280620 280680 280740 280800 280860 280920 280980 281040 281100 281160 281220 281280 281340 281400 281460 281520 281580 281640 281700 281760 281820 281880 281940 282000 282060 282120 282180 282240 282300 282360 282420 282480 282540 282600 282660 282720 282780 282840 282900 282960 283020 283080 283140 W0005851 0[ [tp/Mvww~etthepatent.r-om/Login.dog/Sexam.suplportJFetch/Default.dogNVO00585 1 0-rpc?fromCache~ 1part=maintoolbar--bottom]_Page 484 of.737 WO 00/58510 PCTIIBOO/00435 atagaggcat tttattttaa atgaattgta ttgtatccaa tccattatat agtatttaat aagttgctgc acattttctt aggctggagt gattctcctg ctaatttttg ctcctaacct taagccaccg ttagaacggt qtctttttaa attgaatagt ttgtactaat gaaacggcta ctcattgttq ttcttttttt tgctgatttg ttgcaaatat tgtgcagcag tgcttttgag taggttaact taatggatgt ttttcccagc ttgtcaaaat ctttqqtgta agtatagttt ctttttttcg aaaatgatat tggtcatttt ttgtttcatc cct cct tggt gttgtgaaag aatgctaatg aaatctagga tctaagccta cttggaaatt ttttattttc ccccaaaccc aacaaacaca caatatttta aagggactcc agqacgcttg qatttgcaca actgtcaaaa tcagttgatt caaatggctc ctcagctatc tatgttctaa taaaaaaqca attaacaata ggatgatg tgtcaaacag aataaataaq tqggaaagag cacaatagaa gatactqgtc ctccaaaaag aacaagcatg ccttaatttc atttataaat tttttttatt tagtagtgaa tatgtcattt tactctacat tttccattcc aaaagacatt ttcttttctt gcactggcac tctcagcctc tatttttagt cgtgatccac cgcccagcct tccatatttg tataatgact agatcccctt gtacattccc ttgtttgttq tcttaatttg gagaaatgtc tttgagttat tttctcttat ttttttagtt gtcttattca tctagaaatt atqtataagt accatttatt taagtcagtt tgtqtctact caagtccagt ggctcttatt tggtattttq catgatattc tacaattttg taactatatt gggttgagtt atttqtgtac gtctttcttt cccttacatc ccctactctg cagatggaat ttctgcagta ctctttattt ttttaaagca ccccacctcc gtcagtaaag cgtgaagcca tcaatgaaaa gatataatat agtgaattgt tacaatttgg tqctcagcaa aaactttttg aactaaaaca tagatcacaa catccctgta ctgcacgtgt actcagggca aagacatttc atcaaagcaa ccattttctc ggccatgtat agggaacata atcatttgca tcaatagctt gtctgagatt tttatccctc tttgcatacc tgagttacct atgtttatgg tttttttttt aatctcagct ccaagtagct agagacaggg ctccctccct ataccacatt caattgtgaa tctttttatt ttatttcttg accagcaatg actttttaat cattttcctg tgttcatgtc ttgtagattc tctggagatc taatgtgggc ttaattcttt tatagtttca tgagagatcc aaacagtggg gtaagtattt gtatactggt aacgtgatgg ttggttccat atagcaattg attcttccaa ttcagcaata accaggcatt cttaatttga aatgattttg atgatgtaaa ccagttacgt acccagatag aaatgaagac gtcttttcac gttcacctaa tactggaaag accaacacac gaatttctca ggcttcacat cttcacaata tagataagtg ctaacattcc ttggcagggg actgtgaaat gtatgttaat attctacctg a at caaa ga a aggaacttag gttttgcttc aaaaaaqagt ttttcaaaga gaccttatac attcccctaa ttaagaaaac aattttgcca tttgttgttq ttgggataca ttaacacacc accaaacctc cagagttccc cacttagaat ctgattagta tttttgagac cactgcaacc gggactacag tttcaccgtc cggcctccca ttctttatct ttgtgctgca tgggtagaca actaaatctc tttaagcatt gattgcattt at aact cat a atttgcacac tagatattaa gtctatttgt caattaattt gcctaggcct ggtcttagat agtttctttc tactttcccc ggatttattc accacgttgt ctccagattt atgaatttta cattcaattt cccatgagca ttttgtagtt ttattttttt ttctcagctt taaattgaga aqagaagcaa tgctaactca tcttttgatt caaaagaatg tgctgaaatc cctgcatgcc aacagaagca acaggtatcc tgatccctcc gactgtattc taaagaatat caggatggta atggcaaatt aactaggttt tttccatgaa tattgcacca cttgattgaa acaqctacat tctacagact cttgtatt ct atattgattg aactgagtat tttgtcaaag atcattctca agaatttacg aagatgatat gatttttatt ggtgtttgtt agtcactcaa cctcttctga acttacaagt aatggcctcc ttccatggtg agagtctcac tctgcccccc gcacctgcca ttgcccaggc aagtgttgag actcactggt ataaacatac cccagtagtg tacactgttt gccttttcac ctgcaggagt tgtttgttag ttttgatggt tattttgtct tctgataact at ttt gtt ta atgtccagaa ttcagtcttt ttctacatgt aatttatgat ctgggttctc tttggaaact gttcttattg cgtttttaaa gtagattgtt tgggatgtga ctccttgtat atttttgt at ggttgttgtt attcactaaa aggccaatgg gaaaaatcag aaaatcatat tttatgtgga gttgatatac tttattcctt ttaaagaaaa tctttctcaa tcctttctct cataatagca agctagaatc acttttataa tgtatgaaga gtgagtttgt atataatagt acttgtgttq gcaaaaatgt agtctgactc cacataggcc ttgatgtcag acagcttcct aattgtcaaa tttactttaa gtatatctca ggaggacaag tgccatacta tgatatatta ggttacatgc atactgtaca gtctccaaag gacaacatac agctccgtcc tatctatacc tctgtcaccc gaggtcaaga cctcacctgg tggtcttqaa attacaggca ggatggggac acctgtagat ggattgatgg cccatcgaga catattcaca qaqatggtat ccatttgtat ttttttttct gatgcacagt atttctttgc cgtttgcatt gagttttttc gatccatctt ggctagccag tttgtacgtt tatactgttc atagccttgt catagaattg aagtattgta ttggtcagta ttccatttgt agatctttca gtttgcagct ggtgcatagc tttggttatc agtgtcaccc ctgaagggca ggttattagt aactgtgttt taccattata agaagatttt aaaataaata ttcatcagtg acagggcata caccaaaaac atggtaatga actaactttt ctacctggaa ttcccccctc tacgtaaata tttgactact caatgtgtaa agacaggaca ctgcctcagg ggtcagatac caagacagcc aaagaaaata atgtcacctc gctttcatta acagaccaga ctatttctgt 283200 283260 283320 283380 283440 283500 283560 283620 283680 283740 283800 283860 283920 283980 284040 284100 284160 284220 284280 284340 284400 284460 284520 284580 284640 284700 284760 284820 284880 284940 285000 285060 285120 285180 285240 285300 285360 285420 285480 285540 285600 285660 285720 285780 285840 285900 285960 286020 286080 286140 286200 286260 286320 286380 286440 286500 286560 286620 286680 286740 286800 286860 286920 W0005851 0 [tqpL/tww.getthepa tent.co m/Log in.dog/Sexa m. su port/Fetch/Defau t. dog/WOO 0585l 0.gpc?fromC ache= 1 part=maintoolbar--bottoml Page 48 of 737 WO 00/58510 PCTIBOO/00435 gattctctta aaaaagtata ttacataggt ttaagcccag agaccccagt tataagtgac ggcttccagt atagtattcc tctgagttga tatcttaaac atgaacagat aatatcactq cagaatggtg aggaacactt ggggcaattc gggtatatgt tgatgtgttt acttaccaca tgcacartct acagqaaaat agcccagttt tggatttaaa ttattgcaga gtgagttcct atqaacataa cccctttatt acagagagtt gaataaactq attctactta ggcataatcc cgaacaaata ataattaaat taatggaatt gaattaagta tcaaqtgtqa qcacaagaga tatttttaat caggttgaat gattaagaat ggaqtctact tgacattata aggaagggaa ggcaagttaa agggaaaggt a cagg aqa ga aattttcatc atctaaaatg agataaaact agggatgtgg acattaccgc aaaatgtaat qqattacctg ttagctgctq tggcatgtta cctattctac aagctttgqt actgtttaga ttttaaaaaa aacagtatct aataaaagga ggatggaaaa cttcttttcc atgattaatc qgatcctgat ttatatttta aagcatttgc catgcattag gtgttgtttc aacatgtagt tccatccatg atgatqtata ttccatgtat aaatttgtaa acttctcaga gttattagag attattaaaa ttacactgtt ctcaaagaca ccaaaqqaat tattagttaa tggtgtatca cctcacttgc ctgaattctc tattacctgt ctcattttcc cccactccac aqagtcagag tgaaataaca aaagttgttg atatgtgqta ttaggacaaa gctggacaga ttgcaqacaa tacaaaggat taggttattt taaaatcatt attctataca aaattagtaa ttattacata ccaaagcata ccaqgatttc gtgagaaaag ggttactaga qtgtactggt ggggacagaa aagtagggca aagaaggagg ttgtctgtaa atgqaagcct gccaagatca ctgtaatggt ggaatcctgg acttcatgtg acgaaattaa ggtaccatca accgctgtac aatggactta caactgataa tagaccataa tattacatat atgtactatc tgagcttaac aatacttaaa gtctattttc tgtttaggtt ttattttacc gccttgtgtc ttttaagttc catggtggtt ctatttatcc Cctccctgtg atttggtttt tccctgcaaa tgtaccacat ttgctatggt gaaaaaaaca agaaqacatt aaaagcaaat aqtcaagaaa ggtggcaata tagaaccaga ataaatcatt aacaataatt tgcaatgcac actctttgct acaattattt atgacactta actttggtat cttgtgttqc tatccaggga tttatgttag tttcatatta tttgtattac ataaagaggt aaagctttct qaagaaaaqt gaggaaggtg agaaggtaag ttttaggtaa cattttagaa qatqaagagt tatatgtgtg tggtaactga atgggagata aagcagttgt aqgtttacaa ataactcttg gataaaaatg ctaqagcaga cgagaagaga aagggaqaaq aaggtaaaat atcatgatga gacagcaqcc ggtgttgaac ctttgctata tataacacct gctgaaggat tactctgctg gtctctgttg attgaattgt ttttttgtca acttttgctg agcagtggta aaagcttcag gcaaaggtat ataaaatcta aaqatctttt tttacagaag ttagttatgt tgtgatacat tqccacactt tgatgctctc tccatatgtt ctgtttttgt ggacatgata tttctttatc gaatagtgct aacaacccca catgcaqcca ctaaaccaca caacagatgc tcaattagtt aataccattt ctgttatcaq tattagttaa actaatgaac tatcttgtgt ctaaagcttt gacagtttac ccccatattt agtgtqtgta taqctctctt ctaaatgtat ttatatgcca ctttaaagat acaatacaga agaatagatg gctttccagq gagcatccaa atcatagata gaaagattcg agctcattct cagt aatagt tgtgtgtgtg taacaggcgg gaaggaatga aagtqtgttg agagacctaq gtgctatttg gagggaggat agacagaagg a cct gtgt ga acatggtcac tttcagagaa taagtgaaca atcggagtqq atqgcctatg aqcaggtcat aagagggtaa tcaaaccaaa tcaaatccaa tcccttttag tattactgtt gatctgttgt aaattcagag aatgataact ataaaaacaa ttatatgttc attttttaat cttctcttqa tactgtgaat tttttcttaa gtgcaggaca atcaatccat cctccccaca tttattgttc gttagtttgc tcattccttt cagtctatca gcaatgaaca tcaaaaagia acaaacaaga agataccact tggcgaqgct caaccattgt tactcagcaa gaaattttaa aatgttgtgt gcttcaaaat ctgatggctc tattaccttc attgtaatcc agtcattatt tctgtgatcc taaacatcta aaagagaaaa acaccatact attagagcat cactgaaatg aatctcaaag tgaaagaagc tttaaggatc aacacacaca ttggaatgtt gatatcctat qaatctaaaa tgtgtgtata gagtattaga acagtgtttc aacttttgac gtgqatatta gggttgctaa aaaggggaga aaagcgagqc tttccaacat gaggaaaggg ggatqtttaa ttcagataaa ttacatggta tctcaaagtg ccctcgattc aaaatattag ctctgttaga tccttgccaa tcttattttg ttacagtaag tctgaactct gtactcataa aaaatggtat gattgcattg ttatgtgtat ttacaatata aagattatgt tagcagggca tcagaagttt tga aggt tt g cacctaggta accccgaaat tgctcccact tgaggataat ttatgggtgc ttgatgqgta tatgtgtgca ggc aaaqga c aaaaaatctc tcacaccagt gtggagaaat ggaaggtagt tcacattact agcttctttq ctttcctaac tagccttaaa ttctgcatga ccttaaccca caccctctaa tgtacttctg cctgtagagt atgggattct tatatacttg agtcctattg a aaat aatt g ggattggcca gataaacgga agtggtacaa aaaataacaa tgcatgtqtg ttagaqggaa aaagaatgtg atgtqaatga catatatata aagggtcatc cagacactga gtctatacaa ctagtctttg aaatgaaata acatgagagt atacaaggta ctaagtgtgg ggtgctagca tgtaagtgat gtttcagaac tggcctgggg gtgaccaatc aaaatgtgtt tggctttctc ctcagatgcc gcctctccat aaggcaccta atttggtcag ccattaagga atttgacgac aatttatctt aatatcatgc gttcttacag gagccctttg atattttaat gatattatga 286980 287040 287100 287160 287220 287280 287340 287400 287460 287520 287580 287640 287700 287760 287820 287880 287940 288000 288060 288120 288180 288240 288300 288360 288420 288480 288540 288600 288660 288720 288780 288840 288900 288960 289020 289080 289140 289200 289260 289320 289380 289440 289500 289560 289620 289680 289740 289800 289860 289920 289980 290040 290100 290160 290220 290280 290340 290400 290460 290520 290580 290640 290700 W0005851 0 [http:Mww.getthepa tent.com/Log in.d o/Sexa m. su porttFetcIefa ultd oqNVO00 5 8 5 1 0.cpc?fromC ache= 1 Pa rt=ma intoolba r--bofto mlPag e 4 86 of 737 WO 00/58510 PCTIIBOO/00435 catctcctta acatatgaat acgtagatcc atgtaagcag gctcctgqaa atctgggttg agaaaaccta tgtagtggaa catagttgaa cccaaatttc cttgtcaaga ttgactctgt taatcttgac aatataaaca qaaacqtgat taaactattt atggctttaa tttttgtact aatcttatat gagtttctgt caccccataa aagttttaaa caaaaatcat aaaagaaatc ttgtagctgt attccatacg qatattgtgq tctagctctc tctggacttt atttttccag ttgtcagaca acaqtgttcc agttacttca ttatttcata aagtttttac tgtttataga ttcttctaat agatactatg ttattttaaa gccaacagga agaacagaat aataaaataa taccaaggqa atccacctgt aacccaaaat aacataqgtg aaagcacaag atgcattaaa tgcaaacata agcagtaaaa gagaagatac tgcaaatcaa ataagcaaac cattgctagt ctcaacaagt ctgagagaag aatttataac actcacaatc gagagccaag cactaccatg tcctttccac caacaaagcc agcagcatat ataqaatatt aggtggctca ttcatcttcc aaagtgttct cccacactgt ccacataaag ctaactaatg tattgtggtg agtggtttga tttgtgtaat gacataattt ttacgagttt ctctatgtac ctaatatcac ttaaaagttt aaggatggct aaccataggc tcatggcaat tttatctctg atattaggtg tatagagatt gtgcacaatt tgcaatcttg tattcttgcc taacaagaaa tattgtggtt catctaactt aatttcttta attaaaatct aacaaggtga taattcaaca gtagqatata acataaataa aaattctatg agccgagaag cttctcaaac taaagwtaca taacaagata cccaaccaga ctgttagaga aatagaataa acactaccaa aaaataatga agatcaaaga aaaatatgca caaccaaagg ggatactatc tgtctgacaa acacaattca acaaatggcc acctacaatg agaaacaaaa aggaatgaaa taaacataga tgtgttagtc ataaaagagg acaqcagaag tgaaaggggc agaacagtat atgtgggaag atatctgaag tcattatagg attccatcat taattgtggg aatagatatt gagcagattt cccgtgagct gtagagtttt atgtttccta gatgcttcat tcagtttaag taaaaattat atcatagaat tagcagatac agaatagtgt tattttagta tttcaattct atcaactgga attttattat caattaatga atactacccc caaaatataa gataaataaa tcattccatt cagactcata caaaaatgag tttcttctta aagagcagaa gaaaacatta ccatctctag tctggaccag aagatgtggt aaatgtgttt ctacattttt tctgttgttt tgttaagaga aatt ccctac cagaamccct caggaaqgtg tttttccttt tgtagctttg gcaagccaaa aaataagaga aaqqagcttc gtaaatatta atcagaacac tctaaattta aaagttttta aaaatcgata aagaaaatga gtattaagta attaaaagat aataagcagt aaatagcact caactattgg catggtacag attaccatat cattttcaca tttaatggac gtgaaagaca tttgccctta ggagaaaacc tatgqtaacc taagacaaat taaaagaaga aaaaaqqaat ctgccaaata taagggcaga atttttcact ttgttagtgt tgtcctgaaa qaatacccgt tttagtaagg atgagtccat aagaaatact gtggacaaag atctttatat catgtctgga ttaattttag aagtctattg ttttatgtta gtagtatcct ttcagaaata tcactgattt taaaaaataa tataaccaaa ccctttaatt gctattttta actcagttta gacaagagac aaagccatgg tctggaagtg agatgtgccc gtaagctcaa atcagataca a aaa act agg ctatatactt tgctcttgta tctgggtcta agtttctttg a tggctgaag ttcaggtcac aaaatccagt gcaacatgtc aaagatcttt aaaggagaaa cacacaaggc taaataaaat ctacttcact ataagtataa ttagggaatg aattagattt aaagcaaqta tctagaatgc gaqcaaagtt gaaaagatac ttgcacctac tqtggatgta ccactatgaa gacccagcaa ctgctgataa tcccagttcc tgtcttacat taaaaccatt acccccatga acaattcaag tatctcacaa aaaaaggcac gcggtagtgt gtacatgatc qcacctaaac gtaaccaaat gttttcacca agc taa agt c catgatcaaa gcctcttttc gtgtgacatg gcaattatct tgattaaaaa tggccaacct gagaaaaaga aaagatattt catcatcaag ttagcaatac tcaaatatta tatttaattt ttgcttggct aaatatgctc ctgctcttgc tttcaaaata gaaactataa acagtgtatt ttgtgatggt gaactataaa agaccacaac ttgacaaaat agatctcagt cttttctatt tttatccatt ttagtagaaa ctcttccttt aatgtaggat gccgtcacta actggtcctg tctgtaaatg ctgtaagcaa atcttatttg qaatgacaga tgtactgagc tgttgggttc acttgctgga tcatgccata atataaaact agttcttata tatcaaaatt acagaatagg ttcaagaact caatattaag tagcattagt taggtggcta gagtaatcgg aaaagaaatg ttccgcagct acacatcccc acgtggctga ggcagccagc gagatctcat ttcaattatc atgaaatttg aactatacac atgtccatta tacatactac ttttactgga tgaccagcca gtatttacat aqgaactgct catatattga ggtttgcagc ttccattgat gatttaaata caaactaaaa atatattcta ttctttgaat cttcatgtga ggcacacctt caqaattata atgagatgtc ttttagtagt ctattttata ttattaaact aaatattaag aaaagtgaaa ttagatgata tttttqattc tccaaagaaa atctcttaat tataggcagt aggttctcgt gattttttcc ttagtatttg tttcttttat tttttcctgt gtgaatcata actattacta ttaattttty tttgtctggt atagagattc attcaaaqac attttatgcc gataggctat cagcttaaga agaccaaaaa attcaccaca gaaactgaat tacaaaaact cctagaaaga tatgatgcca aaaaactttt agaaaatatt cttacaaatc ctattcccca cattagagaa taattaaaaa aatcctcata ttttcagttc aggtaaatgc ggggctggqt ggagggcctc aagagaggat cagacttatt tcccaccatq qgtggggaca caatattcct tattcataca atgatgaacc 290760 290820 290880 290940 291000 291060 291120 291180 291240 291300 291360 291420 291480 291540 291600 291660 291720 291780 291840 291900 291960 292020 292080 292140 292200 292260 292320 292380 292440 292500 292560 292620 292680 292740 292800 292860 292920 292980 293040 293100 293160 293220 293280 293340 293400 293460 293520 293580 293640 293700 293760 293820 293880 293940 294000 294060 294120 294180 294240 294300 294360 294420 294480 W0005851 0 fhttpltwww.getthepatent.rom/1agin.dog/$exam.supjpartFetch/Defaut.dofIJO005851 0.cpc?fromCaches 1part~maintoolbar--bottom]_Pane 487 of 737 WO 00/58510 PCTIBOO/00435 ttgaaaatat catacagaag gccagtggct tatcagaaaa aacaaacaaa tqtcagtaaa tacacaagta tatagtcagt aactacttgt tgcttcttct tcttgaaaat ttcactttat attttaatat gtaaaattat atttttacat gaaggaaatt gaaaattgtg gatagatgat gttgcaatgt tgattggtcg tgcattggtc acattttatg gtgtqqaagc ttttcacttg gggtcacttt atqgtttgtc ctctcactcc agaagtgctg cataatgaac ttggttgttt agctcctcga atqcaatgtt atggagtctc gctcccctc tgggactaca gtttcaccat cctctcaaag gttttggctc cataactgga tccttttctt gtttcttatg cttccgaatc acatattttg aggagacttg atcggtagct gaataggtgt agaacacact accctccact atccaatgag aaagactaca aacqctatgc cctaactttt agaat taagt acctaaaact acatatatac aaatatccaa atatatattt cactatggac cctctttttt ttaaagttgg catattctat gcactattca attaagaaaa tatgctaagt aaatgttcag ggcgggagat ttctggattt acactaacat aatgctaaag tgcatttagc taagattqaa gctgggcact agaaaagatc tattgaggac tagatattaa aaataatgca ttcatatttt ctgctccaqc ttgccttgca aatatatatg agatagataa gtaatccgga ttctttcact atttggaaaa atacaaataa cgtaagctqc aaagctagaa gttcatgttt agtcattctc aacgaccqca gatttcatct acttttcgct gtttacactg.

ttcttcatct agcacagtqa tctctqgcgc ccgggttccc ggcgcccgcc gttggacagg tgttgggatt cagagtcccc taactgctgc qttttcttac gttattttat ttctctaaca aggagttttt tgaaccccag gaaatgcctt tgtgqcctct gctttctaag gtccttgtta tgacctgttt attgcatttt ttttgtgaca gtaatggaaa ccattgttct gaatgtaaga act ggggaaa atatttctta ttatatgtat agaagcagta cttctqatcc ctatgqaCag attataaatc caatagcaaa tgtgtcacat gaa aca agt c aacaagtaaa ttccattaac catatttatt atactcttgt taaaacaacc ttttataaac tacatgttta gtcctaggtt aatgatttga cccaaagaac actq'agaaaa tttattaaaa tgcaaatatt atttagtcta cggatatgga tatatatatg ctacatcagc actgtatcag ttgaaqagat ggtttgttca cacttgttaa caagctaatq ttttataatg gaaaaagaaa tcaattagaa tgagcgcycc gaggatgtga gcttcatcaa gqtgtgtagc gcactttcgc aaaagacaaa caaggctgga qccattctcc gccacgcccg atggtctgca acaggcgtaa ctaaaagtgt tctagattct acatgggaga atggcttcat tgccctcttc attatgttca agtcaqtggc agtcttgctt tagtaactga tgagaagaqc ggttatagtg tgqgaagcaa agaatataga gttaatggaa ggattggatt taacctgtta ttttgtgagt gaatatcaaa tatacacagg gttttggtca ccatagtttt atctccttcc caaagacaag atgctgctat gacttggaac atacaccatg 186 tgacacgaaa ggcacagagg agctaacatg gt tgcagagc aactggtgaa tgaagagttg aatgtcttgt attcctgcct caaataattt aaacattttt tattttttat aattttaagc tattttctat ttgacatctg ttgcaggctc aaagagagga tgtgtgtata actaaacaag tgaaattctt cttttaatca tgaagstttg taccaccact gtggcacaca aataacaagt agtctgccaa gcgaagagct ctgccgtcaa aaaaggcatg ggacgtgctt agtgaagact cattgatgcg tacatttcgt gtgcagtggc tqcttcagcc gctaattttt tctctttacc acgtttctta attgggacac aaaactttct ttcttcctca gatgcacaca ttgcctatag ctctgggaga agtgcctgca cagttatttc gtgatgggag ccagcttcct cttatcaatt acatgttaaa ctagtgctac tttaaaaagg ggaatggaat ttcttcagtg tttttttttt aggtacattt tataggtatt tttcacttgg ttcctcttat cctccctcaa tgaaatgtaa aaagacacct caatccaaat qaatactatg gaccacataa cat aa a atag tacagggttt atagtgaata ttttqcttat actatatata taaattatta ttattgaata aacaataatt atttcaggac ataggataca atgtgttqaa tagaaacatt actgaagaga ttgttttggt gtatttcaat tatatgtgta tggtaatttc ataacctgtt aaagtgattt cagattttcc gttctcaaaa cacgttttcc actgtcaqat atgcctactt accaaaaagt ctgtcacgct tactcagqat aactaaaagc tcagtggcac ccactagttt tttgttttqt gtgat ctcgg tccctcccqa gtatttttag tcgtgatccg atattatggc ccagagacct ctgagttgct ttgtctctga cacatcctta atcatqacag gctttcgctc ctccctagct ctttaaatag a ggt cattt c gacagagcac tctctccttt agaaacccta caattgtgat aaaagtaaac cctaatacat acctcgcagg tttccctgca gttttattca tagttattgg taaaatagag atcaactttt ttccagtttg tttaaaatac gcacacttat gtccaacaat cagccataaa tgtatgattc attagtggtt ctttttgggt tactaaaaca gtgaaaaata tttgtagata ctagcaattt ttcattctgc aagagagaca acttttatac tccatcaata ataataaact ttagagaaga agattttcag taaaatgtat taccttttca cagatagata ttacatgttt acattaaaat tgcagaattt aattgttgat ggagttttaa qaaattctgc gtttccctta atgaattacc rggcagcgaa gccgtgcagc ggaaattcca agcatcgttt ctaqtgcggt tgctcccctt tttttttgag ctcaccacaa gtaqtgtagc tagagacagg cccaattcgg aataaatata gcctgagcac ttatcaattg aaatcctcat tatatatttt tattctacgt ctcagggtac tqctgctcac atgctaggtc tttgcttata cattagaaga acagggccca cttgaaagtt tgtcctcctg gtatctataa tatttctctc actgcaagct tgatatatag ttcaaatatt atggtaaaat catcagtgtg cttctcattc tttttctctt gcacatttaa gtttattgcq gatagactgg aaatgatgag 294540 294600 294660 294720 294780 294840 294900 294960 295020 295080 295140 295200 295260 295320 295380 295440 295500 295560 295620 295680 295740 295800 295860 295920 295980 296040 296100 296160 296220 296280 296340 296400 296460 296520 296580 296640 296700 296760 296820 296880 296940 297000 297060 297120 297180 297240 297300 297360 297420 297480 297540 297600 297660 297720 297780 297840 297900 297960 298020 298080 298140 298200 298260 W00L5 0q~I~lwwgqthe patent. comft og in_ o/Sexa m.suppo rtFetch/Defa ut. dofNO0058 510 0.cc?fromC ache= 1 part= ma intoolbar--bottom] Page 488 of 737 WO 00/58510 PCTIIBOO/00435 ttcatgtcct caaggagaaa acacatggac ggggagggat caccagcatg aaactttaag ataattagcc aactgtgact acaaaaataa attttttaga tttttaattt tgtaaataca taccaaaqat aattcatcct ttatctagaa qqcttttgtt ttgccatggg gtgtcatgga tqgtttcttt atttttgqta aaaggggata agagtgattt aattatacaa tagctgcatt cagttgtttc gtagaacac acaaagacgg atgtttcctc attgcgtttg cttctgcagt ctttcagatg cacttggqtg gtgtcctttg ttaatggtat tttttaaaaa atatrgtttt atattttaga tcactatgag tttccatggt accccttgcg tccaattttc atgtatgcta acattccagc caaaatttga tgtgctcttt taaagtaaac ataaaatctg ttgtggcaqt atgaataacc agctcataca atgatttcca agaatgataa caaccaatat cattatttct acagtgataa agctatattg agtttgttta caagagttaa ttgagatgac cctctttcaa ttcattataa aaaagttatt gcttctattc ttgtagggac aaaacaaaca acaggaaggg agcattaggc gcacatgtat tataataata tatgttacta qaaatgtatg attgaattgg gctattccac ttgaattata ctcatttttc attaggggaa gctaaccctt aactgagaga caacacaatt gtgtgtgtgt aagcgtggcc gca acat tat tgatagacat ggagtaaaga cttgaataat gcaagcctag aaataccaag caqagaagag atgcaataag gc cat cga ga aatcttattt tacagattac tgqtaataaa actctcatgc atcaccaaga atgttactgg agtaagtatt tgtcaaattt acaattcagt tgttttcaat ataaagggac tacattgatt ggcagggtct ttcctacatt cttaggcagc attccaaaat aacacgaaaa gcacgtgcat atacactatt aatgatgaaa cttcatatga catttgtata acgtacaagt ttatttttaa aaatggcaga ttatattaat atctatatct acctttctct aattccgatg tatcattaat ttttatttct ataatgccta gtgtgcaaca atgatatttc ttttaatgaa tccatagtag atggatgaaa ccgcatgttc gaacatcaca gatataccta acatatgtaa aaaaaaaatt ttcattttcc agtttctcaa ttaatataca attattcaac atagaagcag attttaaaca aaaataaact tagggtattg acaactaatt tttaagtctg gcacatatga tggggatttg tggagggaqt ggtaattact attaaagtga cccttcatct acacacacta agaAgccttg gcaagttata gcgctattga tattagagga cctttctccc aggaaaacac tgagatctac caccaggtca atgtgggact aggtqtaaaa tattatcttt taattttaat ggaattctct catgagttat gaaatgagtg cactagcagc agtatatttt gtagtactaq tctggcatga tctcaaagca ctgacttttt aaacaataag taaaatactg gtacttaaaa ataatttaac ggagtaaact agaaaagtga ataagagtaa atacggagcc agcttatttt ctatatagat taatatgaat tatggatqggg attctcatat atttactgta tcagtgcctt tcctgataat tat gtgt gtg gcatctgatt tgtaagaatt 187 ttggaagtca tcactcatag ctctggggac atgctaaatg ctaacctgca cttcattgac ttttattttt tagatgctat ctttgtaggt ttcgtaagct tttaggactt catgctttca gttgttgtct acagcctatt atatcctttt ttgaacagqa gaatatgtat attatacatt atgcctctat gctcttaaag aggtcatgaa ctccccatgt gtgttgaaga agttccaaaa gtacatataa attgggaggg gatttctctt taccgcctct tcaaatattg ttgtaaaaat atattcctgc cataagggca tgaaggtttt atcctggaag ttaattgttt cttctttata tgtcactatg ctaatqtaat atgtcctgaa taatgtttct atcaaaaaat ggcatgacat taaccctgtg aaaatgttaa aaacattatt agcaaacatt agtactaata caccagaata gatgcctaga ggattttagc tacatgtatg cccttttcca atttatctta atatatcttc ggatgaactg cctaattatc tttgctattt aattgtgtca taaaatattt taacttatct tgtatttaga tttagggagg tcaaatgtgg tcattctcaq gtgggaattg tgttgtgggg acgagttaat cattgtgcac ttacatgcaa ttcttgcaaa tgattgagtt caaaactggc tactgttggt aaatataaaa tgtcataayg taaaatacat atttttcata gcaaatgagt ctgttgaatg gttaatattc gtgctttgtc gtctttcatt tttgtgcaaa ataaacctat cataatcctt attgtgctgc cctccttaaa tctattatga aggtatcaga catatgtaat ttttttttta ctcgaagaag tagtgtcatt tagggatgag atggatgatg ttttcattct ggattttatt aaaacaattt ttattgtact ttttattaga tctacagggg taactcctgc gcatatagct acttattggt tatattttaa taaaaccata ccatacaatg aaaataaaat tatataagta gtaactaatt gttacggaag aagagaaagt acaggtaatc tatatgaatt cccctcgagt aaaatattat atcattataa atctaccata ttttttatta gcaaaatatg ttattactga caataacaac gggtaatgag atttttacaa gatctaagct acacgttaaa taaactatcg aacaatgaga tagggggagg qggtgcagca atgtacccta tgaataattt attatgttag attttgaagc cctgggaatt tatttatata atatgtaaaa gatcccaaaa tcctttgttg tgtgccatct gcaacagaat gcttaaaaat agccacctta ataaatttaa tagcttgtat tgccactggg taacaaaagc tctcataaat aaaatgcatt gtggaattct acgtatctqa gctaaagagc tctgctttac gccacaaatc cataatcttt gtctacaaca ttagttctta caggcgcata aaatcaaaqt gcttttgaca ttaaactttt tgcattaata aatatccttc tcagatagca tgtattgcaa ccaatttagc tgaacctata ataaagaaac gttaaagttt act aat gcag atttatattt ggggatttat tattgaatct gtaggtacaa cactaattca ttgatacaga caaataatac tccttctccc attttacact aataagatat tattattagt ataaaatttt ctggaataaa agtaaaagga aaaaaagaaa tgtatgaaag tagttttgtc ttccacacat gtatttctag 298320 298380 298440 298500 298560 298620 298680 298740 298800 298860 298920 298980 299040 299100 299160 299220 299280 299340 299400 299460 299520 299580 299640 299700 299760 299820 299880 299940 300000 300060 300120 300180 300240 300300 300360 300420 300480 300540 300600 300660 300720 300780 300840 300900 300960 301020 301080 301140 301200 301260 301320 301380 301440 301500 301560 301620 301680 301740 301800 301860 301920 301980 302040 W0005851 0[httpltwww. etthepatent.comLogin.dog/Sexam.suportFetchDefaut.dgAN0005 8 51 0.cpc?fromCache= 1 ~art~maintoolbar--botoml Page 489 of 737 WO 00/58510 PCTII-BOO/00435 aggaggatta gctgaaaggg atqtcattcc gagaatgaag ttggagatat aggctctatt actcatatct tggtaacata tctctgtcat tggggacagc gatgacttct gcaatgggaa gagagcccat ggacagctta tattttatta taataggtta aaaagtcaga tctcttcctt gctttgatca agtcttaata taactttaat ttaattatac taactatcgg ccccagtagt gaaagttttc atqgctgata ctcaaaccac gttttatctc tagtttgttt tcaggtatac ggtatagttt ttgtcagaat aactaatagg agtqgtaaga actgaaaaag gcccatgcaa attgacttac cact c tttgc agtcaagtta cgtacctgtt aaaaaaggaa tcagqgttga ttcaacatca tggcaattct attgaacatt ttcctcatga tatccaaaga gcattattca ataaagaaaa tcatgcgaca ggaaaacaaa tagagtacaa gtcggtcaga tagcaaggtg gtaatatgcc agatttaaca acatacaatg qggtatttat gatttatttt agtgatccct ctaaatatct acttccatca atgtgtgtat agtgatatga ggttctacaa aataaggact agaaatagtc tttctctctc tatctatcca ataccgatat tggcagattt catgattaag tatttttctc aaactcttga ctacacaccc caatcacgag agattgaaat ttattattqt ctagattttg aatgatcctc cttcaacaag ttcaggqtta aattcttcct tactgaacaa atcatggtcc tgtacaaagt tcagtggcta tggctagaga aaagtatcaa tqttaagctg cagacatttt tagggaggat aaacacgtga caaattgctg gttggttctc tttttatatg gagaaacata tctgctqtga acagaaaaaa acggattaca atttttttgc atatttaaag gtactatggc ataaaaaatc tattcctcaa ctaatcaaaa ccaaaagaca gttggtggga aaacaaaaat aaatqaaatc caatagccaa tgtggtatgt acaccaatga caccgcatgt tggtagctgt qcatacattt actctaatta atcaccacag agtcaacaat ttatctgtca aaaatqcata gcttaataga ttagaccttg attttctgcc ccaaaattg ttttagcaag atgaaactgt agaagtgtga atatttatct attagtgcaa tctctctctc tcatctctgc ctatatttat gtgtatacct gggagtaatg tgttataaga tgggagactt aaaggccaag aagatggcaq ataatagaaa tttqtaatgt taactaaata atccatttta gcactacgtt gtcttcattg attgggtggt tqaagcatgg aagggctcta cccacagatt aagtgggctt gttaacagct tgttgtatat tcacccatag tctgcccaga tgtgttggtt atgtatttgc a agc caaat a tctcatattt ttctaattat tggttagaga atacagtggt aaatggaatt aatttggtat tacatcatct tcacaaagag atatgtcttt ccaaaaaaca aagaagacat atcaaaacca aaagataacg atgtgaatta agaagtatca ggtatgtcaa ggtatgaaat atacacaatg acctggaaag ttcactcatq cagaggctgg acatttgata atgaaaatat aaattgtaac gaatatacac attaaaaaaa tttactttgt atagaataaa atgattttat ccagaaacaa caattaagaa aaagccagtt tggggacctt taatagagga agggatattt acatgtcaag cccctgcctt atatgtcttt atctgtaagc gttatcagtt tgctcttacg ttccataqat gcttctgtga aggaacatgc gaagttgtgc gttatatgac agaaaacatc agataataga gaaacccaat atcctcatcc cccatacttg aataaqatat tagaggtt ta ctttaattaa agacaccaga taagtaccta gagtqcattt ctgcttaaag acttattgta caaaagaatc ctcctatgag tatacagagt aaccaaatgg atgaatct gt gcaaggaaat tcagggaaga gggcagccat gtaatataaa attgagcttt ggccacaaaa tcctagaaat aqtcaactaa aataacccaa acaaatgaag cagtgatgata tgtttgcgag gtatagcctt tttgatccaa agaagtgtct caacctaagt caatactatt cattatgtta tggaattcaa gtgtttagqg gaagaaatga gattctattc agtgcaaggt tttataacat tatctaggaa aagtcaccaa taatagaata aaatataggt tcctttaata tattttcaca ttttgagctg acattttatg cagatttttg tgaaagaaac aaagaaaaca cccctgtccc atccatactt tgatcttagc cccaaatctt tttttgagaa tgtggcaaca cttaatggat aaaggcaaac cgttcccatt gtactctaca tacccctaaa caaaatataa caatttcaat ttccagcttt ttcctatttg attcaataag tactttaata tattttccac accttaggca aggtttatct ttagtaaaat gagatgcata gaaacaatta tatggaagta aaatcacttg ccatttctta gaagaaattg caaaggatag ctatcctgtc atatgttaag tgtgagatta gtcacaaata ccgggcttag ttttaaagac tttgaacatc ttatttttct taaaaataat agcaagtata acagctcacc gacgtggaga tacgaaaaac cagtcctact gcgct tccat ggacatcaat caaccataaa agtaaaagaa atacattggt gagaaatggg atttcaagag ttgaaaaatg aatgcatttg catgttgttc gaatctgtac atttgtgaat aattataatt gagatgctag gaacacttta cagaaaaaac tatgatggag tgtaatgaga gaatgaggta tggtgatgag tattacttct tctctccata atatctccat ctactcatca tacacacact t tgggcccaa atggcaccat tattagccct agagagacaa gcagttattc gacaagttta aatctgtgga tagatataqa ttaatccaaa ccttcccaca ttttaaataa gtgaaatgtc atataattta tagcaaaaaa ggtagtaagc ttattcatgt actgcaggaa tctgttcttt tctcacagta gtcatttctc cacattatgt cacacagcaa atqgtaaact actttttgta ttagcaatca tgaataggac agtagtaaat taatttgttg tgaataacat tatttatgaa acactgactt cgttaacaaa gag ta a aat a tgaaaaaatg ccagttagaa aaagagaatc agtatggaga actgggtaga gtttatgaca ggaaaaatgg aagaatgaaa accaaacata cacatgaagg atggagagat atctattata tagaatgaat tgaattagct atgataaaaa agaaqattgt aacattattg aaatatttaa t tt gct tacc cctttcctta cactattgat ccttttcact 302100 302160 302220 302280 302340 302400 302460 302520 302580 302640 302700 302760 302820 302880 302940 303000 303060 303120 303180 303240 303300 303360 303420 303480 303540 303600 303660 303720 303780 303840 303 90*0 303960 304020 304080 304140 304200 304260 304320 304380 304440 304500 304560 304620 304680 304740 304800 304860 304920 304980 305040 305100 305160 305220 305280 305340 305400 305460 305520 305580 305640 305700 305760 305820 W0005851 0 [http:/twww.g etthepatntcoI gin.d og/Sexam. s upportFetch/Defa uIt. docIAN0005 85 1 0.cpc?fromC ache= 1 part= ma intool ba r--boftom I Pacle 4 90 of 7 37 WO 00/58510 PCT/IBOO/00435 cattagtgat tataagcaaa ga agca gt ac aaccagtaag ccctcccaac aagtgtgttt agatacagaa tgatttgact gttgactctg ttgagaaagc ttgcatagta aagttactca actcaaagct cgaagcaatg tacagcatgt qgaacacagt tgcatcaccg tcctcaccca gaagtatttt gtttccccca tatttgttag tgtgatctcg ctcccgagta taatagagat ccgcccacct atctgatctg tcgctgtgtt gtqqcctccc ccagtcttga tcaagqaaag aaacgtggct tcaagttgtt gaa atct tt a ttaatgttct cctggaaaac acgatatata gagaatgcaa tatccattca cccccgaacc atacagatta tggttttctt ccttgacatt ttaatttagt ccttaattaa gtatgtggtg attctccaat tattgatgtg tatatgaata catgtqcact tgaatatqga cacacatagc aacattggaa agctqgaatt agtctctttc agqaagatgt tcattgtccc gtcttattgg aagaattttt tttttaaaaa cagctccctc tggcatgctt aaagattatc aaaattgaat gcaactgact atgacatatc tggctaaatc gtagagt tcc taqaattctc tattagcttg catatgaaga gttattcct ttccaatcct atgacctatg caagcctcac tctctggaga agcacttgca aagtaatagt taggatgggg gcctgacaat caagtacctt aatctcatct tccccacatq tgccgttctc tttgttttqa gctcactgca gctgagacta cgggtttcac caqcctctca atggttttat aagaaggttc cagccacgtg gggtatttct aaaggtacat tga *tcatgtt ctagaaattc cagtgaaggt agatgtattt atttagcctg ttttgaaaaa ctaatctcaa taaaattgat acaaaaatgt agtaaacatt actggqttca ttcactgtct tttacaatct aataaacttt atgagtagtg tattagctat gaaaaagggg tgtaaaaatg ttgtgtgagg cacaaataca cctttgctaa ggccatgtag ctattctact tttttcatgt atgaaagcac ttaacagatg atgaaatgat gcttcagctc acgtttctaa aagcttaatc gaacattctt ttgatagctt aatgttgacc tctgcacacc attacacata catcagtgta cgctccttga aaatgtgttt ggattccatc atccctgagt tcactcactg cagagcaatt aaaatgagtt tgatgatcac ttgtatccca ttagtattag agaaaattcc accacacctc aagtatgtgt tagaccccaa tqaattqtaa tggaagaagg gtgatagtga gacacagtct acctctgcct caggtgtgtg cgtgttagcc aagtgctgag aagcatctgt ttgcttcccc gaactgtgag ttatagcagt tgtagaatat tgttcattga caactattat gaatctggta gataagaacc tacaaagatq aacatttagt aattttaaat tgcaatatgt qtttatttat ttaqtaatga gaaagagaag tgctgcaggq cattgtatct tggtatttgg catgaacttt gtcagttagg caataaatcc actaggctag gagtgtaata gatacatctt aatgtgatca cttaagatta tgtttcctgt aaatgtacat tgtcacaatg tctttaaaaa aataactgta cttgaccttg cagaaatata tgtatgaact tgaataagta atacttctgt aatttaatga atcctacaga ataactcatt gtattggctc tataagaata gtcggtggct tgtgaagact tcctacatag gaaaaatagc cttgccaaac qaagctccaa tatccaccat gggtctagca ctgaqaattt tcttcatgtg ctttttactc tgaqtaaatg agagcataat tccccagttt gacctaatgg gttcttacaa tgctctgtca cccgagtt ca ccaccacgcc aaqgcggtgt atgacaggtg catttcccct tttatctttt tcaattaaac gtgaaaacgg caaaatatct gaacccactc tgaggcattt ataatacgta ttattctcag tatatttgtt ctcctaaaat aaataaccag tagtgctggc ttattcattt gcttacagat tatttttcag agttcaggag ggcaatttaa atagcaggat ggaattcaca gcaaattgcc tatcattcaa tccctgacta tccaatttct taccatttac tggaattagg aaaacataga cctatcttga atccatgtca accaataaaa tatattaaat cacatgggtg aggttgaaat ctttgtggat ttggggaaaa gaaaatattq ttttaatgta gtgtctgtaa agaagaaact gtggtgggtt tctattctac aggattccac catccaatat qgcatttcta ctgtcaagaa tcttcccaga ttcttttgag accagcccat atcttagaga caagtctcta tttaaaaaaa aaattcctgc acccattata aaccgctgtg acagatatgg tcttactggg gtaactgaat gatctgatgg cccaggttgg agcgattctc cagctaattt cgatctcctg tgagccacca gcttgcactt gccatgatta ctcttttctt actaatagac caqtaattct tattggcttt gcgtattaaa acaacattat tattctgagt atatttttct tataaaaaaa tgcttatagt agcttagtat taaaactact tttatacqat tggggattgc catgtataag gacatagaaa aatgaatacc gaccttggct ttaattcttt agttgtaatg tgggacatag gtattatcat agactacttt atttcataaa atttgcagac gcaagccact tagatttgtg ggagaggatt ttgaaacatt aagattagtg ttaagcctcc cattatacct gataagcact ctctttcatt aataataggt taaggggaat catgttcgta ctaagcaagt ctqttcttaa cttctcctgc tgcccaagga tcttactaac gtaaatgaac atcaagtatt aggtgctgcc accacqtgat tgggatttag cacaagtggt aatcggagaa taacatgttg gcccaacgat atcctcccac tttggctatg ttcagaaaga aatqagggca ttttgtttgt agggcagtg ctgtctcagc tatgtattct tcctcgtgat tgcccggctg ctctctcctg taagtttctt tataaaataa aaagaaagcc ttttcatagg gtatcttgct ttacttttta gctaaccact aaactcgggg taattqaaag tcattgttta gtagttgtat aacacatttt ttatagtaat catgcggttt ctagctgcaa actattctat agtaactttt cagacaggca tagatttcag aaactcaatg agcagtaaag catttatttc actgcaacta tccatgtaca attgaattat agacacaatg caacattttc atgtctatta caataaatgg gtttcagagt attggaagtc tcatctaqtt cattctaatc gtgaataagt ttattgacag atcaaattct ttataaatgt 305880 305940 306000 306060 306120 306180 306240 306300 306360 306420 306480 306540 306600 306660 306720 306780 306840 306900 306960 307020 307080 307140 307200 307260 307320 307380 307440 307500 307560 307620 307680 307740 307800 307860 307920 307980 308040 308100 308160 308220 308280 308340 308400 308460 308520 308580 308640 308700 308760 308820 308880 308940 309000 309060 309120 309180 309240 309300 309360 309420 309480 309540 309600 W0005851 0 httplM w.g etthe patent. comL cgin.dogSexam.suporFetchDefaut.doqvVO005851 0.cpc-,)YomCache= 1 part--maintoolbar--botoml Page 491 of 737 WO 00/58510 PCTIIBOO/00435 tttgcactaa attatttatt tggcccgatc aqtctcctga ttttagtaga gatctgccca accaattttt ggtcaatgca taaggttctt atqgaataga aaagacctca caaatcttcq gtatgtccca cgtgaaagac aatggccatc gctgtccttt ggttqagagg attccctgaa qtccactaca ctgatatccc attatgqtca cttcttatac ataaaaacaa caacaaaaaa tgtggactat gagtaaatta tacatgtata tagatagatq gacacatctc tactatgtat tatcttagca tcattttcct cactgctttt ctgaaatagt gacagcctgg caaaacttca ctggaatttt aaagcaaaac gtctctcttt tttcctcatt atgacccagt catgcctaaa aacttccaat ttcaagatgt cacaagggct gtttgcatta gttgaaaata attttttaac atcaactacc catcagtctt ctcaggggtg tccataagac atttcatcac atgtgtccat agacaattga agaatgaacc gaggatttta tactcagtcc qatgqaggtt ctatcagtct gggatcagqc ggaagtattt atgcttctqc ttgcagtttg tatttatttt tcagctcact gtatccggga gatgaqgttt cctcggcctc tatttttatt actgtggtaa ggttgcaagt tgtcagagac aaggcattaa ctccaccact gtattcagat acataataga acattataca tgaatttqca agaacagaag actaagaaga gttagaataa acatggttaa ctgtgattgt ttactggtcc taatgcattt ccagaaagtc tttttgactc gcatcgtccc caaatatata tagatatatg aagaccctca aatttttttc acctcagcat taatggaagc gtgctttgag caatctgata agaccctgaa tcaccatact ccacttaata tttgaataag cacacacata tccatacttg acatactccc qattctaagg taatgaacat tqtttcccat acacagtaag tattctttgt tctgaagaag agcagctgtt acccccccaa gctcctctat ccattagctt ctttgtcact agaacctgct tcttgagccc aatattgatg aaaacttgaa acaattaaaa tccctgtcac acgcatgggc accagctgta atctacctgg tgtttctact caaacacgga taaagttatt tgagatggag gcaacctctg ttacaggcac cactatgtta ccaaagtgct gacaatgctg agagaacaga gataaaaatt aaatgttaag cctgcaqtgc taataqaact cttcaaaatt tcttcaaaaa ccatggactc tacctccaca ggatgaaatt ggagggattt ccatatatcc acacaccttc cattcactcc agtgaaaaaa attcttttca caaaatacta taattttttc cacaacaata cataaatata aaaggtatat gtggatgcct tttgtcacca atgatttttt actttacagc gccattatta qctggggtgg caaatgaatg cagaacagca tt tt tgga cc gaqaaactac tacacataca attatgagqc tctactttcr gtttttcttt gctggttctq ctggcactat aaccttgaat ttagtagcaa gtacagacag ctactgaagg cccccccctc cagggcctct ggcaacctgt tga ct taat a gccatgttgc tggcacttgg acaagaaaat gatatttttg gaataggatg ttcccattgg tcagctacat gagaccaaca tggcaggcag ggataagatt cttacagact gaacttcctt tcccactctg cctcccaggt gtgccaacac gccaggatgq gggattacag ctttggataa aatgatcatg taaagcagga gttctgaaat ttctgaacgt ttgtgacttc agactaccct tgtccagaaa cactggacgt aagttcctga tctttacttt ggatgttaaa tagctacctt gtggcagaag cttttgctgc gaccttaata gcaaacaaaa ttattctgct taatcctatc ccctacatac tatatgcata ctatatacag gaaaacgtgg t ttcacagat tccctttctt ttctqtttg agtcaaataa ctagtgagtq attcatcccg cacaatttaa atqgtttact tctgtgtgtc ggaaaggaag caaattgagt gggaacactt ttacatatag tacaccatct agtgagtttt cctatqggaa tgatatataa caaaggcaga caaatcactg accacacaca aggttgtgct ccattttacc aggagacaca ttagaaggag gttgtcttga ttggggaaga gatgtttaaa acttgttttg gctcatgact ggacttacac ctgtgcaccc atcacagtgg ttggatgtgg gccttatgca ttatacttag ctgcccagag tcaagtgat c gcccagctac tctccatctc gcgtgagtca agaaagttac cacaatagca aaataatcta tgggcaataa gqgctctgga gggcaagtga tacagctaac aaaataaatg ggttatggaa cctatattgg ttctctaagt cagccacaca ga gaaa gt cc tgtcacaatt taaaatgtgc acaaaattaa caaaaacaca atctctaagt tcagtatttc ggtatctata tatacatatc taggcctcca atagtgccga aaaagattca tattaagtca catagccaaa ggatgacttg actaatgggt agtttgatgg aacttatgaa gcagqtcatt tacatgcaca agaagacatg atttatgact ctgtaatatg aatgaaaaga accacccaga ccatgaatca taagctcaat aagttgtggt cacagaagaa cactctccat cacgcagtac cagtatgaat atqtcctagg cagtggccag aaggagctag tggtcaggaa gacatgtqgc aaaggatgac tgggtgccag aaaatagcca tcaccaaggc aatgtgacac acagcctcca atgtgtctgt Ct gtcgcagt atgataattt tggagtgcag cttctgcttc t tt tt tgt at ttqacctcat ctgcgcccgg t ga acgcct t agatttcagt ttagaaggct gcaaggaagg gctgaagttc cttaaccttt tgagttaaca tggccagaac aactaatctc attttgcctt gaaaggtata ttttgaaaat cagtttacaa tggatgataa atatattctt attttcattt acaacaacaa cttggatatc atcacctaca tctatttata tatatgtata ttacctcaga accctatata ttttgctgta agaacttgca tggccaqtat gacataagca ggggagcaga agaaagaqca ttgtttattc gaaacctaaa tgtataagta tggattctag tgcctCCttc ctagaatttt gtctttcatt acgctgatct t cc agtat tc gcctaacatc.

tataqagttt aaatatatca gattcaagaa tatttgctag gaattagaCa catgtttcta gaaaagagat atatqtgact cttggaagga tataactctc ctcagaatag tcagcctctt ttgtqtcagg tgccttccta tattccccag tcatggaaag cctgaacaca attcctcacg 309660 309720 309780 309840 309900 309960 310020 310080 310140 310200 310260 310320 310380 310440 310500 310560 310620 310680 310740 310800 310860 310920 310980 311040 311100 311160 311220 311280 311340 311400 311460 311520 311580 311640 311700 311760 311820 311880 311940 312000 312060 312120 312180 312240 312300 312360 312420 312480 312540 312600 312660 312720 312780 312840 312900 312960 313020 313080 313140 313200 313260 313320 313380 W0005851 0 [htt:twg etthe patent. comI1Loginado/$exa m. su portIFetch/Defa uIt. dogiIV0005 8 51 O.cpc?fromCach6= 1 part=maintoolbar--boftom] ae42o 3 WO 00/58510 PCT/EBOO/00435 gcatggcttc tcatgggatt atggtaaaat ggcgagggtc taatttttat tgtcaatcta atttacatct aaatcttaaa tgccagaaat caaatattgc gtggctaaat ttgtttattt cagaaacttc atgaatgcat aatttaacat tttgatgtta agagaaacca gagggaggac tcaggacaat gaaggactct gtgcacagct aataacattt taaagaattt ttttggtggc atagaacagt tacagctaca ttaqggacac cataaatact tggcatcacc gataacaatc cgttaaatcc ttagccaata tatccatqct tggttggatg aaatgtcttg aatgcttagc ttaggatgag gcagqtttgg tacattagta ttatttaaaa tatataggag atccctgcag accactgaat cactacaaca qtatccttgg caacaggctt cgtgtagcac aaatgaaaag agatttttta tctctttttt atttagtata caaaaattct tgccatctta ttattgttgg ataqattttt ggaaacttgt agacacactg tattttcatc tgatggtttt tgcactagta tggtatttaa ggtatagata agcaaagtcc tgatcaagga caccggtttt gaccttttga tctagatggc ccaaattcat tcttgggtca tatgtaatag cacatggcta tatagtgctg tacagttgaa taatgatatt caaatcaacc actgagggca gtaactgagt ccatgtaaaa catatatatg agtgattgtt ttgtaatcac gtcgttgtcc gggttttcaa cctcttgttt ggtattttca tgaatatqtg ttcaattagg gcctacgtga ttaatccatg aacagccctt ccccagtccc tacctataat ttaacaaaca aatggattcc agcttgtcaa cttcgggtaa cacaccttca caattctgtt tcttgctcaa aattatcttc aaatgggttt aaaatcatta tgt aaagcat gattccaaaa ccagatacag ccaacctcct tcgggtgcca cagtatgcta agaaaagagt qaagtcttat tgacaaatat aatctcccat tagaaaatat ggtttattta gcatttgtaa ttctgaagtg agttttaaaa tcactaattt ttgcaatact taatgactac agtctcatca caagtgtggc ccattcccaa aacaaaaatc atattgaata acaatttaaa actcacttca atcatqttcc agacagctct tgtaaatgct cttcttcacc aagtttacca tgtgtataca agtttggcag tccataattt acaaaattaa caagttctgt gctcaaacac agcctaaatg ccgtgtttgt tacaatattt tatatatnca taggactgag gaactggggg tctgaatccc aacccataag atggatgcag gagtctgtat at t tgact ca tctatatgca gctagcacca agtcttataa tgccttccct agtgttttta gattaaggat ctgtagcata tgggactgtg acagctaqaa gtgtccactt gaacctattc gttatatcat gttctaggac tcagtctgag atatatgcat aaqttgcttt tgaacagaaa attcggagac ttgcacttgc tgtacatsac at t taatact tgttcaactg aaactgaaca gcaaaaqtag ttatatacag ctccaaggca agatgaatta tctcacactt caacttcctc tttaccatct cattagtatt tqgaagggta tttaaaagca tatttcctct tttttctgtg tgcaatttgg accaactgaa ttcctaagtt caaaaaaaac aaaattaata 191 caqaaaaaga ccaccgtcct agccccagct ctaaactaac tgtgtattat taaagctttt tttatatagt aatgtcataa tgtttctttg aagaataaaa ttcttcatct aggaatccat atcccaaatc caaggccatt ataaaacaac at ta cat at a accaataaaa gaatatccac aggtaagtcc cctgttatct atgcctttcc atggaagtac aatttgggaa atagaacgtg attatggtcc ttcaaatggc gqagaagtgc tqgagcccaa ttgggagatt tgcacactcc t ct cttat ag acacattaaa tgaaattcac ctaagaaatt tttttttctg tgcaggcaat gtaacttcct ttccgaatat cactcaaaga acaatcggaa tctaaccagt tggaccacta tgcaaccaga ttcttctttt actttgagat ctctggcttt gaagcagtgt ccagataatt atttaggcaa tttaagatgg ctttgtcttt aatatgtaaa tactctaaag tatctgatcc aactattgtt gttttcaaaa gatt tct tt t tcatccattt ttcccttgaa acacattctt attttaatat ctatatgatg atactgttaa agagtgccaa gaagcagctg aggtaacttc tatccgatat caatagaaaa catgaatttt aagaaataat agatcacatt agactgattc actcagaatg ttataatcac agcaccaaaa tctatgaacc tgtaaaactg ttgtaataaa tatatatata tatttaataa gggcaaacca actttgactc aacgtatttt agaaggctag ctacctacca ttgtgtgagg aatacttttc ttggtactcc tccagtggct tgtgttttgg ttcaatgtac catttagtga aaaggctt tc gcttttactg ctcttcaaqc cccaatgcaa cttgcatata agtatatttq gaagactggq catatgtaaa cctaataata ctgtaagata actaatcaat gaatccagcc caacatcggg tgcagttgca cactctctac gtatgattct tgtagggaga aggaggattg ttgttataag cagcaagtat attatcatta ttccattatt tttaaaaatc taatctgaac taatgttt ta tcatagatgc ittctcctct aggtgcgttt gcgctgggac ggtattttaa caatggcaag acaactacaa actcgttcct ctcagaggga tgggccatgc gcttgataga acagggcggg atggtgtcat tagcttaatt agtttcaaaa atagtaaaga gtacaacaaa cactggtttt atcacataga ggtgttataa atttttgata t t ttct tgaa gaagttctct tgtatgttaa attaaattca aatatttttg tgaaccagat ttaaatggca cgtttcacca aaattataga tgtttttatt aacaaaacta aaaaacagaa atggcctatt ttgatgttca gttctaacaa gatctccccg attttatcaa cctctttcta ggcctaaatt ttacctactc tcttttatct ttgttggcat acccctattt taagtagggq gqctactaag tttggctgct taaagaaaag gaaatgggta ttgctagtac tgccaatcta c tt gct gga c cccrgtttca attttgacac agtagaactc gcagaccaaa tcaatactct cttataaaat tttattgtgt ttcagctgtt cctcaatatt accacatgca t tgt aat tgt aataaatcct atcacacagg cttttgactg ttgtqcctac aa tat gct ga gtcatggtgc catattcact tctgtgagag tcagaccagg 313440 313500 313560 313620 313680 313740 313800 313860 313920 313980 314040 314100 314160 314220 314280 314340 314400 314460 314520 314580 314640 314700 314760 314820 314880 314940 315000 315060 315120 315180 315240 315300 315360 315420 315480 315540 315600 315660 315720 315780 315840 315900 315960 316020 316080 316140 316200 316260 316320 316380 316440 316500 316560 316620 316680 316740 316800 316860 316920 316980 317040 317100 317160 W0005851 0 fhttp:/twwgqetthe pa tent. com/Log in.dog/Sexa m.su p port/Fetch/Defa ult. d ogAN005851 0.cpc-hromCache= 1 part=maintoolbar-bottom] Page 493 of 737 WO 00/58510 PCT/fBOO/00435 tggaaagcac caagcagaaa tgcagtgggg ttgttaggct aaattcaact catttcactt gggtcaacaa agaggatatt cattcagaat ttqatggtat atttattcac ttatqcatat ttgcaatttg ctttattctg tacactcgtg tctttttgaa ctcatgattt aatgaatatc atatgccaaa tagtttacaa agtctttqqq ctcaqttaaa aaacaaaaaa agggtacatg cctgcaccca ctccccccac tctcattqtt qtgatagttt actcatcatt tccagtctat ccacaataaa atatacccag atcgccacac gtgttcctat ccattctaac ccagtgatga agtgtctgtt tttgtttgag aaattttctc agaagctctt ttggtattta qaatatgcac aggatacttg cctccaccta ttccttccag acttaagaat aataattttc catatttggt ttataaagtt atagtggcag tatgttgcta atttatgata gtqataaatg ataggctaac atccttttta aaacatttct ga tagagat t gtcagacttg cttagaatac aactgcatat atatttctca gaaataattt caatattata atatttttga tgcacattgt ttaacttgtc cccacaacan ncaattccca actgagaatg ttttatggct cattgttgga catacgtgtg taatgggatq tgacttccac ttctccacat tggtgtgaga tqagcatttt catatccttt ttcattgtag ccattttgta taatttagtt gacgtgaagt tctgcataat gtgcrgtttg gaggaactga ttagtaatgg agcat gcgcc tatataaatc actctcctac aaaatcctga aaaaaaatat taaataattt ttttaggctg ctaattataa tgtatgtaaa gttatagtct aagtcaatgt ttcatggttt aaaagttata aaatcaactg ctctttccaa atatttaaac attatgaaaa tggaaatgcc cttttttttt gcaggttatt atttagcatt gtccccagaq cctatgagtg atgatttcca gcatagtatt catttgggtt catgtgtctt gctgggtcaa aatggttgaa cctctccagc tgqtatctca ttcatgtgtc gcccactttt attctggata ggttccatqt agat cccatt ccttgcccat qaagcttatt ctctagatac ttacaggaag tttcaagctg aagtatattc tctattaatt tttgagcttg taactttaaa tcctttctaa cctagagata accttaaaaa tatttacttg aatttcataa tatagatatg aaaatattgt ttttccaaat gaatgaatat tatattcact tttttaatac ttttagaact atttttatgt atagtttgaa cttttctttt tacatatgta aggtatatct tgtgatgttc agaatatgcg atttcatcca ccatagtgta ggt tccaagt tacaacaaca atqgtatttc ctagtttaca acctgttgtt ttgtggt t tt ttttggctgc tcatggqqtt ttagcccttt tcactctgat tgtcaatttt gcctatgtcc tccagtgtac acagctaaca aggaagtttt aatggatgac tataactttc taagtttctg gttgaaccac gactgataaa attataatga ttaaggtata ttatttatga gctttaataa tattqtctag gccttagttc aatgtgatgt cagagtttaa tttaacataa cgaggcactt tgctttctct gaatcatgtt aqttattaaa aaattgtcaa attattatac tacatgggcc cccaatgcta cccttcctgt gtgtttggtt tgtccctaca tatgtgccac ctttgctatt tgatttatag tagttctaga gtcccaccaa t cct ga ctt t gatttgcatt ataaatgtct gtctqttttt gtcagatgag ggtagtttct gtcttttgtt tgaatggt aaatctacag cagcgagcca gatttcaacc acaacatgaa tgttaagatt a at aact gta ataatttgaa tttctgtttq ttaaattgtt ct ta cat aag atttaattgc atatttccag aatagttttt aaaagcacta cagaataaaa agtagtcaat aaataactta aaaatattct ctctctctct ggggaaatga aaaattctaa ggttaagata tttaagtttt atgctggtgt tccctccccc gtccacgtga ttttqttctt aaggacatga attttcttaa gtgaataatg tcctttgggt tccctqagga cagtgtaaaa ttaatgattg tctctgatgg tcttttgaga ttcttgtaaa taggttgcga tttgctgtgc gccattgctt 317220 317280 317340 317400 317460 317520 317580 317640 317700 317760 317820 317880 317940 318000 318060 318120 318180 318240 318300 318360 318420 318480 318540 318600 318660 318720 318780 318840 318900 318960 319020 319080 319140 319200 319260 319320 319380 319440 319500 319560 319608 <210> 2 <211> 995 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .253 <220> <221> CDS <222> 254. .304 <220> <221> 3'rJTR <222> 305. .995 <220> <221> polyA signal <222> 971. .976 W0058105851 /Aww 0eth pten. om&oginr o/mea acppertFe1h/efau t.docNV00551tocc~roa Cch= 1part- ma inPage 494ftom Pof 4 73773 WO 00/58510 PCT/EBOOIOO435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <400> allele 53 99-16050-235 :polymorphic base G or C allele 228 8-135-112 allele 282 8-135-166 allele 388 99.-16038-1 allele 447 8-137-152 allele 477 8-137-182 allele 643 8-130-220 allele 659 8-130-236 allele 831 8-131-199 allele 894 8-132- 97 allele 961 8-132- 164 allele 976 8-132- 17 9 2 *polymorphic base C or T *polymorphic base A or C 18 :polymorphic base A or G polymorphic base G or T polymorphic base A or G polymorphic base A or C polymorphic base A or G polymorphic base A or C polymorphic base C or T polymorphic base C or T :polymorphic base A or T gtagagtgaa gcaagtaatg tgtgtqtgag tagtcattgg atacatacat aasagtgagc aagtttatca gctcctgcat ggcagtgttc tgatgatctt ttgctgcaaa agagctacac 120 W0005851 0 rhttD:/AWW.aetlheoatentcom/Loain.doal~exam-suoortFetchDefaut.doaAWO005851 0.cp~c?fromCar-he=l1 art=ma intool ba r--bottom] Paae 495 of 737 WO 00/58510 PCT/IBOO/00435 cccaaattag gatttggaaa gggaggaccc tggcttaaag taaaagctta ctagtgtata tgatgattct gggcatggca ggaggtctca tctctgcttc acaatgcyga aaa atg ctg gaa aag ctg atg ggt gct gat tint Met Leu Glu Lys Leu Met Gly Ala Asp Xaa 1 5 gttggtccag tgatttagct ctc cag Leu Gin ctt ttc aqg gta taa aggaatctga acacgactqa tattttcttt aatttttaga Leu Phe Arg Val tccagatata cattgggtaa aaatctgaaa actctctaaa acaaggaaag aargatggaa catttacaga gatcattatg gaagaagtaa gcagccatgt tatgaggcct ctaargaccg cagcaaaaag accagtcatg tggaagcaga ttcttcccag actggamtct gacggactct tatttgcaay tctctggtca gtqtqactgq gagaatytct <210> 3 <211> 1035 <212> DNA <213> Homo sapiens aatctacttc ctctattgca gagaaggcat tccttqggtc tggaaaagtc caqqcagcct caaccacaag ccaatccttc gtgtctggga gtaagtgata ctttttatta ataggttttc aaggagacag gaggacggct tcttaccttc ttcatggcaa ctagaacgaa gaaataactt tgatgacaat cccagctgat aaatgccatt awtgtgcttc aa arga gcat aakaaggaag atttggaaat ctcagcccta qaaactatga tgtggacctg ctaccaaagc gtagtctqqc aacacgtggt tctatgcacc aagttttaac tcttctgagc agagacggta ggcacagagg tgcagagctt gttccttgnc caactacaac tgaatgagtt caacatcttc gatgggattg cacctggcct a <220> <221> <222> 1. .253 <220> <221> COS <222> 254. .304 <220> <221> <222> <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 3 'UTR 305. .1035 polyA,_signal 1020. .1025 allele 53 99-16050-235 :polymorphic base G or C allele 228 8-135-112 :polymorphic base C or T allele 282 8-135-166 :polymorphic base A or C allele 388 99-16038-118 :polymorphic base A or G <220> <221> allele W0005851 0 ww. qetthepa tent. com/Log in dog/Sexam.suportFetch/efaut.dogMVOUU5851 0.cpc?tromCachie=1 part=maintoolbar--bottom] Page 496 of 737 WO 00/58510 PCTIIBOO/00435 <222> 447 <223> 8-137-152 :polymorphic base G or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 477 8-137-182 allele 621 8- 14 2-132 allele 700 8-142-211 allele 743 8-138 -218 allele 759 8-138 -2 34 allele 839 8-119-38 *polymorphic base A or G *polymorphic base C or T *deletion of TTTG *polymorphic base C or T *polymorphic base A or G polymorphic base A or'T polymorphic base A or C <220> <221> allele <222> 894 <223> 8-119-93 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 898 8-119-97 allele 921 8-119- 120 allele 926 8-119- 125 allele 996 8-119-195 allele 1001 8-119-200 polymorphic base A or G *polymorphic base C or T *polymorphic base A or G polymorphic base G or T :polymorphic base C or T W0005851 0 flhttDJwww.aettheoatentromILoain.doa/Sexam.suoortFetch/Defaut.doqMIO0005851 0.cpc?fromCac-he=l1Dart--maintoolbar--botom1 Paae 497 of 737 WO 00/58510 196 <220> <221> allele <222> 1005 <223> 8-119-204 polymorphic base G or T PCTIBOOIOO435 <220> <221> <222> <223> allele 1011 8-119-210 :polymorphic base G or T <400> 3 gtagaqtgaa aaqtttatca cccaaattag qatttggaaa gggaggaccc gcaagtaatq tgtgtgtgag tagtcattgg atacatacat gctcctgcat ggcagtgttc tgatgatctt ttgctgcaaa tggcttaaag taaaagctta ctagtgtata tgatgattct qqgcatggca gqaggtctca tctctgcttc acaatgcyga aaa atg ctg gaa aag ctg atg ggt gct gat tint Met Leu Glu Lys Leu Met Gly Ala Asp Xaa aasagtgagc agagctacac gttggtccag tgatttagct ctc cag Leu Gln ctt ttc agg gta taa aggaatctga acacgactga tattttcttt aatttttaga Leu Phe*Arg Val tccagatata cattgggtaa aaatctgaaa actctctaaa acaaggaaag aarqatggaa catttacaqa gatcattatg acagaagctt ttgcagtgtt tgagatcctc taagcaaatt tacatttgag caacaaaact gagagaagaa aaaagaaatt aaattagcct qggawcatcc acttcagtan tgaraggaga accaaattta gagtcatgta kgtattktta tagagaataa <210> 4 <211> 1158 <212> DNA <213> Homno sapiens aatctacttc ctctattgca gagaaggcat tccttgggtc ggtgctaaaa tagaaaagga ctttcaqaga ctcatctgaa aggcactgga aagtcatttc aaqatacaat aaacaacaac ataggttttc aaggagacag gaggacggct tcttaccttc tggttCyctt gaggaacttg cattttaayt acttgaactt atttctcact caaatgycta aattagcttt a aaargagcat aakaaggaag atttggaaat ctcagcccta gtcagaggag accacagaaa cacgatgtgg atcaaaactc ttttttcctt trttttgact cttaacaatt tcttctgagc agagacggta ggcacagagg tgcagagaac ttacgtttta ctgtgtttga gaaarccaat acttgtctag ctccctctca ttttaaatag t kcaccyaga 120 180 240 289 344 404 464 524 584 644 704 764 824 884 944 1004 1035 <220> <221> <222> 1. .187 <220> <221> CDS <222> 188. .520 <220> <221> <222> 3' UTR 521. .1158 <220> <221> allele <222> 1 <223> 8-140-108 <220> <221> <222> <223> :polymorphic base G or C :polymorphic base G or T allele 66 8-140-173 <220> <221> allele W0005851 0 [httPJMww.etthepatent.comILogin.dog/$exam.supportFetch/Defaut.do/WO00585I 1 .cpc?fromCactie= 1 part--maintoolbar--bottomj Page 498 of 737 WO 00/58510 PCT/IB00100435 <222> 179 <223> 8-140-286 :polymorphic base C or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 326 8-141-161 polymorphic base A or C allele 425 8-141-260 polymorphic base A or G allele 469 8-141-304 polymorphic base A or G allele 577 8-144-127 deletion of GTATCCA allele 646 8-144-196 :polymorphic base A or T allele 684 8-144-234 :polymorphic base A or G allele 828 8-144-378 :polymorphic base A or G allele 914 99-16050-235 :polymorphic base G or C allele 1089 8-135-112 :polymorphic base C or T allele 1143 B-135-166, polymorphic base A or C <400> 4 stccacctgc tggtagtgca ctccttaggt gcctgtctct acagaktcat gcatgagctc cactgtggga agtctctaga caccaactga aagagtctat ctaagtcctg aagatcacaa aatgtga atg gaa gtt ggg cct gct cag aga atc Met Glu Val Gly Pro Ala Gin Arg Ile 1 5 tgt ggc ctg gag cca act gcc aag gag igc cta Cys Gly Leu Glu Pro Thr Ala Lys Glu Cys Leu 20 25 ggctgtcctg tgccacctgc gatgagctga gcttacccta gtcatcctca tattcccayg atc agg gct ctt tat Ile Arg Ala Leu Tyr gga aca cac tca gta Gly Thr His Ser Val W0005851 0t [htwwwg etthepa tent. comILog in.dog/Sexa m. su port/FetchDefa ut.dogMO 5 8 l0ccfmahe1 part=maintoolbar--bottom] Page 499 of 737 WO 00/58510 PCT/IBOO/00435 aga gtg ttg ccc Arg Val Leu Pro mci agg tat gtc Xaa Arg Tyr Vai gtg aaa aai aia Val Lys Asn Ile gta rgt tia atc Vai Xaa Leu Ile ggc cag atc aga Giy Gin Ile Arg aat tgc tca Asn Cys Ser ctt gaa Leu Glu gga igc Giy Cys cag ict Gin Ser cci gca gag Pro Aia Giu tat aaa ctt gaa gtt Tyr Lys Leu Giu Vai ctc ctg gca aaa tat Leu Leu Ala Lys Tyr aaa icc Lys Ser aag act tac Lys Thr Tyr at t Ile iii Phe ati cci Ile Pro tat Tyr gaa Giu ggc Giy icc ita gt Ser Leu Val gat ata car Asp Ile Gin aic cia aa Ile Leu Lys ati ggt agg Ile Giy Arg aag ita ica Lys Leu Ser iii Phe 110 325 373 421 469 517 570 630 690 750 810 870 930 990 1050 1110 1158 iaa aaacaiagaa acctgaacaa gaigiaicac iccagiciag aatgiciaia igcagagiai tictigici acccaaacii iiaaiatiii ccacgaaiaa agcaagiaai agcicctgca giggcitaaa agggcaiggc caaaatgctg ccacaaaaaa icaacwiici cticata accaiiiaca catticrit gigigigiga iggcagtgii giaaaagcii aggaggicic gaaaagctga ccaaaciica ticaigicia aagaaccaaa aagagaiiaa tciiaaaati giagicatig cigaigaici aciagigtat aicicigct tgggtgctga acagictic gaaigtciai citciiiaaa ctacaacaai tgctgaaigg gatacataca iitgctgcaa aigaigatic cacaatgcyg ttmictccag aigictaiai aigcagagia iaaaaatgac atigaictig aaagccagaa iaasagigag aagagctaca igiiggtcca aigatiiagc cttitcag ticiicaaca tccrcaaaag tcacaaiaai agiiaaiiic agiagagiga caagitiaic ccccaaatia ggaiitggaa tgggaggacc <210> <211> 894 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .253 <220> <221> COS <222> 254. .304 <220> <221> 3'tJTR <222> 305. .894 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> poiyA,_signai 879. .884 aiieie 53 99-16050-235 aiieie 228 8-135-112: aiieie 282 8-135-166: :poiymorphic base G or C polymorphic base C or T polymorphic base A or C W0005851 0 [httPJww.etthepatent.com/Login.doq/Sexam.suDporVIFetch/DefauIt.dog/WO005851 0.CPC?fromCache= 1 art--maintoolbar--bottomI Page 500 of 737 WO 00/58510 PCT/LBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 388 99-16038-118 :polymorphic base A or G allele 447 8-137-152 allele 477 8-137-182 allele 602 8-138-2 18 allele 618 8-138 -2 34 allele 698 8-119-3 8 allele 753 8-119- 93 allele 757 8-119- 97 allele 780 8-119-120 allele 785 8-119-12 5 allele 855 8-119-195 allele 860 8-119-200 polymorphic base G or T polymorphic base A or G polymorphic base C or T polymorphic base A or G polymorphic base A or T polymorphic base A or C polymorphic base A or G *polymorphic base C or T polymorphic base A or G polymorphic base G or T :polymorphic base C or T <220> <221> allele W0005851 0[httoJMwiw. etthepatent.comLagin.do /Sexam.suportFetchDefaut.do /W0005 8 5 0.cpc?fromCache=l1 art=maintoolbar--bottoml Page 501 of 737 WO 00/58510 200 <222> 864 <223> 8-119-204 polymorphic base G or T <220>' <221> allele <222> 870 <223> 8-119-210 polymorphic base G or T PCTIIBOO/00435 <400> gtagagtgaa aagtttatca cccaaattag gatttggaaa gggaggaccc gcaagtaatg tgtgtgtgag tagtcattgg atacatacat gctcctgcat ggcagtgttc tgatgatctt ttgctgcaaa tggcttaaag taaaagctta ctagtgtata tgatgattct gggcatggca ggaggtctca tctctgcttc acaatgcyga aaa atg ctg gaa aag ctg atg ggt gct gat tint Met Leu Glu Lys Leu Met Gly Ala Asp Xaa aasagtgagc agagctacac gttggtccag tgatttagct ctc cag Leu Gln ctt ttc agg gta taa aggaatctga acacgactga tattttcttt aatttttaga Leu Phe Arg Val tccagatata cattgggtaa aatctacttc ataggttttc aaargagcat tcttctgagc aaatctgaaa actctctaaa ctctattgca aaggagacag aakaaggaag agagacggta acaaggaaag aargatggaa gagaaggcat gaggacggct atttggaaat ggcacagagg catttacaga gatcattatg tccttgggtc tcttaccttc ctcagcccta tgcagaactc tttcagagac attttaaytc acgatgtggg aaarccaatg agagaagaaa aaagaaattc tcatctgaaa cttgaactta tcaaaactca cttgtctaga aattagcctg ggawcatcca ggcactggaa tttctcactt tttttccttc tccctctcaa cttcagtamt garaggagaa agtcatttcc aaatgyctat rttttgactt tttaaataga ccaaatttag agtcatgtaa agatacaata attagctttc ttaacaattt kcaccyagak gtattkttat agagaataaa aacaacaaca 120 180 240 289 344 404 464 524 584 644 704 764 824 884 894 <210> 6 <211> 863 <212> DNA <213> Homo sapiens <220> <221> <222> 1. <220> <221> CDS <222> 26. .76 <220> <221> 3'UTR <222> 77. .863 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> po lyAs ignal 839. .844 allele 54 8-135-166 :polymorphic base A or C allele 160 99-16038-118 :polymorphic base A or G <220> <221> allele W00058510 [http/www.getthepatent.com/Login.dog/Sexam support/Fetch/Default.dog/W0058510.cpc?fromCache= 1part=maintoolbar=bottom] Page 502 of 737 WO 00/58510 PCT/IBOO/00435 <222> 219 <223> 8-137-152 <220> <221> allele <222> 249 <223> 8-137-182 <220> <221> allele <222> 413 <223> 8-143-232 <220> <221> allele <222> 420 <223> 8-143-239 <220> <221> allele <222> 423 <223> 8-143-242 <220> <221> allele <222> 426 <223> 8-143-245 <220> <221> allele <222> 511 <223> 8-130-220 <220> <221> allele <222> 527 <223> 8-130-236 <220> <221> allele <222> 699 <223> 8-131-199 <220> <221> allele <222> 762 <223> 8-132-97 <220> <221> allele <222> 829 <223> 8-132-164 <220> <221> allele <222> 844 <223> 8-132-179 <400> 6 polymorphic base G or T polymorphic base A or G polymorphic base G or C polymorphic base A or G polymorphic base C or T polymorphic base A or C polymorphic base A or C polymorphic base A or G polymorphic base A or C polymorphic base C or T polymorphic base C or T polymorphic base A or T gatgatttag ctgggaggac ccaaa atg ctg gaa aag ctg atg ggt gct gat Met Leu Glu Lys Leu Met Gly Ala Asp 1 tmt ctc cag ctt ttc agg gta taa aggaatctga acacgactga tattttcttt W0005851 0 rhttp 6vw.getI paet amlgin.dog/Sexam.supprtFetchDefaultdog V0005851 0.cpc?fromC ach~e=1 part= m aintoolba r--boftoml Page 503 of 73 7 WO 00/58510 PCTIBOOIOO435 Xaa Leu Gin Leu Phe Arg Val aatttttaga tcttctgagc agagacggta ggcacagagg tgcagagct c ggaaatsaaa ccatgttgga rgaccgcagg gtcatgcaac tcccagccaa gactctgtgt tggtcagtaa atytctcttt tccagatata cattgggtaa aaatctgaaa actctctaaa acaaggaaag catttacaga attttgtata accrtcytgm aaagtcttca cagcctctag cacaaggaaa tccttctgat ctgggaccca gtgataaaat ttattaawtg aargatggaa gatcattatg aagcaggcct taccagacct tggcaagaaa aacgaatgtg taacttctac gacaatgtag gctgataaca gccatttcta tgcttcaagt aatctacttc ctctattgca gagaaggcat tccttgggtc ttatgtcaga tggatctgga ctatgagttc gacctgcaac caaagctgaa tctggccaac cgtggtgatg tgcacccacc tttaaca ataggttttc aaggagacag gaggacggct tcttaccttc agctgagacc aggcttgaag cttgmctatg tacaaccagc tgagtttgga atcttcactg ggattgtatt tggcctgtgt aaargagcat aakaaggaag atttggaaat ctcagcccta tccaacagat aagtaagcag aggcctctaa aaaaagacca agcagat tct gamt ctgacg tgcaaytctc gactgggaga 166 226 286 346 406 466 526 586 646 706 766 826 863 <210> 7 <211> 603 <212> DNA <213> Homo sapiens <220> <221> CDS <222> 2. .310 <220> <221> 3'UTR <222> 311. .603 <220> <221> <222> polyA,_signal 588. .593 <220> <221> allele <222> 27 <223> 8-135-166 polymorphic base A or C <220> <221> allele <222> 87 <223> 99-16038-118 polymorphic base A or G <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 146 8-137-152 allele 176 8-137-18 2 allele 289 8-145-138 polymorphic base G or T polymorphic base A or G polymorphic base G or T <220> <221> allele <222> 311 <223> 8-138-218 :polymorphic base C or T W000551 U ~!p:/www.getthepatent.com/Logiadg/Sexam.suportFetc/Defaut.dogMOU5851 0.cpc?Irom~achie= 1 pr~anola~ot ae54o 3 WO 00/58510 PCTIIBOO/00435 <220> <221> <222> <223> allele 327 8-138-234 :polymorphic base A or G <220> <221> allele <222> 407 <223> 8-119-38 <220> <221> allele <222> 462 <223> 8-119-93 <220> <221> allele <222> 466 <223> 8-119-97 <220> <221> allele <222> 489 <223> 8-119-120 <220> <221> allele <222> 494 <223> 8-119-125 <220> <221> allele <222> 564 <223> 8-119-195 <220> <221> allele <222> 569 <223> 8-119-200 <220> <221> allele <222> 573 <223> 8-119-204 <220> <221> allele <222> 579 <223> 8-119-210 <400> 7 polymorphic base A or T polymorphic base A or C polymorphic base A or G polymorphic base C or T polymorphic base A or G polymorphic base G or T *polymorphic base C or T *polymorphic base G or T *polymorphic base G or T g ctg gaa aag ctg atg ggt gct gat tint ctc cag ctt ttc aga tcc aga Leu Glu Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe Arg Ser Arg 1 5 10 tat aca ttg ggt aaa atc tac ttc ata ggt ttt caa arg agc att ctt Tyr Thr Leu Gly Lys Ile Tyr Phe Ile Gly Phe Gln Xaa Ser Ile Leu 25 ctg agc aaa tct gaa. aac tct cta aac tct att gca aag gag aca gaa Leu Ser Lys Ser Glu Asn Ser Leu Asn Ser Ile Ala Lys Glu Thr Glu 40 kaa gga aga gag acg gta aca agg aaa gaa rga tgg aag aga agg cat Xaa Gly Arg Glu Thr Val Thr Arg Lys Glu Xaa Trp Lys Arg Arg His 55 WOfll5851 0 fhttnlwwi a tthe natent corn/Lon in d nI$pvim suno rtlFetchDefault.doNVOOO585 10.rpc?fromCactie=l1 art~rnaintoolbar--bottom]Paae 505 of 737 WO 00/58510 PCTILBOO/00435 gag gac ggc tat ttg Glu Asp Gly Tyr Leu gaa atg gca cag agg cat Glu Met Ala Gin Arg His tta cag aga tca Leu Gin Arg Ser tgt cct tgg gtc tct tac ctt Cys Pro Trp Val Ser Tyr Leu cct cag ccc tat gca gaa cat tcc aak Pro Gin Pro Tyr Ala Giu His Ser Xaa act Thr ctt tca gag aca ttt taa ytcacgatgt gggaaarcca atgagagaag Leu Ser Giu Thr Phe 100 aaaaaagaaa ctgggawcat amtgaragga tagagtcatg tatagagaat ttctcatctg ccaggcactg gaaagtcatt taaagataca aaaaacaaca aaacttgaac gaatttctca tccaaatgyc ataattagct aca ttatcaaaac tcacttgtct agaaattagc ctttttttcc ttctccctct caacttcagt tatrttttga ctttttaaat agaccaaatt ttcttaacaa tttkcaccya gakgtattkt <210> 8 <211> 593 <212> DNA <213> Homo sapiens <220> <221> CDS <222> 358 <220> <221> 3'UTR <222> 359. .593 <220> <221> <222> <220> <221> <222> <223> polyA,_signal 578. .583 allele 27 8-135-166 polymorphic base A or C <220> <221> allele <222> 87 <223> 99-16038-118 :polymorphic base A or G <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 146 8-137-152 allele 176 8-137-182 allele 301 8-138-218 allele 317 8-138-234 polymorphic base G or T polymorphic base A or G polymorphic base C or T polymorphic base A or G W0005851 0 [tt :/twww.getthepatent.comLogin.dog/Sexam.suportFetchDefaut.dogAN005851 O.cpc?fromCacie= 1 part~maintoolbar--bottom] Page 506 of 737 WO 00/585 10 PCTIBOO/00435 205 <221> allele <222> 397 <223> 8-119-38 polymorphic base A or T <220> <221> allele <222> 452 <223> 8-119-93 polymorphic base A or C <220> <221> allele <222> 456 <223> 8-119-97 polymorphic base A or G <220> <221> allele <222> 479 <223> 8-119-120 :polymorphic base C or T <220> <221> allele <222> 484 <223> 8-119-125 :polymorphic base A or G <220> <221> allele <222> 554 <223> 8-119-195 :polymorphic base G or T <220> <221> allele <222> 559 <223> 8-119-200 :polymorphic base C or T <220> <221> allele <222> 563 <223> 8-119-204 :polymorphic base G or T <220> <221> allele <222> 569 <223> 8-119-210 :polymorphic base G or T <400> 8 g ctg gaa aag ctg atg ggt gct gat tint ctc cag ctt ttc aga tcc aga 49 Leu Glu Lys Leu Met Gly Ala Asp Xaa Leu Gin Leu Phe Arg Ser Arg 1 5 10 tat aca ttg ggt aaa atc tac ttc ata ggt ttt caa arg agc att ctt 97 Tyr Thr Leu Gly Lys Ile Tyr Phe Ile Gly Phe Gin Xaa Ser Ile Leu 25 ctg agc aaa tct gaa aac tct cta aac tct att gca aag gag aca gaa 145 Leu Ser Lys Ser Glu Asn Ser Leu Asn Ser Ile Ala Lys Glu Thr Glu 40 kaa gga aga gag acg gta aca agg aaa gaa rga tgg aag aga agg cat 193 Xaa Gly Arg Glu Thr Val Thr Arg Lys Glu Xaa Trp Lys Arg Arg His 55 gag gac ggc tat ttg gaa atg gca cag agg cat tta cag aga tca tta 241 Glu Asp Gly Tyr Leu Glu Met Ala Gin Arg His Leu Gin Arg Ser Leu 70 75 tgt cct tgg gtc tct tac ctt cct cag ccc tat gca gaa ctc ttt cag 289 Cys Pro Trp Val Ser Tyr Leu Pro Gin Pro Tyr Ala Giu*Leu Phe Gin 90 W0005851 0[httpJMwww. etthiepatent.com/Login dog/Sexam.supportFetch/efaut.dogAN0005851 0.cpc?fromCar-he-- 1 art--maintoolbar--botoml Page 507 of 737 WO 00/58510 PCT/EBOO/00435 aga cat ttt aay ica cga tgt ggg aaa rcc aat Arg His Phe Asn Ser Arg Cys Gly Lys Xaa Asri 100 105 gag aga aga aaa aag Glu Arg Arg Lys Lys 110.

aaa ttc tca tct gaa act tga acttatcaaa actcacttgt ctagaaatta Lys Phe Ser Ser Glu Thr 115 gcctgggawc atccaggcac tggaatttct cacttttttt ccttctccct ctcaacttca gtamtgarag gagaaagtca tttccaaatg yctatrtttt gactttttaa atagaccaaa tttagagtca tgtaaagata caataattag ctttcttaac aatttkcacc yagakgtatt kttatagaga ataaaaacaa caaca <210> 9 <211> 649 <212> DNA <213> Homo sapiens <220> <221> CDS <222> 2. .49 <220> <221> 3'UTR <222> 50. .649 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> polyA signal 634. .639 allele 27 8-135-166 allele 133 99-16038-11 allele 192 8-137-152 allele 222 8-137-182 allele 335 8-145-138 allele 357 8-138-2 18 allele 373 8-138 -234 polymorphic base A or C 8 :polymorphic base A or G *polymorphic base G or T *polymorphic base A or G *polymorphic base G or T *polymorphic base C or T *polymorphic base A or G W0005851 0 fq!p /hvww.getthe patent. comILog in.do /Sexam.support/Fetch/Default.dogNV05510cc~rmale part=ma intoolbar--bottom] Page 508 of 737 WO 00/58510 PCT/EBOO/00435 <220> <221> allele <222> 453 <223> 8-119-38 :polymorphic base A or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 508 8-119- 93 allele 512 8-119- 97 allele 535.

8-119-12 0 allele 540 8-119-12 5 allele 610 8-119-195 allele 615 8-119-20 0 allele 619 8-119-204 allele 625 8-119-2 10 polymorphic base A or C polymorphic base A or G *polymorphic base C or T *polymorphic base A or G *polymorphic base G or T *polymorphic base C or T *polymorphic base G or T *polymorphic base G or T <400> 9 g ctg gaa aag ctg Leu Glu Lys Leu 1 atg Met 5 ggt gct gat tint Gly Ala Asp Xaa ctc cag ctt ttc agg gta taa Leu Glri Leu Phe Arg Val 10 aggaatctga aatctacttc ctctattgca gagaaggcat tccttgggtc attttaaytc cttgaactta tttctcactt aaatgyctat attagctttc <210> <211> 733 <212> DNA acacgactga ataggttttc aaggagacag gaggacggct tcttaccttc acgatgt ggg tcaaaactca tttttccttc rttttgactt ttaacaattt tattttcttt aaargagcat aa kaaggaag atttggaaat ctcagcccta aaarccaatg cttgtctaga tccctctcaa tttaaataga kcaccyagak aatttttaga tcttctgagc agagacggta ggcacagagg tgcagaacat agagaagaaa aattagcctg cttcagtamt ccaaatttag gtattkttat tccagatata cattgggtaa aaatctgaaa actctctaaa acaaggaaag catttacaga tccaakactc aaagaaattc ggawcatcca garaggagaa agtcatgtaa agagaataaa aargatggaa gatcattatg t tt cagaga c tcatctgaaa ggcactggaa agtcatttcc agatacaata aacaacaaca W0005851 0 [http:/Mww.etthepatentcOm/L gin.dog/Sexam.s port/FethlDefault.dogNVO005 8 51 0.cpc?fromCache= 1 Dart~maintoolbar--botom Page 509 of 737 WO 00/585 10 PCT/IBOO/00435 <213> Homo sapiens <220> <221> CDS <222> 2. .49 <220> <221> 3' UTR <222> 50. .733 <220> <221> <222> polyA signal 718. .723 <220> <221> allele <222> 27 <223> 8-135-166 :polymorphic base A or C <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 133 99-16038-11 allele 192 8-137-152 allele 222 8-137-18 2 allele 336 8-145-138 allele 352 8-145-154 8 :polymorphic base A or G polymorphic base G or T polymorphic base A or G polymorphic base G or T polymorphic base A or G polymorphic base A or G polymorphic base C or T polymorphic base A or G <220> <221> allele <222> 395 <223> 8-145-197 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 441 8-138-218 allele 457 8-138 -23 4 allele 537 8-119- 38 polymorphic base A or T W0005851 0 [httpJM'ww.getthepatentcom/Login.dog/Sexam.suportFetch1/Defaut.dogAN000585l 0.cpc?fromCar-he=1 part=maintoolbar--bottom] Page 510 of 737 WO 00/58510 PCT/1-BOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 592 8-119- 93 allele 596 8-119- 97 allele 619 8-119-120 allele 624 8-119-12 5 allele 694 8-119-195 allele 699 8-119-200 allele 703 8-119-20 4 allele 709 8 -119-210 :polymorphic base A or C polymorphic base A or G *polymorphic base C or T *polymorphic base A or G *polymorphic base G or T *polymorphic base C or T *polymorphic base G or T *polymorphic base G or T <400> g ctg gaa Leu Glu 1 aggaatctga aatctacttc ctctattgca gagaaggcat tccttgggtc cartttgcac agacactgag gaaaaaagaa cctgggawca tamtgaragg ttagagtcat ttatagagaa aag ctg Lys Leu atg Met 5 ggt gct gat tint Gly Ala Asp Xaa ctc cag ctt ttc agg gta taa Leu Gln Leu Phe Arg Val 10 acacgactga ataggttttc aaggagacag gaggacggct tcttaccttc tgtcatttta actctttcag attctcatct tccaggcact agaaagtcat gtaaagatac taaaaacaac tattttcttt aaargagcat aakaaggaag atttggaaat ctcagcccta aaagaatttc a ga catt t ta gaaacttgaa ggaatttctc ttccaaatgy aataattagc aaca aatttttaga tcttctgagc agagacggta ggcacagagg tgcagaacat tcagatattt aytcacgatg cttatcaaaa actttttttc ctatrttttg tttcttaaca tccagatata a aat ct gaa a acaaggaaag catttacaga tccaagktga gctggrcact tgggaaarcc ctcacttgtc cttctccctc cattgggtaa actctctaaa aargatggaa gatcattatg ttctaaatgg ttatggaagg aatgagagaa tagaaattag t ca act tca g actttttaaa tagaccaaat atttkcaccy agakgtattk <210> <211> <212> <213> 11 1009

DNA

Homo sapiens W0005851 0 fhttpoJMAw.gethe patent. com/Lo i n.d og/Sexa m. supporttFetciIDefa uIt.d ogNO0551 0.qpc?tromCache= 1 part=maintoolbar--botaml Page 511 of 737 WO 00/58510 <220> <221> <222> 1. .267 <220> <221> CDS <222> 268. .318 PCT/IBOO/00435 <220> <221> <222> <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 3' UTR 319. .1009 polyA,_signal 985. .990 allele 136 8-144-378 polymorphic base A or G allele 242 8-135-112 polymorphic base C or T allele 296 8-135-166 polymorphic base A or C allele 402 99-16038-118 :polymorphic base A or G allele 461 8-137-152 :polymorphic base G or T allele 491 8-137-182 :polymorphic base A or G allele 657 8-130-220 :polymorphic base A or C allele 673 8-130-236 :polymorphic base A or G allele 845 8-131-199 :polymorphic base A or C <220> <221> allele W0005851 0 fhttopltwww. etthepa tent. co m/Login.dog/Sexa m.su p NV1Dfa~tdoMO005851 I .cpc?fromCar-he= 1 part~maintaoobar--bottoml Page 512 of 737 WO 00/58510 PCTIBOOIOO435 <222> 908 <223> 8-132-97 :polymorphic base C or T <220> <221> <222> <223> allele 975 8-132-164 <220> <221> allele <222> 990 <223> 8-132-179 polymorphic base C or T polymorphic base A or T <400> 11 ccaaacttct aatattttac acgaataaca caagtaatgt cygatgattt ttcatttaaa catttacaaa ttttcrtttc gtgtgatttg agctgggagg gaaccaaact tctttaaata aaaatgactc acaataattt gagattaact acaacaatat tgatcttgag ttaatttccc ttaaaatttg ctgaatggaa agccagaaag tagagtgaag gaaagggcat ggcaggaggt ctcatctctg cttcacaatg acccaaa atg ctg gaa aag ctg atg ggt gct gat Met Leu Glu Lys Leu Met Gly Ala Asp tint ctc cag ctt ttc agg gta taa aggaatctga acacgactga tattttcttt Xaa Leu Gln Leu Phe Arg Val* aatttttaga tcttctgagc agagacggta ggcacagagg tgcagagctt gttccttgmc caact acaac tgaatgagtt caacatcttc gatgggattg cacctggcct tccagatata aaatctgaaa acaaggaaag catttacaga gaagaagtaa tatgaggcct cagcaaaaag tggaagcaga actggamtct tatttgcaay gtgtgactgg cattgggtaa actctctaaa aargatggaa gatcattatg gcagccatgt ctaargaccg accagtcatg ttcttcccag gacggactct tctctggtca gagaatytct aatctacttc ctctattgca gagaaggcat tccttgggtc tggaaaagtc caggcagcct caaccacaag ccaatccttc gtgtctggga gtaagtgata ataggttttc aaggagacag gaggacggct tcttaccttc ttcatggcaa ctagaacgaa gaaataactt tgatgacaat cccagctgat aaatgccatt aaargagcat aa kaaggaag atttggaaat ctcagcccta gaaactatga tgtggacctg ctaccaaagc gtagtctggc aacacgtggt tctatgcacc 120 180 240 294 348 408 468 528 588 648 708 768 828 888 948 1008 1009 ctttttatta awtgtgcttc aagttttaac <210> <211> <212> <213> 12 897

DNA

Homo sapiens <220> <221> <222> 1. .46 <220> <221> CDS <222> 47. .97 <220> <221> 3'UTR <222> 98. .897 <220> <221> polyA,_signal <222> 873. .878 <220> <221> allele <222> 21 <223> 8-135-112 :polymorphic base C or T W0005851 0 1fttolwww. etthepatent.com/Lagin do/Sexam.suporFetchDefaut.dogNVOOSB8l 0.cpc?fromCachie=l1 art=maintoolbar-bto1Pge53o 3 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 8 -135-166 :polymorphic base A or C allele 181 99-16038-118 polymorphic base A or G allele 240 8-137-152 :polymorphic base G or T allele 270 8-137-182 :polymorphic base A or G allele 408 8-130-83 polymorphic base G or T allele 426 8-130-101 polymorphic base A or C allele 427 8-130-102 polymorphic base A or G allele 468 8-130-143 polymorphic base C or T allele 469 8-130-144 polymorphic base A or G allele 545 8-130-220 polymorphic base A or C allele 561 8-130-236 polymorphic base A or G allele 733 8-131-199 polymorphic base A or C <220> <221> allele <222> 796 a httpi/twww. etthe patent. com/Logi ndog/Sexa m. su port/Fetch/Defa ult. d og/O005851 0. cpc?fro mCa ch e= 1 part= ma intoolba r--bottom] Page 514of 737 WO 00/58510 213 <223> 8-132-97 polymorphic base C or T PCT/I'BOO/00435 <220> <221> allele <222> 863 <223> 8-132-164 <220> <221> allele <222> 878 <223> 8-132-179 *polymorphic base C or T *polymorphic base A or T <400> 12 tcatctctgc ttcacaatgc ygatgattta gctgggagga aag ctg atg ggt gct gat tint ctc cag ctt ttc Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe aggaatctga aatctacttc ctctattgca gagaaggcat tccttgggtc acatgggaaa caactgagac tcatggcaag tagaacgaat aaataacttc gatgacaatg ccagctgata aatgccattt wtgtgcttca acacgactga ataggttttc aaggagacag gaggacggc t tcttaccttc kgtgatgaca yrgatctcct aaactatgag gtggacctgc taccaaagct tagtctggcc acacgtggtg ctatgcaccc agttttaaca tattttcttt aaargagcat aakaaggaag atttggaaat ctcagcccta cttgactcmr tacaggcttg t tccttgmct aactacaacc gaatgagttt aacatcttca atgggattgt acctggcctg aatttttaga tcttctgagc agagacggta ggcacagagg tgcagagagc gtgatgaggt aagaagtaag atgaggcctc agcaaaaaga ggaagcagat ctggaintctg atttgcaayt tgtgactggg cccaaa atg ctg gaa Met Leu Glu 1 agg gta taa Arg Val tccagatata cattgggtaa aaatctgaaa actctctaaa acaaggaaag aargatggaa catttacaga gatcattatg tgggacttct aaccaatgga tacctttcac aagacctggc cagccatgtt ggaaaagtct taargaccgc aggcagcctc ccagtcatgc aaccacaagg tcttcccagc caatccttct acggactctg tgtctgggac ctctggtcag taagtgataa agaatytctc tttttattaa 97 157 217 277 337 397 457 517 577 637 697 757 817 877 897 <210> 13 <211> 777 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .46 <220> <221> CDS <222> 47. .343 <220> <221> 3'UTR <222> 344. .777 <220> <221> <222> <220> <221> <222> <223> polyA signal 753. .758 allele 21 8-135-112 polymorphic base C or T <220> <221> allele <222> W0005851 0[http:/lwww.getthepatent.rom/Lo in.dog/Sexa m. suortFetch/Defa ult. dogfMO05 8 51 0.cpc?tro MGar-he= 1 part= ma itoolba r--bottom I Page 515 of737 WO 00/58510 214 <223> 8-135-166 :polymorphic base A or C PCTIIBOO/00435 <220> <221> allele <222> 135 <223> 99-16038-1 <220> <221> allele <222> 194 <223> 8-137-152 <220> <221> allele <222> 224 <223> 8-137-182 <220> <221> allele <222> 362 <223> 8-130-83 <220> <221> allele <222> 425 <223> 8-130-220 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 441 8-130-236 allele 613 8-131-199 allele 676 8-132- 97 allele 743 8-132-164 allele 758 8-132-179 18 :polymorphic base A or G :polymorphic base G or T :polymorphic base A or G :polymorphic base G or T :polymorphic base A or C :polymorphic base A or G :polymorphic base A or C :polymorphic base C or T :polymorphic base C or T :polymorphic base A or T <400> 13 tcatctctgc ttcacaatgc ygatgattta gctgggagga cccaaa atg ctg gaa Met Leu Glu 1 aag ctg atg ggt gct gat tint ctc cag ctt ttc aga tcc aga tat aca Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe Arg Ser Arg Tyr Thr 10 ttg ggt aaa atc tac ttc ata ggt ttt caa arg agc att ctt ctg agc Leu Gly Lys Ile Tyr Phe Ile Gly Phe Gln Xaa Ser Ile Leu Leu Ser 25 30 aaa tct gaa aac tct cta aac tct att gca aag gag aca gaa kaa gga 199 W0005851 0 [httpi/tww.getthepatent.comLocin.doo/Sexam.support/FetchDef ult.doqNOOSB8l O.cpc?fromCar-he=l1 art=maintoolbar--botom~ Page 516 of 737 WO 00/58510 PCT/EBOO/00435 Lys Ser Glu Asn Ser Leu Asn Ser Ile Ala Lys 45 aga gag acg gta aca agg aaa gaa rga tgg aag Arg Glu Thr Val Thr Arg Lys Glu Xaa Trp Lys 60 ggc tat ttg gaa atg gca cag agg cat tta cag Gly Tyr Leu Glu Met Ala Gin Arg His Leu Gin 75 tgg gtc tct tac ctt cct cag ccc tat gca gag Trp Val Ser Tyr Leu Pro Gin Pro Tyr Ala Glu Glu Thr Glu Xaa Gly aga agg cat gag gac Arg Arg His Glu Asp aga tca tta tgt cct Arg Ser Leu Cys Pro agc tgg gac ttc taa Ser Trp Asp Phe* ccaatggaac caagaaacta gaatgtggac cttctaccaa aatgtagtct gataacacgt atttctatgc ttcaagtttt at ggga a akg tgagttcctt ctgcaactac agctgaatga ggccaacatc ggtgatggga acccacctgg aaca cttgaagaag gmct atgagg aaccagcaaa gtttggaagc ttcactggam ttgtatttgc cctgtgtgac taagcagcca cctctaarga aagaccagtc agattcttcc tctgacggac aaytctctgg tgggagaaty tgttggaaaa ccgcaggcag atgcaaccac cagccaatcc tctgtgtctg tcagtaagtg tctcttttta 247 295 343 403 463 523 583 643 703 763 777 gtcttcatgg cctctagaac aaggaaataa ttctgatgac ggacccagct ataaaatgcc ttaawtgtgc <210> <211> <212> <213> 14 823

DNA

Homo sapiens <220> <221> 51 UTR <222> 1. .46 <220> <221> CDS <222> 47. .97 <220> <221> 3'UTR <222> 98. .823 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> polyA signal 799. .804 allele 21 8-135-112 polymorphic base C or T allele 8-135-166 polymorphic base A or C allele 181 99-16038-118 polymorphic base A or G allele 240 8-137-152 :polymorphic base G or T <220> <221> allele W0005851 0 [h tiww. etthepa tent.comfI.og in.d og/Sexa m. supportFetchfDefa ult. d oNVO0585 0.cpc?fromCache=l1 art~maintoolbar--boftomI Page 517 of 737 WO 00/58510 PCTIBOO/00435 <222> 270 <223> 8-137-182 :polymorphic base A or G <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 408 8-130-8 3 allele 471 8-130-220 allele 487 130-23 6 allele 659 8-131-199 allele 722 8-132- 97 allele 789 8-132-164 allele 804 8-132-17 9 polymorphic base G or T *polymorphic base A or C *polymorphic base A or G *polymorphic base A or C polymorphic base C or T *polymorphic base C or T *polymorphic base A or T <400> 14 tcatctctgc ttcacaatgc ygatgattta gctgggagga cccaaa atg ctg gaa Met Leu Glu aag ctg atg ggt gct gat tint ctc cag ctt ttc agg gta taa Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe Arg Val aggaatctga aatctacttc ctctattgca gagaaggcat tccttgggtc acatgggaaa tatgagttcc acctgcaact aaagctgaat ctggccaaca gtggtgatgg gcacccacct ttaaca acacgactga ataggttttc aaggagacag gaggacggct tcttaccttc kgcttgaaga ttgmctatga acaaccagca gagtttggaa tcttcactgg gattgtattt ggcctgtgtg tattttcttt aaargagcat aakaaggaag atttggaaat ctcagcccta agtaagcagc ggcctctaar aaaagaccag gcagattctt amtctgacgg gcaaytctct actgggagaa aatttttaga tcttctgagc agagacggta ggcacagagg tgcagagagc catgttggaa gaccgcaggc tcatgcaacc cccagccaat actctgtgtc ggtcagtaag tytCtctttt tccagatata aaatctgaaa acaaggaaag catttacaga tgggacttct aagtct tcat agcctctaga acaaggaaat ccttctgatg tgggacccag tgataaaatg tattaawtgt cattgggtaa actctctaaa aargatggaa gatcattatg aaccaatgga ggcaagaaac acgaatgtgg aacttctacc acaatgtagt ctgataacac ccatttctat gcttcaagtt 97 157 217 277 337 397 457 517 577 637 697 757 817 823 <210> <211> 836 <212> DNA <213> Homo sapiens W0005851 0 [tqpL.twww etthe patent. comII~ag in.dog/$exa msup~rIecIeautdgWOSb 0C fromiCachie=l1part~maintoolbar--bottoml Page 518 of 737 WO 00/58510 <220> <221> <222> 1. .46 <220> <221> CDS <222> 47. .427 <220> <221> 3'tJTR <222> 428. .836 PCTIIBOO/00435 <220> <221> <222> polyAsigial 812. .817 <220> <221> allele <222> 21 <223> 8-135-112 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 8- 13 5-166 allele 135 99-16038-11 allele 194 8-137-152 allele 224 8-137-182 allele 338 8-145-138 allele 354 8-145-154 allele 397 8-145-197 allele 484 8-130 -22 0 :polymorphic base C or T :polymorphic base A or C 8 :polymorphic base A or G :polymorphic base G or T :polymorphic base A or G :polymorphic base G or T :polymorphic base A or G :polymorphic base A or G :polymorphic base A or C W0005851 0 fhttp:ltww.getthepatent.com/Login.dog/Sexam.supportIFetch/DefautdgV05l 0.~~rmah=1Dr~ano~a~otm ae 519 of 737 WO 00/58510 PCTIBOOIOO435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 500 8-130 -236 allele 672 8-131-199 allele 735 8-132- 97 allele 802 8-132-164 :polymorphic base A or G polymorphic base A or C polymorphic base C or T polymorphic base C or T <220> <221> allele <222> 817 <223> 8-132-179 :polymorphic base A or T <400> tcatctctgc ttcacaatgc ygatgattta gctgggagga cccaaa atg ctg gaa Met Leu Glu 1 aga tcc aga tat aca Arg Ser Arg Tyr Thr aag ctg Lys Leu ttg ggt Leu Gly atg ggt gct gat Met Gly Ala Asp ctc cag ctt ttc Leu Gin Leu Phe aaa atc tac Lys Ile-Tyr aa a Lys t tc Phe 25 cta Leu ata ggt ttt Ile Gly Phe aac tct att Asn Ser Ile caa arg Gin Xaa gca aag Ala Lys att ctt ctg Ile Leu Leu tct gaa aac tct Ser Giu Asn Ser gag aca gaa Glu Thr Glu kaa gga Xaa Gly aga gag acg Arg Giu Thr ggc tat ttg Gly Tyr Leu tgg gtc tct Trp Val Ser gta aca Val Thr agg aaa gaa Arg Lys Giu aag aga agg Lys Arg Arg gaa Glu atg gca cag Met Ala Gin tta cag aga Leu Gln Arg t ca Ser t cc Ser cat gag gac His Glu Asp tta tgt cct Leu Cys Pro aag ktg att Lys Xaa Ile tac ctt cct Tyr Leu Pro tat gca gaa Tyr Ala Giu ggc art ttg Gly Xaa Leu cat ttt aaa His Phe Lys tct cag ata Ser Gin Ile ggr cac ttt Giy His Phe atg Met 120 gga gac act Gly Asp Thr tga agaagtaagc agccatgttg aargaccgca cagtcatgca cttcccagcc cggactctgt tctggtcagt gaatytctct <210> 16 <211> 882 <212> DNA gaaaagtctt ggcagcctct accacaagga aatccttctg gtctgggacc aagtgataaa ttttattaaw catggcaaga agaacgaatg aataacttct atgacaatgt cagctgataa atgccatttc tgtgcttcaa aactatgagt tggacctgca accaaagctg agtctggcca cacgtggtga tatgcaccca gttttaaca tccttgmcta actacaacca aatgagtttg acatcttcac tgggattgta cctggcctgt tgaggcctct gcaaaaagac gaagcagatt tggamtctga tttgcaaytc gtgactggga W0005851 0 fhttp:llwww.gethptetcol gn o/Sexa m. supportFetch/efaut. do NO00S550.cpc?fromCar-he=l1 art=maintoolbar--bottomI Page 520 of 737 WO 00/58510 PCT/EBOO/00435 <213> Homo sapiens <220> <221> <222> 1.-46 <220> <221> CDS <222> 47. .97 <220> <221> 3'UTR <222> 98. .882 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> polyA signal 858. .863 allele 21 8 -135-112 allele 8 -135-166 allele 181 99-16038-1 allele 240 8-137-152 allele 270 8-137- 18 2 allele 384 8-145-138 allele 400 8-145-154 allele 443 8-145-197 allele 530 8-130-22 0 polymorphic base C or T polymorphic base A or C 18 :polymorphic base A or G *polymorphic base G or T *polymorphic base A or G *polymorphic base G or T *polymorphic base A or G polymorphic base A or G :polymorphic base A or C W0005851 0 [httpltwww.getthepatent~com[Login.dog/Sexam.suportFetchDefaut.doqgiWO005851 0.cpc?fromCache=l part=maintoolbar--bottom) Page 521 of 737 WO 00/58510 PCTIB0OO435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 546 8-130-236 allele 718 8 -13 1-199 allele 781 8-132-97 allele 848 8-132-164 allele 863 8-132-179 :polymorphic base A or G polymorphic base A or C polymorphic base C or T polymorphic base C or T polymorphic base A or T <400> 16 tcatctctgc ttcacaatgc ygatgattta gctgggagga aag ctg atg ggt gct gat tint ctc cag ctt ttc Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe cccaaa atg ctg gaa Met Leu Glu 1 agg gta taa Arg Val* aggaatctga aatctacttc ctctattgca gagaaggcat tccttgggtc cartttgcac agacactgag atgagttcct cctgcaacta aagctgaatg tggccaacat tggtgatggg cacccacctg taaca acacgactga ataggttttc aaggagacag gaggacggct tcttaccttc tgtcatttta gcttgaagaa tginctatgag caaccagcaa agtttggaag cttcactgga attgtatttg gcctgtgtga tattttcttt aaargagcat aa kaaggaag atttggaaat ctcagcccta aaagaatttc gtaagcagc gcctctaarg aaagaccagt cagattcttc mtctgacgga ca ayt ctct g ctgggagaat aatttttaga tcttctgagc agagacggta ggcacagagg tgcagaacat tcagatattt atgttggaaa accgcaggca catgcaacca ccagccaatc ctctgtgtct gtcagtaagt ytCtcttttt tocagatata aaatctgaaa acaaggaaag catttacaga tccaagktga gctggrcact agtcttcatg gcctctagaa caaggaaata cttctgatga gggacccagc gataaaatgc attaawtgtg cattgggtaa actctctaaa aargatggaa gatcattatg ttctaaatgg ttatggaagg gcaagaaact cgaatgtgga acttctacca caatgtagtc tgataacacg catttctatg cttcaagttt <210> 17 <211> 955 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .46 <220> <221> CDS <222> 47. .235 <220> <221> 3'rJTR <222> 236. .955 W0005851 0 [htt:Itwww.qetthep~atentcomLoinqdog/exam.suportFetchIDefaut.do NVO005 8 51 0.cpc?fromCache= 1 part=maintoolbar-bottoml Page 522 of 737 WO 00/58510 PCTIEiBOO/00435 <220> <221> <222> polyA,_signal 931. .936 <220> <221> allele <222> 21 <223> 8-135-112 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 8 -135-166 allele 135 99-16038-11 allele 217 8-137-152 allele 247 8-137-18 2 allele 361 8-145-138 allele 377 8-145-154 allele 420 8-145-197 allele 505 8 -14 3-2 32 allele 512 8-14 3-2 39 allele 515 8-143-242 polymorphic base C or T polymorphic base A or C 8 :polymorphic base A or G polymorphic base G or T polymorphic base A or G polymorphic base G or T polymorphic base A or G polymorphic base A or G polymorphic base G or C *polymorphic base A or G *polymorphic base C or T <220> <221> allele <222> 518 W0005851 0 pttrpJAww. etthe patent. co mIIog in.d og/Sexa m. support/FetchfDefa uIt. d ogiWO0058 51 0.cpc?fro mCa rhe= 1 part= ma intoolba r--bofto ml Page 523 of 737 WO 00/58510 PCTJIBOO/00435 222 base A or C <223> 8-143-245 :polymorphic <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 603 8-130-220 allele 619 8-130-236 allele 791 8-131-199 allele 854 8-132- 97 allele 921 8-132-164 allele 936 8-132-17 9 polymorphic base A or C polymorphic base A or G polymorphic base A or C polymorphic base C or T polymorphic base C or T polymorphic base A or T <400> 17 tcatctctgc ttcacaatgc ygatgattta gctgggagga cccaaa atg ctg gaa Met Leu Glu 1 aag ctg atg ggt gct gat tint ctc cag ctt ttc aga tcc aga tat aca Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe Arg Ser Arg Tyr Thr 10 ttg ggt aaa atc tac ttc ata ggt ttt caa arg agc att ctt ctg agc Leu Gly Lys Ile Tyr Phe Ile Gly Phe Gln Xaa Ser Ile Leu Leu Ser 25 30 aaa tct gaa aac tct cta aac tct att ggt att cac caa atc cac aaa Lys Ser Glu Asn Ser Leu Asn Ser Ile Gly Ile His Gln Ile His Lys 45 aat caa agg aga cag aak aag gaa gag aga cgg taa caaggaaaga Asri Gln Arg Arg Gln Xaa Lys Glu Glu Arg Arg argatggaag atcattatgt tctaaatggc tatggaagga acctccaaca aagaagtaag atgaggcctc agcaaaaaga ggaagcagat ctggamtctg atttgcaayt tgtgactggg <210> 18 <211> 851 agaaggcatg ccttgggtct art ttgcact gacactgagg gatggaaat 5 cagccatgtt taargaccgc ccagtcatgc tcttcccagc acggactct g ctctggtcag agaatytctc aggacggcta cttaccttcc gtcattttaa ctcattttgt aaaaccrtcy ggaaaagtct aggcagcctc aaccacaagg caatccttct tgtctgggac taagtgataa tttttattaa tttggaaatg tcagccctat aagaatttct ataaagcagg t gnt accaga tcatggcaag tagaacgaat aaataacttc gatgacaatg ccagctgata aatgccattt wtgtgcttca gcacagaggc gcagaacatt cagatatttg cctttatgtc ccttggatct aaactatgag gtggacctgc taccaaagct tagtctggcc acacgtggtg ctatgcaccc agttttaaca atttacagag ccaagktgat ctggrcactt agaagctgag ggaaggcttg ttccttgmct aactacaacc gaatgagttt aacatcttca atgggattgt acctggcctg W0005851 0 rhth3:/Atw-atthea tent. comLo i n.d oa/Sexa m. su nortFetchDefa ut.doQAwOOO585l 0.cpc?fromCarhe= 1 Dart=maintoolbar--bottom1 Paqe 524 of 737 WO 00/58510 PCT/IBOO/00435 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .46 <220> <221> CDS <222> 47. .343 <220> <221> 3'UTR <222> 344. .851 <220> <221> <222> <220> <221> <222> <223> polyA,_signal 827. .832 allele 21 8-135-112 <220> <221> allele <222> <223> 8-135-166 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 135 99-16038 -1 allele 194 8-137- 152 allele 224 8-137-18 2 allele 362 8-130 -8 3 allele 380 8-130-10 1 allele 381 8-130-102 allele 422 8-130-14 3 :polymorphic base C or T :polymorphic base A or C 18 :polymorphic base A or G :polymorphic base G or T :polymorphic base A or G polymorphic base G or T :polymorphic base A or C :polymorphic base A or G :polymorphic base C or T W0005851 0 fhttp:/MMww.getthepatent.com/Login.dog/SexamsupportFetch/Default.dogivo00585 0.cpc?fromCactie= 1 part=maintoo~baE-.bOttOmjPage 525 of 737 WO 00/58510 PCT/EBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 423 8-130-144 allele 499 8- 130-22 0 allele 515 8-130-236 allele 687 8- 13 1-19 9 allele 750 8-132-97 allele 817 8-132-164 allele 832 8- 132-17 9 :polymorphic base A or G *polymorphic base A or C *polymorphic base A or G *polymorphic base A or C polymorphic base C or T *polymorphic base C or T *polymorphic base A or T <400> 18 tcatctctgc ttcacaatgc ygatgattta gctgggagga aag ctg Lys Leu ttg ggt Leu Gly aaa tct Lys Ser atg ggt gct gat Met Gly Ala Asp aaa atc tac ttc Lys Ile Tyr Phe ctc cag ctt ttc Leu Gln Leu Phe cccaaa atg ctg gaa Met Leu Glu 1 aga tcc aga tat aca Arg Ser Arg Tyr Thr agc att ctt ctg agc Ser Ile Leu Leu-Ser ggt ttt caa Gly Phe Gln gaa aac Glu Asn t ct Ser cta aac tct att gca aag gag aca gaa Leu Asn Ser Ile Ala Lys Glu Thr Glu kaa gga Xaa Gly aga gag acg Arg Glu Thr ggc tat ttg Gly Tyr Leu tgg gtc tct Trp Val Ser ccaatggaac gacctggcca aaaagtcttc gcagcctcta ccacaaggaa aca agg aaa gaa Thr Arg Lys Glu rga tgg aag aga agg cat gag gac Xaa Trp Lys Arg Arg His Glu Asp atg gca cag Met Ala Gln cat tta cag aga His Leu Gln Arg tta tgt cct Leu Cys Pro tac ctt cc Tyr Leu P3 atgggaaa kg actgagacyr atggcaagaa gaacgaatgt ataacttcta ccc tat gca gag Pro Tyr Ala Glu tgatgacact gatctcctta actatgagtt ggacctgcaa ccaaagctga tgactcrmrgt caggcttgaa ccttgmctat ctacaaccag atgagtttgg agc tgg gac ttc taa Ser Trp Asp Phe* gatgaggtta cctttcacaa gaagtaagca gccatgttgg gaggcctcta argaccgcag caaaaagacc agtcatgcaa aagcagattc ttcccagcca W0005851 0 [http:Avwwwgetthepatent.comfLogin.dog/Sexam.suportFetchDefauit.doANVO005851 0-cpc?fromCachie= 1.part=maintoolbar--bottom)_Page 526 of 737 WO 00/58510 PCT/EBOO/00435 atccttctga tctgggaccc agtgataaaa tttattaawt tgacaatgta agctgataac tgccatttct gtgcttcaag gtctggccaa catcttcact ggamtctgac ggactctgtg acgtggtgat gggattgtat ttgcaaytct ctggtcagta atgcacccac ctggcctgtg tgactgggag aatytctctt ttttaaca <210O> <211> <212> <213> 19 742

DNA

Homo sapiens <220> <221> <222> 1. .46 <220> <221> CDS <222> 47. .508 <220> <221> 31UTR <222> 509. .742 <220> <221> <222> polyA,_signal 718. .723 <220> <221> allele <222> 21 <223> 8-135-112 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 8 -13 5-166 allele 135 99-16038-11 allele 194 8 -137-152 allele 224 8-137- 182 allele 390 8-130-220 allele 406 8-130-236 :polymorphic base C or T polymorphic base A or C 8 :polymorphic base A or G polymorphic base Gor T :polymorphic base A or G :polymorphic base A or C :polymorphic base A or G <220> <221> allele W0005851 0 pV _geteaetcoIoi~ogSxms~ort/Fetch/Defaut.dog/WIO05851 0.cpc?fromCache=1 art=maintoolbar--bottomI Page 527 of 737 WO 00/58510 PCT/IBOO/00435 <222>' 578 <223> 8-131-199 polymorphic base A or C <220> <221> allele <222> 641 <223> 8-132-97 polymorphic base C or T <220> <221> allele <222> 708 <223> 8-132-164 polymorphic base C or T <220> <221> allele <222> 723 <223> 8-132-179 polymorphic base A or T <400> 19 tcatctctgc ttcacaatgc ygatgattta gctgggagga cccaaa atg ctg gaa Met Leu Glu 1 aga tcc aga tat aca aag Lys ttg Leu aaa Lys aga Arg ggc Gly tgg Trp agc Ser 100 tat Tyr tgc Cys act Thr ct g Leu ggt Gly tct Ser gag Glu tat Tyr gtc Val cat His gag Glu aac Asn t ct Ser ggt gct gat Gly Ala Asp atc tac ttc Ile Tyr Phe 25 aac tct cta Asn Ser Leu gta aca agg Val Thr Arg gaa atg gca Glu Met Ala tac ctt cct Tyr Leu Pro gga aaa gtc Gly Lys Val 105 tct aar gac Ser Lys Asp 120 aac cag caa Asn Gin Gln 135 aaa gct gaa Lys Ala Glu tint ctc cag Xaa Leu Gin ata ggt ttt Ile Gly Phe aac tct att Asn Ser Ile aaa gaa rga Lys Glu Xaa cag agg cat Gln Arg His cag ccc tat Gln Pro Tyr ttc atg gca Phe Met Ala cgc agg cag Arg Arg Gln aaa gac cag Lys Asp Gln 140 tga gtttgga ttc Phe arg Xaa 30 aag Lys aag Lys cag Gln gag Glu aac Asn 110 ct a Leu t gc Cys Tyr Thr ctg agc Leu Ser kaa gga Xaa Gly gag gac Glu Asp tgt cct Cys Pro gta agc Val Ser ctt gmc Leu Xaa 115 tgg acc Trp Thr 130 gaa ata Glu Ile 103 151 199 247 295 343 391 439 487 538 598 658 718 742 Asn His Lys agc agattcttcc cagccaatcc 150 ttctgatgac aatgtagtct ggccaacatc ttcactggam tctgacggac tctgtgtctg ggacccagct gataacacgt ggtgatggga ttgtatttgc aaytctctgg tcagtaagtg ataaaatgcc atttctatgc acccacctgg cctgtgtgac tgggagaaty tctcttttta ttaawtgtgc ttcaagtttt aaca <210> <211> 920 <212> DNA <213> Homo sapiens <220> W0005851 01 rht/ww. etthe patentcomfLqoginAdoglexa m .su pport/Fetch/Default. dogAN0005 8 51 0.cpc?fromCa che= 1 part= ma intool bar--boto ml Pa ge 52 8 of 7 37 WO 00/58510 <221> <222> 1. .46 <220> <221> CDS <222> 47. .97 <220> <221> 3'tJTR <222> 98. .920 PCT/EB00100435 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> polyA signal 896. .901 allele 21 8-135-112 allele 8-135-166 allele 181 9 9-16038-1 allele 263 8-137 -152 allele 293 8-137-18 2 allele 431 8-130-8 3 allele 449 8-130-101 allele 450 8-130- 10 2 allele 491 8- 130-14 3 :polymorphic base C or T :polymorphic base A or C 18 :polymorphic base A or G :polymorphic base G or T :polymorphic base A or G polymorphic base G or T :polymorphic base A or C :polymorphic base A or G :polymorphic base C or T <220> <221> allele <222> 492 W0005851 0 fhttp:ltwww. etthe patent. comI~OAin.d og/Sexa m. supotechefutdQWO5l Op~rm~ce art~maintobar--bottoml Page 529 of 737 WO 00/58510 PCTIIBOO/00435 228 base A or G <223> 8-130-144 :polymorphic <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 568 8 -13 0-220 allele 584 8-130-236 allele 756 8-131-199 allele 819 8-132-97 allele 886 8- 132-164 allele 901 8-132- 17 9 polymorphic base A or C polymorphic base A or G polymorphic base A or C polymorphic base C or T polymorphic base C or T polymorphic.base A or T <400> tcatctctgc ttcacaatgc ygatgattta gctgggagga cccaaa atg ctg gaa Met Leu*Glu 1 aag ctg atg ggt gct gat tint ctc cag ctt ttc agg gta taa Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe Arg Val aggaatctga aatctacttc ctctattggt gtaacaagga aggcatttac agctgggact ggttaccttt aagcagccat ctctaargac agaccagtca gattcttccc ctgacggact aytctctggt gggagaatyt acacgactga ataggttttc attcaccaaa aagaargatg agagatcatt tctaaccaat cacaagacct gttggaaaag cgcaggcagc tgcaaccaca agccaatcct ctgtgtctgg cagtaagtga ctctttttat tattttcttt aaargagcat tccacaaaaa gaagagaagg atgtccttgg ggaacatggg ggccaactga tcttcatggc ctctagaacg aggaaataac tctgatgaca gacccagctg taaaatgcca taawtgtgct aatttttaga tcttctgagc tcaaaggaga catgaggacg gtctcttacc aaakgtgatg gacyrgatct aagaaactat aatgtggacc ttctaccaaa atgtagtctg ataacacgtg tttctatgca tcaagtttta tccagatata aaatctgaaa cagaakaagg gctatttgga ttcctcagcc acacttgact ccttacaggc gagttccttg tgcaactaca gctgaatgag gccaacatct gtgatgggat ccc acc tgg c aca cattgggtaa actctctaaa aagagagacg aatggcacag ctatgcagag cinrgtgatga ttgaagaagt mctatgaggc accagcaaaa tttggaagca tcactggamt tgtatttgca ctgtgtgact <210> 21 <211> 811 <212> DNA <213> Homo sapiens <220> <221> <222> 46 W0005851 0[ twww getthepa tent. com/Log inAlog/Sexam. suportFetchDefa ut. doaNVO005851 0.coc?fromC ache= 1 part= ma intool ba r--bottom] Page 530 of 737 WO 00/58510 <220> <221> CDS <222> 47. .97 <220> <221> 3'UTR <222> 98. .811 PCTIBOOIOO435 <220> <221> <222> polyA,_signal 787. .792 <220> <221> allele <222> 21 <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 8- 135-112 allele 8-135-166 allele 181 99-16038-1 allele 263 8-137-152 allele 293 8-137-18 2 allele 459 8-130 -22 0 allele 475 8-130-23 6 allele 647 8-131-199 allele 710 8-132-97 polymorphic base C or T polymorphic base A or C 18 polymorphic base A or G *polymorphic base G or T *polymorphic base A or G *polymorphic base A or C *polymorphic base A or G *polymorphic base A or C polymorphic base C or T <220> <221> allele <222> 777 <223> 8-132-164 :polymorphic base C or T <220> W0005851 0 [http J~ww.qetthe patent.comLog in.dog/Sexa m. su portFetchi~e fa uIt.dogMO005 8 51 0 cpc?fromCache= 1 part= ma intoolba r-boftoml Page 531 of 737 WO 00/58510 230 <221> allele <222> 792 <223> 8-132-179 :polymorphic base A or T <400> 21 tcatctctgc ttcacaatgc ygatgattta gctgggagga PCT/IBOO/00435 cccaaa atg ctg gaa Met Leu Glu aag ctg atg ggt gct gat tint ctc cag ctt ttc agg gta taa Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe Arg Val aggaatctga aatctacttc ctctattggt gtaacaagga aggcatttac cttgaagaag ginctatgagg aaccagcaaa gttt ggaagc ttcactggam ttgtatttgc cctgtgtgac acacgactga ataggttttc attcaccaaa aagaargatg agagatcatt taagcagcca cctctaarga aagaccagtc agattcttcc tctgacggac aaytctctgg tgggagaaty tattttcttt aaargagcat tccacaaaaa gaagagaagg atgtccttgg tgttggaaaa ccgcaggcag atgcaaccac cagccaatcc tctgtgtctg tcagtaagtg tctcttttta aatttttaga tcttctgagc tcaaaggaga catgaggacg gtctcttacc gtcttcatgg cct ctagaac aaggaaataa ttctgatgac ggacccagct ataaaatgcc ttaawtgtgc tccagatata aaatctgaaa cagaakaagg gctatttgga ttcctcagcc caagaaacta gaatgtggac cttctaccaa aatgtagtct gataacacgt atttctatgc ttcaagtttt cattgggtaa actctctaaa aagagagacg aatggcacag ctatgcagag tgagttcctt ctgcaactac agctgaatga ggccaacatc ggtgatggga acccacctgg aaca <210> <211> <212> <213> 22 978

DNA

Homo sapiens <220> <221> 5 1UTR <222> 46 <220> <221> COS <222> 47. .97 <220> <221> 31UTR <222> 98. .978 <220> <221> <222> polyA,_signal 954. .959 <220> <221> allele <222> 21 <223> 8-135-112 <220> <221> <222> <223> <220> <221> <222> <223> allele 8-135-166 allele 181 99-16038-11 polymorphic base C or T polymorphic base A or C 8 :polymorphic base A or G <220> <221> allele <222> 240 W000585 10 [httpJlwww.qetthepatent.com/Login.dog/Sexamsupport/Fetch/DefauIt.dogNVO005851 0.cpc?fromCarhe= 1part=maintoolbar--bottom] Page 532 of 737 WO 00/58510 PCTIIBOO/00435 231 base G or T <223> 8-137-152 :polymorphic <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> allele 270 8- 137-182 allele 384 8-145-138 allele 400 8-14 5-15 4 allele 443 8-145-197 allele 528 8-143-232 allele 535 8-14 3-2 39 allele 538 8-143-242 allele 541 8-14 3-24 5 allele 626 8-13 0-22 0 allele 642 8-130 -2 36 allele 814 8-131-:199 allele 877 8-132-97 polymorphic base A or G polymorphic base G or T polymorphic base A or G polymorphic base A or G polymorphic base G or C polymorphic base A or G polymorphic base C or T polymorphic base A or C polymorphic base A or C polymorphic base A or G polymorphic base A or C polymorphic base C or T W0005851 0 [tQ:/Arww.getthe patent.com1Log in.dog/Sexa m.supot~th~futoiOO8 1 _c?tromChe=j 1part= m a ntoo Iba r--bottomj Page 533 of 737 WO 00/58510 232 <221> allele <222> 944 <223> 8-132-164 polymorphic base C or T <220> <221> allele <222> 959 <223> 8-132-179 polymorphic base A or T <400> 22 tcatctctgc ttcacaatgc ygatgattta gctgggagga aag ctg atg ggt gct gat tint ctc cag ctt ttc Lys Leu Met Gly Ala Asp Xaa Leu Gin Leu Phe PCT/iBOOIOO435 aggaatctga aatctacttc ctctattgca gagaaggcat tccttgggtc cartttgcac agacactgag agatggaaat gcagccatgt ctaargaccg accagtcatg ttcttcccag gacggact ct tctctggtca gagaatytct acacgactga at aggtt tt c aaggagacag gaggacggct tcttaccttc tgtcatttta gctcattttg saaaaccrtc tggaaaagtc caggcagcct caaccacaag ccaatccttc gtgtctggga gtaagtgata ctttttatta tattttcttt aaargagcat aakaaggaag atttggaaat ctcagcccta aaagaatttc tataaagcag ytgmtaccag ttcatggcaa ctagaacgaa gaaataactt tgatgacaat cccagctgat aaatgccatt awtgtgcttc aatttttaga tcttctgagc agagacggta ggcacagagg tgcagaacat tcagatattt gcctttatgt accttggatc gaaactatga tgtggacctg ctaccaaagc gtagtctggc aacaCgtggt tctatgcacc aagttttaac cccaaa atg ctg gaa Met Leu Glu 1 agg gta taa Arg Val tccagatata cattgggl aaatctgaaa actctct 4 acaaggaaag aargatg catttacaga gatcatt tccaagktga ttctaaal gctggrcact ttatgga cagaagctga gacctcc tggaaggctt gaagaagl gttccttgmc tatgagg caactacaac cagcaaa tgaatgagtt tggaagc caacatcttc actggam gatgggattg tatttgc.

cacctggcct gtgtgaci a taa ~aaa gaa atg Lgg agg ac taa cct aag aga L ct aa y Lgg <210> 23 <211> 993 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .46 <220> <221> COS <222> 47. .97 <220> <221> 31UTR <222> 98. .993 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> polyA,_signal 969. .974 allele 21 8- 135-112 allele 8- 135-16 6 :polymorphic base C or T :polymorphic base A or C W0005851 0 [http:/twww.getthepatent.comf~ogindog/Sexamsupport/Fetch/Default.dogIO05 8 51 0.cpc?fromCache= 1part=maintoolbar--botoml.Paqe 534 of 737 WO 00/58510 PCTIIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> -<220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 181 99-16038-118 :polymorphic base A or G allele 240 8-137-15 2 allele 270 8- 137-182 allele 434 8 -14 3-2 32 allele 441 8-143-239 allele 444 8-143-242 allele 447 8 -14 3-245 allele 504 8- 130-8 3 allele 522 8-130-101 allele 523 8-130-102 allele 564 8-130-14 3 allele 565 8- 130-14 4 :polymorphic base G or T :polymorphic base A or G polymorphic base G or C polymorphic base A or G polymorphic base C or T polymorphic base A or C polymorphic base G or T polymorphic base A or C polymorphic base A or G polymorphic base C or T :polymorphic base A or G <220> <221> allele <222> 641 W0005851 0[http:/twww. etthepatent.rom/Login.dogi$exam.support/Fetch/Default.dogMV000565l .Cc'tromCarhe=l1part=maintoolbar--bottoml Pagie535 of 737 WO 00/58510 PCTIBOO/00435 234 base A or C <223> 8-130-220 :polymorphic <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 657 8-130 -23 6 allele 829 8-131-199 allele 892 8-132- 97 allele 959 8-132-164 allele 974 8-132- 17 9 *polymorphic base A or G *polymorphic base A or C polymorphic base C or T *polymorphic base C or T *polymorphic base A or T <400> 23 tcatctctgc ttcacaatgc ygatgattta gctgggagga aag ctg atg ggt gct gat tint ctc cag ctt ttc Lys Leu Met Gly Ala Asp Xaa Leu Gln Leu Phe 10 cccaaa atg ctg gaa Met Leu Glu 1 aggaatctga aatctacttc ctctattgca gagaaggcat tccttgggtc ttatgtcaga tggatctgga act cmrgtga ggcttgaaga ttgmctatga acaaccagca gagtttggaa tcttcactgg gattgtattt ggcctgtgtg acacgactga ataggttttc aaggagacag gaggacggct tcttaccttc agctgagacc aggagctggg tgaggttacc agtaagcagc ggcctctaar aaaagaccag gcagattctt amtctgacgg gcaaytctct actgggagaa tattttcttt aaargagcat aakaaggaag atttggaaat ctcagcccta tccaacagat acttctaacc tttcacaaga catgttggaa gaccgcaggc tcatgcaacc cccagccaat actctgtgtc ggtcagtaag tytctctttt aatttttaga tcttctgagc agagacggta ggcacagagg tgcagagctc ggaaatsaaa aatggaacat cctggccaac aagtcttcat agcctctaga acaaggaaat ccttctgatg tgggacccag tgataaaatg tattaawtgt agg gta taz Arg Val tccagatata aaatctgaaa acaaggaaag catttacaga attttgtata accrtcytgm gggaaakgtg tgagacyrga ggcaagaaac acgaatgtgg aacttctacc acaatgtagt ctgataacac ccatttctat gcttcaagtt cattgggtaa actctctaaa aargatggaa gatcattatg aagcaggcct taccagacct atgacacttg tctccttaca tatgagttcc acctgcaact aaagctgaat ctggccaaca gtggtgatgg gc accc acct ttaaca 97 157 217 277 337 397 457 517 577 637 697 757 817 877 937 993 <210> <211> <212> <213> 24 822

DNA

Homo sapiens <220> <221> <222> 1. .46 <220> <221> COS <222> 47. .97 W0005851 0 [http:/twww.getth~epatent.rComIIogin.dog/Sexam.suportFetch/Defaut.doqfNVO00 5 8 5 1 0.CpC~tromCaChe= 1 part=maifltoolbar-bottomI Page 53b of 137 WO 00/58510 PCT/EBOO/00435 <220> <221> 3'UTR <222> 98. .822 <220> <221> polyA,_signal <222> 798. .803 <220> <221> allele <222> 21 <223> 8-135-112 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 8-135-166 allele 181 99-16038-1 allele 240 8- 137-152 allele 270 8-137 -182 allele 436 8-130-22 0 allele 452 8-130 -2 36 allele 624 8-131-199 allele 721 8-132-97 allele 788 8- 132-164 allele 803 8-132-17 9 :polymorphic base C or T :polymorphic base A or C 18 polymorphic base A or G polymorphic base G or T polymorphic base A or G polymorphic base A or C polymorphic base A or G polymorphic base A or C polymorphic base C or T :polymorphic base C or T :polymorphic base A or T W0005851 0 http://www.getthepatent.com/Lo in.dog/exam.suportFetchDefault.doiNOOSS8l0.cpc?fromCache= 1 part=maintoolbaC-7Aqtom Page 537 of 737 WO 00/58510 PCTIBOO/00435 <400> 24 tcatctctgc ttcacaatgc ygatgattta gctgggagga aag ctg atg ggt gct gat tint ctc cag ctt ttc Lys Leu Met Gly Ala Asp Xaa Leu Gin Leu Phe cccaaa atg ctg gaa Met Leu Glu agg gta taa Arg Val aggaatctga aatctacttc ctctattgca gagaaggcat tccttgggtc tggaaaagtc caggcagcct caaccacaag ccaatccttc gtgtctggga aggtgatggg cacccacctg taaca acacgactga ataggttttc aaggagacag gaggacggct tcttaccttc ttcatggcaa ctagaacgaa gaaataactt tgatgacaat cccagctgat attgtatttg gcctgtgtga 10 tattttcttt aaargagcat aakaaggaag atttggaaat ctcagcccta gaaactatga tgtggacctg ctaccaaagc gtagtctggc aacacgtgtt caaytctctg ctgggagaat aatttttaga tcttctgagc agagacggta ggcacagagg tgcagagctt gttccttgnc caactacaac tgaatgagtt caacatcttc ttcttattat gtcagtaagt ytCtcttttt tccagatata aaatctgaaa acaaggaaag catttacaga gaagaagtaa tatgaggcct cagcaaaaag tggaagcaga actggamtct tgttttgttt gataaaatgc attaawtgtg cattgggtaa actctctaaa aargatggaa gatcattatg gcagccatgt ctaargaccg accagtcatg ttcttcccag gacggactct ccttgttttt catttctatg cttcaagttt <210> <211> 776 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .46 <220> <221> CDS <222> 47. .508 <220> <221> 3'UTR <222> 509. .776 <220> <221> <222> polyA_signal 752. .757 <220> <221> allele <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> 21 8-135-112 allele 8-135-16 6 allele 135 99-16038-11 polymorphic base C or T polymorphic base A or C .8 :polymorphic base A or G allele 194 8-137-152 :polymorphic base G or T W0005851 0. [http:/ww.getthepatent.com/Login.dog/SexamsuportFetchDefaut.dogW0005 8 51 0.cpc?fromCactie= 1 part=maintoolbar--boftom PEage 538 of 737 WO 00/58510 PCTJIBOO/00435 <221> allele <222> 224 <223> 8-137-182 polymorphic base A or G <220> <221> allele <222> 390 <223> 8-130-220 polymorphic base A or C <220> <221> allele <222> 406 <223> 8-130-236 polymorphic base A or G <220> <221> allele <222> 578 <223> 8-131-199 polymorphic base A or C <220> <221> allele <222> 675 <223> 8-132-97 polymorphic base C or T <220> <221> allele <222> 742 <223> 8-132-164 polymorphic base C or T <220> <221> allele <222> 757 <223> 8-132-179 polyimorphic base A or T <400> tcatctctgc ttcacaatgc ygatgattta gctgggagga aag Lys ttg Leu aaa Lys aga Arg ggc Gly tgg Trp agc Ser 100 tat Tyr t gc atg Met aaa Lys gaa Glu a cg Thr ttg Leu t ct, Ser gtt Val1 gcc Ala t ac gat Asp ttc Phe 25 ct a Le u agg Arg gca Al a cct Pro gtc Val1 105 gac Asp ca a tint Xaa ata I le aac Asn a aa Lys cag Gln cag Gln ttc Phe cgc Arg aaa ct c Leu ggt Gly t ct Se r gaa Glu agg Arg 75 ccc Pro atg Met agg Arg gac cccaaa atg ctg gaa Met Leu Glu 1 aga tcc aga tat ac Arg Ser Arg Tyr Thi agc att ctt ctg ag Ser Ile Leu Leu Sei gag aca gaa kaa gg~ Glu Thr Glu Xaa Gl' aga agg cat gag ga Arg Arg His Glu Asi aga tca tta tgt ccl Arg Ser Leu Cys Pr ctt gaa gaa gta ag Leu Glu Glu Val Se, tat gag ttc ctt gmc Tyr Glu Phe Leu Xa 11! gaa cga atg tgg ac Glu Arg Met Trp Th~ 130 aac cac aag gaa at~

F,

W0005851 0 rhttP~ww. ettIepa tent. co mI1og in.dog$exa m. su port/Fetch/Defa u~t.d o NVO005851 0.cpc?fromCacie=1 part=maintoolbar--bottom] Page 539 of 177 WO 00/58510 PCT/EBOO/00435 Cys Asn Tyr Asn Gin Gin Lys Asp Gin Ser Cys Asn His Lys Glu Ile 135 140 145 act tct acc aaa gct gaa tga gtttggaagc agattcttcc cagccaatcc Thr Ser Thr Lys Ala Giu 150 ttctgatgac aatgtagtct ggccaacatc ggacccagct gataacacgt gttttcttat gggattgtat ttgcaaytct ctggtcagta ctggcctgtg tgactgggag aatytctctt ttcactggam tattgttttg agtgataaaa t ttat taawt tctgacggac tctgtgtctg tttccttgtt tttaggtgat tgccatttct atgcacccac gtgcttcaag ttttaaca 538 598 658 718 776 <210> 26 <211> 947 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .46 <220> <221> COS <222> 47. .367 <220> <221> 3'tITR <222> 368. .947 <220> <221> <222> <220> <221> <222> <223> poi yAs igna 1 923. .928 aiieie 21 8-135-112 <220> <221> aliele <222> <223> 8-135-166 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> aiieie 135 99-16038-11 aiieie 194 8-137-152 aiieie 224 8- 137-182 allele 388 8-143-232 :polymorphic base C or T :polymorphic base A or C .8 :polymorphic base A or G :polymorphic base G or T :polymorphic base A or G :polymorphic base G or C <220> <221> allele W0005851 0 [httpJIA~.qetthepatent.r-omft~ogn .dg/Sexam.support/FetchDefault.doqNVO00585 1 0.pc?fromCache= 1part=maintoolbar--boftoml Page 540 of 737 WO 00/58510 PCT/IBOO/00435 <222> 395 <223> 8-143-239 <220> <221> allele <222> 398 <223> 8-143-242 <220> <221> allele <222> 401 <223> 8-143-245 <220> <221> allele <222> 458 <223> 8-130-83 <220> <221> allele <222> 476 <223> 8-130-101 <220> <221> allele <222> 477 <223> 8-130-102 :polymorphic base A or G *polymorphic base C or T *polymorphic base A or C polymorphic base G or T *polymorphic base A or C *polymorphic base A or G <220> <221> <222> <223> <220> <221> <222> <223> allele 518 8-130-143 allele 519 8-130-144 <220> <221> allele <222> 595 <223> 8-130-220 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> *polymorphic base C or T *polymorphic base A or G *polymorphic base A or C *polymorphic base A or G *polymorphic base A or C polymorphic base C or T allele 611 8-130-2 36 allele 783 8-131-199 allele 846 8-132- 97 allele 913 8-132-164 :polymorphic base C or T W0005851 0 [httpJtww.getthepatent.com/Locin.dog/Sexam.supportJFetch/Default.doqivOO05851 O.cpc?fromCache= 1part=maintooIbar--bottom]_Eane 541 of 737 WO 00/58510 240 <220> <221> allele <222> 928 <223> 8-132-179 :polymorphic base A or T <400> 26 tcatctctgc ttcacaatgc ygatgattta gctgggagga PCT/IBOO/00435 cccaaa atg ctg gaa Met Leu Glu 1 aga tcc aga tat aca Arg Ser Arg Tyr Thr aag ctg atg ggt gct gat Lys Leu Met Gly Ala Asp tint Xaa at a Ile ctc cag ctt ttc Leu Gln Leu Phe ttg Leo aaa Lys ggt aaa atc tac Gly Lys Ile Tyr t tc Phe 25 ct a Leo ggt ttt caa Gly Phe Gin att ctt ctg Ile Leo Leu agc Ser tct gaa aac Ser Giu Asn aac tct att Asn Ser Ile gag aca gaa Glu Thr Glu kaa gga Xaa Gly aga gag acg Arg Glu Thr ggc tat ttg Gly Tyr Leo tgg gtc tct Trp Val Ser agg aaa gaa Arg Lys Glu aag aga agg Lys Arg Arg atg gca cag Met Ala Gin agg Arg 75 tta cag aga Leo Gln Arg t ca Ser att I le cat gag gac His Giu Asp tta tgt cct Leo Cys Pro ttg tat aaa Leo Tyr Lys tac ctt cct Tyr Leo Pro cag ccc Gin Pro agc tga Ser tat gca gag Tyr Aia Glu ctt tat gtc Leu Tyr Val aga Arg 105 gacctccaac agatggaaat saaaaccrtc ytgintaccag kgtgatgaca yrgatctcct aaactatgag gtggacctgc taccaaagct tagtctggcc acacgtggtg ctatgcaccc agttttaaca accttggatc cttgactcmr tacaggcttg ttccttgmct aactacaacc gaatgagttt aacatcttca atgggattgt acctggcctg tggaaggagc gtgatgaggt aagaagtaag atgaggcctc agcaaaaaga ggaagcagat ctggazntctg at ttgcaayt tgtgactggg tgggacttct tacctttcac cagccatgtt taargaccgc ccagtcatgc tcttcccagc acggactctg ctctggtcag agaatytctc aaccaatgga aagacctggc ggaaaagtct aggcagcctc aaccacaagg caatccttct tgtctgggac taagtgataa tttttattaa aca tgggaa a caactgagac tcatggcaag tagaacgaat aaataacttc gatgacaatg ccagctgata aatgccattt wtgtgcttca <210> 27 <2ii> 16 <212> PRT <213> Homo sapiens <220> <22i> VARIANT <222> <223> Xaa=Ser or Tyr <400> 27 Met Leu Glu Lys Leo Met Giy Ala Asp Xaa Leo Gin Leu Phe Arg Vai 1 5 10 <210> <211> <212> <213> 28 110

PRT

Homo sapiens <220> <221> VARIANT <222> 47 W0005851 0[http Jtww. qetthe patent. co mO i n.dogSexa m. suportfFetchDefa ut. d oNVO00585 1 0. cpc?fro mCa ce= 1 part= m aintoolba r--bottom] Page 52o 3 WO 00/58510 PCTIIBOO/00435 <223> Xaa=Pro or Thr <220> <221> VARIANT <222> <223> Xaa=Giy or Ser <400> 28 Met Glu Val Gly Pro I 1 5 Leu Giu Pro Thr Ala 1 Leu Pro Ser Gly Gin Tyr Val Ser Asn Cys Asn Ile Lys Thr Tyr Leu Ile Ile Pro Giu 1 Ile Leu Lys Ile Gly 100 Ile Leu Giu Cys Ser Val1 Arg 105 Ile Gly Pro Tyr Leu His Val Ala His Giu Leu Al a Asp Leu Leu Ser Lys Giu Lys Ile Ser <210> 29 <211> 102 <212> PRT <213> Homo sai <22 0> <221> VARIANT <222> 9 <223> Xaa-Ser <220> <221> VARIANT <222> 29 <223> Xaa=Lys <220> <221> VARIANT <222> 49 <223> Xaa=Glu <220> <221> VARIANT <222> 59 <223> Xaa=Giy <220> <221> VARIANT <222> 96 <223> Xaa-Lys <220> <221> SITE <222> 62. .63 <223> basic p: <220> <221> PEPTIDE <222> 1. .63 <220> iens or Tyr or Arg or Stop or Arg or Asn rotease cleavage site W0005851 0 [httpJItwwgeth~entcmlognjog/Sexam .s pporIFetchiIDefault.dogWO005 8 Sl 0.cpc?fromCache=l1part=maintoolbar--bottoml Page 543 of 737 WO 00/58510 PCT/TIBOOI00435 <221> PEPTIDE <222> 64. .102 <400> 29 Leu Glu Lys Leu

I

Tyr Thr Leu Gly Leu Ser Lys Ser Xaa Gly Arg Glu Glu Asp Gly Tyr Cys Pro Trp Val Thr Leu Ser Glu 100 Met Lys Glu Thr Leu Ser Thr Asp Phe Leu Arg Al a Pro Leu Gin Al a Trp Leu Al a Arg Leu Glu His Leu Xaa <210> <211> 118 <212> PRT <213> Homo sapJ <220> <221> VARIANT <222> 9 <223> Xaa=Ser <220> <221> VARIANT <222> 29 <223> Xaa=Lys <220> <221> VARIANT <222> 49 <223> Xaa=Glu <220> <221> VARIANT <222> 59 <223> Xaa=Gly <220> <221> VARIANT <222> 106 <223> Xaa=Thr <220> <221> SITE <222> 63. .64 <223> basic pr <220> <221> SITE <222> 110. .111 <223> basic prc <220> <221> DISULFID <222> 82. .104 Lens r Tyr )r Arg )r Stop Arg )r Ala )tease cleavage site )tease cleavage site W0005851 0 [ttD/twww. eteaen aoloin.doa/$exam.suDDortlFetch/Default.dogiWO00585l 0.cpc?fromCache=l1 art=maintooibar--bottom] Page 544 0? 7:37 WO 00/58510 PCT/EBO/00435 <220> <221> PEPTIDE <222> 1. .64 <220> <221> PEPTIDE <222> 65. .111 <220> <221> PEPTIDE <222> 112. .119 <400> Leu Giu Lys Leu 1 Tyr Thr Leu Gly Leu Ser Lys Ser Xaa Gly Arg Glu Giu Asp Gly Tyr Cys Pro Trp Vai Arg His Phe Asn 100 Lys Phe Ser Ser 115 Ala Tyr Se r Thr Met Leu Cys Asp Phe Leu Arg Ala Pro Gly S er Ile Thr Arg Ser Phe Lys <210> 31 <211> 98 <212> PRT <213> Homo sapiens <220> <221> VARIANT <222> <223> Xaa=Ser or Tyr <220> <221> VARIANT <222> <223> Xaa=Lys or Arg <220> <221> VARIANT <222> <223> Xaa=Glu or Stop <220> <221> VARIANT <222> <223> Xaa=Giy or Arg <400> 31 Met Leu Glu Lys Leu Met Gly Ala Asp Xaa Leu Gin Leu Phe Arg Ser 1 5 10 Arg Tyr Thr Leu Gly Lys Ile Tyr Phe Ile Giy Phe Gin Xaa Ser Ile 25 Leu Leu Ser Lys Ser Giu Asn Ser Leu Asn Ser Ile Ala Lys Giu Thr 40 Glu Xaa Gly Arg Giu Thr Val Thr Arg Lys Glu Xaa Trp Lys Arg Arg W0005851 0 [http:/tww.etthepatent.com/Login.dog/Sexam.supportFetch/D efaut.dgWWOO5851 U.CPC?trOrncaCfe= 1 Part=maintoobar--bqtom Page 545 of 737 WO 00/58510 PCTIIBOO/00435 244 55 His Glu Asp Gly Tyr Leu Glu Met Ala Gin Arg His Leu Gin Arg Ser 70 75 Leu Cys Pro Trp Val Ser Tyr Leu Pro Gin Pro Tyr Ala Glu Ser Trp 90 Asp Phe <210> 32 <211> 126 <212> PRT <213> Homo sapiens <220> <221> VARIANT <222> <223> Xaa=Ser or Tyr <220> <221> VARIANT <222> <223> Xaa-Lys or Arg <220> <221> VARIANT <222> <223> Xaa=Giu or Stop <220> <221> VARIANT <222> <223> Xaa=Giy or Arg <220> <221> VARIANT <222> 98 <223> Xaa=Val or Leu <220> <221> VARIANT <222> 103 <223> Xaa=Asn or Ser <220> <221> SITE <222> 63. .64 <223> basic protease cleavage site <220> <221> DISrJLFID <222> 82. .106 <220> <221> PEPTIDE <222> 64 <220> <221> PEPTIDE <222> 65. .126 <400> 32 Met Leu Glu Lys Leu Met Gly Ala Asp Xaa Leu Gin Leu Phe Arg Ser 1 5 10 Arg Tyr Thr Leu Gly Lys Ile Tyr Phe Ile Gly Phe Gin Xaa Ser Ile W0005851 0 [http:/ww.gettheatent.comLogin.do/exam.suporfFetctDefaut.doqNVO005851 0.rpc?fromCache~ 1part=maintoolbar--boftom]_Page 546 of 737 WO 00/58510 PCT/iBOO/00435 245 25 Leu Leu Ser Lys Ser Giu Asn Ser Leu Asn Ser Ile Ala Lys Glu Thr 40 Giu Xaa Giy Arg Giu Thr Val Thr Arg Lys Glu Xaa Trp Lys Arg Arg 55 His Glu Asp Gly Tyr Leu Giu Met Ala Gin Arg His Leu Gin Arg Ser 70 75 Leu Cys Pro Trp Val Ser Tyr Leu Pro Gin Pro Tyr Ala Giu His Ser 90 Lys Xaa Ile Leu Asn Giy Xaa Leu His Cys His Phe Lys Arg Ile Ser 100 105 110 Gin Ile Phe Ala Giy His Phe Met Giu Gly Asp Thr Glu Ala 115 120 125 <210> 33 <211> 62 <212> PRT <213> Homo sapiens <220> <221> VARIANT <222> <223> Xaa=Ser or Tyr <220> <221> VARIANT <222> <223> Xaa=Lys or Arg <220> <221> VARIANT <222> 57 <223> Xaa=Lys or Asn <220> <221> SITE <222> 54. <223> basic protease cieavage site <220> <221> SITE <222> 57. .58 <223> basic protease cieavage site <220> <221> PEPTIDE <222> 1. .53 <220> <221> PEPTIDE <222> 58. .61 <400> 33 Met Leu Giu Lys Leu Met Gly Ala Asp Xaa Leu Gin Leu Phe Arg Ser 1 5 10 Arg Tyr Thr Leu Giy Lys Ile Tyr Phe Ile Giy Phe Gin Xaa Ser Ile 25 Leu Leu Ser Lys Ser Giu Asn Ser Leu Asn Ser Ile Giy Ile His Gin 40 Ile His Lys Asn Gin Arg Arg Gin Xaa Lys Giu Glu Arg Arg 55 <210> 34 W00 58 51 0 [htptolww.g etthepa tent. co m/Log in.dogl$exa msup ort/Fetch/Defa ut.do PNVO005851 U..c?from~ace= 1 part=maintobar--boftom) Page 547 of 737 WO 00/58510 PCTIBOOIOO435 <211> 153 <212> PRT <213> Homo sapi.

<220> <221> VARIANT <222> <223> Xaa=Ser o.

<220> <221> VARIANT <222> <223> Xaa=Lys o.

<220> <221> VARIANT <222> <223> Xaa=Glu o; <22 0> <221> VARIANT <222> <223> Xaa=Gly o: <220> <221> VARIANT <222> 115 <223> Xaa=Ala o: <220> <221> SITE <222> 63. .64 <223> basic prol <220> <221> SITE <222> 122. .123 <223> basic prol <220> <221> DISULFID <222> 132. .142 <220> <221> PEPTIDE <222> 64 <220> <221> PEPTIDE <222> 65. .123 <220> <221> PEPTIDE <222> 124. .153 <400> 34 Met Leu Glu Lys 1 Arg Tyr Thr Leu Leu Leu Ser Lys Glu Xaa Gly Arg ens Tyr Arg Stop Arg Asp tease tease cleavage site cleavage site Leu Met Gly Ala Asp Xaa Leu Gin Leu Phe Arg Ser 5 10 Gly Lys Ile Tyr Phe Ile Gly Phe Gin Xaa Ser Ile 25 Ser Glu Asn Ser Leu Asn Ser Ile Ala Lys Glu Thr 40 Glu Thr Val Thr Arg Lys Glu Xaa Trp Lys Arg Arg W0005851 0 [fhttp:/Iwww.g etthe pate nt.com/Login.dog/Sexam.support/Fetch/IDefaultdogNVO005851 0.cpc?fromCache= 1 partmaintaoolba r--bottom] Page 548 of 737 WO 00/58510 PCT/IBOO/00435 55 His Giu Asp Gly Tyr Leu Glu Met Ala Gin Arg His Leu Gin Arg Ser 70 75 Leu Cys Pro Trp Val Ser Tyr Leu Pro Gin Pro Tyr Ala Glu Leu Glu 90 Gbu Val Ser Ser His Val Gly Lys Val Phe Met Ala Arg Asn Tyr Glu 100 105 110 Phe Leu Xaa Tyr Glu Ala Ser Lys Asp Arg Arg Gin Pro Leu Giu Arg 115 120 125 Met Trp Thr Cys Asn Tyr Asn Gin Gin Lys Asp Gin Ser Cys Asn His 130 135 140 Lys Gu Ile Thr Ser Thr Lys Ala Glu 145 150 <210> <211> 106 <212> PRT <213> Homo sapiens <220> <221> VARIANT <222> <223> Xaa=Ser or Tyr <220> <221> VARIANT <222> <223> Xaa=Lys or Arg <220> <221> VARIANT <222> <223> Xaa=Glu or Stop <220> <221> VARIANT <222> <223> Xaa=Giy or Arg <220> <221> SITE <222> 62. .63 <223> basic protease cleavage site <220> <221> SITE <222> 63. .64 <223> basic protease cleavage site <220> <221> PEPTIDE <222> 1. .61 <220> <221> PEPTIDE <222> 65. .106 <400> Met Leo Gbu Lys Leo Met Gly Ala Asp Xaa Leo Gin Leo Phe Arg Ser 1 5 10 Arg Tyr Thr Leu Gly Lys Ile Tyr Phe Ile Gly Phe Gin Xaa Ser Ile 25 Leu Leo Ser Lys Ser Gbu Asn Ser Leo Asn Ser Ile Ala Lys Glu Thr W0005851 0 fhttp:/twww.g etthe patent.com/Log in.d og/Sexa msuportfFetchfiefa uIt. d oMO005851. 0 cpc?fromCache= 1 part=mqintoo~bar--bottomjPaqe 549 of 737 WO 00/585 10 PCT/iBOOIOO435 Glu Xaa Gly Arg Giu Thr Val 55 His Giu Asp Gly Tyr Leu Glu 70 Leu Cys Pro Trp Val Ser Tyr 40 Thr Arg Lys Met Ala Gin Giu Xaa Trp Lys Arg Arg 'Arg His Leu Gin Arg Ser 75 Pro Tyr Ala Glu Leu Ile Leu Pro Gly Gin 90 Ser Leu Tyr Lys Ala 100 Leu Tyr Val Arg 105 <210> <211> <212> 36 1301

DNA

<213> Homo sapiens <220> <221> 51UTR <222> 1. .899 <220> <221> <222> <220> <221> <222> <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> CDs 900. .1265 3'UtTR 1266. .1301 polyA,_signal 1277. .1282 allele 191 8-121-187 allele 313 8-122-271 allele 314 8-122-272 allele 368 8- 122-32 6 allele 390 8-123-55 allele 806 8-127-28 :polymorphic base A or C :deletion of CAAA :polymorphic base A or G :polymorphic base A or C :polymorphic base A or T :polymorphic base A or G <220> <221> allele W0005851 0 [hftpJ www.getheaen om gi.dog/$exam.support/Fetch/Default.docg/WO00561 .CPc?tromCache=l1 art~maintoolbar--botom1 Page 550 of 737 WO 00/58510 PCT/IB00100435 <222> 897 <223> 8-127-119 :polymorphic base A or G <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 937 8-127-159 allele 961 8 -128-61 allele 968 8-128-68 allele 969 8-128- 69 allele 985 8-128 -8 5 allele 1044 8-129-50 allele 1055 8-129-60 polymorphic base A or C polymorphic base G or C polymorphic base C or T polymorphic base A or G polymorphic base A or C polymorphic base C or T deletion of A <400> 36 gtcattatta agtgtatctg ataattattt gggttaactg acaaacaggc cacattcaca aagcagamtg actgaggcac ctgagccagg gtaatcccag ccagcctgac tggtggcagg cct gggaggc agagtgagac ataaatgata caatgaaggg catagactaa aagaaccata magtgaatca cttgggccgc aacraagaca gaagcagatt atcctgtacc aaccctgctt cact ttggga caatatggtg tgcctgtagt ggaggttgca tccatctcaa gaaaacaaaa aagaaaggaa aggagacaag agaattcttt aactattgga tgcctctgtc aacctgtgta tcacctgcaw aaggagagac ttaagaggaa ggccgaggcg aaaccccatc cccagctact gtgagccaag attaaraaaa taagcatgtt gacatgaagg aggaagtact cctagcttct ttataattcc tctcctgcct aactgaagca ttcctacatt ctttgttact ggtcttggcc ggcagatcac tctactaaaa cgggaggctg atcacaccac aaaataagat catgagccag ggaaatggga gagcaccttg cataagcctg atgaagtaag tccccactga ccacaaaact caactgaatc gcctttgatc aggctcagtg ctgaggtcag atacaaaaat agacaggaga tgcactccag acagaatata aaatcaagaa ctatttacca attcctgcag ctccttcaaa tttattgaag atctccagcc acttttatga ctttaaattg ctgagacctt gctcacacct gagttcaaga tagccaggca attgcttgaa cctgggcaac aagagacagc gaaaagrca 120 180 240 300 360 420 480 540 600 660 720 780 840 899 947 995 1043 atg ata aaa agg gct gaa gcc gga ggc atc cca Met Ile Lys Arg Ala Glu Ala Gly Gly Ile Pro 1 5 10 agc agc tct gga gsc tgc tgy rtt cct tgg ctc Ser Ser Ser Gly Xaa Cys Cys Xaa Pro Trp Leu 25 tct tca aag tgc atc act gca gcc tgc gct tca Ser Ser Lys Cys Ile Thr Ala Ala Cys Ala Ser 40 ggc cmt ggg tct gga Gly Xaa Gly Ser Gly ttg gmt gcc tct cca Leu Xaa Ala Ser Pro tcc atc acg ttg gct Ser Ile Thr Leu Ala W0005851 0 [http: vwwgethgtetcmloi dgSxa upot tcleautdgNO0058510.cpc?fromCarhe=l1part=maintoolbar--boftomI Page 551 of 737 WO 00/58510 PCTIBOO/00435 ytg tcg Leu Ser ctc aca ttt cta ctt ctc tct tgc aag Leu Thr Phe Leu Leu Leu Ser Cys Lys gac Asp cat His cct tgg gat tct Pro Trp Asp Ser gga ctc acc tgg Giy Leu Thr Trp ata Ile atc caa gat aat Ile Gin Asp Asn ctt Leu tta Leu ctt aaa atc Leu Lys Ile aat tta gtc aca Asn Leu Vai Thr ttc cat atC ctg Phe His Ile Leu 100 aca aag gga aca Thr Lys Giy Thr 115 gtggattcag gaaaa <210> 37 <211> 1154 <212> DNA <213> Homo sapie cac His aga aaa tca cct Arg Lys Ser Pro tgt aaa gta Cys Lys Val 1091 1139 1187 1235 1285 1301 gag gaa ggg ggc Giu Glu Gly Gly att gat Ile Asp 105 caa taa Gin gtg tct acc aca gca tcc Vai Ser Thr Thr Ala Ser 110 atgcatatag aaataaattt aaa aat att Lys Asn Ile ~ns <220> <221> 51UTR <222> 1. .719 <220> <221> <222> <220> <221> <222> <220> <221> <222> <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223>

CDS

720. .1118 3' UTR 1119. .1154 poiyA,_signal 1131. .1136 allele 191 8-121-187 allele 313 8-122-27 1 allele 314 8-122-27 2 allele 368 8-122-32 6 allele 390 8- 12 3-55 :polymorphic base A or C *deletion of CAAA *polymorphic base A or G polymorphic base A or C :polymorphic base A or T W0005851 0 [qp-./lwww.getthepatent.com~ogin.dog/Sexam.suportFetchDefaut.dogNVO05 8 S 1 0.Cpc?fromCache= 1par=maintoolbar--botonl Page 552 0f737 WO 00/58510 PCT/IBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> a liele 814 8-128 -6 1 allele 821 8-128-68 allele 822 8- 128-69 allele 838 8-12 8-8 5 allele 897 8-129-50 allele 908 8-129-60 :polymorphic base G or C polymorphic base C or T polymorphic base A or G polymorphic base A or C polymorphic base C or T deletion of A <400> 37 gtcattatta agtgtatctg ataattattt gggttaactg acaaacaggc cacattcaca aagcagamt g actgaggcac ctgagccagg gtaatcccag ccagcctgac tggt ggcagg caatgaagg catagacta aagaaccat magtgaatc ct tgggccc aacraagac gaagcagat atcctgtac aaccctgct cactttggc caatatggt tgcctgtag rg aagaaaggaa gac "a aggagacaag ag.

a agaattcttt cct "a aactattgga tt jc tgcctctgtc tct "a aacctgtgta aac :t tcacctgcaw ttc :c aaggagagac ctt t ttaagaggaa ggt ia ggccgaggcg gg ~g aaaccccatc tct ~t cccagctact cgc gtt gca gtg agc Val Ala Val Ser atgaagg ;aagtact agcttct itaattcc cctgcct ,tgaagca ctacatt .tgttact .cttggcc agatcac actaaaa ;gaggctg caa gat Gin Asp tct caa Ser Gin ggaaatggga gagcaccttg cataagcctg atgaagtaag tccccactga ccacaaaact caactgaat c gcctttgatc aggctcagtg ctgaggtcag atacaaaaat agacaggaga ctatttacca attcctgcag ctccttcaaa tttattgaag atctccagcc acttttatga ctttaaattg ctgagacctt gctcacacct gagttcaaga t agccaggca attgcttga tgg gag gcg Trp Glu Ala cct ggg caa Pro Gly Gin tgy rtt cct Cvs Xaa Pro cac acc act gca ctc His Thr Thr Ala Leu agt gag act Ser Glu Thr c ca Pro 25 gcc Ala att aac Ile Asn t gc Cvs tgg ctc ttg Trp Leu Leu gmt Xaa at c Ile tct cca tct Ser Pro Ser tct gga gsc Ser Gly Xaa aag tgc atc Lys Cys Ile ctc aca ttt Leu Thr Phe 120 180 240 300 360 420 480 540 600 660 719 767 815 863 911 959 1007 1055 act gca Thr Ala cta ctt Leu Leu gcc Ala tgc gct tca Cys Ala Ser t cc Ser gac Asp acg ttg gct Thr Leu Ala ctc tct tgc Leu Ser Cys cct tgg gat Pro Trp Asp t ct Ser gga ctc acc Gly Leu Thr t gg Trp atc caa gat Ile Gin Asp aat ctt Asn Leu ctg tta Leu Leu cat ctt aaa His Leu Lys ctt aat tta gtc Leu Asn Leu Val aca cac Thr His ctg gag Leu Glu aga aaa tca cct Arg Lys Ser Pro tgt aaa gta aca tat ttc cat atc Cys Lys Val Thr Tyr Phe His Ile W0005851 0 [httpi/Avww.gettheatent.cOMf~oqin.doo/Sexam.suportFetc/Defaut.dogNVO00585l 0.qpc?fromCacie= 1 part= maintoolbar--bottomj Page 553 of737 WO 00/58510 PCTIBOOIOO435 100 gaa ggg ggc att gat Glu Gly Gly Ile Asp 115 aat att gtc caa taa Asn Ile Val Gin 130 gtg tct acc aca gca tcc aca aag gga aca aaa Val Ser Thr Thr Ala Ser Thr Lys Gly Thr Lys 120 125 atgcatatag aaataaattt gtggattcag gaaaaa 1103 1154 <210> <211> <212> <213> 38 838

DNA

Homo sapiens <220> <221> <222> 1. .484 <220> <221> CDS <222> 485. .802 <220> <221> 3'LJTR <222> 803. .838 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> polyA signal 814. .819 allele 191 8-121-187 allele 313 8-122-271 allele 314 8-122-272 allele 368 8- 12 2-32 6 allele 390 8- 12 3-55 allele 498 8-128-6 1 allele 505 8-128-68 polymorphic base A or C deletion of CAAA polymorphic base A or G polymorphic base A or C :polymorphic base A or T :polymorphic base G or C :polymorphic base C or T W0005851 0 hftp:/Mww. _etthepatent. comLo in.d og/exa m. supo rtFetchDefa ut. d ocMiAN0005 0 CPC?fromC ache= 1 part= ma intoolba r--bofto mlPag e 554 01 7 37 WO 00/58510 PCT/IBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 506 8-128-69 allele 522 8-128-8 5 allele 581 8-129-50 allele 592 8-129-60 :polymorphic base A or G polymorphic base A or C polymorphic base C or T deletion of A <400> 38 gtcattatta caatgaaggg aagaaaggaa agtgtatctg catagactaa aggagacaag ataattattt aagaaccata agaattcttt gggttaactg magtgaatca aactattgga acaaacaggc cttgggccgc tgcctctgtc cacattcaca aacraagaca aacctgtgta aagcagamtg gaagcagatt tcacctgcaw actgaggcac atcctgtacc aaggagagac ctga gcc agc tct gga gsc tgc tgy Ala Ser Ser Gly Xaa Cys Cys gacatgaagg ggaaatggga ctatttacca aggaagtact gagcaccttg attcctgcag cctagcttct cataagcctg ctccttcaaa ttataattcc atgaagtaag tttattgaag tctcctgcct tccccactga atctccagcc aactgaagca ccacaaaact acttttatga ttcctacatt caactgaatc ctttaaattg ctttgttact gcctttgatc ctgagacctt rtt cct tgg ctc ttg gmt gcc tct Xaa Pro Trp Leu Leu Xaa Ala Ser cca tct tca aag Pro Ser Ser Lys tgc Cys aca Thr atc act gca gcc Ile Thr Ala Ala tgC Cys 25 gct tca tcc atc Ala Ser Ser Ile acg ttg Thr Leu 120 180 240 300 360 420 480 529 577 625 673 721 769 822 gct ytg tcg Ala Leu Ser tct att gga Ser Ile Gly ctt aat tta Teu Asn Leu ct c Leu ctc Leu ttt cta ctt Phe Leu Leu ctc Leu 40 caa, Gln acc tgg ata Thr Trp Ile atc I le 55 tct tgc aag gac cct tgg gat Ser Cys Lys Asp Pro Trp Asp gat aat ctt cat ctt aaa. atc Asp Asn Leu His Leu Lys Ile cct ctg tta tgt aaa gta. aca Pro Leu Leu Cys Lys Val Thr gtc aca cac Val Thr His aaa tca Lys Ser tat ttc Tvr Phe cat atc ctg His Ile Leu gaa ggg ggc att Glu Gly Gly Ile gat gtg tct acc aca gca Asp Val Ser Thr Thr Ala taa atgcatatag aaataaattt aca aag gga Thr Lys Gly aat att gtc Asn Ile Val caa Gln* 105 gtggattcag gaaaaa <210> 39 <211> 985 <212> DNA <213> Homo sapiens <220> <221> <222> 1. .583 <220> W0005851 0 [httplMvww.getthepatent.comf~ogin.dog/Sexam.supportFetchDefaut.dogNVO005851 0.cpc?fromCache=l part= maintoolbar-- botom] Page 555 of 737 WO 00/58510 PCTJIBOO/00435 <221> CDS <222> 584. .949 <220> <221> 3'tJTR <222> 950. .985 <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> polyA,_signal 961.-.966 allele 191 8-12 1-18 7 allele 313 8-122 -2 71 allele 314 8-122 -2 72 allele 368 8-122- 32 6 allele 390 8-123- 55 allele 490 8-127 -2 8 allele 581 B-127 -119 allele 621 8 -12 7-159 allele 645 8-128- 61 allele 652 8-128-68 :polymorphic base A or C :deletion of CAAA :polymorphic base A or G :polymorphic base A or C polymorphic base A or T polymorphic base A or G polymorphic base A or G :polymorphic base A or C :polymorphic base G or C :polymorphic base C or T <220> <221> allele W0005851 0 rhttpJ/www.getthepatent.com/Login.dog/Sexam.support/FetchIDefault.dogAWO005851 O.cpc?fromCache=lp art=ma inMod ba r--bottom] Page 556 of 737 WO 00/58510 PCTJIBOO/00435 <222> 653 <223> 8-128-69 :polymorphic base A or G <2 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 669 8-128-85 allele 728 8- 12 9-50 allele 739 8-129-60 polymorphic base A or C polymorphic base C or T deletion of A <400> 39 gtcattatta agtgtatctg ataattattt gggttaactg acaaacaggc cacattcaca aagcagamtg actgaggcac ctgagccagr aaaataagca caatgaaggg catagactaa aagaaccata magtgaatca cttgggccgc aacraagaca gaagcagatt atcctgtacc aaaaaaaata tgttcatgag aagaaaggaa aggagacaag agaattcttt aactattgga tgcctctgtc aacctgtgta tcacctgcaw aaggagagac agatacagaa ccagaaatca gacatgaagg aggaagtact cctagcttct ttataattcc tctcctgcct aactgaagca ttcctacatt ctttgttact tataaagaga agaagaaaag ggaaatggga gagcaccttg cataagcctg atgaagtaag tccccactga ccacaaaact caactgaatc gcctttgatc cagcataaat ctatttacca attcctgcag ctccttcaaa tttattgaag atctccagcc acttttatga ctttaaattg ctgagacctt gatagaaaac rca atg ata aaa agg Met Ile Lys Arg gct Ala gaa gcc gga ggc Glu Ala Gly Gly atc Ilbe cca ggc cmt ggg tct gga agc agc tct Pro Gly Xaa Gly Ser Gly Ser Ser Ser gsc tgc tgy rtt Xaa Cys Cys Xaa tgg ctc ttg gmt gcc Trp Leo Leu Xaa Ala cca tct tca Pro Ser Ser aag tgc Lys Cys 120 180 240 300 360 420 480 540 595 643 691 739 787 835 883 931 985 atc act gca Ile Thr Ala ttt cta ctt Phe Leu Leo tgg ata atc Trp Ile Ile gcc Ala ctc Leu gct tca tcc Ala Ser Ser atc Ilbe 45 cct Pro acg ttg gct ytg Thr Leu Ala Leo tct tgc aag Ser Cys Lys gac Asp cat His tgg gat tct Trp Asp Ser tcg ctc aca Ser Leo Thr gga ctc acc Gly Leu Thr tta gtc aca Leo Val Thr caa gat aat Gbn Asp Asn ctt Leo 75 ctt aaa atc Leo Lys Ile ct t Leo tat Tyr ca c His aga aaa tca cct Arg Lys Ser Pro ctg Leo 90 gat Asp tta tgt aaa gta Leo Cys Lys Val ttc cat atc Phe His Ile ct g Leo* 100 aca Thr gag gaa ggg ggc att Gbu Gbu Gly Gly Ile gtg tct acc Val Ser Thr aca Thr 110 tcc aca aag Ser Thr Lys gga Gb y 115 aaa aat att Lys Asn Ile 105 caa taa Gln atgcatatag aaataaattt gtggattcag gaaaaa <210> <211> <212> 1386

DNA

<213> Homo sapiens <220> <221> W0005851 0 http:/Mvww. etthepa tent. co mI~ogin.dog/$exa m.sup ortFetchDefa uItd oqNVO005 8 5 1 0.cpc?fro mC ache= 1 part=maintoolbar--botom] Page 557 of 737 WO 00/58510 <222> 984 PCT/iBOO/00435 <220> <221> <222> <220> <221> <222> <220> <221> <222> <220> <221> <222> <223> <220> <221> <222> <223> <z220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223>

CDS

985. .1350 3 'UTR 1351. .1386 polyA_signal 1362. .1367 allele 191 8-121-187 allele 398 8-122-27 1 allele 399 8-122 -2 72 allele 453 8 -12 2-32 6 allele 475 8-123-55 allele 891 8-127-2 8 allele 982 8-127-119 allele 1022 8-127-15 9 allele 1046 8-128-61 allele 1053 8-128-68 polymorphic base A or C deletion of CAAA polymorphic base A or G polymorphic base A or C :polymorphic base A or T :polymorphic base A or G :polymorphic base A or G *polymorphic base A or C polymorphic base G or C :polymorphic base C or T W000 5851 0 [tqpjAiww.gefthe patent.co m/Lo i n.d ocg/exa m. su port[Fetch/Def ult.dogNV0005851 0.ppc?fromCache 1 Dart=maintoolbar--botom]_Page 558 of 737 WO 00/58510 PCT/EBO0100435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1054 8-128-69 allele 1070 8-128-85 allele 1129 B-129-50 allele 1140 B-129-60 :polymorphic base A or G :polymorphic base A or C :polymorphic base C or T :deletion of A <400> gtcattatta agtgtatctg ataattattt gggttaactg gtagtctggg tcagggtttt tgccttCCCC aagcaccaca acattcaact ttactgcctt tggccaggct atcacctgag taaaaataca ggctgagaca accactgcac aagatacaga gccagaaatc caatgaaggg catagactaa aagaaccata magtgaatca caccagagca gtaagtttat actgaatctc aaactacttt gaatccttta tgatcctgag cagtggctca gtcaggagtt aaaattagcc ggagaattgc tccagcctgg atataaagag aagaagaaaa aagaaaggaa aggagacaag agaattcttt a acta tt gga ccctgagccc tgaagacaaa cagcccacat tatgaaagca aattgactga accttctgag cacctgtaat caagaccagc aggcatggtg ttgaacctgg gcaacagagt acagcataaa gacatgaagg aggaagtact cctagcttct ttataattcc agtggactgc caggccttgg tcacaaacra gamtggaagc ggcacatcct ccaggaaccc cccagcactt ctgaccaata gcaggtgcct gaggcggagg gagactccat tgatagaaaa ggaaatggga gagcaccttg cataagcctg atgaagatct accagt ggac gccgctgcct agacaaacct agatttcacc gtaccaagga tgcttttaag tgggaggccg tggtgaaacc gtagtcccag ttgcagtgag ctcaaattaa caaaataagc ctatttacca attcctgcag ctccttcaaa gccctttcat tcttccatcc ctgtctctcc gtgtaaactg tgcawttcct gagacctttg aggaaggtct aggcgggcag ccatctctac ctactcggga ccaagatcac raaaaaaaat atgtt catga gga ggc Gly Gly grca atg ata aaa agg gct gaa gcc Met Ile Lys Arg Ala Glu Ala atc I le t gg T rp cca ggc cmt ggg Pro Gly Xaa Gly 1 gga agc agc tct Gly Ser Ser Ser 1gsc rXaa tgc tgy rtt Cys Cys Xaa cct Pro 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1011 1059 1107 1155 1203 1251 1299 1347 1386 ctc ttg gmt Leu Leu Xaa cca tct tca Pro Ser Ser atc act gca Ile Thr Ala gcC tgc Ala Cys gct tca tcc Ala Ser Ser tgc aag gac Cys Lys Asp aat ctt cat Asn Leu His ttg gct ytg Leu Ala Leu aca ttt cta Thr Phe Lau tgg gat tct Trp Asp Ser at t I le aat Asn ctc acc tgg Leu Thr Trp ctt ctc tct Leu Leu Ser atc caa gat Ile Gln Asp aaa tca cct Lys Ser Pro ctt aaa atc Leu Lys Ile ctg tta Leu Leu ct t Leu tat Tyr tta gtc aca Leu Val Thr tgt aaa gta Cys Lys Val ttc cat atc Phe His Ile gaa ggg ggc Glu Gly Gly ga t Asp gtg tct acc Val Ser Thr tcc aca aag Ser Thr Lys aaa aat att Lys Asn Ile taa atgcatatag aaataaattt gtggattcag gaaaaa W0005851 0 [httpJ/Aww. etthepatent.CamILo-gin.dog/$exam.supoort/Fetch/Default.dogAJO00058510.cpc?fromCache=1 part=maintoo~bar-bottomI Page 559 of 737 WO 00/58510 PCT/EBOO/00435 <210> 41 <211> 121 <212> PRT <213> Homo sai <220> <221> SITE <222> 86. .87 <223> basic p~ <220> <221> PEPTIDE <222> 1. <220> <221> PEPTIDE <222> 88. .121 <400> 41 Met Ile Lys A; 1 Ser Ser Ser G.

2' Ser Ser Lys C Leu Ser Leu T~ Ile Gly Leu T] Asn Leu Val. T] Phe His Ile L 1 Thr Lys Gly T 115 piens rotease cleavage site rg ly 0 ys hr hr hr eu 00 hr Giu Cys Thr Leu Ile 70 Arg Glu Asn Gi y Val1 Ala 40 Leu Gin Ser Gly Val 120 Gly Pro Cys Ser Asp Pro Ile 105 Gin Pro Leu Ser Lys Leu 75 Leu Val Gly Leu Ser Asp His Cys Se r Pro Ala Ile Pro Leu Lys Thr Gly Pro Ala Se r Leu Tyr Ser <210> 42 <211> 132 <212> PRT <213> Homo sapiens <220> <221> SITE <222> 97. .98 <223> basic protease cleavage site <220> <221> PEPTIDE <222> 96 <220> <221> PEPTIDE <222> 99. .132 <220> <400> 42 Thr Trp Giu Ala Giu Val Ala Val Ser Gin Asp His Thr Thr Ala Leu 1 5 10 Gin Pro Gly Gin Gin Ser Giu Thr Pro Ser Gin Ile Asn Ser Gly Gly 25 W0005851 0 http: ww.gethptetcoI gno/$examsuportFetch/Defaut.dogWO00058510.cpc?fromCar-he=l1 art~maintoolbar--botom Page 560 of 737 WO 00/58510 PCT/IBOO/00435 Cys Cys Val Pi Thr Ala Ala C3 Leu Leu Leu S( Ile Ile Gin A.- Arg Lys Ser P3 Glu Gly Gly I: 115 Asn Ile Vai G: 130 <210> 43 <211> 105 <212> PRT <213> Homo sai <22 0> <221> SITE <222> 70. .71 <223> basic p~ <220> <221> PEPTIDE <222> 69 <220> <221> PEPTIDE <222> 72. .105 <400> 43 Ala Ser Ser G.

1 Ser Ser Lys C: 2' Leu Ser Leu TI Ile Gly Leu TI Asn Leu Val TI Phe His Ile L Thr Lys Gly TI 1' Leu.

Se r Asp His Cys Ser Ala Ile Pro Leu Lys Thr 120 259 Ser P Leu A Asp S 7 Ile L Thr T Ala S Ile Phe T rp His Glu Lys Aiens rotease cleavage site ys 0 hrr hir eu 00 Gly Ile Phe Trp His Glu Lys Cys Thr Leu Ile Arg Glu Asn Val Ala Leu 40 Gin Ser Gly Val1 Pro Cys Ser Asp Pro Ile Gin 105 Leu Se r Asp His Cys Ser Al a Ile Pro Leu Lys Thr <210> 44 <211> <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide g34872MbisEco <400> 44 cccgaattcc caaacttctt tcatttaaag aacca <210> <211> 36 <212> DNA W0005851 0 [http:/twww.getthepatentcomLogin.dogSexam.suporfFetchDefault.dogAA1000585l 0.cpc?fromCache=1 part--maintoolbar--bottoml Page 561 of 737 WO 00/58510 260 <213> Artificial Sequence <220> <223> oligonucleotide g34872LR13O9nBAmHl <400> atgcgggatc cagagattct cccagtcaca caggcc <210> 46 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide g34872genoLE'22nEcoRI <400> 46 tactggaatt ccaggtagag tgaagcaagt aatgtgtgtg tgag <210> 47 <211> <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide g34872LR13O9nBAmH1 <400> 47 atgcgggatc cagagattct cccagtcaca caggc <210> 48 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide g34872MterEco <400> 48 cgagaattcg atgatttagc tgggaggacc caa <210> 49 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide g34872LR1305nBam <400> 49 tcgggatcca gtcacacagg ccaggt <210> <211> <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide g34872LF1140ECOR1 <400> gctgggaatt cgctggaaaa gctgatgggt gctgattctc PCTIBOOIOO435 36 44 33 26 W0005851 0.[htt:llww.getthepatent.com1Login.doglsexam.supportFetchIDefaultdo AN0005851 0cpc?fromCache= 1 part=maintoolbar--bottom1 Page 562 of 737 WO 00/58510 PCTIBOO/00435 <210> 51 <211> <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide g34872LR13O9nBAnH1 <400> 51 atgcgggatc cagagattct cccagtcaca caggc <210> 52 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide g34872LE'lO64Eco <400> 52 tcagaattct catctctgct tcacaatgcc g <210> 53 <211> <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide <400> 53 acgggatcct ttcagtactg <210> 54 <211> 1158 <212> DNA <213> Pan troglodytes g34 872 exRBAM139 aagttgagag ggaga <400> 54 gtccacctgc acagagtcat caccaactga aatgtgaatg gccaactgcc cagacttgaa taaact tgaa tgtaggttta aaaaattggc gatgtatcac acattctttc gaatgtctat cttctttaaa ctacaacaat tgctgaatgg gatacacgca tttgctgcaa atgatgattc cacaat gccg ttctctccag <210> <211> 92 <212> DNA tgatagtgcg gcatgagctc aagagtctat gaagttgggc aaggaatgcc cct gcagaga gttgtgaaaa atcatacctg attggtaggt tccagtctag atgtctatat atgcaaagta taaaaatgac attcatcttg aaagccagaa taacagtgag aagagctaca tgttggtcca atgatttagc cttttcag ctccttaggt cactgtggga ct tagtcctg ctgctcagag taggaacaca aatcccctag atataaagac aattttcctt gtgtcaagtt aatgtctata tccttcaaca tccacaaaag tcacaataat agttaatttc agcagagtga caagtttctc ccccaaatta ggatttggaa tgggaggacc gcctgtctct agtctctaga aagat ct caa aatcatcagg ctcagtaaga gtatgtcagc ttacattatc agttcacaca atcattttga tgcagagt at ttctttgtct acccaaactt ttaatatttt ccatgaataa agcaagtaat agctcctgca gtggcttaaa agggcatggc caaaatgctg qgctgtcctg gatgagctga gtcatcctca gctctttatt gtgttgccct aattgctcat cagtctctcc gatatacaga aaacatagaa ccacaaaaaa tcaacat tct ttttcattta accatttaca ctttttcatt gtgtgtgtga tggcagtgtt gtaaaagctc aggatgtctc gaaaagctga tgccacctgc gcttacccta tattcccatg gtggcctgga caggccagat ttggatgcta tggcaaaata tatatatcct acctgaacaa ccaaacttca ttcatgtcta aagaaccaaa aagagattaa tcttaaaatt gtagtcattg ctgattatct actagtgtat atctctgctt tgggtgctga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1158 W0005851 0 [h ttr,:llww.qetthe patent. com/Log in.doq/$exa m. su portFetchDefa It. dofNVO005851 0 gc?fromCache= 1 part= ma intool ba r--boftoml Pa qe 563 of 7 37 WO 00/58510 PCTJIBOOIOO435 <213> Pan troglodytes <220> <221> misc feature <222> 71. .72 <223> n=a, g, c or t <400> atccagatat acattgggta caaatctgaa nnaactctct <210> 56 <211> 152 <212> DNA <213> Pan troglodytes <400> 56 caaaggagac agagagaaga aggcatgagg acggctattt agggtctctt accttcctca <210> 57 <211> 94 <212> DNA <213> Pan troglodytes <400> 57 acattccaag gtgattctaa atttgctggg cactttatgg <210> 58 <211> 141 <212> DNA <213> Pan troglodytes <400> 58 gaacacagaa gcttttgtag tttatgagat cctctaagca ttgatacatt tgagcagcaa aaatctactt cataggtttt caaaggagca ttcttctgag aaaactccat tg aggaagagag acggtaacaa ggaaagaagg atggaagaga ggaaatggca cagaggcatt gacagagatc attgtgtcct gccctgcaca ga atggcaattt gcactgtcat tttaaaagaa tttctcagat aaggagacac tgag tgttggtgct aaaatggttc ccttgtcaga ggagttacgt aatttagaaa aggagaggaa cttgaccaca gaaactgtgt a 120 141 <210> <211> <212> <213> <220> <221> <222> <223> 59 316

DNA

Pan troglodytes misc feature 8,265 n=a, g, c or t <400> 59 actctttnca aattcttatc atccaggcac gagaaagtca t g taa agat a aataaaaaca gagacat ttt tgaaacttga tggaattcct tttccaaatg caataat tag acaaca aactcacgat ttgggaaaac caatgagaga agaaaaaaga acttatcaaa actcacttgt ctagaaatta gcctgggaac cacttttttt ccttctccct ctcaacttca gtactgaaag tctatgtttt gactttttaa atagaccaaa tttagagtca ctttncttaa taattttcac ccagaggtat ttttatagag <210> <211> 388 <212> DNA <213> Pan troglodytes W0005851 0[htto:/A~~. etthe patent.com/Log in.d og/Sexa m. supportFetch/Defa u t.d oANVO005851 0. cpc?fromC achie= 1 pa rt--ma intoolba r--bottom) Page 564 of 73 7 WO 00/58510 PCT/IBOO/00435 <400> gagctgggac aggttacctt taagcagcca caggcagcct caaccacaag ccattccttc gtgtctggga ttctaaccaa ttacaagact tgttggaaaa ctagaacgaa gaaataactt tgatgacaat accagctgat tggaacatgg tggccaactg gtcttcatgg tgtggacctg ccaccaaagc gtagtctggc aacacgtg gaaaggtgat agactggatc caaggaacta caactacaac cgaatgagtt caacatcttc gagacgtgac tcctt acagg tgagtggcct cagcaaaaag tggaagcaga actggactct tccggtgatg ctt taagaag ctaaggaccg accagtcatg ttcttcccag gacggactct <210> <211> <212> <213> 61

DNA

Pan troglodytes <400> 61 gagctgggac ttctaaccaa tggaacatgg gaaag <210> <211> <212> <213> 62 279

DNA

Pan troglodytes <400> 62 gctttaagaa gtaagcagcc tctaaggacc gcaggcagcc gaccagtcat gcaaccacaa attcttccca gccattcctt tgacggactc tgtgtctggg atgttggaaa agtcttcatg gcaaggaact atgagtggcc tctagaacga atgtggacct gcaactacaa ccagcaaaaa ggaaataact tccaccaaag ccgaatgagt ttggaagcag ctgatgacaa tgtagtctgg ccaacatctt cactggactc aaccagctga taacacgtg 120 180 240 279 <210> <211> <212> <213> 63

DNA

Pan troglodytes <400> 63 gtgatgggat tgtatttgca <210> 64 <211> 84 <212> DNA <213> Pan troglodytes <400> 64 ttttattatt attgttttgt tggtcagtaa gtgataaaat actctctggt cagtaagtga taaaatgcca ttccttgttt ttaggtgatg ggattgtatt tgcaactctc gcca <210> <211> <212> <213> <220> <221> <222> <223> 1152

DNA

Hylobates sp.

misc feature 115 n-a. g, c or t <400> gtccacctgc gcagaatcat acaccaactg gaatgtgaat agctaactgc tcagacttga tgacagtgcg gcatgagctc aaagagt cta ggaagct ggg caaggaatgc acctgtggag ctccttaggt cactgtggga tcttagtcct cctgctcaga ctaggaacac aaatccccta gtctgtctct agtctctaga gaaggtctca gaatcatcag acttagtaag ggtatgtctg ggctgCcctg gatgaactga agtcatcctc ggctctttat agtgttgccc caattgctca tgccatctgc gcttnacccc atgt ccccat tgtggcctgg tcaggccaga tttggatgct W0005851 0 fhttp Jtwww.getthe patent. com/Login.dog/Senam. su portFetchDefa ut. dogVOO 05851 0.cpc?fromCarhe= 1 part=maintoolbar--bottom] Page 565 of 737 WO 00/585 10 PCT/IBOO/00435 ataaacttga atgtaggttt tgcattggta cactccagt c tttcatgtct ctatatgcag taaataaaga caatatacat atggaaagcc cacataatag gcataagaac attctgttgg gcctatgatt ccagcttttc agttatgaaa aatcattcct ggtgtgtcaa tagaatgtct atatgccttc agtatccaca tgattagcaa cttgagttaa agaaagtaga taagcaagt t tacaccccaa tccaggattt tagccgggag ag aatacaaaga gaa t tt tcct gttatcattt atatgcagag caca tt ctt t aaagacccaa taatttaata tttcccatga gtgaagcaag tatcagctcc attagtggct ggaaagggca gacccaaaag 264 cttacattat tagttcacac taaaaacata tatccacaaa gtcttcaaca acttctttca ttttaccatt ataacatt tt aaatgtgtgt tgcatggcag taaagtaaaa tggcaggagg gctggaaaag ccagtctctc agatatatat gaaacctgaa agaaccaaac ttctttcatg tttaaagaac tacaaagagt catttcttaa gtgagtagtc tgttctgatt gcttcctatt tctcatctct ctgatgggtg ctgagaaaat cctaaaaatt caagatatat ttcaacattc tctagaatgt caaacttctt ttaactacaa aatttgctga at tgga tat a atcttttgct gtatatgatg gcttcacaat ctgattctct 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1152 <210> 66 <211> 135 <212> DNA <213> Hylobates sp.

<400> 66 ggtataaagg aatctgaacg cgactgatat tttctttaat ttttagatcc agatatatat cgggtaaaat ctacttcata ggttttcaaa ggaacattct tctgagcaaa tctgaaaact ctctaaactc cattg <210> 67 <211> 89 <212> DNA <213> Hylobates sp.

<400> 67 atccagatat atatcgggta aaatctactt cataggtttt caaaggaaca ttcttctgag caaatctgaa aactctctaa actccattg <210> 68 <211> 148 <212> DNA <213> Hylobates sp.

<400> 68 caaaggagac agaagaagga agagagaagg taacaaggaa agaaggatgg aagagaaggc atgaggacag ctatttggaa atggcacaga ggcatttaca gagatcatta tgtccttgcg tctcttacct tcctcagccc tacacaga <210> <211> <212> <213> <220> <221> <222> <223> 69 94

DNA

Hylobates sp.

misc feature 54 n-a, g. c or t <400> 69 acattccaag gtgattctaa atggcaattt gcactgtcat tttaaaagaa tttntcagat atttgcgggg cactttatgg aaggagacac tgag <210> <211> <212> <213> 57

DNA

Hylobates sp.

W0005851 0 fhttp:/AMw. etthe patent. comLog in.dqgISexa msup ortFetch/Defau it.dofvVO005851 0.gpc?fromCacie= 1 part=maintoolbar--bottom] Page 566 of 737 WO 00/58510 PCT/IBOO/00435 <400> gaacacagaa gcttttgtag tgttggtgct aaaatggttc ccttgtcaga ggagtta <210> 71 <211> 313 <212> DNA <213> Hylobates sp.

<220> <221> misc feature <222> 21 <223> n-a, g, c or t <400> 71 actctttcag ggacattttt aattcttatc tgaaacttca atccaggcac tggaatttct gaaagtcatt tccaaatgtc taaagataca ataattagcc aaaaacaaca aca nactcacgat acttatcaaa cacttttttt catgttttga ttcttaacaa ttgggaaaac actcacttgt ccttctctct ctttttaaat ttttcactca caacgagaga ctggaaatta caacttcagt agaccaaatt gaggtatttt aagaaaaaga gcctgggaat actgaaagga tagagtcatg tatagagaat <210> 72 <211> 389 <212> DNA <213> Hylobates sp.

<220> <221> misc feature <222> 365,369,372,376,381 <223> n=a, g, c or t <400> 72 gagctgggac aggttacctt taagcagcca caggcagcct caaccacaag ccaatccttc gtgcflgggrlg ttctaaccaa a caca aga ct tgttggaaaa ctagaacgaa gaaataactt tgacgacaat anccanctga tggaacttgg tggccaactg gtcctcatgg tgtggacctg ctaccaaagc gtagtctggc naacacatg gaaaggtgat agaccagatc caaggaagta caactacaac tgaatgagtt caacatcttc gagacgtgac tccttacagg tcagtggcct cagcaaaaag tggaagcaga actggactct tccggtgatg cttgaagaag ctaaggactg accagtcatg ttcttcccag gacggactct <210> 73 <211> <212> DNA <21'3> Hylobates sp.

<400> 73 gagctgggac ttctaaccaa tggaacttgg gaaag <210> 74 <211> 280 <212> DNA <213> Hylobates sp.

<220> <221> misc feature <222> 256,260,263,267,272 <223> n=a, g, c or t <400> 74 gcttgaagaa gtaagcagcc tctaaggact gcaggcagcc gaccagtcat gcaaccacaa attcttccca gccaatcctt atgttggaaa tctagaacga ggaaataact ctgacgacaa agtcctcatg atgtggacct tctaccaaag tgtagtctgg gc aa gga agt gcaactacaa ctgaatgagt ccaacatctt atcagtggcc ccagcaaaaa ttggaagcag cactggactc 120 180 240 W0005851 0 [http:tww.gethepatent.comLgDldog/Sexam.supportFetchDefautdOcNVO005 8 5 10.cpc?fromCache=l1part=maintoolbar--boftomlPage 567 of 737 WO 00/58510 PCTIiBOO/00435 tgacggactc tgtgcngggn ganccanctg anaacacatg <210> <211> <212> <213> <220> <221> <222> <223> 333

DNA

Gorilla gorilla misc feature 58, 95, 165 n=a, g, c or t <400> gagggtttgg agttgaagcg acactttaca atctctccag tcatcatcac aagtcactgg aattttcttc cgtcatggta ctgtctttca cctcaaacta cttcttcttg gaagatcagg aagatgcaca tgtatttcta ggaataaata ttccttcCtc tctgaactca accccacacc tttttctttc cagcnaacca ccatttgaga agggcagaat tcaacatttc aag tttaaccttt aaggaaancg ctttgcttct gcaatttcag aagantggcg ggggtagcac ttccccgtga tgctctcttg agccaaatta ctgtgctgct 120 180 240 300 333 <210> 76 <211> 1158 <212> DNA <213> Gorilla gorilla <220> <221> <222> <223> misc feature 493, 1055 n=a, g, c or t <400> 76 gtccacctgc acagagt tat caccaact ga aatgtgaatg gccaactgcc cagacttgaa taaacttgaa tgtaggttta aaaaattggc gatgtatcac acattctttc gaatgtctat cttctttaaa ctacaacaat tgctgaatgg gacacataca tttgctgcaa atgatgattc cacaatgcca ttctctccag tgatagtgcg gcatgagctc aagagtctat gaagttgaac aaggaatgcc cctgcagaga gttgtgaaaa atcattcctg atnggtaggt tccagtctag atgtctatat atgcaacgta taaaaactac attcatcttg aaagccagaa taacagtgag aagagctaca tgt tggtcca atgatttagc cttttcag ctccttaggt cact gt tgga cttagtcctg ctgctcagag taggaacaca aatcccctag atttaaagac aattttcctt gtgtcaagtt aatgtctata tccttcaaca tccacaaaag tcacaataat agttaatttc agcagagtga caagtttatc ccccaaatta ggatttggaa tgggagaacc gcctgtctct agtctctaga aagatctcaa aatcagcagg ctcagtaaga gtatgtcatc ttacattatc agttcacata atcattttaa tgcagagt at ttctttgtct acccaaactt ttaatatttt ccatgaataa agcaagtaat agctcctgca gtggcttaaa agggnatggc caaaatgctg ggctgtcctg ga tga gct ga gtcatcctca gctctttatt gtgttgCcct aattgctcat cggtctctcc gatatacaga aaacatagaa ccacaaaaaa tcaacattct ctttcattta accatttaca ctttttcatt gtgtgtgtga tggcagtgtt gtaaaagctt aggaggtctc gaaaagctga tgccacctgc gcttacccta tattcccatg gtggcctgga caggccagat ttggatgcta tggcaaaata tatataccct acctgaacaa acaaacttca t tcatgtcta aagaaccaaa aagagattaa tcttcaaatt gtagtcattg ctgattatct actattgtat atctctgctt tgggtgctga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1158 <210> 77 <211> 135 <212> DNA <213> Gorilla gorilla <400> 77 ggtataaagg aatctgaaca tgggtaaaat ctacttcata ctctaaactc cattg cgactgatat tttctttaat ttttagatcc agatatacat ggttttcaaa ggagcattct tctgagcaaa tctgaaaact <210> 78 W0005851 0 http:/twww.getthepatent.rcom/L q in.d og/Sexa m.su port/Fetch/Defa utdgMO005851 0 cpc?fromCa rhe= 1 part= ma intool bar--bottom] Page 568 of 73 7 WO 00/58510 PCTIBOOIOO435 <211> 89 <212> DNA <213> Gorilla gorilla <400> 78 atccagatat acattgggta caaatctgaa aactctctaa <210> 79 <211> 152 <212> DNA <213> Gorilla gorilla <400> 79 caaaggagac agagagaaga aggcatgagg acggctattt tgggtctctt accttcctca <210> <211> 94 <212> DNA <213> Gorilla gorilla <400> acattccaag gtgattctaa atttgctggg cactttatgg aaatctactt cataggtttt caaaggagca ttcttctgag actccattg aggaagagag acggtaacaa ggaaagaagg atggaagaga ggaaatggca cagaggcatt tacagagatc attatgtcct gccctacgca ga atggcaattt gcactgtcat tttaaaagaa tttctcagat aaggagacac tgag <210> <211> <212> <213> 81 139

DNA

Gorilla gorilla <220> <221> misc feature <222> 83 <223> n=a, g, c or t <400> 81 gaacacagaa gcttttgtag tttgagatcc tctaagcaaa gatacatttg agcagcaaa <210> 82 <211> 315 <212> DNA <213> Gorilla gorilla <220> <221> misc feature <222> 16 <223> n=a, g, c or t tgttggtgct aaaatggttc ccttgtcaga ggagttacgt ttnagaaaag gagaggaact tgaccacaga aactgtgttt <400> 82 actctttcag aattcttatc atccaggcac gagaaagt ca tgtaaagata ataaaaacaa <210> 83 <211> 388 <212> DNA agacantttt t gaaact tga tggaatttct tttccaaatg caataattag caaca aactcacaat ttgggaaaac caatgagaga agaaaaaaga acttatcaaa actcacttgt ctagaaatta gcctgggaac cacttttttt ccttctccct ctcaacttcg gtactgaaag tctgtgtttt gactttttaa atagaccaaa tttagagtca ctttcttaat aattttcacc cagaggtatt tttatagaga W0005851 0 [httpJiAww.getthepatent.com/Login.dog/Sexam.supporYIFetch/DefaultdogAN0005851 0.cpc~fromCache= 1 part=maintoolbar--bottom1 Page 569 of 737 WO 00/58510 PCTIBOO/00435 <213> Gorilla gorilla <400> 83 gagctgggac aggttacctt taagcagtca caggcagcct caaccacaag ccaatccttc atgtctggga ttctaaccaa ttacaagact tgttggaaaa ctagaacgaa gaaataactt tgatgacaat tccagctgat tggaacatgg tggccgactg gtcttcatgg tgtggacctg ctaccaaagc gtagtctggc aacacgt g gaaaggtgat agactggatC caaggaacta caactacaac cgaatgggtt caacatcttc gagacgtgac tccttacagg tgagtggcct cagcaaaaag tggaagcaga actggactct tccggtgatg cttgaagaag ctaaggaccg accagtcatg ttcttcccag gacagactct <210> <211> <212> <213> 84

DNA

Gorilla gorilla <400> 84 gagctgggac ttctaaccaa tggaacatgg gaaag <210> <211> <212> <213> 279

DNA

Gorilla gorilla <400> gcttgaagaa gtaagcagtc tctaaggacc gcaggcagcc gaccagtcat gcaaccacaa attcttccca gccaatcctt tgacagactc tatgtctggg <210>.86 <211> 104 <212> DNA <213> Gorilla gorilla <400> 86 gtgatgggat tgtatttgca cccacctggc ctgtgtgact <210> 87 <211> 126 <212> DNA <213> Gorilla gorilla <400> 87 ttttcttatt attgttttgt tggtcagtaa gtgataaaat atctct atgttggaaa agtcttcatg gcaaggaact atgagtggcc tctagaacga atgtggacct gcaactacaa ccagcaaaaa ggaaataact tctaccaaag ccgaatgggt ttggaagcag ctgatgacaa tgtagtctgg ccaacatctt cactggactc atccagctga taacacgtq actctctggt cagtaagtga taaaatgcca tttctatgca gggagaatct ctggatcccg cata ttccttgttt ttaggtgatg ggattgtatt tgcaactctc gccatttcta tgcacccacc tggcctgtgt gactgggaga <210> <211> <212> <213> <220> <221> <222> <223> 88 1055

DNA

Pongo pygmaeus misc feature 297,306, 844,854,1021, 1037 n~a, g, c or t <400> 88 gtccacctgc tgacagtgcg ctccttaggt gtctgtctct ggctgtcctg tgccacctgc ccagagtcgt gcatgagctc cactgtggga agtctctaga catgagctga gcttacccta W0005851 0 [httpJAtwwwqetthepatentcom/Login.dog/sexam.supporlFetchDefaut.dofVO005851 0.cpc?fromCache=l1part=maintoolbar--boftoml Page 570 of 737 WO 00/58510 PCTIBOO/00435 caccaactga aatgtgaatg gccaactgcc tcagancttg tataaacttg tatgtaggtt tggcaatggt tcactccagt ttaaagaacc acaaagagat atttcttaaa tgagtagtca gttnctgatt agcttactat gtctcatctc ngctgatggg aagaatctgt gaagctgggc aaggaatgcc aacctgcaga aagttgtgaa taatcattcc aggtgtgtca ctagaaggtc aaacttcttt taactacaac atttgctgaa ttggatacat atcnttttgc tgtatatgat tgcttcacaa tgctganttc ct tagtcctg ctgttcagag taggaacata gaaataccct aaatataaag tgaactttcc ggttatcatt tatatgcaga aaataaaagt aatat tcatc tggaaagcca acataacagt tgcaaaagaa gattctgttg tacctatgat tctccagctt aagatctcaa aatcatcagt ctcagtaaga aggtatgtca acttacatta ttagttcaca ttaaaaacat gtatccacaa gactcacaat ttgagttaat gaaagtagag gaacaagttt ctacacccca gtccaggatt ttagctggga ttcag gtcatcctca gctctttatt gtgttgccct gcaattgctc tccagtctct cagatatata agaaacctga aagacccaaa aatttaatat ttcccatgaa tgaagcaagt atcagctcct aattagtggc tggaaagggc ggacccaaag tattcccatg gtggcctgga caggccnaga atttggatga cctggcaaaa tcctaaaaat acaagatata cttctttcat tttaccattg taacattttc aatgtgtgtg gcatggcagt ttaaagtaaa atggcaggag ggctggaaaa 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1055 <210> <211> <212> <213> 89 135

DNA

Pongo pygmaeus <220> <221> misc feature <222> 102 <223> n-a, g, c or t <400> 89 ggtataaagg aatctgaaca tgactgatat tttctttaat ttttagatcc agatatatat tgggtaaaat ctacttcata ggttttcaaa ggaacattct tntgggaaaa tctgaaaact ctctaaactc cattg <210> <211> <212> <213> <220> <221> <222> <223> 89

DNA

Pongo pygmaeus misc feature 56 n=a, g, c or t <400> atccagatat atattgggta aaaatctgaa aactctctaa aaatctactt cataggtttt caaaggaaca ttcttntggg actccattg <210> <211> <212> <213> 91 152

DNA

Pongo pygmaeus <400> 91 caaaggagac agagagaaga aggcatgagg acggctattt tgggtctctt accttcctca <210> 92 <211> 94 <212> DNA <213> Pongo pygmaeus <400> 92 acattccaag gtgatactaa aggaagagag aaggtaacaa ggaaagaagg atggaagaga ggaaatggca cagaggcaat tacagagatt attatgtcct gccctatgca ga atggcaattt gcactgtcat tttaaaagaa tttctcagat W0005851 0 [httplMrww.getthepatent-comIILogin.dog/Sexam.support/FetchDefaut.dogNVO005 8 51 0.cpc?fromCache=1 part=maintoolbar--bottom] Pa-ge 571 of 737 WO 00/58510 PCT/BOOIOO435 atttactggg cactttatgg aaagagacac taag <210> 93 <211> 141 <212> DNA <213> Pongo pygmaeus <220> <221> misc feature <222> 97,12 <223> n=a, g, c or t <400> 93 gaacacagaa gcttttgtag tgttggtgct aaaatggttc ccttgtcaga ggagttacgt cttatgagat cctctaagca aatttagaaa aggagangaa cttgaccaca. gaaactgtgt tngatacatt tgagcagcaa. a <210> 94 <211> 313 :212> DNA <213> Pongo pygmaeus <400> 94 actctttcag attcttatct tccaggcact agaaagtcat taaagataca aaaaacaaca.

agacattttt gaaacttcaa ggaatttctc ttccaaatgt ataattagct aca actcacgatt tgggaaaacc cttatcaaaa. ctcacttgtc actttttttc cttctccctc ctatgttttg acttttaaat ttcttaacaa ctttcaccca aatgagagaa gaaaaaagaa tagaaattag cctgggaata tcaacttcag tactgaaagg agaccaaatt tagagtcatg gaggtatttt tatagagaat <210> <211> <212> <213> <220> <221> <222> <223> 389

DNA

Pongo pygmaeus misc feature 376 n-a, g, c or t <400> gagctgggac aggttacctt taagcagcca caggcagcct caaccacaag ccaatccttc gtgtctggga ttctaaccaa atacaagatt tgttggaaaa ctagaacgaa gaaataactt tgatgacaat cccagnctga.

t ggaacacgg tggccaactg gtcctcatgg tgtggacctg ctaccaaagc gtagtctggc tagcacatg gaaaggtgat agaccagatc caatgaacta caactacaac tgaatgagtt caacatcttc gagacatgac tccttacagg tgagtgacct cagcaaaaag tggaagcaga.

actggactct tccggtgatg cttgaagaag ctaaggactg accaatcatg ttcttcccag gacggactct <210> <211> <212> <213> 96

DNA

Pongo pygmaeus <400> 96 gagctgggac ttctaaccaa <210> 97 <211> 280 <212> DNA <213> Pongo pygmaeus tggaacacgg gaaag <220> W0005851 0 [http:/Awww. getthepa tent. com/Log in.dog/Sexa m.suportFetchDefa ult.dWOQO055 0.cpc?fromCache= 1 part=maintoolbar--botom Page 572 of 737 WO 00/58510 PCT/EBOO/00435 <221> misc feature <222> 267 <223> n=a, g, c or t <400> 97 gcttgaagaa gtaagcagcc tctaaggact gcaggcagcc gaccaatcat gcaaccacaa attcttccca gccaatcctt tgacggactc tgtgtctggg atgttggaaa agtcctcatg gcaatgaact atgagtgacc tctagaacga atgtggacct gcaactacaa ccagcaaaaa ggaaataact tctaccaaag ctgaatgagt ttggaagcag ctgatgacaa tgtagtctgg ccaacatctt cactggactc acccagnctg atagcacatg <210> <211> <212> <213> 98 58

DNA

Pongo pygmaeus <400> 98 gtgataggat tgtatttgca actatctggt cagtaagtga taaaatgcca gtctatgc <210> <211> <212> <213> <220> <221> <222> <223> 99 92

DNA

Pongo pygmaeus misc feature 18 n=a, gj, c or t <400> 99 ttttcttatt attgttangt tggtcagtaa gtgataaaat ttccttgttt ttaggtgata ggattgtatt tgcaactatc gccagtctat gc <210> <211> <212> <213> <220> 100 854

DNA

Macaca mulatta <221> misc feature <222> 248,250,257. .258,260,263. .266, 268. .271,276,278. .279, 283,285. .286 289,292,294..295,297,299,301..303,307..309,312..313,316,318,321 323,350,358,365,368,372. .373,375. .377 <223> n=a, g, c or t <400> 100 tgctcatttg tctctcttgg ttatgtccta gcttgaacaa acccaacntn nnncttnnnc aaaangancc gactagcaat ttgagttaat gaaagtagag gagcaggttt actactcccc gagccgggat tgcctgtaat tccagtcttt <210> 101 gatgctgtaa gaaaatatgt aaaattggca gacatatcac aaaattnncn annacntntc cnncnnnaaa aatgtagtat ttctcatgaa tgaagcaagt atcagct cct aaattagtgg ttggaaaggg ttagctggga t cag acttaacgtt aggtttaatc ttgggtaggt tccagtctag t tnnnnannn ntnttcatgt cttctttcat tttaccattt taacattctc catgtgtgtg gccatggcgc cttcaagtaa cacgcaggag ggacccaaaa gtgaaaaata attcctgaat gtgtcaagtt aatgtctata ntgtcnannt ctagaatatc ttaaagaacc acgaagagtt atttcttaaa tgagtagtca agtgttctga aaacttacta gtctcatctc ggctggaaaa taaagactta tttccttagt atcattttaa tgcagagtat atncnnttna tatatgcagn aaacttcttt taacgataac atttgctgag ttggatacac ttatcttttg ttgtgtagga ttctcatctc gctgatgggt tgttatccag t cacacagat aaacatagaa ccacaaaaga ananncntng agtatccnac aaataaaaat aatattcatc tggaaagcca gcgtaacagt ctgcat aaga tgattctgct tgcttcacaa gctgtgtCtc W0005851 0 [httpltwww.qetthepatent.r-omf~ogiaN/SgIexam .supportIFetch/Default.doqNVO005851 O.cpc?fromCar-he= 1 part=maintoolbar-bottomj'Paqe 573 of 737 WO 00/58510 PCT/EBOO/00435 <211> 126 <212> DNA <213> Macaca mulatta <400> 101 ataaaggaat ctgaacacga ctgatatttt ctttaatttt tagatccaga tatacattgg gtaaaacttc ataggttttc aaaggaacag tcttctgagc aaatctgaaa actctcaact ccattg <210> 102 <211> 83 <212> DNA <213> Macaca mulatta <400> 102 atccagatat acattgggta tctgaaaact ctcaactcca aaacttcata ggttttcaaa ggaacagtct tctgagcaaa ttg <210> <211> <212> <213> <220> <221> <222> <223> 103 143

DNA

Macaca mulatta misc feature 6,8,12. .14 n=a, g, c or t <400> 103 caaagnanac annnagaaga atgaggacag ttatttggaa tcctttacct tcctcagccc <210> 104 <211> 94 <212> DNA <213> Macaca mulatta <400> 104 acattccaag gtgattctaa atttgctggg cactttatgg agagagaagg taacaaggaa agaaggatgg aagagagggc atggcacaga ggcatttaca gagatcatta tatccttgag tat atggcacttt gcactqtcat tttaaaagaa tttctcagat aaggagacac tgag <210> 105 <211> 137 <212> DNA <213> Macaca mulatta <220> <221> misc feature <222> 25,31-.32,111, 114 <223> n=a, g, c or t <400> 105 accacagaag cttttgcagt gttgngtgcc nnaatggttc tcttgtcaga ggagttacgt cttacgagat cctctaagca catttacgaa aggagaggaa cttgaccaca naanactgtg tttgatacat ttgagca <210> 106 <211> 277 <212> DNA <213> Macaca mulatta <220> W0005851 0 httpJMww.getthe patenlt.comILogin.dog/Sexa m. support/Fetch/Defa uIt. dogNVO005851 0.cpc?fromCa che= 1 pa rt--ma intoolba r--botto n Page 5 74 of 73 7 WO 00/58510 PCTIEiBOO/00435 <221> misc feature <222> 177,179,241 <223> n-a, g, c or t <400> 106 gctctttcag agacattttt attcttatct gaaacttgaa tccaggcact ggaatttctc agaaagtcat ttccaaatgt ntaaagatat aataattagc actcatgatt tggaaaaacc aacaagagaa gaaaaaagaa cttatcaaaa ctcacttgtc tagaaattag cctgggaata actttttttc cttctccctc tcaacttcag tactganang ctatgttttg aatttttaaa tagaccaaat ttagagtcat tttcttaaca attttca 120 180 240 277 <210> <211> <212> <213> <220> <221> <222> <223> 107 389

DNA

Macaca mulatta misc feature 377 n-a, g, c or t <400> 107 aagctgggac aggttacatt tcatcagcca caggcagcat caaccacaag ccaatccttc atgcctggaa ttctaaccaa atccaagact tgttggaaaa ctagaatgaa gaatgaact t tgatgaaaat cccagcntga tggaacatgg tggccaactg gtgctcatgg tgtggacgta ctaccaaagc atagtctggc taagacatg gaaaggtgat agaccagatc caaggaacta ctactacaac tgaatgggtt caacatcttc gagacgtgac tccttacagg tgagaggcat cagcaaaaag tggaagcaga actggactct tccggtgatg cttgaagcag ctaaggactt accagtcatg ctcttcccag gatggactct <210> 108 <211> <212> DNA <213> Macaca mulatta <400> 108 aagctgggac ttctaaccaa tggaacatgg gaaag <210> <211> <212> <213> <220> <221> <222> <223> 109 280

DNA

Macaca mulatta misc feature 268 n=a, g, c or t <400> 109 gcttgaagca tctaaggact gaccagtcat actcttccca tgatggactc gtcatcagcc tcaggcagc a gcaaccacaa gccaatcctt tatgcctgga atgttggaaa tct aga at ga ggaatgaact ctgatgaaaa acccagcntg agtgctcatg gcaaggaact atgagaggca atgtggacgt actactacaa ccagcaaaaa tctaccaaag ctgaatgggt ttggaagcag tatagtctgg ccaacatctt cactggactc ataagacatg <210> <211> <212> <213> <220> <221> <222> 110 74

DNA

Macaca mulatta misc feature 6 W0005851 0 [http:/Awww.ethepa tent. comLogi n.d og/Sexa m. support/Fetch/Defa uIt. d OgNO005851 0.cpc?fromCa ce= 1 part= ma intoolbar--bofto m] Page 575 of 737 WO 00/58510 PCTIBOOIOO435 <223> n=a, g, c or t <400> 110 gtgatnggat tgtatttgca actatctggt ccataagtga taaaatgcca tttccatgca cccaccggcc tgtg <210> <211> <212> <213> <220> <221> <222> <223> 111 108

DNA

Macaca mulatta misc feature 32,40 n=a, g, c or t <400> 111 ttttcttatt attgttttgt tggtccataa gtgataaaat ttccttgttt tnaggtgatn ggattgtatt tgcaactatc gccatttcca tgcacccacc ggcctgtg <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 112 514

DNA

Homo sapiens allele 380 99-30329-380 polymorphic base C or T misc binding 368. .392 99-30329-380 .probe primer -bind 361.. 379 99-30329-380 .mis primer -bind 381. .39 99-30329-380.mis complement primer -bind 1. .18 99-30329 .pu primer Ibind 496. .514 99-30329. rp complement <400> 112 gacatacccc act t tgaat a cttatttatc cctattacta taatctaata ggtgtttgat tggagcattt aaacacagca gcacaaagca gacaactgag agtaaaattg aggacaatat tttctttgag acattaaact aaataatata atattattct gattagtggt ttgtactttt ttgtcttttt tattttcaty gtctcttaaa actgcctgtg accattagct gaatggtttc tgtcatattt acttttttta catacctttt atacttaata attgtcaatt gttattaatc acatcgttga cttttttacc atttttgtaa aataacatcc acttttagat atctgcacta ttttaaatag taaacagttt cttagaaagt tgttgtttat gatttactac ttgttgttca W0005851 0 [hftpt/www.qetthepatent.comII~ogifldgSexamsupport/Fetrh/DefaultdogAN000585 1 0cpc?fromCar-he= 1 part=ma intoolba r--bottom] Page 576 of 737 WO 00/58510 PCT/iBOOIOO435 275 caaaactaaa taattgcttg atgtttcatt ttatccttct tattaaatag gcagctcgtg tacatatgaa agtgtctttt tatacaccga aacc <210> 113 <211> 617 <212> DNA <213> Homo Sapiens <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 330 99-1608 1-2 17 :polymorphic base C or T misc -binding 310. .329 99-16081-217 .misl, misc Tbinding 331. .349 99-16081-217 .mis2, complement primer bind 114. 131 upstream amplification primer primer -bind 556.. 575 downstream amplification primer, complement misc binding 318. .342 99-16081-217 probe misc feature 4,607 n=a, g, c or t <400> 113 ctcngggagg gcagaggcca cagagaacca gggcggagtc tctccatgaa acattaggca gccataataa tatacagtat ttggaataca aattaagaac aaaacanaca ccaaaggggt ggggaggagc gcaggcaggc ggaagggagc gttccagaag ctggtggctt aggcatttga catgccagaa catttttcag tataacttac cgcaaac cgcccctggg acacaccaca cctgggtcaa gagggagcca ccaatgacca cgctctaaay attatgttgc acaaatttat ctgagctcta ttccacccca gcagatgtct ggcagatgtg gccccgtgat gggaggcagg gatcggcgca gaacagttct ttttgatgaa aacattgtta agaattactt ctccacctca atgggagaag tgggggagga gtcccaggag gccctctgag tgcaaacagc taaaactgct actataaaga tggtataaca ttcccttgcc ccctacccca cccaagggac gcccaaagga gaggggagga ggcagggagt ttaaaagaaa ttcagttcta tattggcttt gcaggaatac ccaggttggc gaaacaaaga <210> <211> <212> <213> <220> 114 642

DNA

Homo Sapiens W0005851 0 [http:/twww.getthepatentcomLogin.dog/Sexam.suportFethDefaut.doalWO005 8 51 0.cpc?fromCache= 1part=maintoolbar--bottoml Page 577 of 737 WO 00/58510 PCT/EBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 233 99-16082-218 :polymorphic base A or G misc binding 214. .232 99-16082-218 .misl misc_binding 234. .253 99-16082-218 .mis2, complement primer -bind 16. .33 upstream amplification primer primer -bind 527 5i7 downstream amplification primer, complement misc binding 221. .245 99-16082-218 probe misc feature 486, 611, 613 n~a, g, c or t <400> 114 gaagcgggaa aggtgcttta gggaagcatt ttcctttaca taagcaattc ggagaagggg ccactgtcac agacaagtag tgttgntttt ttgctgctat caaacatttg ctgtgcaatt caaagaagca gttgtcattg gaacagatgc caaaggctgg ggagtgattc atccatggct agagaggcta taatcagagg gataacactg ngnttctctt cagcaagagc ggctgtgata ggtcacacct tgagcctgcc ggtaaggggt aggaagagga agtcctgtgc gaacaaaagc ttgaaattca cataacaaac tcatgggcct cactttggtt aaaacaaaca cctgcaccag tggaggtggc agaaaagaga gaaacctgtt aaacttccag taaagtgtag.

tactctgatg aaccccccaa atgtgttggc aacaaacctt agacaacatt gcaggtggtt aatt taccaa agctcaaaaa catttcctcc tccccagctg atgtcccata caaactgtat atctcagtgg tg ctgggaatga cataaactgt gtctgctgcg tcratggtct tgttagggat caaattacaa atatccctgc cactaatcag tagtcagttg attacaagga <210> <211> <212> <213> 115 3001

DNA

Homo Sapiens <220> <221> allele <222> 1501 <223> 99-15056-99 :polymorphic base G or A <220> <221> <222> <223> <220> misc binding 1502. .1521 99-15056-99.misl, complement W0005851 0 http:tww,. qetthe patent. com/Lo in.dog/Sexam.s pportFetcIDefaut.dog/WO005851 0.cpc?fromCache= 1 part--maintoolbar--botom] Page 578 of 737 WO 00/58510 PCT/EBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc binding 1482. .1500 99-15056-99.mis2 primer Ibind 1582. .1599 upstream amplification primer, complement primer -bind 1098. .111 downstream amplification primer misc Tbinding 1489. .1513 99-15056-99 probe <400> 115 cacaccaaca taaaacttaa tttccactct atgaaagatt gatt cat ttt atagtcgaag aatgaggcca catataaatg gcagacagac aactagaaga atctctgtcc ccatcattat taattatctg tgaaaattag tttctaagat tt ctataata tattaaattt aaaataggta tgatagttat accaaaggt c caatcataga ggggttcaaa tttagaatta ca aat cggca aaacaggaga rgcactcata aggtgctcga aatgggagga aatgatgttt tcttgtctca atgttctaaa aatatttacc atgacaacac ccacaaccta aatgactcac acaattcatt taatggttga aaagctttac acacttttgt ttttactcac tgacatataa tcaagtattc atccttgaaa tggcacatgt agtataataa aagtggtgta tgggttccct aaaatccatt cacacacaat ctttaaatac tatagaactg aatatatatt aat ttgaaaa tatttttaca taagagagat taaccaaaag catgtttatt gtttcataga gacaataaaa atttagttga tttagcaata attacataaa aattatgcct tcaactgttg agaaggctag agatccaaaa tttgattaag aattattatt gccacttgta aggaaatctq agggagtaca taaaacaaaa tgctttatag aaaattattg atattagaaa aatgtgcatt aaagcaggtg ctaataaaat gttttgttta aaaagccttt aaatggattt actctttttt caatgatttt atcttccaaa ggaaactgtg gcttgagttt atacatatgt taataataat agagtttgtg aaaagatatt ttactaactg aacaaatttc taacatacat aacatactgg attactgtga acaaatttca catcgtttaa atatatcaga taatttttca tcatgctaac aatacttgaa ggctgatttc aagtaatcca ataactt tag agggagacgt atgtttacaa ctcactgttt atcacaagct ataagaggca tggtaacttg taggaagtct aattgtaaga gcttcttgtg tttatcttaa cgtacttata ggcggct tca ggtattccaa ttaaatcatc acgtgataac agaagaaatg aaagctttat aggtatatga gcagat aact ttaaagtttc aatgaaaagg atagcatcat cattggcata aaactttgct gctactggca aacaaacctg agtaaagact ctcagtagag tctagtcaac tcaagccgtc tgggatataa acttaaggta actatttaaa taactattat caatcaaaat tgtcacacac ataggtatgt gaaaaataca aataaaatta gaatataagc ctaaaatatt gcattttaag gatgtctagg attttgggga taacttgaga catcgaaaca tattcctaaa aagaaaatta tttgatataa acgtggagaa gttaagaagg agtttcctgg tttttattta tttccattat gagctgcagt agaccttttg caaaaaattt atattagttt gcgttgctta tttcatgtca aaaaaatggc atggatatcc ttgtgatgtg cactaatcta gcattggtca atttattatc tgatagataa atagctactg cacgtcgtgc ttaataatcc tcatagcttt ccatgtatct tcatattgat ccttccaact tagactaccg actgaattat gaccaattag gccatccagg acacacacac aatccaggtt cattatttaa tttttaatca aacagtaaat tatttataat taaaatatcc cagtttataa acaccaaaca cattggtgtt aatattgtga tgaatttatg aagttacata acataagcac attattatgg cctttgcctc aagttaggct tttctcctta acaaataaag tttcagacta attttgtagt taagttgttt cattaaaata atatttttgc gctttttcat aagcctcaca t t tgt tctt c taatctgaaa tcttgcactt tttggagaat taatataaga gttttccaaa tccgt tgttt acatgtaccc caaagccaag tatatagttg taaacaccat caaaataaag gtagtattcc tgatttactg atataatata tactaaggca tttcccttac acacacaccc tatttacatt aatactgaca caagttttta tatgtgctgg ctgaataaat attttcagat acacatggaa tatttataga tttctattaa ggagcacaaa atcatctagt gtgagcaatg agagaatata gaactataaa tttattcagg ttgactgtac atgcctttta aaaggcacat gttgatcttt tatattgatc gtttattaaa actatattt t ctatctcttt tcaatatatc gagatatgga atacgacccg cgatatgaat cgaataaata attgattttc catatcacat tttctactta tcccgaagtg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 W0005851 0 [httpJtwww.etthepatent.r-omfLogin.doq/$examsupport/Fetch[DefauitdogNVO005851 0.cpc?fromCarhe= 1 parI=maintoolbar--bottom] Page 579 of 737 WO 00/58510 PCTIBOO/00435 actggctcac catttctgtc tcagctcaca aggggctgac gactaagttg ttcccaggag tcggcttcta t ttcattcatt agttgttctt gctccaacaa attctttcag tgtgacttcc tgtgaagtgg ctgtggtacc tttgaggaag tcaagtagaa tgcatgggtg aaaaggagac tcaggacatt tgaagacacg atcccgtaaa tctgccaaat gt ggt gt tcc cttctcctca atgccaataa cattctcatg atagatgtta tatccacagt gcccaaatgt ctaaaaagga agaaaaccat ggctcaagat ggaatctgaa gcacactcag gaaaaaggat ggtgaaactt agaagctagt cacatgctgt ttaattacat gttttatttt agctatggcc gacgacgtcc 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 116 3001

DNA

Homo Sapiens allele 1501 99-15063-155 polymorphic base A or C misc -binding 1482. .1500 99-15063-155 .misl misc binding 1502. .1521 99-15063-155.mis2, complement primer -bind 1347. .1364 upstream amplification primer primer -bind 1784. .1804 downstream amplification primer, complement misc binding 1489. .1513 99-15063-155 probe <400> 116 aaaacctact agactcagta aaataaattg gatcactaga agacgtagag cttttctgta tgagttttca gcaatgacaa tattagaatt gacacaattt aaaacaaaac atatttaatt gaaaagaaac ttaagaggta gatcacatac tatgatggct ctatgtactt gctattatct gaaataaaat tcttaatata tgcaatcaag ggcataggaa ctggacaagt acagagtgtc atcaataaac ataagtgaat tttcaataca caaagactga ttctaggctg atttaaattt agagaaatgg cgacaaaaat acaacaatta gaaaatattc gggacaaat a ttaaaatcag aataaataaa ttgataaagc tcaccatcca tgtcactcta cagagatagt acaacttagc acaaatatat atgcatacat aagtatggaa tcagcagtaa tatgtctaaa gaaagtcgac aaaatacaat atgaaataat gagacagtag caaatctcat aaaataaaca gagcaacaca taaataaata acaatgaaga gtagccctgt ggatgtgaac ggcatcccat atcacacaac gagagtttgg acaagtttta taattatata cacattatca tatatatcat ataaagttta ctagtaaata cataaaaatg agaaaataag taaaacataa tacatatctt aagatgcttg aaaataaaag attaaaggaa gaaggaaaca tctgaactga ggctactgat tcctatttaa accactgaga at gtgcccaa taaatatttt gggataaatg ataacattaa ccaatatatt atataagata tattaaagat tgagagataa atctatagat gtaataagga ctttcttaga tgtgaactac gattgtgcac gggagacttg aatacttaaa tgaaacaaat gagcaaacaa ttgaaaatca agacaaaaaa atttaaaaaa cagaaatttg ttatataggt aaacggagtt aagtgaaata agaatgagaa tatttgaaga ataaatggta ttaattggaa ttctcttcaa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 W0005851 0[http:/fwww.qetthe patent.com/Lagin.dog/Sexam.supportFetchwoefault.doANOO0585 0.cpc?fromCache=l1 art=maintoolbar--boftom] Page 580 of 737 WO 00/58510 PCTJIBOOIOO435 ctatgtacta ttcggaagaa cagactactc aattggcata catttcatca acactatcaa atacgtggaa mcatgctctt tatattctat tctcaaatgt aatccataaa ct cagaacat ataaactatt tattttgatg tatttttgat cacctctttt aa cagaccca gaagttctgt ttcacaacat cacttattca cgt caacaaa aaataaggga aactcgtata tttgtacagc aa ccagcaga actcccacca cctctccatg gagcctcaat tggaaataag agttagacct gcacttgacc tttggaggct gatcatggaa gtaactataa acaataatat tttttagtat atcacatctc tataaacaac aaaatgctga ggttggaaag gaaagtccaa atataaaaga taatcaaaat acttatggag aatatatttt cataaacaaa gcataaaacc agaaaataaa atgtgctaat tcaataaagg acacaacaga aaagaaattt ttccaaaaac ataaaagagc cat tt ctgcg atacaaccca tggtaaccaa gcgtcatgac gcaaccagct ttgtattagc tacagt ggcc gctccgaaag ttgaattctt cggttgtcct acaatgcagg ttatattatc gagagtagca gtataccaaa aataaagcag aaaccaacta aactctacat aaatagcgtt ataccaacag aagaccagcc ttaaaataaa tttcaatata tttgatgcat tatatatttt tgatatcaga acaatatttt taaaataaca agaqtttaaa caagtactga tgaatagtaa ggaggttaca ataacaatat ggaagataat gaaattccat agcaatccct aatttacaag ggaaattgcc ctgaccctta aagagcccat gagcatcacg tcccaggtga gaatcagtta gaaagaaaaa taccttgaaa tgttatacag gccaaaat tt tcagaaacaa aaaatacatc taaaaagacc ccaaagatgt tttttttttc aagaaactaa acaatgaaaa tgacaaagca aaacaaaatg tgatgcat aa cttctgcttc tctgaccttt gattgaaaca aagtgaagat aacacaaaat cttcacagaa accacaatga gaactattgg ggtagaacca gcatagttat agcggccctc t gctatggca gccctttccc attttgcagg cctttgggga actcagtgag agccaggaac taacttggag aaggaataaa ttaaaaagaa gtataagctc taaaattgcg acagcaaaaa ttacaaaatg gtaaacatac caattctccc atggatctgg agaagtggag ttaagggaga ggcctggtgg tttttgatgc acaaacaaaa acaacacaca taataggaaa ctcaactacc gaat caaaat ataaattatc gaggacacat gaaatcattt ataagatatg acttggaaaa gaagtgaaga attgcttatt atatctagga tacaaagttc taattgaagg ttctgggagc agattgctgt ct ccctgggc aaatgtctgc aacataagaa atat tacagg actggaaaaa tttaaaaaca cctattatgt cgtacaaaac agagtaaata aaagttgaga tcaagctaaa gcttagatat ggatagaagc gacctgttta ataatatata acataatata gacacacaca gtattttctt tttaaattta ctagaagata aagtcagaga gtatgttcaa tacacttgtg gatcaacagg caatttggca aacttgcagg agcataagac gtttgctgcc taaataactt agggtataag actgcctgtg ctaacaacac gaaaccccag agatgtgctt 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 117 3001

DNA

Homo Sapiens allele 1501 99-15065-85 :polymorphic base C or G misc Tbinding 1502. .1520 99-15065-85.misl, complement misc_binding 1481. .1500 99-15065-85 .mis2, primer -bind 1568. .1i585 upstream amplification primer, complement primer bind 1120. .1140 downstream amplification primer W0005851 0 [http/tww.getihepatent.comf~ogin.dog/Sexam.suportFetch/Defaut.doqNVO00585l O.cpc?fromCache= 1 part=maintoolba r--bottom) Page 581 of 737 WO 00/58510 PCT/EBOO/00435 <220> <221> misc -binding <222> 1489. .1513 <223> 99-15065-85 probe <400> 117 ctcttcacct tgttgccttg taattcatta gtaaaataat ctacctattt ctgaaataca ttttctacca ttcattctta tcaagttatc aaattatgtg agtacatagt ctaatgattg tacaaccatc agaattcgga tccatctctg cattgtggac aacacaccac gaacccaagt gaaggtaatt tgaatttata aacagttaaa gcagtatagc gaaggcttcc attattatta cctctgggga scctcattaa tcttgctcta atgtcttctg tcatgatcac actgagcctt ctgagggact tcacttgata gttgcagacc agcctt ggca atttatacca taattttcat gggaaaacac aacagttgtc gaacatgagc cctatccttt gaggatgcaa acagtgcagg tagtcaattt ttggcatcag cacaatgtgc aactcgtcat acaacaggcc ttccacctat gaatgatggt tggctgcata t aaatttatct actccagagg tttgatattc tttagggaaa gcattgtacc tttttcatca gtgagattgc tgaaggtcag aggctttaac aagtaaagta acactgcact aattaaacca agtatttggg gcattcaaat agaaatgtca ctgaatctat tttcaatttt ctaaacagaa ttagataata tgctacacat aattgacata agcagcatca agtctccacc ttttatttga agaggacata caatattttt tgaatccatg taggcacttt cttgattctg aatatcaata ctgaaggtat cacagaatcc cagagggtat aaagccaaaa ctattcactg tgatctaagg atgaaataat aaggaataac tgctggtaca ttcattagca gctttgccta tgttctgttc tggcagggaa attttcttcc aggtgagt ta ttaacattag ctggtgtgtg gagtgagaac ttccagcttc gtattccatg tttatttatt caaaaatctt ttgtttcaaa atatactaat attactattt tgcctcctga aaagcaaaaa ttgccaaatg gttttcaaga taacataact gcagataacc tagtgtatat tgaacagctt gatactagag agatttaaga ttacccaggg tgaaatattt aatcaatgta tttttaatat aagcaatcat ccattcatgc caataaacaa tacgagtctg gaa gaa acat ttcggctgga tcttacaagc ctgctccagt ctctgcaggg aaccattttg acgtctataa attttttgca ctcaaagtca gctagacatg cagcatcctt atgctagcta atacctttgt catgaatgtt aaaatcttgc aaatggtgat tagtaacgac tcatggcgag ttggcattct caccaaaaca tttttttttt cat aggtata gtgtatctcc atgttcccct atgcggtgtt atctgtgtcc gtgtatatgt ctctcatcat atctcccaac atgggtagag gtatgttcca gatgtagcct gtctctaagt gaaatatgta atgccaaaac tgtttatgtt gtttcttttc ggctgataac ttttctaaat cagcatccat aaaagacatg agagccgcaa tcaaatcaag gcaaatacat tgtttcgtat tttgtttgac tttattatac aataaaaaat gctgttacaa tattttaatt cagaagcagt tggcttctaa ctctctttga ccttcaataa ttaacaatgt gctatttctc cattcttcaa tatgtaaaga ccaccttatt catagctatg catgctaagt gcatggtatt cacacagctg taaagagaat agtcctcatc gaaaccagtc ctagtaagaa tttacactta taattcctgt gt gaagt tt c tattatactt catgtgccat taatgctatc tcctgtgtcc tggttttttg ctacaaagga gccacatttt tatcaacaac aatgtctctt gaaaacttcc gagcactgga tttgctcatt aagagtgatt gtatttattt cttactttct tgacaaccat tatgaaacat cagctctcaa gtattcttaa tagtttttga aagactgttt tttcaaaacc gatttggaac gatgagatat ctaccttata accaacatta ctattcacat aatatgctga aatagcaata taaaagttac cgagggatta agtgtttcct ttttataaac gctgattaaa catcttcatt catcagtcaa tgttcacttc ggtcagacaa aatcctcatc tatttagttc tcctttttag caagaaagta aattaataaa ttcagctgca cagtccagct agaaaagctg atgtactcat tgtacgcctg atgagctgtc at tcgcat ta taagttttag gttggtgtgc cctccccctc atgtgttctc tccttgcgat caagaactca ct caatcctg tactaggctt aagttaagtg tgcatatacc aggtccaaag atgcaatgag gactcattcc actcatggaa agaatgctat atataacata gcctatttca cacatacaac ttaatcacat gcaaagaact atgagattgg agggctactt agaccatggg cttggggatg gacatagtct ttcctgtctc gtaagtactt aggtaactaa acaaacaaag tgtacgctgt ggaagtgggt ccagtcatct tgacatgatt cattttcatt gccactatta tgagtgaaca atccagttta cattttattc actgagcata ct gtgt tcca aaactttcat ttttttatat gtcacatttg ggatctgctg tccctgcagt cccctgatga ggaaagcagt ctgcattagc tcattggctg tagacttgtt ggtatatgtg tgcacccatt cccccagccc attgttcaat agtttgctga tcatgtttta tgtatcattg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> 118 <211> 451 <212> DNA <213> Homo Sapiens W0005851 0 [http:/twww. qetthe patent. comfL gi.d og/Sexa m.suportFetch/De fa uIt.dog NVO005851 0.qpc?tromCadhe= 1 part=maintoolbar--bottom] Page 552 of 737 WO 00/58510 PCTAIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 404 99-15252-4 04 :polymorphic base C or T misc Tbinding 384. .403 99-15252-404 .misl, misc binding 405. .423 99-15252-404 .mis2, complement primer -bind 1. .18 upstream amplification primer primer -bind 434. 411 downstream amplification primer, complement misc_binding 392. .416 99-15252-404 probe <400> 118 atgggggcat atttcctttc ctcactcggg tttagaatac tccaaatctt ttgaagggga ttgtcctgta ccatgagaat atagcaaccc tcttactaca ctgcctaatt acattttctt tcctatcatg tagagatagg atatttcatg ttgtaaaaat tttagaaaca tttaacatgg tttccctgat aacagaagat ctgtgttctt ctgt atgaag gatagcccag ataggctctg aaactacaaa gaggttttct tttccatcac aataatcaga tggctctttt tccacgctga tggtgattaa g aggtaagctt gtcttcttgc atgtctcaca ttcaaatatt tctttatgaa agatgtctcc gactttattt gaagttttgc accygt gtgt ggcttgctac caaatataag gaagtcagcc cctgccctac acaggaataa <210> <211> <212> <213> 119 3001

DNA

Homo Sapiens <220> <221> allele <222> 1501 <223> 99-15253-382 :polymorphic base C or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> misc binding 1481.-1500 99-15253-382 .misl, misc binding 1502.-1520 99-15253-382 .mis2, complement primer-bind W0005851 0 http:/Iwww.getthepateflt.comIILogindo /Sexam. .support/Fetch/De fau It dog/WoOO5851 O.cpc?ftomCache= 1 pa rt--m aintool ba r--bottom1 Page 583 of 737 WO 00/58510 PCTIIBOOIOO435 <222> 1120. .1138 <223> upstream amplification primer <220> <221> primer bind <222> 1578. .Y596 <223> downstream amplification primer, complement <220> <221> <222> <223> misc -binding 1489. .1513 99-15253-382 probe <400> 119 atggagtaaa tataatattt ttattatgtc cttaatttgc ttcaaaatgt acaattatta catgtattct taactatcat tttggttaat tatatctgga tagatcaagg attcccctaa tttgaagata ttgttttaag gagcatgact ggagaatcaa ctctccactt cctctaccct cttagcaact attttgtacg tacagatgaa attacaaagt gcagagcact tccaacctat aataatcttg yctatgaacc taactaaaca ttaggggaga caaagacagg tacacatttt atcaaacaca aattattaat cacacatatg cacaagtgtt gtttgctgcc cataacatgg agcacttcac ctccttggtg aatgtgagtg ctaaacaagg tttctatatc aggaaattta attaatgcat aagcctatga atatcatttc ctctctgaat gcatatagca aaaaaaagtg ttatttaaca gattgaaggt gacatacaat tttgtaacag ttggtggcga atgccaatca aaatatcacc tataaagaaa tgtattacta gagttatttg aatttaagag ttacatttcg aatattattt aatcatccta aaaaatcaaa tttaatcatc aat tagagag cttagtacca ttctttgtac tcattatacc ctaattttgt aaaaaaacta tagaagacta ggcctaaaga gatctgttga actggtttct tagggaaatg ttgcatagaa ggtagctgct agaaaatcat aat tccaaaa gggcaaatat ttgcctgagg catatgtaaa agctgcattc tttttcattg tgt cgcattc agaatctggt gtatgactgt gtattatgag ttatactgtt tgtaggtgta ttcaatgaca agcagaatta tataagttag ctaaataata aattgagaat tgttcttttc tgcaaacctg aaaagttcaa tggaaat gga caatacaaac agagatgttt aaaacactgc cttaaaccat cataagaatt tggaatcagg gggtttcatt tgatttattc tgtaaaaagt ctaggttggc tggtaagtta tatatttcaa gtttataaac tctgcacttt ttgcaaacac caggctaagg aaaacaattt atttaacaag aagat cct ga gaattcaaat agaataaaat aaatatttca atgagcattt gttgaccaca tatttaagtt tatgccagtg ggcagctctg tcaacaaaac agagtgggag attcagaaca aaaacgttta agaaaagcgt acaatgacat ttgttcaaag cagactgttg acgctgctat tacagaaaca gaatcagatt taatagccta agaacccaaa tcatagcaaa ataatcttgt tttccaagga acaatacacc ttgaaatcat attaaaaatg ccagcctaag gtgataattc ggcaacattc attttgctga aatatgaaat ctaaatcctt tttaaaattt gaaaatcaaa aatatgtttc aaaactggat tatcttaatt gacaattaaa aataaaatta cttaaaaatt tatattttag tatgtctata aacacaggcc ccttgaaatc agacagactg cagtgttttt aatacattga aaagtttcac tttctgagtt ggcctaattt aaaaattagt tgcatatata gtaacccact tattttttga atgatggaga acacattgaa ccctgaaatg gcacataatt atggagatat catttatgat atcaaaatct tgcagtgacc gaagataaat gtagtgtttc tttcagcagt ttagagggaa gctaaaagca aaaaggcaaa gttagaaaaa taaaatcaga agcaatgata caaagcagtg tgtttgtttt cacacaagga taatatggtg tggtacttct taaataaata tctgatatgc tacaataata aaatgatgca tggggctgaa cccttttctt taaatttttg aaaaagatct tttctctact aattttgcct aatctttaca tccatataat ttggcacatc atttttttct tttacaaaat ttaggatatt catctagtcc agcagtcaag gaagtatttg aaatcaattc tattttatgg tttttttaca ccataatgtg catcttttcc aataaataaa gcacagcaca ttacacaggt aaagctgt ca aaagttcagt tgtacttgtt atttttgtca ttccttcctg ggtatataca aactgtgccg tcatagcttg ttcaatattt cacatataaa ctatgctt cc cagaaatgct tgcatatttg taataatata aacatctttt tttttttatg ccaaattaat tgactaaagc tacactttta aagcaatatg agaggtaaac tcttaaaaat gaattgcatt ttttccctga gctagagata tagtagatag atttgctgat ataataaatt aattatactt ttgtcaatta ttttttgtat tctttttaaa taaccaaaag tacataattc ttgtgttcct aactccatct cactgtgtca tacaaaaatt agtcatctag gtaacaagcc taacaatgtt cccaacactc tttcatgtgt atattttatg agtggtaaat ttaatttttt ttactttgta gcctgtaatt cctcattgtg aaatcaatat gactcaagta tttcctgacc acatagattc ccaattcaag catgtctaca gaaagtagga ctttgccaca cccttgcttg ttattggtct tcccagcctc gccagtgcac atgaagcaag tgagaaatca gtcgggatta tgagtaaact tttatgtttt cctctgtaaa aaatttttac ctttttattt aaatctgccc tgtactgatt gtggaacata 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 W0005851 0 http:/wwgetthepatentcomILogin.do /Sexam.suportiFetIDefautdogNVOOSBS 1 0.cpc?fromCache= 1 part=maintoolbar--botom] Page 584 of 737 WO 00/58510 PCT/EBOO/00435 283 tgttatcaca ttaatcattt gctcctactg ctatttcata cttggtggtc attcttatgc 3000 c 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 120 3001

DNA

Homo Sapiens allele 1501 99- 1525 6-392 :polymorphic base C or T misc Tbinding 1481. .1500 99-15256-392 .misl, misc_binding 1502. .1520 99-15256-392 .mis2, complement primer -bind 1110. .1127 upstream amplification primer primer -bind 1548. .f565 downstream amplification primer, complement misc binding 1489. .1513 99-15256-392 probe misc feature 1719 n-a, g, c or t <400> 120 aaatattaat ataagaagtg actttttaaa tctgataaat tgtatatata aaaaactaaa ttttcactaa atacatctca taatttatga aaacttagaa agatgcttat gggaaaagtc ttacaattca tctacagctt cgctttgtta tgacttgttt tgcatttgca aatcaaagat ataagctatt cttagagcaa taactcaaaa taaaaagtat tatataggta acttcattaa aacataagat actgcattaa aagagagctt tcataacaga aaaactatca ctccataatc aaatgagatt tcaattttct ctacagagca cca taa ct ac tatactggag aggagtaaat aaacaaaggg agatacaatt gctgacacag cattatatgt tataaagtat gattttcagg attttccatt tctaatttca tgattgactc agaaaagcag gatctcctga caatcacctc gtgtggggac gacaattaaa ttaagagaca tgtttgaatc gatgggaagt ttgggataat cagaaacatc ataaataaga ttgagcaact taaatatgta gcaaatatca aaaatgttac atataatacc catggctata acagttctgc gagagatgga gactcactcc ccatcaggct acagagccat tatattattt gagtcttcat tgactttaga atttggtaca tcaccagcac tactaaaaag aggtacttaa catttgtata gatggctgga gcatgatata tgagtatctt aagtgcatat cagaaataca agtgctggag gtgcaagcaa ctgtcatgag tctcccttga accataccac tagtctggga tataaatgtt gacacgttct agagtataag t tct ggt caa tgcttcctat tttatcctac gactgtgagt tttgagagca aatatatatg tttcctaagc ccatattccc cttaaatatt cgagactggg aggcctcggg gagaaaggcc aacagcatgg cacatggtga caactcacat atatttgaca agaatatagt ttcaaatgca cctagaaatg tggcttctga taagcaattg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 aaacaaaaag ataattattt ttatatgtgc ctctctatga W0005851 0 [tqp://www.getthepa tent. comILog in.dog/Sexam. sup port/Fetch/Defa ut. dogNVOO05851 I .coc?fromCar-he= 1 part=maintoolbar--bottom] Page 585 of 737 WO 00/58510 PCTIBOO/00435 gggaaatgta ttggataatt atgcttttat tttacccagg gtcagtcatt ctgattagtc ytatggacag ctttgtttac cattataact tatataatgt tattgatatg tatttaataa tatatagcta tctcatgtcc catacaaagg ctgtaagatg atatgagtgt ttttgaaatg attgtcataa aaaatcttcg atgccatcaa acactcacac aggcttattc ttaaaatagt gcaaaataca atatagagaa taatgtcttt tttttctttt tgagttacag tgaattgAga ctttacctta ataaacaagg gagtgaataa gt tctcagag ttggatatgg gtcatgcttt cttagacatc tcagtgaaac atttatttcc aaaataaaca caataacttg acaacaatgt aactacatgt tcactataga acaagcaatt ttcaaataca ctatgttatc gcatgtgtgt tgtaactttt t taat tgata atagagacca ggqttacctt acattattat atatttaact gatattataa tttaagaaaa aataatgagg actatttcat cattttattt tcaatggttt gtgacattta atattttcat gttggtgagc tagtgagaaa aatgagtcac tcctctgtac gtgttggtcc ttttcaattt tgttgcaatg tagctacaaa gttgataatt t t tcaccaca gctaaaaaat tagcttaagt acagtttcct ttacttattt atagtacttg caaaagcgtg ttacacctgt ctaaacatgt gctataacct attagtacta atgtctctgt taagagagtt atctgtaacc ttatgaactt atttccatag ggaaaaatat ctcataaaat caccggttga ttaatagaaa gtccaacata aaattagtac at ct tcct ta ctcctgtgtc tgagagccaa tggtaccctt atcatatggt gaacactggg gcccctcata tgtacacatg aaaccaaaaa tatgctaant agaactttac atccagttat aacaacaaat acagcaaatg ctaaactttg tgtgtatctg ctttcaaaac gggctaatgg gccatggaga aggcaaatga cctattttta atatttcatt agtagtaatt ttatgaaact agccaaactt agtgacagat aatctatatt agttaagcac aaaatcatgc aagaaaattt tggttaat tt gtgagatgtt tgatgttgct ttgtgatgat taagtcagtg atgccctctt gctcctcatt gcagattgga at tccaagca tgccttaata tttttgtgaa aatagataat cacaagacac aataacccat gaaaaatgat tggggacatg tgtgttgcat ccttagaatt gttcttccta agcatataat gaagtacttt tgggtctttt aagaacagtt tttaagaaca acattttact gattattaag acaagaaata aactagaaac attcgttgtg agagaaatgt ttaaaggaaa ttcacaaata tttggaagaa ccatgttgga acacaatggt gcactaatca agagaacatc cgggtaaaaa tctcaatgca atttctatat gctgcttgtc tgtagtagca aatgcaatat ttagaccatc caagcaattt ggttgaagcc gaagtattat atacatgagt ctgatctcca tgaaaatgtc ttgtaatggg cacaatcaaa aatgccatat tacataattc atacacatga taaactttgt atgtcagaaa gaaaaaagca cttatgtttg aattatgtaa aaccaaaaaa aaatggttag tgtacctaat 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 121 3001

DNA

Homo Sapiens allele 1501 99-15258-337 :polymorphic base G or T misc Tbinding 1481. .1500 99-15258-337 .misl, misc_binding 1502. .1520 99-15258-337 .mis2, complement primer Ibind 1165. .1183 upstream amplification primer primer Tbind 1685. .1705 downstream amplification primer, complement W0005851 0[ rhtotwww~getthepa tent.co mLg in.d og/Sexam. su portFetch/Defaut. d ogAN000585 0.cpc?fro mC ache= 1 part= maintool ba r--bottom].Page 586 of 73 7 WO 00/58510 PCTIIBOO/00435 <220> <221> misc -binding <222> 1489. .1513 <223> 99-15258-337 probe <400> 121 ttataatggg ttt cat cttt tgacttagat cgtacagctg ttttgtcaga tccattgatc tattataagt tatgcttttt aaattcaata gagagggagg agggacagaa aaggcagqta atactaagag agagtataca ggcat cagct gtcattttgt ggt gct ccat tcacaagctc ccatgaggaa at ttccagca tgagctgcta cctgtgtggg gaaatcttat gtaatatatt atttcaagca kgcctatgtg tgcctagtta ttatctgcaa atttccactc ttggttttct ctaatgtatt agcattgttg acatctaatg catgtcgcaa atccagaaat tgtcttttta tcagccaaaa attctgactt ttaaatgaca ctctgtccac agtgtgtgct aaaaatttgc atagtatgta caaagtctat aatgtcatgt taggtagtaa ggaagaactt acatataacc atcatacagt atcagtttgg a attgctgggc tgcattttat tctttttatt ctgcagatcc gatgtattga tatttgtaca attgagtctt atatagcatg tgatagaagg caaatggcca agctgaagcc gttct t tgt t atagaaagta aaagaaagaa cccttcttac caagttctgg caagccacta cagttacaga gacagacaag accattgagg atagat cagt ccttagggaa gaaagattaa ccatgtgact gggttctgaa aaatcacaaa gaaaaagagc taagttggta taccatgtga tatacataaa taaagaaatt ttaatcatct aatataaaat ttgcacagaa cctttccaat ttacttgcag caagatcctt acacacatct tttatttagc tcagttcatt tgattatttg aaacaatatc tctaaagaag ctaaattggt agatataagg gtgttacagt gttactttgt cagaagagct tttcagacca aaatat tcca caaatggtat ggccgatttt tgttttttct atttgttgac ctatattttt ttctttcacc gaagttagtg gaggaaaaaa tgagtgaaga accctcaatt tagagaccaa gttgctattg gaccttaagg agaacctagg cattttttgc attttcttct gagggaattc ggtCtcctgc tacaatatag tttccagtaa aaataggatt atacaaaatt attaaaaaaa gaaatactag agattctaca aacagaaatc gtgaagggat gagcaaaatt aattttgcaa atgcagttag agaataatgc ctaaccttca gttgcatcaa ttcttcaatg ttggtttttg ttaagttgaa cttctctccc cctcattgag atagcttctt ttttagataa tcagt ccatg ttcttttcct atttttgaaa gtttcttcac agaagagtat agatgcatgg ggaataagac gtggttttat caagaaagac aatcatcaga ttctagttct gagttaattc ttgttgttgt atctatcttt gtgtgtctgt aatactacac tcagaactcc tacttaatat ataaaggaaa aggagatatt aggaaagaag tttgcagaca aaatgagaga aagtccactg ctcatgaaca ctgcatttac cttttcttct attcttcagg ctctgtgatt agaaggactt tattaaacac tacaaactga tataaatggg ggaaaattta ggatgaagga aataaggcat cagttaacac aagcacttcc ctatgagcaa taataactaa t tgcagt at t gcctgggatc aatgactgtt gctctctaat ccaagttttc ctgcaggcat ttcctttgcc gtgagcagtt tcaccagaat gtatgcacct atccattcta tatcttcaaa gactaactaa atctgactgt gtgtgtaaat caatggagta tttttttttt gtttaagaaa tgattgagta ttgtgggtaa agatccttga ttgtgaagca tgttgctttt actgcatggt ttctggcc tctcttgatt aagtttgttt aaaaatataa aatggaagcc tagatgtgaa gcaatttaat agggagt gca aaaaatggta actttctcca gttagttttg tgaatatggt gcaagccct t atttgtattc ctttccaata aggaaatatt agctgtattc tgtgattttc ggcaactcaa gaagtagaat agaattgccc gtatggaagt aaacaagaag cagtatactg gctatttaat ctcatgaatg ataaatgttc ttctacatac ctaaaattaa accatcaatc tagtttcatc tacaaattac catcagagac ccccatcatt gtagagttga gcactgaagt tgcatgacac aggaagatgc aaaaaat aat atatgtggaa aattttactg tttttcatct taattctaat gtagagaatc acattatcaa gctgttcagt ggaatgggag tgtaaagtct tgcatgtgga attgtcttta tct at tctgt attgtccctt gttgtattgt atagtgactg gtgacaggta gatcttacag tatcctgctg aagttaataa gaggaaaggc aaagataaga tccttattca ggaaactgct cctcccctta tggtcatgct tcttctcatt ttttgaatca aggactctga ttaccagtaa tcacataaaa ttaagtgaga atatgccaat acagagtgat agtttaatgc atagacgtta attctgtaac attaaatggg agtaaatatt attcttactc acggttttct ctagaatgtt gtataatagt ttgcatatag tgtatttata ttaaatttag aggctttctt cat tgaaa tt tgtggatatc aggttgaaac aacaaatgtt taccttcaat taaatcatat gaagaatctg ttgattagat cagaagagaa atataccaac aacatcattc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> 122 <211> 3001 <212> DNA <213> Homo Sapiens W0005851 0 [http:lwww.qetthepatent.com[Logindog/Sexam.support/Fetch/DefautdogNVO00585 1 .cpc?fromCar-he= 1part~maintoolbar--botom]a Pae 587 of 737 WO 00/58510 PCT/IBOO/00435 <220> <221> <222> <223> <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-15261-202 :polymorphic base A or G misc -binding 1482. .1500 99-15261-202 .misl misc -binding 1502. .1521 99-15261-202 .mis2, complement primer Ibind 1302. .1320 upstream amplification primer primer Ibind 1782. .1802 downstream amplification primer, misc -binding 1489. .1513 99-15261-202 probe complement <400> 122 tgtatgtcaa tttgtattca aatcactaag ccagaaacag gtgtaactgt ctttcccatt gccaaaatat gtattactgt atagcaatag atgatattct acctactgtg aattatttaa gtcgcatttc ctgaagatgg tatgagtaat taatgccaaa taaaataata tggctcatct atttccaagg caactgcggc taagttttat tttatttgtt acttatttta aaggtgcttt atataagcgc rcctctttgc gaaatttatt gaggtacccg t gt ttt t tga caaatttacc tactaatgtc aaagaaatct gtgaaatatg ttaaaatacc caatgtgaaa attttgacag caaatgcatg agcttatatt ttctcctggg ctgataaata taataagaac caacatatat tttgaaatgt ttggttagct tctagtcttc tctctttctt ccagttttaa gatatggtta attatttttt ctgttccaca cagctccccg tgtcattggg actacatcac ggtttcttca tttcattcct taatatggtt tatacgttca tctctttttt ttcattcttt tgatgtccaa aaggttaaga acacatcaag tgcttctcct tgtctttggc ggattctgct aagaaagcct atataagcag agttctgact tacaattatg tttaacttat aaatacttcc ggccttttca attttagtgt tctactgctt tccagtcatt atataaacgg atacctataa catgtcttca agcacatttt tctactgtgg gtgtccccaa aggcatcgac acacggctga ggccactctg ttcatttctt ataataaata cattttatcc atcatactcc cat tccat ct tatagctggt tatgtactga ataagtgttt aaatctcatt cagatactta tgtaagcaaa agtggaaaac tgatttaatt tgagtatgat atgaattacc tttaagagaa aaataattca ataagttggg attatgtaat ttgataaatc aacatattct atctcttact atccagaata atcagtcatt agctgcagaa agcagcaggt actgaaaggt tataacagac atctgtactt tggggtggct ttagtgctgg agggaggccc tttccagaaa tttcactatt cttttttcta tgatagtgtt cctttggtta tcactcaaaa ataaaattta atattaattg cagaaagtaa ccaagttgtt tgtatatct a ccatggaggg tttgagattc tgcttgcaag tattaaatct ccatattatt caatgttctt tttttttttc ttaattgtta aaatttacag ctgcttaaag tccacggcat gcattcctaa t caa caa ta c tgatctcccg gccagtgaat ttcctatttg caccccaaca tgtgtagggc tggcagggac ctggcagtgt ctggattttt cactggcagc tcttctaatc aattccattt atttctttct tctttccatt tgtcttactt aaaatacttt ttggggtttt gttgtttaaa tggtagacat tatttacccc t tt accggt t aatgcgataa atatgttaga aataatttcc actttgccta tcaaatgcag cgtaaacgaa catttacatt agacaaatgt cact cacaag cttcatttgg aaagaaatac atatatccaa ccttggccca ggatatctgg ttttaataaa tttagtgact ttggcaggaa cggcattttc gttgagatct tacagttaaa taagctgcat ctttgtttcc tattatactt tagtcttctt tcttcaccga tgccattttt atcatggtgg tttgtttgtg a at tct gga c tagcagtatt tgttactagg tctctctgta 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 W0005851 0[htto:/twww.g etthe patent. co m/Logindog/Sexam.supportFetch/efault.doiWO005 8 Sl 0.cpc?fromCache=l1part=maintoolbar--boftom Page 88of73 WO 00/58510 PCTIiBOO/00435 CCCttgttgc agaggtatct tctgtgtaca tttactgtat tgaccattaa tttcattgat tttcctgtct ttaatccttt aatctatgct tttccatgct gcattgatat acacaggttg acttttttta ttttatggga actactatca ctaaaaagtt gtacttaaga tttgtatatt t aatgatatgg ggct tgcgga tgggaaataa catgattaat gaattccatg ctacgaaaac ctattcctat tcatctttgt tggttaaaga ccccctgatt tttgggaaac gtgatgactt atcttagtga atagcagctt taaactaaaa tatcctacat ctgtgagtac tgagagcatc taagcagagt gaacagctgc acttttattg agagatgggt tgactatgag atgaaaagct ctctttaatt tatttatatt cggagaagag atggtaccaa aattatttgt gccaatatat tttcctaaat tatcaactaa atattaatat aagaagtgct tttttaaata tgataaatta 287 tgtgataaat tttgccatat tattatgtct taataatttt aatttgcaat ataatcttta gatattccag tcttcaaact gaatagaggt agttgcagca tctgccttct ttctgctgta ttcctgttgt aatataagaa aagctattaa tagagcaaag act caaaagc aaaagtatca tggtttggtc ggtctgagac atgagaatgt tatactattt acagtgccac gaattagtac gctctcatga aaaggctgta gagtctgact cgtctttcaa tcctgcccag gttaaattaa tacaattttg agttaaatga acaaagggca atacaattat tgacacagtt ttatatgtta aaacaaaatt ccacagcagt gggtttgttt ctttttcctt tctcctttgc atccagaact gtccttgcag ttcaatggca tgggagatcc cagctccttt t ga tata tt t tttatctcta aatatgtgat agagcagcta gaaacatcta aaataagaag gagcaactca aatatgtaga 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 123 3001

DNA

Homo Sapiens allele 1501 99-15280-432 polymorphic base C or T misc binding 1481. .1500 99-15280-4 32 .misl, misc binding 1502. .1520 99-15280-4 32 .mis2, complement primer -bind 1070. .1087 upstream amplification primer primer Ibind 1590. .1610 downstream amplification primer, complement misc Tbinding 1489. .1513 99-15280-432 probe misc feature 170,2 706. .2707,2715. .2716 n=a, g, c or t <400> 123 ctagatgcat gacagatatt accctttatc accttgtaaa caaatacggt tgcccttgct agataacact aatatgttta agatcttcca gctaattctt ggtgcttctg ggcaccttgt 120 W0005851 0 httpJMww.getthepatent.comILogin.dogl$exam.supportIFetchIDefaut.dogNV0005851 0.cpc?fromCache~lp 1 atmaintoolbar-botom Page 589 of 737 WO 00/58510 PCTIBOO/00435 cttcatctcc attatagttt taaatgacaa gatctttgtc aaagtqttta catgctttgc cttgtttctg cacagtggtc tggctaagac ttatttcagg ttcctctggc aatgccctgg attcgcagcc tgacagggta tctcttcctc ccaaataaac tcttgcccag cctattgctt ctcagagcat ttaatgtctc catattttcc aatttctctg ttatttctcc yagtggtact aatcatctgt aactacttaa gattgacatc gaggccctaa aataggtatt tttagtttta ccaactatct tttgtagtac cctgaagtgt aaaaaatgtg gatataaaga aaatagagac tcacttgtat caaagacttt aactttttca ttgaccttag attagataag tggcatttaa caatcatcac ggagcnnttt ggagtgcagt agcgattctc gctaagtttt aaactcctga g atagtgggaa tcacacttat ctgcattctt ctacactgaa taatatttct tcacccagat ctcttgtcac tgtaaaaatg aaaatgttgc ccct acaggt tctaggaaca gagcatccat ctcaggtcaa taattctagt tccctgtctc tacttagcct agagagtttc tcctctgtta ggacacttgc ctccctgagc ttcatagcct tccccccact agcctccata tggttatagc ttgaggctag ttcagattca ataatgagat tacagaattc ttatatttcc tcagttttct tggcaatatt atactttaac aggatgttga gtcttcgatg aattataaaa tcaaattgta agatatacaa gtagataatt aaaaatgtta aagctcatct tttcttcatg gtatttgcaa ttagtctcag ttttnntttt ggcacgatct ctgattcaac ttgtggtttt tctcaagcaa tagt a atatt t tcct cat aa ccatttcctt cgactaatct acttctcacc gacagaacta cacatcctgc cacatccatt cagtgccccc aactgctat t atactggatg caaccatgga gacactctga tgCtctgggc actttaccac ctaatccttg tacaacactt cattgtattc tgctctttct caatcttctc ttaacaccat aaatataaac cttttaagaa acccctagca gaattcccag gtgcagtgaa tgacatcata aaaggtaaaa cacatggaaa tttttattca acactgactt aaatacgttt cat tgtt tt g aattctaaag acttaagtta tgtgtgttta atgtatatga ctggttgttt ttcacattgg ttctgaaata ctggtctaaa gagtacttgc attctgcaaa tttttttttt tggctcatgg ctcctgtagc aatggagacc tctgcctgcc tgcattgcag aagcttatcc ggattaaaac attgacaaat act at tacag attccttgtt ccatacacaa cttgccactt ttctcttttc ctaaacacct agtagttaag cagaagaaag agtatgtgat aacctgctta tttagtcctg tctcagacat cct ctgcaag ccctcactgt gtgtcatgat cacccccaca ttgaaatgat ttcaggatgg aataaatttt aaagaataca agagggaaac gatgaaaacc atgagattaa ttgctcaaca tctagaagta aggaaaacat ataatttaaa tcaaattttt agtatgttga tgacatactg ttaggttgat ctctttgcat ggt t tcat aa gctcagcaaa ctaaaatatc gttctatttt gagttcttct ccctgttctt aattatgaag ttaatatagt caacctttgc t ggga t taca aggtgtcacc tcgccctccc gagcattttn tgcactcttt cct tagagac ctttttagct ctattgtgtt agttttacca tcagttacca ctgtgctcca actccctctc gtagctcctt gtagaagtac tggtggataa gtatcatccc tgaatgaact gtatttgcta tgcttcaaga ccctttccct ttcttccaac gctgctcact acttacgcac atatatttga caagaatgta ggttgtataa aaaaaaggga aaggagtaat agctttcacc gtcccttcac caaaacctgg agatcacaga ggtaaaaagt taatatgtca ctaagagtca tggcatccta tagttaaata ataaattgat agactgaatt aatcctcatt gaaatgtttg taagccaaag gtctaattac agcctgctgg tactcatcag caaatactag ctccctttgt ctcctgggtt ggtgtgcgct attttggcca aaagtgctag aaggctcgag ctcatttcag aactttaata ctaccttcat agtttaaggc actttaactc tcctcataga aaccccccaa t caacactcc tcctagggat agaaatattc gtattccagt caaagggtcc ctgtatttgt gaatattctc t gt ccat cca acttgcctca atcttcccac tgtccctttc acttacatgt ttgcttttaa gtccattatc gccatccagt gaatgtttgc cgtggaactc taagtaagga tccagaaagt gtgtgttaag aactattctt atactctcaa gtgtgtttct ttttgaatga ttgcataaaa taaaagcaaa tagtaaactt ctaatcctaa ctcatgacta attcgggaaa tgttctgcac ctcctgttac tat tt gca ca tttgcaatgt ttagtttttt cacccaggct caagtgttca accatgccgg ggctggtCtc gattgaagac 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> 124 3001

DNA

Homo Sapiens allele 1501 99-15355-150 :polymorphic base C or T misc binding 1482. .1500 W0005851 0 httpJtwww.getthepatent.com/Lo i n.d og/Sexa m.su porttFetch/efa ult. d oiWO05851 0. cpc?tro mCarhe= 1 part= ma intoolba r--bofto m) Page 590 of 737 WO 00/58510 PCTIiBOOIOO435 <223> 99-15355-150.misl <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc_binding 1502. .1521 99-15355-150.mis2, complement primer Ibind 1352. .1369 upstream amplification primer primer Ibind 1822. .1840 downstream amplification primer, complement misc Tbinding 1489. .1513 99-15355-150 probe <400> 124 attttggtat aaaatgtttc attttatttg tgttaaataa attccggaaa tgccttcaag gtgtgtgatg tgggttctct atgtagggtt tttgttcact tgagaatagg aggatggaat tcttgttagg ctctgcctta ctaaatctcc atgtgtattc agaacttcct tcatgtactc catcactagt tagtaattaa ttcagtcaat attgactttt ttcctgattt tatgtcaata cccacctcca ygat gtgtca ttggttatat aacctcttaa tcaatgattt tcccctactc taggctttgt ttaagtgtaa atataccgta tccaaagcta caat gagctg tcattccttt catggaattc atgctattca taacataaaa tatttcaagt ttctcttaag taccaagatt aaaaaatagt aagtttgcca accaagtttg acagacctat gacacatatt aattaataaa aaggaaaact cggaatgaga tgtgaagact tgccaaggtc gcagagggct gtaaggatat cttgctccat catttgattg ggt at cttgg actgcataac acatttcatg acaagagaca agatgctttc catgccaggc caaaatatga atgactgaaa tctctttcct gacaggccta gatatagtct cagtggttgt ccatttttca ttcacctaaa tgcct tga ct ttcattattt aaataatttt cctatttgca a aat acatt t tctaccagtg attcttatga agttatcagg ttatgtgaag acatagtaca tcataccact agagtctgag aagggtaaaa aatcaattaa gtttgatata tgttatcacg agattctaag ttcaatactg attataggtg aagaaaaaaa tgaaattcca ctgcctactt gtaattacat attagaccac gtctgcctta ttatatcttt ttcaataggt aagaaagttg atgtggaatg attgaccaaa aagttgtgag tcatatttag taccattctt t t tgtt tct g aatttatctt gtaatcattt tctaagtttt gttttgaatt taaaccttaa ttcatgcagc caaaatgaaa tttatctttt ccagaggcaa gatattcttg agggaaaata ttgtaccatt ttcatcatgc agattgcaaa aggtcagttg ctttaacgtt taaagtataa ctgcactgca ctggattgtc taataactgt ttctcttaaa gaaacattct tcaggatgtg t t cta ca aga aaagccaaaa catgaagtga actcagtatc tttcattatt cttcacagcc atcacagttt gttgaaatag tgctaactag aaaatgcata agaaatcaaa ttacctatcc agtcaaatac aagtcagtca tttaaataat caatgtggta ttaacttctc ccatctttaa cttcatcttc ctggatctgc tgttcttgcc tttcattaca ttcaaaattt atttattctc a aat cttat c tttcaaaatg tactaatgta actatttgat ctcctgagtc gcaaaaagaa ccaaatgatg ttcaagatgt cataactgtt gataaccggc aaaatatcac taattattat tgactgagtt gtcataggag cacacacatg aaaatccttg ggatgagatg atgcctatgg atagaattaa atgttacatg ttcaaaagga gaaaggtaag acatcttgcc ttctatttag cgactattta aatttatgac tctctaagcc aatgatttat tttttaatat ttaaaataac attcatatta cgtctctcct actgcctatt tactttgggc tagcacttct tgtaaaatgg aacttcctca ct gta ga tt a tcatcattat tcccaacaat ggtagaggaa tgttccagag gtagcctttt tctaagtaag atatgtagta ccaaaacctt ttatgtttga tcttttctat tgataaccag tgaattgtaa tgctttctct gcatagtaat ttaagctatt ccgtactcat cttgtgttct aagggtttta gcagtaagga aaaagggaca agaaaaaaaa cttaggatat ccatacatca act actt ca c ttaaacttat tttggaatgt tcacacacta cccaactttg gta act t cta atgaaggact agtaaacacc attgtacagg atgattcatt tcttagccca ccagccccct aaaaggaaat ctgtgtgtcc ggataataaa ttcaaaatct ttgagacaag caacaactac gtctcttaag aacttcctgc cactggaagg gctcattatg agtgattgac tttatttact actttctaga caaccatata gaaacatgcc ctctcaacac 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 W0005851 0 [http:/Mww.getthepatent.comfLogin.dog/Sexam.suportFetchDefaut.dogO SBl0ccfmahe1 part=maintoolbar--bottom] Page 591 of 737 WO 00/58510 PCTIEBOO/00435 at acaa cct a atcacattac aagaactaga agattggtcc gctacttcat ccatgggaac ggggatggaa atagtctgaa ctgtctctga agtacttaac t atgattgaat aaccatcagt attcggagca atctctgaga tgtggacctg acaccacttt cccaagtcta ggtaatttta atttatatgc agttaaaaat taaaccatag atttgggtga ttcaaatgat aatgtcaaga aatctattta caatttttga aacagaaaat gataatattt tacacataag tgacatacca 290 tgtatatttt acagcttcag actagagaaa tttaagaaga cccagggtca aatatttgca caatgtatgt ttaatatttt caatcatttt ttcatgcaat tctaaatgta cat ccattag agacatgaag gccgcaattt aat caaggat aatacatgat ttcgtatcta gtttgacacc attataccta aaaaaataat ttcttaatta tttttgagca actgtttatg caaaaccagg ttggaacaga gagatatctt ccttatagac aacattattc ttcacatgta atgctgaagg 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 125 1887

DNA

Homo Sapiens allele 1126 99-25224-18 9 :polymorphic base A or G misc binding .1107. .1125 99-25224-189 .misl misc -binding 1127. .1146 99-25224-18 9.mis2, complement primer -bind 937. .955 upstream amplification primer primer bind 1446. .1466 downstream amplification primer, complement misc -binding 1114. .1138 99-25224-189 probe misc feature 1114, 1877 n=a, g, c or t <400> 125 aaattatttt ataattgttt taaaaagaaa ctagcttctt ggctatttca aagaagctac ttagaaaaca ttttatgctt aaattttgaa cataagcaag gaatgcctga aataaaaaga aacattccaa attacgtata tttttattta ctatcaatca caacatgaac ttatttatca gccagttctt ccaaaactaa atggacatgc agatacttta atatgatctt gactgattag tgcctattcc ctcagaaccc tggattttac agaccactga caatagacaa aatcatatac tattcaaatg aaacagtact acaaatggta aacgttcaga tactcttact aaagttacct tgaaacttca ggaaattctg aaatttgtct tcttctttta ttttgagcat tgtaagctct gagcagcttt tgtttctcag ctaaaaacat aagtactttt aaatgcaatg agcaaaacca caactacacg ttctcagtaa cttgccattt cttgagaagg ctttgaaaca aaatagaatg atccaagaaa actttagggc tatttactat ggctcttaaa aaaaattaat taatattaaa W0005851 0 http l/www.g etthe patent. co mI~ogin A og/$exa m.suportFetch/efaut.d qq V0005851 0.cpc?fromCache=l1part=maintoolbar--bottom] Page 592 of 737 WO 00/58510 PCTJIBOOIOO435 taaatttact gctttgattt aaacagtcca ttcactgttt agtgttgtgt tcagcctctg cttttatttt gctcgagtga acacccagcc catcaagaat aaaatgctaa ttcaatagaa cagtattgaa tttcctggtt tgagtcttgg atcatgagcc aaagctcaca cctatgggaa ctccagacac ctcccagaat gaggtcatta tgccccgcga catgcagctg gcaagcgaag ttcagactgt tcacagctca gagtagctgg tgtagaaacg tccttccatc aaaaccatgt caacacagtg gtttagtgcc atgaacaaat ggacttaatt a aga tct att ggacatcata taaaggtatg ttcatcctgg agttgtaaaa ttgtcggtgg ctgttaatgt gggtgggcgc cgaggacaca caaatcaaga atgccactct tctcctncag cttcagcctc gact at aggc tggtctcact tcagcctccc tttattatga ttctgaataa tgttagaaat gaaataaaaa attctagtag tttttcactt gttctatgaa tatagataac ttgctccata gcacacacgg tagaattgtg gaccttattt taatccagtg caggagaatg gatgtcaccg acaggtttca cactgtt aacctcctgg gtgtgccacc atgttgtccg aaagcacttt acaaatcaga gattgtatgc cctaagattt ttcnttgact aatttcaggc tacgatccca a aggga tat a ccaatccctc tgtgtgccca tgtttgctgg tccccccagc ggaaataagg tgactggtgt ccaagtgaca attgcctgat gaggaagcat catcacccag gttcacacag atgccccaat ggctgatctc gattatagga taatccaagt aattcttttt ttagagggat taaggrtttt attgtttatg attattatat agaagatagt cacttacttt ctcagacagg atcataggag aaaatatgtt ccttcacaga ctgatataag acagtggtat acctccaaag ggtcctgaca gctggactgc tcctcccact aatcttttta aaactcctag atgagccatc ttaccaacct gaacatttgg atctgatagt gaaa cat gca tgttctgttg ggtaagcttt ttctaccttt agacctgcca tacatgctca ctccacatcc gaggtcctaa tgattaagat.

gagaggagaa aaattggagt tcaggaggag ccaccttgat 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1887 <210> <211> <212> <213> 126 3001

DNA

Homo Sapiens <220> <221> allele <222> 1501 <223> 99-25950-121 :polymorphic base G or C <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> misc binding 1482. .1500 99-25950-121 .misl misc binding 1502. .1521 99-25950-121 .mis2, complement primer bind 1381. .1399 upstream amplification primer primer Ibind 1859. .1879 downstream amplification primer, complement <221> misc binding <222> 1489. .1513 <223> 99-25950-121 probe <400> 126 ccatcccatc ttcatttatt tcagagtaaa gttatctaaa tgaacctatt ttctaattaa gaatttcttt tatggccagt aaattacttt caagatttgc cctgtaactc tgcagaatgc caccagcata ctatgtcttg aggataatag agaaaatttc tatattcata aaagaatgtt ttctgtccag aattgctttt gattaatatg aggctgcatt actgacactg cctttttctg W0005851 0 http://ww.getteatent.com/Lo indog/Sexam.su portFetchDefault.dog/WO005 8 51 0.cpc?fromCache=l1part=maintoolbar--botomI Page 593 of 737 WO 00/58510 PCT/IBOO/00435 ggaaagaacc atggcattcg gctacgtttg tgccagaacg cacttttgaa agcatgaatg cagggacagg ctctgggagc t gtgt ttat t cataaagtgt ctggactgat gagaaatcga aaagctattc atggcattaa tttcctttca gcacaaagta gttcaggtaa a ga ta ca aat agaatcgtaa ctaccaaatc accagaatta stgtagaaat ttgttgtgtt tattgtaagt attgggaaaa ttcaactctt aatttcccct taaatctcac atggagcttg tcttctcttg ttccaaatca atatgaatta atcaactctg tgtagatatt tggccaatat catagcaata catttctcag t tt agat gt g ctCt t gga ca tgtattaaac tcacagaaaa t gaCa a aact ggctatatta aggaaagagg atcatggcag tggggaaaag ctgagtgtat ttagctttga catgagataa gtaatgctgg cgtgtctgtc atctaaattg cggccggata tagaggggag gggggCt tgt gtaattattt ttttgaaaaa ctagcagttg ttaaatatga gaaaggtgga cccttctcca at gact ggag attctaactc tgcagtattt agctttcaaa atcaactacc tcacagagtc cttccttatg agaagtggct atcacatata agaatatagt ataggacaaa agatctcaga tctcagcaat aaggtggtgt ctttttttct tagctaagtt agcaactata aactatgaac atcacacttt agcaaaggac tatctcacat agatcaattg tttgtaaaga cacacttgca atctatgata accctaccat caggaaaaga ttcattctca tttaatgatt aacatgtcct ccccttataa tttatctaag ctctaatggc tgacggctca gcgtgtactt aaagtagctg aaagaagcat atgaagcaaa cttcgccatc gatcccctct atttttacaa tcaaaaaact tgaattgttt tgcctagaga aagaatgaaa gtatggagag gaggtttctc agaagatgtg gaattttgta tattaaagga aaatacctca taaagttatt gattcaatat atctattgtt atccaggata ctgcaaatac ttcagaactc cagatgctga tacactactt cat at tga gt tagttgagta at ttat tt gc ttttatttaa tttgcattca tatagatgag aaatcaagaa ct tgt taa tt cacatatatt agatgttagt aattccataa tgccgggttc gtaggtgaat gaatcaaaat tcctgctaat cacagttctg t ct tca cat g aaccatcagg 292 tgccattatt tgtaaaagct ttgcaggcca agggcttttc gtagaatcaa attgagaggg ggcacccagt atttgtcttc tcttttttca ttctgcatta gctttttctg cagttcatat ggggtttggt ggttgctagg gtgaggtttg agtagaagcc agttttcagt taaagataat ctataaaatt gtgcattttc tcacacttaa tttgggaaag actttgtaat ttttcctttg aaacattgaa aactaaatga gatctgtttt gaagaatgta gtaggcacgc aaaataggtt atagcatcgg aataataata aagacacaga aaaattgagg tttgaaccca gtagtactga taaatattca ttttcttgtg atcatcacta agagaaagtt atgttatttt gatttttcta a a aga cata c catggctggg qcagcagcaa tctcctgaga gttctggaaa atgggaatgt gctttcatga ctctcgaagg tgaaaatagc ctggaaccca ggcacagctg catttgcaca accacccagg tccagataat cattgttcaa cctacgtagc agatggggag aatttaatag gactgtagac aaggaagacc caagattgac acatagggtc aaattatatg tagcattaac ttttgtagaa aagcctcagt aaattatctt gaagaggcaa aaatgtgacc aattctttat gtagcattca ccataagaag aacaatataa agtgggcatc atcatttttt gtaactacca tcaggtcatg cccgaagagt gtcctttaga t aaga ttt ca aaataaaaat ggatctctac gataataaaa atttttatgt cagcagcagc gagttataca catgactggg gaggcctcag ggagaagtgc actcattcac taagatagca aggactttgt acttcatttg ct cca cat at cttggcctcc gtcacaaatt tgtcgcatgc cccagagagc ggcatctgct attttgaaat aattgacttt tagaagttat tcaatgcaca gcttaaatac gaacaggtaa tggtgccagg ctgttgctca ttttcactga ccattattta tttatttagt ataaatagat gatggatatt aaagggtgtt acccagttaa tctgcccctt attgttaaaa cccacgtacc agcaaactta gtgatccttt atctcagata ataatatctg tttatcaagt gagtttttga ctaagtaact tcctggtgtc gttattacag tctaaatgtc agtttcagtg ctagcta aag attgtttaat atcttatcaa gcaagatagt taatttatga gacacttaca agagtgaagg tatcacgaga 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> 127 3001

DNA

Homo Sapiens allele 1501 99-25961-376 polymorphic base T or G misc binding 1502. .1520 99-25961-376.misl, complement W0005851 0 [http:/hvww.getth~epatent-com/Login.dog/Sexam.supporVlFetch/DoefaultdoqNVO005851 0.cpc?fromCache= 1 part=maintoolbar--bottom] Page 594 of 737 WO 00/58510 <220> <221> misc -binding <222> 1481. .1500 <223> 99-25961-376.mis2, PCTflIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer bind 1854. .1873 upstream amplification primer, complement primer -bind 1391. .1411 downstream amplification primer misc -binding 1489. .1513 99-25961-376 probe <400> 127 ctagacgatg attctggtcc gat taaatga cccttttcct aa agct tga c tttggcagac gaaaataata aaaaagggca taagtcatat aaaatataat tctgatacct aaaagccaga gccacatggc ttattttgaa taaatttaat ataaacccta agtagaaatg ttttttttct taaattcttc ttctcccaaa aaacctacaa ttacttctta tcacactgac cagattttca ccacattcaa kccccgtccc ctaagctctg aaggaaacca atagtttcat ctt ccagacc ctccttttcc ttcacagggg atgaattaga catttttttt cagaaagcca ttttctttat aaataaaaga cccagctctc gaaaccattg ccaagtattt atactaaaag acaaatatac agaatctgga tcaagtcttc gctaatgttt tttgtctttt ttgattgtgt aaataaacag ttcagtaatg agtaacacat tagactccaa tgcttttcat gaaatttcct atcaaggttg aactgacaag cagcaaacat gcaatttcca aatttaatta gatgagttct tttctttttt gaatgtttgc agaggtgggg ctttgcctaa tagttcttcc atttatggca agccctcagt gggtttacaa aggagccaca ggattcaagc ttttcacttg ggacaattat ttggtgaggc aactgtggag agagaaagga aagctatttt tccctccagc tctctaaaat gttctctata aaaataaaac aagagcctct ctagaagcca cctgaacaat acaaggtgtc aatgtaatat atttaggatt aattggaaaa gtagtatgct cacttccagt tttcctaatt ttgatgattg t ggt t taaga gttgatatct cattaggtat agggagaatt gtcttcggta atctcagagg tggtgttgca ttatttcagt ttcaattttt atgtatgtat gtaaaagtc gaagtaaaag ctgcacattt aatgtgctgg tacttcattt cattttgtga aataacgaaa t taacagaag tgatcgtctt ccaatcctat aaagcaagag gggaggtggt ttgaagaaag aggcagaacc gagaatgtag agacattcaa tctttaactt aagagctcaa aataagaaga gtctcttcag a aca t tt tca agaaaaggtc aacagagact ttttaggggc aaggagaggt acgagaaaca tgcaatgaag ccgatacagc aaaagtcatg cat at gca gc tctagttctg gttgactatt aagtatgcaa agagatatat tggtaggaat gttatgtgag cctttcctac ccaggcagtc acattctatg caattgactt ctaaagtaca atctttactt gtgttgcttt tagcattttg taaaaagaat ccagtttccc atgtttcctt acgtttttaa ttccttttaa ctaatctcac ccagagtttg tcctactgca acttggggaa aaggggaaga aatggaaggg ct ctgagt cc aacataattt ctaataaagg cctcctccat cattgtatta atctggaaaa aactgcattt ttggatgatt aaggaggtct ctggtgacgc cacactcagt cctgaaaaaa gagccatagg gacttgacag a atgt ttt cc cacagcacct tcaagccacg tggcacaaaa gct tgctcta aagtcattgt aaatagaggc ttttaaaaaa ctcatgtggg tattttcctt ctcacctgag caatgggtga taattaaatt atacggattt aattaaaata tggaacaagt gcaaaaataa tccaggcatg gttatcatta atttatgact aagttcatag a actca ttag agtgacctgc aga ta taa gt tagtttattt aggcttctca ccatcaggct aaagaaggca aggggtgtgt caaattcata aattatgttt agtaacttcc gatagaaata caagctggta tttaaaaagt atgtattcaa aaatgctcag aagtgatctt gctagatcct tacctggtct tgagacacac t gat tta at c ttttatgaca cacgatcacc tttttctcta gtggtggaca cagctaagtt a ga a aact ga aagtgaagct gaaatctcag ctgcttgata tcttcaaaag ttgggcacca attatgaaat taatgtcaat ttaaaatgat tcatttttta ttttggagtt aaataacccc gcaaagcaca ctgggctgtg cataaatggt catcatctga gtgagaaaca catgcccctg tgtctgtgta tctcggaaat caaattcaac ccaactgcat gaaagtgacc ct gtct t tcc catgttccca tcacaatgag aaaatggaat atgtaagtat gagtagttat gcaaatctca t ct taa a aat tagaatggaa aggagattct gggga tgcaa attatgactg atgtagagaa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 W0005851 0[hittp:1twww. etthepa tent. com[L.og in. do /$exam. sup portFetch/Defa utd ogWO005851 0cpc?fro mC a che= 1 part= m aintooIba r--bottom] Page595 of 737 WO 00/58510 PCTJIBOOIOO435 gtcttgactt tttaatgctg tttacagaag ggttagacta attagctcct tgagaaaact ggagcacaga taaaaaagct c acgtgcaatt cgcagtccac gctcagtaac ttaacagctg ttactcttac gatacacaaa tggacttatt ggaagttact ctaactatag acagacaagt actgacccat acttttacat aagctatatg gaaactaaat aactactact tgagcccttc 294 aacaaaggag tgaggttttc tttttttttc ggaatttact ataaattcat agcgtcacat ctatggtatt atttatgtcc ccgtagtcac atttagtgac tgcagatgat gttctaagca tttattaacc aaagtgacct ttgattcctc tacacaaaaa ttttaaggat acttccttta tcttaatgct cattacttgt attttaaaaa ggccaggttt aataacttct ataaatgtgc 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 128 3001

DNA

Homo Sapiens allele 1501 99-25965-399 :polymorphic base T or C misc Tbinding 1502. .1520 99-25965-399.misl, misc -binding 1481. .1500 99-25965-399.mis2, complement primer -bind 1879. .1899 upstream amplification primer, complement primer rbind 14 29. .1i44 9 downstream amplification primer misc -binding 1489. .1513 99-25965-399 probe <400> 128 ttatttcact tattcttttc tgattcattg agagagtaca gtgggattga cttttcctga atcctcacca ggtatctcac atctagctgt ca ct t tgta a tataaatccc tctttgttgt ttttacaatc gtcccataac taagcctttc cacttttctg cccactgtat tagcacagtg atggctgaat atgaacagtt tacatctctt tgaattatgt tggctgcagt gtattcattt tgtggttgtg tggccatttg ttagattgtt ttgttaaata gtcctttgcc gttgcctgtg atttccccag atctattttg cat atgaat a atcctcagca acctacagtt aatattccat aggttgattc caaaatacta tagatttatt acttcacatt tttgtctttt gtttgcattt tatgtcttct ttttgctgct aaacagttca atgcagaagc ctgttgatgt tgttttcttc aatcattttt tccagttttc cctttgtcaa tcatccatgt tgtgtatatg catatcttga atttcctttc ttttgttttt tccaccaact tgatactagt ccatgactcg tttgagaaat gagcactttg caaacatttt t tt ttgga tt cttatcccag tagt agt tt c tgtatatggt ccagcaccat aaatgaatag tgctacaaat tacacatttt caattgtgaa ttcagaattt tttgaggaac gtgtaaaatc cattctaact gtgataatga gtctattcag aattccttat ctcccattct gatgtaatcc aaaatcttgc gtagtttcag gaaagatggg ttattacaga cacgtggatt gacagaattt ctttatccat caatgctgca atacacaaca ctccatactg ct tt ct tagg ggcgtgagat gca at t tttc gtcttttgcc gcattctgct gtgagttgtc aatttgtgta caaaaccagt gtcttccatt aatccagttt ctgtcctgtc tatttctggg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 W0005851 0 http Jtwww.g etthe patent. comlogi n.dog/Sexa m. support/Fetch/efa ult. doqNWO00585 1 0. cPc?frOmC ache= 1 part= ma intool bar--boto ml Pa ge 596 01737 WO 00/58510 PCTIIBOOIOO435 ctctctatgc actccttctt a gt aa gt acc ttatgccaaa tatatataca ttttttactt gatctagaaa cagtaaccca ygcattttcc aacaatgagc t tct cta gt a tttattctat acctaggaag ctctgcgctt ttggcctccc caagatatca ggattgtggc cctgtggtta cagtagaccc gtttatgctc tgtttggtat tgctttaatt gacttaatgt ctttttcctt accgttaacc aaacaatgtt attttcttct agaacactgg ccacctgctc tgccaacaga at tt cga gtc aagttttcat attccctttg a tatcccattg ctctttctcc aggatggggg ggtatttaaa tgaaca tat t ggtgtataca acttgactat cattgtacct ttgtgaaagt aaaacttatt gctaaacgtt cat ttaaa gt ttgacaaagg ttcttatcta atttaaagct ttctttttat tacacagtgt agtacatgta tatgagaggc ccacttcagt tagtgttttc gctaattgtt cattgctggt tgtctttaca ctttatttta tataagacaa ttctcttttc cgctatcata cctaatagct cccaagctct ctgtcgtatg tttgaggggt ggtaatttcc gtctataatt atgttttctt tgtgtagttt ataataacac taatttatat atatgaacat gaagttctct ttggttttta cacgtgacca atctccttac acaatcgagt tactgatttg tgagctggca agcatcct ca ggtgtatatg ataagtatgt gaataatgac ttatactaga atcagccagc tcttttaagt atacaatgaa aagaaatgta catctttcaa ctttttttaa catcattatc aatggtattc cttctttaaa gctcactgga agaaatgcag ctacaggcgt aacttaatcg cattaaggct tagaaagctt taattagcct a at gaga aa a cattttaaaa aaataatatt aaaggagaat atatatatat agtataggcc atgaggaaga gtacgcattg acttcatgtt cagctttctc gatcattatt ctgaaaagca atcgaaacct tattttgaga cttgtcagct acataagcac gagcaaagaa acccgggaat gcattattaa agatgataaa tattgtttcc ctagatcaaa gggacgtacg tatggcattt aatttcaggt gacaggttct gcctgtaaat gtgatcatac gagccactgc agtaaggtga ttaagtttaa atcaaaatat gaaaatggaa tatagaaaaa tagtaaggtt taaaggcaaa gtgaatacat gcatatgtat cttagaagtt tgatctgctg acagaatcat aagttctttg tcagccaatt ttcctttccc acttgaccca cattcttt ct atatatcatg ctttgctttt cctgtttatt tttctttcta gagctgccat tagtttatgt gtgatgccac ttcaagttca ttactctcat tttgtgtata atactttata aatttagtct ctctctgttg cctaaact cc ctagtttttc actcagctca aacgttaggg ctaaaaaata ttatttggta agttagggag aataatgcaa gaacaaaagt gatgtatatg atgtatgaat ttatttactt ctaaaagtca tggtgaataa gagacaaatt aactttcatc gttttctcta atgacatttg ggaaaggggg ttccgttatc tcttccatca ctctgatgct taaaaggttt aaattgattt agatatcttt gactccttaa ttttattgtg attcctttgt actgttttat tagataatcc attattttaa tagaatactt ccctggctgg aggga tcctg ctcccccacc gtcttagaat gcagagtttt agtatatatt tagat ttcaa 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> 129 3001

DNA

Homo Sapiens allele 1501 9 9-25 966-24 1 :polymorphic base T or C misc Tbinding 1502. .1520 99-25966-24 1.misl, complement misc_binding 1481. .1500 99-25966-24 1.mis2, primer bind 1721.-1741 upstream amplification primer, complement primer bind 1219. .1239 W0005851 0[http:llwww.getthepatent.comftLo n.dog/Sexa m. sup po rtFetchDefau t. d oANVO5851 0. cpc?fromC a r-e= 1 part= ma intool ba r--b otom Pa e 597 of 737 WO 00/58510 PCTIB0OO0435 <223> downstream amplification primer <220> <221> misc -binding <222> 1489. .1513 <223> 99-25966-241 probe <220> <221> misc feature <222> 1659, 1987 <223> n-a, g, c or t <400> 129 tatttttgtt gggatacatg tcaacccgtc ctcccgttgc atgtgtcctc tttctgtgtt atgatctcat aattttagtt tcctttttaa gcttcattca tttatttaaa ttactttatc atagctgtgg taatgtataa tgatgaccat tgagcaagag gttccctgtt tgtttccagg caggggctgc aagcttcttc aggacaccac ctaagatacc gtaagggttg aaataaacaa agttccgtgc ycttgaacat tcctgaatac accttcttag caccttcatc gtctccctat ccacagcact tgtgtattac attgaattaa gaataangga ttgtagtgga agtggaaaag ccacagaaaa agagtacgtg gtacaattga cctgtgactt tggaattaaa tataaggaat accctgccat gaatggccgt tatgtcagtt caactaacag atggtcaagt agcataaata aattaaaata atcatgatgc tggaaagtac tgcaggattg atctatgttt ctcccatccc attgttctac agtttgctga tcttttttat catgcctgaa attattatta tcatgtgatt tccatttact caaataatca cttttttccc ttaataacat tattttataa gtgttaagga aattaagtat ttcttcctat gtggctagtt ccttcatcct aatgcccttg cttggagcct atgtgttact ggcacatggg tgaagtggga tctcaataca tgacatgact aaagcctttc tttatgaaac ctagcttttg taagaaaaca ctatgagtca gatttgttag ggactttgca aagtcaatat acttgagttc cctatagcaa aaaaatgtat tcaagcctat cctagctttc aacacattaa tccctggctt gaccctctgc ggcagtccaa ttgctggtac acaactgtga gtaaatattt atatggcatg tttaagaaga tttaaaataa aaaattttat ttatagaggt taagccccgc ctaacaggcc tctcacttat ggacgatggg ggttgcatag atattttcat tttcattttg tagcagctgt agttacgggg aacttcaacc ttttttgtac ctatatggaa tataaattac gt ga tct acg ttactggata gtccatagga gcagtcataa ctttttgttt agagtcagtg aagtgagaaa gaagcttagc gaatgaggga tttgctatga tgcctcacac tttcctatac ctgaactcat ttattttatg atttccttaa tttgtacatg cagcccgtaa ggagagatag caaggacatg agagagacca t tga aga gaa ttaaacacat ggtgtcttat agtcagctgc cagactgggc ttttccatcc ggtgcctgat tggtatgctt gttgctccgt tgagtggctt ttttaattga tgaagaaaag taatttgtat acctttattt ttatttatct tatttttatt atacatatgc attcattagg acagtgcgtg gagtgagagc ttccagcttc tattccatgg aaaattgggt aaactaaaga caaaattgta taattatttg tattaggaag tataattaaa tattataaaa gtcttgatga ttggtgtcaa tggcagacaa atactccctt agcttgggga gcagctgggt aagatgatgt caaatcttca ttgcctgacc gcaagagcgg gcttggagga tttcatacca ttaaatatga actcatacnt tgtttttaat ggttaaagat accatttcat tgggtctgag aaagccatcc cttttccagg ggttggtgga atcaactaag aaagcaagta ctcaaatcat taattcacga aaaatgatat at ta gggt ga tgctttgcat ggctgcctta aggaaatata caaattcaaa acatgctaat ggtttcttaa gcaaatatat atgtccatag atctatagca tttattttac atggtggttt tat ttct cct atattcccct atgcggtgtt acccatgtcc tgcacatgtt atcttgtgca atcagttaag ccctttgctg cccaagagta ataaaaaaac taaaatacat aaacacttac ctactgaaat atatgctggg aatat tgt at tcccaggccc gaagcgaggt aaatacagag gcagctgatc ctgggtgaag tgaccaatat taagtgtgga aggagtggca t ca agca tga atgcccagaa tttagtctgg ggttggctgt catatctttg catttattta gatcaataca tgggctgatg aagttcaagt aagtcttggg ttcaatagtc atttgattct tactcaatgt gtttttttgt ctgcagacat tgtgtgcccc agctggggat atcttggtat atatgtgcac cctagctgtt atcatggcca ggtaatgtga aacagcatgt gaatttcatt caaacaaaat tttaagttct gctttacgta aatgctctcc ccctgtgtcc tggttttctg ttgaaaggac ggaaagtaca gcgaaatgtt aaaatgaaag atgtcttagt ttacgtatta tattaaaata ttgctatttt tgtatttctt tatgagatat tatgtcacta gttcataaaa tgtacatctc catcacttcc gacctgt gag tcctgccagc ccactgaaat atctacctct ctttaagaac gtcaaccgac ctcagatttt gttaaataat actcctgtgt ttacactatt tatctatgtc caaacacaaa tgtgtgtcta aaagcttttt ccacttggcg tgccaagcta taaattttgg actttattgt cagggcagaa t t ttgttt t t taaagaatac acaggtggac tccacttaac atttcatgtt tgtagaaagc gtaaaaacaa ttttgaaaca gtagtttcaa atctttacaa gagaaaatag ataaaatttc 120 180 240 300 360 420 480 540 600 660 72 0- 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 W0005851 0 [httpJtwww.getthep~atentcom/Loqin.dog/Sexam.support/FetchiOefault.doQNVOO55 O.cpc?trom~aClhe= 1 part=ma intoolbar--bottom] Pa e 598 of 737 WO 00/58510 PCTIBOOIOO435 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 130 3001

DNA

Homo Sapiens allele 1501 99-25967-57 :polymorphic base T or C misc Tbinding 1502. .1520 99-25967-57 .misl, complement misc -binding 1481. .1500 99-25967-57 .mis2, primer bind 1537. .1556 upstream amplification primer, complement primer -bind 1064.J.084 downstream amplification primer misc -binding 1489. .1513 99-25967-57 probe <400> 130 tt tgt aga ct gcactgaata taatagaaat atgcattttc tcactaagtt gatttgtcaa atgattaaac ctcatgatat ttattattta tacatatgtc agaataaaca cataaagtta ttttgacatt attttgtgta ttaaatttta tatgtaaagt attaatgctt taaaaatgaa tacgcatttt gtttaagaat tatgtttcca acaatgaaat tgactttgtc taacttgttt at tat agt aa agaatctctt tcagagagaa gttctattag taatgagata aatttatttt tattcaccat tat cagacag tttcagttat atatatagtt ttttttgtct ttttgttata ttaagtggaa aaaaatgtta tccttgatag cgtggacata acaagtttat t ttat tt gct ttgccatata ttgttttgta ggttcttgaa actgactaga aaaacccttg gttggcacat ttgccagaaa tagcccagct tgcttacatc aaattatctg tgtaccatgt acatactgaa actctagact actgatattt aaatagtaaa tcactttgtg taatcatata tgatttttaa attcaaaaat aaggctggtg ttttattagt cttccattgg gttgtattca agatttcttt ttaaagggct ctgtattttt tgaaaagtaa taattatctc tatctgtgcg accttcctat t tat t tgct t actgggagga gttctcttgt tactaaaata aagcaacaca tcattaaagt tgaatcatat ttatgacctc taaatagtta tgatattaia aaggataatt aattatgtaa aataatataa ctggttcttg caaaaatcaa aaataatttt tttcttctct aatatagata tat ttaaaaa tactaactct gatgcaaaaa ttgatatatc tagcacagaa gtatggctca ccctcacgag ttaatttatt gttcttgacc gcctgcttct tgccaaaagc ccagatacat tttgcacaga attacaatat cttgcaaaac aaaatggctc gcttgaatgt tctattctga tattaataat aattatatta ttttttaaaa gattgcaaag cctttgcagt aatttgcgtg tactgttgtt tatacttgaa tagataaatt atacaatcag ttttctagta ctttgttctt gcaaaatctc cttgtccttc tttttatttt ttctctttct tctcttcgtc acacatttat tttcaggtat acatcaaact aaatgaccat tttaaagagg atgaatgaac caaactatag cctaattctt a tgt at agcc t ct tta acaa tatgtatttt tattttagct cattactatt gtatttcttc ttaagtggta atgttctaac gttctcgttg aatgccaaaa taatcatttt cacttagatt cattcttaat taggactctc tttatgtttt cacacctcca cttttcaatc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 W0005851 0 fhttpv/twwwgetthepatentcomi~gin.dog/exam.supprtFetchDefaut.dogAN0005851 0.cpc?fromCache= 1 part=maintoolbar--boftom] Page 599 of 737 WO 00/58510 PCTIBOOIOO435 yaggctctgt taagactcct ggaagacact atccctgctc gaaccctttt ctggctaact agagcttaat tgcatgttaa gtgaggacaa atatgcatag tacatcgatt tgctagagat aattattttc aagtaaaaga tgccacagtg gacttcagag ca act aa aa g atgatttaaa tataatcaga ttatgcttta tagttcctgt agtttgaaat gatatatttg gagttgct tc ttatggtgaa gtaacagtcc cagtgacatc ctgaactcag acatacgatg 6ataactgtg ttattcttga tcaaatcagg ttgccgcacc gagacctggg gtaaaataaa agtgtccttt tggatctgac tttggacttg ataacccctt aaaagcagtg aat ttagaag ttgatccgct tactcctcta gttgagtttt ataaaacctg ctcgacggga tgggcacagt aaataaacaa agttcttcta acagaatgca aaatagagaa tgttatactt tcctctgctg ctaaatccat gtcttcctaa aactaaaggt tcagactctc acatgttgag ctcttgattg aatttagtga gaatatttgt cacaaccaca tacttgatgc gacatcatat aggttccaga cagtaattgt ttttattatt ggggaaggga tatactacaa tttcttactt ctcagctatg tgaagtctcc tgctagcaca ttctatgcaa taatgcaagg aatgtacatt aggataaaaa aatggacagc attgaatttg atgcctggaa taaatttacc gtttctgtag tatctatctc gctgt tacag gtgaatgtgt ttttctggac cggtacacat cttggatttt tggatttcca ggcaaggcgg ctgtagaaaa accattgcct gagaactttt gtgtatcctt gaaaattaat tgcttgtgtt aaatagcact atgactataa ccactcagtt tactttctaa tgtcatgtca tccaaggacc cccatctctc ctttagctcc tggttttccc ttcaggaaaa ctgcacttct cgccatgaga ccctggtatg aaattggctt agtcatttct attcacacgc ttttcttcca gtctagctag tgggagcaat tttcaagcta ggcaatttta ggtttcagtt taaattagaa ttagagaatt ttaggagagt acggatttct tggctaaaaa tttatatgtg aatatttttg cttgtttgtg ttactgttca cctccagcgc ctaggggact acctccttga ggcttccatt catctgcaac tcgagggtca taagatcatc tttaaacagc gt cca t tgac agctggaatt gattcaaaac gtaaggtcac acaacccaga gtgataaaac aacagtgcca ctaaacttac gaattactca cactattgcg agttcataat aca t ttat at aataggactt tttttaaagc tttggaaagt 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> 131 3001

DNA

Homo Sapiens allele 1501 9 9-25 96 9-200 :polymorphic base C or A misc binding 1502. .1521 99-25969-200.misl, complement misc_binding 1482. .1500 99-25969-200 .mis2 primer -bind 1680. .170 upstream amplification primer, complement primer Ibind 1171. .1191 downstream amplification primer misc binding 1489. .1513 9 9-25 9 69-2 00 probe W0005851 0[hIttp Jtwww.g etlhe patent. comL ginAdg/exam.su~portFetch/DefaultdogNVO005 8 Sl O.cpc?fromCache=l 1 artmaintoolbar--botm] Page 6000of737 WO 00/58510 PCTIBOO/00435 <221> misc feature <222> 454,710,842 <223> n=a, g, c or t <400> 131 ttgcccaggc ggttcaagca acactcagct atcttgaatt ggcgtgagcc tcttttgcta gtatctcaat catatggaat atcatgagtg gacattggat cacttggtca atgctggcat atggtcctgc cctaaaagtg cnaatataga ataaacataa atttaatatt gcctagtatt ctcattttga gagagccttt cttcactctt tgaactctta gaagatcatt ttgatattga gtgattcatg mtatgctaca tcacagtgta aaatctcctg taaaagaagg aaagtttata tttaatataa aattggttgt a ca ggt cct a gtgggcagag tataaataca taaacaaatt gttgtctatt aaccattttt atgtctcagc agcaatctca ttatttattt ctgtagtgca ccatgccaac taaagttttt gctcaagtga ccatttttaa gtatttatat tttcatttaa cacatgagac atgtgcattg c tggagtgtag actctcctgc aatttttgta cctgaccttg actgcgccca gatgacactg aattcaatta aaaatactct attctgtttt aaacactaaa aataaattgc tccgctgagc atacacatgt tgtatgtgta agggaagaaa ttcagggatt taacttttta atatggcatc aagaactctg ggttttggtg tgctgttggt ttttgCtctg ctctccttcc ctttatgggt gggcatctgt cagtttactt cattatttta gtggcagttt agtcactaac ttttctgcaa gggttggaaa acatttctgt cataaacggg cttggcccat tcccaagagc tcctcagtgg taaaacctag cctcctccag ggtgaggaag gcaaaatggt atttatttat gtggtgtgat ctcctgagta tttagagaca tcCtctgttt ttatatatgg gaatctaaca ct aagat t ta tcttaaacaa gttcagggtc tggcacaatc tcagcctcct tttttaatag tgatgcacct accggaaaac attttttttt tttacatctg ttagtcttcc ctatcacaga ctgtgtttga gtactgaatc actgggctgg atttggagat tttttctcat aagtcttttt tatattttct aaaattaaaa tattgcctgt taccagagca cccttctctt aagcatggct ttctgtaccc agagtttatt ctaccacata gattctCCCt gactgtgtag aagactgcat aaaattttac ttcctagtta agcacttaaa actttttatg tgcaactatc catgtctatg aggttctatt atctcttatg gggtttcatg ccatgagcct aaggaggtat agacacacag catttgtcta ttatttattt cacgtctcac gctaggacta aagtctcact tgatctctca gactacttgc gctacaaaac acacgaaaga ggggcagagc ctaagtcacc ttggactcac gagtagctgg agatgggatt gcctcggcct ctattttaag taagtttgaa tccagtgt tt taanaaCcc gaagtaagat atattggctc atccaaaaat attggagggt aggctcaqat atcatgctac tcataatcat ctcattttaa tagtattctt caagacagtg gctgtcctaa gctacggt gt ccctcccctg ctcccttttc ttacatgagg taatttgtta ctgtctggtt catataaatg tagaacaaaa ttgataatct ctcttaagta tatatatgta aaaagggcaa ccacactgtc ctccagccac catagtttgt ttttttggaa taagtattca tgtatgacct gtacaggtgc gcaccaaaga tttttgtttt ttgagacagg tgcagcctca caggtgcatg atatggccta aagtgttggg ttttatttat tacttcaact aattgctcac cctaagttaa taagttttgt tgcaactact gactacagga tcaccatgtt cccaaagtgt acaagtctct aggagtgcta catagttttc ataaatcagg cgggtagttg tgaaatttac atttcattag cagatgtggn tttaaacaaa cggaaacgtc attttcataa ttgtattctt gtaaaatact gcattaaaaa aaataaaaaa ttgcttttct cttccttatg tcagattttc acaaaaaaaa tatgttgaca tggagaatgt ctgtacttga tcagctggta gctttgaaac tatatagagg ttagaaagga atagtaaata atcatagcac attgtattta gaacacctgg ccctctggat cactctccca gtgattttac tccgcagtca gtggcatgca cttttgtctc gccttgctct accacctgga ccaccatac ggctggtctc attacaggca cttgtagctt t ttatt tt ct ttctatttgc ataatgggca agatagtttc ccacctcccg atgtgccacc ggtcacgctg taggattaca tttccaattc tagatttatt aaaacacatt ttagccaggc tttaaacttt tcataactaa catctaccac cctcaatgtc aacgcaccag tagaatagtg a ca tat ttcc aaatattttg tattttctat tttttttaaa acaacactcg gcactcctga gcttctgaat attgacatgt tgcttttaac ggatttctag ggtaggattt cttgaatatg ctccttagct cagaaatgtg gacattggac atggttacag atttagaatt aaaagaagcc caaataggca tttagtatat ggggaaggca gctgctatga agtgattctg cattagtgtc atcatactaa gtcttccttt gtcacccaag ctccagagat cagctaattt aaactcctgg ctcagccagt gtttttcatt tttcaatacc ttgggaccaa tttagttttg tttactccac 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> 132 3001

DNA

Homo Sapiens W00581 0rhtDtwww.getthe patent.co mf.og in.dog m/W~rt~thIea~toNO005851 0.cpc?fromCache= 1 part=maintoolbar--bottomj Page 601 of 737 WO 00/58510 PCTIBOOIOO435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-25972-317 :polymorphic base G or A misc binding 1502. .1521 99-25972-317.misl,.

misc binding 1482. .1500 99-25972-317 .mis2 complement primer -bind 1795. .1i815 upstream amplification primer, complement primer bind 1368. .1388 downstream amplification primer misc binding 1489. .1513 99-25972-317 misc feature 1274 n=a, g, c or probe t <400> 132 ggataaagtg taaagtcaga tgcaatagac ttttccaagt ttaaaaactt tttagtttta ataaaaggga gttaggaatt atcatcttgc cagcacaagc gaattttatg aaaaacattt tgtgtgttta ttctttagct tgtttagcac agcctgaggt tcaggttcct gtattttggt tggagaaaat ctccaaagga aagttttgaa ttaacccctc tgataaaatt cagaaatcag gtgacatctg rttttctgaa atgttttcta ccttacctat ctatccaatt aatttttgga tgaattcaaa tcatttgcaa aataaaaagg aaggtacttt attaaagatg a a ctact ga t attgtttagc.

tggaaaactg aatatttttt attgactcac ttcatttgct tctttgactc ttttttgtct atgttaaaag gatatcttct tgtaacaaaa aagaaacact agatgtagat ttgtattctt tccntttttt atcctgccaa aaaatcattt caaattagac attcttggga ggctagattt agcttaataa ttgagagcta gagaactata atgcactttg agttctgttg cctgtgctat gcagcacatg ttattgagat ttcttataat aaaattcatc a tca tggat t tcttattttt atagtttgtc taatcacaaa ttatcaagtg tcgtttcagt gggtaatgtc tcgaggtgat gggagtgtaa aaaaaaaata a aa aa a aga c caacatttga tttttttttt agaccttggt aagcttgggt agaaaagtat gctaaagaag taaagaagtc ttttaaaatg tctgcaattt attgccccat agattcagcc aattcttttt aagaagttag tgttagtaca gctgtgagtt agtgtatttt tt gcgttttt ttgaaatagc ttccttaatc aggtatttaa aaaactgttt gtttgtgttg aacttcacat agtgagcccc aaccattaat agtgttgcca aataaaaaac act aa gatat taaaacaaaa ttttttcact ctgaagccat tagacagctg gcagctggca ggaccaggaa aagattatat acatttctaa tgcttaatat atttaaaata tactcactta ttagttatac tgttctttgc acttacaaaa tgcaaaacat taactcttat ggagtcaaat .caccgtcttt ctaaggtatt taaagaaagg cctccaactg ttatcattga acagtatgta gccacgtcac agctgcttga gaatcatggt ttacctctaa ttgtgtggca attcaaactc tttctctgtg tatttgtgta tgtgaagtgt aaataatcta aaagagaaaa atatatgtag tccaattata tcgctttgca ttattgagaa aaaaataatt ttagttatat cattattcct tctggtaaaa aatttaaaaa ctaacctgga gatggcaaaa tctgctccca ttatttctac ttttacttct taattgatgt ctttttgaat ttcagaaaag agtgacagct agggctagat gatactctac gtatgataaa tgctataagc ttaataaaaa ccaggcctgg gccacttctt tat ca agt a a aaatgcaaca agaaacaaaa caaagaaagg tgtaataatg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 W0005851 0 htt:1lwww.g ettheoa tent. com~og in.dog/Sexa m. supportFetch/Defa utdog NVO00bab1 U.cpc?tro mCar-he= 1 pa rt=m aintool ba r--bottoml page 60 1 of 7 37 WO 00/58510 PCTAJBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99- 25 972-3 17 :polymorphic base G or A misc binding 1502. .1521 99-25972-317 .misl, misc -binding 1482. .1500 99-25972-317 .mis2 complement primer Ibind 1795. .1815 upstream amplification primer, complement primer bind 1368. .1388 downstream amplification primer misc binding 1489. .1513* 99-25972-317 probe misc feature 1274 n=a, g, c or t <400> 132 ggataaagtg taaagtcaga tgcaatagac ttttccaagt ttaaaaactt tttagtttta ataaaaggga gttaggaatt atcatcttgc cagcacaagc gaattttatg aaaaacattt tgtgtgttta ttctttagct tgtttagcac agcctgaggt tcaggttcct gtattttggt tggagaaaat ctccaaagga aagttttgaa ttaacccctc tgataaaatt cagaaatcag gtgacatctg rttttctgaa atgttttcta ccttacctat ctatccaatt aatttttgga tgaattcaaa tcatttgcaa aataaaaagg aaggtacttt attaaagatg aactactgat attgtttagc tggaaaactg aatatttttt attgactcac ttcatttgct tctttgactc ttttttgtct atgttaaaag gatatcttct tgtaacaaaa aagaaacact agatgtagat ttgtattctt tccntttttt atcctgccaa aaaatcattt caaattagac attcttggga ggctagattt agcttaataa ttgagagcta gagaactata atgcactttg agtt.Ztgttg cctgtgctat gcagcacatg ttattgagat ttcttataat aaaattcatc atcatggatt tcttattttt atagtttgtc taatcacaaa ttatcaagtg tcgtttcagt gggtaatgtc tcgaggtgat gggagtgtaa aaaaaaaata aaaaaaagac caacatttga tttttttttt agaccttggt aagcttgggt agaaaagtat gctaaagaag taaagaagtc ttttaaaatg tctgcaattt attgccccat agat tcagcc aattcttttt aagaagttag tgttagtaca gctgtgagtt agtgtatttt ttgcgttttt ttgaaatagc ttccttaatc aggtatttaa aaaactgttt gtttgtgttg aacttcacat agtgagcccc aaccattaat agtgttgcca aataaaaaac act a agatat taaaacaaaa ttttttcact ctgaagccat tagacagctg gcagctggca ggaccaggaa aagattatat acatttctaa tgcttaatat atttaaaata tactcactta.

ttagttatac tgttctttgc acttacaaaa.

tgcaaaacat taactcttat ggagtcaaat caccgtcttt ctaaggtatt taaagaaagg cctccaactg ttatcattga acagtatgta gccacgtcac agctgcttga.

gaatcatggt ttacctctaa ttgtgtggca attcaaactc tttctctgtg tatttgtgta tgtgaagtgt aaataatcta aaagagaaaa atatatgtag tccaattata tcgctttgca ttattgagaa aaaaataatt ttagttatat cattattcct tctggtaaaa aatttaaaaa ctaacctgga gatggcaaaa tctgctccca ttatttctac ttttacttct taattgatgt ctttttgaat ttcagaaaag agtgacagct agggctagat gatactctac gtatgataaa tgctataagc ttaataaaaa ccaggcctgg gccacttctt tatcaagtaa aaatgcaaca agaaacaaaa caaagaaagg tgtaataatg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 W0005851 0 [http:/twwwgetthepatent- comfLog in.dog/Sexa m. sugpo rt/Fetch/efaut. dogAA(00585 1 0.cpc?f ro mCac?,e= 1 part= ma intootba r--boftom]_Paqe 602 of 737 WO 00/58510 PCT/IBOO/00435 ggaataggac gtgtcttttt atgaactcat cttaattgct gacttaataa aggaggatgc ctgttctagt atgattatct tct ccgcat g aattattgca tgaggccatc cagcatgtct tttcctgtag gacttacagt tcttacatgg acccatcaga tccgtgattc acaattcaag cacataacat tggaaaccac cagaggccct ttcccctctt t agacctgggc tagtgtctgt aggtcacctc tttggtttga gaacacacca aagggaaacc tatgtattgc tgtccctgat catctgctgg gacatcactt tgctagaacc accgggtt cc ccataaccaa tccacatggc tggcgacaag tctcatgaga aattagctcc atgggatttg cctttctact ctcatgggag ctttgaaaaa ccatgtaaaa taaaaactga ctaggtaaaa ctcctcctct aatttgcaat actaaaatta tctacattac tgcataataa gctgcagtac gccagcccaa gggttggcag tttgcacatg caagggagta aaaacatacc tggggaggcc agaaaaatga cttattcact ccctgggtcc ggtgcagaca ctattcacaa gaatgtcatt tacagtttgc tgcattcaac caatttatgc tgaattctct gccaactttt cctgctactt tcaggagaaa aaacaattta gtcaccacaa gatcaaggct aagtaggggt tgaaggttgg ttcttgcatt tcccaaggag tgaaactaag ttagaatcac ggaggaagca ctcatgagaa ctcccacaac tagccaaacc agttctacct taacatgagc cacagtctgc ctctccctca ctaagtgtgt agattaagtg tcattttggt gaggttataa ttaaggaatt tttatatggg aactcagtgt ccagtagata tatttgacag ctgtcagctg gtggctagtt acaaaatggt aagaaaaaga ggcaggtgat aaagtggaaa tggcacaggg acgtgggagt atatcaccgg tt caaaggga ccagggaaca cacctggcca aaatctaagt gtgcacctgt gaatgaacca ttttacttag aacaatagtt tcaggtcaat ctgcagttct gaaagcaatt tctcagctct gtgggactag ctactttgcc ggctttctag ca acca tggc agtttaattg gaaaggcact ccactgataa aagaccggcc tctgggagac ccttgaaggt gggtctgtca a aat atctt g caacaatcca ctcaggcctt 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222>! <223> <220> <221> <222> <223> <220> 133 3001

DNA

Homo Sapiens allele 1501 99-25974-14 3 :polymorphic base T or C misc Tbinding 1502. .1520 99-25974-143 .misl, misc -binding 1481. .1500 99-25974-143.mis2, complement primer bind 1623. .1643 upstream amplification primer, complement <221> primer -bind <222> 1100. .1120 <223> downstream amplification primer <220> <221> misc -binding <222> 1489. .1513 <223> 99-25974-143 probe <400> 133 ggcttttggc cgcatttatc acttgtaaaa agaattttac tgaccaggaa taaatacatt tacaatgtgt ctaagtaacg cctgtgtgat tttcatttac atgacaatga ccctttccac tgttttctta caactttccc ttcgactgcc tgatgtttat tggttcatta tttgtaaaag W0005851 0 IttpJtwww.getthepatent. co m/Lo i n.d og/Sexam. support/Fetch/Defa ult. dog NVO00585 1 0.c-pc?fro mC ache= 1 pa rt=ma intoolba r--botoml Page 603 of 737 WO 00/58510 PCTTBOO/00435 agtaaaacct aaaaccgccc gtacatttta aagtattcac cccctaggaa ggcaggccat tgaaaccaag gcgatgaggt gggagaagct atcaactgaa gcccgtaatc tgtggagcac agaggtgact tgaacttggt ttctaattca acaaaaaaag gcactgagag gagaaggaca gact t tgat g aatccagccc aagttttttt tttgtctcac ygcttggagg tgagttttca accaaggaag ccacatatga ttttttggca ctcatggtgt ataagttgct gacacacaga ttgtgacaga aaagtacagg cttggctggc aaatcactgt cagcctt tgc attctattac ttttctggct accaaaattg tcttcacctc tgcgtaggcc aactgtatta ggctaggtgt attctaaatt tcctttattt tatattttta atgtaggaat cttccagacc t catctgaaaa aagggcccta gttgaaacca agctggagtt aacctcctcc ggatatgatg acaaaaactt tgtcactgca tttgttgggc aggccgagtt attaaagaaa atttgtatga gacctcacaa gtttgtagag gccttttatg caccttttca ttttgttctt gggtgaggga tcccacatct ccatgcaaat attatttgag ctccctctgc cacgcagtgg ggccaagaaa gagagattat tgggggaagg gaatattttc tttgctaatg cagatgggtc gcagaaaatc atgtcatctt agtcagagat ctgtaagtat ctctcactac acaataacat catctgcaca agggtaggct gtaattcgga atattcaagt taaatgagag ataaacacaa caaatacaca ccatctggag ttatggattt gtccagttga tgaagaaata aggggacaac aaaaaaaaaa tgggggatat ggtgttttgt ttatgcttca ggcatgaaga aagtcacaga tcaaggaatc cagaggggct cggcttttgt aatctatttc aataactagg gttgaatttt aacaaatgca qaagacgtaa gattcacttt cgatttggtt tgtggccagt gaccgataca ccagaaaaga gcagtgatca agcagagact tccaagacct ctgagcactg aataacttaa agctgaaaaa aaaatctaaa gaagtggatt attctctgag acaccctcat tgcctttttt ctgtttgtga tgtggaagat ca tgt tct ct aggtggcttg gtatcttttc gaggccaact tatctagttt gatttacaag t aa cat acat gacagaatca taaacacact gtaataaata tataattttt ctgcattaaa aaaagcacct aaaataaaac attattaaac 302 aaaagaaagt taaatctgtc atattgaact cacattttca gaggctgaac tatcggaact caagtgcaca gaaaagcagc cttcataacc tagtgaacat ttggcatgac ttgcatatgt cacagcagcg gatggcctat aacctttaaa agccttcctg aagaaaagat ctgcaatgtc gcttcatgtt ggctatattt tccagtaggc cagagaccca ggttctgtgc aaccctaaga tgtcagtact aaacaaaaag gaaatatttt taagtgtttt gttggaacat ggaatttggg ggaagcaggt tctgaatgag gagctggagg ggagtcctta atttaagctt tacttaaatg aaagccataa atcttggaaa taatctagac ctccttcaac gataaaatga agatgagttc atttctcaat taacttaaaa tttactaact aggagaagat catatctttc gtgttgtgtc tctttgctgt ttttaacact tgtttgagaa aatgcgcttc gaatgcgaga ggttctcaga atcaaagcca a gcat tgga a tgttcgactg caaaaaagca tattgtgcgc ctgcttctta taaaattaaa gactccttaa gagaaatttg t cagagaggg ttcatccctt agctctgatc agtaaaatgt acagtttaga gactgttgtt agctctgaca aaataaacaa tgacagcaca ttgatgggtg ccttcccagt cttcaattgc cgagtatgaa ggtacagatt tgaggagtca aatgagtcca gtaacaagac tctgatgcac gtggcaatta agaaataaaa cttctattag attcaacttt ctggaaactg aatgtattaa tgactatgtg tatatcttta tctattttgt attttaatta acagactgtg ctcaccttac tctagacatg tttaatttta atatcttgat gcagggaggt caagaagcaa tgtagctagt tagatgccag tcaatcacaa ctaaagagag gccagct cac tgtgtagtta ttgattttcc atgagagaga gcctccacaa aacataacat aaatacagca tcatggcatt ggtaccgcta cttagtatgt attccagatc tgttcatttt ccctgttatc aggatgtcag gtaggcacca ccccaaggct aaacagttgc ttttaacatg tagacctagg tttgagtgac gtttcatgtg cgCtctgtgt ataatggatg agaaggaggg acagtgatgc atgtgctttt tttgagactg cccactaagt ttctacgtaa ctgttccgat aaatctgatg taaatatttc ataggccctg aggaccatgt ctgtcatttt taggccattg gacagtgatt agggagggat caaatatcat 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 .28 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> 134 3001

DNA

Homno Sapiens allele 1501 9 9-2 5977-311 :polymorphic base A or G misc -binding 1482. .1500 99-25977-311 .misl W0005851 0 http:/wwgetthepatent.comlLogin.dogI$exam..suoprorFetchoefaultdoiW0005851 0.cpc?frqmC arhe= 1 Dart= m ain too] ba r--boftoml Page 604 of 737 WO 00/58510 PCTIIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc binding 1502. .1521 99-25977-311 .mis2, complement primer bind 1191. .1211 upstream amplification primer primer rbind 1710.-1730 downstream amplification primer, complement misc Tbinding 1489. .1513 99-25977-311 probe <400> 134 catgccgcag agcagtatct gtggct ctct ttgaaagctg gggcttatgt gtcagagtcg ttcctaagtg cacttttggt cctccatctc ttagcttccc atgacctttc tgttttagag gccaaaaggg agtctctaag ccagcaattt tgtccaggta taaccccaaa ttttcttatt ctgttgagca aaacccatgt aaaattgtct tattccattt gagaagactg gctgctcttc aacacttaag rttctgtgtt ggtggaagtc tgcaccctgg ccatttaaaa agcagtttct ctgacaaaat tcaaagctgt ggtgaactca taatttttga gaagttgttt at ttaggagt acaattatcc ctgtcttagt aactttatca tattcactat agtagcagag gagccttcag tttcatcctc tgtgtttttt ggcgtgttgt taacctgtct tcatattcct gttctgctca gtagtgatag ttagtgggct cactcctctc cacaggtaga aattttcttg gatttttctt aacatggtcc attaaaatta tatcaactcc accgcagttc acatgtaata attaatatat agttttcaaa caaataaaca aattttctct aggctaagag tact ca gat t cactttaaat aattgtgctc agttctgctt gaacattatc tatatatacc cccattcaca gaatcacaat gaaagcttat ccaacacaca ctttttattt cctaaagtga at tt agt tcc ttcacttgcc attttgttat agtaaaagta gggcaaatgg ttttcacttt agcaagaaca ctccattggc tttcttgcct ataggacaat agaat ttggg ctattggcct aagagacggt atgtggaaga tgtgttcctg aggtgaaaca tcaggctctg gtatatttca agctctaaga ttactagctc ccatctaagt acctgtcagc tgtaatgggt gagtgatcac acctacttct atgttttaaa agtattgagc tcccacctca aaaaggattg tctgacttca agctatgaaa tgatgattgt ctctgttgtt ttcatccgta acagcttctg aaggaagagt caattaatat atacttctct atcttgagct attaatcccc caatcat ttt tttagagtcc ataagtgagt attatctttc tataaaagta acttaagtag gtatcctaga ccaaagtcag caggcctagt gtgtcatggc aggagtggag ttgtgttgaa tgcctttgtc ctgtatcttg tggaaaatgt agctgcaacc ggaaggct gg ataaagtctt cagctgttac actaagtttc ctcactttca gttctaccag tgtgcctgtc ccaagagaac ttccaagtta atattacttt ttatgactga catcgtgatg ttaagatgta tccaggctga attccacaaa aatgcaaaat tctctttctt ttgcaaggaa ttttaagctt atacagtgtt caagtgagat gtaatggttt ctggaagcag ggagaagtca ttagatacac tcttcataaa atatctgttt caatctttca tattttttac gatattaatt gcctttcaga gggtattata gaagcacatt atcctgggtc t tgt aa tt tt gtaataggac ggtttattgg tcacctgtta tacatctttt tctggaaatt ttcactttca aggggcct ac ttcctgtggg tttcccttcc tagttagaaa aactaaccca attatgtctc tctccagatt atgtttaagt tttaactttt cggaacatat ccccaagtcc aattatgttt aatagtaact aaggttagaa ggtcttaaaa ggaatctatt tgcagcccca tgttcctagg tttatagaca gaaatactac ttgacaacaa tatttataag gattaaagga ttacatcatt aatgcatttt cataatttgc ttgtctttat gtttcattgg ttgttatggt tctccatttg ttattctgtg aacattaatt cctcttctcc atgtctaaat tttgttgtag tatagtttgg tactccaggg actccagact agtgaaaat t catgactcat cacatttttt actcaggtaa gttaggcctt ttctgctaaa ctagtactct cacccagct t tggtagcttc ttggggtggt ttgttgagct aaataaaaac gtgctcttt t caattctctc gttcacaggt cagcttcata aaaggcagaa ttaggaaagc caagcccatg cggtaacgga aatattctgt agcaaaagaa aggcatatta ttttatgaaa aatttgatgg gttccctctt acaaagtatg acaataatga ttccttaact gggtcattcc ttctggaaac taagaaatac ttagactgat ttcatatgtg aacttctata 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 W0005851 0 http:/Mwww.gethepatent.comILo in.dog/Sexam.su~rortiFetchIDefault.dogNVO005851 0.cpc?fromCache=l1 artmaintoolbar-botoml Page 605of 737 WO 00/58510 PCT/iBOO/00435 acaaccctgg gtaatcaagc acaggtttgt t t tgtga tt t ttaagcccac ttccttacat tattatgaat tatgtcatct ctctgctcat t gaaatgtagg tatgctgagc actgaccaaa taaaaatttt ccacattctt tcacagtttc ttaagaacag attttgactc ctttaatcca ctgtattatg taggtactga aaagaaaaaa aaaagtaaat tcttgtttct tcaccaccca ctggtgtttg caatttgcat atttattttt tctattttgt agagtttctc aaaatcaacc attaatttag cacaaaagtt atttgatctg atttaccaat gtgtctgcaa gtttcctgaa agataaagaa acaaacaaga gtgtttggct ttattactat attccctaaa taaccttgct ttcccaccat gcattctgaa gtaccttatt cttgcaactt aga tat tgtc gccattttta gggcaaagca cacattcttt tctatctgtt ttatgctttt tatgagaatt cccatactgt 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> 135 3001

DNA

Homo Sapiens allele 1501 99-25978-166 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> :polymorphic base T or C misc binding 1502. .1520 99-25978-166. misi, misc_binding 1481. .1500 99-25978-166.mis2, complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer bind 1644.-1663 upstream amplification primer, complement primer Ibind 1155. .1175 downstream amplification primer misc Tbinding 1489. .1513 99-25978-166 probe <400> 135 aaaaggcaga attaggaaag tcaagcccat acggtaacgg gaatattctg aagcaaaaga caggcatatt attttatgaa gaatttgatg agttccctct tacaaagtat tacaataatg cttccttaac tgggtcattc gttctggaaa ttaagaaata agctgctctt caacacttaa gattctgtgt aggtggaagt ttgdaccctg accatttaaa aagcagtttc actgacaaaa gtcaaagctg tggtgaactc gtaatttttg agaagttgtt tatttaggag cacaattatc cctgtcttag caactttatc ctactcagat gcactttaaa taattgtgct cagttctgct ggaacattat atatatatac tcccattcac tgaatcacaa tgaaagctta accaacacac actttttatt tcctaaagtg tatttagttc cttcacttgc tattttgtta aagtaaaagt ttctgacttc tagctatgaa ctgatgattg tctctgttgt cttcatccgt cacagcttct aaaggaagag tcaattaata tatacttctc aatcttgagc tattaatccc a caat catt t ctttagagtc cataagtgag tattatcttt atataaaagt aattccacaa aaatgcaaaa ttctctttct t tt gca agga attttaagct gatacagtgt tcaagtgaga tgtaatggtt tctggaagca tggagaagtc cttagataca ttcttcataa catatctgtt tcaatctttc ctatttttta agatattaat aggtcttaaa tggaatctat ttgcagcccc atgttcctag ttttatagac tgaaatacta tttgacaaca ttatttataa ggattaaagg attacatcat caatgcattt acataatttg tttgtcttta agtttcattg cttgttatgg ttctccattt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 W0005851 0 [http:/twww.getthegatntgcoml&ogin.dog/Sexam.support/Fetch/Defaul.doQNVO005851 0.cpc?fromCache= 1 part= maintooibar--bottom] Page 606 of 737 WO 00/58510 PCTIBOO/00435 gt tagactga gttcatatgt taacttctat acttgcaact aagatattgt tgccattttt tgggcaaagc acacattctt ttctatctgt yttatgcttt atatgagaat tcccatactg ctttctgtag tttcccaaat tcccttagca agatatctga ctgcaatact gttctaatct ct ctctgact tgcctcatga gaagcttaac gcagcagatc catttctact tctatttgag gtgccggtct gtggtgggat tttgcctgta gtttatagtc ttcctaaaaa cccagctccc actgaattta tcttctctcc ctcacatatt tccttaattt ttattcacta gagtagcaga aacaaccctg tgtaatcaag cacaggtttg atttgtgatt attaagccca tttccttaca ttattatgaa ttatgtcatc tctctgctca ttgtgacctc ttcccattta attttatagt catatccttt atagccagac ttaaacattt tttgaagctt gctccttctc ggaaaccaat actgcctagg agaaacaatg taaatgagct ttttgagatc gccatcttga ctttaaacag ggtaacggat acttggatat ctcatttcca tcactcaaac catgttttct agcctttatg gaagtccctc ctattatttt tgggcaaatg g tt t tcact t ggaaatgtag ctatgct gag tactgaccaa ttaaaaattt cccacattct ttcacagttt tttaagaaca tattttgact tctttaatcc tttctaatac aaaacccttt caaatccttt tctctaacgc gggctacttc gtcctctctg ctgacttccc tgttatattt ccttccctct agagtagtca tctaactaaa ctatttgagt tcattcaacc atcttccacc aaatccgagc acttttgtgt gataccctct ttctttagcc ctctgtctgg tcatctctgt ggaaactcaa caataacagt ttgtcatgtt 305 gacttaagta tgtatcctag gctgtattat ctaggtactg aaaagaaaaa taaaagtaaa ttcttgtttc ctcaccaccc gqtggtgt tt ccaatttgca aatttatttt cttctgtgtC ga tcctct CC aacttccgtt ttgcaaaatc tttccatatc c a acat tact tgggccttct gca act cct c gctcttataa tggagtagaa gcattcaaga tttgatttct aatgcatgtc taagatggta tggacactga cctatctaag tagggtctga ttttaatccc ggtcagggaa ctccccgttt gt ccccagct t tagcgtcct ggaatctaag ggcctttcag agggtattat gtctattttg aagagtttct aaaaat caac tattaattta tcacaaaagt aatttgatct gatttaccaa tgtgtctgca tgtttcctga aacttcctcg ctttccaatg tttatactca tttcaaatct t ta cacctt t agacaggttc tgacactgta ttttttctct act gaa cctg tacatagctg aaataaaaat tcatttctac agtgcaaggt tttgctgaag tgagctcatc gctatgtagc ggaggcatat cttcacaccg tgggaccatc actctgtcta ctcttcacag ggagatcaaa atagactact attattctgt aaacat taat tagataaaga cacaaacaag cgtgtttggc gttattacta tattccctaa gtaaccttgc tttcccacca agcattctga agtaccttat tgtgtgcttc attaccgtat ctgtgctcat agcatacttc ttaatgtttt ccttctttaa ttttcttgcg cacct ctaaa ctctatctgt tacgctggat aacctttctt ttaaatcagc ttgaattctg gattcattgt ttacctccgg tattcaccag ttacatagat tacccctctc aatttgagac gcgcaaatga tgacatttct agcaagatag ctagccccta 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> 136 3001

DNA

Homo Sapiens allele 1501 99-25979-93 polymorphic base A or G misc_binding 1482. .1500 99-25979-93 .misl misc_binding 1502. .1521 99-25979-93 .mis2, complement primer bind 1409.-1427 upstream amplification primer primer-bind W0005851 0 [httpi/AMww.getthepatent~com/Login.doq/$exam suporFetch/DefauIt.dog/WO05851 0.cpc?fromCache= 1part~maintoolbar--botom] Page 607 of 737 WO 00/58510 306 <222> 1924. .1944 <223> downstream amplification primer, complement PCTJLBOO/00435 <220> <221> misc Tbinding <222> 1489. .1513 <223> 99-25979-93 probe <400> 136 tatggcttct ttcaacataa gatattacta gttattatgt agctcgtgga tggt tcat gg actataacag tgacacagag tcttcgattt aggagtgtgc gtttgttccg gctttctcta tcttcttttg aaagtgtaca ttatgtttgc agtgattctc catctaatgt aaactcctga gtgagccacc ttgttacttt gggggaggtc actgtggctt gtcacttgac aatgaaacaa ga t tgacta c rtatttgtgc atagtaaaaa tattattcaa aacggcccag agttgctgtg ttacctggga gttactgcgg ggtgtgaatc ggctagcctg aaatctatgg caaatccaca agtatttttt ttttagcaca agtgaaaata tcgatcaaga ccatgatttt tggggaaaaa ctcctgcgtt gaacttttaa cccccttttt agtggcacaa gctcagcctc tatttttaat tgtgatgcac caaccggaaa t <210> 137 <211> 3001 ttccgtaaac gagaaatgaa atatcaaatt ctcagggaat gcagtcagaa tgcccttaaa atataataat acaaaatgta gtaaaaaaac ctataattgt taatttttac aacataaaaa ataaaattat ctttaatagg agtgcagtga ctgcctcagc ttgtattttt cctcacgtga acacctggcc ctggctgctg cccatgt tgt ccactatggg ctaaaccctg acgccaaaca ccgtggatca tatccat tag tagaaacatc tatattgttg acaggagttc gatctttgct tcttcgtaga cttcacatga aggcagcaga tgcaagaaaa agtcgtttta cgttttctat tcctacatga tcactattat tagaggatga atgaccccag aaggttttga gtaatttgag tacactaaat gagataatat ttctgttttt tcttggactc ctgagtagct agagatggga ctgcctcggc acctatttta atgccttcca gtgtgacttt agtaatattt agtgaagttc tacacacaac caattacaat aatgaaaaag aagacactaa acagtatctc ctgtgaagga aaaattaaaa ctactgcctg gtgttttctg atatttgttt cacaatctca ctcccaagta aatagagacg tctgcctacc actttaatag caaacttatc gcagtctcca gccaagtgtt acattcagat* tcaagagaca gcctgaagct taaaaattac cagatattct tcgtgtggca ccaagaagta tctttaaagt atcacagaat tacccactgg aatgaaatat ggtgtaactc ttcttggcta gtaagaatta ggaagttgag tcgcttccta ct tcagggaa gaaattggtg aaatgcatat aagagttggt tttaaaaatc gctagaaagt gttttttaag actgcaacta gggactacag tttcaccatg ctcccaaagt agacaagtct cactaaactt tactttcact gatattaatg caggaaagta acttattaag agtaacatca atttaaaata tagacttgct caaaggagaa gaaatagtct taaaactcac ttacattcaa aagtatttgt tttgttattg gctcactgca gctgggatta ggtttt tcgc tcagcctccc aatatttgat cacccttacc caggaagtca ttaactaatt gttcagtact ctacagtaat tcaccttttt caaagaggag atgaacccta ccaacgccag ggt tca ggt c gttgtccatg cttggtccct atgtgcatgt agtctgtatt agtctgaaga cataggtgtg tgcatctaga acatttccgc ctaacaagaa attgtggtgc aaagttttta gttctttttt taagacttga cattagctaa taagatctgc agtcttgctc ctccacctcc gaatgtgcca ttggtcacgc gttaggatta cttttccaat aatcatttct caaatactta ttattatgtc agggagacag tctgccatct aagatcactg ttgtgagaat ggccgcaggc taaagcaaac caaaagaaaa aaaaggtctt gcaggttcta ttaaagacaa ttatgttttt acctctgcct caggtgcccg atgctggcca aaagtgctgg tacctgggta tggtagcatc atttcctgca ctggttggag aggagtttgc cggagacaat tttcaaagtg cataatggaa ggaaatttac a ga agaat ta catgagttgg gattgcgggc aacccagatc acattcaagt atctgaactg gaacactgaa tttcacattc aaggataacg tacatttgat cttcaagcag tttcagaggc tcttgtggca tgtgtgagtg gctgaataaa gaacttataa ctacataaag tgttgcccag cgggttcaag ccacactcag tgatcttgaa caggcgtgag tctcttttgc gggtttttgt aagagtattt t a atat tcat gggaatgcac tctaaggtca ttcacgcatc gaccaaaatg tttccacaaa tacagtaaaa tgtagcatgt aaatgcaatg cagttgactt ttgtataact gtttgtttgt cctgggttca ctaccacgcc ggctggtctc gattacaggc tggcagacac tctttcttgt tcagttgccc agggaggaca ttcttaagct gcagtgacag cattttgaga gcatagagaa acaacagtat attgctgagc gaacttgctg atcatcagta tgcagaatca tt ga aa tgat tggtccccaa attaaaaatt tttaaaatct ggggaaacat caaacctttc agaggctttt cagatgtcca aagacaaaaa cttcaatctg atgtgatgat tacaaaaagt gtaaagaaaa gctggagtgt caactctcct ctaatttttg ttcctgacct ccactgcgcc tagatgacac 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 W0005851 0_[http:/lwww.getthepatent.com/Locgi~oc/exam.suporFetchDefaut.doMVOOO5851 0.cpc?fromCache= 1 part=maintoolbar--boftoml Page 608 of 737 WO 00/58510 PCT/EBOO/00435 <212> DNA <213> Homo Sapiens <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> k<221> <222> <223> <220> <221> <222> <223> allele 1501 99-25980-173 :polymorphic base A or T misc -binding 1482. .1500 99-25980-173 .misl misc Tbinding 1502. .1521 99-25980-173 .mis2, complement primer Ibind 1332. .1352 upstream amplification primer primer bind 1817. .1837 downstream amplification primer, complement misc Tbinding 1489. .1513 99-25980-173 probe misc feature 1245, 1633 n=a, g, c or <400> 137 tgtgcatgta gtctgtatta gtctgaagag ataggtgtgt gcatctagaa catttccgct taacaagaac ttgtggtgct aagtttttat ttcttttttt aagacttgag attagctaag aagatctgcc gtcttgctct tccacctccc aatgtgccac tqgtcacgct ttaggattac ttttccaatt ataga t ttat caaaacacat gttagccagg gtttaaactt ctcataacta cattcaagtt tctgaactgt aacactgaaa ttcacattct aggataacgg acatttgatc ttcaagcaga ttcagaggcc cttgtggcaa gtgtgagtgc ctgaataaaa aacttataat tacataaagg gttgcccagg gggttcaagc cacactcagc gatcttgaat aggcgtgagc ctcttttgct tgtatctcaa tcatatggaa catcatgagt tgacattgga acacttggtc tgaaatgatg ggtccccaag ttaaaaatta ttaaaatctc gggaaacata aaacctttct gaggctttta agatgtccat agacaaaaac ttcaatctgt tgtgatgatc a caaa a agt g taaagaaaac ctggagtgta aactctcctg taatttttgt tcctgacctt cactgcgccc agatgacact taattcaatt taaaatactc gattctgttt taaacactaa aaataaattg gtgtgaatca gctagcctgt aatctatgga aaatccacac gtattttttt tttagcacat gtgaaaatat cgatcaagaa catgatttta ggggaaaaag tcctgcgttt aacttttaag cccctttttt gtggcacaat ctcagcctcc atttttaata gtgatgcacc aaccggaa aa ga t ttt t ttt atttacatct tttagtcttc tctatcacag actgtgtttg cgtactgaat ggcagcagaa gcaagaaaag gtcgttttat gttttctatg cctacatgag cactattatt agaggatgac tgaccccagg aggttttgaa taatttgaga acactaaatt a ga ta atat g tctgtttttg cttggactca tgagtagctg gagatgggat tgcctcggcc cctattttaa ttaagtttga gtccagtgtt ctaanaaccc agaagtaaga aatatt ggct catccaaaaa atgaaatata gtgtaactca tcttggctac taagaattat gaagttgaga cgcttcctac ttcagggaaa a aa tt ggt ga aatgcatatg agagttggtt ttaaaaatcc ctagaaagtt ttttttaaga ctgcaactac ggactacagg ttcaccatgt tcccaaagtg gacaagtctc aaggagtgct tcatagtttt cataaatcag tcgggtagtt ctgaaattta tatttcatta 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 W0005851 0 [twwgthpaet oIoin.dog/Sexam.supoprtFetchDefaut.doqNVO05851 0.cpc?fromCache=l1part=maintoolba~otm Page 609 of 737 WO 00/58510 PCTIBOO/00435 gcatctacca wcctcaatgt aaacgcacca ctagaatagt aacatatttc taaatatttt ttattttcta atttttttaa aacaacactc tgcactcctg ggcttctgaa cattgacatg atgcttttaa aggatttcta tggtaggatt acttgaatat actccttagc ccagaaatgt ggacattgga aatggttaca aatttagaat caaaagaagc acaaataggc gtttagtata tggggaaggc agctgctatg catgctggca catggtcctg gcctaaaagt gcnaatatag cataaacata gatttaatat tgcctagtat actcattttg ggagagcctt acttcactct ttgaactctt tgaagatcat cttgatattg ggtgattcat tat atgct ac gtcacagtgt taaatctcct gtaaaagaag caaagtttat gtttaatata taattggttg cacaggtcct agtgggcaga ttataaatac ataaacaaat agttgtctat ttccgctgag catacacatg gtgtatgtgt aagggaagaa attcagggat ttaacttttt tatatggcat aaagaactct tggttttggt ttgctgttgg attttgctct tctctccttc actttatggg ggggcatctg acagtttact acattatttt ggtggcagtt gagtcactaa attttctgca agggttggaa tacatttctg acataaacgg gcttggccca atcccaagag ttcctcagtg ttaaaaccta 308 cactgggctg tatttggaga atttttctca aaagtctttt ttatattttc aaaaattaaa ctattgcctg gtaccagagc gcccttctct taagcatggc gttctgtacc cagagtttat tctaccacat tgattctccc tgactgtgta aaagactgca taaaattt ta cttcctagtt aagcacttaa aactttttat ttgcaactat gcatgtctat taggttctat catctcttat ggggtttcat gccatgagcc gattggaggg taggctcaca tatcatgcta ttcataatca tctcatttta atagtattct tcaagacagt agctgtccta tgctacggtg tccctcccct cctccctttt tttacatgag ataatttgtt tctgtctggt gcatataaat t ta ga acaa a cttgataatc actcttaagt atatatatgt gaaaagggca cccacactgt gct cca gcca tcatagtttg gttttttgga gtaagtattc ttgtatgacc tcagatgtgg ttttaaacaa ccggaaacgt tattttcata attgtattct tgtaaaatac ggcattaaaa aaaataaaaa tttgcttttc gcttccttat ctcagatttt gacaaaaaaa atatgttgac ttggagaatg gctgtacttg atcagctggt tgctttgaaa atatatagag attagaaagg aatagtaaat catcatagca cattgtattt tgaacacctg accctctgga acactctccc tgtgatttta 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 138 3001

DNA

Homo Sapiens allele 1501 99-25984-312 :polymorphic base G or A misc binding 1502. .1521 99-25984-312.misl, complement misc binding 1482. .1500 99-25984-312 .mis2 primer bind 1794.-1812 upstream amplification primer, complement primer -bind 1293. .1i310 downstream amplification primer misc -binding 1489. .1513 99-25984-312 probe W0005851 0 [http:/twww. etthepatentcom/Login.dog/Sexam.support/Fetch/DefaultdOgNVO005851 0.cpc?fromCarhie=l1 part=maintoolbar-bottomj Page 610 of 737 WO 00/58510 PCTIBOO/00435 <400> 138 agcctggttt ggaaggacaa a gat t tga ta gtccctctgc ggagaataaa ataattggta tgtcctctct aaaatgtgaa ct t taa gaa g atgtcttatt accactaaca acctaggacg aaacatggac agcataactt caaactccag aatgagtgta gtttgcaggt attagtgccc cccacagcag tgccagtgcg ttagaagcca aattctaata atactgggtg atacacaaga gcagattatt rccaagatgc tagctaaatt actgcttacc aaatactatg tgtggtggta gtgaacttga aagattttca gggcgtatgt accttttatt agaattcaat tctccatatt ccagttcctc tcagaagtgt ttaccctagc tagggaggaa gtgaaaaaag atcattgact taagaatata agtgtctaat tctgaactta ttctccatgt acataatagt gtaataattg tatttggatc ttctacccta gtgattgcag tgagactgca atagtgccca caggcaactc tggaaaacta ttttaaacat ttgtgttatg ggatcagtac cactttgcag tctcaagtgt acaacaaaaa ataagaaaga tcattttgac agt gacagca gaaatcctag cacgttcccc gaggccattg ttataaaaag a aa gaa accg taatcatgaa cgcagtctat ttcctgtcac ctcctaccat cagctcccac ctacttgtga tagttgaatt ggccctatgg tagatagcat gaaacagttt gaaacacgag cagtttggtc ggccatcttg tagggtctga aagataacca atgaatagca ttttttagct atctatagaa gttggtcttt aaacattgct tattggagaa tgatgtctaa catattgata tttacataac ttcattaagc ccaatggcta caatgaagtg tgtatatatt gggtatcagt ctctgttaaa aaggatactt aaatgataga taaaccatgg gaatggaaaa aaataaggtc ttgactcaag atatatttga acttattgtt accaattcct ttttaactgt tcccaatcag aatgtatcaa taaatgagat cagcagaacc gt aga aa tat tcctaactag ca a aat tcat ggagatgatc aggcccca ga tctgtgaatc ctttcagcct ggtattttat aggactataa ctggtaggtt aacaacaaca tttgataagc gtaaatattt agttgtgggt tcaacaatta aattgacaac ctttagattc ttgtgtctgt tacagctgct agaagacagc ttaatatt ca gaggaagaaa tttagaattt ctaactttaa tctgtacaga ggaagaaata t ta tggca ga tgaaagtcaa ttttattata aataatataa taataaatat aattccaatt catgattttt tatggagcac tcaaacaagg atcaattccc t gaag t tggg caaactcaaa ttgagtatct cattttagcc tagaaaacca ctgtgcatgg ttctaagcaa taaaacacaa at ct tga ttt atcatacaca a ca tt cact c acggtcttaa aagaaagaga tgccagtgca aagatagaga gtattgaaac actcatgagg gagcatcctt aggaagccag gcagaactgt tatagcagcc tatgtagtac gaagacaggg aaaaattacc agtctgtgat aatctggttt attaataaag gccattaaaa aacatgaatt caaaggccga gagtcccagt gtgattattg tat tat ta ga cggtgtgtat gaatctgcga a gga at ttt t tatatttttc agtatgaaga aaacctacat gtcacctctg tccattctac atgacctcat tttgactagg tgccagaggg tccctgaaat aaatttattt atgtaatqtt ga aat at tgt taattatatc ttatccatgg ttacatttaa tatctacatt gtttactatt ttgacttcaa tcatatatga gaataaaaga aacatttaga tattggttgc tctatgtagg tttacaaagt caatgagttc gaccgactt t aggtactaaa aaCtaagtag ctaatctcca atggagccct acttcttcac tcctcaccag gaggaagaaa tgaattaaga cgatgttctc atcctgctaa tggtcccaaa gtagtactta gtgtgttccc aaattgtatt agatggaaat catttcttca gaaaggcaac taccctcttc gaattgagct gctgctacca tcccttggta ttagacttcc ctgagtctca ttcatgagct gctgctccta taggaagggt ttcctagccc tttaatacag tattaaaaga aagtttctca ctatgcatgt ggcccctggc tatttttaat ttcatacagg ttatttctat ttctgtacta agagaagcta aaaataatac taagatgagt gaacagaatt aaatggtgag tttttcatca tttccactta ggtaattttt ttaaaagttt taaatttgtc attgggttaa tacctttcaa taccttagta gagagaatga tttattctag atgtaataat cattaatgga catgtaaaga acactgaatc tttgtgttgt cactattata agctggggtg acatcct aca tgtcagtcat ttaatcaata aaaactaaat gaattatttg aaacaagaaa aaagttatgc tcggaacatt tgtaaattgc aagCaaggca ctaatgttag tggcttgtac ttgcatcttg cggaaaattg gcatcaatgt ttttgcacgc agggcaatgt act acat cc t atggttaatt tggatccaat ct aacact ca gatagtcgtg attttaagtg tattatgggt aaaacaatct tcccaagttt gattttagtt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 atgttgaaaa tctttattaa atatatttta aaagcaaagt <210> <211> <212> <213> <220> <221> <222> <223> 139 3001

DNA

Homo Sapiens allele 1501 99-25985-194 :polymorphic base C or T W0005851 0 [http:twww.getthepatent.com/Loginadog/Sexamsupport/Fetch/Default.doqNVO005851 0.cpc?fromCachie= 1part~maintoolbar--bottom]Paqe 611 of 737 WO 00/58510 <220> <221> misc-binding <222> 1481. .1500 <223> 99-25985-194 .misl, PCTlIBOO/00435 <220> <221> <222> <223> <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc binding 1502. .1520 99-25985-194 .mis2, complement primer bind 1308. .1328 upstream amplification primer primer bind 1756. .1776 downstream amplification primer, complement misc binding 1489. .1513 99-25985-194 probe <400> 139 ccctggtttt at tgt gctt c aagcctttat cactttttaa ggccatgagg gggagcaagg tagaggggac aattgcacaa aacacaggct tgaccacgat aggaggccaa tctcattctg gtcctgcttt ccaaactcac ttgcaatggg acatcatgac taagttcctt ttccgtaatc gagacagaat ataaaaaata tgttccaaac ttctaatgca caaatgagat aaatagatag gtcactttgt ya ttat ta ca actagataag ttaagacatg aacttaaaac ctaatgtatg tatgttccca ttatttatag gcaataatat catattgtta acatttccaa agactggagt caatctagta atcttatttt ctccctgccc cagggacata gagattgtct cattcaaatt cacaatagca tccagcccct tggggcaagc cttccacaga ggatgattgt tcccgggagg caaacttggg gtttctctct caggctgacc gtgtttggga atcatggtgg tggtgcctaa aaagaaagtt ttcaattaat actagggcac ctttaagtca atcaaattta acaaggtatt actagttcaa taagtgttca ttaacgacaa acaagagaac gctgaactgt atattaatct ctgtgctgaa aatgctaaac ttataatatc atgcaacat t accaccctat tctttttttt gcagtggcat gctaggacta atttatttat cataatgttt ctcaagccac gaatgacaga ctatacttgg ggatgacgga ccactggcat tactggcagt ctaatgaatt cattagcact ccagcctgtg ctcacatcgt gcttcctcac acccaggctt gtgaaagtgg tgattgatta atctattata tcacttatct agtttagtaa aagtcaatat caagacttta agtatttctc t aa aca act a aaaaacacaa gtatctataa aaaaataaat atttttatag ccaagaagca ctgacaatca aactttactc ttattaagat atgtaacttc agacacatat aattggataa ttcttttttt gatcacagct cagcacaccc ttatttattt ttgtatttcc aat tt t tagc gaaggcaaag gcaaacatca gcagtccctt gattcagtac atttgccaca gaggtgagac tgaccaaagc gggaatcagc gagagatgta t tcct gat ca cagaattgag ggattgtaac tttctttttt aaatttggca ctcttttatt tgaaagaatt a cat tat ta a tatttttgga tttcattcat actataatgt ataacaaaat cctacttagg accttagatc atttgaactc t ct gtgat ta cttgcaatca cccatttctc agtctgaaaa tagatatata gtatatgtgt tacagttcca cttttgaggc cacggtaacc aggccaccat atttatttat agataaaatc tggagacatt aggca gct ca gctccctccc gtctcctgct aggcgtccat tcagcattcc tggggtctaa cagtt tgctc ttaggtagtt tgtatctccc tcagaaacta ga ct cttact ttgcctcaaa ttttttcctg tttgcaaata gaacatctcg gtaaattaac tagtcatcac ataatttatg agccctgctt ttggacatct tcataataag tattatttca tgtacaaaag agagagctct ttggggtgtc ggtaagattt acatacggag taaaatttag ctgtgtagta atacagacac taagcaagtg agagtctccc ttgaactcca atctggctac ttatttattt aaataaaatt tcaaggaaat aattacctaa tgatgtgtct ctgtgttcat gaattgttgc tggttcagaa gttctgcaat agaggattag aacctttacc atttccctct cttagaacct tgcgcagtta actgatgtat gagaaaagca ttggatgagc agcccatact ctttaacttg aattttgttt cagttaaata tgcttacaat gtgcttttaa taaacacttt gc at a atat a tatagactga gcacatcact ctccctgtga tcatcctgag atgattctaa atttgacatt taatatgtta ttgagggcca agttctacct tctgtctccc gggctcactg tt tggtttat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 W0005851 0 JqV 'ItwIww. gethe patent. comI~ag in.d oa/Sexa m. support/Fetch/Defa uIt. d OQAN0005851 0cpc?fromCactie= 1 part=maintoolbar--boftom] Page 6 12 of 737 WO 00/58510 PCT/IBOO/00435 ttcttataga cagtcctcct gccctccaat ttccatactt cttagtatca cctctggtga cataccaaat tagatgtaca ttatttatag acaaagaaag aaactacagg caaaatagcg catacttgca a gacatggtct gcct cagcct ttttttcctt acttaatatc ttgaagttct aatcattata ggcacccctt tatattcaca tgaatgtaat tgtgtattag agcaatctga aaagccaggg agaggccagc cactgtgttg cctgaagctc attttcaatc tgaaaaccaa tggaatttaa actgactgtc ggggaggggg atgatgatta gagctttccg aagagctctt gaccttgact gtgttctacc atttatttat cctggctggt tgggattaca tgtgccataa attttttgat gatttttatt aataatgttc tgggtgtgga cccagcagga tactgagctc caacttacac agggtaagtg aacagcacgt tttgcattgt ctcaaacttc tggtctcaag ggcatgagcc cttctaagca tcactgggaa tttgaataag aagaagacag aaaaaagcta atatcttaga aactcttttt catcaattgg gttcttagca gctgtatact acgcaaacat actgccccta tatgtgagtt tgccggaccc gcacatatca aattttaata accaagaact acaaggctgc agaaccacaa actctctgcc gagttcatga gagttccttt cttcagtgat 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <2 23> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 140 3001

DNA

Homo Sapiens allele 1501 99-25989-398 :polymorphic base T or C misc -binding 1502. .1520 99-25989-398 .misl, complement misc binding 1481. .1500 99-25989-398 .mis2, primer -bind 1880. .1898 upstream amplification primer, complement primer bind 1346. .Y366 downstream amplification primer misc binding 1489. .1513 9 9-2 598 9-3 98 probe misc feature 1322 n=a, g, c or t <400> 140 aaaaaagtca act ccaaaga aaaatgtctc aactgttgtt ctcatggaaa tagctaatga tatcacagtc gccttggtta atttcatctt tgaatagttc caaaattgat gagcaaggca agatattcat taagatgaga accctttaca ttatgatagt tttcaaaatt gcctttctat actgaacaaa ggagaaagta cttaaaccac ttttatatcg gtttctgcaa acttagggtt gaaatagaag tctgctcatt tgttccctgc ctccagagta atttcatgca gattatttag tatatcaaag actggaaagg ttaagtatta catgtacttt tatgcattaa atagcctttc tatgttatat tcaatcattt aattgtgatt ttttaaagtc ctgtacagct ctatcttttt W0005851 0 Ctqp Lllwww. getthe patent. co m/Lo i n.d og/Sexa m. support/Fetch/Defa uIt. dogNVO005851 0.cpc?from Cache= 1 part= ma intaolba r--bottom] Page 613 of 737 WO 00/58510 PCT/IBOO/00435 ctagttggat gattttgata acctataaaa gttctttcct tactagatac tccagtccac tgattcagga gtcccaaatg ttttacgaag ttcctcagta aaatgaagat ggaccatggt agtgaaagca agagattctt tttctaagct tnagatggaa taatctgaat ttggaaagac ygtaatgatt atgcaaatag caattaccct ggtgagagat ttcatgattt tgctttttaa acctatagtg agaatttcta tgtttcacag atcatacatt taacatagca attgggactg acccatcttc acattttcca gacacaacac gattacactt tgtgacattt atggctggca acaataagca cttcaaattc cactgtgacc aagtgtgcag acaaaatgaa tgtctgagga ctgccttccc g attaaataat gctgaaaaat gtaaattttg ttcattcaaa tgtaatacaa actgtctcct cgaatgagtt gaaaggccag tattttctca caaagaactc gctaattcac ctttcaaaag tagtactatg ggaatctctt ttctaaagtc agtaatattt gaggccaggg agtatgcttg attataatta ctctcaagaa ggaattagtt tttacctttt cagggtaaac atgtctgcat taacatgggg atacaacatg gtatccacct tcttaaatac acactacgct atgtcattta aaggactacc aaaattctag acaagcatga aacttataac aaactgttat gaaatcagtt acgggcatga ctatcagcaa ctgctgtgtg acacttgctc aaaagaaata actatccaca cagcctccaa ttaaagataa aa t tggat tt tatttttcta aagcatattt gaaaaaaaaa ccagatagtt ggattttacc catatgtgaa ggtacctaga caaacaccaa aatgcctgct ttttcaagaa agttcagggt ctaagattcc cctcattcat cgttttcaca ccttacctct agtatggtta tcgctgttat ttactgtctt tacatgtggg attgttaagc tcagtggcat tatctaagaa atttgaagat atccatgtgc agcattgttg aaaacactgc ccttgttgtg tgaaagttag tgggacattt agataaacat agccatgctt atttcccttt gacctagaat tctaaaatcc aatttttaaa aagcaacagc tcatgtcctg tcctctcttc tttaagagat atttgatccc acaccaaatc 312 tgatgttcca agaagaatcc tagtatcaaa tacaagtcta aaaaaagtca tgcatttcat aattaaaagg agcctggaag gtatatagac agataaactc ttgtatctac acttggaaat catagcagaa tgttcatcta caatgagctc gttgttttca agaaatttca gcaaagtcca ttgagttagt ggaatacaga ggtcggagag atatgtacat tgcacttctt tactaattag aagatgggag tgccaaagtt ttctcagcat actacctgaa gttattctgt ttaacggtaa tagaatactg attcagatct actttttgat ttctatatgt ataaagttaa tccttatact aggtt taacg agactcctgc cgagagattg tcccatcata taacaaactt at gcagggac cagcccactc taagctatgt aaattttttc atgatatgtt cttggtatac ttgcctgccc ttataaaata gattggagtg gtcaagattt ttcccttgaa tttttaatct at ggt ccca g atggattaac aacaaatcaa ggggagaata taatcctcat aatcccaata ttttctaaaa tagtgaatac agccactgat aaatcaaaac a aatgact a c tagcactcca cgttttccaa gt tt gt tt ta agtgaatcct cagagaccac gatatttgtc aaaaaaggac attgtaactc aaaaagttgt aaaaactagg gtgctagaag ctgattcaca gcatcagacg aattgctatt gtccccgtct atggagacag taaggaacgt cacaaaacaa ct agacccag gtgagcactt aaactttcca tctttaagat ttaaaaatta aataaaactt acccatgaaa attttttagg ttgaggaact tagtaattcg acagagaatt cttaaaataa acctcacacc ttttcacaca atataatgtt agcagaaaag agccttcgga ggcca agt tt ggctttaaac tgaactgaaa catttgtatc tcagtaaata agtagttgtg tatcaccctg caaaagtgat tcaagccatt aaatgacttg tacttactgc agttgtgagc accttgtctt tcctaaaata tagcattgat tttaaatgga catggaattg ttttaggttt ttttaaatat catctttaga tggtgctgac ttttttcaaa tcagttagtg aagatgtccc tctcagatct cagtgtaatg gataagatgg tgaaagggtt tcttacccat aaatcaattt 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <2 11> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> 141 3001

DNA

Homo Sapiens allele 1501 99-26147-396 :polymorphic base G or A misc binding 1502. .1521 99-26147-396.misl, complement misc -binding 1482. .1500 W0005851 0[http:/Avww. etthepatent.com/Loagin.dog/Sexam.support/Fetch/Default.dogAN0005851 0.cpc?fromCache=l1part=maintoolbar--bottom].Page 614 of 737 WO 00/58510 PCTIIBOO/00435 <223> 99-26147-396.mis2 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer bind 1879. .1896 upstream amplification primer, complement primer bind 1433. .1453 downstream amplification primer misc -binding 1489. .1513 99-26147-396 probe <400> 141 ccactgcact aaataaaatt ttagtggtac gcctgcagca tgaacatctg atctaaatag agattggttt tgggaccaat ctctcttacc tagaaaacaa cccaaatctc ggggaggt aa agtctcatga ttttgacact accatgtgga taccagcagc tagaaaagtc actattgacc tctattaaac ctaaccaaaa ctaatgctaa ttgttgcatt tattttaccc ctaaattatt ctactattgc rcaattaatt tgatttctca gggaaatttc tagagacatg aaacacatta tcttgcaatt catattttct cat ct gga cc aaaggaatat a ca atat t ta catgttcccg gcagacaatg gagtttttca ttgaggatgc ctaactccat caggtccttt tatctctccc ttggctgtgt atgggagggc tgttcttctc ccaacctggg atatatatat caccttgaat aaacctctgt atgtgataaa aatagaattc ctagaagtac ttgtcctgtt taatactgat agttgttgat aacttgaatt ttaaatcatg gatctgctgg gccatgtaag actgtaagtc atggaaacag tatgcttaat taaaatgaag acttcacttt acacaccagt ctctgttatt catgaaatga aactaaaaat caactttggg tactaataaa tggaggtctt atcacatgtt gagattacta taqtcaatag gtttttgttt gaaggtaaaa tctcca gggt tccttggaca gga aat a acc agtcctaaaa ctggcttcct cctgatgtct aaccctgact cttcaggccc gcccaattag atctcctggg aaggtttttg ccccacccaa cccagtggga atgatagtga tgacagagta atatttctct aagcctttaa ccctgtctca atagaattcc tatttagaat tgctaattgc tttaagattg cttatgaaaa gataaaataa gtatctccca ggggccggtc gtttatcagg aagtgccttt taattaaacc actaatacaa acaatgcttt ttataggagt tatgaagaag ccttcaagga at t ta acaa c caacattaat ttgaagccaa tcaatctaaa attagttatt gggaaattca gtaatgccta tacaataagt gcgacttcat acctgtactc tccagactta agatgttagg agttacatac atatttttcc acagtggttg ctgcagtgga gaggt ccccc gagccaggtc ttctcctgaa ggcatctctc atttccccaa atcctactag atctcatctt agtaattgaa gttctcacga agactccatc acctcatgtt atactatact ctccccttca atctaattct tctaatatta tagactgagg gga tat ta gt tagagaatgc catatttaat gaattcccac ttttccatgc ggttccaggt tgcctcccac tctttttcat tattttgtat gagcttgaag tcttggaatt atgttttaaa caggccaagg aaaatcttgc gctttctgga taaaatgttt tttcaaagat tcaatttttg aaaaaagaat ctctgagaac aataataaat at ccaa tgt a aaggtagttc gatgctttgt ggtagtttgc ctttattatg cactatactg gcacttagta gctcccctaa ctcaatatcc atgtcatcct caaggcactg tctgactgaa aacaactgtg aggccaaggt gaattgtagt tcatgggaat gatctgatgg taaaaaaaaa tactcctctg tgaaacacta gttagagaaa attccatcta gcccagtaat caagttattc atcaaattta aaagctaaat atggtttggc gtgttatggg tattcttgag tttgcttcct catgactctg cccagtctca taatatcttg gat ttcaaga atctaaattt aaagaaagca agcttagaat ttaaaattgc tatagcatac ctctcagact acgttaaagt ttttaaaaat gaactccttg agtattgctc acatggaaga aataaaatat caaatatcca tagatttgat ctcacgccag act taatttc ataatcgaat agtaccttgc ggtcttagcc aaaccctggg ctcccttggc tgacattgct atttccagga aaaattccat acaactacct tcccgtaatc ggggactatt ttttataagg ttaaaaataa caaactcata tatattaaaa gaactgcatt attctat tct tgagttgtta tcctttatgc aacattatat ttaagattct tgtgtcccca agggacccag atagtggata cctcattttc aggcctccca ggtatgtctt gttaacttaa gggatgcatg tttttcttga aacataaagg tattttatga aaaaccagag ggtgattctt agttgcttaa tcagagaatg tatatctgca at ttat tggt taggcattgt tagagagata ataaaaaatt at gacct tca ctcattccct gtcttcctcc tgtatctata taaatatttt agggcctagg agcatttctt t tt gca ct ct tggtgtgcct actgacgatt aatcagggat ctttttattc ttgatatggt cccaggtgta acccccatgc gacttttcct 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 W0005851 0 [httpDJMwww.ettheatent.comLogin.dog/Sexam.support/FetchI~efault.dogIWO005851 0.cpc?fromCaChe= 1 part=maintoolbar- bottom1 Page 615 of 737 WO 00/58510 PCT/iBOO/00435 tctttgcttg tctgccatga aacctctttc ggactaatac ataattctgg gcaattctcc ttgctgccac catgtgaaga aggacgtttt tgcttcccct ttgtaagttt cctgaggcct ccccagccat gctgaactat gagtcaatta ctttataaat tacccagtcc caggtatgtc tttattagta gcatgagaat acccttttga aaaaattttg catcagtcat taaccttctt tgtattttcc ctctttccct cattaaacaa tgactgtatc attcttagtg ggactgagat 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 142 3001

DNA

Homo Sapiens allele 1501 9 9-2 6150-27 6 :polymorphic base T or C misc Tbinding 1502. .1520 99-26150-276 .misl, misc binding 1481. .1500 99-26150-276 .mis2, complement primer bind 1758. .1776 upstream amplification primer, complement primer Ibind 1323. .1340 downstream amplification primer misc Tbinding 1489. .1513 9 9-2 6150-27 6 misc feature 2165 n-a, g, c or probe t <400> 142 catcattgca cggttaagtc atctagcatt gtggcttcca ccactatcat tctggaaatg atgatttcaa gatatatagc tcat taaagt cacat tggaa gtagtggctc gttaggagtt aaacaaaaca tatttttcag aaaggtggca ttgaaatcaa agttaaaact taattagctt gaagtaactc agtggctgca aaatataatt aatcattaaa atttgaggtt tctatatagt aaactaagtc acacctgtaa cgagaccagc acaaaaaaag acagactatt attagcaagg acctaataag cactccagca taattagcag tttataaatc gtcacctgac attgaaataa ttatcccaag t tct tca gcg atatgttttt ttttaacctt gcctagcact ctggccgaca aaaaaatgga ggaaaggagg ctgggagtaa gcctattgtg tcgagccctc cataaaacct ttgaatgagt cataagctgt taaggtacta agaaaatcaa aggcccctgt actcttattc tgattaagat ttcggaggcc tggtgaaacc gtttagtctt cttgatgtct aaatgggcaa ttcacgcata tccagtcacc ccaaatacca a atca ct ta a gtt t tccat c catcttgtgc t atga tga ga tgtaacttgt atcagtatat aatttagcct aaggtgggtg tcatctctac aaattttttt gcaaagttag gacctaaatg caatgctgtg agaagagcat ggtagctgaa cttttgtgat taagagagct tgttttgttc atgcaagtat taattttaat aatgaggctg taggcctggt atcacttgag taaaaataca ttatgttaaa tgacaagtga atgttctgtg W0005851 0 [qp-/A'ww.getthe patent. co mILA in.d og/Stamsupqrt/Fetqh/Defa ult.doqA(wO0058 51 0. gc?fromCa che= 1 part= m aintool ba r--bottom1 Pa ge 616 of 737 WO 00/58510 PCT/EBOO/00435 atgcctccct aatgtacctg atttaatagc gaaaggtaaa agtcaaatcc acatgtttga ctcatccgac tctgtgccac gtttttaaca aactttagaa ygctcattta gaaccaaatg cgctcgcaat ggtacgaata tttagagatc tcatatcatg gccatgagtt tcccagcact tggctaacac gqcgggcgcc ggaggcagag ctcanaaaaa cagagcaata agatgtggag tttaggagat ctttcaatgc agtcccaggt ttttaaaaat gtgaacccca catgaacaaa agatagtcaa agaagaggtc aaagagctgc cattttacaa gtatgtttaa t gtctcgtttc gagaagggtg aaaggacaca caatgctaag ttgaaatgtt attgtctctg ttggctgtca caaaagtacc gagaaaaaca acctcaaaat tctccatctc tctcaatagg t catt ct cct ttgcagtaac agattatctc aaataaactc atttgggggg ttgagaggct ggtgaaaccc tgtagtccca cttgcagtga aaaaaaaaaa ctttctatct tctacaataa gagaagcttc tgcgagaagt gaactcccag ttcccattct cttggagaag t tgct t ttat aaactatttt acatttatca tagagaaaaa taatctttca aaaagatttt accttgtagg ttaatgcatg gaaagcattt gccttatgcc tctttaggtc tatataa tat ttcagttcaa atatttcttt atgtatcaaa atgaaaagtt cgtggaaatg ccttcctcaa ccaacaagct tgttcttgga atgcaactaa tgcaaaa tat gaaaaaaggg gaggcgggcc tgtctctact gctactcggg gccactgtac aaaaaaagat taaaggcctt t tt gtgaca a tgctttccat ccacaaggcc ccggcagcca gaccaaccac c aga act gt g ttaagccagt ctatttggaa ccacaaatat tggtacattt aaaaataatt cccagtgatt 315 ctttgttctt gggaacatta attcacacta agctctgtat aatttaaaaa tcaaaacaca taggtattat gcatctcaga ctgacatgtc agtatgctgt accacagtac actgagtctt ggtgtctttt tcccttgata tctttctaga atatttttgt ggggctgggc gatcacgagg aaaaatacga aggctgaggc tccaacctgg ttattggcag tttgcctggt aagaaaagtt gtatgtgggc atgtggagta gcagcccctt cagctaaatg ccgcctaacc aaatttgggg atgtttcata ctagagaaaa aaaaaaagct ctttgtatat cttattaact atttgtgggc tccaccccac ggaccaaaaa gatcatttct tcaggcatac ttataattgg ctactatgtg tgccatgtat atcaattaga taaataaact aaaacaccag atctcctctc caaattgcaa aaatattaaa acttcttgaa catgtttaaa gcggtggctc tcaggagatt aaaaattagc gggagaatgg gcgacagagt attgtatttc catcttgaag atgtcacttc tgccatttct gaagcacagc cca ga cat gg cagctaagta tgagttccta gtactttgtt ttttgtgaag aatcatttta aagcaagcat ttgtttttat atcaatgatt tgctgcttaa ctaggacatg gactcaagtt gattcattgc caatcatgaa a ga aaat a ca ctatatgcac catagcatat agatgcgttc gtccaaaata attgtcacat tgactctctc agttgattgt aaggcagaat gtacaagctt aaacatttaa atgcctgtaa gagaccatcc agggtgcggt cgtgaaccct gagactccgt taaacatggc ctttctatca tcaggttggc ttggaaggca caccgttgaa, acccagatca, aacgatccca gtctcagagt acgcaggaac acaaattaaa aaaatatgat tatcccagca ga ctga a agt tttggtggta 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> 143 3001

DNA

Hoino Sapiens allele 1501 99-26153-44 polymorphic base A or C misc binding 1482. .1500 99-26153-44 .misl misc binding 1502. .1521 99-26153-44 .mis2, complement primer Ibind 1458. .1476 upstream amplification primer W0005851 0 [hto:/Iwww. gettiepa tent. co m/L ogin.d og/Sexa m. supporlFetciloefa ult. d oNVO005851 0. pc?fro mCachie= 1 part=maintoolbar--bottoml Page 617 of 737 WO 00/58510 316 <221> primer -bind <222> 1885. .1905 <223> downstream amplification primer, complement PCT/BOO/00435 <220> <221> <222> <223> misc binding 1489. .1513 99-26153-44 probe <400> 143 accccatatt caggaaactt gttcccaaac gccaaggctt tagccatggc ggtccctagg gaggcactgc attgacattc aga aa ata ga ctgttttcct gctgcttaga acaaatccct ca cc t ttact tttcattgtc gttccaaact tgcctgttac gctctccagg tgaaactggg gggaggcct c agagagaatg act tatt ca c cgctgggtcc ggtggggaca* atataatata gtatatgggt matctatgtc agt tcct tgt taaaactccc atatgcacat gctcagaatt gatggagaga ttggggtgaa agaaatggca cattaggtaa atatacaata atgaacatat gcagttggtc tgaaccttga gttttaaagt tgttctgacc cttaaatttt atggtacaaa gcactgaatc acttttgtgt aagatgtaag gaaacaggaa tatcaatctc tcagtcagaa tggaggtgcc aga cgtt tt t g tcccttccac ct ga ctgga c cttaactctt ggggcttcca tagagtggct cccagcccat tgcaaacatc agctcctcat ttttcctttt tttaaaacca aatttcttcc agggcagggg ccagttccca catatcacta ttctcacatc ccattccaaa taccaattta gaatttatga acaatcatgg agagccaaga taccatgaga ctcccataac cagcca aacc atagaaatgt ataactaatg tacctgttca gcaacagata agcacctgca acatatataa ataacggtaa agtcagaaac taaacacatg acacctttca aattatttgt tctatattgt ttatttacct cattagaatt aagtttgata cagggaacta acagaataca gttaggcatt tcaaaggggt agtgtatcag ttgtttgcat atactgtgag accagggtag attgattctt ggtgttttgc aagaggttgg ttctattagc actgccctgg atccaggcat cacttctgtg ccctctgaag gggatgcagg gagaccattt tctgacatgt tacttatgca ct at cacat c aatgctttta gccagatatc tgaaatgccg ataagtttct tcagcatttt tttctatcct gttacttcca ctgtattaga agaaaaagag tagaaggtgg ggaagggttt acagtatggg acatgggaat a tat ca acat atacataact cttaatgcac gggtataaaa gtgtacagca ctgaacttcg tatttttata tttctcaaaa agagaatgag agatggtata gttgaaatca tttctaaacc atatacagca aagtgattgg gttggcgaag aggaatctgg tctgataaaa aaatgttata gacatttcct agggattatg ga cca at ta a tgtttaattt gtccattccc cttgcaaact ccaaagagct agggtgtttt acatgtgagt tgctttctct caaaggttct tttcatactt cactcgcagg ccacaacctg gcaccaagtc cttcctccta cctggagaca cattacttca atcaggctgc gcatcaccta ctaaataatc ccagtttctt catctccatc ggtcaaagcc cttcttagct cattttgggg ccattttcac gtttaatgaa aaggcatgtc tctccttata ggaaaccacc tatggaagct aaaatataat atgtataaca atctacataa tctttgcata attaactgct ctggtcaata tgtcaattgc acaaagaaac ggaagaagaa aagaggcagg acttacactt tcagttttat tatgtatcta cacataaaaa attcaaaggc atgacatttg gccacagcta aatagaataa aataaaatta aaatacccag tttatttttg actgaatatg tagggatagc ggagagaaaa ctgagcaggg gccaatgtcc gatatcttag at t taggct t cca tgagggc cctctgtaat ctcaacacca agctgtacct cctaggctgc ggcctctggg cttttcccat gcgggcttga aaattttctg aatcatatct tctctcaagt tgctaaaaca tgagaccacc attcaacaag ctccaaactg tat ctt ta ca attgctgata cttacatttc ttattttggc aagccaccca cccatgattc acaattcaag tataatacaa tatatttgat tctatataaa ctacgttaac gtcaagtttt agtgcattat tcctctagat ggaaggaaag aggaagtgct taatgtttca tacaatcagt atacacacac t acat a aat a tggtctaata agctagagat gtggttaata acataaaata tttcatttac aaatctagga taagagagga ctttattttc tatgttagat tgagtgaggg gactgatggt atggaataca tgggagctgc gcctcactca atgtaagatt cctgtccctg ctaggcagag tgtggaagct tggcccct tt acatggcagg tctgtgatgg tgtcttgggg atttctcctc aatttttatg tgaatgctgt tcaaagttcc tagcaagagt tcagcctgga tctctaggaa taccaacctc gcagcaccca aagacatacc tatgtggctg agctggcaag atctcttgag aattaccttc atgagatttg t gt aga ttat atatacctaa tcaatcaatc atagtataca atctttcctg atacacaccc tgagtccaat aaggaagggg gaaaatgtat cttctttaat gattttgtgt atacacaaat catctaaaca agtgatatta tgaa tt gca g cttattgaaa tgtttgagaa acattaatca aaagtcagtc aactgctata cctgatcata tataaaacta tcaatagaat gatcaaatta accgccccgt caccgaacga tgcttcaagc ttattttaaa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> 144 W0005851 0 htpi/twww.gettlhepatent.com/Login.do /Sexam.suorportlFetch/Default.dog/W0005851 0.cpc?fromCache=l1part=maintoolbar--bottomjPaqe 618 of 737 WO 00/58510 PCT/EBOO/00435 <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 3001

DNA

Homo Sapiens allele 1501 99-26154-107 :polymorphic base G or T misc binding 1481. .1500 99-26154-107 .misl, misc Tbinding 1502. .1520 99-26154-107 .mis2, complement primer bind 1396.-1415 upstream amplification primer primer Ibind 1903. .1920 downstream amplification primer, complement misc binding 1489. .1513 99-26154-107 probe <400> 144 gcactgaact taatattttt taatttctca aacagagaat atgagatggt tcagttgaaa tgttttctaa tgtatataca cctaagtgat attgttggcg ataaggaatc ctatctgata acaaaatgtt attgacattt ggtagggatt caggaccaat cattgtttaa gaggtccatt tagcttgcaa cttccaaaga tgcagggtgt tggacatgtg agctgctttc a at taga aa c gcaactttag kctggga cca cgcgtgggca agtgggttca tcgctggtca atatgtcaat aaaacaaaga gagggaagaa ataaagaggc tcaacttaca acctcagttt gcatatgtat t ggca cata a aagattcaaa tggatgacat aaagccacag ataaatagaa cctaataaaa atgaaatacc taatttattt tttactgaat ccctagggat actggagaga gctctgagca tttgccaatg agtgatatct tctatttagg ccactgacag atccacttta tccagggcca cgggttcctg aatgggtgcc ataagtgcat tgctcctcta a acggaagga gaaaggaagt aggtaatgtt ctttacaatc tatatacaca ctatacataa aaatggtcta ggcagctaga ttggtggtta ctaacataaa taatttcatt ttaaaatcta cagtaagaga ttgctttatt atgtatgtta agctgagtga aaagactgat gggatggaat tcctgggagc taggcctcac cttatgtaag tgaaactaaa gaataccctg gcagtgctgg tactcttccc cagaggagcc tatatacaca gattgagtcc aagaaggaag gctgaaaatg tcacttcttt agtgattttg cacatacaca atacatctaa ataagtgata gattgaattg atacttattg atatgtttga tacacattaa ggaaaagtca ggaaactgct t tccct ga tc gattataaaa gggtcaatag ggtgatcaaa acaaccgccc tgccaccgaa t ca tgct tca attttatttt tttggaggta ttcagaagat caggaatcta tttggggcat ctgggactca cccatatgca aatgctcaga ggggatggag tatttggggt aatagaaatg tgtcattagg aatatataca acaatgaaca ttagcagttg cagtgaacct aaagttttaa gaatgttctg tcacttaaat gtcatggtac atagcactga ataacttttg ctaaagatgt aatgaaacag ttatatcaat cgttcagtca cgatggaggt agcagacgtt aaagcctctg ggcatatatc tctaagtacc gcctgggtct gtgtggtccc gtctttgggt catacatata attataacgg agaagtcaga ga at aa aca c gcaacacctt taaaattatt a tat ctat at tatttattta gtccattaga tgaaagtttg agtcagggaa accacagaat tttgttaggc aaat caaagg atcagtgtat tgtttgtttg aagatactgt gaaaccaggg ctcat tgatt gaaggtgttt gccaagaggt t tt t tct att ctatttaaaa aattctagta ccttccagtg gaaagggact tcatcttatg tccattcaga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 W00058510 htto Jtjwwaethe oa tent. comlLoa in -doo/Sexam .sunnort/Fetch/Defa ut.d ooNVOOO5851 0.-coc?fromC ache= 1 Dart= ma intool ba r--bottoml Paa e 619 of 737 WO 00/58510 PCTIEBOO/00435 cccgtggcct ctggtcactg cactgtgact ccatgtctgg gtgtccttgc cagatctggg ctaatgggcc tgagtggtca ccagctccac cagaggcatc gatttccaca agttaaatgt tttggattgg cagcaggatg tcaagaaacc ggagggtaat cactcaatat aaggtagctg tccagattga aattatacat ctagggcatt ttcccagcct c catcggtcca tcacacttgt ttctggtgtg tttacatcag ccctggggtg tggctgcacc tttccaattc tctgccaggc acgcaaactc gtcaacatgg gagcacctga aaacttaaca attgtgatca gacaatgcca acagggaaaa aggagggttg ttgacagtta gacaatggac atcattatat aacataaaat cacactgttg gaaactctgg ggatatacca tgacacagga gctgcatgct tcaaggctgg gtcacccagt tctctgtttc t cct gtct aa tcaatgatgg catgtttatc gaagaggaac ttggaaaatt taaccagaca tgatcgaaga agtgatgagg ggccatctat ctaacttttt agaacacaaa agatatgtaa ttcacaggag gcaccatcat tgcagcttcc acccagtaaa ctggcagtca caaatttaga gattct ca cc catgggtgac ctttctgctg aagagctttt cctcaaccaa attgccatac cttcctgctg atcctctaca gttctgtgtt aagaattagt gaagagtcct ga tga tata c attgttcaag ttactggtag gagatagttc tccactctgc ctccaacatt aaccattttt accaccttct cactatttcc ca gtattt ct gcatagggct tctgggttcc agcaaccttc gctctgtact gagatgatta t ggggt ga ta tctgcataaa gggatcaggt tacagcaatt cacactctaa gttcacattt tgaaactcag ccagcattga tacaaacaca gagatacaaa ccgcatcaga tctactcatt ttgtatttgt aaatgtacag atcaccagaa tcactttcct ttccgaggat acctgcaatc aaccatggaa cttaccctgt ctatgtgagg gtccacaatg tcatgtttgc tgggattgtt gtgtggccag atgggttaca aagttgaaaa tgctatatac aggtcacagg aacaatgatg ggcctaacaa attagcccag caagaaagac gatataaatg tattgcagta tttgttggca atgtcttgtc ctccactgag 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 145 3001

DNA

Homo Sapiens allele 1501 99-26156-2 90 :polymorphic base A or C misc -binding 1482.-1500 99-26156-290 .misl misc -binding 1502.-1521 99-26156-290 .mis2, complement primer Ibind 1212. .1229 upstream amplification primer primer -bind 1702. .1722 downstream amplification primer, complement misc binding 1489. .1513 99-26156-290 probe <400> 145 ggaaaattgt tctgtgttca cactctaaaa gttgaaaaag ttaaatgtaa acttaacata accagacaaa gaattagtgt tcacattttg ctatatactt tggattggat tgtgatcatg atcgaagaga agagtccttg aaactcagag gtcacaggca gcaggatgga caatgccaag W0005851 0 [http:/www.getthepatent.com/Login.dog/Sexam.support/Fetch/Defa ult.doIwOOO5851 0.cpc?fromCache= 1 part= ma intoolba r-boftoml Page 620 of 737 WO 00/58510 PCTIBOOIOO435 tgatgaggga cCatctatat aacttttttt aacacaaaga atatgtaatc cacaggagct accatcataa cagcttccac ccagtaaaca tttctgtctg tgtctttttg agtatgttag cattttgttt tgtgaatgct gtatgtgctc aactgccaca agggttccaa atagctatcg tactgacatt aagaccccca ttcgaatcct ttgagtatca ia a tact gta actatttttt aacttgatat cataacaagg ttttataaac tactatcatt aaagcataac taagaaatag gaccccttaa tggcccatta gaggaaaaaa tttttgcttt gatttttctc gcctctgtgc ttaccctcct catccattta taaaaaatgt ttctcatgta taatactatg tttccttcga tgctggtgtg tgccaatttt aaaaaaaaaa ttttttatta atcttttgtt t tgatataccc tgttcaagta actggtagga gatagttccc cactctgctc ccaacatttt ccatttttaa caccttctat ctatttcctc tat gaat tag tgactgtatg aatttccttc atctattcat gctgctatta ggaaatggaa ctgtttccta tttcttcaca tgatgagtgt gaa aatct t t aaaacatatt aattccacca gaatttttat aaattagtct gcacccctct taattttaag aaaaaaaaac acgtgattaa tagcaaatgt tatattagag aagatgagaa tactttgttt tgtaagtaac ataaaaaaaa tatttttaaa tgcaaagccc gcgcctctct ttcagtgcag tgttttttcc tgttttttac aattactgat tatttttgtc aaacatctat t t tcta ct tt taaaacatgt agcgtctctt tagactatat tgccaaccta agcattgaaa caaacacagg gatacaaaat gcatcagaca tactcattga gtatttgtta atgtacagtt caccagaaat actttcctct ctactccagg agtgtattat tttataaggc ccct caa tgg acataggtgt tggctgatga tagcagctgc ttcttgccat gaggtagtgt ttataatgtc tgtctagggc cctattagct attggctgca tttcttgaaa tctatatctt aaagatttga acagaataaa aaggaaaatc attacaattg agtaaaaaat gctaaatgta aggttgtaaa ctaggatgag ttattttcag tgcataaggg cttcttttca gtctcatgaa tctggatttt cttaaagttt atgtatctag tttggggcag ttttaaatgc agttcttagt gt gctct t ta ctttcaaacc cttccttgag aagttttcat gtatatgggt 319 caatgatgtc cctaacaagg tagcccagca agaaagacaa tataaatgtc ttgcagtaaa tgttggcact gtcttgtctt ccactgagcg aa at tct tat actaatactt tgaataacat ccacctgggt tcaaaaacct atgaagtatt gctattttgc acatgttatg ctcattttgg tatatttata cttgtagacc gtgtagtgtt ttttaactgt aacaggcaga atgctattgt aattagccat gatttaagcc aattagaact ttttctccag agtattttat ctgaatctgg aggttgttgc t aatga aat a tatgttatat acataagaca gtacattatt cccagacagc gcctcctggc acaaccctgt ttttctagat aagtgaacat aattttaagt ttctggccct gatgcctact tctggatctt ttttcagcat tgccactctc t tgct tacaa aagaaaccac agggtaatag ctcaatattt ggtagctgga cagattgaat ttatacataa agggcattca cccagcctga catgaccatc aaatggaacc tcaaggttca tccattgtgt ggcgtccaaa attgttttta tttcttttta attccttgta ttctgttgta ttttgagttt aaattatatt caaggggaag gaatatatct agatagctgt acctagtatt ccacgagctt attttagtat acaggaaggg tgaaagggtt taaaaataaa tctttcaata gggtt ccctg ttttatgata cagaatacag attctaatct atgctatgca tgcgaatttg ctgcttagct aaaaaataga gcttctgttt ttttatcagt ccaggaattc tgcttcctta ccagatattt tcttaatagt ataatacgta tatctattgg gaaaatgaat ttctgagcct agggaaaagg gagggttgct gacagttaag caatggacag cat ta tatt t cataaaatgc cactgttgtg aactctggac tcccttctac atacaatttt tccatgttgt gt at atat ta ttttggctat gttcttttgg atttctgagg gcaatgtacg ttatttttta tcctaatgat tatatagaca ccctgatgga gtaaacctac tctggagcaa gacagatata attatattgt gtcagttttc aagatatttc agcactggat gattaaaagg agtgagattc cctctgtgtt tagacttttt agtaatgtta atatcttctg gattaatgga aaatgctttg caaagtgggt gacatccatt gtctgatatg aagaaagcca gtctttgatt acacatttta tttttttttt tcatagggca ccttttttta tcctctcatt atctgttcag ttctctcctt 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> 146 3001

DNA

Homo Sapiens allele 1501 99-5873-159 polymorphic base G or A misc -binding 1502. .1520 99-5873-159.misl, complement W0005851 0.[httpJMww.getthepatentcom/Login.dog/Sexam.support/Fetch/DefaultdoqNVO005851 0.cpc?fromCache= 1 part=maintooIbar--botom1 Page 62 1 of 737 WO 00/58510 <220> <221> misc -binding <222> 1481. .1500 <223> 99-5873-159.mis2, PCTIIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer Ibind 1632. .1649 upstream amplification primer, complement primer -bind 1176. .1194 downstream amplification primer misc binding 1489. .1513 99-5873-159 probe <400> 146 atttctgcat ttgcctagtt tcagttctct tttagggttt ttaagtttta tttacttttt tttaagccat ttctttatat gaatcaggtt atattttttg gcatttctca gctacagttg ttgtgtcttt tttttgtttt atggtgtgtg tgttggtgat tgtaacaatc tctgtgtgga taaaattcct ttcatatact atacttgtta atttatttac tctttatcat tttaattccc aattcaattt rtgttactct atctttttaa gtggcgacta ttttattaga tccaagttgg gatttttata gaatagaaag tcagccccca ttgggcagcc atcccattca aagcctctca ttagcttcct attttaaaaa aacctacttc aagagaccga ttaaaataaa atctaatctt ttgctattac ggcct ct t tt tatagaaatt caagtagttt gaaaatttct tgaatttatt tttcttgatt aaaaaat att tgcttaccct gcctttttgt cagcctccat tgtatgttct ccaaagtatg catgatatgt t ggaa ttat c tctctttcac tcacttgttt aattatgttg ttggtcttat tacttttttt ttcttaaagt ttgcaataca tattcctctt gaataactct ctttcatacc ga ct act ga t accctgctta tatgatttcc ccttgagttt ttcatatggg caaggtgcca agtatagaca taagttatct tgagtttgat tcactttagg cttaacttat gctggattta tttattttat taaaattcag cgatccactt gactttgatt agctatggta aagtctttgg tcttaaatag attgaggctt attctatgta gttttacatt catcatggca ttccatagac tttgttattt ggaaattaat gttttgagat gttatttgtt atgcttttgg catctgtctt tatctacact cttgctaatt taaaacattt tgcattagtt aacagtatgt taaatat tat atatttttat tctttgatgg tttaacaata ttgttctttc tatttttttt ttcattagac ttgttacgcc tttttccttt gtatctgttg cctgatcatt gcatgagaac taagtagcct tgtcactgag ttcctcccaa gctcagttga agcccctgca atccagagtg t gga atca ga aattatttct tgtttattag tatctataat gccttataaa gacagtttat attttaaact acatttcatt gattgtaaag attttaattt ga gt tttat c atatcttata atctaactct tttaaaatgg atcatttgct t tat a acaca tgatttttca tgtatttgtt tcaaaattat atatttttat tgaaaaaggg ggttctgggg gtcaccggtt tattcattag gatattaata ttacactagg tctaatctgc aaaggatgta cttttttaac ttttttagtt tgctcctttt acttatttct cttatactag aaacagctct tcaacatttt catcattata attttagcat tctttggggc gcaattgcca gattttgctg tttagctatt agtctcccct ttttaaatca ttgttttgtt tttccttttt atgagtttgg ataattttga agagaaatta ttgaatcagt ctatttagac ctagtgtttg aacagtattt ttgattatgt ctgaactaaa aaaatgtccc aatattatca tgaattattt aaatatgaat gagacttttt attcatgttt attctttaat ttattataaa gataaatttg taggatatta ctttctctat ttgccatggc t a atat cat c tgtttaagta ttttatccct acttctcttc ttcctcttat ctgtatggtg attcagtatt attgtcattg tcagtaatat ttggaaaaat ttatctctca tgccaaaggt agaaatgtct acctctctgt ccaattt tag tgtaggaaga tcttctgtta gtgcgctgta tgtttttaac caggctatct aagctctttc gattacttct aactacagct tttaataatt gattttgatt catgtttata gttttttaaa tcttacacaa tat ttatcat tcaaagtact ttaatcagta aaatatatat tcagcatttt ttgtgtccta ttatatgtga tcttttcatg tagaagatgt tgaatttcat catcttatgt tcctagttgc agcatttttt acatatatca attcattaag tttccggtat ct at cat gt c ctcaagtttt gataatttct tgaagtattc tcttggggct aaaatcaaat acccttaccc acttcatgtt cagggctttc gatatttccc ttcctgattg ctctagcatt ttttcatggt tttggtctca tccaagtaac 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 W0005851 0 fhttD:IMww .aettheDa tent. com/I.oain.doalSexa m.suooort/FetchDefautdooIWO0585. cpc?from Cache= 1 part= ma intool bar--bottom] Pa qe 622 of 737 WO 00/58510 PCT/IBOO/00435 ttgtcaagct actaccatgc cattcatagc tttgatgtct atggcgtggt tcttttaaga aatatattat ctgggcattt cctgtgcgca g cctatttttt tcttgctgat tagaatgaaa ctccaatacc cttgatctcc atgctggctt atagtaatgt attagaaaag gatcccagca tgtgcctttt attctcagcc tttttttaac tatagataaa ctagaaattg attttcatcc ttttcaaagt caacctttgg gtccacactt ttattcactt ctgtatgctt ccatcaaatt gatctttaac caccttgaga ctcacttgat aggttcctag ggtcacatcc tcacaagccc aatcaccata atccaaccct gttccttcct gaaagcttaa ttgcttccca cagtgctctc aacagcagta tagacttctg tccaggtgtt gaccatcaca tctctaccta gcttaaaacc gaaatgctcg ttttctttcg tcatgtcaaa tcaacctcat a atca gaa ac tctgatacat 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 147 3001

DNA

Homo Sapiens allele 1501 99-20977-72 polymorphic base A or C misc -binding 1482.-1500 99-20977-72 .misl misc -binding 1502.-1521 99-20977-72 .mis2, complement primer bind 1430. .1447 upstream amplification primer primer bind 1921.-1941 downstream amplification primer, complement misc -binding 1489.-1513 99-20977-72 probe <400> 147 ggagcaggtt aaaaaaaaac ttctgttttc catttctggg gtgctcagta cccatatggg taacaaatat cattcaactc gtgtatatta ttgtcagcta aaattgaaaa cattgaagga attccatgaa atctgtactt aatttattcc ttccccgctg gt caa tgt ca aataaaaata tctgaagctt ttagaggaga tgagacagaa cccatcataa caaacacaca aatattcata atgaattcat ttgtacaaca agaaaaaata cattttgact aatatttgtc cttgattaat tcgagt ggct aaaaaattca accaacctgg gataaaactg cattttgtct tgtccttctc gtggctcgtc cacgtatttc aactactaac acttaaatat ttatttgctc tgtgcgaaga acaaaaacct agatgaattc ccatttcctc tattgttaag tcatgttcat gtgtcagcaa attgtttcag tatttaataa gtatctaagc cttccagagg ctccatgtcc ctaactacaa aaaagggttt atgctgagga tttcagcaaa cttcaaagat gaaagtccaa taagagttct aagtagtgac gtgaaaccaa gaaatgtact agaagatatg aggtggttgc atcgcttcct agagatttcc tgatcagcag agtgtggaca ccaaaaccat gcaagaaata gtagagctct tatttattgt aagttaaaaa tagacaacag atcttttctc agctatgtag ttttcacagt gtgcacatca tcaatttctc tttttagatt ttccctagcc agacaagttc ttacatcaag gtgggttgtt acgacctact tgtggaaaac tggtatcaaa actccttcca ttgtggttta ttaagttaac agaatctgtg ggagttttta acattttatt cttgtctttt aagttaaaat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 W0005851 0 fhttp:/A w. qetthe patent.com[Loqin.d og/exa m. sup orFetch/Defa uIt.d oqNWO005851 0.cpc?from Cachie= 1 part= ma inMod ba r--botomj Page 623 of 737 WO 00/58510 PCTIiBOOIOO435 tgcagaaaag cagaggcaga tggtaatgtc tttagtaaat taattagaaa ttttatattt t tat cct ga t ttatattgat gtggtagatg maggcctaaa tccatgttac gtaaatgaca atttgaagca gaaatctcaa taattattct gtgagaaccc ccaataacta gaaattcaca aattcttatt caaaataact atggatttta ctgaaaatat cattctagag gacctaagag tacattatgg ttggtgttca tcttttcagc ttaagatttg tgtcccagcc agactgaatg tgacaaggtg aaatcat tat gtctaatggt tgttgatgtt g tacttattta tgttcaacgg gtctttaact gttgccacca aagagctttg tctttcagcg ttcctctggg caaaatgttt gtgaaaataa acaatagatg aaaaatggca aatcaactgt aaattgtgca tataccatct tcttcctact tgggctctga atcccatttc aaaatatgta gaaaagccaa ccct cagtga tatagtttta tggccacatt cttagagaaa tttctacaga aaagaca tat gataactcat agaaacatat acca ctccac catacaaaag ggaataacgt gaggtatttt gtgggcaaaa actaacccaa atgaaataaa cacgctgctt ctgcattcta taagagagaa cttaaacttg Ctatttctac tcaaagaaga.

ggttaaaaac caaattttgg tttttatatg aaacactatt acaaattacg aacattgaaa tctttaaaaa atccaagttg tctgggaggg acagatatgg ttaatcactt aaacaacttt actatacatt taactttcat aagctataag tttatggtaa aatagtgatg tgtgagttcc tgtgctctgt ccagcctgga tagat ct ct g tatattaaat caccataatt attttttgtg atttgggcat aagaaacatc taaattggtg ttaactgtgt 322 tgctgaaaga atatggccat tctcagggga aacgttttaa atgttcataa aagtcataaa tatataaa ct ttagctatat taaggagttt tcaaaatgta taaatgccaa caacaattaa ttatacacac agttattttc acagtgtatg ggtatttctc tggaattaat tttctttttt tttcttcaca tgttttttct ctattgaaac tatgacctgt acaaagatag atgcgcacta gctatttagg aggcaatttc aggggttttg aaagagagat ggttgctatt aggcttagga tcatcctggc attctacttt aatattggtt gtgcccttca gcatgataaa atttgcatta gaaaaaataa agcaagagca aatgacacaa catcactgca actgtaaata ttgtgaatgg caaagatgat ttctctcttt ggaagccaat tagctattat atgtgagagg cttttttttt ggaggtacct tcagtatcct aagaaaaata tccagaggaa agttgtatac tttttatgtt aatagtgtgc ccaccagaat acgcagatgc cattttaagt gtttcactaa attgaaaggg tccagggtta gagtcacatg tgctgttcta ataactagat tcctatctat actattaagc tat tccatga tgaggaaaca tccacagaca atgaagtgag aaccctaatt ttaataatta aatactttgg gtttgcattt gtaacaacat tacatggtag ctaaaacatg gttttcactc atatcatatg agctattaaa actcatgact t tt t tta aga gtcaggcact caatgcagct atttatttta taactaaaac taaaaattgg gtttgtttct atttatttga tgatctaaca agtcttgtgg ttgacttcac atgttggttg tgcacaatgt gaccttggtt ttaataagca attgaggtag ttttgttctc tatttagcag tgacactagt gaaaagcatc atgacaaaga 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> 148 3001

DNA

Homo Sapiens allele 1501 99-20978-89 :pol misc -binding 1502. .1520 99-20978-89.misl, ymorphic base C or G complement misc Tbinding 1481. .1500 99-20978-89.mis2, primer bind 1571. .1589 upstream amplification primer, complement primer-bind W0005851 0 rhttQ:/Mww.getthepatentcom[Login!.dog/$exam.support/Fetc,/Default.dogAw0005851 O.cpc?fromCache=l1 art=maintoolbar--boftoml Page 624 of 737 WO 00/58510 PCTIBOO/00435 <222> 1124. .1144 <223> downstream amplification primer <220> <221> misc -binding <222> 1489. .1513 <223> 99-20978-89 probe <400> 148 aacacgaatg gcatttttgc attcattggg ttgttcttgt tctatcagtt tacattaata tgtgcattta cattttcaaa gttactagtt ttgttatttg ctctctatgg ttataaatct aattaccata tcttgaggaa tgcaaaggtg caggtggcca gaatatttat gctatagtga actcagtgga actgcaggtg aaagaaaaag ttaaacttat ggaaatgtgg tcctttctaa ttgggtttag sagatttgat gtacaggctg cagctgttaa gtctcgattt agagttaata ggcgttatga caatttggtt gctccctcac gtgagtgggt aagacagagt tttacagaaa aaaaattctc acatattttc acttagccca ccactagtgc catatgtaac aagctttcat attattttcc tggagtcacg ctttgtaatt gtcttcacct actcagtaac gtggagagat agatggggat tctttgtgaa t <210> 149 <211> 3001 tttcagaaga atggctagct aatctgtatt aggccttata tattgaaaaa catgtttgtc ggatgaagtt ctcttttggc tctatacttg ttttgtgttt gatttttccc acttaaccag aaattgtcca atggacgtgt tgtgcatgtg tatttgagac aggtaaccca gcagagccat tggtgaagag ggaagaccac agcgagagat agtactgaac ccaatggaaa cctttgcgtt acacagtggc ttgcatttta cattaggtag cttactggtt cttcatcctc atagaatgtg tttctaaaaa gtattttctc ccaaaatgag gggtaggtgg agctcaaata aattgtaaat tttttcatgt agtgaagagc gtcaggtctt atatcttaga gcaatgcaat attctaatac aaaaggattt tctcaaatga tcttcaggac atttgcaaga gtccgactgt gccagttgcc ggcttttgca gcactggatt gaataaagaa aaaatatagg gtaagacttt tttaacgttt aatgagcatt ttacacatgt tcatttttta taatttcatg tttttaacca attttagctt cctaaactat gaacacataa aaggaagaat tgatagaacc ggtgcatgcc agataaggtt cagtgaccca cagataagat tcactgcata ctaagagagg gcggaagatg tagcaatttt agtgagatgg actgctttgt agttaatctt tttttagtgt cagttaagtg atgtaccctt caagtgggct cttctaataa ggaaaaacgt gaagttaaag gcataatccc cttctcactg ggagactgct cactaatatt ttttaactct ataaataaaa ccaggtgatg attatgtgat aatcacttag agctagtcac ttccaatatt tcagttttaa taataaagag ccacaatttt ttcgacagcg atggtgaaga aaaccacatg actagagtgg ctaataattt tgtaggactt gggatacatc actagaaaaa tttttacata aatatttcca tcctagtaac ttagatttca caaaatccat attttattcg tctaacttta attgctacac ttgatgtcat agagtgggga tacacagatg a aggg aa ca g ggtgaggcta agggccttac tttccagaca taatgagggg catcaaaagg ggtaaggttt atctgagaag aatcacaaat caaaatacaa tgaagacatt ggcagggt cc tgtcatatta tctattaagt tgcctggcac caaacaatat gagaaaaaca aaatctctct cctcgcctga taggaataag ctcatttttt ttttgctttt tacagcaaaa ggcagactta ttgggaagtt atatttattt actgatgttg ataccatcta atgatgtgca ct taa gga ta tctattgatt gattgcatta ttatgatgtc caaatatttg atgtcttttc tatgagttaa tagatattta agtatttaaa tatcatgcaa ttacatgtat cacttttata tatatttcag atagatcatc gtaaaagaaa tatcacctct ggtaaactag attcacctat ctgaagtttc ggaggaaaag tgcaaagggg gatagatgtg cttgcagggg tgcggtaagg tgaaggattt ctggcagtga aattgagcaa taatggggca aggtttttca tcagctctgg gttggttttg ttagttcaat agagctgagt ttactactta aaggtaatgg ctgagaagaa gtaaccagat taattttaca gtataagcat tctagttaat tgatgtcaga ttcttgacaa attcgcttct c ta agga aga* ggcacaatag a tat act aca ttaaaatcct tgatgatctg tgaagcaagt tagaaataga gctctcaaaa ataaggtact gcatggccca ccacatccaa ttttcaaagg aatgaatcat aaagtatttt tttttcaatt acaaaaatac gcct tct tat ttttacatat tctgaaggta attgtcttta atttgttttt aatctcatct aatccttatt ataatataac gataccataa aggaaagtgc gaggcagctc cattttaatg ggaa at ta tg atggataagg tgcatacgta gaaaaggaaa aaatagaaaa cccatttgtt gagatgtatt agatctttga ctagcaggat gttttttaaa tattccgctt gatcagattc attgctctgt tgaggatcca tagaatcaat gaatcaaaat tt ttat ttgt gagggcgcgt tcaactccag acataaaagt gagaataata tttccatgct agtctttagt tatttttttt gaataaggaa actcttttaa ctgttcgtgc ctaggtacaa tactgaaatt aaattttttt aggtttcatt ttcagctgtt tctatccctg tacaactgac caaatgagga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 W0005851 0 [http:/iwww.g etthe patent. comlLog in .dog/Sexa msupportFetchDefau t. d oNVO0058 51 0. gpc?fromC ache= 1 part= ma intool bar--bottom] Page 625 of 737 WO 00/58510 PCTLEBOO/00435 <212> DNA <213> Homo Sapiens <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-20981-300 :polymorphic base A or G misc binding 1481. .1500 99-20981-300.misl, misc Tbinding 1502. .1520 99-20981-300 .mis2, complement primer Ibind 1202. .1219 upstream amplification primer primer bind 1630. .Y650 downstream amplification primer, complement misc binding 1489. .1513 99-20981-300 probe <400> 149 accacgctgt gtcatatcga aaaaatataa aaaacaacaa aaaatgtgca atataaatca cacacccaca aaggttattt ataataagag tgtcatgatt ctctgtttct aaatataagt ggtaccagaa ctcttgtgct ttgacatcta tttctggatt aatggagatt aatgatactc gcacatataa aagtaaaagc atttgccatc acatagtcaa gt gcaa agt a aatgaatcct aatctactag rtctctattg tcgtttcaga gattatgatc aacaaagtgc gcctatttta ttaccctgct gagcaagaca taagataact actgtccagt atctctctct tacacaacct ccaactccaa aagttgaatg tacaaattct ccctgtgaac aatatttaca catcttaacc ggttaaatat ggaggttttg gttctgtaac taaatgtatt agccttctta gtgggtgttt ttgtatcttt cctttgctga ggtacccatg ctcagagatc gtgaaatcag gagcactttg tagtctcact aatgaagcag ttgtttgtgt attcatcagc cccttgatat atattggcaa ctgcaaacgg tgatttttgt ttcatcaagt ttccctctct tgaaaggctg tgtatcaatc tagatttatc ttctcttatt caacaacaaa gaatttgctt agaatactta gaactct cat agtgactaag ggaaaggaag cagttctttt tttcctgttg ggaagaatct ttctcaggta tggtttgatt tgctcaagtg aacactatgg agagaatgca acatttcagt tggaggtgat ctatggtgtt agaatgtttc ttaggaggtt tcggctacag taacaagata cat ata a aca ccttgaggta ttgtgagaaa ctctctctat tgcagaagca taaagagtaa ataaatgatt tccagatatc tatgttatgt tgacttggtt ggaccctaac t cat at acat taccttcacc aattatgtcc tccaggtctc aaaataataa tttgactgaa gtgactctct tggaatgtgt c tta gat ta c tctaataaca tcaaataaag tcaagttcta tgcttgatca ctcttgtgaa attacatttc tgctaacttc ctaaaatcat tagtcgacca tattcaggga ggcaaaaatt ttggatattg ttcagtctct gcactattac atttgaaacc ttaaatgcag cataggccat ctagtccatg aagattagta actgtattcc ttatttgttg aatctgtttc caaatgattg cctttgaaat cacatactac t t taat ga aa gtagctatgg catttcgttt aacaatgttt ggccatagca atgtactacc cagtgtttca ctagaggaat tagcactaga agatatttgt agcattcaac atcaaaaaaa ataaaattgg aaagaaaact agcaattgaa aaaaagggaa ctctcacaca tttatcttca ttgttttgaa tgctatcctt catagttaac tgtggcctgt agaaacttat tcatttataa tttatcacca ccaacctttt tcctgttgag cctgttttag ctgccactta ctgctgaatt accaccacat gtgaaatgag tgatgcaaat aaatagagca taaagtgcaa cat tttttca atgatattat tatgaattag gtcaggatat gtaagtttag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 W0005851 0 [httn:/Mww. getthe patent.co m/Log in.d og/$exa m.su portFetchDefa uItdog/WOO05851 0.cpcfromCache= 1 part=maintoolbar--boftom] Page 626 of 737 WO 00/58510 PCT/IBOO/00435 ttgccccaag attggcaaga aactgtgtgc tacatacata tatatacaca tttgcacaac cttatttttt gaatagttta gaatccactc aaatctgact gtatcagaat tgccatacct cctacccacc ctacccatgc ttctttctgg ttgactagaa atatagattc atataaactc ctcattactc gcagtggtcc gctgctacct t tctacaatta tgctgaatag aaactagcca tatacacaca cagagcagta ttgaaaggga tgtctgaaga tgcccataac cttttccttc tttcagaggc agttcagact gtttagaaag ctggcctgac tagacctctg tgtgatgtca t ttgt gaga a caaactcttt atcccacact ttcatttaaa cactgccagg tcattctact aacagcaaga caatgaaacc acatcaagca tatgcatatg tttctatata ttgtcttctc acaagaaccc aactattcag acaagctcaa atttatcaga catggctaca gtgcagaatg atgagtgata att ccagggc aagagatccg aaccacagaa catgaataac actcctaaaa agttcatgtc gtacatgaaa tgcttttact 325 cacaacgaca agtggggatg aatagtcttt tatacacaca gtcctttaaa attgtctagt tatttcctca tcaacgctgt aagcacatac cagaaacttc ctgatccttt gggtatgcac ggaaaaagtg ggtgaactac gcaaacaaaa gaatggcaac tcaattgctt cctttctcga cttttcactc gcggggta gg tccactccgt ggctttgaat aagaattact atgatttcta cctatctgtc aaatgtaggc tataaattaa actccgtatc tgaaaatatg aaaagagcaa ccattctgaa aaaagcaaat tgcatggaga gaaaccttct tgcttttcct gtaaattcat cctggtagtt.

ctttttatct gaattcttat ttcaatatca gagggataat tcttgggttc tttaatggaa tgcaaatttg tatatgtatg tgtatatatg atcttgtgtc acttgtagac cccaagcatt tcttaactga tgaggctgat aagtatttgt aagctcttaa gaccctacct cagccctggg cgtgtgtggt ttacagacaa ctttttaaac taattttgtg gtctttctat ttatcatgga ttcagtctca tctcaattct 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <22 1> <222> <223> <220> <221> <222> <223> 150 3001

DNA

Homo Sapiens allele 1501 99-20983-48 :polymorphic base T or C misc -binding 1502. .1521 99-20983-48 .misl, complement misc binding 1482. .1500 99-20983-48 .mis2 primer Ibind 1530. .1548 upstream amplification primer, complement primer -bind 1099 .1119g downstream amplification primer misc Tbinding 1489. .1513 99-20983-48 probe <400> 150 atgtcggata caagccattt gattgaaggt acagtgtggg ctacaaggac gcagaataga aactgtcaga gtaataattc tgccaaaaaa ttagacagtt taaaatgatg tttatgaaca aaaatgtact ttaaccactt atcactattt ctagtgctga gagaagcagt caagtttttt gtttgcttgt ttgttttcca agcctgtgac tttgaaagac taagaaaatc ttccgtagaa 120 180 240 W0005851 0[http:Jtwww.getthepatent.comIL gin.dog/Sexam.suportFetchDefaut.doiWO005851 O.cpc?fromCache= 1 part=maintoolba r--bottom] Page 627 of 737 WO 00/58510 PCT/IBOO/00435 agctaaggtt gtcattcatc agaaagatgg ctgggcttta tcctaatctc tcaagttaat aggtaatctt ttatgagaat tcttcgcggt ccagattgta aggaaaattc gccaagaaaa tgggaggccc ctaaagttac ggggagacgg atggactact tgaagtttac aacttctgga tacaggataa gtattcctca gttctgatat yacctgccct gtctgtcctt gcttccatga aa tgt tatt t atacaactgc ccctaagagt agtattgcgt acatgccgat cctcctcccc gtgcttaatc gcagaccaag ct ccctggga tttaagaatg gtttctttat taacaatcta atatatatac attatgcatt atattaataa catgctttaa gttcagttgg aagataattt ctaatttcaa gt aa t tggt t gaatttgaga gacaacagaa a tggaatgtaa atcagggcag agaagaaaaa ttcagaacac tcctagtctg tatggggttt acataaaatg attattttcc cgtaagtgcc taagtggaga aaggttacca gtacagattc gagaatcaac tatttcaact tgataacgtt caggcattga agaagtttga atagggactg atatgtatat gtaagcattt catatctttc cctctgtgcc agctttccaa actgttcatc tcctcttgaa tctgttttat aacacaccca gaattcattg tctcataaaa caggttttat aaataaactg ggccttggca gcactaaggc gaaattattt cataaaaagt tgacactatg acatagacac ctcctcaaat aatgttaaat caatatttct atatatctgc atagtattaa catccagcat atgtccaaga aacaaataca attatggaat attgtaaaca ggataaagga gaaggacgta ctgggtcctg tcccctcatc acaattctgg catagagatt tcctggtgcc agtgttctcc gaaatataat tgttttgcaa ct tgga tcac agtttgtaag gtggacaatc agaccaaggt aactaaatat aagcagacca gtcatctctg atgaaagttc tcaagatcat aggagcattt agcaggcttc gagcacccag ttcttgcagg atttattcct cagtatggta aagacataca cccatcccta atgttcacta gtttatttgt agctctagtg gcatttgagg aaagctatac tattctttat atattaaact catgtttttc acatatataa tatatataca aacagtttta ttttttaatc caggttgaaa taaagcaagt tcgtgtaatt atgccattat gctagtaaac 326 ataaggaaaa tagttgaagt aaagagactg gatctgacaa tgtcagatta ttttagtatg cctta ttggt atcagtgctt tgaaattagc cctttttcat atattagggc catctagata ggtcaccctc acacaacaag gatggtaaca ttggattttc gcatacttct tgggctggca tttaatcaag caaagtctta tcaaatgagc tcttattgat gcataaaagc at cta taat t ctcttcgttg cctatcatcc tgtccctcac gcacctgtcc tttactcaga tttgttgttg gccatcactg gttgctcatc caagttcatc cttttattct tgagatgatt tgcacaaaca ttctcatatg tttatcccac catttgcaca aagcttttct tggctattat atgatacttc cccatgacat ctacttaggg t gca t tta ac actggtaatg gagaatgtgt atgatacaat ccaatacctg catga t ttct attgattttt attttatcac ccatgttcta atctcatctg gttgatttta tcacgcgaat ttttagt 'tca cctcacttct cattgctgca gagttggtga taactgttct tcacttaagc tcacctctcc gaaagaaaga.

tccactctac ctcttctaca gtgtcctgag atccgagcaa ctagcaaaac ctcaagttta ttcagagtct ctgtaagtac tgtctctgag cattggcagg tttgctacca gccatcaaca ctggggaaga tagttacaca tcatctctct attaatgtct atatctaaca tatgtgtatg gattatgagt: tactttaaag gtgacttctt cctttcttgg agctaatttt tgaatattga tcactaactg tagttataaa aggttgaagc aaaggaaaat ttctggcata gagtaaatct tgttaaaact ct tgaa tcct ctgaatgata aggctggcat ggtgcaggca aatctgttaa aaaataaacc cacctggaaa gtgggtctaa gccggttatt atggtatctg aaatcagtaa accactaagc aacaactcag tacctatcca taaatgctat ataagatagt aaggtggttt ttgtgtttcc cccacctcat aaggtggaac gggtatagaa ttctaatctt acactcatgg taacaccttt gcttcctatt ggcagtgca t tccattgcag gcctttcatt caggtgcccc gaacaggttg ccaattatta ctttttgggg tttcattgga gttt ct gt tt ctttacttgt tcacattaga tatcttggcc ccc.cctaatg tgcacagaat gaaaggaaaa tcatcttttg tagataacag 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 *18 00 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 atccaatttt tttatttgtt <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> 151 3001

DNA

Homo Sapiens allele 1501 99-14021-108 :polymorphic base A or G misc -binding 1482. .1500 99-14021-108 .misl W0005851 0 [httr,:/fwww.getthe patent. com/LoginAdogLSexam. sup port[Fetch/Defau t.do/V0005851 0-cpcflromCache= 1 part= ma intool ba r-bottom] Pa.ge 628 of 737 WO 00/58510 PCTIBOOIOO435 <220> <221> <222> <223> <220> <221> <222> <223> misc binding 1502.-1521 99-14021-108.mis2, complement primer bind 1394.-1411 upstream amplification primer <220> <221> primer Ibind <222> 1853. .1870 <223> downstream amplification primer, <220> <221> misc-binding <222> 1489. .1513 <223> 99-14021-108 probe <220> <221> misc feature <222> 267,299, 336, 617, 679 <223> n=a, g, c or t complement <400> 151 caacatggca tgcctgtaat gaggttgcag tccgtctcaa aggcttctat tca caactgt gaaagagtag gcttgcctcc tctttttacc gtagagtaat attgaattga ttt tagtagt taaagtaggg t tat cat tgt: aaaggttgta aa tgcct ct g agatggggga atttagtggt tgttttaaaa aagactattt gcttgggtgt: tat atcgt at aagcttgaga tagtgaatct ataattctaa rtcacattca acaattacag taggagcaga gcaggggcag aatcagagta cactcagtgc acttcttact cttcaaattc tgatgtctcc gttaagtttt ggctggagtg attctcctgc aaaccccgtc cccagctact tgagccgaga aataaataaa atgcacagag atgaatctgt gaaggtataa atggaggcca actattaacc gccatttaga cccaaanagg ccattcaant aggagaaaga cctgatgtag gaatatatga atctattgtg agttacagtc atattaaaat ttcagaattg gaaaattttc ggtgggggag gggatagccc aactgctcag cattttgttg agcaagagca ctctgctcca aacactttct tgctgaaatt agggtcagcg ttaaaataag caacaattct agcttctgcc a ca ctag a ga acacacaaag gtttgtttgt cagtggtgca ttcagcctcc tctactaaaa caggaggctg tcgcaccact taaataaata gatttgnttc agcatgaaat cgaaccaatt tcattgtctt taatctatgg ggctggatgg ga at tt tcaa ttcattagct gcagaattaa tcatgatgac accaaatcaa tgcataaagc cttgagtgat gctaattctc gttgctttat tggcttcctt gtgcaatctt tatgacaaag aataagcagg ttaatcgccc aagacagagt cacctcagat cacccattac gcca tacgca gaaactatcc aataataaaa taacagtgtc actttggtca ggaaaaggaa ctccttcacc ttgtttgttt atctcggctc caagtagctg gtacaaaaat agggcaggag gtactccagc aataaaataa acatattgat acatanttgg ctgagatttc ctagcacaat cagtgttccc gtttacagtt gtaatttctc tgtcaactct gagaaggaat ctaagtcatc aatgggacaa atgactttat tt tcgta tt c atccaaggtc gaaaagtaaa aacttcagta ctgggtagag aatgacatgg gagagtgaag cttttctgca tgggagatca aatcatgtgc t acct tgat c aatcagtgaa cagggttcag ccaactaaaa agtgatggat gctgctgttc at gca ta cat atgccagtct tttgagacag actgcaacct ggattacggg tagctgggta aagcttgaac ctgggcgaca taataataat tctcttatgt caagtaaaga cctaagcaat ttgtgagaga agggaccaat gcagccaagc tatctttgta aatatctgac atatgtgcca ctttgatatt ggagagctgc gacaaacaca aacccagtgg aaattcaact tttgagacta cctcttgcca a cca gga at c cccaaaaggc aaacaagctg acacttgtgg ccagtgaggt ttaactgcga ctcacaattc ctgaagctta ccaacaagaa tttaccgtgc ccctgtgccc tggggaggt t ataggaccaa caatctgctg agtttcattc ccgcctccca tgtgcatcac tggtggcagg ccaggtagca aaagcgagac aataaataaa ggtcttcant ttctataaag cagttcacct cagcaaggca gttgtcagtt aagggtctgc tgtgtgagtt aactgaaata gaggagagta gctttcatat ttgctcacaa tagagactct gatcactatc ccatacaagc t t tggaa ata t tgt gtca ca ccactaagcc caatcatgcc atgctcaaac gt tagggaaa tcaattttcc aacttgcttg tgtggggtag gagacctcca agtatattgg tttttatttc cagggga'Zag aactttctta atttcactcc ctctggggag ttgttgccca ggttcaagcc cacacctggc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 126 0 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 W0005851 0 DhttD:twww.aetthe Date nt. rom/Loq i ndoal~exa m .su oortFetch/Defa ult. dogANO005851 0 cpc?fromCache= 1 D art~ma intoo Iba r--botto ml Paqe 629 of 737 WO 00/58510 PCTIBOOIOO435 tagtttttgt tcct tact ct agtcaccatg a ggaa at gca tcaccatgcc ctaggtcctt tggtacattc cccttgcctt ctttgacttt ctttcacttc atttgcttac tgatgataaa ggggctgaag a attttcacta caggtgatcc cccagccagg taaatacagg tgtctcaatc aaaatactgt cagccacctg acagctggcc gtcacaggta atcacactct ttctgtgcat gagaaatggc gctggatgct gagatggggt acctgccttg aagttaagtt accaaatttc ttgtcattaa tcattccatc agacaaccaa taaccacagc aaatggtgtt attctctcta tctacacact agttagtggt ggaggcaggg ttcaccatgt gcctcccaaa tcttacctca actcctgatg agtggtattt ccatgggttg tcttatgcca tggggatgac tctaactaat attccaaccc tccaacaaac ctgaaagatg tgtgtgtttg tggtcaggct gtgctgggat aattaacgct tctccacaca ccttattagg agtacattac atcagtgcta tgactggaga cacaggtctc tgccaaactc cctatgtttg gcgtctgacc gtgcagcact ggtctcaaac tacaggcatg agagaggaaa caaagttcct aaaaaaagaia atattgacag cagagagcac atgttgtgat tgtgctgtgc attaggccaa cctttccttg tttttatgat gatattccct 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 152 3001

DNA

Homo Sapiens allele 1501 99-14364-415 :po1 misc Tbinding 1502. .1521 99-14364-4 15 .misl, misc Tbinding 1482. .1500 99-14364-4 15 .mis2 ymorphic base G or A complement primer Ibind 1798. .1816 upstream amplification primer, complement primer bind 1344. .1364 downstream amplification primer misc Tbinding 1489. .1513 99-14364-415 probe <400> 152 aaagatgcat atggccaaac tagaattctg agacaaacag aaaaaatttc agaagcaaat taaaaataag tggatacaga tttgaaccca ttgctttatc aacatatata aacttcctta tactttcaaa cagatgatga tgcatagcaa atactaacag ttcacatatt aaagaaaaac atgaagttaa aataacataa gaaatataca attttaaaat ctctatatta ttttgatgaa ggaaaaagca tgaaatggca aaatatcctt aagttgtgac agataaaaga aaaaagcaaa actaaatcta agacattagg aaaaaattta caaaataaat gacaatattt ggtaatctaa acaagactga ttttaaaaat tcatttgaag cagaggagcc tcaaaaagag tatagggtaa gaatgtaaat aaaaggaggt tataagtaga agtacctttg aaaatcattc actaaattta taactgaatt tctgaaaaaa gcaaaaatca tatcagaaga aaagagaaac atctaagtga attatgatac tacaaatcaa tttagtcaag acagaaaaaa ataagaaaga tatcaaacat accaaaacaa attgtcaaat gaacttttcc aatgttaaag actgaagtca aaaaattcca tagaatagca tctcatgaac gaatagaggg aaattatctc aatagaaagt catatttaga W0005851 0 [http:/Awww.getihepatent.comILagin.dog/Sexam.support/Fetch/Defaut.dogIMO005851 0.cpc?ftomCactie= 1 part=maintoolbar--boftoml Paqe 630 of 737 WO 00/58510 PCTJLBOOIOO435 agtataa tat gtaagtttac actcagggtg ttattttgaa ggttagacaa gtgtgtatta aggcaattgt ctgacacaag atacgtctct gtgccaggat attaggagtc gttcgttgtt gagccagca t raagtttata taataatatt atggggaatt acaacttgcc tctccttatt ggttgaatta ttgggcaggc tgcaacattt tatcctgcca cattatgata tcaacttctc tgaacttgcc at tgt ct agc tgagagaaaa acctggggt t gggttaagga gtctgtctct ctggattcta attggatcag tattatgcaa gtggctggca ttcctattgg gggctgcttt taagtaattt tagataataa t tgaaaggttt tcaggaacac gcaaaagaag acagctattc gcagatatcc ggttgcaatg gtatgaaaat tgacttcatt aaaaccattg gaacttgttc agtatgaaac aaqtccaact tattctctca a agaa a aat a gagccaagaa aggtaagtcc caaaggggtt taaccaatag aaacacagaa taagggctta tttacagctt agtgaaaaag aggaatctta accctggttt gtgtggctca ttcattctac gt gga t tgga ggtcattttg gcggaaagtt tgccagagag caggcaagct gtgtgacatt atgggctttc aagagagggt cacaactgcc tcattaaaag cttcttaact aaactaagaa catcttaaat gcacagcaat acaagggttt ttagttgcaa tcacagaagc gctttgtata gctttcttca ttgattcaga ctgactaatc tgggtaactc cctttagcca tcatcagttt ggagttgtac caaagtaaaa cctaggct tg tgttgtaact tatccaggta agaatctaga tgagcaacag tctgtcaggg cctgcagaag gtaggcacaa tttcaatgtc gtggtttgaa aacatcaggc gcgggtttag ggaacctaca tgctgagaag taataagcag aggtatctga tgagaaggca tacattgtgt cacttggcca ggagctgcca agcaataggc gaaaacctta cctatatcag actatgca~a 329 aacagaacag gcagaacatg ttaaaggtaa ggatcaaaaa gtgtgcatgc tgattgtagt tggcctttcc caactttcac attctgtggt tgatcccatg catttgagca catagacaag ttctgctgaa ttaatagtaa aaagcaactg atgtggccta cagcatgtat gcaattctat ttgtactaga catgtaaata ctattgattg gcaaggaaaa ttgggaagaa ggtctctggt acaagtcttg aaaagggtgg a gtga agt gg attaacaaca aagaaagggg aaaggaaaga ctgtctgatt gtgggaaggc ga acc at ct t ttttgagcct tgctcttcgt ctgaggactc aagaattcaa gggccaacat agagaggttc tcatagtaaa agtgaggagg caagtctgac acgcgagtgt tttgtcaaag tggcttcatt atttgcccct tagattttca tcagagggaa tcaggagttc ggttatcatc atttgacaag taggaaaatt actgaatcag ttttcttgag tattggcaat catttcgtat gat gct gtt g tttaggatgg tgaaatttta attaagaggg tttttcccag tacagcattc tcccttgaaa ttttgttctc catcattgtc tggacacgca agaggagagc cctgctggtg tatgtagggc tggtcgcccc gtctgctcct gcctattccc aagaaaagaa ccatattctc gatccagtct ctaacaagta tccaaagata ctatggaagt gttacatgag attagtccaa gtgtatgtgt tcttattatc atgtcagtgt tttgatcaaa t cat cca tca gtgattgctg tgtggggagt tcaaaactct caataagtac ctagtttatg ccaaatgacc tatttgcatc a gc aca aat a cttatagctg aagttaccca gcatgacaga actataccat gcaagagtct catgaaattg gacagtttgg tttacatcaa actaatttca tggggtaaat ca cat ggaa t agccgtctct gcagagtgca ccacagattg accctaatct tactgtacgt aggtagtttc aatgatttgg actatctgcc agactacaga tattagagtt 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> 153 3001

DNA

Homo Sapiens allele 1501 99-7308-157 polymorphic base C or T misc binding 1482. .1500 99-7308-157 .misl misc Tbinding 1502. .1521 99-7308-157 .mis2, complement primer bind 1345. .1362 W0005851 0 [http:1twwgqetthe patent. comLog in.d og/$exa m.support/Fetch/Defa uIt. dog O000585 10 0cpc?fromCa che= 1 part= m aintool ba r--boto mjPage 63 1 of 737 WO 00/58510 PCTJIBOO/00435 <223> upstream amplification primer <220> <221> primer bind <222> 1814. .1834 <223> downstream amplification primer, complement <220> <221> misc binding <222> 1489. .1513 <223> 99-7308-157 probe <400> 153 cctgcatgac ttactaaaca aggaagaaat accattaaac aaagtaaatt cagtgctccg actgaaataa ctgaacttgt agtatttagg taatattttc ggcaatacag ttcagcagga tagaacaggc aggcacaacg aagctcagcc gtgccttgct aagccttcta caagaaccat tttttggtaa actcaagcat tt ggt tt tag aatctttttc ggcaaactgt agatgtggga cat aga acca yttaagtaat tctgtgcctc ccgttgtttt gtgttaatat tttaaaatat ggagttttaa ccctaataca atgggcacca aataataact ctcaaaagga cat tgtgtcc ccacaacatt ttgcagacag ttttttagag ctcactgcaa ttgggactac tcacaacttc tatacctatc tqtgacattg tcttatgtgt tttttttagg atcttgggtc.

agagtagctc tagtagagac tccacccgcc atcatttcat ggaagccgag agattcaaaa cacattgtat tcttttgttt agacatctgt tcacaagatg atcttgttaa atcatataat tagctgacat tgttgtgctg ggcaggggtc acacatcaga tctgtgggca tgcagtggct tccccaggtt ataaaatatt aactggcaga aatgtcagaa gctggggcta aacctagatt atgggtggat agtaccatca agccatgatc gtttctacgt tttaagtaat ttcagaaaag cattgtggat tctggcgtcg cagagaatat aatgactaat gtttataaga aaaatagaat taattgtata taaattcttg tatatcaaaa ttttaaaaag agaggtaaaa acagagtctt cctccgcctc aggcacgtgc tatttagcca aggtaaattt gcatcctcct cctcataatt cagagtcttg actgcaacct ggattgcaag aggattacac ttggcctccc tttccaacac acatattgag tttacatcca cttaatgtac gaggaatcac tactccctgt cttcagggct agaaattctg ttcagagctg gatggggtca gctgaccttc cctccttcaa cacccttggt gtgtggcaaa gacattcaga gctgcaggag ttttatccct acacagatct ggatccatga aatgatttgc ttctgaactc gtgcaaatga gcagtgtggt atcagttgca ttcagggtat tcacatttta atgaactaaa aatttctgtc gcacattttc agtaaccaat actaaggcaa tacagtggct aagacgtact ttttaaaata agaggatgaa catctcatgt ttaacaatta aagagtaaat gctctgtcac ctgggttcaa ctggctaatt ctaccacaaa ccaatcattc act ca caca a tttttttttt ctctgt cccc ct gtactcctg cat gcgc ca c ctgtcggcca aaagtgctgg cacacat tga gccaagtaac ttctcattaa atctaatgca tactggtttg cattagccca gaccttgcaa agttggtgga taattaaaga cgatcccttt aactaatctc cgatattccc cagggctttt tgcaacagca agtgatggca ctaattgttc tttaatgaag atccctggaa cttccttcaa ccaaggccag cagtcacctt ttccaataat ctggatatgg ttattcctga atgtattcat agtaattttc cactggcata ccatattttt tttcctgata ttccaattct ctatgagatg tctgataaaa gtttggtagc agtgaaaaag taacccattt ctcccacaaa aaatataatg tcttcatgca tcaggttgga gcaattctcc tttgtaagtt tcactaccaa ttcaaggtcc tttcacaaat tttttttttt aggcttgagt ggttcaagca cacacccaga ggctggtttt gatcacaggt ctagaatcat tttccaatgg cctcaaagtt gcaccggaag ccagaaattt accatcataa tgttgttagt tgat ggggga taatctaatg gagaatctgg tacttggagg tcttcctata at tcttgagg tagcaattct gcaggaactg aaagttgcat ttggttttgt aaatatacca tttatttaat ctctctatct tcaatgtgca gcaggctgtg tgaactgttc ggggcaatgc ggtgacaaat ctgaatgtgc tgtgttcaga gtgtaaagtt aataacaatt tttttcacca aattaacctt atcaaaaata acaataggat tgtaactgaa tccatggtgt catatacacc cattaggaaa ttccatattt gtgcagtggc tgcctcagcc tattattttg ttttgtttca aaggaaaact acaataaaat tttttttttt gctggcagtg attctcttgc tgattttttt gaactcctgg gtgagccact tacaatcatt tgaaccagct t gca ca act a gctatatgag gcttgggtga ttacacaccc cactctgttg aagaaaaatt caatgattca tgaaagacat tagtcccagg ccctggcagc gtgaaagcaa gggagccttg gttcttggca tctgagccta tgtttgtaat atacacattt agatgaggaa attagtagtg taaatgctct gggagaaaga cttcacacac attccagtta ttattcacat ctcattggct tttcaacatt agacaataaa cac-atatctt tgtatctatt ttgcatgtaa acgtattagg gactacagtc ttatttgtaa gcttatttca tactatatat ggctaattta ttttgggttt atgatctcgg tcctgagcag ctgcctcagt gtcattatca t ca cca aat c taactatgct tttttttttt cagtgttgca ctcagcctcc tttctatttt cctcaagcaa atgcccggca 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 W0005851 0 [http Awgetthepatent.com/Login.dog/Sexamsuporlecleal~0W05510ccfo~ce part= ma intool ba r--botoml Page 632 of 737 WO 00/58510 PCTIBOOIOO435 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 154 3001

DNA

Homo Sapiens allele 1501 99-22310-14 8 :polymorphic base G or A misc binding 1502. .1520 99-22310-148 .misl, misc_binding 1481. .1500 99-22310-148 .mis2, complement primer bind 1630. .1648 upstream amplification primer, complement primer Ibind 1183. .1203 downstream amplification primer misc Tbinding 1489. .1513 99-22310-148 probe <400> 154 aaatttttaa ggtgtcatat cttctaggat tgttatgaag gtcccagtac gtcaaaggtc ttgatctatc gtgagtcttg tggatattct ccaactaagt taactgatat catttggttc aacatgtttt cattcatcaa tattattttt actaaaatat ataatgccta atgaagaagc catttgtata ttctctcaaa tagagagctt tcttacccgc ctgctctaaa tctttcccag gattcagtaa ttttagtgaa atgaaagtca ttttataatt gacgtatgat cgttagttga agttgactgt tgtctattcc aggttgggta tggacctttg cactgggatt tctgacaata ttctttgatt gttagtaaat gctttttttt aaaataatag ttacatgttg ctctaaatta tatttcaagc aaaaaattaa atacgtatgg tgtcccaaca ttctctgcca tcaatgaga t tttgtattgc aatacaagca gtccagttta tagcacaacc t tgcat t tta ctatgtttgg aaagactact atttatgtgg ttcaccaata gtgctagtcc cctctccgtg ttgattggga ttgagtcttc tttccattag gtacttttaa tgcttgattc atattttatc ttgattttta tgaaaacaat tgtcaagaat attcaaatcc tcaaatgacc gggtagcaga gt catcgaac attgctatct aataatattg cacatttaga ttaattattt taagttca tc catttattta atttatgttt ttttctttat gtctatttct cttcactgtc tctcactctt taaactttag ttgaattgaa ctacccatga agccttaccg acatattttc agtcttttca ttatgtacag t gt t ttgct t gaaatacaaa atactcttag acactttaaa atttttttcc gagataatga tactccctct gtctgatgca gggtaaaata gcttgttctt cttccctgaa tagattttct cgtgatccat t gca tgt gga tgtattgctt ttgctctttc t tggt ta tgg tttctccttc tatcagtgtg tctatagatc agatggagta ttctcctcat ttcccactgt gagtatgatt ttagagattt ttatgttcgt tatgggcatc ctctgtattc atttttaaaa ttctgtgtag ttctactatt actccaaaac ggttacattc ttgcatgggt ggatttgatt t ca tgcctt t cataggttac tttaagttaa cgttccagtt ttgttccttt ctgtgctcca taactgtata aatattgtgg tcaaaatcca aagttggaaa tctcttcatt atggaccttg tttatgtgga ttaaggtatg ccctgttgac tttagaaaca aaagaggaaa aaaagtactt aagtaattgt ttgcttattt gtctttaaat t tggtctgct cagtatctta ttacaaaagg tgcattgtca 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 W0005851 0 rhtp:/lww.gehepatent.comL ginqdgI/examsupportFetch/Default.dogN0005851 0.cpc?fromCar-he~ 1part~maintoolbar--botomJ Page 633 of 737 WO 00/58510 PCTIIBOO/00435 rtttggtgcc gctttgctct ttaaaaaaag gcactctggc acaaaccaca atattaattc atgtaaaggc ttattttatc gattaattgc aactaccttt tgcctctctc taatctctac tcctcttttt tatttaaagt ttcagagttc atattactca ctcccatatc caacatattg tggagggcag atggaagccc acttctgcct acaattcatt ga tat catt c ttaagcccgg tttgtttaag t ttcaggagtc atatcggtag aatgatctcg atcagtactt gctctgtaca atcatcacat ctacgataat tcttgtcaat at ttaaagcc attatttata ctcattccca ctctgccttc atatggatgc aaacttaact caggtagaca acttctccac ttctgtgtct caagagtctg ggagttgact gtagtaagaa ccatggacat ttttaaaata cagctagtac ttttccaaat aagtaaaagg at t tcacat t ctttcaacct tat caca cca aaaacagctc atagaacagg acgtggctag tcagacttct ataaattgag tagttaagac gtgggtgcct ggaggtgcct acatggtgtc cagtcatgag aattacatct tggatttttg tgcttttgat attttgcctg ctaaataaat tattcaggtc ttggaaaaaa catgaggaaa ttggcatttc agtttctggt tattgaggct ctggccaggc ctttgcttcc gtgctgcact gaccaattaa cccaggagat ctgctccttt aaaaaaattt ttgaggagag agaataaaca tatttaagac tctgaaggat ggcattcctt ccctgtgtgt atttaggccc gcaaagacca gaggacactc gctgttcaac ttttgccccc atctgcttcc tctatgtgaa ggaagagagg cacacacgtg atactcacat tataaaattg cacaattttg acagtggctc acatatcagc tctgaaaccc atcagaatct tctcaaaggc ataattatta agaacaaaaa cttttatttt gacaaacatt tattatgcat ctgaaggaga ggcttgtaga gtgtttttgc accctaaact cacttccaca ttcagcccag actcttctga ttctgtcata tcttattgtc caccaaccaa aagaaaaaga ccttgacttg caaatatctt tagatcagga agaagtgtga atgcctgtaa ttttagtaaa tagggagctt ctggaggctg agcgatggtg atcatagtgt gatatgtgat attgttattc acaaattagt aatacaggaa atcagttcta cgcatcaccc cccatgtgtc actatgacct taaagtcata tact gcact C gaactccttc atgcccctaa tgtgcaatcc tttttagctc gaaggttgtg atggacctat gcacctgcat ttaatgatta tttccataga tcccagcact 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <2 11> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> 155 3001

DNA

Homo Sapiens allele 1501 99-15232-291 :polymorphic base G or T misc Tbinding 1481. .1500 99-15232-291 .misl, misc binding 1502. .1520 99-15232-291 .mis2, complement primer Ibind 1211. .1228 upstream amplification primer primer Ibind 1677. .1695 downstream amplification primer, complement misc -binding 1489. .1513 99-15232-291 probe W0005851 0 [h ttp:/www.getthepa tent.comfLog in. dog/$exam. .su pportIFetch/Defa uIt.d oglWO005851 0. cpc?tromCache= 1 part= ma intoo Ibar--botom I Page 634 of 73 7 WO 00/58510 PCT/EBOO/00435 <221> misc feature <222> 2775, 2807,2844 <223> n=a, g, c or t <400> 155 gtcactggga attctgacaa tcttctttga ttgttagtaa aagctttttt ttaaaataat atttacatgt tactctaaat gctat t tcaa taaaaaaatt aaatacgtat tttgtcccaa gcttCtctgc aatcaatgag agtttgtatt aaaatacaag ccttcaggag ctatatcggt agaatgatct gcatcagtac cagctctgta tcatcatcac gcctacgata tctcttgtca gcatttaaag ktattattta tcctcattcc acctctgcct ttatatggat gtaaacttaa tccaggtaga caacttctcc tcttctgtgt tgcaagagtc agggagttga ccgtagtaag ctccatggac ttttttaaaa tccagctagt ggttttccaa agaagtaaaa ccaaggtggg accccgtctc cagctactca agccgagatc taaataaata gcacagagga gaatctgtag aggtataacg ggaggccatc t t tt tga ttgg tattgagtct tttttccatt atgtactttt tttgcttgat agatatttta tgttgatttt tatgaaaaca gctgtcaaga aaattcaaat ggtcaaatga cagggtagca cagtcatcga atattgctat gcaataatat cacacattta tcatttcaca agctttcaac cgtatcacac ttaaaacagc ca at aga aca atacgtggct attcagactt atataaattg cctagttaag iagtgggtgc caggaggtgc tcacatggtg gccagtcatg ctaattacat catggatttt actgcttttg ctattttgcc tgctaaataa cttattcagg aattggaaaa atcatgagga tattggcatt acagtttctg attattgagg ggctggccag cagatcacct tactaaaagt ggaggctgag gcaccactgt aataaataaa tttgnttcac cat ga aata c aaccaattct at tgt ctt ct gattgaattg tcctacccat agagccttac aaacatattt tcagtctttt tcttatgtac tatgttttgc atgaaataca atatactctt ccacacttta ccat tt ttt t gagagataat actactccct ctgtctgatg tggggtaaaa gagcttgttc ttctttgctt ctgtgctgca cagaccaatt tccccaggag ggctgctcct agaaaaaaat ctttgaggag agagaataaa actatttaag cttctgaagg ctggcattcc tcccctgtgt agatttaggc c t gcaa aga C tggaggacac atgctgttca tgttttgCcc atatctgctt tctctatgtg aaggaagaga aacacacacg tcatactcac gttataaaat ctcacaattt gcacagtggc gaggtcaggg acaaaaatta ggca ggaga a actccagcct taaaataata atattgattc atanttggca gagatttccc agcacaattt aatctataga gaagatggag cgttctcctc t ct tccca ct cagagtatga agttagagat ttttatgttc aatatgggca agctctgtat aaat ttt taa ccttctgtgt gattctacta ctactccaaa caggttacat tattgcatgg ttggatttga ccacatatca cttctgaaac aaatcagaat attctcaaag ttataattat ttagaacaaa agcttttatt cagacaaaca actattatgc atctgaagga ttggcttgta gtgtgttttt ccaccctaaa cacacttcca tcttcagccc acactcttct ccttctgtca cctcttattg aacaccaacc ggaagaaaaa tgccttgact atcaaatatc tgtagatcag tgagaagtgt tcatgcctgt gtttgagacc gctgggtatg gcttgaaccc gggcgaca aa ataataataa tcttatgtgg agtaaagatt taagcaatca gtgagagaca tcaagttgga tatctcttca atatggacct gttttatgtg ttttaaggta ttccctgttg gttttagaaa tcaaagagga tcaaaagtac aaaagtaatt agttgcttat t tgtct ttaa acttggtctg tccagtatct gtttacaaaa tttgcattgt gcttt tagta cctagggagc ctctggaggc gcagcgatgg taatcatagt aagatatgtg ttattgttat t ta ca aat ta ataatacagg gaatcagttc gacgcatcac gccccatgtg ctactatgac cataaagtca agtactgcac gagaactcct taatgcccct tctgtgcaat aatttttagc gagaaggttg tgatggacct ttgcacctgc gattaatgat gatttccata aatcccagca agcctggcca gt ggcaggtg aggtagcaga agcgagactc taaataaaag tcttcanttc ctataaagga gttcacctgc gca aggcat C aataactgat ttcatttggt tgaacatgtt gacattcatc tgtattattt acactaaaat caataatgc aaatgaagaa ttcatttgta gtttctctca tttagagagc attcttacoc ctctgctcta tatctttccc gggattcagt caatttggtg aagctttgct ttttaaaaaa tggcactctg tgacaaacca gtatattaat atatgtaaag tcttatttta gtgattaatt aaaactacct tatgcctctc cctaatctct tctcctcttt cttatttaaa tattcagagt tcatattact tcctcccata aacaacatat cct gga gggc tcatggaagc t gact t ctgc atacaattca atgatatcat tattaagccc gatttgttta ctttgggagg acatggcaaa cctgtaatcc ggttgcagtg cgtctcaaaa gcttctatat acaactgtat aagagtagga ttgcctccat tttttaccac 120 180 240 300 360 420 480 540 600 660 720 780 840 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> 156 <211> 3001 <212) DNA <213> Homo Sapiens <220> W0005851 0 [http /Wwg etthe patentcom[Login dog/Sexam.supportFetch/efault.doiWOOO5851 0.cpc?fromCache= 1 part~maintoolbar--botoml Page 635 of 737 WO 00/58510 PCT/IBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-6080-99 polymorphic base G or A misc_binding 1502.-.1520 99-6080-99.misl, misc -binding 1481. .1500 99-6080-99.mis2, complement primer Ibind 1572. .1589 upstream amplification primer, complement primer bind 1061. .1081 downstream amplification primer misc -binding 1489. .1513 99-6080-99 probe <400> 156 gaatttaaag cttaaaaata tatattttac ggccattact tacatttaat tttttcctca tgcttaatag acatggctac ttgatgtacc ttgtcatggc tctgctatcc aaggcaagat ggggtatgga atttcccctc attaaacaat ttcttatatg gcttagggca tataaataaa gactgctttg gagcctaaat atttgcacac gcagtacatt accatcttgt aaatatttta ctaataaaga rtaattgtat aatatagcat tctgctgcta ttccagctgt caaaatgctt tcc tgc t tgg ctacccaaca tcctttggta aaatgaattt ttaattttaa gatttctaaa gccatatact atctacatgt attcagctgt aatactgtct atggtaatca gt gatt gt.gt aggtttgccc aggctgccat aaaaagaaag aaagctgaat ctcatatccc ggagaagatg cagtcctaaa gcatttggca gct ttattgg gcaaaatagt tatttactat aataatgtac tttgaaatta agatttttca gaatctagtt cat accttga taaattgcta gggtttcagg ggt agcacta gaactgctgc gcgatttggc tttgcccatg ggaatattct gatttaataa tagtaatggg gctatttact aatattatag ttggacatat agcacacttt attttcagag aatgatttct cccactaaat gcgcat ccta ctctagtgtt tgctattttt tatgtgttgc ttttaaggag agaaggtcta ctatagaaaa aggactttct aactgtaact aatgcagcca ggtggagttg ctggccaact atgttttaat aaaataaact ataatttttt tataggaaat acacgagcta gagatggctt gacacatttt aatccccaag taaagcagag cctagaaaaa tggtatttat atattgagta ccgt agagaa tttagtatat gaagaaaaac gttatttttc ataaagtgtt acacaagcta aaaacacaca gcatgtagca atttacaaca agacgtgatt ggcttctcgt attttctact cttactgcca acagcaaacc agttactagt gtttcccttt ctcttcttat gctggttaaa cactcattca agtaattaat cactttttgg atgtgacaat tgtaatagaa catataaagt agcataaaca ttgttttgca tgtaatcaaa tgttgttgta ggactcaaag aagccctgtc gggaccgctg ctcagtccct gcacctgact agagagctga attaaatcat atgaccactc taggaactgc ttttggtaag aattctatcg agattacaga aaatccaact tgaatttatc cctgtactat tttgctttgt tctgatggtt ctattctatg tcacagattc tacgttaaac tcttttcttt agcttaacaa tctggcctgt tgtgaatgcg acaagcgctt tttaaggtaa aaaggttttg atatagttct caatacatct tctgtttcga tttgccaact gacattagaa gtggtttttg atgagaaaca tgtgatatta gcagtgttgt tctgatcagg actgaccaaa ctgcaaagtg gttcatataa agtggaactt tgttaatttt tatctgagat tatttggcat gctatttcta ttttggatta tgtgactcac ggttgagtaa gctgcttttc caggaacatg atatgagtca aggggattta aaaagaaata ttaaatatac tcaaacaaca cccctatttc tattgtctgt ttcagcctta tgaaatttta ctgcatttat aaagagtttc ttatagaata taaacttccc tttccatttc tattcagttg tttttaattc ggaaaaaaat gttcgtttat acataagtgg gccagaaagt tcagatgttt ctaggaatga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 W0005851 0 fhtto:/twww. aetthe na tent.ro mlLoo in.doa/Sexa m.sunooortlFetchloefault-doaNVO00585 0.coc?fromCache=1 Dart=maintoolbar--battoml Paae 636 of 737 WO 00/58510 PCT/EBOO/00435 ct agagact g gagaaccggg ataaagtaaa atggtcagaa cattggaagt ctatctccca aacatcagag agggaataaa tttagggggt gttgagggac ggaaaattgt tcccttttct ctcccatgtt catcaacaca tcagccttac attatgctaa ttttcctttt agagagagca ggagagagac aacagatgaa gcca actgca ttgtgtgtgt tatatttcca tctcactaat tcacacaaca caggtgcgtc agaagaggct atggaggttc gggtatttac gattgtggca taaatagata aaagggaaga gtgaaataag cttataactt cagatgctta agtgagcaag gcaaaaaaag cccatttatg gtgatgcagt tgtatctgca atatatatag gccctattta aatgagtgaa gtgcactgct ctcaaataac ctaaaagatt ctatgtgcaa aagacaatgt agttctgtca ccaaacacag atatgtggaa 335 cagagagcct aaaaggagga aaattgagtc aggacataac ggcattccaa agaagcctta ctaattgatt t ggt t tagca tcagtttggg ggtgggactg taaaaataga cgaaatcatt tagccaactt ggtacataca tttgcaataa acaaatacca tgtaaaacac cagtagttac gagacaaaga agaagaatga tgcttgaatt ttctccctga tcacctatga attttcaaaa aa tgatctca tgtaggaagt tgaattagtg attgccatat atgtccaaga atggaatcag tatacacaat catgaatgga cacattctca ttttattctc tggcgggaaa tggagaggaa cagaatgaat gctgatgtga aggtatttac cagagctaca taaaatgtga aactcacata gatgggtcag ctgccattat gatccagcaa gatgtctgca tcgaagtgtc gaaatactat attggagaac tacagaaaag acttatatgt 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 157 3001

DNA

Homo Sapiens allele 1501 99-15229-412 :polymorphic base T or C misc Tbinding 1502.-1520 99-15229-412.misl, complement misc -binding 1481.-1500 99-15229-412 .mis2, primer Ibind 1893.-1912 upstream amplification primer, complement primer Ibind 1419. .1437 downstream amplification primer misc_binding 1489. .1513 99-15229-412 probe <400> 157 gttttgaatt attgccatgc ttgtgaacgt acaaggtaaa ctggcatcag acttccagga aagacctcca tcttttcttt tcagaaagtt aatgtatttt ggcctgaaca gatgtttccc ggggaacaca aatcctttag ctctgctata cctaagatat gtgtaacgct ataattactt ttctagctca ccttggctca gcctcctcac gcatcattac ctaacctgca gttgcttaaa tccatgaatt tcagaaatac tgtgcgtaat ataactatta ccttccaatt actttttccc cagggacagg tgtaagggaa tttctttatc agcgtttcta tgatagcaat atatcaaatg tcatttcaca taggccccct gaaataactc agctacttgg ttggaaaaac at tgaga agt gaatt att tt aaagcacaca ttacctgcca atcctccctt taagtgcatc caactctaac W0005851 0 [http:/Awww.getthepatent.com/Login.dog/Sexam.suporlFetchDefault.dogNVO005851 0.cPcfromCaqhe= 1 part=maintoolbar--bottom] Page 637 of 737 WO 00/58510 PCT11B00100435 acacacacac ggaagagttg tctcatatca agaagacaaa tgcatttgac tctatctaat atttataaac tacatagaat ttcttaagct tccaatcctt gggcaatggc tcaccatgtt ctcccaaagt taagctcatg gaatatgacc gcatattcac gggtggtgta ytggccgtat ggttcaagat agcctcccag ggatacattc gacagtggtc taaaatagtt ctgagttgta gcttatgtta ttttataaat ttaacaagta ggagataata atacattttt gcccaagtct tgcacttgga aagctcttct tgtgtggtta ttctttctac acattagatc atatcactga atttgtcatt cctctcccag tgagggattt gttttaaaat atttactgat ggtgcaaaat t actcacccca atgtggttcc tctgtgggcc ttctaaatgg aaccaagttc ttctttatta tgatgtgatt tttatatggt ctgctttctc tttttttttt acaatctcgg ggccagtctg gctgggatta tattcatcac t tgaaat tca tgctgtttaa ggggt tgtgg taaataccta tagttcatta tgaaagactc taattattaa accatctgct cttcaaatat tcaaattctc ccacagcact gagaaaactg ctaatggagt catcaagaat aaaaattaca tctgtctcta ttcatgaaac taagatgtac actcagagga ctctctaagt ttcctctcag caagaaaaaa agtcgcagat agcaact g at ccctgcatta tctttccttc aggcat cacc tcatacaaca ga aa tt c tc atttataaaa aaatgttttt attcaaggtt acagaagtgc gaacacacat aatatataaa gatttttagg tacttcaggg ttttttgaga ctcactggct gttttgaact caggcatgag cacct tcata aagattcact acatttccac taggcagggc taagagctaa tccctgtccg tggat ctcga tattacagat cctctggaac ttggagacag taagtattat ttggagtttc gggct cagag gtctactgta ggtgcccccc gatgataccc aaccaaatta ccacttaagc cttcttcatt gaactctaca tgccaacctt t t tct gcca aaaatgccca tagatttcct tactcatctg aaagttttat tgagtgtgga tcctgcttca ggggccactt 336 gctcttcaca atagcagcta ctaaaaacat catcaaattg caaaatgaaa ttttgtgtgt ctgtgttaat aagttggaac aagcaaaaag tggagtttca aatttttgta cctgacctca ccaccgtgcc agttccaatt ctttatccaa tagtgatgac ttctaaacca cgaaagcatt cctctagcac ctggtttcca gttgtcctta tacatacaaa ctctgttctg tggtagcatt caaaa ca ct t aggataagtt tgct tggcgc ttctagctct agataatagt acagaccatt tagtctttct ccataactaa ctgatttcta cttttgaact tctgcaagtt caagtgcttg attagctaag tgaaatgagg aattcaatat gagaagaaaa ctaaaggaag aagcagaata agagtgtgt t tttaaatggg acattctctt ctaagttttc ataagtaaat ttttcatgtg ctgcaattat acatagtcca agaagttcat ttcgtgttgc tttttagtag tgtgatcctc tggccctttc tctctagctt tgcaagattc atcagactat gcaagactac gagattgcta caaggctgct agggtagaca cattgagaca aatgggtcca ctaatcttag tctcaatgac tcacaactgt acattacctt aggcaaaatc tatgatctag cacacctggt aacttcagta gcaactagct atgtgtgagg taaaattgta cttattttat ttatgaaatt gtgtgaaaga tgaccttggg aaatcaggct gttttaaaat tgcagaatat gaaatacatc gctaccacac ttctccttat aaaagctttt t ttctagcag tttgggttaa taagaactgt tatgcattat ttttatttcc tataaattgt atctcttctt ccaggctgga agacacggtt ctgcctcagc caatcctttt atattcagct tgtctatcat gcaggggatg cttcattcct tggatgaatt ctaggcttta gaaaattaca catctgcctg atcccttaaa ctttttcaga agtagcaatt aggttcttaa aa taat tgat ctaggatata tatgggagga tgggacttta cagcagacac gtcctggtac agtctgtgca ttctgccatt catttctcac gtgttcacct aagagcacac cagataacat ggagaatttc gcgaggctga gt ct act ga t agcaaacatt ctttccttaa 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 158 3001

DNA

Homo Sapiens allele 1501 99-6012-220 :polymorphic base G or T misc_binding 1481. .1500 99-6012-220 .misl, misc Tbinding 1502. .1520* 99-6012-220.mis2, complement W0005851 0 [http:Iwwwgetthe patent.com/Locjin.dog/Sexam.suppotIetch/pefaut.dogfNVO005851 0.cpc?fromCache= 1 part= ma intoolbar--boftoml Page 638 of 737 WO 00/58510 PCT/IBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer bind 1292. .1310 upstream amplification primer primer bind 1758. .1776 downstream amplification primer, complement misc binding 1489. .1513 99-6012-220 probe <400> 158 gaatggctgg aagccttcat gtctggttga aaagtattca ctttaaagga tactaaatta gcacacctgc atttgccttg ctcccaaagt atttctccta agtaaaaatt tatccaggac catggaaaaa aaaggacttt atttactaaa tgaaaagagt gaaaaggggc taacagcctg gaaaggattc atgcatttca acttctcaaa ttcttgcgta ttgatttgca gccctgtggt tggttccctt kaattttgaa ttgtttaaca actatcagag gaaaattagt tatatgccca tgaaatatct tgctcttgct aagctcagct tctgaaagtc tgtcatgaaa ttgtcaatgc ctagatagca tcctgtagaa atgggaagca ggtgagaaat gccagagaac caccactaat ccttctgtgc cttcagggca gaatggaaga actgaagact tttctcagag tatggatcta aatgtcaatg aaaatagatt aatgaatagg ttgtgcttat atattgggtg tgagactcat tcatatttta cctaactaaa t tat taat ga agaagttctc ctgcctcaac cttttccttc agatggctgt attttgacat aagaat caat ggtgattaaa aggttcatgt gctgcaaaaa gtaagagtgc gctatggcat tgctctt gag ttctcaggac gtggtctcat gactttcttt aatggatagt aagtttcctc tatttgaagt taatattcat tatatttcat tct gga at gc aaagctaata tactagtcgc cagtagcatt tcagtgcatc catagtaata cgctctagct cacagggaga ggttcaactc agctggctga ccattcattt atttttgctg t ct tagga ca gagaataaag tcactctgat gggagcttta gacagttgca agagcaggat ttttcctcct gaattgtatt aattttggat gctaattaaa cctcaggacc tgaggctctg aaacttcctc tatatttaaa tcagtctaaa gacagcagga tgtttccttg attttttttg atttaacaaa cattagtgct gtgatcagga gt ctcaacta tccccaaagt agtcagaatt aattgtattt gaaatataca ccagtgagct caaggtgagg cacatttcta gatatatctg gaaaggcacc atttggctgt atatacaccc cttcaaactt ttagcttcat tggcatatat tgaaatactt tctaggtcag ttagaggtag acacagtgtg gttttcttcc gggttccatc agctggccaa tcttggcagg tctttctcaa gctt ccatcc taggaagggg gaaactgtcc tcaatccact cttactgtaa attagccttg ggggttgatt aaattgaatc aaattaggtt tttcgtttac gtgctaaaaa ctctgtcata gattcaactc tttggttatt ataaaagaaa cagctttcca aagactttac ggttggttgt agtcaaaatc actgcagaat tcttttaaaa aaaaggagtt tgtgatattt ccaaattaaa atttagattg agtcttgact cgtcttctca gctgctccca a att tcct ga ggcataaaaa ccaacaaaga atacttagtg.

ctttagttgt agga tat cat atcctctggc gccatagtag ggatagaaca a gaat aa a aa cattttccca gaaattattc a at agt tat t ataacatggg agacagatgt gacccactca agttttaggg tataaggacc ctggggaatc aaagaaatga tggacctcac cttcttttta ttcataaagg aacaaatgtc cttatagatg atgtttttaa gcatttctaa atgattttct tgcatacagt aactgggata tttttccctc taaaatatct ataaatgaga tgacagacta aatgaaaaag tctttccaaa acgttgaaaa tggtaagttc cacagtgatt gtggtcatca catatcaggg tgtttgccat tgacaattgt tgttttcctg gttttaataa ggtcagtctg ttttagagat aatgtacagc ccacatggag ttttatttcc ttctaaagta tttatatatg cctggaacta agcattttca tttgatgagt atgaggattg gctgtgttat tactgcttgt aggacctatt tcaaattgtg aggctgcatg cacccctgag cagatagt tc cttgagaatg agccacattt aattttacct aggcaataaa gtgatctgcc tcacccagga ccatggccca gtcttccaaa agtgcctgct ttaaaacaac tggagtagga cactcagtat gctcaaatta cacttcaccc ttacttactg tgatgaatgg aaaaccctta aaacaaataa cat gacttcc aatgtgcagt aaaatatatt aaaaatgagt cagatatcat aaactggtat ttcttgacac gttttttaac agggtccagg ttgactgaca caagggatgc ttctttatcc actctactgc tatttcattg atgagtgaag gtgctgattt tcacaattca ttctaatcac gaaaactggt aaattccagt attttgtatg tctttcctgt gaaactagaa at agca cttt cctctcttaa actatcaaga acccagccta atcaccacag ttcccatctc tctcatgtgt tcaaagatga caaacagtta tatctgtgat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 W0005851 0[http:/Mvvw.getthe patent. co m/L g in.dog/eCa m. suprortFetchDefa ut. dogNVO005 51 0.cpc?fromCacjhe= 1 part= ma intoo Iba r--boftoml Page 639 of 737 WO 00/58510 PCTIiBOO/00435 gtatctccag ggtctgactg gtgaagcatc gtgtgtgtgt g gcaaaaactt tcatatacag tagtttaaaa atgagctgtt tcttcctgca cacaggcata ttgagcgagg caacttgaac accaggctga ggccgatttt tttcactctt tctcttttct ggggatgtgt gacaggttgt gggtgggtga atgctggact tctttggaag atgtgggacc caagaagtat cactgtgaga 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <22 1> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 159 3001

DNA

Homo Sapiens allele 1501 8-98-68 :polymorphic base T or C misc Tbinding 1502. .1520 8-98-68 .misl, misc -binding 1481. .1500 8-98-68 .mis2, complement primer -bind 1550. .1f568 upstream amplification primer, complement primer Ibind 1135. .1154 downstream amplification primer misc binding 1489. .1513 8-98-68 probe <400> 159 cctttagaaa tgtgtataag ataattcaat ttcctatcac tttttttggt ttgacttctt ttttaaggga ttaaaaggcc aacccctgcc ctgaataaca acttctgtca aatcttcttt atgtcagatg ctcctgtgtg aaaaatctga tttcttgtgt ccctattggc atgctcagca acccagtgtg t tgct ct cgt ttgcatctaa aaaagtggtt tagatttacc gtgaatttca tgagtgaata cttttgtgag tgcatgaccc aatggatgca acactaccat cagttttaaa attcattttt ctatttattt ggtgagttta acttaatgac cttgtcttca tcgattaatt aagaatgtgg atttggggct gcatccctgg acaatcaaaa taggaaccac atttgcataa ttttttttag tgtaaatatg tacaaagcaa tttgtaattt cttctgagat caggtttcca tacttcaggc ggaataaatt aatgtgatcc aattatcagt aaaatgttaa aagtgagagt cagtttttgc ttgtccccat aatgtgaata at tt ctaat a ggataattcc cctctaccca ttgtctgtag ttatgttaat ctcatttcta ctctaaataa taagggaagt agtttcacca ctatttaagc tggtgccatt gtaagtaagg ccattttata aaaataaaaa cttatttcta agatatatat attgtacatt agacaaataa ccttgatcca attaaaatgg tgcatgttt t gccatataac ttgtttgggg ccaaatgtct atgttgccaa tatggaagaa ataggtactc ttaaaggttg cccaattatt ttaagaaaat catttctaga ttatcacagt tatccttaga tgtaactcaa atcagatttc gaaacctaaa actgacacag tttcataatt cttagtggct gccccactct tgactgatac ccttagattc tcaatgtttc gctgtcctgt gcagcatacc atgacttttg tctttttttt ggatttcatt cctaaactaa gtacactttc aaacattttg tttttttttt atttctcgtc aaaaaaagta tattgtcttt ttgtacgcat atagatatcc agtataaaca tctttaagag aaatgattta gatattctac ggaattctgg taatatggtc tcagtttgag acactgcggg ttcctacccg ggtggaaaaa ctaatgttat cgtaattcag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 W0005851 0 [tftp /Awww.getthe patent. com/Log in.d og/Sexa m.su pport/Fetch/Defa ult.dog/AN0005851 0.cpc?fro mC ache= 1 part=m a intool ba r--boftoml Page 640 of 7 37 WO 00/58510 PCTIBOO/00435 aaatagaaaa cttcgcattt attgttaagg agcattcaca yatgattatg aatgaaatca catcttatta tgccaccctt gacaattttg acataaggct tagtaaggat ccttcagcta aaatggattt ggctgagccc cacatcaact tcaaagtaaa gtgagtttga cttcattctc tcccaaatgc cagccaccta agcaattaga ctctgtcatc acttcccaca ctaaaggttt ccatcatcca ctgtaattca gccttgaaca ttgattctta tgaatcatgt t acat acaatg atatgttcta atattctgag gtttccacag atcaaaatgt tttcattcat agcagctgcg taccgatcag ttttccctta ctttgacata gggcagaaag gagctgagga ataaccaatt tctttatacc agtggtaccc atggttgcca gggtggggag ttgtattctt ccacttcgcc aagcattgca aaaggttaat acagtcacag atgacaagaa ccatctcgaa aaggtaaaag taaaggtcac aatgtcccat tagatggtct ttttaaagtg gtctttttaa atggcccaga ccaagccaga ctacatattc gccaaattta ccttggtaga agacatctaa atagtcacca aagagcaagt acatgaggca caaaggtcta gaagtacaca atgaggactc tctcccccat agattctgtt acaaaattct gttactttgt ctatgcctag tttggtagat tgacgagtgt actgcacctg aactccccag cctgaaatta tagaatatcg tgtattgaat ccaggaaagc ggcccagtct tccaaaaaag cctgctcttt 339 cctgtcctag aaaaataaga tttcacatgc cattccctgc aacatgctat ttttcttatt tctttcaaac tcctgtatca tatatctgac ggccaagtaa acttaatgac tgtctctgtt aataaattag acacacatcc taaaagaata tttctgtgtt ggaaggatcc gaataatgtg atttcatatt ctcttggctc tacaaatgag aaatatacca caaaggctat ttgacacact ggctggtt ic cttcattatg ggttgaaatg tattcaaaaa aaaggaaatg tggtgaatat atccagacct atttccattc aataaaatac tataaatcac gt gca atga t aattagtggc ctccagctag ttatgaataa tccgtgaaga gcacaaagag tcctcgtaac gatagcagtg agttccctaa tttcattccc caatatacaa caaataatca aggcttttgt cacggttggc tataacaaac accatcatgt ctcctcagca tactcaccat gacaacaggc tcagagggga gatctagaca tcaatgagag tagatttttt aatagggaat a ca tggt tt c ctctcatgta catccatccc atataggtat aagtgtccac gttattatta atttatttgg gcttttaggt atacagaaaa gagtcttacg tcatctttta ttggctaaac gctatgacac aagcaaccaa tataccatgt ctgcatacat caaaatttag gagggctttt cctgttggtc tgtggcatag ttgtcgcagt gaacaaatgc caccttataa ttctaataac gct tt act ta gttgcaatta caggatgggg cctcctaaat tgtattaaat 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> 160 3001

DNA

Homo Sapiens allele 1501 8-97-98 :polymorphic base G or A misc Tbinding 1502. .1521 8-97-98 .misl, misc binding 1482. .1500 8-97-98 .mis2 complement primer -bind 1581. .1i598 upstream amplification primer, complement primer -bind 1249. .1i268 downstream amplification primer misc binding W0005851 0 [http:/Mwwwgetthepatent.coM/Logindog/Sexam.support/FetchiDefault.dog/WO005851 0.coc?fromCache= 1 part=maintoolbar--bottoml Page 64 1 of 737 WO 00/58510 PCTABOO/00435 <222> 1489. .1513 <223> 8-97-98 probe <400> 160 tcgttaggaa ctaaatttgc aaaaacatac atttatatgt aaggatattc cacagtttcc tatgatcaaa atcatttcat attaagcagc cctttaccga tttgttttcc ggctctttga ggatgggcag gctagagctg atttataacc gccctcttta aactagtggt taaaatggtt ttgagggtgg tctcttgtat atgcccactt cctaaagcat tagaaaaggt catcacagtc cacaatgaca rtttccatct tccaaaggta ttcataaagg aacaaatgtc cttatagatg atgtttttaa gcatttctaa atgattttct tgcatacagt a act ggga ta tttttccctc taaaatatct ataaatgaga tgacagacta aatgaaaaag tctttccaaa acgttgaaaa tggtaagttc cacagtgatt gtggtcatca catatcaggg tgtttgccat tgacaattgt tgttttcctg gttttaataa g ccacttatgt ataactcatt aatggtcttt tctaatggcc tgagccaagc acagctacat atgtgccaaa tcatccttgg tgcgagacat tcagatagtc cttaaagagc cataacatga aaagcaaagg aggagaagta aattatgagg tacctctccc acccagattc gccaacaaaa ggaggttact tcttctatgc cgcctttggt tgcatgacga taatactgca acagaactcc agaacctgaa cgaatagaat aaagtgtatt tcacccagga ccatggccca gtcttccaaa agtgcctgct ttaaaacaac tggagtagga cactcagtat gctcaaatta cacttcaccc ttacttactg tgatgaatgg a a aaccc t ta aaacaaataa catgacttcc aatgtgcagt aaaatatatt aaaaatgagt cagatatcat aaactggtat ttcttgacac gttttttaac agggtccagg ttgactgaca taattatgga tct a at aggt ttaacctgtc cagaaaaaat cagatttcac attccattcc tttaaacatg tagattttct ct aatct tt c accatcctgt aagttatatc ggcaggCCaa tctaacttaa cacatgtctc act ca at aa a ccatacacac tgtttaaaag ttcttttctg ttgtggaagg ctaggaataa agatatttca gtgtctcttg cctgtacaaa ccagaaatat attacaaagg atCgttgaCa gaatggctgg aagccttCat gtctggttga aaagtattca ctttaaagga tact a aat ta gcacacctgc at t tgccttg ctcccaaagt atttctccta agtaaaaatt tatccaggac catggaaaaa aaaggacttt atttactaaa tgaaaagagt gaaaaggggc taacagcctg gaaaggattc atgcatttca acttctcaaa ttcttgcgta ttgatttgca gccctgtggt agaatctttt actcggattt ctagtggtga aagaatccag atgcatttcc ctgcaataaa ctattataaa tattgtgcaa aaacaattag at cact ccag tgacttatga gtaatCCgtg tgacgcacaa tgtttcctcg ttaggatagc atccagttcc aatatttcat tgttcaatat atcccaaata tgtgaggctt tattcacggt gctctataac tgagaccatc a cca ct cct c ctattactca cactgacaac tttctcagag tatggatcta aatgtcaatg aaaatagatt aatgaatagg ttgtgcttat atattgggtg tgagactcat tcatatttta cctaactaaa ttattaatga agaagttctc ctgcctcaac cttttccttc agatggctgt attttgacat aagaatcaat ggtgattaaa aggttcatgt gctgcaaaaa gtaagagtgc gctatggcat tgctcttgag ttctcaggac ttttctaatg cattcgtaat atatacatgg a cctct ct ca attccatcca atacatatag tcacaagtgt tgatgttatt tggcatttat ctaggctttt ataaatacag aagagagtct agagtcatct taacttggct agtggctatg ctaaaagcaa tccctatacc acaactgcat atcacaaaat ttgtgagggc tggccctgtt aaactgtggc atgtttgtcg agcagaacaa ccatcacctt aggcttctaa gggagcttta gacagttgca agagcaggat ttttcctcct gaattgtatt aattttggat gctaattaaa cctcaggacc tgaggctctg aaacttcctc tatatttaaa tcagtctaaa gacagcagga tgtttccttg attttttttg atttaacaaa cattagtgct gtgatcagga gtctcaacta tccccaaagt agtcagaatt aattgtattt gaaatataca ccagtgagct ttatttgcat tcagaaatag tttccttcgc tgtaattgtt tcccagcatt gtatcatgat ccacaatgaa attacatctt ttggtgccac aggtgacaat aaaaacataa tacgtagtaa tttaccttca aaacaaatgg acacggctga cca aca cat c atgttcaaag acatgtgagt tt agct tcat tttttcccaa ggtccagcca atagagcaat cagtctctgt atgcacttcc ataactaaag taacccatca cttactgtaa attagccttg ggggttgatt aaattgaatc aaattaggtt tttcgtttac gtgctaaaaa ctctgtcata gattcaactc tttggttatt ataaaagaaa cagctttcca aagactttac ggttggttgt agtcaaaatc actgcagaat tcttttaaaa aaaaggagtt tgtgatattt ccaaattaaa atttagattg agtcttgact cgtcttctca gctgctccca 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> 161 3001

DNA

Homo Sapiens <220> <221> allele W005510 ~to:tw,.etI~patent.com/Login.dog/Sexam.supportFetch/Defauit.dooNVO005851 0.gpcfmahe 1 _Emito~a~otm age 642 of 737 WO 00/58510 341 <222> 1501 <223> B-95-43 :polymorphic base T or C PCTJIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc Tbinding 1502. .1520 8-95-43.misl, misc binding 1481. .1500 8-95-4 3.mis2, complement primer bind 1526. .T543 upstream amplification primer, complement primer bind 1125. .1144 downstream amplification primer misc Tbinding 1489. .1513 8-95-43 probe <400> 161 gaaacaatct agatgtttta ttttatatcc taacctcagt aagaaagtat atatagatga atagatagat gtgcctcagc tctccctcaa ccctgaactt ggatataatt acgtggaaag gcaatgcaag tactcctggg tcattctctg agaatctgag ttgtgggtga ttaaaatgct caatgatctt agggaaataa gctttctgtt aggcaggtaa acagaccaca cacccggcga gtataaagaa ygagcacact acacaaatac gtggtctgga aatttttgtt acaacttatc tagtatgatg aaaaagtggt tatagttcat tttattatcc cttagggtgg cgaatttatg tactgctcca cataaacagg ttttttgtca ttgatataga agatagatag cttccattaa cccaccctcc aaaataaaag attttcttgt atctgtaatt aataatgttg actctcattt gacagtttat cgtatacctc tat ta tact t gacttgcccc ttattgatag aagtcattac tatcttattt agcaagttgc ccatcgaggt tctcctggag agtgcacact attaaaccca acatttccaa gtggaagtgg t cat tcatt t ctgatgattc tggccatttt cataggtaat agaactcatt tcgtcttaaa ctgccatgac cctggtgttc ggtcatcacc ttaaaagggc ggtttcaaat tagataatag atagatagat gacacacact accctccaat ttagaaaaga aatgtaattc cacatgcatc acccacattc ttgtgggtta taatgccagt t tgtgat tt c tctcctacca aaaacctttc tgtactgcgt aaacctaatt ttaacagcaa atgcaggtag cttcacagcg gatagcaggt tatgaggaga aatctcctag cctccctaag cagttgctgt ttgaataaat cttgaacata aaaatgtttt atttcaatgt ttagcataga atttaaaatt aatggcataa cattattggg aaggtctgac ttttcccctc gtcttatcgt atacacagat agacagacag ctactaccca aagacatatg cacacattct catgtccaca agcctcagcg ccagccatgg cctctgctca gagctcttgt taagagtaat gtgtttataa acgatcataa actttcacat gtatattgct ttgaaaaagc catacagcta gcgatcatca gcatttgcca gtcccggaat aatagttcca gtaagctgaa ct cagaagtc ccattataaa acataataca aatcttgggt gctattttag acctatgtca ataaatattt gataaactgc acgctaagca tgcaaaaatt aactcacaga tggttagaga aatagatgat acagatagga ttagttattt taacaagcct gtttctttCC tcacttcatt atatgaactt aggtgctcgg ctaccttcta ttgggtatga cttactccat ataaagtaat agtatcttag acctgctaaa tttaggttca aagagtcagt tgagaaaggt cactcacaag cattcacatt cactaaggct gtctgtgcct gttcaagaag attcacattt actctctggc ttatatatac ctatctgctc tgactatttg aagagcataa ttgcaatgaa ccagcacagc tgtgggagtt caaaaaagtc gaaaggaaag gagaacaggc agat agatag tggatggatg ttcctgatcc acctatgcat cccaataaag tatactggaa tttcaagaat atcagcactc tctgcctcac gaggcatcat tttttcaagt gaaaatcatg tacttagatt t aaagagttc atggtatatt agaataacaa tactacctcc tcttgccata tacctggaaa ttcaaggagg gataatagtt aaattccgtg gctattctct tatttcatat tgacataatt catgagaaaa tagtcaattt cctaaatatc tttggttcat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 W0005851 0.[http:/twww. etthe patent. com/Log i~o exam. suportFetch/Defa uIt.d o/005851 0 .00cfrom Ca rhe= 1 par- m aintool ba r--bottqmi PEage 64 3 of 73 7 WO 00/58510 PCTIIBOO/00435 cgtttgggaa taactatgtg cattgactag agtaactttc cattaacctc aatgcagcac ggtttgccag agcccaacca ttgcaatgtt ggtggatgat taaagataat ccctttgaga aatctctact attccctctt gcttttattc acagcatagc ccccttaact t ca a acact a aatcattaca caatggtgaa aaagtttgca cggaaggcta aaatttgctt tcataattac gttagtcact gggggaaaga ctaatgcaat atctggtgaa tggaggt agt cctataccct ttgagggtga aattctggga agtcccatta tcattccctg atcattttac ccagctagga caactaacca tatgagaaag gggtgacagt acacccactg ctgttgctga aaaattagta gattcataat agacatqgca cccaggttca ggcagctaga aagcaaaggc gccttgaagc tgctgacttt catgacatca taaacaggaa agaaatagat ttaaaccaca taaatttctt gctccgagac aaataatcac acttgtatct tttaggatca at ttt ct agc atacagtgtt gcaggaggca acaggcacac acaacgtctg tcagcctgca catcatgatt tttcattttc gccgagacat tcaaaattta ttgtatctta ttgtttgagg atctgttact aagatgcttc tgttaaagaa tataatttca tgacatgatg gtgctggctg ggggt ccct c atcagacacc tgggcagtgt gtggctgaca tattgagtgg caacaccaca attgaggcca catccattct atgtacatct aatcactact ccctgtcatt agggctgacc attctgagtt gagctgtaat gggtcacgat accttcaact cttcaacgat cttggtcagg ggcaaatgca ttcagaagtg 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 162 3001

DNA

Homo Sapiens allele 1501 8-94-252 :polymorphic base A or G misc Tbinding 1482. .1500 8-94-252 .misl misc binding 1502. .1521 8-94-252 .mis2, complement primer Ibind 1250. .1267 upstream amplification primer primer Ibind 1651. .1669 downstream amplification primer, complement misc Tbinding 1489. .1513 8-94-252 probe <400> 162 atgtccatga atttgcttaa gtcaatgctt gtgctttcag ttatgtacat ctaaaggcca aaatctaagg cagctctaat catcagtcac actcatcatt tccagtctat catgcttttg gatacgcatt ttgcactttc cattctaccc gctcttcgta gcacttgtat tcttatatgt ttttatggct cattgttgga tctgctaatt agttcctttt aagtatgtgt ccttgaacat aaatacctta ttctgacggc cctttctcag gcatagtatt cgatacaact taattagtaa gctaccttag gctgatgaaa agggaatgca aactttcaaa agatgacttt gacttccaga ccatggtgta tcactacata taggagtgag caagtaattt actcacgtga tatggtagtt aacctaaaaa aatccctagt aatcattttc tatgtgccac gaaaatcaag ggattggaat aatagaaacc tgcattgata catcttaact gcagtttggg tttccccaac taaaaagcca 120 180 240 300 360 420 480 540 W0005851 0 tqpL./fwww. getthepa tentcom/Loqg .dogSexa msupo rtFetchDefa ut. dogNVO005851 0.cpc?fromCache=1 pa rt=ma intooalba r--bottom] Page 644 of 737 WO 00/58510 PCT/IBOO/00435 cgtgaactac ggtagtttca gatttttaat gattgtagga agttatttgt tgaaccacat attgattgaa tgagttttct gtgtgtgtgt tgtcctagac tgtgaaggga ctcaatggaa aggt atggat ttcccatcac ccgaagcctg aaaccagtca rtcctgagca cagcaggaag ataaatctca cagaccatgg gacacttcat acccataatc agcacacaaa tttctcttct attttgttcc tcaggaagcc ttgttgtctc tactgtgctc agctctctat a cat at ca ca ggtttttgag tttttcatct cctacaagaa ccaaacttaa caagacggct agactttaat atttttttta gctcagcatc cagaatacag atgaggattt agtttaacac t tatgattatg gttgctgtct aacatagcag aatgaacatt tattattttg gaaagaaagt gtgaatgaga ttttttgaga gttttacatc aaaaatccat gtaatgtcct ttgctttact ggaccattct tagttgccat gggtgacgcc acaagagtaa cagttgagtg taagctaatg acctgttgca aatgccctac gtgaatgaca ctttttgagt taatattgag tcccattttt tctaaatctt ttctaaacct tggctcacac ccaaggtcgg gatatgtgtt agcttactgg aaagtgggtc attaattctc ttgcgctacc cgccatcccc gttgtgttct atttttggtg gctcagcatg tggggctcat tctgttgaat tggtccattc tgtttgtttg ccaccagaca tgccattctg aaaatgagtt gaaatgataa tgtagctttg aatttaatgt agt tcatgtg attaagttaa atggacccac gcacactcat ctgtgggctg tcagggaaaa cacacctaac gtaccgagaa aagtaaaagc gacaacatag atttatcctc cttattcttt ccccccacaa cagatatgga tacttcacaa cctgtttcag taatttctag acagggctgc aaatgttgca attattacaa tatcgattaa cattgcctgg tgacatcccc taatggtaac caaagatttc at tat ttgga taaatccatt gtttctggct t tcct gca gc tttaatgaca ctgagtccgg gttgcccagt tatcctagat catttatttt agcttaggga ctatttagat ttttctgccc gcctt ctgct tctcctgaag aagttgacac tctaggatgt ttgatattaa atgcctgtca aaagaggcca atacatattt gaaatgattg cagaaatggg caagcaatgt: ccatctttgc aca agtgcgt: ccagatcctc accagacatt gctgtctccg caagaagaca atgccttttt gtacactcga cgaaatctat ttagacgctg tcgctccact gttggcttag attgcatcta acacacatat gtgggaaatg ctctagtttc atttgccttg tgtaggcctt aaaaaaaaaa tcagatatac gcgtt cccct agcaatgcaa agt tt tta aa tactgtgtat ggctgggtta gaaaataaag cttttatttt agacaactac aaatcctcag ctgtatcatg gcccaagggt gctctggctt tagtatgact aaataccgca tgtgcagtgg ttctcctata tagctcccat taggtataca ctttacaaca caaactgcag ttgcttttcc atgatgttgg ctgcaataat acaggtgttg cctgctccgt aactt ct ctg cctggataac aatatctttt taccttgcct gtgtttaagt taaacctgtg gtctgtgacc gtcggagagc taaagaaaga acgctctgtc gctcaaacac tttgtgtgtg cccagcgagc gtaggcctga aggaaaatca tccgtcctgt catactcagc acgttagtta ctggacatat ttcaccagta gaggtgcctt gcaaaccaac gcattcttaa caagaaaggc agtt tattca t ca att atta ctttttccat atgggaagag atgttgcttt gctcacaaag aaggga tgtc gtgtgtgtgt ttaaacctgc gaccagagaa ggaattctgt tggtctatgc tcctcctttc ggaaacggtc gaatggaggc tgacttattc ggct gaagag ttgcaagtgg cagctaaact ctgtgactgt gctgacagct tcaattttgt ctattacgga ttttgcaggg aatcagggaa ttaagaaaga cagtagcaga aatccaggga tgtgttttat aagacccact ttaaggttca gtaattataa ttttaatgaa agagcatggg taaattaatt taggaaaaat catgcctcta gccatgatct a cat tcat cc tttccttttt caggaacagt 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 163 3001

DNA

Homo Sapiens allele 1501 99- 152 31-2 19 :polymorphic base T or G misc binding 1502. .1520 99-15231-219.misl, complement misc binding 1481. .1500 99-15231-219.mis2, W00058510 U [htto/Iww.g efthepa tent. comILog in.d og/Sexa m. su pport/Fetch/Defa uIt.d ogWO005510.cpc?fromCache=l1 art=maintoolbar--botoM1 Page 645 of 737 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 344 primer -bind 1701. .1i719 upstream amplification primer, complement primer bind 1189. .1209 downstream amplification primer misc -binding 1489. .1513 99-15231-219 probe <400> 163 gaatatggag attttagttt gagattgtgt agataaactc cactttagtt aacaagcagc taatcccact cacccattac agagttgaaa tttttccaat tcaaaaccac agtaaaaata tctactataa gactatattt atgataattt tgacactctt ttaataaaaa ttgtgatgag gcccagctgc gaatttttta gagacaggga cgccgtgata tccaatgtct ttgttcacag ttgactactt kagaactaca ctattacatt taaaataatt ttggaaattt atttccaagt aggattttac attaaaggtt tcccaattat attaagaaaa ccatttctag tttatcacag gtatccttag atgtaactca aatcagattt agaaacctaa tactgacaca ttttcataat acttagtggc agccccactc gtgactgata tccttagatt ctcaatgttt tagggtttca tttttttttt ttgcatttga aaggagccca gacttttttg gttagtgcca gcaacttcct aagtaagttt atcacattta ctaaattcaa acatacacac tttctgtttt tacagttccg tcatctttgt ctccaatatc cttacatgag ggataataac ctatagagaa cagccaaatc aatttttttt cgtacgtggt gagaaatcca gtgcatcagc cttaaaatgt atatttccct acatggttgc atgagaacat ttcaatatta gacttataaa aaaaattttc aaagtaattc gcctaaacta tgtacacttt taaacatttt attttttttt tatttctcgt aaaaaaaagt atattgtctt cttgtacgca aatagatatc gagtataaac ttctttaaga taaatgattt tga tat tct a cggaattctg cta atat ggt ctcagtttga aagtgttgac tcctggtttt ggtagtggag gaaagacaac aaaaagtctc acaccttctc aaaaacagga gttcttgccc agaaggaaag tcacttctta acaaacacac caaagaaaaa gtactatggt ccaaaatttt taaattcttt actatgaaaa atacagagga tcaagggcag cacccttaag acagctttaa ccgtaaagtt aaggtcattt gaatacgtca ttaggtagtg cattttacgg actccttaat tgttagtact aatttttaag gtttaagcca atcttaaagt acctttagaa atgtgtataa cataattcaa gttcctatca ttttttttgg cttgacttct attttaaggg tttaaaaggc taacccctgc cctgaataac aacttctgtc gaatcttctt aatgtcagat cctcctgtgt gaaaaatctg ctttcttgtg gccctattgg agttgagtct cactaagt ct ggcggtactt gggtatagtg tgggtggaat taaacttgct atgagccaat tgcttgtttt agtttatgtc atagatatat acatacacac gcattccttg ttctaactaa agatgaat ca ttctgagaaa agagcagcac ttataagaaa ttccagtgga ttgcttttgt agtattaaac taactttctg gtattacgat tcaaaattgc aagaggaaag aagagatcta ctcaggatag ataaaaatca taactcagtg tgactagaat aatacggaaa aaaaagtggt gtagatttac tgtgaatttc ctgagtgaat t ct tt tgt ga ttgcatgacc aaatggatgc cacactacca ccagttttaa aattcatttt actatttatt tggtgagt tt gacttaatga gcttgtcttC atcgattaat taagaatgtg catttggggc gcaaactaag aattccaatg tccaagtgct gctctcctct acctcagtga gcatcccttc gagatttgct ttagagggag tttacatgta tggtgtttgc aaacatagtg gagtttaggt atgaacacta cattttgaac acaaatgccg ttttgttgta aataagacat gctgaggctg atggcctggg agaaaccaac atccttaata ggctagataa tacaaaacaa aatataacct tcaatttacg agataacaat gcatcagtta gatgcatatt atttacatca tgattttgct ttttttttta ctgtaaatat atacaaagca atttgtaatt gcttctgaga ccaggtttcc atacttcagg tggaataaat aaatgtgatc taattatcag ta aaa tgt ta aaagtgagag ccagtttttg attgtcccca taatgtgaat gatttctaat tggataattc gctgagttat tctactggca gttggaatcc tatgacttag tgatttgcca caattgacat tattttctct tttctatcat actattttat attgctggca gacagaaata accattaact gaacagagct tttttatggt agga ca tt tt gttgttgttg acctgaggtt acaaagtact agctcagaag aaaagaatat ggaggataag tgtaatgaat taataatagg acattattta tactcaataa ttttataaat aatgttctct ttccttattt ttaaaataaa acattattct gctctaaata gtaagggaag aagtttcacc tctatttaag ttggtgccat agtaagtaag cccattttat taaaataaaa ccttatttct tagatatata aattgtacat tagacaaata cccttgatcc tattaaaatg atgcatgttt agccatataa cttgtttggg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 W0005851 0 [tpr:/twww.getthepatent.qomf~q indo /Sexam.suportFetclID fau do NVO005851 0.c cfo~ che-- 1 a-maintoolbqr--botmlae66o 3 WO 00/58510 PCT/IBOO/00435 345 ggctgtcctg tacactgcgg gatgctcagc agcatccctg gcctctaccc accaaatgtc tgcagcatac cttcctaccc gacccagtgt gacaatcaaa attgtctgta gatgttgcca aatgactttt gggtggaaaa attgctctcg ttaggaacca cttatgttaa ttatggaaga 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 164 3001

DNA

Homo Sapiens allele 1501 99-15239-377 :polymorphic base G or C misc Tbinding 1482. .1500 99-15239-377 .misl misc_binding 1502. .1521 99-15239-377 .mis2, complement primer bind 1139. .1156 upstream amplification primer primer -bind 1579. .1599 downstream amplification primer, complement misc -binding 1489. .1513 99-15239-377 probe misc feature 1878, 2817 n=a, g, c or t <400> 164 tccatttagt ttcattcagc tcattttctt agaggacata ctgt tct aca cccttccccg gtcatgttac cagcgaccac atgaggaaat ctcatttccc aaagaactta acttgagaga aaaatacttc cacaccatgc tattgattgt atttggcact gtggaagtaa atctggtata aataactttg agatccaaaa gtggtttgct aatcatgtgt agcacaatat acttccgcgg aggaacatgt aaccagctga atccaacaca caacagagtt aagaaatctt ttcatttgca catccagacc tctcctattg atattagttt tggtgtctct ttttgttgtc cat acaagga cttcatttgg ttcatgcaaa ca ga aca gga gccatctgct atgttggcag gccgtggcct agcagagagt ttcttcttta ctagcttaac gcaataattt t ttt tat cag aatttgcaag cttactaata atctgtatac ctattattgc ctaatttctt tatttttgca ttaatcttca gttcagtctg atggagtcca gattcacaca agctttccaa gtgaagcaac tttaagaaag tgcatagtca ataataaatt ta a atgga at tatggagtct gctagtcaca aaacaaaagg ctctctgctt ataaaaatta gataaaagta tgaatcctct agcttcaagt ggaaagacag ggcaccagca gattcttgct accatcctct cacaggaaag aaatgtgtaa atttggcatg tgaatgtagc tataccacct tagcgctatt ttaccactgg gtaactttca acaaataaca acattagctt ttaattctat cacacgcatt tggggacagc ttgctacatg gagatactca t tgt tctt cc ctcacaaaca gagtgagagg accataggat taattgtttg ataggagatg ttcttgatag cttcattgca tggcagtatt t aca aatgg c acagatacaa ggattcatgt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 W0005851 0.[httpJtwww.qetthepatentcom/Login.dog/Sexam.suportFetch/Defauit.doqNVO005851 0.cpcfromCache=l 1 art~maintoolbar--bottoml Page 647 of 737 WO 00/58510 PCTIBOO/00435 t tggca cat t ttttggtata attgcctgcc cagtttccgc tctctgaatc tttgctacaa acgctcatca atttgctctg stctccacag ttttttcttt acagtttagt ctggtggaga ggagtgaagg aaggtttttg attttttttt attttccctg agccagagaa aattgggatc ttctgggaaa gccatacctt tgttcttgtc ggtaattgtg acaaacaaaa tgtgaccgat ctacactctt caggatttct attcacaggc ttggcctcat tttttttttt tttttaatct actgccaaga tgattccaca agggtccgac a ttttttggtt tatgtaacat accaacacac tcgacccttt aactatttgc aatcaagcac ttcacactga gcaggaccct ggaggatgag tttttttagg ggagaatgaa agcccaagtt acacttgcga atcactgaga gttgttgntg ggttatacca ggtctgggag ctgaaagaaa aacatcggat taacatgcac acacaggtta gtctttttca aacccaaaaa aattggctca cccaatgtgt taattcttgt actttctctc tcaacactcc actgaatgaa ctccataatt ccacagggct ctttgtgttc ccatagaccc tggttcctga tgtatttgtg cattagattg attccttttc ctagcgaaga catggacaaa ttagcctctc caggagtgaa taaccaatgc agtgatagga atagatggct ttggcatgag gaatgcggat ggtaagcaga tttttttttt catccctacc agcggttttt gacaggatac acgaatgggg tcaatcagca gcaaaaaagg cctagcttga ctgaaaccat gccagatcgg tgctttgctt ctctttcaac cttgcaagtc tcctttgtct taagtgcagg tctttcttga ctatctccag tattagcatc tggtggaaca cattggttcc acagctatat catgatattc ctgatatgtg gttactgagt gtggtccctg tgaagctgtt ccttggtcca ttaatggttt atttctttaa gtgagaattg aaatacagtg cggtaggacg agtctcctgg tttttttgct tcacaggcca taatccagca taggaatgtc gactactaaa agtgctctgg aaaaaagtaa tttacatgca taaagtttaa aactgactct ctatatttca caccacatca tcttctctat ctatttattc tattcaccca aaaatccatt cccctgattt cccacttaat acggatgaac tggtttttca accaggatgt catttcaatt cattacctta atctgttatc ctcttctccc gacaccgttc tctgctcccc gcaattaatt tttctacaga agagcatgaa aaaaatgcag tggtaagtaa agagggtttc ttttaaatta tgcaacaagt tatgttgctc tgacattctt tctgcaagaa cactttctaa ataaataaac aagtaaaaac aagtagcatg agttcctctg ctttagaaag tttgaaggta tggcatgcca tt ctact tt t atgtttatct aaattttggg tctcctacat acctccagag aaatgcaccc gatgtttatc acacctgttt tcttccattt cagcagggtc aacagagcat agggacagat tctcctgacc ctccattcag attataatta aatccctcta cgtgtgcaga tagagtaaat ctgtggtgaa ttggaaaact aataagagag gcctcctaac ccct ggagaa ttaaaaaata aaatgtcgct ggctaatgac aaat aaatga aaacaaagaa catgtaaaca attccaatgt tgagacacag tatatttgat caaaattctc tttttttttt ttaatcatct ctttcanata tcccctttca ctacataggc agacacaggt 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> 165 3001

DNA

Homo Sapiens allele 1501 99-26126-498 :polymorphic base A or G misc Tbinding 1482. .1500 99-26126-4 98 .misl misc Tbinding 1502. .1521 99-26126-498.mis2, complement primer bind 1004. .1022 upstream amplification primer primer bind 1525.-1545 W0005851 0 [tqpltwww.getthepatent.com/Login.dog/Sexamsupport/Fetch/Defaut.doqNVO005851 0.cpc?fromCac-he= 1 part=maintooIbar--botomj Page 648 of 737 WO 00/58510 347 <223> downstream amplification primer, complement PCTIBOO/00435 <220> <221> misc binding <222> 1489. .1513 <223> 99-26126-498 probe <400> 165 gttccatcta ttgctagtac tcaggggttg tcctcttagg ggaaacagcc tctgcagaaa cccaaagact gagcattgcc ttattttccc agttattcat gtaacaatgg aagctactat actggcccca ctgatcactc tacatatata gccacatgac ttagggatag ggatgcagaa ctgcacttga ggttggaaat gaagcaacca acacctacat gaactgctga gctgatctat ttttcgattt rt att agg tt ttatggttac agggcaga ag gaatttgcta gtccctagac tactctgt cc gttagaactg cttcatagtt aaaggcactt ttaatttaca gcctacaata gaagttctaa gaaattagga caatgacttt t cctggggct tgaacctgga attgagtgag aatcagggtg taactgttta actttcaatt aatttctcag aaaattatct acacaactaa aaaggctata tctagatacc t <210> 166 <211> 3001 <212> DNA aggatacttt tgtattctgt gtattagatg agtttattag tctgaaactt agggctagat attataaggc tcctccctct aggagtcaca tgaatgatgt gtcggaaggg gggagagaag cctccgctaa ttggattcat tgtgcctcac atcatctacg gctcttacct ttgtcaaaat ctcagaaagc ttgatctctc aacatctgtt cagaatcatc tttgaaattc actcagtcac gttgccaacc tagatttctg tgtatcttta agtaaaatat gcaaaagcca aaacagcatc ccagacttac ctgctctcag t t tct t taga agttcaaggt aa cact gct c taagcagtca aattgtgata ccaggctact aacatgacat aaatacaata tttgcatttg gtttgagatt catataaagt ctcaaggtga tctaaataat tt tgt attt t gcttcaattc acatatgaga gga ct ttgt t aaaggagaaa gttaccctat gcggaaaaga aagaaacaca gttttttagc ccaggctgat aacaaatctg taaataggac taattttaca tcagtaagaa gaacctgtct taatgggcac agaaatagcc ctgcttattg cactgcattc cccctcaaga gttccctaat ctcacctgtc gacaatactc agtcatagtc atggaaaagg gaatctttaa tagggtgctt atggggccca tacatatgtt acatagagaa ggtgccaagc ttgttactag attaagctac tatttgcatt agcatcacct attttaacta cttccatttc ttattttctg aagtgttcaa ttattttcta tgttagatgt cttaaccagg tacttttcta taataagctt atctgtatct gttttcaaaa gaaatacata aagggcatct aggagaggct ctattagtct aggataaaat caattcaaaa aaatagaacc aagttttata aagaaaatcc gttgtatgaa ccattggagt agatttctct tgccactaag cctttcattt atcctctttt aggatcttaa gctgagcaaa ggtcatatgt ttccaaccta tcagagaatc cagccagata cccactgatg tctactccat ttcagactcc tgctggggt t ttgtgactct acgataactc agagctctgg tgcttttgtt gtcagattgt attagagcag gatacaaatg cctgtaggat ctagaaagtt aagccctgca gtccacatag tagcaagtgc ctaacttggt gggaacttgt gctttctggg cttgtctgaa ttgtcattat taaatagtaa attgt tt aa c tttatatata aaaatggcag ctgtcattta agtgggtctt cttcatcttt tcaatcattt tcaaccccac tctgtagcca gagaagtgat tgtgggaata tccttattaa tatattcccc ccaaatttgt tggtgattta aaatgttcac aaagtggatt cacccctatt gtcagttggg tttagcttat atctaaattc ctctacagta ggactgagaa ctgaagccca aaaattaaaa gggatcagat tgtatgaatc cagtctgcat cattatgatc cccaggttcc cagttgagag agtggaaggg acccaaatca tgtgcagtag catgctctaa at tgt tgt tt.

ctcaaagcat atacctcatc cacactgaat gttacatcct aggtcaagaa attatttagt ttaccatgtt tcatcatact gcagtgattt tagaaatgca tgattctgat taaaacaatg aaaactaaga gcatattatt ttcaagagaa taagttctaa atttttattc aatccacttt tgaatttctt gacacgctga tgctattcaa tagagggtga tctcataaaa tcttacatga tttaaaacca taaattcagc ccttttctcc ttcataaaaa gaaataagac atagtaatta ttctctttag ttttgcaggc aaatcctttt aagaagagag catttctacc atagctccca gtgccataga aaagattaag taggtgagac gttaagaatc ccaggcaacc gggctgcacc tttagccatc ctaat acatg catctcattg gacagaaaag a cgtgt gtt t tagctctgtt accaagattt tctcatggaa gttggaaaca cctcaaccca tgtgaggact ttcatggact ataagagaaa tattgtgtct atgctctaca cacactgaag acaaagtgtg aactcgctcc gcatgctaaa ataattgatc taatgtacaa gagcttatat tccacaggtt atgggatgca ttccatttta aaggtattca aatcccagtt taaaaatccc aggcaaggca cctttatcta ttggattgta ataattaata agctattgca tctgaatttt caaaagacac caagcaaaca aaacatattc gagagctcag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 W0005851 0 [http:/AMww.gefthepatent.com/Login.dog/Sexam.suportFetchDefaut.doqNVO05851 0-cpc?fromCache= 1part=maintoolbar--botom Page 649 of 737 WO 00/585 10 PCT/.BOO/00435 <213> Homo Sapiens <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-26166-257 :polymorphic base G or A misc -binding 1502. .1520 99-26166-257 .misl, complement misc -binding 1481. .1500 99-26166-257 .mis2, primer bind 1739. .1757 upstream amplification primer, complement primer -bind 1237. .1257 downstream amplification primer misc -binding 1489. .1513 99-26166-257 probe <400> 166 taaaagtcag tcaaccacaa tccggggtac tttgctgcac ctagctcccc ttctcattgt gtgttagttt actcatcctt tccaatctat ctgcaataaa gaacatgatg agagcctt ct aaagttatac tttggagtaa tatttcatgt tgtaaaagtt ctgttcccat gtccaaacac aaactgagat ggctaaccta ggtagtagtt agtctttcta agcaataact aattttctgc taaaacctga rtcagtatta ttcatggtgt cacaaactgg acccattgaa tgtgtagagt cattatactc gattccctct atgtgcagaa tcatcaacct acctcccaac ccaactccca gctgagaatg ttttatgtct cat tga tgg a catacatgtg cagaaactgc ccagatctgc aggacagcag gccactaaag ttgaccaact gcaaaagttg gctactgctg tcccataaat gcatattaca aaggtaaagg ataatgaatt tttgttcact ggtgtcatca aacattctca atataagaaa tttaccacta ggtcggtgct ctggaaaact caagacaatt ccctcatgaa tagtgtcttc gttcattcct tgtgcagttt gtcatctaca aggccccagc cttatgagtg atggtttcca gcatagtatc catttgggta cgtgtgtctt tgggacagta ctccactcct agttcagaca agggtgaagc tttgttttct ctaaagtttc ctgaactgac gttatcattt ctgttaagta t acaa tgtt t ctccagcaga ttttaaaaaa taattgacta ttggcatctc ataccccaaa tccttactag ggtaaagccc tgggcaggtc tgatagatgc ttagatctta ctggatgtac ataatttatt tgttacatag ttaggtattc gtgtgatgtc agaacacgcg gcttcatcca ccatggcgta ggttccaagt tatagtagaa atgttacaaa ttctgttcaa cgtctgttcc aagattgaag gcatcccaat aagaatatgg acatttttta ttactttctg ctttttgcaa gtgtctttgt atctccccag ggaaacagca gcctcacact cagagatagg tttcacctgc agcccaaagg tggaggtaga tgttaacacg ctctcagctt gaacattgag ccatagaaca attattatta gtatacatgt ctcctaatgc cccctcccca atgtttggtt tgtccctgca tatgtgccac ctttgctgtt taatttataa tgatggccac tgcatgggac atcatctctt ttttcctaca gcctttgcat cactcatgag tcattagaaa catggttgta ctttctatac gagttttgct gaacattcgt ctttgcaata gctattcctt cctgttgatt attttgtctc tccacaaaaa cacactgggc cagagacctc tcagttcttc acagtagtgt ggctagaatg tactttaagt gccatggtgg tatccctccc tgtccatgtg ttctattctt aaggacatga attttcttta gtgaatagtg tcctctgaga cctgcagaaa aatagtttta agactttcct agatttcaag tttggaaaat caaaggtttc tgcccttagt tagtcaagtg taacaaatca tttgccctat ttacaagcta tccatttttt ctctttttta ttttttttct acacatttcc actgccactc cttgtgctcc tatgcaatga ttttgcacgc attcctttgc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 W0005851 0 [htlp:/lwww.getthepatent.rom/Login.dog/Sexam.suportFetchDefault.dogAiN0005851 0.c~c?fromCactie= 1 part=maintoolbar-botom] Page 650 of 737 WO 00/58510 PCTIBOOIOO435 cagagcaatt gatacttaag ctgtactccg gactgtcctc cccctttctt cctgaaaata acagccctcc attctcctgt ccactaaaag ttatttgttt ttatttttaa acccatttaa aaagaggtct tctccacaac tcttcagtct cttctaaata cagaaaactg tggatactaa gcactaaata gctattagat atatgttaca gtatccatga tacactcata tagatgctga tagggttggc gttggttaat ctccttccct attcacagat tctgtttaat tat cttaaca aaattacagc agagaataaa aactaacatg tctgatctgt gaagttctgg gccactagaa gcaagctgat ccagtttgag agtgaggttc ttttattaaa ttagaaggcc cttcaacact caaacaagca cagtctatgt ttagactcca catctttgta atagtcaccc ttgaatatag gcctcccagt agtctcatta ttgtgtacat gcttcaatga aatgaccaca aacttaaatg tagataatat ttcattggaa ctagatggca ataacagtat tcaattttaa agtgcctcct 349 acctacattg atgcaatcta aacaaacaca tcagtgcctg tgcttcctgt tattctatag tgctctatat agacaggaaa atttatagaa ttttcttcta aacagcagtc ggaaatatgg cacacacaca aatgtcaaat tgaacatatt aagagcaata acattggatg cagctggctt taagttgcat ttgaaagaag tggttttaat tgcctgtaac aaaggccctc tctccctgtc tagctgctca attctgtata ttaggcatat aaaaaagcct ctcgattctt gggttcgaat acactaggtg a aat aatga c cacacacacc tgcctcacag cctcagcaac tacaaacaaa aactagaaaa tctttggaag tattcaaaca gctagactaa ttgtaggatg aaaattgcac tggagaacag tctgccttac ttaaatgcag tttgtggcac aaaagctaca acccaagtct ccagacactt ctgtacagaa caaagttaaa aagcctagga acaattagag gaatttcaga agcatgcatg caaaaaaccc ctgagaccac agagagagaa tagaactaaa tgtgtttctg 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210>' <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 167 3001

DNA

Homo Sapiens allele 1501 99-26167-278 :polymorphic base T or C misc binding 1502. .1521 99-26167-278 .misl, complement misc Tbinding 1482. .1500 99-26167-278 .mis2 primer Ibind 1759. .1778 upstream amplification primer, complement primer bind 1319. .1339 downstream amplification primer misc -binding 1489. .1513 99-26167-278 probe <400> 167 atatgaaata tatttacatc acattttctt tgtccattca tccattgatg gacattgacc cccatattct ggcaattgtg aagagtgata caacaaacat gagagcacag actttttttt catataccca gcagtgggat tgctggatca tatgatagtt ccctttttta ttttttgaga aacctccata ctgttttcca tagtggctgt actaatttac tttcccacca aaaagcatat gagggttccc ctttctctgc atcctccccg gcatatgtta ttttcctcat tttgattata W0005851 0[h ttp:/ww. getthepa tent. co m[Log in.d ogSexam.sup o rt/Fetclloefa ultdoWWO0005851 0.cpc?fromCa che= 1 part= ma intoolba r--bottomj] Page 651 of 737 WO 00/585 10 PCT/IBOO/00435 gccatgtcaa attagtgatg gaatgtctat attgttcaag atattttctc aagtttgtca gaggtcttaa cttctggtag cagttgattt tcttcctagc ttgtcaaaaa ttccattggt ttgtagtata tttttatagt ctataaagtg aagctgtaaa cactgtcttt gtcctgaagc tgcaaagctg ggtggtgttc yttgaaacct gctccaggtt gaggcctgtg atgtactgag tggctaccta agcattttct atcca at ta a ggatctgttt aacatgtcca ttgtgaaata agaaagttga gccctggact tcaaactttt ctgtctgttt tcactcatgt ggggcagcgt tctgtgtgtg taaatgataa caaagcagca ttcagcgaca agtattggac ttgagcacct gggacagcaa taattctgtc caaattgttg

C

ctggggtgag ctgaacattt tcagatcttt tttcttatat attctgtagg gcttgatata ccccaaaatt ttttaaagtt tttaatatag actgcttatt tgagtttgtg ctatgtgtct ttttgaagtc tacttctaaa ttttttgatg tgttttaagg tcatagagct attaacctga tactataaaa ctgagtgtgg ggttcattga tctctggcct ccacatcagt caagaagcat tgccattcga ttttttagaa agtgaaggac ctgaatcacc cacagtggga gagtcaaatt atccatgctc gcgtgcaact gactgcaata tcttttaaca ccacccttcc ttgccatact tgtttggtca tacatttcca attcccttcc gggaatgcat atttcattgt actatatgac ccactgccct t tctgaggca aaaatgacat atagtatctc taaaaatata gtccattttt attctggtta ttgtgtctcc atcccattta cttgctcaga tcaggtctta tgagagatgg aaagaaagtg aacaaaaatg gtttttatgc aggcagtgtg ggatgatcat ctgagctgtt aagaaaatac gaaattaaag aattttaaaa t ta a agg aa a tattttaaag gggctagctg atggttctcc tacacacaca gaatgtaaaa aaggagtgtg attaaaagta ttaaatgtac tcgcctcttt ttgcttgtta aaaattgaaa tagtgcaaat ccacatctca ggtttccatg attttataag tcacttacta ttactctgtg agattaggca ccgtttaaat cagttcctgt tactttgtgg ccttttggat aggctctgtt tatttatgtt aaactaaatc gtcatcatct 350 attgtggctt actgttggct aaatggggtt ttaatccctt attctgttgg tctatatttg ccaatgtcct cgtattacat.

ggatctatgg tccttttccc tgtggattca cagtatcatg atgcctctag cttccttggc ttccatataa cttaaacttc gaggagtttt ctggtttgaa ccaaaaacag ttttgacttt caaaccttcc aggaccctgc aaaaaaggct atatagaacc ccaaaatgtg tggctctgat atttgggaga ctcttcctcc aattaggaca gaaaaCaact gttcttccag cagtttgctt t tt t taaa ct aaactgtttc attattcata tgtgtgtgtg gggagacagg aaggtatgct agcaaatgac gagagttgat gtatttattc ctaggcacct ccatcttggt attccattcc tcagattaaa tgatttgcat atttgtatgt tgttattttg gttagataga tggcttcctc cttttcttgc gagaaattct t taaa tctt t ttttgcatat caagtgtttt tttctgggct cagtgttagt cttgttcttc cagtgacatc tccaacctga ctagtagatt tgtttggttt atattaggtt gcatgggaat cagtttcctc agatcttgtc agtttttttt tttgggtaaa cctagggata cgctgagtag gccaaagcta gtcggggga a ctcccaccct ctatgactat gaaatgcaaa ctcaaactac tatgaagtat tttgctctaa cttttctcct gtcaagcccc tgtgtgtgtg gatcctaaac ttttttctca catccaactg tcttacacag atatattaat ggaatctagc gtcactctac ctgtttttgt cattttctta ttttctggtg cttctttcaa ttgttgttga tagttggcaa tgctgtgcaa ttacactttt ttaatgattt aatacatttt ggatatccag cttggtgcct ctctattctg tactatggct atagcaagca atataaatta tggccacata tggatcttaa tcacaaacat ttctatcccc atgatagtta atggcattca ctt ctttgca ttttttttca gggaaacttc aggaattcag tgcctttccc caaaccataa agtggaaaga ccaccctgaa gtaactatat aaatatgaaa ctctaaaata caaaacattc taagcaaggt ctccattcct taagaagaaa tatgtatgtg t agt gct tt t agattttttt cttgaacact gatagctagg gatgtattta agtgaccaaa ttatttgtcc gacagcccca cacggttttc 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <2 12> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> 168 3001

DNA

Homo Sapiens allele 1501 99-2 6169-2 11 :polymorphic base T or C misc binding 1502. .1521 99-26169-211.misl, complement W0005851 0 [ttk/twww.g etthepa tent. com[Log in.dog/$exa m. su pport/Fetrch/Defa uIt.d OQNVO005851 0.cpc?fromCa che= 1 pa rt= m ain tool ba r--bottom Pagg_652 of 737 WO 00/58510 <221> misc_binding <222> 1482. .1500 <223> 99-26169-211.mis2 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer bind 1693. .1711 upstream amplification primer, complement primer bind 1262. .1282 downstream amplification primer misc -binding 1489. .1513 99-26169-211 probe <400> 168 gagagaaaga tgttggcccc ttcttttctc ttatgcttga actggctatt tatcaaatat tcttcagcac gctttttatt taagttttaa tatgtgtgtg ggttgagtat aaaatatttt aaaactcaag tggatcactt tactaaaaat ggaggctgag tgcaccactg taaaataaat acatcatgtc aattaggaat ttattctttc accttccaga gtgggatcta tcttactcca caaagactgg ytgtgatgct ccacattaga atttctcaac gagataatgc ggcaaaccca tcctgtacac taatgatata cttacttcca aagcagtttc catagataag gagcctgatg catcattgta acatatgccc caactcttcc ccgctgttaa ttctccattg tgcggatatg tgagaggtga gtaatgtaca ttaactcctg ttcttgtttt tagttggtta aggaaatatt cttgacaaaa caaatttgta tgatttgatc taaaatctgt tgtgtgtgtg ctcttgtgtg tgaatatttg gtgccatggc gaggtcagga acaaacatta atgggaggat cactccagcc t aa a aat cct agtgttcaag gctcaaccta actttccaag atgttaaaaa attatgactt ggctgctata agtagccctg gctgccagct cctgtgtgct taagtttata atgtgagagc ggacctaggt ataataatat aatcagtttg tctttcttat aatgattatc gcccaaaact agaaataact gataaagcac tccaaaaaat ttcatcccta aagcattaat cggagttgga acccataggc aatgtacaga acacagtgct gttgccttgg taaaaatatc taactagaag atttccattt atagagagga tgtaaattct tttcagaaca gacggagatg tgtgtgtgtg aaatgcttag cactattctt tcatgcctgt gttcaatacc tctggacgtg cacttgaacc tgggcaacag aaaggcttca aagtttcaga tgctactaat tttatttcct cctatgagct agctcttaaa actctgggca acaagaaatc ttggccacac tttgaataag attctatcta atttgtgagt aaatctttcc atatcctagc gaaatgtgaa ccttatttgt agttcagtca gtgaaatccc ctcctaattg acacacagat tgcttatctg agtgacagga gttttctttt gtcacactat ttgctgagga gtggggggca catctccata aagctctcca tagctttcac tgaaaatttt tgggtcccta tgtttttctt ttgaattttt ttacccactg ggtatttctg tgtgtgttgt gaccaaaagt actgtttgaa aatcccaata agcctggcca gtggcacaca cgggaggcag agtaagactc at gaa cat tt ttttggagca actactagta ggcagcaaca tacctgaaaa gttcacaaga acaggtgtat tgagtattct cccaaataga tgactcggct t tctgct taa tgtcacactc acatjtctat ataccatgtt ttgggagaaa ctctagtata tcttatttta ctattatggt gttttattga atacatgtct aggctgtagg aagaagggat tggagccttt gagaaaatct gtgatctaat tagaagaggg tgttttcctt gtgccat caa atatggtagg aagtcataat cttcttaaat atataaagct tggaagaaaa agtaaatcca tcaatactca atgtttcatg gtttcagatt gatccctcat tt ttgggagg acatgatgaa cctgtggtcc agtttgcagt: tgtctccaaa actttgagca ttttttattt tttttgttgt aagttgtaga agtctctaat gaggttggaa tcttactcat tctctgaagc cctctatttg gctctaatct ctcacaagta taggcacata ggatcagaac tctaatttca aagatagaag ttttcttatg tagataaagt ctcatggtga ttactgttga gcctgcgtgc a a aggatct a ttcctttcca tgctgcctct gaatattaga agccagggag agctatggag tcttccaaaa ccaattttct agtgttggtc tcttagagaa atagaaagac catgaccaag atattgacta tattccactc tttctgggga cctttataca tcagattttt ctaaaaatag ctgaggcagg aacttgtctc cagctactaa aagccgagac aaataaaaaa taaccattga cagattttta aaaaattggg ttatcaaacc aaagatttgt acagcatatc aagcaccctg ctgtggttca cagagctctt taatatcctt aaacttgaat tggtgagcgg ccttttcttc tttccaggaa ttatttgtta tcttgcctag taccccaaaa gtcattgtca tgcagcattg atgtaggtac ttatattttt ctcagattcc cattatgttt acacaaagtc tgatggtagg ttcaggcaaa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 W0005851 0 http:/Hww. etthepate nt. comIo i ndog/$exa m. sup ortFetchDefa uIt. doANVO005851 0.cpc?fromCache= 1 part=m aintoolba r--boftomj Pag e 653 of 737 WO 00/58510 PCT/iBO0/00435 cgcaatgcaa gtatgggaag atgatatgaa aaaaagaaag ccttggagaa caattttaat tagattataa

C

aagccacagc cgttgatttg cacaaaatga ggaagggagg ccaagcagta tatggttaag ttgttaggat accttagtgt gggcaagaaa gaaaaatatt tttctgctag catgggtatg taatttaaaa attcaagtag 352 gagtgccatc aaggcaaga t caggca ctgc ctagcaaact agaacccata tacttgatat aatacaagat atctgaaact atttatttga tattgcccca ttgcaaatgg ggtatatctt caaaccaaac tccaaagaaa gtccttggtg tactgacttg ccttaatagt gtatgaatac tgtgcagtat aggtatttag ttcctgatta 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 169 3001

DNA

Homo Sapiens allele 1501 99-26171-71 polymorphic base A or G misc -binding 1481.-1500 99-26171-7l1.misl, misc binding 1502.-1520 99-26171-71 .mis2, complement primer -bind 1431. .1f450 upstream amplification primer primer bind 1860. .1880 downstream amplification primer, complement misc Tbinding 1489. .1513 99-26171-71 probe <400> 169 tagtcctttg agatccctga caacagtgta tttttaatga atttctctga tcttcttttg tttttcttgc gagtagattg tcttttgctg gttgccattg gtattgccta atccatcttg cttatggcta ttgtttttgt ggctctgttc gttactgtag ttttgtttta gtagtttttt ggtatatacc ggaatcgcca aaagtgttcc t cgcct tt ct tggccagtga agaagtgtct aaatttgtct caaaaatttt tgcagaagct cttttggtgt ggtttacttc aattaatttt gccagttttc caggtttgtc tgttccattc ccttgtagta ggattgactt ccaattctgt cagtaatggg cactgacttc tatttctcca aactggtgtg tgatgagcat gttcatatcc ga gt tcat tg ctcccattct ctttagttta tttagacatg tagggttttt tgtgtaaggt ccagcaccct aaagatcaga atctatatct tagtttgaag agcaatgcgg gaagaaagtc atggctgggt cacaatggtt catcctctct agatggtatc tttttcacgt ttcacccact tagattctgg gtaggttgcc attagatccc aagtcctcgc atggttttag gtaaggaagg ttattaaaca tagttgtgga ctgttt tggt tcaggt agca gctctttttt attggtagct caaatggtat gaa ct agtt t at cacctgtt tcattgtggt gtcttttggc ttatgatggg atattagccc tgttcactct atttgtcaat acatgcctat gtctaaagtt gatccagttt gggaatcctt tatgtggcat accagtacca tgatgcctcc ggttccacat tgatggggat ttctagttct acagtcccac gtttcctgac tttgatttgc tgcataaatg gt tgt t tgt t tttgtcagat gatggtggtt tttggctttt gtcctgaatg taagtcttta cagctttcta tccccatttc tatttctgag tgctgttttg agctttgttc gaactttaaa ggcattgaat 120 180 240 300 360 .420 480 540 600 660 720 780 840 900 960 1020 1080 W0005851 0 [tgp:/Iwww.gettheipatent.rom/Login.dog/Sexam.support/Fetch/DefaultdogNJO005851 0.cpc?fromCar-he=1 part=maintoolbar--bottomI Page 654 of 737 WO 00/58510 PCTILBOO/00435 ctataaatga catggaatgt ttctctttga gacactctgt ctacattatc tccattcatt tgaagagtgg rctatttgcc tcctacttta aatccatttt tctcctctcc aataataaga ctatccattt taatctaagt tcaatccaat tattatcctt catgttaaaa ctgttactgg ggaccctttc tgacctgcaa tt tgg catt c atcgaaatac atagtgacga atttgatgtt aatgcttggt gacagagtgg tttgtattta tactatcata cactcaagtt catagttcat cctaagggtt a cat gat ta a c ccttgggcag tcttccattt agaggtccaa gtctattgag cattcattaa cattttacag ggctgggatt tgcacttaca aattcacagt cacttaactg catttctact aataaatgtt actcctcttt tcaagacctc aattttcttc aacagtattt aagaatcccc caaaactctt taaacaggtg gtgatcaaac aaatttt cat tttaaaccta tatatttggg cagccaaaca gtttccttac cttgtctcta aatataatag gcaaataatc taagcat tat tttctctatg tcaagtattg ggtaatgttt tatggccatt gtttgtatcc taattggata tactatttaa tacactaaat atgaggaatc aggagaagat aggctgaatt caataacctc gatcatattt ctcagctata cacatactcc ttattttttt atcaaattta tcttctgcat aaatatgctc tcttggttat tgaaagagaa tttgtcccca tcaagattct aataaatttg ccatttaccc tttctaattg ctaatagtac ttgggaagaa t aaaacagaa atttgtgatt attggcaaac gtagaaagaa tggaacgttt ataatatgtt ctacatttgt ttcatgatat tcttttattt attattaatg tcttcacaac tatccagtaa ggaaacaaaa ctgctaactg tggctgaaga agggggcccc cttaccttac tccttacttc acaactgctt actgaacttg gcattagacc catcctactg taatatttag gcatttctct attgcaacta gtaacaaact gttttcagtt tattttttac aaccagtacc agagtattaa tcagttggta tattcctttc gaagatgaat aagcaacggc taaaatatta atagtcataa tcatggatag ctacctcttc gtttttagtt tgattcttcc cattgagcag tatttaacaa aaacccatgt tcgataatac ataaaaagct tttagcccat aaaatacgca ttggtacatt ttcccttcaa tatttgtctg ttataagtct gggataaact atctctccta tgttatccca aacatcttaa ctagctattg tccttctccc gttcttgtca cttatcctac tacaaagtgg ctttatgcga tacgttaact ttcgggtacc atcacatgta ggtctttctg tgcttttcag gtttgcttaa actttggaag atttgttcct t tt acc ta cc tttctatgtt tacccatgag tggtttgtag ctacctgcat ggtaggtaca actaatatta tgcatagctt ctgcctgcct gacacattgg tcttttttaa acctcttatg agaaagtaga atctgcagat cctagtgctg ctcagggaaa catcctcctg ataattaccc aattaattgt attctctctt cggtcaccca ccgtatagta taaagttagc tcatcttttt attccatgtg attagaaggc tttgtgtttg agaattagtc actccttaat tga taa atat ggccgtttat tatttttaca tattacacag aattttttgt 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 170 3001

DNA

Homo Sapiens a liele 1501 99-261B3-15 6 :polymorphic base C or T misc_binding 1482. .1500 99-26183-156.misl misc binding 1502. .1521 99-26183-156 .mis2, complement primer bind 1348. .1367 upstream amplification primer primer bind 1798. .1818 downstream amplification primer, complement W0005851 0 fhtti0:Iwwv.q ettheIpatent. comIlogin.dog/Sexa m.support/Fetch/Defa uIt.dog AA(005851 0.cQc?fromCactie 1part=maintoolbar-botom] Pageg 655 of 737 WO 00/58510 PCT/iBOO/00435 <220> <221> misc -binding <222> 1489. .1513 <223> 99-26183-156 probe <400> 170 taatgctcac taacatgcta tttgtcaact cttctttgta tggactaata tacaggtggt atcacacaaa tatcttctct caatcttagc actctaaagg tatctttcca gggttgagct tgcctctggg gtgtattggt cataaactga aaaattgact ctttgccttc aacttcaagg ccactctcct ctcaccatgc taacacagtc tccaccacag agcagcactt aggtgcagga tgaataggaa ygcagagaac taagtccttg gtatggcatc ctgtctacgt atgcaattca ttccatcctc cagcatcctg gaggctatga agcacactat ggatgaatat ataacactgg ttttacttca gttaaaagaa tgatgcccaa gtttgtttct aacaaaaatt taagggacac gattgtgttg cttgaaaatt tagcttttct ctctgtattt catctgaagc attatttact gtgtgaacat tatgtgtgtg t tctacattag taaagagcct tcgcagctgt cttaggacaa gataattcct gtttcttcaa ggtgaattta tccatatttg aggagttgtt gctattccaa tatctctgca gttgtgttta agtcaaagaa ttctcactgc ttatcttata tgtcagtagg ttccatttct tcaacaatgt tttaaggacc cacagtccct acacacttca caaagcaatc ggctgcagaa gcaggaaaaa ctagccattt aagcctctat tcactgtcca ttaactgcat atgatcttgc ttttttgtat attccgtggt tgctgttatt cttacattaa ggggagacca gggacaaact gtttggggta catgttcaat ttatcaagtt ataatatatg aaaacacttt ttttaggtaa atttttaaat tgttcaattc agctattggt tgttttttgc atttatagag atgtatcaga actacattca tgttaaattt tatacatatg ttaccaatga cttggcagaa agcgctgggt ggataagtct gagatgctat ttagaagcac aagctttacc tatatttgta aaatctcaaa atgcaaaaga agataaaaag gtgaaagcac aacacagacc tgtaacaata gttctgtggg gctctgatcc agaggccatc tgcatttttc ctgttattac aacttaatct ggtataagaa acatggacac tattgtgatg cctgccagag gaaaagatgc taaaatccta gcctctgaga gcatcatacc cactgcctgc aattaacaga gatgctactt tggccatata accacatagc gcctactgtc acctccttgt ttttggggac ggcccatgta aagaatgttt tggctaaatg tcaaagaatg tataaggcac aatcaaaaaa cctattattt aatcttatca tatgtcacat ctctcacctc agttctctct gcagcttgga ctgattgggt tatatttgta aatctgtcag atagtaggtt gtggggcagg cagtcagttg ctactgctaa cagcaagcta ttttctctca agttatttta tgagttaagg agcctgatat tgtgaaaaaa tttcactaac ctccccatga agtcattaca ctaaaattct tttttggaag tacattcctt tgataattac actggacaca tgtatgcaaa tgtaggtgct ataatcacaa gtacaaccca gcaatcatgg agagactggc ccatcctgcc aaggatctgg caacatccag tttaatctac cct cccaaga tcttatctaa tggttatgtc taattggcaa aaatgttaga tctctgcaaa gtggtagtga attacaaggc tgatcttaat gtaaacaata tacagtggga ttttccttag aattgaaaag tattttcctt gttcctgt cttcgtacct tcaacttctt gtgattggtg tcaaaaacct taagtttcta tatgtatgta tgggtatatg aaaatgggag actttgtgtt ccctgactgg tattttatgt aataaagtat cctaaccatt atcataatgt tatatgaaat tattgtcact aaaaaaagcc acagaggacc gatgctaaga aacttaatgg gacgtggatc ctgtagaaaa atcacgtggc ttaatagtca cccaaataat ggcccttttg ttcagggagc tacatcatgg ggctgacttc acagagaggt tttcaaiagc tcccacatta catctactgc tgaccagagt tgacctcaaa tttggacact aataacattt cacctttcag ctgaacccca ttttgttcct ttcattttcc gtcataacaa ccagggattt tagcttttac aggatgaggc acctacatgg gggaaaatta atgcttcttt gctatgcaa aagtctgcca ctaacatgca tctctatttc gaataaatta agatttacaa attttatatg tgtatatata ttaagcaata cggaaatttc tctgagactg gggagttcat ctatggccta catgacaata ttcatttttc agatacaatc cacctttaaa ctttcttaaa aggaaaggtt tgccttatga atcttgtcag cttgaaagaa tcgccaggct gaatccattt actttccttg cctctgcctt ccaggataat ccatgtcatg cattgttctc ttaatgccat atgcagctca gatgacaggg aggcagccca ctctcacaat agggtcatgg gatagttcac tattcttagg tggccatctt gagattcata agaaattcaa ctgttttccc ggagatttta ctttagccat gcttaattcc cctctctgct taggcctttc ctattttttt aaatcttcat agagtttaga tgcatctttg ctctagacat agtaattgga cactctcatt tgatattctc aaactgtgtg ctttctaact tatatttata tagaaataca 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> 171 <211> 3001 <212> DNA <213> Homo Sapiens W0005851 0 [rhvtnJmw&getthepatent.com/Login.dog/Sexam.supporttFetch/Default.dogNV005851 0.cpc?fromCarhe=l part=maintoolbar--boftoml Pa-ge 656 of 737 WO 00/58510 PCTA~BOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-5912-49 polymorphic base A or G misc binding 1481. .1500 99-5912-49.misl, misc binding 1502. .1520 99-5912-49 .mis2, complement primer rbi nd 1463. .1483 upstream amplification primer primer Ibind 1946. .196i downstream amplification primer, complement misc binding 1489. .1513 99-5912-49 probe <400> 171 agtaaaatag gtagcactca aagacaaaga tggggtggac ttaggaagat agcagtggga aggagccgtc taaacccctg cagtgctgtg gggagtggga gacatgtcaa atgtgtcatt gatttggact tttagattga aaaaagttag agtatttctg aaaggaagca cctttagcaa tttattttag ttccagatac aagaagtagc gatactttac ata aaaagat tgcagtttct tgttgctttt raattacctt attcagatca cattgattca caaaatggaa tacattttcc cat taacaca agcagaataa agggacatac gagagcaggg agcaagtgta ggacatgtgt aggccatgca tgcttcggag cattgtgctt tgatgagttc aaaatcagtt gtgcaccacc atacactgtc tcatgttgaa cat tggcata agcatatggt gct gctgaga agggtgcctt gtactggcag ccatatctca cca aactgat tgaatcaaaa catagaacca acaactttaa ctaagagatt gtaaatataa gggaccttat atagtttaaa tgtgtctttt tttatataaa cct taattct at ga a agaa g gagaatggca aacttaactg ggagcatgct agaaccgtga ggctgatgag ggtgcatggg gaacgttaga ctccgtgccc tgttctgggt ttaaaggttt cctttcccca atttagacaa gaataaaagt gtgacttcat gattcacaag tcctgtgaac tctaactcca ttctatcaat actttaaata gctcagggat tccgaatgtg cagagaaggg atttgtccaa ctacatgaca tagtcaaatc atgaacatat cccaaaatat atctgttgtt tttaaacaca tatttcttgg t gaa cct tac agatcagttt aaatgagtga atggcaagac ggtggccatg gcacgcgcac ctgtgggaag gttcctaaat ctgatctccc gaactgcaca aataagggtt cctgacttca agacactgac agcaaagact tttttaaatg tgcctggtgg cacaactacc cacagtttgt ccaacaagtg gtaaatattg attaagtgaa cgaccatcag aggtttttca gaaaaaatta ttattgtttg atgttaccat taagataata ttataccttc tacatttgga taatggtttt aaacgtgcct taggctttga gggaaggctc gtgagagaga gcttggggag agtagcaagc gaaatagagg acactggagc tcagttaatg cttccccata a agaccctt c tcttaaagaa aacaaagaga catgacaagt ttaagttgta ctgccagaat aaaattataa ttcaaaagat agtattttac gggaacctta taccaccacc ttgcccagtg gtttcagagt aggcatgata ctaaagaaac ctagaaagta taggacacat atgatagtgt agattagatg ga aat at ttg atgtaaaaat tagtcgctga ctatcaggtt tatttcagat gagagagaca ggaaagcatg gcgaggatca cagagttgtc tcttagagca aaatgcttgt gcctgtgtat aaagtttgaa aaataataaa aaatcccacc caacagtgga gattggcatc ttcttagaaa aatcagcagc agagggtagc aacttgtttc ttaataatta agtgtatcct ccagtcagtt ctatgccctt cttgctgaaa acatagccca gggtgctagt taaaaatgtc tcagtgcaat tatgcaaatg agaaatattt attgctaaat aatattcata tgctgttggt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 W0005851 0 [http:/twww.cetthepatent.com/Login.dog/Sexam.support/Fetch/Defauit.doqMO00585 1 0.cc?fromCache=I1part=maintoolbar--bottomlPage 657 of737 WO 00/58510 PCT/IBOO/00435 ttttgactat taatatggac cttttcaaat ccggactagg cagtcactta catgtttgct ggggagatgg gatgtgctga ggtagtgggg aacaaaaaca aaattacaag acaaccacag gtgtgggcct ttgaccatgg aagcaaaaca ctgccaggaa aaggcgatgg atgaaccatg atggacaata tgtgaaacta acatgacata gattctttaa aggcaaggga tttcattaag gggcatatgt catgatcatg tttccgtgat gctgtgttat attggcttca cagtgtctat caaaattcat aaagagccag gaagcaggac ggtaccaagg gaggctgcct aggtttaggc atggaagtgg gtgtggctta tagcctgatt tttgtctgcc tatcacataa gggcagataa tgatatatct tatgacaaca aaaatggttt ttccccaaat gctctctcct gacattttga ctatagatac gctgtaatct gtggggcaga aggagaagga agcacactgt gcaggaatgg ttgcttcaat tgttgcaaca gcgatggcaa tctaaatcag tgacttttga agggaggtga catggtgctt cactagaagt gagaaattca ttcccagggt gtgggaaact t ga tgt cagt acaaaacaag atacatagtc ataaacactt acctaaaagg tgttacagcc acagaccatt tgtggaagac aggtgagcta ttcacatggt cgggcatctt gaagaaacgt tcccagctac gataactaaa tgaaatcttc gaggtagaac cagactggtc gagcttaccc cactcggctg tttttttttt tagaagctgt acacatgctc tttagaaaca accttgagaa agtgaccata cagcaaggag catcagctgc cttatacaag gtgggttgta tagatgagaa gtattgttgt aacctctggc gggggtgatt tgtgactttt ataacaaatc ttacccggca attgcattct cataattggt tctaaaagca tttctttaag ataaaaacac gggagaggtt tgacaaacat gcataggtaa cccagcctga agactgaggc gagaaccatg ctgggaagag gaatgtacat 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2 94 0 3000 3001 <210> <211> <2 12> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> 172 3001

DNA

Homo Sapiens allele 1501 99-7337-204 polymorphic base A or C misc_binding 1482. .1500 99-7337-204 .misl misc binding 1502. .1521 99-7337-204 .mis2, complement primer Ibind 1298. .1318 upstream amplification primer primer Ibind 1731. .1748 downstream amplification primer, complement <221> misc binding <222> 1489..1513 <223> 99-7337-204 probe <220> <221> misc feature <222> 1564 <223> n=a, g, c or t <400> 172 atctaaaggt atgtgtaatt aagttgaaat ctattaagaa taattaaata acagccttct W0005851 0 [httD:/Mwww.getthepatent.com/Login.dog/Sexam.support/Fetc/DefautdofNVO00585 1 .cpc'?fromCacrie=l1 art~maintoolbar--botomI Page 658 of 737 WO 00/58510 PCTJLBOO/00435 tcatgataac cagattacaa aaagaaccct tcctccttta gtcattattg gttagtaata gtgtctaata taaaaaatgt ggtgggcaaa aaggtgacat taacagaaca tatatgtttg cttaggaatt caaattttac ttaggttttg aatgcagaca ttacaaaaac agattctcaa cattcctgat caaatggccc ctgctactgt aacataaaaa tgatttagtt ttgattttgt magatacatc cctnaaattt gcacaataat gaagcaaagt tgaaggctca aagaaatagt tttgaaaaat gggacggctg agagcctgag cactcctgta tatccctgga cctattggac aagtatgact tttaggtccc aaaaaggaaa gtcctggcta ttactttgtg acatatactc aacatcagta gtatttataa atgtcttcct ttatgtttct tgtatctcag tgcctttcac ctcataacaa aacatttgag cttaatttct ttgttgttta agttcaagcc agctgttact tattagtagc tcgtttctct tatgattgtg cttgaagaca agtaactaag taaaggcttt catatgtgaa tgctactggg cttagatcag tgagcca taa caga ca atat aggtgaaaat ggtcactttc gagttatgga atcacggtat taagataata agatataaca tggcagtggt tgtggtgggg aaactcctta aaataagcat tgtattatcc agggctcctc caggcttccc tgccaatgtt cagatcttct ctt t ttt aaa tcagaggcca tctacctggt gatctcatca attttcaatg gtgcaattac ttataaggaa atat tttct t c cagaa agt t tgttctggtt atgtgctaca cgacatgttc catacgaatc ctcacttata caaacctatc tgatgaacta aataccattt atattatatt ttgcactttc agtccataaa atattatact tcctctgagg gggaggggac tattatttat atttcctctt ttcagaatgc ttaacaaaaa tggagttggt tccaaggatg aatatgtgca ttaataactc gattggcaaa agatctttct ataaacaaag tgtgtttggc aattctgagg aggagagCtc tttcctaaac agtacaccac tttctgttta gcaaattaat gtgatggttC tcgatctcgt tttcatatta aactgtatag tttctttggt tgtggccCct aaaaggagat aaagatctaa aaaatcattg tttatcctca cattagaggc attacaatta caatctgttt tctcaagagc atacctttta tcttgaataa cagaagtcag ctctatttgt aacaactttc ttaacttttc aggccctatt agacatctaa ttcccatcta tttacagttc attctcccta gttctgtcat aaactcaatt ttatttttca caaagtaaga agagatactc tgaattcgtg catgtattta tttaagttat cccttttata cataattttc gggctaattc aaacactggt atccaagttt ttccctcaat cttttggcaa.

cgaccacgca gaaagtgcct ctgagagtca ttatggtttt cttccaacca aaaggcattt agatggtgct attattgcat attcaagctt taaacatagt tttggcagat tcactgccag ca act atca a tcttgctgct tgacccactc tatctgtaga ggtttttatt cttctaccac ttacggtgcc atttgagttt tttccaccta tcctaaagca atttttgttt aaaattcatg tttttgtaac tgtgtcataa aatattaata aggttcattt gaaaccatCC attattccct tttgtttatt caacattctc tccaaatgta taatcactct ttttcagtga tctcgttgta cctctcttat acttggactt ctaaggagtc gatgactctg ttatgtgcta tttggaattg gttttccctt atttagtctt ctagtggaag gaagctcctc aacttgggaa tacttaggtt aggaccatat gctctgaaat gttttccaat gtttgctgga gccagattat gaagtctctc ccctcagaag ttcatttcaa ttttctatcc ctgctggaac caaggaggca tcaaagagtt ttttagagag ttagactagg gtacattgga aaggttgaaa aacttacatt ttcacaggag tgtcttcatc atgatcatgc gtggCccgtg ctggacttta tactgcagga atgttggtca ccaagaaact attatagtct tcctgatatt ctaactatta tgtgagagat tccacactga tgcatattca agagttttca cacttctgtc ccaggCcatt agtattttat aatgaatgac aatataacta ttgatatttg ggagacctcc caggatgagg gaaaatagag tttgctactt cctagtattc aaatggtgat agataacacc cctgggctcg cttcaagttg tgcttagctc ggaaagtcct agtaaacatt ttgtagtgta gaaaccttat ccactggatt ctgagttatt tttgtacaag a ggaatt ct g aaacaaccac tatgacttga tcatctgttg aggtgagaaa tatatttaag tgtttcactg actgccttga ggtctcatac aacaaaaact tcttacttcc aaccatgtga tcctcaccac cagctttcct ctgtgcacat agtagttcta ttgaagcaca atgtcagttt tttcattttc t tCtct t tt t atttctcccc acgtgaacac tagggttgaa caacagattt ggaattcaac agacccttta ccacaaagcg tcccacctct aggtaagtca tattatttat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> 173 3001

DNA

Homo Sapiens allele 1501 99-15672-166 :polymorphic base G or A misc binding W0005851 0 [http:/www.aetthepatent.comiLogin.doq/$exam.supprt/Fetch/efault.doNVO00585l 0 gpc?fromCar-he= 1 part--ma intoolbar--bottom] Page 659 of 737 WO 00/58510 PCTIBOO/00435 <222> 1502. .1521 <223> 99-15672-166.misl, complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc_binding 1482. .1500 99-15672-166 .mis2 primer bind 1649. .1666 upstream amplification primer, complement primer bind 1120. .1138 downstream amplification primer misc binding 1489. .1513 99-15672-166 probe <400> 173 aagactttat ttcatcatca atgctgcaaa caagcataca cctctatgat tcatttgttc gtgcattttt tatggatata tatgaacctt tagtctcttc ctttaaagag tcacaaggat ggttacacct ttacttgaac ctttattagt aatagctatg aaatattaac gtaaacgaaa atatgctagt ggaaattttg attatgcaac aaattgttct ctgtttagtt gctactaact ttttttcctg rtgtatttga ggattactta cat atat aat ttattttcag aaatcaagaa tcatgtctgc tgataaacat caatgaggat acacaaagat tttgtgttca atattaagac catctaggta acacacacac gactattcta aacttttttt ttttctctat cgttgttggg gtcctgcgtt aagatgactg ttcataatat aatatctttg attgagctga tcattctaat ttcatttcaa tatcaaaggc tttattgata cctacctcac tgggataatt caagagggtc atttagaact atgtttttga tcctttttta aattctcagt ttttggagtt catttatgta caaaacagca agactcatgt gactataagg aggattcagg ctgcacacac ggattaggat actcttccat tgatggcaat tataaagctt ttagttttaa attcatagta a at t tcaat c aaattttgtc atgctattgt gcatagtact aatttagggt acaccctatg agtt cactaa attgattcag gctgattaca aatcagatgt ctttttcgtt gttctagcca tctaaaaaca gctggagatt aaatctcatt ttttactgat ccacaatatg attcatttaa gtaattttta tcacaaaata tgtaagtgtt at aca atat t gtttaaattc taattacatt a at ca aat ta ttagctgtca atcctagaaa aagtaatatg gtgtcacata agaactaaga agagagctta taggttgatt gtgcacatac aataataaca gtcctataga aatctttcaa aaggagagta attccacatt tgagatttta actcatgtga atttttctaa aaaaactaaa tcatctcttg ccatggt ttt tagagtttga agcatattag tgatcatttt tcaagggtca gcactatcat gaaactagta tattagcctt ttaatgcaat caatagaatc aaaacttaaa taaattttat aacacatcct taaatatgag ttaataattt atctttgact ttacattgtt ggataatcta aacttatatt ataaaaattt gtttatatta ttcaagtcac tattgacagt agaacttctg tgtctctttc gaatattcac gagtttacat aaatacagct gcacaggcac ctgataataa ggagttatgg gatagatagt tagtatttac ttctctattc actagttctc atatataaaa aaataaagaa aacaaaagca aaacacaatt aaagtagaaa tctcatatcc aatccctctg cctaatgctt tgtaatgtct aacagacatg caatctacca gtataaatct gtgtattcaa tatggatata tatgtctttc aactgacaag aagaaattta ctttccaatt cagcgtcaaa gtggcatatt tgcagtgaat tggaaatatc tggagataat aaaaaagaac tagaagacaa ccttttcaaa ctattattta tacatgacaa aaacacctaa accagatttt gttttaaact agactttacc agatgtattt taatcatagc tattggttga tattattagc ctgtatcaaa ccatagattt atgggcatgc taataaatta atcactattt aaaaaccctc atgcacactt ctatactccc ccaaaacaaa ctatattatt attcatgaag acttcactaa aaatcaatgc agaaatttta ttgaatgttt ctttatgaga attgaacatt atactacttg agtataaata aaagaataag ctgttttcac taattttcat attaatattt tttaacaaca atttaaaacc tattttacaa ttggtaccag gactatccaa atgtgttcta ctataaaaca gacaacactt gaataatcct aagatgtgct aggtttagaa tttactcaac ttcttttatt aatcatttgt tgcatgaata tccattttaa gtactagaga tagagaagta tttctgagtt ttgatcacag acaatctatc taagacaaaa tgaaaatgcc attaacacac agtttttatt attataataa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 *1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 W0005851 0.[http:/twww. efthepatent.comLogin.do /Sexam.supporIFetch/Default.dogMIO00585 10.cpc?fromCache=l1 art=maintoolbar--bottoml Page 660 of 737 WO 00/58510 PCT/IBOO/00435 attatccctc tttgctttta ttcaaagttt ttgtaggagg aagcattttt ctctcaagca catcaaatgt acatctgttt tggtaaggtc ttgataggca atcaaaatta a gtttgtatat aaaaaacaag ggatgttaaa cactttaaag taaaatgggc cttaatgcgg catagcaaca gctgacaact agaggcctta gggaaatgac agtagggtta aaatccatta actattagaa tagaggcatt gaaaaaaata attaacaaat atagacctac gctgccctag tcagatcaaa cctatttgtt taacatacta caaaaggaag 359 tgagaaggtg gttctattat tccaggcaca tgtttggcac tagccgggaa aaatcacatt tagctctgag tgacaaatgg agtttcagtt tcagttagtg attattattg t tgt tggt ga attctctcat gatcaactct aggaa atta c tgcatcattc atcatcactt tgtgccttag gagacagaaa gtaataggga ataatactaa ttttgtgatt ttaggacaca gcaaataaca tcgaaaatta atttaactaa ccatcttacg tccatacctt gctaaaggag tgtctgtgca ttttcttctt ttcttcttca gacaggtgtt 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 174 3001

DNA

Homo Sapiens allele 1501 99- 15 665-398 :polymorphic base T or C misc binding 1502. .1520 99-15665-398 .misl, misc binding 1481. .1500 99-15665-398 .mis2, complement primer Ibind 1879. .1898 upstream amplification primer, complement primer Ibind 1423. .1441 downstream amplification primer misc binding 1489. .1513 99-15665-398 probe misc feature 821 n=a, g. c or t <400> 174 cagaagcata ggcgattcta acgtttcttt a ag gcaa aat tatatcaact tatgcttacc tttttctttt attgtttgtt ttaaaatatt caatgtggca agaaaaatgt tctgttccac ttttgactct ttttgtgcta attattttta caatatgaaa cccttattat tcatacggta gttatttcat atgagcagtg aactggaatt taattttgtt attagtactt ttttagcaag gactttgcaa tatccatttt tggcaaacca atttccatga gcaaattaag aagtttaagc aatctatttc tcatagagaa ggtattaata aattattttg actttcctta tgaacctgga tagttcaatt gagctggaaa tgaattactg agcttatttc aaagtttaat ttttttatca acctggaagt ttccattgtt aatagaaagc tttttattga gaaaataaaa agtcttcaca tcaggataaa gat tagt tat cttacagatt tcagcgtatt gttatttaat tgatgcattt W0005851 0 [h ttp:lww. etthe patentcom/Log in.d og/$exam.su ppo rIetch/Defauft. d oqVO005851 0.cpc?fromCa cte= 1 part= ma intool ba r--bottom] Page 66 1 of 737 WO 00/58510 PCTIBOOIOO435 aaataaggtg ggacagtatg tttcaggatg ttaataacca aacagtttaa tagctttaaa aatttattct gaatactaga caactgtggc ttggctgtaa atcaccccat tgtgcatgtt attactaatc cttcttaaga taaaaagtga gaataaccca ytctctgtga aaagctgaca actctgtggt tttgtttcca atatggtctt tatttttatc taacattcca aacatatgct aagtcaggtc tctctctctc ccatgttctt gtcatcaact gacatgtgca gatccatgtc aatatttaag gatataaaat tatagctaaa ttcatatggc aaaaaattaa aagaaaccaa aggccgtcag atctttggca tatttgtgca at ataaggtt cggagtcttg

C

cacttgatat ataatcaatt tccaaaaaaa attagcatca gaatcttaca ctcttcctcc cttaacgaag ccttgaagaa tcatgagaag cccccacccc gcagtggcat ttataataaa cctaagtatc ctcttcaaga aatgattata ttgatcaaat attacattca aaatattttg gagtctattt cagggaagac tcttccaagt catcaatctc agaagaggct tttcttttta tgataaccac tctctttttt ggtattcact attacattgt gccttgttca tgtagcatag cagtttcagc gtagactgat ttgtaaggta attgtagata tgtaaagatc ttctacttta aatcaaagta agtataagtc attttctaga cagtggtttc ctgtgttgct ggtagcaccc cataaattat cttcaaactt ctgcagaaat agattttatg tttgctgctg agagaaatgg aagagaaatt aaaaccatgc aaaacacaca aaatgtggtg aatactagat ttttattgga aattgaaata aaagtgaata caatgaaatt ttaccttagt tttggttttt tttaaccctg tttaaatgtt taacaatcta ctgt tgacat atgcttttca gcagcttctt aaactactgt ttaatctaaa cagcattcca ttacgccttc taatctgcac actactgcct ttcactttca tgttggtatt tgtcatttga cttatgcaaa aagt act gca cttgcatatt gctctctaat ctccctgatt gcaaaagaaa aagaaaatct caggctggaa 360 aaatagcctg gtacacctga agctctttca agtgtaatcc ccaaatgtgt tctgtgtgca aagcttgccc gtaaagaaac tggtcaaaga cccaaatcaa ggtgagaagg tgccaattaa gaattaatta aacatgaatt gaatctcaga tgaaacatga aggaagcctg aattcattca ttctttgaag tqaaattagt atatgtccag atcaagccca catttacgta ggcactgttg ctgcagtatt gcatgccttg gtcttttgag cagtgttgta cctgtctctc aattctaaga acaaaaatat attatgtaga aatattggat tgaaaacatt tttaaaaaat atgccgttta attcaagtag ttcttacaga ttgtgagata aagtattttc tgcagtggcg gaggctgtat gcccttttca aatcaatggt attatgaata naacatactc tttttaccaa tcataacctt attgaaactg ttttaagaat gagatttcca gaacatctct ttgatcttag ttttctcaat catatagagc agaaataagg atgaaactta.

tt tct tagt t cgattgtcaa tgttagaaca cactatgttt ttgtttttta.

gtatttcaga cactcaactt gtgattattg tactacttta agattagttt ataacctgaa tcctctcaaa cttcacaggt gctatctttc ttatggtatc ttttaatgtg gaaaaaagat aatttcacta gaagttgaaa aattttctta ttaatttgtt agtgaaatag acctctctga tttcttttct caatctcggc aagcttttct ccttaggcag ttaagccatc tttaagtatt tttatctttc aggtagagag tgttataaca aagcgttggt ttttgccatt catgaaatgt ttttcttgac ctgttgtaaa attaagcaat t aat tttca a gagggtatta tacgtgaatg tcatagatag ttgtgcattt aagatattcc tcttctttga tataaaattc tatttatact ttattaaggc agttacagcc catttctttt ttatcagatt tctcaatttt tttgaaaagt ggaaccaatt tcagatagaa atgtggatat at tta-at atc atcatatatt cacttctaga tcagaacaca caatttcata ttagaatacc tttacattaa ttacacttaa ttttttgaga tcaccgcaac 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 175 3001

DNA

Homo Sapiens allele 1501 99-15663-298 :polymorphic base G or A misc Tbinding 1502. .1521 99-15663-298 .misl, complement misc_binding 1482. .1500 99-15663-298 .mis2 W00585 0 .p:Itwww etthepatent.comLogin.doI$ex m.support/Fetch/Defaut.do /WO000b851 0.9Pcfmahe 1 amitobaqotm ae 662 of 737 WO 00/58510 PCT/EBOO/00435 <220> <221> <222> <223> 361 primer Ibind 1781.-.1798 upstream amplification primer, complement <220> <221> primer bind <222> 1349.-1369 <223> downstream amplification primer <220> <221> misc -binding <222> 1489. .1513 <223> 99-15663-298 probe <400> 175 ccctgt ctct taattctaag aacaaaaata tattatgtag aaatattgga atgaaaacat atttaaaaaa tatgccgttt tattcaagta tttcttacag attgtgagat taagtatttt atgcagtggc tgcctcagcc catatatttg ctcaggtgat catttcaatg ctttcctttg ctgtgcttca agtttgggag tctgcctagc aagtatctaa agtaataaaa aattgagaaa tattatttag rctatgagat gttacagagc ttaataactc atatgatacc tttttaagtg aagagccaga ttattcacta tcatagatcc tacaaagaca aacaggatta gttgtaaaat ggagaagctt caatcttcta tgccatattc cagggtcctt tgttgttcca atgctgttta catttattta tagtcattca tgcatatcct actgacattt atattaaaat ccttcacagg agctatcttt tttatggtat attttaatgt tgaaaaaaga taatttcact tgaagttgaa aaattttctt gttaatttgt aagtgaaata aacctctctg ctttcttttc gcaatctcgg ttccgagtag gtagagacgg ccgcctgtct ataggttggg cttttacata ct tat t tct t aggcacttgg tacagatcat ttcttagggt aagtctaact tgaggctgtc gtattcactt ctaacacatt agatcgctac cct att tct c aaaagaacta tcctcaccta cactggt tgc attatagtat ctgcaactga agtgtctaac tgattctatc acataggttg taccaataac gtatcccatt agttttaagt gcacaaagta acttttataa atatcttcag atgtcgaatg taagcactta ggaagaaaca tacacgatga acatgtttct tggaaccaat ctcagataga catgtggata gatttaatat tatcatatat acacttctag at cagaacac acaatttcat tttagaatac gtttacatta attacactta tttttttgag ctcaccgcaa ctgagattac ggtttctccc cggcctccca aaagt tatt t gagggagctc ctcatagagg actgctcagt actcattctc gggtattggg tttgtgatca atttattaag attgtttcag tttaagtgga agcttattta ccttcagtat tatatgtaaa tcaacgtatt aagtaacgta tttctatata gagccatggc aaagttctaa tcaaaaaatt tgtaagaagt aaaatgaata ctagtat tta gtggaaaatt ggatttatca ttttcaacac attctttgga gaatattttt aagtaacatt gatt act aaa ctatcaaaac agcacattta tgatccatgt aaatatttaa tgatataaaa ctatagctaa tttcatatgg aaaaaaatta aaagaaacca aaggccgtca catctttggc atatttgtgc aatataaggt acggagtctt cctccgcctc aggcgtgcgc tgttggtcag aagtgctgtg tttgttgagc aattagagca agaaacgacg taagtctttc tctgtttttc aaactcacct tcgtcatctg tgcccaaaac aatttttatt caacatataa ttttgcttga caaaaaataa caaaaaaaaa gaagcaacac atttgcatct tttcccttat taaaaaatca atgcaaaagt ggttattttc attgagatgg actctgaaag ccaagtaaat tcatacgtat taaaaactca acgattctcc t agcaggagt accctaattt tattttcata gaatcttgag attaaactac ttaagattgt ctgtagcata gcagtttcag tgtagactga attgtaaggt cattgtagat atgtaaagat attctacttt gaatcaaagt aagtataagt aattttctag tcagtggttt gctgtgttgc ccggattcaa ctccacgccc gctggtctcg agccacggtg aagtggggat acatccctgg tgtctcattg tcttcttcat cattatgtaa tct ccaacat tctaacttgt tacaatattg ttattgtggt ttgttggctg ctaaaattaa attttagaaa cctatttcta gtttagaaga tttggaaatg tttaaacttt tctaattcaa taccctactt acctaatata tattgcagat ttaaggatgg gttattcctt ttacttatcc gtaaaatgtt aaaacatcag tatattagat tataataata tttcatgaag gcatagtaat ttaacaactg tttggattgt gactactgcc cttcactttc ttgttggtat atgtcatttg acttatgcaa caagtactgc acttgcatat agctctctaa cctccctgat agcaaaagaa caagaaaatc tcaggctgga gtaattctct ggctaatttt aactcccaat cccggccagt gagagtgctt cagctttctg gtgagtttgg ttcttccata atttaaagga agactttgtg gatgatctct tatttgtttg aagaagagtt taggtacaat tgcctgttga gaggctaaat taaagtctaa aggtgggaac aacaaatatt aacttacaca taccttcttg tgatatctaa tactcacact ccctaagact aaattgt agg tttgtctttt tatctttttc cttattccag actattcttg ccctagaaaa atatttctaa taaggtatag gtctgttaca accaccaata atttgttttt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 W0005851 0 [http:/Avwwwqetth~epatent.comfLognog/Sexam.support/Fetch/DefaultdoQNVO00585l 1 .cpc?fromCactie= 1 part~maintoolbar--bottom] Page 663 of 737 WO 00/58510 PCT/BOOIOO435 gaggtaccaa tactagcaag gtaatgttaa agtgtatatt ttagacatgt taaaactggt cctctgtcat caaactgctc tgtaagcaaa atgcatatat gcaggtgcgt aaaaaaactc caagacattt tttttaattt aaaaaaatca aaacattagg cagactcttt ttgaaataaa a 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 176 3001

DNA

Homo Sapiens allele 1501 99-15664-185 :po1 misc binding 1502. .1521 99-15664-185 .misl, misc binding 1482. .1500 99-15664-185 .mis2 ymorphic base C or A complement primer -bind 1667. .1685 upstream amplification primer, complement primer bind 1184. .1203 downstream amplification primer misc binding 1489. .1513 99-15664-185 probe <400> 176 ctaatatata ttgcagatcc aaggatggaa tattcctttt acttatccta aaaatgttct aacatcagac tattagatcc taataataat tcatgaagta atagtaatgt aacaactgac tggattgtat agacatgtta aggtgcgtaa gactcttttt tattctagca aaaatagtgg tacctctttc aaggaaaata ttggatacaa ggtcataaac ctcacactgt ctaagactgg attgtaggca tgtctttttg tctttttcca tattccagtg tattcttgat ctagaaaaca atttctaata aggtatagtg ctgttacaac caccaataat ttgtttttga aaactggtcc aaaaactcca gaaataaaaa aaacaaatcc ggtgtacacc attttgatat ttgatttcaa ttttaaagca aggatagtta tgtaaa -atac agaagcttta at ct tctagt ccatattcag gggtccttgc ttgttccaac gctgtttaat tttatttaat gtcattcata catatcctgg tgacatttta attaaaatac ggtaccaata tctgtcatca agacattttt ataaaacaaa tcaaatgaaa taacttttac aagtaaagta atgaaaaata ggtaagaaat atgatttcca ataggttgtg ccaataacaa atcccattct ttttaagtgt acaaagtagg ttttataatt atcttcagat gt cgaatgga agcacttaaa aagaaacaga cacgatgact atgtttctag ctagcaaggt aactgctctg tttaatttaa tatctacttc atacttcaaa ctcttagagg aattatttat aacagaaaaa gaagagaaga ccaaggtttc taagaagtat aatgaataac agt at t tacc ggaaaatttc atttatcata ttcaacacac tctttggata atatttttac gtaacattta ttactaaaga atcaaaacat cacatttatt aatgttaaag taagcaaaat aaaaatcaaa taggagctat ttaaatagct ttaatttctt aaaaagttat aaatctttta aatttgggat gacttacttg tgagatggta tctgaaagtt aagtaaatgt atacgtattt aaaactcagt gattctccaa gcaggagtta cctaatttta ttttcatatt atcttgaggc taaactactt aagattgttt tgtatatttt gcatatatgc acattaggca attctgtagg attaactaga tatcaattgt aatgcatgaa cttccacgct tttatttttt aaaatcaaat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 W0005851 0 [http:/twww.getthepatentcomfLogin.dog/Sexam .support/Fetch/Defaut.doNMO005851 0.cpc*?fromCache= 1p~an=maintoolbar--boftom] Paqe 664 of 737 WO 00/58510 PCTIBOO/00435 gatctgatat gcactggaat acaaagtcta mgctgaaacc attatcctgg tgccagcccg taaacaatga agagaagcag cttttttttc gaacagaaag aattcgaaca taacataaag caatagccac atgctctgac acatccatca aaacactgcc gctctgggta atcaagagat ataagaagac ataagacatg tgagacacga aactctgaga gactttatag ttcaggcaca agtgagctcc tgtggggtgt ggtggaaaca aagccaagtc a ccaggtgatc gccaaatctg agtggagagt ctccagccat ggaagtcaga tgctccgctg cagttctgtc agctatttta ccctttaaac caggaggctt tatagtagtt ctttcttgca acaccagagg aaggctacag gattttccac tgaactattt aagatgaaca acagacaaag aaagaagat a tatagataaa agagaaaaga gcaaccatgt ataagaaagt catttaagca ttttattttg agctctgatg taactcaagc agtaaaatcc tctggaaagc caatacaact gctgagaggt taaaccgctc gacaggaggc tagagaatga aggaatctga tttgtggcat aaatcaaaat tagacatgtg ttaaaaaaat ttctcaaggg ctgttagaca tagaaggagg tgagttcgtt gagacataaa cctgcaatgt tacttcgttt gggacataca agacactttt ggaagcagtg aagctgttga taaagatgag caaagatgtc tttgtctaaa gatgt caatt ccccaagcca cttccttgca 363 atgtgaacat agttagaagg gattcaccct ttaacactag ttcccttgtg caagtcacac gaggcttttc ataaaaatga tagaagagtg aaaattcttc tacttaaatg catgctaatg ggatacaccc ccacgtgatc caaaagtgtg aagaatgagg ctgctatacg gt ttggggtg ctgcagcgaa attaaaaaga atactgatat cagaaatgat agaggtggct tttgttaacg atttctttcc atggtgagac ctgtaattag gcgttttata tgtgtttctg ttlzgaccacc ccttctctgc ggagcacact caagtcagca aaatatgaca atacttctgc cggcatgaac t tagca gct t taaaaatttc accttagatt tcatctagag catgtaaaca attggatcac ttatatattt caagagcttt aaaacacaaa tcatgctagg ctcagagtct agaaagcaca cagtaattat ctcatatctc ggcaagttat accacataac ctttttctgg ccggtccttc actggaaata gtgatgt tga tcttttgttt cgacgaccac ctggtcagcc ttccccagga tcaggccccg gtgctaatgg atgtgccgaa tcttcacccc tatggtttgg cctaactaaa tgtgatatct ggcatggaac tagatgaggc ccgcaatgtt acggtgtgga gctttaagga gtaccgtacg tattgcgggg aaggaaagac atacaatcaa gaagtgctta ccaaacaatg agagtgaaga tatttgcttc cgaaagcctt tgtatacaag atgaagggca gagaaggat c 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> 177 3001

DNA

Homo Sapiens allele 1501 99-15668-139 :polymorphic base C or T misc_binding 1482. .1500 99-15668-139 .misl misc binding 1502. .1521 99-15668-139.mis2, complement primer Ibind 1363. .1380 upstream amplification primer primer bind 1801. .1821 downstream amplification primer, compl1ement misc -binding 1489. .1513 W0005851 0 [httD://WWW.atthenatent.comlLoindoa/SexamsuooartFetchloefault-doaANOOO585l 0.cp3c?fromCache= 1 oart=maintoolbar--bottoml Paae 665 of 737 WO 00/58510 PCT/IBOO/00435 <223> 99-15668-139 probe <400> 177 ctttaatctg tcagtgttaa acatacaaga tgct aaggat gcctattgcc gcaacccact ttatatccta tattgaaatg tgtatcataa tttgccctat gtcttatttg tttagtttat agatggtttt acctctaagt atggaagtga aaactattca tgcattttct tgggatctga tctggatgtc gctaataaac aggtagctac ctcaagatta gcaggattaa aattgtgcaa cttaaagcac yccctcaaaa aggaagtctt atgtgtttta gcatgtatgc attgtggaaa cagaatccat tcatctccac accaattctt ttcccttccc agagctgt ca cattaataaa aggcgCCagc atgctgcatt agaacaagcc gcccttatga tttctaacac cctttctgac ggcatcatgt catggctgtc tctttcttca gaaagqaaga aataaaatca aacatttacc cacgtgtttt tatgtagaga t tcctttctcg gaactggtta cttctggacc gagacatgac ttcatgaaca tttagcatct cattaaatga ataaagttat ctgtggaggt t t tcctt tt t ggacaaaatg caatatggta tattcaatag acctgtaatg taatatgctc tctaaaatgc ttctactagc tgcttccatt atgattgaag tcttccaaat ctcatgagaa atttccattg agaacaaaag atatggacat tctcagaaac caagattgtc ccaaatacct agccctaaaa ctcagtgcag taggtacact act tacacct cttcttcacc ctaaaatgct tgcatttctt accagttcta gaagaagaat aaatttggtg ttcaagatgg actccttcaa tctcagctgc atgaatttta ctctgctacc acatatcacc tct gct ta ga tgtcagagca actttaacgc acatgtatat agtttaaaca ctgtcaagta acaaatcaac ggtacatcac aaatttgggt cttctactct aattagattt atgtatggaa agtttagaaa cccttagcac ttttgtactt gacagaggga aatatttttt cgcaaccaat taattaaacc cctttttttc agggggacat ttaataatcc t cacaggctg gagcaggtaa tctccccaga gagagctgct cttcctagct aattttaaag gcaagccctc caagcaaaga cgaagttatt tccaagaaag ctgaacttat gcctcgttta atgcaaatat gtgtatatct gacagcaggg caagatgagc aaactgcatc cagctctctc ccttctccac gt cagttttt tcatttctca tgtggtaggg gaagaatgct gaatttttta catgggt ccc gggaacacat actgactcta attatagaat cactgcctcc cagcaccaca tgaaaatgct agatatatac gtgtattagt aagactacaa atgtgtaCc ctagat gcct ggggtggagg gaaattgttc gttatggt ta acctgtagaa agtatgtagt aatatatcaa ttcaattaaa aattctgcat tccacaacaa accaaagatt tcatttcccc cttcttgagt gttgagctgc cattaatcga aggatgcagg attgagttgc agcctgcgtg gtgcgctgtt gacaatgctc tgcctcaagc tgctgcagca aaagctcatc cagacacata ctgttgattg aggaaatata cagataatca ccaggaaagg cagtgtctcc actggaagcc agaacagaac cctgttactt aagcttctgt cgtatttgac gctgctgtaa tagttgtgga gttgcgctct gtgtccttgc tagcagcatt cacct cccaa tcagactgta gactaggct t tgaccactat tcctaaagat gatatagtaa ctttcctagt acacatatac ttctaagcat atgaaatggt cgacatccaa gatttcatga tggaggaaat tat cataaac aaaaaaaagt gttccatgca ttataagcta gatttatgca attccacatt acctatcaac a cgt tt ta gt gctgactatt aaatcaaata gatatacttc aaagattatg ggcaaagtat attccttcta acagggcgaa cattatttca tactggggct ttctcatttg aagcaggtag tgagtctgaa ccagaggtga tggtttccat gtcagatttc ctcaaaagta atggaattcc gctagcacta tgaagccagg acagtctgga ataaccattt ctccactaac gtctctccaa ttgactaact cagaatacca ggctagaaag gcttccaaga atggcagaaa aa t ttat tca cacttgcact gcacaacccc ggtatctatc gtcagaaatg taaacactca acgttcagaa aacctctaat atatatatat tgttcttaac tgatatcaga aacaatcaca tggtaatacc gcagtctttc tcggcattgc aaaaaatact aaagattatg ttgcttccat tgtacgtata ttaataaaat cat taga tca agcaatgcct cctagacagt ttaatattgt ttcgaaagta taactattga actaagcctg gcctggcaga ccatgggaag gaaatctgcc ttggactctg ccctgtcatg caagtggctg taccaataat gagaaaggtg gtcgtgagac tcacttttgt gtatgattta aaaagatttt aacagagctg gccttagagg gagcaaagag tgctatgagc ctcaggacat ataatgctgt aatatctagc cagactgggt tccgagatga tgacgctttg agagtggaag tgagggtgga tgggattaag tccaggaaaa cttgcttccc tccttcatca tgttcaaaag aacacgtagt catgcatttg atatttgttg aaaatggtaa atgacgcaca aaatagcttt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> 178 <211> 3001 <212> DNA <213> Homo Sapiens <220> <221> allele <222> 1501 W0005851 0 [tqpltww.getthepatentcom/Login.dog/Sexam.supportFetch/Defaut.doqNVO005851 0.rpc?fromCache=I1 art=maintooIbar--bottoml Page 666 of 737 WO 00/58510 365 <223> 99-15682-318 :polymorphic base A or T PCTIIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc -binding 1482. .1500 99-15682-318 .misl misc binding 1502. .1521 99-15682-318 .mis2, complement primer 'bind 1184. .1i202 upstream amplification primer primer bind 1665. .1683 downstream amplification primer, complement misc binding 1489. .1513 99-15682-318 probe misc feature 1842 n-a, g, c or t <400> 178 aacataaatt tctggtgatt tttaaaaggc atctagatgg catagtaaga aggtcaaaag cgtagatgcc agctagtgtc ttttacttta atgtatcata gcctgcattt tcaaacagat ttgcaaggta atttaaataa gggtaacatt agtagataat gtattagtcc atatagcatt gcctgctcca ctttcaatga tggccacaca aataaaaaat atttgtttaa acttatttcc taagatacag wtctaaaact atcattgaag gagataatat aggcattttt cacaaacact ctatcaaaaa ggggcattat accagctctt agctactacc gatagtatgg agaagaagaa aatgccttca agcatttgag aatgtggatt tttacaaaga ctatgttaaa gccatatgat aagaggatga aacaaaaagc gaaaatagca aatatagaaa agatggcata tgtagttttg tggagtgact cctccatctt agtat tggag tctatataac agttacagac tctgtatagt ttcaagggca cttgtatctt aactatttga atggagcctg gtttccttat acagttagca gtttgtacaa ccagattcaa atatctaata agtgccttgg a agg agaact gttgaggtaa aaacacaggt tttgagacaa taaaactcaa aagagagaaa aggacaaaga gaagctaata aacagatttt cttttgagaa aagtgaacta ctcaaaagag a gt tgt gcgt gctcttgcaa cagaggggca aaaagtggaa aaaaaaaaaa aaatgctata tacttagatg agatgcctct caattttata taacaaccat actctgtaga.

tcggctttat gtaaaatgtc gttgagtttt acccaaggag tatgttctga ttattcccta ctgagtggga aatggggtgt cttatttttg tttaaaaaat tggtcaaata gagaataaag ggaaagctga tggagtacct attgtcatta ataatttcaa gaaattgata caataggaag tataaagtta tattttctat aatctgaaga gacatcttcc gcagcataaa ttagaatgtg tctttaagaa ttaaagtatc tctgt agaat attcaaagat tttgtaatta gtatagatat t tt t taa taa ctatcacccc cttatttgct gttggtgaag atttatggga ctttagttca ttggagaaag gggctattga ttctatactc agtggtagaa ttctagtgaa ctatagatat tatcacgtct acagacacca ttgatagtgc gatatgtttg aatggaaggt atgtttgagg gtgggaagac ttaataagca gagctgggtg aatgacctcc gatgtttgat gggagagagg atcgaatctt acttatcaca taacatttca atttacggca aataactgtt tgaagtacaa gtatgtatgt tcagctgatt ttttctttaa accatggttt tcataactac aactctcatg ctgaaactga tggcttatgg tacatgactt aaaatgataa gcttttcacg aataacagaa ttgaggaaag aaacaacaat tcaagtggtc aatagaaaca ggatgagatt gtgaaaggtc t t tgt agaa t caccacagaa accccctagg at ct tgacat gagcaacaag cagtagacac tccattaaat aagatcagta ctataatctc tgaaattgag gacatttaca aattaattat atgccaataa ttgctatatc aaattattta 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 W0005851 0 fhttiJtwww.gettheDatentcom/Login.dogl~exam.support/Fetchoefault.doiWO00585l 0.cpc?fromCar-he=l1 art~maintoolbar--bottom] Page 667 of 737 WO 00/58510 PCTIIBOOIOO435 taacttttgg tggtggtaga ccccactcac aaatttattc agacttaatc aaattcaaat tttatttaaa aaataaaata taaacgggaa tttttcttat tcatttcata t t tt taaat c ttatttataa taaagacaga actttaattc actaaatatc ccatggaatt aaagataatc tgcattttgc gttcctatgg tttctgaaaa gcagacagaa tggatttata catgaactac tgatctctgt aattcaattg tccagattac ctttattatt gaataacaac taagaagcca cgctaagaga agattttgaa agtgttgttg ttctctatga tggatgcata agaattgtac tgatataagc tgtaaaggaa ttcattaatt gtttgcatga aattggtaat aaataaacac tagctgacag a cgat tgat c gtatgtgatg ttgtagacac caaaattatt ctacgtagga ttaatttcaa taagagatag ttaatctgga gaagtaaaag gcttctgcct taatagattt aaatatattt acttatttta atttaaaaat aataattata tgggaattat attgtatgac 366 aaaacaggca ttcagcattt tttgacctct attaagaaaa cttatattaa attgattact acctagaaga tgaaatttgg gtggaataaa tcatattact gtcagttggc aaataaacat attacttaat aaggagggaa ttcattaatt gtttttaaat gtgttttttc tatgttattg caatataaat tgggaaaaat angtaggaaa atttttaatg tttattgctg taaagacatg atcttccaaa taattgaatt aaaagatatt ttcagaataa attgagagtt gatttatggg tttttattat caaaacataa attcattcgg gtaataagta ttgaaacact acagttttca tcatggtgaa gttatctttt acagaacata gtaaaatgca aagaattatc acctagttaa atatgaattg a aaa g tgg ca tatataaaat tatttattta ttaatcagaa caacaaccat ctttcttcct -taaat aat tt ttttgcgtgc ttaaaatttt tatttggttt tgtactataa atctcattca gggtccagga agcagagaca tgtttgttag gtcttcacta agctgctctt 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 179 3001

DNA

Hiomo Sapiens allele 1501 99-20933-81 :polymorphic base T or G misc binding 1502. .1520 99-20933-81 .misl, complement misc -binding 1481. .1500 99-20933-81 .mis2, primer Ibind 1563. .1581 upstream amplification primer, complement primer Ibind 1130. .1149 downstream amplification primer misc binding 1489. .1513 99-20933-81 probe <400> 179 ttcttaaaat gcttcaccta aaatatacat atattatttt tacctcatat atgtgtcata ttgtatgtta catattatat atattatata taaaatatac tgtagccaat tatatttttg cagttttaca ataagtacct ccaatgtttt aattctcttt ccctcaatct ctttattttt attaatctag aaatgctcat aaattttact tgaatgtttt ctcttccgag caacttattt taaaattttt attatattta agtacatgta gtatccttta ttaactattc tatgtacaaa W0005851 0 [http:ltww.efthepatent.comLogin.do /Sexam.suppo~thDfutdgw055 _.p~rmah art=maintoOlbaE_bottom] Page 668 of 737 WO 00/58510 PCT/EBOO/00435 catgattgtt caaaagagca ttacattgca aggagataat cctttaaatg tttactaata aagaaattta tattatatga atgaattcct tgaattctac ttgaataaat tacttgacac ttccttgagc gtaaggtttg aaaatgttct tcatgttcat tttctggaag aggaaatacg tactcaggc ttgacttggc kttactgaaa tagtttctca aacacaattt tcctagaagg tgaaataccc tgttttaaaa t aat ttaaga gtcttcaaat atggaaaaaa tctacactaa agtgtcttta tcatttaata t t ttatct ct caaagcttaa gaatgttaac gacagatcta aaggcttata aaagggttaa atgttccacc ttgtaaacag tgatattcaa taaagcttcc ggaggtagca atccaatttg ttattaagtt

C

ctaagatatt t tttct t tt t tatttcaact gcatatgaga tatggtgcat gaattgattt tcataaactc attggatctc tgggcctcca cattataact aatctcccta tatctatgac ttctctttgg caatattttt cccagaaatt gttttctagg cacccgattc tctagcagta cagaaagagc aaatatatct atatacaagc tgtgaatgga ccagctctga ggttgacttt attttagcac atataacaca cctaagtcaa ttttgccaca agtaatactt cttgagtaaa gcataacagc tttattaaat gaaaatgcct taggaaggta tgaaattgat tcaatattac ttttcaaatg aatatctgct aaaaaaaatc atatttcagt gcccatcttc attcaaccat aggtacaaaa atgtctgcaa gat taattta caaaattcca gcattttcaa aaaga tat tt aatatgtaaa ttttagtatt tcaggcttag atattcatat ttaatgcctc aagcaaaggg cctatgggaa atgtcaagat attttcttca cagcataaaa taaagaatac tagagaattc ccagctttaa caggttaagt acttcactat cttgcccctt cagttttttt acacaaaatc agtgtctccc aatccttctg tataaacatt tttgtcccta g cca agc aa t taatggtggc tgtaaggtta cttgaaaagt catttctgac agatagactt gaataaataa ttgaaatctt gttctggtgt aacaaatatc atgcttaaaa ttcaagaata catttacatg aaattacctg aacaacaaag taatttgttt atgcattaat aacaaaaaac gatgaataag aaattaggat ttaaactaat ggaatcaaaa gcaaaagaaa cacacacaga ttattaactg ccacataatg ttctgttaat attgcttcct tctatagtct tcaaaagggc tataatgact tccatataat tatgaataaa ataaatttgc ctgatgtatg atcttggaag gttgcaaatg tattcttatt gtcttgctga ggagtgattc ata caa a aca agattaaaag ctgattggca ctcttttaca aacaaaccaa aaatcaatgg atagcttcag aaatttcaca aacaatagtg atatgtcaag agaaaactat aatggaacat gaaatgtaaa ttcccaagta aaagcaaaac tatgtgaaca gtttattatt tgaatagttg ggcattgcca tttaaagtat tggagggcag aatgttattt ttgcaagaat ctagaaaaga ggccaatggc ttaattttta aacatttttt atataatttg gtattgaaaa taatattaca ggttccatga attgctccat tcagggtaca gaagttcctg cacgattgag gttgaaatcc acttattata taagcaattg tccttgattg agtaaagata ctacatgatt aaagaaaatg ctttttatat aagcaatagt t gaca ct tgc taacagaaat atggatcctg aaatcattat ggcatttatc agacataaaa tatttccaaa ttgttcatgt taaaatctat taaattatac tgagcatgta atgtgacaca tattcttctg gattgttaac tgaaacagaa ttgaatcgtt atttattaat taattatctt ataatgcgga aaacacaatt attttcctta gtagtagaag attccaactg caggaaatct ttgtttattt agagagagct aaaaactatt gatgttgaaa tactataact aattaactca actactagat taatgagctt acactttata ttgtaatgat tccatgggaa tgaatgcatg ccttgtatgc atcatttttg ataatccaaa tgtcttctac agacatggga tttacaggat ttcagatgta atttactgat ctggagactg taccccagca agtaaacaca tacatttaat t ct ggt at ta tttccttttc aatcaatttt gtcctttgca attattattt gatctttctt tgaaagccat ttatagctat taataggtac tcagagaggg ttgtgacttt gtacattcaa actattaact acattttcta caatgtaatt aactatttta taattttttt aaatctaaca ccactgtaaa aattccaaca gggttcaaat gtcattagtt acgttaatga 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> 180 3001

DNA

Homo Sapiens allele 1501 99-25029-241 :polymorphic base G or A misc binding 1502. .1521 99-25029-241.misl, complement W0005851 0 [http:/twwgetthepatent.com/L.oginadogleamugoW tdI fa iNVogO005851 0.cpc?fromCache= 1 part=maintaoobar--boftomI Page 669 of 737 WO 00/58510 PCT/IBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc binding 1482. .1500 99-25029-241 .mis2 primer -bind 1722. .1741 upstream amplification primer, complement primer Ibind 1292. .1307 downstream amplification primer misc binding 1489. .1513 99-25029-241 probe misc feature 1368 n=af g, c or t <400> 180 ctgctttctt tggatcccat tgtatcatga ggtcctgttc ttgagtgcat gtctgaatta ggaagtgatt gtaaadtatg tattacccag tatacagcag agtccctgag caacaggagc ctacagaggt ttttcttgga ggataggaag ataccttaca cctcagcagg atgcatgtgg ttccacagct catatgcgtt ttgtctatac cttcacaatc tccaaatcac taattagagt taaaatgaca rtgaacagct ttaaaatgtt tggaatctat gcaaagactc gtatcccaga tagtccagaa agtcatgggt aattaggcca ctagaaagaa actgtgtgag ttgggataaa tactcagtta tctacttcct ctgaaatcat atgatgaaag aatatcaagt tatagatctc cgtgtgctct gaagaggtct aataaactta acactattta agttaactgt ccacagaacc gaagccttgg aataatccaa gaaatttcca acttggtgaa ataagatgtc gatgtataac tcccagtggg tggttcagga gtctccctac tatttgctta tgttgatcta atagttctaa atactgaggc tcaaggggag cgatctgcac atgatcctgg aagaactcaa ctgaggtcag aggcaggatg agtcccactt ggcactgaag ccagcatagg tctttgacct tatataactt acacggata t catggaaatg aaatatcagt t tat cat tt a attcttctca ctctatgttt taattaaaga aatgtccacc taaactccac gtcttcgtat aaagttggtt tgtcaacaaa aacagatcaa cctgagctta ccaagcttgc agtgttttgt ttttgtaatt tagaagaaaa atcttggcag atttcagttt ataggaggct atatatacct atgccttagt tttttaattg aagtattata t tcct tcat a ttctctgcat gggctgtcca cacctgcact aattagaaaa agtgaagcca tgggtccagt acttcctggt ctcctctgat ggatcatgtc agagactgaa aactttttca cagcttctcc ctcatgaagt tgtttccctc gcaagaagtg ttcgcctcta cagacttggt taattgctag tagtgagtga ttgtgtcctg atttttccct agtgaatcct tccctttctg gtataatcag tttctatgta accagatgta aaaatctttg ctttcttgta tttctttctg tgctttttat gttgaaataa acagatctat cagaaagttg aacacatacc atcatgcaga ctgtttccat ttaggtagta ggcaaataat agggtgctga ggggtcacac tagtcagaag aatagaagaa caactgatag ttgtgtcaat acactcgatg ccagcaaagc ggttcagacc a gtat tct ag caatactgct tggaatacca gtatttagat gattcattaa aaccgtgatg aaataaagaa acaaccaccc gcctaatgat ttaacaaaac ctgttgttaa tcaatgcatg ccatgccttc ctagctcctg caaagggcta tagttttgaa agaatctggc accttattct ttgtagctca cactttttct ttaattcttg gtcaggaagt cctgtgttca aaaagtgtgc tagcatcacc tcatgtggaa ttacttgatt tttctttctc taagcaactc gtcatcantg cacgagaagc aagggcattg at aaat ga ta ggagagattt aacccacgct aggataaatc atgagttgtc aacagtatct aatatgcaca tggcagagag tttagctttc catgacacat ctgattcaat atagattaaa taattaatta atacaatatt atatttagtt ttgctttata ctttttccca cagtgagtgg tctgagacaa ctgggcaact atccacatgc aacttgtcaa tggcgctgtc caccctccaa tttttttttc atcaattttt agcaaaagta gtgtgttata tcagctcaaa ctgatatcac tccgacgcct taaggtaaaa tactgttatg aataattttg cagta 'atatt ttaacactaa tgttttgggg aaatggtgcc atttccagct atatggatat gacctctgtg ttacacatag agaaagacac aaaacatcta actgtggagc atggtgcttc tcagacatca gttaaacatg tccctccaca aacacttgtg tatatttgcc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 W000 58510 U [htto:/ww.g etthe patent. co mliogin.d og/Sexa m. su portFetch/oefa uIt.do NV0005851 0.cpc?fromCactie=l1 art=maintoolbar--botomlPage 670 of 737 WO 00/58510 PCTIBOO/00435 agactcttgt gtacactgca ctgtaaccta caactggata tatggaacgt taagagagct tgggatacaa aataagcttt ttcctctcat agagggtaat ccaggcaggg gggtttgcat a gtggacgggt ccaccaggta caaaggactg tctactgata tctgtttgaa tcctctttag attccataat gttagaaaaa cgctcatttt gcccacgtcc agcaccctgt ggcagctgtt tgggccacat cattctggga tgcaggagat gctttcatta tacacatgtg tattgcgagg gtcaccgagt ctaacaagac atttctggag tgacagatat ccatcagtct cagttatatt 369 gaccttcttc aacatttttc gtgtatgttc ttcttctgaa ttcctgactg tgaccttctt tcttaaccca aaggggcagc ggggtatgcc gccagcctct tggaaggact aactcagaaa tgacttagca tctttgagaa ttagtcatat tctcaggttc tagtccttac gtattcatca cttatttcac agcaaaagag tgctgacatt gt tgcc tcca gcttggccac gcaggcttcc gatcgctgga atagatgtca cctaaaatgg acttcaaatt acgtatatcc ttaattgagg tgggttaaga aaaagacaag ttatttctgg tactcacatg ttggttgtct aacacccagg 2340 .2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 181 3001

DNA

Homo Sapiens allele 1501 99-25869-182 :polymorphic base A or C misc binding 1482. .1500 99-25869-182 .misl misc Tbinding 1502.-1521 99-25869-182 .mis2, complement primer bind 1320. .1340 upstream amplification primer primer Ibind 1849. .1868 downstream amplification primer, complement misc Tbinding 1489.-1513 99-25869-182 probe <400> 181 cagctatcca gcagttaata cactaaacaa aaccaattta aataatagtt atcctggcag aattgttgaa accaaaaata cattttctta gaatatgatg taaaataata cagtattttt ggcaatatta tgtttctttg agtaaataat taaaaatatt atttgtaaca aaatatcaag aattctacat ttcaatgaaa tcatgataaa ttttatgtac aaactaagct ttggtttcaa taaggcactt aaaataatat gacaaatgag tttgatagat tatattacta attcttatga tgttttgact atatataata ataaaaatct attttataca caatttttag agaaaatctt cctggatcag atgtttgaaa ctcataattt aatatcagac gtagcagcag cttaaaattt ggccctagag ttctaaattg agaacaagga tatatttaga attatgtatc ttatataaaa gttataccaa ataatttatg aataaaatga acagatatca tgagaggtag aataagtcaa aaaaatctga aaattgctta aatcataatt ctgtaaaaca cactttgtct attgaagaaa aacacacata gaaattatat agcaacacac gtacactgga agagtagata aaagaacaaa ttcaaaaata agttgtgtaa attttccttt attagaataa tttgttaaaa aaaatactta ccacaatgta ctctgttttc ttaaagacac atgattgact aacataatag tggaatttta 120 180 240 300 360 420 480 540 600 660 720 780 W0005851 0 [http:/Mww~qetthepatentcom[Login.dog/Sexam.suportFetch/DefautdogAN0005851 0.cpc?fromCache= 1 part=maintoolbar--boftomj Page 671 of 737 WO 00/58510 PCTIiBOO/00435 tttgtatagt agaatgtaag aattgattag caccagtgga aacctaaaat ctaagaagtc tagtgacaag aacatttttc atcagtttat tttggttttg ctaggtagaa cattttctct mattattatg aattaagaaa ccttcttccc cccttcctcC gaggttagga gaagagatgt cctgggtcta aatgagtttc caactagaaa caccaatcac tggcccttac tgtattacat gctaaaaatc tgtttttctt tccagacatg acttgtctga ccagagcctc aaatgctatg atgagttcta ca at t ttt t atatatcttt ttagatgaaa aaataatttt catttttcaa gtcaatccat g cttagaggaa aaaataaatt aacattagaa acaataacca ataacaacag ctgcagttct cagctctgca cagcagcaag aattccaaag tagtgatgcg cataaaacag tagttatatt tgtttaaata gcagttgctt ttgctccctt tctcttcctt gaacaagaca aagatacaaa taaagactca acagaagaca atccttgtag ctttacctcc ttaaagagga ctatgtgcct taagaacgca cttataattc agatcattat agcctggaac tttagacaga gagaggatat tctctgagtt acagactatc tattaaagca tttcatgtta cgtcttcatt tggtattttt cgtcttttta agttgatcga gtgccgaata tttctggatc tgtgaagatt ggagggatgt gacaatgagt aaaccattag catctccatt gcagaaacta gtaagggcag ttctttttac ttatattaac tcacccatca ttcttaggaa tcttttctcc ccttctggac gaaatacaac tatgaatatt cacttcctga aaattcctac ttctcatgca ttcagtcccc atggacaccg gttaataatt gtttgaaatt gtattatgtg acctctggat aaggggatac aaattctgaa tatctttatt catctggtgg ctttacattt catatactta ctgacatgaa ttcttaatac cctgggttca ctttcgtgat 370 ccagaatgaa ttgtaattta aaatgtggac ttggagactc tacttacaag ttgactaatg t tt ttgtt tg cctttgtatt tttcattcat ataatgcatc atgatctaca ttttattaaa tttctgtaaa tctttatact ctttctttca aaatatgtag actagtgctc atgtaagata ttttcctttg at caaaat aa acccaatatt aggctcccag atacatatgt aaataaatac aaatactatt ggttaagcta ttctataaaa cttcactcaa ttgatacctt acatagtaca tcagaaattt tggtatttat cagaatactg gaccaacaag agatctttag ggatttttgg ttctattgag aactattcgt agagcaagta tgtcatatat ctgtctcctc acgtagtaaa gtaagagctg ttatatttat tcttttacct atcctgagct tgcaaaatga ctatttaatt tcaatttagc attgaaacaa gaaaaattcc tcttccttcc tttacttgat atttagcttt att tgagtgc tttacctaaa aatttccctt ctgagcctgt gaccctttta ccagcagaaa tttaaaaagg aatatttact gcaattgact gttgttcacc caaaagaaaa gccatgaatt catttactct gaccatttca ttcacggctt cccatgagat aatattacag aacctatgaa ttatttccgc aagttggctg acagaaatta tttatactaa tatcagtgga caatccagat actcacctga tgtgaatagg caaattgaca acctagcaaa cttagcatgc atgagctgct gggtcataat ataaatgtta agtagaaaca ttaacttgtt ttcctagctt cttgtttgta aatcattttg tatgattttc tctagtagct taaattacct tcccccattt agaaagcctg ctggaagtga tattgcaact ttgaagtcat tttggagtat actacaacct taccagtatt tggttgagag tctatgtatt ctgtattaac tttaatttta gcatgtacga ggttgcctca tttttgcctt ttagaaagaa tcaatcttat 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 182 3001

DNA

Homo Sapiens allele 1501 99-2 588 1-275 :polymorphic base G or T misc -binding 1481. .1500 99-25881-275 .misl, misc -binding 1502. .1520 99-25881-275 .mis2, complement primer bind 1227. .1i24 upstream amplification primer W0005851 0 [http:/Awww.getthepatent.com/Login~dog/Sexam.suportFetch/Defaut.doNV000585I10.cpc?fromCar-he= 1Dart=maintoolbar--bottom] Paqe 672 of 737 WO 00/58510 PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> primer -bind 1693. .1713 downstream amplification primer, complement misc Tbinding 1489. .1513 99-25881-275 probe <400> 182 taatatattt tactgagaga cacacacaca ataataattc tgcaaagtag aagtgatttt catttgcttt ttctcgtctt aagcaggttt agctttctct aggcagcacc tgatgtgtca gtttaaccac g cat at ct ca aggaaaagtg atctgtgcac ggtctgtctg t tt tct tct c ggaggattcc gggttaagga tctgaataaa tgttaccata gcaaatcagc ct agaa tgc t gctcccagct kcagaagcat aaactagcaa acagcagaca tgagcaaata gaaacactgt tatctttgca cacagattta atgaaaaaaa gtttaaatta tgttcttttt ttgttacagt gatgagcgta cgaaggctac catccataaa tgccctattt aagaaattat catatgtagg atgtcaaatt atttttaggg tgaggtaaaa ttcattctgg gacttctata tgtgagtgag gaggaagct g cgaagagaat aaaagtaagc tgtcctagac tatgtatata ttatacaata gtaagtttgc attaaaaaat gctatttttc tgttaaatga taagatacag tcaaaattaa gcctcctgaa ggccctaatc aacctctatt cgtgttgtgt acaggctcat tctggttgaa cctcagatag taaattcatc agagttaatt atagcgtttc ttttattttt aaaggtttta aaattcaaaa ggaaaaattg ttaagtcctg aatatttaca gtcaatactg cgtttgttct gagaacagaa actataaaaa catcatgtac caaaatgcca agtgtattta ttaatgacat ctctgtctgt ttctgaggta tggattcttg aatgactaca t ct tat taa t cagacttgcc taggaccatg atagaaacta tttccattta agacgtagct atagtggttg aacacttgct aacagacatt tcaaagcctc ctattaaacc cagattggcc atctttttgg ttatcttggt tatgaaatgt accaccaccc tgtgctagat caggacattt tcaaaatggc tttgctagtc gtggaaaaat aattaaacaa acaatagagt agctctgttt tcagcatgac tgtgggtata tcatgccttc cctccgcact ggccggctgg ctgccttgaa aaacgctgaa agcaaccacg ataagtatac aaaatagatt ccatccttta ttgctttgct ttcactctgg aatatttggg acatatacta taattttcct gaagccagga ctttgcaagt aagaaagttg gagaatattc aagatctcgg gtatgtgttc aaagtttgaa gagagacaat gaggtaaaaa gtaaaataaa cagggctact cagtttcttt taagacagat cgcatagtat cagatgtgcg gtatgtcatt ttctaagagt gtttcagttc ggcaaaggaa ataaagcatt actagcctta cattacttga gtgttatttg gggtaaatac atccaaaagc ttataagacg attagagaag tatgcatatt attttaaaac tagtgcctgg taatagtaat agttacttgt catcaggcac cacagtgctt tggagaagga aagtgaatcc gagacatttt ccttaattta cttctgtagg ctttacacac tttgtttctt ttaatttagg attgagagag taaaaaggac cgtaaaatgc gataaggcca atttgctctg tcaaagatga gttttagttc aaaggtaggt aactggtatt aattcagtac tgttttggca tttgcattca acaacctcga acttcaacat ataaatcagt taggtagcat gttcaattca acagccctaa tcgaaataca atcacttaga aatcaaatca tttgaagaag gaatttctat tatagctgtg atcccctgtc tgattcattt attaaataaa ataatttgga agcaaagcaa taaaagttaa ctcagaaact atattttttg tatataataa attcatgatt agtcttagtt ttattattta t tcatcccat t tggcaaaat aattatttca gtagtcagga gttgctgccc tgctccataa agaataacgg atcatttgct tgggtctatt gtacacacag acagcaaccc acatataagc tagaaatcgc attaagcata atggggaaat accatatgcc attggaaaca tggaacgact tgcacaccac caggtcagat cactaaagat gt ttggcaga gtcctcggtg cttgagttca aaatgatcaa aattaagaga cctttttgtt ggaatgtttc aaagtttgaa ttggcatttt tgaagaagaa agcccagccg atgagcaagg agaaagacaa aggaacaatg cataaatagc tggttgtgtg atttatattg tgaatgcatt tgagaagaat gcaaactaag tattttatct cacatatgta ttgttttaat gtaaataaac tatatacaca cataagaaat ttttataatt atatttatag ctttatcagt aaatagtaaa cagctttgta ctgt agcaaa aggatggcaa ccgtctaatt aagcagattt aggagaccag ggagaggcag gaaaatt tta ccatgcgcta ccctgaggag tccatttacg atatgcctcg ctgtacattt tttccccctc aggagatgct gacaaataaa tccaccggag ggtaataatc ttttattatc actacatata agataaagcc gatttacttt ttttcattga tatcttaagt gacacagaac tatatgttta tttcctttcc ataaaaacaa ctgtaggtca cagagacaac agtaagccct gagaaaatta aaaaaaaaaa caactattgt ctatattgat agatgatctc cttgacctat gtgcagagtg tccttttccg atgatctaat taatgtccga ataatgcaaa gaatattttt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 W0005851 0 http:/Awm. etthepatent.com/Login.dog/$exam.suportFetchDefault.dogNVOOU5851 0.cpc?fromCache~ 1part=maintoolbar--boftom].Page 673 of 737 WO 00/58510 PCT/EBOO/00435 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 183 3001

DNA

Homo Sapiens allele 1501 99-25897-264 :polymorphic base A or T misc binding 1482. .1500 99-25897-264 .misl misc binding 1502. .1521 99-25897-264 .mis2, complement primer Ibind 1242. .1262 upstream amplification primer primer -bind 1736. .1756 downstream amplification primer, complement misc binding 1489. .1513 99-25897-264 probe <400> 183 aagttaaaat atgtttcagt taccaagtta t tt gt atgct gtcttaatac agataatttt actacaataa ctctaaaata tctattttga tcaaaggatg caatatatgc tgccttgagt actaaggttt tttcctatcc tatagactag aacaagggaa tttctctcct tgttaaaatg gtcccgcact tctgtggttt tccagatgca acaatctcct aggcaagtac gatctttcca acatttcaat wgaatagggg aatcctccaa tttaaaacat atttttagat tcttagttat acattaattg taataaaatg aaacagtgac tcacctctgc tagttctgat agcttcagta attttttttc gcctgttttt attgaggtgg agaccctatc ataaatcaga gaaagaagcc tccactgcct agcaggttat gccatctgag cagaatcctg gccaagcatg tccaaactgg ggttgcttga ggtgtagaca gaattgaagg ggaggaaatt ataatattgt tttgtttata gatatacata tattgctagt tattcccttg ttgaaacgtt ccatgtgtcc tattataaag ttattctttt tttataatgt t tat ttt cat ttttttttta catctagagg tatagctata actctgagag ttattctatt cctttaattt gagatgttga caggagcagg gtagaggaga aaatcagctc gctaggaatt aagttatggg aatgctctat ttggagttga gctgat cccg attatataca caatacaatt tttatggtag ttttgaaaaa gcttatttat tccatgttct caagcactct tttatagtct attctttaat ctttttttct cttattgggg aatctttcaa gtgttaaatt gatagatagg attagaaact ttgaggtctt atattggggt gt gaggagcc cgtctgtcac gcgtt acttt gggtggataa tgtattactg aaacaaacaa ttctggatga gagtgtgtcg ggagctaaag tttatgtttc ttataaaacc atgtgagtga tcttgaatat atagtaaata gttatttcag tctaagagcc tactttatac atattgttat gttacctata ctacttttag attggtttga ttatgcttcc gacataggtg tcaacatcca tctttgaaca cccttagttc cacacgactg gctgaagacc aagaagcaga ccttgaacag aactatgcca ataaaaacta caggt ttgat tgacacattc cacctttttt acttaggaat tttccctatg aagctttgta atttctatta acatttgcaa ctaaaaaata agaaagacag catatttatt atattacttt tcattagcat tctaacttat ccataattag tatctttttt atggtagaga caagagagta ttacaaataa tgggtcaatt tcctcctgag tgcgtgctac cacgtgagcc cgacaaaaga agttcgaagg aagaaatcca ttgcttaaac ctgtcttacc cacacacgtg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 W0005851 0 [httpi/Awww.getthepatent.comfLogin-doq/$examsupportFetch/efault.dogAA(000585 10.cPc?fromCar-he=l1part=maintoolbar--boftom]_Page 674 of 737 WO 00/58510 PCTIIBOO/00435 gtcggccttt ggt gaggaga ctcagcggag aggttgtgtt ccttttccac atttctattt ctagtttgtt ggaagttaga atagtctaac ttattctaca gtgtgtttgg tgacttagca tcttttttat cagtagcttc ttttagttcc aattaaattt taatgactat atgttagtat tattttttac aaaaataatt gggtcatgag ccttgcaaaa gt ggt gt tt a acagttgtta ggcacttttg cgctgctgcc gagacacccc ggtcttgcca ttatcagata tcaa at tat t cttactacca atgtattctc aaagaaaatg atttgtaaga tgtattatta aattctggaa taattttctc tagaggtaaa aaaatctttt tctgtcaagg tttgcatcac cttttgatat atttattaaa taaatgctgc tctggagtat tccttaatag gaatgatcta ttgcaaattc tcacatgcac ttgagtcagg cacctagtga ttactatgtg cactttatat taaaaaattg gatgagtttg gaaagtttag tgaattcact atgtgtgtgt attctatttc gccatat tca atgtcacagt ttgcttttta aagttggaaa aaaatataaa tattattaat taacaaatga tatgtgattg tact tttaga tggacacata ggctaagcta tttaaaattt ttctattatt attgcctgcc acctgcatta agctaaaact ttcatatcat cagtgctttc gaaatcttta atggtggggc attctcatct tacgtgtttt gtatgtatct ttaactattt tagtttttat tttccacact ggagaatatt tgtgcatgtg atttgaaatc gacgttttag agggaacact aaatttattt aagattagaa tactagttat tattagggtc atttcaaaaa attaatatta agctcctcca atgggggcgt gaaatctgat atgttaaatt ctccgatgaa gagagaaatg ggaaagtgtt aaactgattc catttagatg cttggtgcgt taggtgtttg ttaaatctag cactcattat cgctaagtat cctgggaaaa acaaatgact aaggtttaca ttcgacaatc aataagcatt gacgtgcggc tccactaact agtttccaca ttgtattgct tcaacacatt ccctccactg aaggttttta catgagggag ttacgtattt ttaagattgt ttttgtacca tctttaggtt atataaacca ttaccaacaa gtgtgtgtgt taaattaatt acacataaag gtctaaaacc ctacactcta ttgaaatcaa cattcctttc cacattcaaa aagctttggg cct gaatgac aga gggct tg ggt tatgcta tgcataggct gt aa taaa tg aatgttaaaa 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> 184 3001

DNA

Homo Sapiens allele 1501 99-25 90 6-131 :polymorphic base G or T misc_binding 1481. .1500 99-25906-131 .misl, misc Tbinding 1502. .1520 99-25906-131 .mis2, complement primer bind 1374. .1392 upstream amplification primer primer Ibind 1888. .1908 downstream amplification primer, complement <221> misc binding <222> 1489. .1513 <223> 99-25906-131 probe <400> 184 aagtaacaaa gacttgaagg ggttaagtga ctgaatataa aaccaggaaa tgggcattgg W0005851 0 [http Awwgettheoaetcmtoi~oIea~uat~th~futd~W 055 0.c?fromCache=l1 art=maintoolbar--boftom1Paqe 675 of 737 WO 00/58510 PCT/IBOO/00435 tacaatgtgc gtgtgtgtgt caaccataat ccatccccaa agattatata atggcgggac cagcctccgg tttagtagag tgatatgccc gccgagaatt agcttctaga atcaatagtt aactattctc ctaatatgta gtgcatatat agctcagagt ttgttttata gatgataata tcatgacaag ttattgtaat atcttcttga taagaatttt actgtttcaa aaaaattcct kcaacacatt ttcctatgtc aatacactgg ctgaatataa tatttctgga gaaat gaaca tttggctgac tgcaacaaaa tccaccttat gattttatat taatctagcc atttattctg taatttcagg aaacagatgt aataaaggag aaattttaac tcattacatg tgtaaggtag gaaaaggaca atagtgtgca attctagatc ttaagtccct cctgttgtta ggattgaagg ttaacatttg t acaacttatt gtgtgagatc caagatttaa actctgccca tatatatata ctcagctcac agtacctggg accgggtttc gccttggcct ttatgtaaac ctcagcacta cttcagcttt ctattgagaa caagatttgg taggttgtgt gacagggttg tacgagcttc acaatgatgc tccttagacc tgcataactt atttattctc tattactgat tcaatattaa aggaatgaga gaaggagggt tgtgaaattt tggtattcaa agaaaaagga ctttttaaag gacaagggca agcaccattt agtaaatact gtacccatag taattcatta actaagatca ttgggaatgt tcatggcatg actgtcattg aaaataagga gcactgaaga tggttttagg cctctaaacc aagcat tggg ttcctcaaag tct gtggggt gagattaaga ca cat ttt cc atgcaaagta agt cat ggac caggttttgc gtccatgcaa aactgttctt ccactaatct ttagatggag cgcaacctct attacaggca tcaatggagg cccaaagtgc agaatcatac cgtccttgag tattgctgta aaatttggat ggaacgtaaa ggtaaacaat tgttgtgagt acaacctgct catttcaaat tgtaactaac tggacactag ttgtagaaaa ttgaataact tataaacaat ctttttataa gttaatgagc catggcaatc ataatttaag aacctcaaaa ggtcccaaga ctctctggac ccaatttcta tacttcagtg taaaactttt atttaacaca tagggttgag tgacaacctt agcattgaat gtgatcagag tgcagtcatt tgaatgggtg cctgtgtgaa tttctaagct aattattgca tagtaaataa aagtcaggca tcattttgtt atacccagtg ttgttcttgg tgggaaaggc caattttaca ttttgtcaca caccctaaga cttctccatc ttgtgctctt gcctcccggg tgcgccacca tcaggctggt tgggattata agtatgactt agatccct cc tttcatggtg tgtcctcatt tttatgtttc gcggttattc aaggatgtgt actcatggga ggaat cat tg aagcaataag tcatattaaa atgttcatgc tttatagggt tgtgtataaa aatttactta cagcccatat tgtcaaaatt ttctggttcc ccacct tcaa gtagagaaca ataatccctc ttttgcttaa agcttatttt gttattttta tatcgtgagg caagagagag aatggtaaat gataatgagg aagttctctc tccagaagag attgatctca aaaacatgaa cccagtttaa atcatttttt tggtgtttta tcaagtcaat ccacagaaca tgacccttaa gtgtgtctgt agttctaccc tgcactctgt tgtgtagatt ttccctcatg tctataatgt gttgcccagg ttcaagcaat cgcgggatta ctcaaactcc ggcgtgagcc gtgcatgtct aaattgttgt tgaaatacca cttgactatt tccgaaatat agacagacaa tctctgagac ccctcagtga tgatgattgt ttttcaataa cactttccca ttaaatatac tttggaagca aatcaataat ttttatgttt gaacagtgtg agccaaactt aaatcgaata aacatattga aagtttggtg aggccaaata ctccaatgtg tccaaaagca tacaattatt gcttgctgta aaagattctg aagtgaatga cagggtgagg tgaccaggat att t tca acc gggatgaggt gttgttccaa tttccaaaga gtatgctctc ctcatctcat gtgtgttgaa aaatggagcc tactgagtgt gagggggttc t cat tct ggg gtgtgtgtgt tcttgtatca ccctacatca tatcattttg ctggagtgta tctcctgcct attatgtatt cgacctcagg accgtgcccg tttgagagtt agttgtgtat taatttctgt ataaataaat gaaaccaaaa aagtagatag caaaatgtct taaaaatgaa gttagttaat atgttagcta tatatttatt tgatattatc aatgccgtca gaaattttaa ggaaggctag gtgcccaaat gtttccatta taaaactgtg agccttaaaa acagtgtttt tactgtgtaa tttaataaaa gcactatgca ataaattttg tacacagcac ctttcatgat acatgagata gtatgaacag agaagccczag aaagaacaga tatacttagg gaagagtttt gcccacagtg cttttttagt agggcaaaag tgaaatattt actgtttaaa caacttgatt ccaaaagaga tgggcacaat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 294 0 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> 185 3001

DNA

Homo Sapiens allele 1501 99-25917-115 :polymorphic base G or A <220> <221> misc binding W0005851 0 [httw:/twww.getthepatentcomLogn.dog/Sexam.suportFetchDefault.dofvVO00585 1 0.cpc?fromC achie= 1 part=maintoolbar--bottoml Page 676 of 737 WO 00/58510 PCT/iBOO/00435 <222> 1502. .1520 <223> 99-25917-115.misl, complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc -binding 1481. .1500 99-25917-115 .mis2, primer bind 1595.-1615 upstream amplification primer, complement primer -bind 1115. .1135 downstream amplification primer misc -binding 1489. .1513 99-25917-115 probe <400> 185 tatttacctg tctattccca agttctcatg tataaaataa taaagaaatc aaaagcaaaa cacaattatg gtagaaacta catatcccca ccctctgcta gaaggtgttg ctattatatt aggcacagat ttggcacagg ccgggaatgc tcacattatc ctctgagtgt caaatgggag ttcagttgta gttagtgata attattgttt acattcatca tagggactat ttacttattt tttatagtca rtaattccat tgtatgaaat tgacagagac gcctttccac tttgtgagag tatctctgac tcacatgatt attattgaat gtttttatga tcttttttat aaatgcctaa tccttttcag tat tttaagt agaaggtaat tatcaaagta tagattttag ggcatgcttt taaattattg actatttaca aaccctctaa cacactttga tactcccatt aaacaaaagt tattattatt ttggtgatta ctct catgca caactcttcg aaattacatt atcattccca atcactttcc gccttaggct acagaaa.tgt atagggattt atactaattc tgtgattgac tactttaaaa aggttccact aaaatattag ctgaatgtga attttagtca cgccttgaag agatactgtg agagttttga agtcttggtg aattcctgcg ctatgttgtt gatttactgg gcagattaac ttcagtgttt ggcaaacaac ctattctctt ttgtcttgct attaaatttt ctagagatca agaagtatga ctgagttcaa atcacagaca atctatcttt gacaaaaata aaatgcccat aacacacaca.

ttttattgac ataataaatt ggacacattt aataacattc aaaattattg taactaaaag tcttacgctc ataccttcat aaaggagaca ctgtgcatgg tcttcttttg ttcttcaatc aggtgttagt gtaaccacag tcttttgagc t ttagt tct t atgcccattt cctttaatcc aatattgtgc tgaaggaaaa ttctgttagg ataaagaaag ttatttttgt tcttttagta tcctgttaaa ttgtcaatta atctgtt tat tttttaaaat gtgaaaaatt ttatatttta ggagtttagt tgtctgctta taaacatatt tgaggataat caaagataaa gtgttcaatg ttaagacgca ctaggtaaat cacacacaca tattctaagt atccctcgtt gcttttaaaa aaagtttgga taggaggcac cattttttaa tcaagcactt caaatgtcat tctgtttgct taaggtcaga ataggcaggg aaaattaagt tgacactttt atgtttcttt tctaaagaga tcgaactaag ttaagtgaaa ttttttaaat tattcctcct gttctcaatg ttttatcaag atgacatggg aatatttttt ttattttttc tgattcattt gatatacatg cctgttcata gcagggaaga ctcatttttt ttcaatacat tcaaaatcaa gttttaaatt catagtatga ttcaatcact ttttgtcatt ctattgtaaa tagtacttca ttagggtcca ccctatgtag tcactaaagc tgtatataaa aaacaagact tgttaaatag tttaaaggaa aatgggcatt aatgcggata agcaa cagct gacaacttca ggccttacct aaatgactaa agggttacaa tttttttttg tagtctgatc gtggtctttt aaaaaagtct ataactaatg tcaggtgaga catattgttt ctcaaagaaa cctgcttgag ttcctcatac ggttagttta ttaagtctaa tgaaatctac taaatttagc aaactgctaa aaattattcc tcactttttg aacaaactta tctgatgcaa ccacattttc gattttaact catgtgaata tttctaaaaa aactAaaaac tctcttgaaa tggttttaaa agtttgatct atattagaat tccattatga attagaagtt aggcatttcc aaaaatatgt aacaaattag gacctacaaa gccctagtag gatcaaatga atttgttagt catactatca aaggaagatt gtttgtgttg aaaatgaaat aacttaaggg atttacattg taaatagcaa gtttggtttc ccacccaaaa gatgcccgaa atgccatcct agacgtattt tgcttcattt tgtagtcaat aaattctaat tttttacttt tgtacaggga ctgtgtttct ctcgctttat cttctcagta aaatctttga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 W0005851 0 [t~p/w.getthepatent.cqm4.qg in.dog/$exa m.supot~th~tutdgW055 0.cc?frqmCactie= 1 prt=maintooIbar-btomJ Page 677 of 737 WO 00/58510 PCTIIBO0100435 tagattgaca ttcttactgc cagaatctaa caataatatg aaggagtcat tactctcttt ttgttttctt acaaattaat gaagcatggg atccttaact ct att t taaa t ttgcttcatt aatactagga aaatctaaga agaaacataa ttgtgctcaa cactttatat acctctctgt atagaattag ataaaatata tcttttaatt agccacatta tattgcttca tctcaggcta attaaatatt aacagtggtc ccttgttaaa attctgtttt ttggatgtcc gtgctatatc aaaggccaga gaaaacaaga agttat t ttt tttggcatac gaaatatgag tgaacactct aaagcaaatt gaattttatt aaaaattaca tacgtttctt tagacacagt ggcttactga ctttcttaag agttttttaa atttatttag tgggaactaa acatatattt tactttagat tttatgttta ttaaagtatt tgatcatttt cattaaaatc ctaattgaaa tctacctgta tgtgtagtaa tttctatatt gtctatcctt tgtgagagtg ggtttttaag tgagtcacct cgaagtactt ctcaacaaca cctcaaatgt atatagtaaa atttaccagt act aaga cat 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 186 3001

DNA

Homo Sapiens allele 1501 99-25924-215 :polymorphic base G or C misc Tbinding 1482. .1500 99-25924-2 15 .misl misc Tbinding 1502. .1521 99-25924-215 .mis2, complement primer bind 1287. .1306 upstream amplification primer primer -bind 1717. .136 downstream amplification primer, complement misc Tbinding 1489. .1513 99-25924-215 probe misc feature 1914, 2542, 2811 g, c or t <400> 186 aatttgtcaa agtaatcaaa aaaaatttta ata tat ggaa actctgtgtt gataaggtaa gtcaacttga gttaaatctt agagcttgca cctcaagtga tgttttgatt caacacatgt tgatgaatta cagataatca attacggctg acactgcatt ctctgacctt gtgggactgc catagtaaac atatgattcc actgatcgtt agggagataa t cgaagggaa tcacacacta tagtgggctt ctttcttgta cttcttccct atgctgagaa aaagagtttt aataaaattc cagcgtgttg agtgcttgaa attaaaaccc atctgccaat ttcatgtaag ccaggtcttc atagcaactt gggtttataa aaataagata ccttgaatta aaaataatga atagatcaat gcttcactag cgctaaatga cacactctgt ttatgtgaaa atttcactaa tatgttttta aaatacgctt taatatttga tacaagatga ctgtcctgct tttttccagt cgggaa ggtg 120 180 240 300 360 420 480 540 W0005851 0 httplwww.getthepatent.com/Login.dogSexamsupport/Fetch/Default.dogAN000585 1 0. cpc?from Cache= 1 part=maintooIbar--botom1 Paqe 678 of 737 WO 00/58510 PCT/EB00100435 gtgaagagac ttagggtgaa tcaagacaga cacaatcatt tgaatgcact agacagggtc acacatggtt acagcaatat ctttctctgt ttcccagact accgccatgc aggctggtct ggaattacag cataattcaa tttatttttc gcccaacatt sgatccagcc gggcattaaa aacacattca ctggttatta tgaaaagata aaagcacatg aattaaacgt ctctcctgtg taacttgaaa gtcttgaatt aaaatagggg ggaacaccag gaacatgaga atgccatgtg gttccttgta ggagcagtga gt gggagggg gagtctcgcg gccttctgcc agccatgtgg tatcagcagc atgcagacct aggttggaaa ttttatcctg gcagttagca a aggactgcag cttgacagag tgctctttta ccaacatatt tggcacatca aagtgggaga ttagagttag acaaacatga cacccagttt caagtgattc ctgactaact cgaactcctg gtgtgagtca agtgccttac atct ct gtt t acagttagaa tccataacca atcaaacagc aacaatattc acattagttg aagcaaaacc tgtggtaggt ggctctttca atttttgttt actctggctt gtaacaccca agttaagaag caaatattgg cttgtcctga ctccaaccta aggccctctg ctcacacctg attgaattat agatatggtg atccatgtct acctgtaagt aaggacacgg ggcaaagtag cacttacaaa gttttccaca gctctttatt ccctcataaa gtgtaagcgt tgaagtgaaa cttgatggaa taaaagagat tcctcaagaa aaatgaaata tttttttttt ggagtgcagt tctgcttcat tgtgtatttt agctcaaaga ctgctcccag aagtattaat catagcctat agaataataa tgccagaatg atttgttgat tgaaattttc ttggaccctg aaacaaacaa ttccattttt gaatggtaca ttttgcaatg ggagggtgat catttctatt tgggtagtaa aggtcaagtc gacacagaaa tgagaaaagc aattatgcca.

taattccaga gggggcgcgt gntt taaaac tgctcctcct ccattaaacc actaatacag atctgaaatg cccagacatg aaaggactat atgagcgctc ggctctgcag cgagaaagaa tttcgaccct aaggctaaca gagtaggaaa atactcctga g ta aga aca c cattgagtaa ggtgtgatct tctccagagt ttgtagagac gatctgcctg ctcttcattg gcatttaatt agaactaaat tcagtataca ctgcctctcc aaataacaaa attacaaaac gcgggtgggt aatgaataaa gtgcaagagt aagtctgatg actatgaggc atagtttggc agtctaatat gagtgaaaac acctgtaagt tagtgatatt tccataaaca ggaaaataat tattagactg ctttcctgtg tgggagtttc tgccttccac tcttttactt atggctcatc ggactccgga agactcacac gaagaataca tcttcgtcct gtgctcctca actgtgagaa aagacaccat tgtcttcctc cacaggaaca gcccactgtt tagcaattac ttattttttt ctgctcactg agctgggact aaggtttcac cctcagcctc agtgactatt cccaaaaaat cacagagagg aatgcaagca aatacatttg cttctttggt ttccttgaaa gtgaagagtt aacactttgt tatgtgaagg gatgcttacc catacaaaga tgtgtcccca ct gggt ctt t tgtgctccag ttcaggattg gaaaacagtt accaacatgt agtcactcaa ggttccatga ctgttctcgt cctgcacaag catggttgtg cccagtctcg cagaagttag actaatgaca cttaaatggt aatggctcct atttaggtaa atactggcct gttccaataa ctcctggggt aaccaccatc tacaagcaag tgaaatggtc agtgatcatg gagacagggt cagcctctgc acaggtgtgc tatgttgccc ccaaagtact attttacagg cccatcagat ttaagtaacc gtttctcccc aacttttatc ctgaaaattt gcaaatcaac gaggagggga gtctacagtg gttgtcacaa atanagttag gctcatgtat cccaaatttc ctgtgatagg gatatgaatg gtagaaataa aaatacctct tcatacagtg caaagagcca gaggagccca gatagtgaat cactttcttt aggcctcccc gttatgtctt aaaattagag ntggctttct ctgttggagc tcagagagtg actccattct 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 187 3001

DNA

Homo Sapiens allele 1501 9 9-2 6138-193 :polymorphic base C or T misc binding 1481. .1500 99-26138-193 .misl, misc_binding 1502. .1520 99-26138-193.mis?, complement W0005851 0 fhttp:/Avww.g etihe patent. co m/Log in.d og/Sexa m. suportfFetch/Defa utdo/WO005851 0.cpc?fromCactie=1 part=maintoolbar--bottomI Pge 69 o 73 WO 00/58510 PCTJIBOOIOO435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223>* primer -bind 1309. 1327 upstream amplification primer primer Ibind 1741. .1761 downstream amplification primer, complement misc -binding 1489. .1513 99-26138-193 probe misc feature 65..696, 980 n=a, g, c or t <400> 187 tcacgaggtc aaatnnacaa gtcccagcta cagtgagctg aaaaaaattt ctgaaaataa catatttgtt tgatccttag tagatacgta tttgtcaagg tatatatata aatcatgcct atctattcat tcaattgttt ttactttgca t tgaagaaca ggattatagc atagagtctt ctctgcctcc ggcgtgcact attggccagg tgctaggatt tcttaacttt atatgtcaaa tattatttta yagaaaaatt ttaagaaata aagtcttcac tgagatggtt gtagcagtaa tcatatgtag tttataaaag agttcggtca gtggatgtat taaaactaca ctggaaaatg aggttcaaat aactgcaact agaatataaa ttaatgttct tgaaacatta taaaacttaa aggagat tga aaaaaaaaaa ctcgggatgc agatcacgcc gtttccctct caaatgaaag agttctgtct tgttcgctca gatacaaaaa gacttggaag tatatatata tcaaatcata gat tagtaat gcatatgatg accaactttt taaaagtgat ccggctccgn gct ttgtccc cgggttcgag accataccca acggtctcga agaggtataa gcatggcatt at gttat ct t ttatttgtgc tctagtgact gggaaatgct tgggaacact atgttgatat agaagtggtc atattaacgt aggggcacca aatcacttat aatagagtgg accttgcaaa aaataggcac atcctaaata tgtaatattc tctagttttc ttccattgtg tcaaagcaaa aaacaaaact gactatcctg aaaaaaaaaa t gaggcagga actacactcc ttcctttctc aattatataa ttgccttact tagttacaga aaggttttct aaaagactat t atataaaat tctagaaaat aattagaaga tgccacttat gaggtaacat ctaccctgcc tttttttttt caggctggag cgattctcct gctaattttt tctcttgacc gccactgcgc tt t tgtct ca tggatggtga tttcaaacta ttacacaatc cgaccggcca gagcaggcaa aagactttta aaggccattt catgaagatg cctatgatgt gtaatcctaa tgggaaaacg tgagttaaat tctatttgct taatactgga tacaccataa catgaattct atagattgta attgaaagat agagtgagaa gctaacacgg attagccggg gaatggtgtg agcctgggcg atttcatgaa aatcgatatt tcacactatc atgaagattc ctgaaatttt caataaaata ttgcaaataa caaaaaataa aaatcaatga tttactaaaa ccttttcatt caagcaacac tttttttttt tgcagttgcg gcctgagcct gcatttttag tcgtgatccg ccagccccag gattcataaa tattatgggt tctgcagtat tggattaaaa aggatgagcg gctgcaagac acaagtccca gatatgccat atggcaggga gacagatgct aaagatgaga at t tggggt a gaccataaga gagggatgct acacagatat ttatggtgta tagtgagaat ctgtgtactg cagagaaaca gaaacttaga tgaaacccca cgtggtggtg aact tgggag acagagcgag tcttttatat ttgtttccag agtttttctt gatttcaatg gaccatgttc tatatatata aaaacatatc gggaattata taatattaaa tattttaagg ctgttttcct aactactata tttttttttt tgatctcggc cccgagtagc tagagacagg cccgccttgg tcttaacaga tgtgtgtgtg gacat t ttat atgtttagta ggcaaagtaa cttctaagat tagaaaataa gaatatgtct caataaatgc tgggcataat ggcacaggaa atttcatttt tttaggggat gtataaatta aatgctacca tattcaattc gaataaataa atgggattca aggaactttc ctatagtcaa cgctaacttg tctctactaa ggcgcctgta gcggagcttg actccgccta tctaggttat aatttttcta taatatttgg aagattgatt agcacattaa tatatatata aaacattaaa gatattcata ataactaata gttgattcat gaggaggaga cattgctgct ttttttttag tcactacaac t ggga t taca gtttcactat cctccaaaag gagcccattt tgtgtgaatc tatttgttat attttataag tatgagaagg ggt caaaagc tgcctcatac gtgaat gaaa agagtcttgt gtggatcggg gagaaattag ataggagagc cagaaagaat atctcatgca ggactgtgta aacatgtgtg tgatgaaatc tggaaaaaat aggtaaagga ctgcataaat aagatctcct 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 W0005851 0 http:/Mwwg ehepa tent. co m/Lo in.dog/Sexa m.suppo rtFetch/oefa ult. dogqvVO00551 0. cpc?fromCa che= 1 part= mai Mod ba r--bottom ]page 680 of 73 7 WO 00/58510 PCT/EBOO/00435 ctgtttcagc ttatggtaaa tcccatatca aagccaaagg ggtttgtgcc ctgccagccc ttgagccgtt ctctgccatt a ttgttcctga ctcagttagt gtcaacatac tgcccagctt tctcctcccg ttgtgaggga tttcccttac ttgtctctta agggtctggt tagaaccatg tgaaaggggg gatctttgat tgatgtttcc ccacatgcag cagttgagtg gtgtgcatgc ttcatgtgaa atattagaga ccaggtgggc ttgtggtttt ttggggcagg tgtgttccct gtcctagaag tt gagccccg caaattttaa ggacagtgac atggcaacat atatgttggc ctgtccgcat gaagttgttc aaggttatat cgcccaactt gaccgatgca aatgtcagca acaaaaacac atgcttcttg gtgcagtggc acgtgcgcat ggcagttaaa ctgagatctt 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> *<220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 188 3001

DNA

Homo Sapiens allele 1501* 99-2 614 6-2 64 :polymorphic base C or A misc Tbinding 1502. .1521 99-26146-264 .misl., misc_binding 1482. .1500 99-26146-264 .mis2 complement primer bind 1746. .1764 upstream amplification primer, complement primer -bind 1314. .1334 downstream amplification primer misc -binding 1489. .1513 99-26146-264 probe <400> 188 aatttcaata accttacttt gagtggcctt tctggttttg gt gaccggca ttcatgctgc caatgatcaa gttatgaata tagctatttt tcctcattag ggagctggat gacaggatat tatattataa at tt gcaa cc ctttagcatg agaaactttt atagttaaaa ctatactctc tattaaagat atgttttgaa acagtaaagc aaggtatagc tcttcaccta gaggttctac attaatctgc tattcatggt tagcatctat caggaggagt ctttggcaag atatataggc ataaatgtaa ttcatgtatg gctccaaagt aggtccgaag aatattttaa tataataaaa ataattacac atgtgccgat tgtacattct tgttggctca atgagaaacg tgat atcaga ttggaagact gcaaagaact gagtaaatct ccacttgaac acttaccact gatatgaaaa tgttgtcatt tact tattta tgaataaaat tcttccattt caaaacacag gt gga gcc tt ctagttaagt ggaggagaaa gcaggtatcc tggtatataa attggtaaag gcatatagtt atttttacaa gggtttgaat tcagtctcag aatttcctaa tactttatac tgattacaca aaaaaagtaa attaatttgt acctttttct agagt ggctg ctctggctt t atatgtgatg attgttgtag acacaaatga atgtatctat tcctcatagc atatagcttt cat tttaata cagaattctg gtttctcaac gtagttagat ttacttaaca aatttttaga gaaataagag gtgtttgttg ttctttggaa attgggcatg cagaatttct cactcatggt gaatgattat agttaggtac ataccatttt atttcagttg atttcataca aagaaaaaaa ctccttattg taaaaatggc aat ggaagca ccttactctg ctaagcagga aagttacaaa aatgcctaaa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 W005851 0 [hflttAw~w. ethe patent.comLog in -dog/Sexa m. supportFetch/Defa uIt. d oiO005851 0 cpc?fromC ach~e= 1 pa rt=m aintoolba r--boftoml Page 68 1 of 737 WO 00/58510 PCT/BOO/00435 acaaatccaa atcactatta tcctttaaaa agtgaatgcc aagcgaattc tt catgcaag atattaaaat tgatgtgtaa mga tat ta aa ctttttggct acacatacta tcctcttaat ttttaggttt ctaatataga caaaatctcg ttgcctttat attcagagac agcttggaag taattctgga ggcatcattt caaatatgga aattctgtgc gcagtggcgc cctcagcctc ttttgtgttt gacctagtga acgcctggcc ttattttgta gtgagaagca acagtacgtt ttttacttat attttgtaga agagaaagtg t atctatgggg taggtaaaat tgagtgaact tgtgaactaa tttattaatc aaactacaga aggtttacta ttataaggaa taatgtagcc cagatttgtt gtaacaaatc tgattcactt tgatgggtgt taaacataga attcatttat attcccagca gctatggcta acgcagcaca atcaatgagg cattattaga aagtctaata tttttttttt catctgggct ccgagt agct ttagtagaga tccgccggcc agattctgta aggtattgat aatcaatatt tttatttata atgtacatat aaggcttgct tgtatctaag gcgttcacat gttagtgata gagtcataga tatttactga tacataatta tggtccccaa aggtactaaa gtaatcccat aagataatgc tcataacaca ccaaataaca aaactcattt aaaactgatg gtgagaaaag aagtgaatag aatggataaa accaataagt ctgtgaaggg agttatcgaa aaaaattaca gttttcaatg tttttgagac cactgcaagc gggact acag cggggtttca tcggcctccc tttttatgtt gatcttcttt atccaaagct ctgaaacaca atttatgagt catttttcaa gtctatctta gtacaaatta aatataaatt gaaatatagc gtt t ttgact acctcagaat cttaagatag tgcatttcaa cttaaggtga ctttataagt tcactgcatt acttcggtct cctgggtaga aaactcataa agaagcatat tgaggacttc catagaaaga cacagataac cattgagtgt ggcatgggag aattgaatta ccaagattca ggagtctctc tccgcctcct gcgcccgcca ccatgttaac aaagtgctgg ctgattaata ctttatccat tattgtgcca t taaaat at g tatcaaattt t tgtgt tct a atatttggtc attttaatga tattaatcat aacttgtttt attttttaag atcactatat ttcaatttgg cttacaatag taagcatctg gaagttgatt agttgtgtca gaataagtcg tattaaaatg acacgtatat actgagtgct aaggaaatat gt ga tctga a ggacgcaatg gatgctgaag agacgttcaa aagctataag ttacaagact tctgttcccc gggttcacgc ccgcgcccga caggatggtc gattacaggc tttacaaagt aaattatatc acatttttta aaataacatc tctaagaaaa ggttaaaaaa atttttatac acactgtgaa ttcaaaattc ct aa tat aa a tcctacattc tttcctattt gatttttttg tttgaattta tagatgtaaa tcaaaacctg taataaaaat agtattcatt tatgaaggat tataaatact agtcaagaga gctatataca agtaatgtgt tcaagaaatg tatttaggtt gcaggaaaat gaagttatat atgtaaagaa aggctggagg cattctcctg ctaaattttt tcgctctcct gtgagccacc gaaaactcat tttaggtatt gtgaagaggt tttaaacatt ggaatttatc aaaagaaaga tgtagtttct 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880.

2940 3000 3001 <210> <2 11> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> 189 3001

DNA

Homo Sapiens allele 1501 99-26189-164 :polymorphic base C or A misc_binding 1502. .1521 99-26189-164.misl, complement misc -binding 1482. .1500 99-26189-164 .mis2 primer bind 1644. .1664 upstream amplification primer, complement primer bind 1215. .1235 W0005851 0 Q~ttp: N-eteaetcoANgnoIeams~otFth/ea~~o V0005851 0.cpc?fromCar-he=l1 art=maintoolbar--bottomI Page 682 of 737 WO 00/58510 PCTIBOO/00435 <223> downstream amplification primer <220> <221> misc binding <222> 1489. .1513 <223> 99-26189-164 probe <400> 189 tagcagaatt ctaattgttt tcccaaaata gaa a aca aat atgctagtcc taact aggca tatctcactc aatggggctg cctgaaggat gacacaaagc taaatcactg tctgtgatag aagcatattt ggaaat caaa tatagaaagt ctgtctgcat gtgcaataat tcttactaaa acagatatgc gagttgaaca ct cct cat gg ctgtttaaag aaggctgtga gagttataga ctattaatag mccagaaagt aggaccaaat t cat tat gaa tgaaaccctg actttcagct ttcaaatccc tgttttacaa aatgttgtgg cagtattcac aagactgcgt tgtttcactt attacggcta agacactttt aatttttaga aaagggaacc cactcatgta ttttactgag catttggaaa tgaaatagat ttttggaaag gtaacactt t tttgctgatt taagagatgt catgtatcat tatcaaaagt a <210> 190 <211> 2997 <212> DNA aaatacaagc taagatgaag ccgattatga gtgtccaaaa acaaactcag ccccagcaca tgacatgttc gcctgcactt aaaacatatg cagctgagtg atgtgtagac cttctataca tatgcatgtt acaaaaacat cacatcaaca cattctatat atatatgcag gtttattttt ttagagtgat aggcaatgtc tctagtgagt tggcccccaa tgtgccttat tagtgttctt catatccaga gctaaagtga ttatggattc gctggaggcc ttcccagcta tgcaggcagg taataactgt ggatgttggg ccagaggctt taattcagta gtgctggggg ctcataccca ttagggttat aacatgaatt aattacatgt ctatacaaaa gaa aaggaag agaattagag ttgcaagttt acacatgtga acaaaattac gtgtaaaaaa aaattgataa gtggtcatat acctcaaaat atacaaacat tctcacatca actattatat ctttcattaa tcctttaaaa ttactgcaaa aaaccttgta tggccagt gg gttccttttc gagcagtgtt acctcaccaa ccgtgaacca gcattataat taaagtaaaa accttattct atggcaatgt tcaggatgcc tcaatcttca atcccccaaa agaaaatttg ttctctcctt ggcacttttt atgtaacact ggggaaaaat ggccatccga aaagtagaaa tccctggtgt atgagatgat aaaggagctt gcactggctc caaggtagtc tatgtgaaag aaacaaacct gcaggaccct ttctcagaaa gcgggggtgg tcttattcat catgcctgaa actcttcttt gaagtagcta caatttagtt gctagattct aagtagagaa agatatcaaa aatctgaaat ctgagaaact ttacataaaa agactaggtt gatggtacat ccctaaaatt atatacataa aatctctcag tgtttgtttt tttttcttca tacagttgaa caaaatgcac accatgccct atgcagggag cttcccatga aagttgcctc aaccagagat aataaatgag gacactagat taaatttttt gtttggaaat tatccattat atatacatca ttctttgcag tgaatactca aatttttaag gttacagctt ttcagctttg aaagtgttgt tcatatgtta tat tggat tt agaaatgtat gtgtaataat aactgacttt atggttacat acacacttca tctccagatc agcaggtttt gtatgaaaca aactctgtac ctctatagaa caggtgtgtt tatgagcaac cattaaacat tttattttac tattaaatgt ctcctaagat gtttaaattt aaatt taaaa tgcatatctt aataaaataa gtaaagacaa ctgaaagata gagtgttgag ttttataact cttgacctag gtacataaat gatcaatata tctctgaatg tcatggatct gtgacattgg attaattttt tcaccttcat atgggaagag gagaaggcca agttgtcaca ctacttaacc gattattaaa aactaataca aaaaaaactg taaccaaact tttaaagtga ttttaccggt attgcatatc cagtgctttc aagcatgttt tcatgctgta tgtttttgtg atagtattct gagaagcttt cagggttaat caatttgcct ggtatggaaa taaagatgca gacccagcat tagggtgata aggaggcagt caacactgat aatgcatttc ttctcctagg aatacctacc tgtgtgtggg tgtaaaactt atgaatatgt agtaagtata aagttttatt taaacaccac ttaaaagaat atcatgggtc acatcaaaat gaagggattt acaataatta aaatgggaag gacaagtatc tttccgaaaa tgattttaca gtatgcatat attacttgat tttttgtctt gatat tatt t ttgcaaatgc ttttttagat atcaaaggcc cactgtatca ggacaaagcc atccatccca aagcccagcc gtcaatgtgt aaaatacaca cagtgactgt ttttcatcat cagatgcaat aagcgtgcat tgtgagtttt atagtcattc gaatgaggct aacacttgtt agtaatttta caatcacaag gttcacgtgt tataaacaat gtgaggctgc aggt ggacaa tttggcagca cagaaaaatg cagcatgaac ggaagcattt gagactggct agttaatgaa agcaataatt atgaacaagg tgttaaatat tatcaacttc atgcatatat caattttact gcagaattgt taaggtagat ataaaattga aactgttgat gaagtcctca taaatatgtg tacaaaaatt tgataggatt agtaactctg agcagttggt tttaggcatg atatacacat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 W0005851 0 [p:pjvww. getthe patent.com/L og in.dog/Sexa msuroFetchDefa ut. d oqNO005851 O-cpc?fromCache= 1 part= ma intool ba r--botoml Page 683 of 737 WO 00/58510 PCT/iBOOIOO435 <213> Homno Sapiens <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-26190-20 :polymorphic base C or A misc Tbinding 1502. .1521 99-26190-20 .misl, complement misc -binding 1482. .1500 99-26190-20 .mis2 primer bind 1502. .1520 upstream amplification primer, complement primer Ibind 1071. .1091 downstream amplification primer misc -binding 1489. .1513 99-26190-20 probe <400> 190 gaagatactt gataagtctg tact tagcat gacctccaaa attcgtagtg tgtatatgtc attttggctt cctattctag tatgtcttca acctttaacc tataattact aatgtttttg atctgatatt ttggttgcaa tttttttttt tcatatcaaa agagcactgt gccaggacaa cacaatccat aaccaagccc taaagtcaat tacaaaaata actgcagtga aactttttca gtgacagatg mggt aagcgt tatctgtgag tttcatagtc gtttgaatga tgtaaacact gttacacatt tgtttaaatg cccctgttca gtccaaagta gccctctatc atctgttgga cacatctcgt gtgacccaca ggggaatgat agggt agcag tgatctaatt tctttcccaa atttgaaaac atgcatgcta agattaacta ggcctatctc atcaaatggg agcccctgaa cccagacaca agcctaaatc gtgttctgtg cacaaagcat ctgtggaaat tcattataga caatctgtct gcatgtgcaa tttttcttac attcacagat ggctgagttg gggaagcagt ccagctttaa gaggcagcca ctgcagaaag atgcttacct aaattctgaa ctgtataaca aacagttatt aaaaatattc aattaaatac gttttaagat aataccgatt aaatgtgtcc gtccacaaac ggcaccccag actctgacat gctggcctgc ggataaaaca aagccagctg actgatgtgt atagcttcta attttatgca caaaacaaaa aagtcacatc gcatcattct taatatatat taaagtttat atgcttagag aacaaggcaa acagtgttgc cccttgccag ctgcatctac cttttaattt agactctcaa tcccccatct aaagcttgtc taaaatttaa aggcaaagat aagctctcac gaagactatt atgactttca aaaatccttt tcagttactg cacaaaacct gttctggcca acttgttcct tatggagcag agtgacctca agacccgtga tacagcatta tgt ttaaagt acatacctta aacaatggca atattcagga gcagtcaatc ttttatcccc tgatagaaaa tgtcttctct gagtggcact ccttctgagc ctgagctccc ctaagtctgt gcgtcattta aaacccaagt ccctcctcca ataaaacgta ttattcatcc ctgtggatag atcaaatctc atattgtttg t taat tttt c aaaatacagt caaacaaaat tgtaaccatg gtggatgcag tttccttccc tgttaagttg ccaaaaccag accaaataaa taatgacact aaaataaatt ttctgtttgg atgttatcca tgccatatac ttcattcttt caaatgaata tttgaatttt ccttgttaca ttttttcagc cagggcctgt cagtgtttgt gctgcaacaa ttcccaggtc cacaaatcac ggcaaaagtt tgttctactg tttcccttct gtgaggtgtc tcaggatcaa tttttctctg ttcatcatgg tgaagtgaca gcacattaat cccttcacct ggagatggga atgagagaag cctcagt tgt agatctactt tgaggattat agataactaa ttttaaaaaa aaattaacca ttattttaaa atcattttac gcagattgca ctcacagtgc taagaagcat gctttcatgc tttgtgtttt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 tgttctcctc atggtctagt W0005851 0 [http:/twww.qetthepatent.com/Login.dog/$exam.support/Fetch/DefauIt.dogNVO005851 O.cpc?fromCactie= 1 part=maintoolbar--bottom] Page 684 of 737 WO 00/58510 PCTIIBOO/00435 tgtgagtaat tt ct caat ca ctttgttcac taattataaa gcctgtgagg gaaaaggtgg tgcatttggc gcatcagaaa gatacagcat cagtggaagc tgatgagact tttcagttaa taggagcaat taccatgaac tgggtgttaa actttatcaa atgtatgcat tatacaattt tattgcagaa ccactaaggt tttactgttt caagaaggct gtgtgagtta caatctatta ctgcaccaga acaaaggacc agcatcatta aatgtgaaac gaacactttc at tt t tcaaa ggcttgtttt tgaaaatgtt aattcagtat aaggaagact atattgtttc cttcattacg atatagacac tactaatttt ttgtaaaggg agatcactca aaagtggccc gtgatgtgcc tagatagtgt atagcatatc aagtgctaaa aaatttatgg tgaagctgga cctgttccca agcttgcagg tccctaataa acaaggatgt qtggccagag tcactaattc gcgtgtgctg acttctcata gctattaggg ttttaacatg tagaaattac aaccctatac tgtagaaaag ccaaatgtaa ttatggggaa tcttggccat cagaaaagta gtgatccctg attcatgaga ggccaaagga gctagcactg caggcaaggt ctgttatgtg tgggaaacaa gcttgcagga agtattctca gggggcgggg cccatcttat ttatcatgcc aattactctt atgtgaagta aaaacaattt gaaggctaga cactaaagtg aaattcatat ccgatattgg gaaaagaaat gtgtgtgtaa tgataactga gcttatggtt gctcacacac agtctctcca aaagagcagg acctgtatga ccctaactct gaaactctat gtggcaggtg tcattatgag tgaacattaa cttttttatt gctatattaa agttctccta ttctgtttaa ttgtatagta gttagagaag atttcagggt gt at caatt t taatggtatg cttttaaaga acatgaccca ttcatagggt gatcaggagg ttttcaacac aacaaatgca gtacttctcc agaaaatacc tgtttgtgtg caactgtaaa acatatgaat ttacagtaag atgtaagttt agattaaaca attttta 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 2997 <210> <211> <212> <213> 191 3001

DNA

Homo Sapiens <220> <221> allele <222> 1501 <223> 99-26191-58 :polymorphic base G or A <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <22 0> <221> <222> <223> <220> <221> <222> <223> misc Tbinding 1502. .1520 99-26191-58 .misl, misc binding 1481. .1500 99-26191-58 .mis2, complement primer bind 1539. .Y558 upstream amplification primer, complement primer bind 1095.-1115 downstream amplification primer misc_binding 1489. .1513 99-26191-58 probe <400> 191 tcagctctgt tcacatttga ctgagaatgg tttcttgaac attgattcta aaatagcaaa cttgcagtct acagccggcc ctcgatcttg ttcctttgtt tttggttgct tgaccatgat gcacataggt attaggcagt gagaggccag tgtattctct tcaatgagta gaaatatttc cgcatagcct gcattacaca acctatgcaa gatgtttgca cacccagtgg cacctgcaca aagtgtcata aagccgttcc acagagccct gatgctatgt gctttgttCC taaagatctt actgaatgta agtaaaagct t ga ga tccat gtgtcttttg ctgtgagtta atcatatgtt W0005851 0 http://www.etthe patent. comL gin.do/examSUpoort/petch/Default.dogNV0005851 0.cpc?fromCar-he~ 1 art=maintooibar--bottom Page 685 of 737 WO 00/58510 PCT/IBOO/00435 acagccagct aaacgttctt tataaatatc agatgcatca catgtatttt cctggctatt gtatgtgtat gaacagagtt tttttgccca aattttagct ccatttggtt atttcataag tcctaattta ctacacagat attatacgga ttagcaaaaa gaaattaaaa tcagaattgt tcaagtatta rtattagaaa acacattggg ttaaatgcca ctgttcagag caaagtactg ctctatcatg tgttggaaaa atctcgtctg acccacaaac gaatgataaa gtagcagaat tctaattgtt ttcccaaaat tgaaaacaaa catgctagtc ttaactaggc ctatctcact aaatggggct ccctgaagga agacacaaag ctaaatcact ttctgtgata aaagcatatt tggaaatcaa ttatagaaag t tcatcacgtt taaaatcctc atttgcccca aatataaatg ttatgttgtt gctaactttt ctgcttattc cagagtttca gttctatcaa ttttttctcC cccaataact ttctcttttt caagatgtgt actacaccaa taaaatataa tat aaa atat tgaggagaga tcaaatcttt caat act gat caaaacttaa aagcagtaca gctttaaccc gcagccactg cagaaagctt cttacctaga ttctgaatcc tataacaaaa agttatttaa aatattcagg taaatacaag ttaagatgaa accgattatg tgtgtccaaa cacaaactca accccagcac ctgacatgtt ggcctgcact taaaacatat ccagctgagt gatgtgtaga gcttctatac ttatgcatgt aacaaaaaca t ca cat caa c taaaactggt tacaaagttc tcagaaaaag ttttcaatta gaatggtcca aaattttaaa caagaggaga tttcattgat gttcttcatt cattgagaca tccctaaata agtggtagtt tgtgatattg agagaaaact atgaccaaag atataggttt gactttttag tgacccactt aggcatgaca tacaagtatc gtgttgccct ttgccagctg catctaccta ttaatttgcg ctctcaaaaa cccatctccc gcttgtcata aatttaatta caaagatctg ctctcacatc gactattata actttcatta atcctttaaa gttactgcaa aaaaccttgt ctggccagtg tgttcctttt ggagcagt gt gacctcacca cccgtgaacc agcattataa ttaaagtaaa taccttattc aatggcaatg ggattttctg acagatataa caatcttcca acgagtttct tgtggtatat tgtagactta tttctctgtg tttatttgct gcactgcttc ttttctaaag tcattataac gaatgaacag gctggaaaaa gagtaagttc caactgattt caaacccaag aaatgaattt act tcat tt c accttcattg caaaatgtcc tctgagccag agctccccag agtctgtgct tcatttattc cccaagtcac tcctccaggc aaacgtatgt ttcatccttt tggataggtg aaatctctca ttgtttgttt atttt tctt c atacagttga acaaaatgca aaccatgccc gatgcaggga ccttcccatg taagttgcct aaaccagaga aaataaatga tgacactaga ataaattttt tgtttggaaa ttatccatta agagtcgtta aatatctctc tctcttgcgt gaataattgc gacacatttc aacaatttga attcaaatta atgaccattc ttgatctaaa tctgatgatt tttttttcct gcacaatgac aaatgccaag ata cgt t tgt gccattttgt act cccacgt gattaaactt tgggaattat caaagtgatt ataatgagaa ggcctgtgat tgtttgttac gcaacaagac ccaggtcatt aaatcactgt aaaagttatt tct act gcct cccttcttat aggtgtcacc ggatcaatat ttctctgaat atcatggatc agtgacattg cattaatttt ttcaccttca gatgggaaga agagaaggcc cagttgtcac tctacttaac ggattattaa taactaatac taaaaaaact ttaaccaaac ttttaaagtg actattaaca atcagatagc tcaatcatct ctcatgtcta taaaaactga acaacaatgg tgctgggtaa tcctccaccc accacttaag aaactttcct gtagaagttt atccgaaatg catgcagcac gcaaaacaaa acttgctaaa actgttggtt tcaaaaagtc ataaataatc gatagaagct gatacttgtt aagtctgtgt ttagcatccc ctccaaagtc cgtagtggcc atatgtcatc ttggcttcac attctaggtg gtcttcaggg tttaaccagg aattacttga gtttttgtct tgatattatt gttgcaaatg tttttttaga tatcaaaggc gcactgtatc aggacaaagc aatccatccc caagcccagc agtcaatgtg aaaaatacac gcagtgactg tttttcatca acagatgcaa 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> 192 3001

DNA

Homo Sapiens allele 1501 9 9-2 6201-2 67 :polymorphic base C or G misc Tbinding 1502. .1520 99-26201-267.misl, complement misc-binding W0005851 0 [htt:/twww.gethe atentcom[Loq in.dog/Sexa m. support/Fetch/Default.doMJO005851 0.cpc?fromCache= 1 part= ma intaooba r--boto m Page 686 of 737 WO 00/58510 PCT/EBOO/00435 <222> 1481. .1500 <223> 99-26201-267.mis2, <220> <221> <222> <22 3> <220> <221> <222> <223> <220> <221> <222> <223> primer bind 1749. .1767 upstream amplification primer, complement primer bind 1304. .1324 downstream amplification primer misc Tbinding 1489. .1513 99-26201-267 probe <400> 192 tttcaaaatt acatttgata aaaatgttat atgattttat ccagagaaaa atatgtgtat tatagtatat tatagtatat tgcacacaca gtggctggca aggtgttgct tgtcagtctt ataaactgtt ttactgcaac acacagaaaa cagtttttgc ccttttgcaa caaatgccca tctgactatt aatctttaat tctagtctct ttctgctcta gaccagagac catagagaaa atctctccag saaagcataa gaaaatcagt ttttaaaata aataaaaata atagtaaagc gacaataaaa agaaatttta aaatatatct ttaatacata tttagttatt caaaggaaga aaaaaaaggt ataaaattga aaggtacaca tccaaaatct cactagccct attaggctga taacctacca atggtctgaa ggggaggcat ggacaatcaa gaaaacagca ggattccaaa agaaccagt a atatattata acatactata ataatatata cacacacaaa agtctaaaat gtgtgagttc tcgccttagg tatttaaagt attcagttgt ctagccacca ttttaaagat tagaaagata aaagataaaa ctcaggatat cgaaaaggga agaaggaaaa gacagtagtg ttacctttgg t tagcataaa cgataggtcc gcctccatcc gaaaaataaa ttaaatataa tgttattaat cactaagaga cttgttaagt accaccttct tatataattg tttatttaaa catataaggt aatgaactta agacagaaag aaaatacaga taagattcat gacaaggaca atatataata attaaatcac cattaagtaa agtttgtaat gtttcaaaat ctgtgcaatt gagttaggaa gaggaaagct gcattaatgg tatacgtata tataatacac gt gttat at a cggagagagg ttgcgaagta aagggcagt c acttcagctg ctactgattt gt ttat ccaa cgggcactgt gagtatgaac caaactccaa atggaaaaga ttgaagaatc gactgaactg tctgccaact aaaatgacat aacagtaatt atgtataaca tcagtacagg aatactacaa aataaagttt aagtaagtgt aaaaaatata aattctggga cagaaaatgt ctaactataa aaattttaaa aatattttgt gctacagaga tgttttaggt aaataat aaa cggtcccttg cacactcatg gaacaagaaa ttatcaagcc t ggagagtga ttcacataag cccttgaaat tggggaggct ttatgaactg gggcat aagt gaatgcatag atagatagat caatacatag tatatattac tatgatatat ttattttaag gaccagcagg tggaggcaga attggatgaa aagtgttaat atatttgtat attggaaaac agtagatgga taaaacacct agctacaaaa aaaggttctg gtcactagat agacagggag aaaataaagt cacatcatct tatgatatcc gtagagagaa atacatgagg ggccctcatt gcctaaaata agacaatgta ggcaaaaaaa ttgtgaaggt tgatattatt tacataccat attgaacaaa tcaaaatttc taagaagttc gatgtgtcaa accattgaag tctcatttta gaaaaattat aatcttgaat ggatggctga aaaataaaag tcatattttg gaattaaaag agaaagtgta tctttttata.

tggagcagta acagtatata.

tatatataat tatatatagt actatatata gaat tggtt t atggcaatcc attccctctt gcccattcat ctcggggaaa atggtggcct ttgagagaaa.

aggagaatca gaagtaacat agagtatttg gaataaggaa tttatggtgt aaggcaaggg aactctctca gagtagttca ctgacataaa atctcaagga gggaaatacc aaaattagaa aatcaatata gacaaacact aaaatattct atattgttta acaagcagta gatgggtcaa aattatattg taggaaaaat tcacagagaa.

aattaataat aaatgaaaac tgggctaaaa act cctatct tatatgttag cccttagaaa attatcttta aaatcctaac aactgggcta ctgacacaag ctcagaatct ttagggttct tataaaatat atatagtata atatattata tcatatatag atgtggttgt aggggagatt ccttggggga gct ttggagg aaaaaaaggt agccaagt tg a ca gtag tca gccaagtaag aaaaataagg gttggcattc tagagaaaaa aaaataatat aatttgtctg aaaaatgtat ggaagtttta ttaacacagc taaaaactca cactctcaga aaggagggtt taaatgttgg taataagata cacatattaa ggagcaaaac agatataact tgaagatatt aaaagtttag gcttataatc cagattcact attaatataa ttaactgaaa gtttcttcat cattaagagt aaaacatatg tccatgaaag aaatgctgct ctacaaggtg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 W0005851 0 htt Wlwww.getthe pa tent. com/Login.dog/$exa m. supportfietch/Defa uIt.dog/WO005 5 10 0Cpc?fromCa che= 1 part= m aintool ba r--bofto m Page 687 of 737 WO 00/58510 PCT/EBOO/00435 atggtgtaag atgggcatag tgcacacagc cagcttgatc aagccaagca aaaagatctg g gaggtggaag tacccttata aaaatggcac ttgaactttc ggttatggta atgaaatgtc atttgggagg aaagaggtcc catttgtgaa caggctccaa ttttgttata ctcactcatt tgattagttc cagagatctt ccaggaaatg aactgtgaga gcagcttgaa cacataaaaa ataaggatag cct cacatct ggccctcacc aacaaatttc cagact aaga aaactacttt agccctcatg cccaccagag aggcacaatg tgctgttaat cagatgcaaa cagaaaataa 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 193 3001

DNA

Homo Sapiens allele 1501 99-26222-14 9 :polymorphic base A or G misc binding 1481. .1500 99-26222-14 9.misl, misc Tbinding 1502. .1520 99-26222-149.mis2, complement primer Ibind 1354. .1373 upstream amplification primer primer -bind 1843. .1863 downstream amplification primer, complement misc binding 1489. .1513 99-26222-149 probe misc feature 2564 n=a, g, c or t <400> 193 cttctaggct catctgagtt tcaatggaca tgaaataatg gggactggca gt gat at t ta tagaaaagga ttggcgtaaa gtttacagat acataaagag acaaatgagg actgcctatt cacctttttt ctgacagctc tcagactctg gtcctatcag acaagcccaa ttcaagagaa tttctccatc tggagcagac agagacattg tgggattagt tgacttaaac tgaactaagg aacaaatact aagtcagaac tttccctcta ttgcctcagt cccaaagtac taaagtgagg ttcaaacttg tacctggaga tcagctctgt ctctggatct ttctctaagt tacacatccc tatagccacc aactatctac tgacaataaa ctcatatatt gccattgctg tcagggactg aagtcttaga acaactgtat cacaagaaca aacttgaccc tcacatctat ccaggatgac gtatcaatac tgcaccaatc ttcaacaata tttaaaaaaa gttgcaaatg ctgtcatact gctggggcaa cagtagataa cagaccaagt taccctttag ttctcaagaa ggatctggtt ggggaattca ttgtgtcttg aggaactttc cttgtcagca gtgagcccca ccttaatgta atcctcaccc tcaagcccaa aagttttggg gtggatccca cccttggctg gtagactggg tggttgagtt actctttatt aaatagggca ttaccatgaa tccggtatca gaaaataaaa ctcttggctt accctctccc ccaggatgca aaggcactgt gctatgtgtc attccaatcc W0005851 0. fhvww.getthepatent.comLogi.dog/Sexam.support/Fetch/Default.doqNVO005851 0.cpc-,frqmCache= 1 part~maintooIbar-botom Page 688 of 737 WO 00/58510 PCTIBOO/00435 tgcttaggag tgctaattct tttatttatt gcacgatctc cctcccaagt atttttagta gtgatccacc ggccagtcac ggtcactttt ccctaatgag ctaacttcca rcacaatgcc tccatattgg tgcaagagag tcctgctttg ttcacagttt cttctgtttc caaattaaaa gcaggttccc ccaaaaagcc catataaggt tgtctacata tataggatta taagctgtga caatatttac cttccgctct agctgaggag gagcagggtt gctatgaagc ccagctaggt cctttgcttg a gaat at gga aacacaaatt cttatgtttg tcatcagata taaaaaagaa aagaatcact ttccaggtcc attttttttg ggctcactgc agctggaact gagatggggt cgcctcagct att t ttagcc ttttgagtcg cacgctggct tttcccttct ctccccgtgt aagatataca tcaacaatgg tgtctccgat gatatttagt cagtgaaagc ttctggctga ttgctcaaaa cttctagtgC aatatgaata ccatgtcatt taagcatatt atgtgattag cttttcactt t t ttgt gagc ttctgtctag gcgggcaata cgaggaaagg gggagcacat tgtggttgtt tgcttccaca taggatgatt ttgcagcact atggataaag tgagattcag gcccatgtgc acttcagcct agatggagtc aacctccact acaggcgtgc ttcaccatgt ctcaaagtgt ttgtgtcctg ttaatagcaa cagaagtcca tttaccccat ctgtttccca agagcccacc ctgtggtcag ggacaacttg tgcacaaaaa atgcagatgc tccagttaca aaaattcata ccaagcacag cattgaggca gctcaggaag ataaatgtgc t tta gt tt ta tttgtgtagt ctact atgt g tcatgtttta gagaagggga gaacaagtca gtaatttgaa tgcttgcttg cattcatgta ttatgaggca gtttacaata aaaatatgat tcatttgcaa aagagctgta tttggccagt ttgttctgtC tcccaggctc ggcagcat ca tggccaggat tgggattaca ct caa tga tt gatggtaacg gggactcctc ttatgttatt aacagctcac caatcatttc tgatggatgg gaggtgtatt ataatcagcc tagtctctag tagtttgtgg atttaaagac gt caccccct tatagacttt cagtaaactg ttcataggga ttaaaatata aaggtaaggg acacttcttt ttttgccttt ggttagcaga gcaatgaagc acacttggca tcattgctca tttgatctac tctagggtat gctaagattt tcatatacac catggttgga gttagctggc cactttttaa acccaggctg aagcaattct cgtccagtta ggtctcgatc ggcatgagc gggcaaggta taacaaccta agtctgacag ccttaacaaa cttgaacaga agtaagtgca aagttgttaa ccacatgggt tactctttct ctcagctctt ggccaatggc agcaacagca gtgaagctag tgatctgtat gggaaatact atctatcttc ttggaatatt gaatactttt gtagctgaaa ggaaattggg aaggtaaact tgantcctga tacttaagct acttctatgt tttggaaggt atcaatgaga ggaagcaacc aatggagtag actggagagc agactccatc tttaatttta gagtgcagtg cctgcctcag atttttttgt tcttgaccac actgcgccct gtgctgtcca gtcatttctg cctgtcttgg tccttcacat gattttctgc cacccggaaa aggcattctt tctcaaaggg ggtacttcaa ggaggagatc aaaataaaat tgccattaaa ccccaaacaa tttctctcga gacctaccct aaagtaaatt ggactatgta aggacaaatg cactgcaaga aggctggttg ctagatggct ctctgaggat ggatttaatg tgataagcag acagtgaaat tatctgccct taagtgtcca tattcagcca attatgttaa 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 194 3001

DNA

Homo Sapiens allele 1501 99-2 622 3-225 :polymorphic base G or T misc -binding 1481. .1500 99-26223-225 .misl, misc_binding 1502. .1520 99-26223-225 .mis2, complement primer -bind 1277 .1i297 upstream amplification primer W0005851 0 http:/&vww. qetthe patent. comlLoginadog/Sexa m.su pport/FetchlDefa ult.d og/W005851 0 -ci~c?fro mCach e= 1 part=maintoolbar--bottoml Page 689 of 737 WO 00/58510 388 <220> <221> primer bind <222> 1842. .1862 <223> downstream amplification primer, complement PCTAJB00100435 <220> <221> <222> <223> misc_binding 1489. .1513 99-26223-225 probe <400> 194 cacatttttg catgtgtgtg actatatctc tacaataagt agtttgagaa ctgaaaaata agctggcatt ccaaaatacc gaacaagtgc agagatgtct aatctgaagt gatggcaaca ggaattacag tgttttgcat ctctcacttg aaaacattcc acagagagag cctgcaaaaa attaatctga aatgttctac agacaatgat gagctaagaa gttcaggt ta gcagtggaga agcaaaacaa kgggcttcca tttggtgttg aaacactgac agaggcctgc ccacaggtag aaaggaagtt gatattacaa agaataatgg tggcggcata gcacctagct cagcagacac tatctattgg gcatcatgca agtagaaaat atggtggctc ggacaggagt catgctgtcg atcacttgaa catgggtgac actttatata ctgtcagaaa atgaataatt tttcatttaa aattttaaac acgatttgaa t tagcatcttt tgtgtacacg tggcttggtc attcaaatta tttagaaaaa tagaaattag ttccccttct aggttttatt gtaatattcc tcagagaaag gcaaaatcca gccgttaaaa agaaaaattc tgaaaataac gttagaaaaa aggcaatcaa aqagtgagag ctcacctgca acttaactgc tccaataaga atacagtctt tctggagagg gtgacctgca atcagagctt aacaaaaaac acacctggcc tacaccctgc tggagatttt agaatatgta atagtatgag aaaagttgca aaaacatata cctctcgctg gtactccatg ctcactgagt tatgaactac ctactatgct atacatctat ttttaacaaa atgcctgtaa tcaagaccag tcatggtgca ccgaggaagt agagtgagac tatatatata ggaaaaattt ttatgctaaa aatgtcacaa caaaaagcca atagtgaaac tctgtgtgia cgtgtttaat ccacatattt aaatgtagca tattttacag tagagtggta gttcccagaa tt ttgaa tga agaatgagtg actcaaatag aaccatgtat tcctgtttag atattcacga aacagaaatt agcaaagaaa gaacacttcc acagaaatgt taaagttaag ctttggattc gactgggaca tgaaatgcag t gaaga at gt gaacttttcc acagccattt aaacaacaac ggtttaactc cctatgggca ctgcactctg agattctctc atcaacctca taatcttggt catgtggtaa cat cca tgt t atgtatgtgt ggaagtt aaa tagaggaggg cactgcctgg gtaataaacc gttaagcatt tcccagcact ccttgccaaa tgcctgtaat ggaggtttca tccgtcaaaa taaaatatat tattatagac aagtgacaat aaacaaacag gttgcacaaa tcatggaaat tgtgtgtgtg ttctattcat caatctttag tatgggtaaa agccatcccc cttgctaatt attattgaaa aactaggaga aagagtccag tagtcatcaa ttacaacaga tttcagaaag atatattcta gtaaaataaa tgcaaattta ctgcctctac gaggagaaga aaaacaaaac caagcacaat tctgcctaaa caaaaaactt tgttaagaat cagggacggt agaaaagcaa aacaaaaaac tgggacactg ggtactaacc gggaggcaat agataaaagt ctccacatac gaaaggcttt ttgtttctct tcagcaaagg gccacttttt cattgagtat aaggagacag atgacaggat tgcaaatgta atgaatatat ttgggaggct aagacaaaat cccatctact gtgagccgag caaaaacaaa aaggatagat actttagtca ttgaacttga agagtatgat aacagaccct agaatgtgga tgtgtgcgcg gggaattatc ctgttatgta caggtgtaat tgcatattgt ttctctttga agcaacaagg aaattagagc agaaccttgt aaaagatcca gagaaaggac agactttgca tctctatgga aacgattcat ctcctaaact ttccagagac aacatgtaga aaggaaatta acagtagctg aaaactggaa catagacaag ctggagaggc tttatcatgg acgaacaaac agaactttgc accaaacccc aaaaaagcag ggttggaagt cctggagggt ccctccaaaa acacaacttt gtttctgcat acatgatttc ctttaattca acatgtgcat ggggtcatga catccatatg ccccctgaat gtaaagactt gaggcgggtg cccaactcta caggaggctg gtcatgccac aacaaacaaa agaaaaaata ttaaaatgat ccaatttctc gacttctaaa gtatgacttg agggtagttg cgtgagtgtg aatttctttt aataagatac attttaacag ataatttacc agatgtataa agaactacaa ctccatctaa ggaaggtatc gtcaaataca tagatgaact tatccaatta gggggagaaa acagatgtca ttgaaccata agaaggagag tacacctaat cctattaatc at tggagcct aagatagaat ggaagtagag gaagaatgtt gagagaggat aacaacaata cagagacctg agaaggacag aaagcttttg gcctgaggta tagggacaaa gaaagtgaaa cacacacgtc taatttgatt atgcttttta ctgttaatgg cagatagcac tctgaaaaac ccaaacctta ctaaaataaa gaggccgggc gatcactcaa ctaaaaccta aggcagaaga tgcactccag caaacaaaag gaaataaaat aaaaaatatt aaaatataac tgtactttaa atttatatga ccagaggccg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 W0005851 0 [httpo/AiwwA.getthepatentcom[Login.dog/Sexam.suppoort/Fetch/Default.doqNVOO05851 0.Cpc?fromCachie=1 part=maintoolbar--bottom] Page 690 of 737 WO 00/58510 PCT/IBOO/00435 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 195 3001

DNA

Homo Sapiens allele 1501 99-26225-148 :polymorphic base G or T misc -binding 1481. .1500 99-26225-148 .misl, misc binding 1502. .1520 99-26225-148 .mis2, complement primer bind 1355. .1375 upstream amplification primer primer Ibind 1805. .1825 downstream amplification primer, complement misc_binding 1489. .1513 99-26225-148 probe misc feature 37,514,2455 n~a, g, c or t <400> 195 gagaatcaat aggcttaaaa atggctcaag cagtctaact tcttcttttt agatgttctg tacctgatca ttgcaaatat tactaacatt aaagcattga attacaagtg tatgcaacct aggttttcaa tctatagtat attaaaaaaa aatgtgcatt tagaaaacaa aattaatctt aattttaaaa gttggagaca tgtgtgtatg aggaagagat atgagaataa tacagcataa ca at gtgt ta tctatctaca tttccaataa attagttaca caagtgagat ttcaaatata tctcaggaga tttatggatt atggagtgat aagtgttatt gataattagt ataagccctt gaattttatt ttgccaattt catagggttg tgcctgctct tctttattta cagaatctcc catgcaaatg acattttatg acaatacctc tttttttttc tataaccttg ggcaaaatca aataaacttt atggcatttg a tt tggt aat catcggataa aatgtgt gca taaaaagttt ggattaaaaa ttgttttatt attattgatt cctcacaaac ggtttatctc tttaaatctc tttgtgtcat attcagatat ccaataacat actacagcca agctcatgtg aaaacaaatc taatccnttt tcatttattt gaaacagatt.

tcactaactc agaagttctt ccaacataat ctaaatgttg ggtaaaggta tacnctttta gtatatttca ctgtttttat atgtgagtgt atttcaaaat gtaaagaata tgctgaaatt aatttttgct agttgttgtt aataaattct cttgctatga attattgcct agtgtacatg tataggttta tgcaatcact tcctccttaa ttttttaaaa ttcctacagt t taat gtat g ttgccaaatt agaatgggaa attgtaaaca t ca ggt at ga tgaattctac ttattggcag aatacacgaa atgtaatatg agtatataat cttggaattc tttttattga gggaattatt ggagaattta catgactaaa ctaagatttt tttaggggaa gtgggtatat ctatcatttt taaaatcttg aagctatcct tttttactat cttctatttc gaaaaacaga aactttgtta acttacataa ggtgtagagc tttttatcaa tacaggtgtt aatatgggat attaacaata tttatttgac ttgtaaataa ttattgattt aattggattt agttaacact gagaaaattt aagtgtgagg ggagcaagac ggttcagcga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 W00058510 p lwww. etthepa tent. com/og in og/Sexa m. suportFetch/Defa utd ogNO0058510 .CPC?rOmC ache= 1~r~ano~a~otm e61o 3 WO 00/58510 PCTIIBOO/00435 gtttctattt t gt ttgct ga ctgaaataat katctgaatt tacatttgta aagtcctcta ttgtagttag attacaaata gaatcattta gtaatttgaa cttacccatt aaacggcaaa ctctgtttct ttttccaaaa attacagtga agatcattaa aaatacagtt attgattaaa gaagcaatgt ggagtctcgc tccacttggg agtgccacca agtcaggatg tgggattaca attcatcaaa taatcctaga atacactatc tgaatttttt t ttactgtaaa ttctaggaca ttaaatttat cttgtgtttg atagttgaaa attgtgatgc tagggctaaa atattttgtc tagtttatca gtagtttcca tttattaatg catcgtattt cttttatttt atagaattgt atctttttaa acaaaaaacc tttggaaaca tatcacaaaa cagtaatagg tttgtcgccc ttcaagggat cgcccggct a gtctcgctct ggcatgagcc aaattgcaaa aaagatacca tttcgtaaaa attataaggt ttgtggaaag gaacctctaa tattgtcaat cttatatttc cagagcacaa tacaaaagaa tgaaagaaac aaaattacta gtatgaagtg ggcagtcaat tcattaatta aatttgtgtc ctgatctgca ttatttttgg gaaattataa aaaataaaaa caataataca cgataacaaa gataagttaa caataaattt aggctggagt tctcctgtct attttttgtg cctgtccttg accacgcaca tacattttaa acatttttac cctcacatta aaataatatt cacgcactca tctttgatga catatagcag gttggccaag ttttctaaac aattaccttt tgatcaaagt taataaaaac tttattgtgc aactttctta cctgtatatg aagcagggaa gattcatgta aaaaaattaa aagtcacatt gtaactgaaa acgttatttc ctttttcttt gcactggtgt cagcctccca tttttagtaa tgattcgccc gcttaggtaa agtacatctt agtaaggcat aatttaatat ct tga ctt ct tatcaataaa caggagaatt gaatcataca aactattaaa atatccccaa tatcaaaaat ttcttatctc a tat gta act atgctatttt gttttctctt aaaagaaccc ttctttgata gaggttattt actctaaaaa acaagcattg ggcatgccca taaactaatt aaattaaggt tttttttttt gatctcgact agtagctggg agacagggtt gcgtcgaact taaatttcaa atcatgtaag atccatgtgt aaccaaattc ctaatataaa gcctcaaaca ttccatctac aaatggaatt aaaaatcaag atatgctaaa gaaatgcaaa tacaaaaaac aaaaactaag tctagatttt tctgatcatg caaaatgcat ttatctcttt tgatgatttc atttcagctt acatcattaa aaaaagaata taaaacaata tttatgaaaa ttttngagac cactgcaacc actacaggca tcaccgtgtt cccaaagtcc gtaaaattca gataaaaaca gtataatagc tcatgcattt ttcattaaat 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> 196 3001

DNA

Homo Sapiens allele 1501 9 9-2 6228-172 :polymorphic base G or C misc_binding 1482. .1500 99-26228-172 .misl misc_binding 1502. .1521 99-26228-172 .mis 2, complement primer bind 1330.-1350 upstream amplification primer primer bind 1792. .1812 downstream amplification primer, complement misc Tbinding 1489. .1513 W0005851 0 [Iqttp-llwww.getthepatent.com/Login.dog/Sexam.supportFetchDefaut.doNVO00585 1 0.pc?troMCaChie= 1part=maintoolbar--bottoml.Page 692 of 737 WO 00/58510 PCTIIBOO/00435 <223> 99-26228-172 probe <400> 196 atcgttgttc taactattat ccttcaataa gctgtctaat ttttcttcta tgtcaggatt taggttttgt gacatgacga ggtaaaaaac acgaaaagaa ttaaatttac tagacatcag tccttctttt tttctgattc tcataataat taaggatcca attagatgaa aaataaaaat ttaaaattgt aa tct at tat tccactcaaa tataaacttg attgcactag tacactttta ctattcaaaa sctactactt atatgtgcac accatggaga tattcttcaa aaatatgaaa attaacacac aaactttcat tatccctgca aattttagtt gggaactgat aaattgttta tat taatcta tcttttcagg cagtgttcac agaaaaaata gaaacaaggc ttatgatata aatatatcca atatgtgtac tgtaacagct taattaaaac tagtttcatt acctgaagct ttggtctggg gagacaaata g ataggcaggc actcaattgc ttttttttaa tttaacatgg agcaagctaa.

aggttttcac ttgaggctct ggcatttact agtgtatttt atggaatctt tctcttttta aattggatgt ctatataata cgtttggcag caattttagc tagagcacag tctgatctct tacgtgacag ctacaactga agattttttt aatacaggcc acatcttctt gt tat t tcag tcctggcgta ctttcttcca ttctatgaac acctatgcac agtcccactt tgattggaat tgttttgctt taatatgagt gataacaaag aatgtgctaa gcaagcaatt agactttatc acatagtttc gcttattttt attcagtcat ctctgacact tatttgttat taggcacatg tgaatagttt acctaaactc tcacctattt tagatattct acattagcaa acaacatata ctaaaactgc taacaacttt tcttttaaga tgaaacacac ttcatggaat taagtacttg ctgattttag attgctttgg atttcaggat gtcacaaata tccaaatctg tgaaaaataa aaaagatggg tggtttgagt aatgcctatt aaagggttga tgattacttt aatagacata aaattcaaca atgtgattta tgctatattc ctaacttttg atccacctac atactttctg acattgttag aaatgtggca gtgacctaac aatagcctta cataagctgt cccaggtttt agt t tgct aa tctttaaatg tggcttttca ttttatgaaa cacttgaatg tacttaacgt tttttcagcc ttccacagag attacatttg tgcaatattc aacattcaac attttttctc ggtgggtgga tgctatccat ttattcttgt actttttagc aacagtaaca ctaacattcc caataaccaa t ga aaga aa a ttggttatga acataaagat cttttcctcc tcaaaaactt gtaaagttca aataggagat ggatattgga tcacagaaag taatagcagt tcaacattat cctttgatag agtatataca aaagatattc ttgctaatgt tttcgataag ttatgtctaa atcatcattg agtgggaaag tgcacaaagg cataaaaaca ttttgacatt agtgctaagt aacttctatg tctgacataa taatttttag caaaatagta caatctgttt ggatcctttg acatctccaa aaattaaaag tgcacctttt aagtatttat attttttaga aaatgaaccc cgttaatcac gatgtagaca taattgatta aaacaacaat tttctgtatt agaacgagcc tctctctgtc taaatatcac cattcacatt tggaattaaa caaagaaaaa tttatactca ttaatctggg ctcaaaatgg ctaagggaaa atccaaaagc caaccatcat cttgatctat caatgatttt atacctttcc gttaacacca acactttctt gccttggttt tataagtaaa attttgttat ataacttaat atattactct tatttgtgtg gtttaattac tattttatta acaattgttc tgtcatttgg tattatatca atttgggaga tgttatttgt caattttgaa tactatttag gttcagtgga tataggaagt gttcaagagc tgtattaaaa gccttgcata tgtgaagaag ccccagagtt tgaaatacgc aaattttatc tgtctaaaac tttttaaatg aggtttgcat tagtcttttc ttaaattaat gtacaataag atctgaaaga tcttactctt cctgtcaaga atgattctag tcttcaagta tattgatagt ttatcacaat tcaccccaaa gtaatcacgt tatgcaggtt attaataact aactccatga acaggcaaca ggaaatttaa agttagcatt tttctactgg ccttataagt t a aata cat t aatcaccctt gtggttgaat ttgatatcca gaagagaata gtccttgagt aacgtttctt ttttcctctc ataaatggtt ttaatattat aagtgtcaat tgtataaaca aataaactgc taacaaattt ggtatttttt gctattcatt tacaatgcct aaaaagaagc atttttgtgc tgttttactc gcatgtataa aaacacatac acacctgtcc caaagccagc aattgcaaat tcttggatgt atggtttctc aaacgttaga tttggttcta ctaaggaaag taatacatgt aaattattat cttgcccata aaatgaaata aattaatcaa caaacaaata gtgagattaa tgcatgaaga ttccaatctt tttacaataa aagagcattc aaaagccaca ttaatagaat catcataaca aaatgaaaag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 ggattagata aaactaaaaa gcttctgtag agcaaaggaa acaataaaca <210> <211> <212> <213> 197 3001

DNA

Homo Sapiens <220> <221> allele <222> 1501 W0005851 0 [httpJtwww.qethepatent.com/Login.dog/SexamsuporFetch/efaut.dogM0005851 0.cpc?fromCache=l1part=maintoolbar--bottomI Page 693 of 737 WO 00/58510 392 <223> 99-26233-275 :polymorphic base T or C PCTJIBOOIOO435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc -binding 1502. .1521 99-26233-275.misl, misc binding 1482. .1500 99-26233-275 .mis2 complement primer -bind 1755. .1775 upstream amplification primer, complement primer Ibind 1254. .1274 downstream amplification primer misc binding 1489. .1513 99-2 623 3-275 probe misc feature 116 n=a, g, c or t <400> 197 gcagaagact cattccagcc aaaaaaaaga aaacagctat cagaattgtt ataaccaaaa taacattttc t tt gaat at g taataaaata aaacagtatt ttaggcaata gtatgtttct ttcagtaaat cactaaaaat actatttgta tagaaatatc ttatttgtat ttaagaatgt taaaattgat ggacaccagt gataacctaa tgactaagaa aggtagtgac acaaacattt aaaatcagt t ygctttggtt gctctaggta aatcattttc ttacattatt acaaattaag agccggaacc tggcgacaga aatacttatc ccagcagtta gaaaattcta atattcaatg ttatcatgat atgttttatg ataaaactaa tttttggttt ttataaggca ttgaaaataa aatgacaaat atttttgata acatatatta aagattctta agtcttagag aagaaaataa tagaacatta ggaacaataa aatataacaa gtcctgcagt aagcagct ct ttccagcagc tataattcca ttgtagtgat gaacataaaa tcttagttat atgtgtttaa aaagcagttg cggaaggtgg gtgagactgt ttctttttct atacactaaa cattgttttg aaaatatata aaaataaaaa tacattt tat gctcaatttt caaagaaaat cttcctggat tatatgtttg gagctcataa gataatatca ctagt agcag tgacttaaaa gaaagttgat attgtgccga gaatttctgg ccatgtgaag cagggaggga tctgacaatg gcaaaaccat aagcatctcc aaggcagaaa gcggtaaggg cagttctttt attttatatt atatcaccca cttttcttag aagttgcagt gtctcaaaaa ttaatgttca caaaaccaat actggcccta atattctaaa tctagaacaa acatatattt tagat tatgt cttttatata caggttatac aaaataattt tttaataaaa gacacagata cagtgagagg tt taataagt cgaccagaat atattgtaat atcaaatgtg at tt tgga ga tgttacttac agtttgacta tagtttttgt attcctttgt ctatttcatt cagataatgc tacatgatct aacttttatt tcatttctgt gaatctttat ga gccgaga t aaaaaaaaaa aattagctga ttaaataata gagaaaaatc ttgaaattgc ggaaatcata agactgtaaa atccactttg aaaattgaag caaaacacac atggaaatta tgaagcaaca tcagtacact tagagagtag caaaaagaac gaaaactatt ttaagagcaa gactgtcata ctcctgtctc aagacgtagt atggtaagag ttgttatatt atttctttta catatcctga atctgcaaaa acactattta aaatcaattt aaaattgaaa actgaaaaat cgt gccat tg aaaaanttaa agcaaaaatt gttatcctgg tgattcaaaa ttaagttgtg attattttcc acaattagaa tcttttgtta aaaaaaatac ataccacaat tatctctgtt cacttaaaga ggaatgattg ataaacataa aaatggaatt cgtacagaaa gt at tt atac tattatcagt ctccaatcca aaaactcacc ctgtgtgaat tatcaaattg cct acctagc gctcttagca tgaatgagct attgggtcat agcataaatg caaagtagaa tccttaactt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 W0005851 0 fhttD:/twww.aetheroatentcom/Loain.doa/Sexam.suoortFetch/lDefault.dooNVO00585 1 .coc?fromCache= 1oart=maintoolbar--boftoml Paoe 694 of 737 WO 00/58510 PCTIiBOO/00435 gttccttctt cttcccttcc gtagaggtta ttggaagaga ttccctgggt gctaatgagt cctcaactag tttcaccaat ctgtggccct tgatgtatta actgctaaaa cattgttttt tattccagac cctacttgtc at tccagagc gagaaatgct attatgagtt aa cca att ct ttaatatatc cgattagatg t cccttgctcc tcctctcttc ggagaacaag tgtaagatac ctataaagac ttcacagaag aaaatccttg cacctttacc tacttaaaga catctatgtg atctaagaac cttcttataa atgagatcat tgaagcctgg ctct t taga C atggagagga ctatctctga tttacagact ttttattaaa aaatttcatg ctttcttttc cttccttctg acagaaatac aaatatgaat tcacacttcc acaaaattcc tagttctcat tccttcagtC ggaatggaca cctgttaata gcagtttgaa ttcgtattat tatacctctg aacaagggga agaaaattct tattatcttt gttcatctgg atcctttaca gcacatatac ttactgacat tccctttctt gacaaatatg aacactagtg attatgtaag tgattttcct tacatcaaaa gcaacccaat cccaggctcc ccgatacata attaaataaa attaaatact gtgggttaag gatttctata taccttcact gaattgatac attacatagt t ggtcagaaa ttttggtatt ttacagaata gaagaccaac tcatcttcct tagtttactt ctcatttagc ataatttgag ttgtttacct taaaatttcc attctgagcc caggaccctt tgtccagcag tactttaaaa attaatattt ctagcaattg aaagt tgttc caacaaaaga cttgccatga acacatttac tttgaccatt tatttcacgg ctgcccatga aagaatatta tccttcctag gatcttgttt tttaatcatt tgctatgatt aaatctagta ct ttaaa t ta t gt tcccc ca t taagaaagc aaactggaag aggtattgca actttgaagt acttttggag accactacaa aaataccagt atttggttga tcttctatgt tcactgtatt ctttttaatt gatgcatgta cagggttgcc 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 198 3001

DNA

Homo Sapiens allele 1501 99-26234-336 polymorphic base C or G misc_binding 1502.-1520 99-26234-336.misl, misc -binding 1481.-1500 99-26234-336.mis2, complement primer Tbind 1813. .1833 upstream amplification primer, complement primer Ibind 1379. .1399 downstream amplification primer misc_binding 1489. .1513 99-26234-336 probe <400> 198 tttcaaatat gtcctcatat gatcaccata tggtcaccag tgaccaaatc atttcttCta tactttttat atttgcttct tcatctcttt gtctactatt tattgcctcg gttctaatct gtttctacta ctgatggcct atttcaggtc tgtatcaact tattctttga aaaattttga aataactgtt tatactgaat aaattgccta tgaggatggt agtgcagatg aataaataag aagagagttt gtaggcagaa gatgcaaaca ggacatataa tctatgctcc agaaatggtt W00058510 [ttD:Mwwgtt aen m1oin.dog/Sexam.support/Fetci,/Default.dogAIW0005851 0.cpc?fromC ache= 1 part~maintoolbar-boto Page 695 of 737 WO 00/58510 PCT/IBOO/00435 gttttatcct tttaatatag tagtttgaat aaatcaataa tgagaatgga agcagcatta agtattattt attacatgta aagttaattt caaaaatgtg catttagttg aagtacttct taataccata tttctttttc aattattatt aagtgcattt ggaactggcc tagggagtcc gtggtaaaca tcactaaaca sagtccatgt ccagtagtta tttaaccata cagggacatt taaaccagga tcagaaaaga tttatccaca ccctatcagt gctcctttta attttggaca tttccttctt acatgtagag taaaccagtc aaatatataa tacttataac attggcaaga agtaacacta ccaaaattct atgctgcctt ataatttata acatatctga gtggttgggg tggatggcag cagatctcat attca at ta c c ccatttatac aagacataaa taaatcaata gatattgatg ggttggctaa tttctatgtg agcattatat tatcatatat tataggtaaa aaattgcatt atgagtgtta ttgaactata acgatttgtt agtttacttt cattttaagg tgttgttgtt ctattatttg tataattacc ttaggcagga cactgcaggc ttttgggtaa tgccattaat accctgttgt tgtgaaagtg ctttcccaag agcaaaattg tttttctttt acagaatgtt atttctagtt tcttgtaaga tgcagaaaat cttcaagcta atattctaat actatgttct atcctagagt tatatttata agttattatt gagatgggtt taaaaatgtc taataacatt gattgggcaa aagcctcaca caggcaaaag gagacttatt ctcccactgg ttcaaatttc cattatattt ttgtttgtta taactaaatc gcagtaacca ttttctttat agtaaatcat ttgatactat taaaaatgca attggagaat ttaaagtttt aggtatacat tagaattatg aatcatttaa atgtttaaag attattgttc atgtttgttt atctcatcaa gccccaaatt aaaaggctaa ttttattaaa tagttttaag attggttata aaaatagttg ctaaccagaa ttgataactc tgtaagatgt ttagttatcc ttgcaaaaac tatcttctta aataatagat ctttcatact ttatgtctac at at tggtt c attcagtaag taacttaaac ttattattac cttgctgagc agttgtgaca tatagatttg tttacaaaag atcatggtga agagagcttg cactctcatg gtcccttcca aagaacagct gttaagcaac ttctttatcc ttcttcagta gagatatgaa taaactcaaa aaatatctgt aggtaacatt tatatgtaag caataaagac accatcataa tcaatatgtg tattattttg tgaacattgg caatgtttta caagacttta acgttagtat tcatgagttg tgatgcaggt gtgacaaaga tgcaaattca tttcagcttg agaagaatga ataatagtaa catacgatca tgctagtctc gttacaaaat aaaaaagata agctccaaca tctttatttg aataagttat tcaaagacat tagaaactaa aggtgaaaat taattgttga tcctaagttt ccatgagcta tacagataga tttttacaaa tagt tatcca aaagaggttt aaggcaagga tacaggaaaa agaataccat caacatgtgg atgaatgtgt aaggtcatgg taatcccaaa agatttatga atcttcattt cacttgcacc ataaaataaa ttgtctttca atgactgagt aataaatgga t ttat gt t tg ttttaatgaa ttagctgaat agttgcagaa gtattatctt ccatttgctt ttatttattt actatccttt gagtaattat aagacatgat gtgatttgca agccaaaaag acacataatt attggtggaa ttctagttat cttcagggtt cttttttcta aataatcacg tgttgcaaaa gctgtagaat tatcctaga gattcaagga caatatattt ttatacacta ataaataatt aaacattatt aaacataatt tgcttgtata taagaatata ttttcatgct aattggactt ggagcaagtc ctccttttta gagaaagacc gaattgtgag tctgcaatgg aagatttacc agaccataca gacactgata gagttttcaa aaaactatat atttgcagta cactaagcta atacataaag ctaagggaga gtctgtgaaa gttttatata ttcgttttac taaaaatgga ttgttaatca acaattagca tgaacaagat ggaaactctt actgtaatcg cgttgcctaa cacatctctt cactttatat taacttcaaa cctgtaattc aagatgtact ctattatttt gatttgatct tgctcctctg tgattcaaac gcattactat tagaaatcaa cggtttaaat agtattattt atattatgaa aaataattga tgaatctaaa tgttgcaaca ttaaaaagaa ttactcagac gct ga taaa g atagttccat atgtcttaca ttttaatcat tgcccccatg agatacaatt 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> 199 3001

DNA

Homo Sapiens allele 1501 99-26238-186 :polymorphic base T or A misc Tbinding 1502. .1520 99-26238-186.misl, complement W0005851 0 [http:fww. etthepa tent. co mLgin.dog/$exa m. supprWetch/oefa ult.dogAoOO0585 1 0. epc?fro mCache= 1 part= ma intool ba r-botoml Page 69 6 of 7 37 WO 00/58510 PCTJIBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc -binding 1481.-.1500 99-26238-186 .mis2, primer bind 1668. .1686 upstream amplification primer, complement primer -bind 1235. .1255 downstream amplification primer misc binding 1489. .1513 99-26238-186 probe <400> 199 tttctcctta tttgatactt tttggttgat agtgatatac tttgcgatgt aaaattatta aattatcttg tattttctat gttacccctt aatatttaca tgcatcaact ctgaacaatc gatgaagctg tttattgaga aaaacagatg ttagataagg ataattttgc a ca aatat at atatattata gtgtatatat taagaaatca cttcggaagt tcaagaaggt ttttgggagg acacctgtat wtcatttgtg taaaggataa ttgagaaagg agatttgtgc tgtgtaatta gctttatttt attaaaatgt tgctgttgaa attcagggcc aggagaataa atgaaaaatg agagcagttt tgggaaaagg agtgctttgg agctatgatc aaacataaaa aatggaaggt ttaatggtaa acttcttcta aggaaaagtt tttgtaatga actcttggta tagcattgat ttgttctctt tctccccttt tttcctcatt ttctcccact taattcttga tttgtaaacc tgttgcatag gtagtggcac acctactgtg aattttgcca aggttacaga ttgtaaggcc atatatatta tatactgtat atatagagag cgtgatttga ttaaattctc agacttcaaa gaaaagttgg acataagtct tataagaagc gcqattggaa gaatccagca atgcttttgt tttcaagaca aatctttgat tgagagtata gaacctttga tagatgttgt catttcaaga tgaatttacc caatgaagta ggagttaaga gaggccgaag acaccactgc taaattaaaa aaacaaatgg aatactattt gtggatgaag ggtgttttga ttcaattgag catctcatca cattggactg tatattacta gcatccatca ctgactacgt tatttcgtca aatttcaatc ctaatgagaa caaaaagaga tatcattcat tgccagacca cacagagaag agtcatcaga caggcagata tatatatatg atatagattt agagcagtac actaggaagc aaattatctg gtattgaaac aaaacagagc agattttagc attcagttcc agttaaggta gataaattag gtcaaaccag t gaggccgct aaaagtaagg ccattgagat aacccattat tatagctttg aaaggcagct attggatctg atgggaagaa gatagtgagg caggaggatc actctattct agtaatagtg agttaatgct ttattaagtg acttcctata gtattatgta attgagcatc gagggtatat gaataatgcc aacattttga gcaaatctat gtattgattg gtcatttatt cacatatgac tgtacattgg att gt tga ca tcattaactt tgttatagga tctagcatag aacgagacta tttagtaagg agaaacatat atagcagtac aaagttggaa tattagctaa acagattgaa tgcgcaaggg ttattagaaa cacgatgagc tctaggagag ttggtgcact ggtaaaatag aagagattct ccatgtatat ttgctaaaga taactgagac tagaataaag tttaaattat ctctcaggtg gtgatgttga aagcccttct gcaggtgtgg acttgaatcc ggggaacaga agtactgatt gaatgattag aaagtgtaaa cgttccttgt aaaatgccac tggaaaaaga tatttcaatg taccaggatt agagtatact cctgcagcaa gaatgcctcc tatactagta tttacgatag gaccctcatt gcagatagag atttgctctt ttggggggta agtaagcaaa ttcaggacct gacagttaat atagtatata atgtatgtgt gcatggagat ga tggt ca ga tatagggtat ggtgaatgtt tccagttaga ctggggttgc aacgttgggt gtaaggttga aaaatgacat gaaatctaga tcatccactc aggaacaagg gccattagac tggttacctg aatacagtgg ttgctaatat attcaatgct ggaatgagtt tggctcacag agcagttcaa atgaggcctc catatgagtg gtggggtcta tagttgaatt ctttcatgac ttaatttggg ataacacaga tggtttacta tttccactgt gaaatcatgt gtattaccga ataagaaaca tggacttatg aaatcagaaa agtacaaact ttcaccatgt ttcagatata cccattaaat gaaaagaata agattttact attttaaaat gatatagcat gtgtttgtgt ttgagtaatc ttcagaatat aaaagaacag gcatttacta attctaataa aaactttgaa ggagtaaatt catt ggggca agaagtcgct gaaggctccg tctgtgtttt caaatgaaag ttactaacga gaatgagtct cctaaaaaca gtccaatgag gactttgaca taataaataa ctgtaatccc ggctgcagtg atctctagaa tttttgctac aagaaagtac aatgagtgaa 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 W0005851 0 [httpJtwwgetthep~atent.com/Login.dog/$exam.support/Fetch/DefauItdoqNVO00585 1 0cpc?fromCache= 1pDan=maintoolbar--bottom] Page 697 of 737 WO 00/58510 PCTIBOOIOO435 taagcactta aaagtatttt cagtaggtcc aagaccaaaa ctctcaatat tttaatcttc aagattataa taaaacaaaa ttgaaataat tacacgtgga aaagcatgtg ccgatctagt atagctgtac attctggagg a ttctttattc ttcaggttct catttacctt cacagagagt gccttctctg taagtatatg agaaaattgt taataatggg aataaattct tttctttctt ggctgattgg gctttcagaa tgatgcactc tgtaggaatg tgtcaaaggt cagttaattt t ggaaacctt gcatggagtg tttcttctgg atggtgtgac attatttcat tcaacagcat caatactata act t ttatta gccttatgtt t tt tgacagt cggcaaaggt gctgctcttc 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 200 548

DNA

Homo Sapiens allele 79 99-16106-48 polymorphic base G or T misc -binding 59. .78 99-16106-48 .misl, misc -binding 80. .99 99-16106-48 .mis2, complement primer -bind 32. upstream amplification primer primer bind 518. .535 downstream amplification primer, complement misc -binding 67..91 99-16106-48 probe <400> 200 gagagagaga taaaggtatg tgagagtaat aaggccactg acacatatgc tctcccagac atgcctcagt cagcctggaa ctcttatctc a cat tcaa gaagcatttg aatatatakt gaatcatgat tgccctgact attattcaaa aatcaccata catgtcatat accagaagga ttgattctcc aaaaacatga cagacaaaaa aagctattgg caggaacaca gacagacatg agcaaatcca ctttactccc cccttcataa cagaccagta acattaggat gcaattaatg actgacatgt cacatacaac catacacatg tcacacatga tgtgcaacaa tatgttccca tcaaatgctc ttgaacagag ggcagctcag tcatgattaa acacatatgc gacattcaag ccaggggacc aaaataaaat acaagccttc catccaaacc ccttaacacc ctggctaaca tctgaactta atacatagac gaaagctgta tgtttaaatg acaagcccca ccagccatat acactcctca 120 180 240 300 360 420 480 540 548 <210> <211> <212> <213> 201 478

DNA

Homo Sapiens <220> <221> allele W0005851 0 http:/twww.getthepatent.com/Login.do /Sexamsuport/Fetc,/Defaut.dog/WO00585 10.cpc?fromCache= 1 part=maintoolbar-boom~ Pae 698 of 737 WO 00/58510 PCT/IBOO/00435 <222> 125 <223> 99-25332-125 :polymorphic base A or G <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc Tbinding 105. .124 99-25332-125.misl, misc Tbinding 126. .145 99-25332-125.mis2, complement primer -bind 1..18 upstream amplification primer primer Tbind 461. .478 downstream amplification primer, complement misc binding 113. .137 99-25332-125 probe <400> 201 aacacaggca ggaagttctc gcaa raagca tggcctggtg ggcgcacagc ccaattcctc gtcaagggtg tggcctggga catcattgct aggcctgggt gcccacaggg tgtgtgtgtt tattcaacaa aggtccagga gctcacactg acgtgtcttc cagctgacct tgcatgtaca gtgtttgtca gggggtggtt gcctggggac catagatgca tattttgtag tagggcatcc gaaggcatgc aggctgctca gtcccagaat gacagggcat atgtctgctg tggctccttg gcccagaata cacagagttg ctgccaggtg attggcctgg gtagtcacac ttcctccagc gggttagcca cctatcctgg tggacacagg cttctcaagt cagcttacag gggtatattt acttcttagc tcaggacaca atggaatgag ggatgttttt gctgctcagc ctgagaca 120 180 240 300 360 420 478 <210> <211> <212> <213> 202 404

DNA

Homo Sapiens <220> <221> allele <222> 306 <223> 99-25516-307 :polymorphic base C or T <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc Tbinding 286. .305 99-25516-307 .misl, misc -binding 307. .326 99-25516-307 .mis2, complement primer -bind 1. .18 upstream amplification primer W0005851 0 httloilwww. etthepatent.rom/Login.dog/Sexam.suporYtFetchloefault.dOgNV0005851 0.cpc?fromCache= 1 part~maintooIbar--bOtOm Page 699 of 737 WO 00/58510 PCTIiBOOIOO435 <220> <221> <222> <223> <220> <221> <222> <223> primer bind 385..4064 downstream amplification primer, complement misc binding 294. .318 99-25516-307 probe <400> 202 aaagtgacca ccaacgaggg gacmckwcca gcccattatc ctctgcgacc ttgcgycgca tgtgaagggg actcatcctg cagttgttcg ttatccccat acacaggtcc tccgttctca gatggggctg attggaagtg tttggccaag gtccccttaa atttcagaga taagagctcc ccaccgttct cctgtctcca tcctcgagtt gactgtcctg tgcaaattct gaggrctgag ctacttaggg gtgctattcc aggccttccc ctttctgaag agaatcctct ggcaacacct gctcagaatt acttaaatcc ctgagaggca tgctcctatg aaac cagtcctgga ctctgacatt ctaagaactt aaatcttgga gcgcaggtcc acagtggagg <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 203 3001

DNA

Homo Sapiens allele 1501 9 9-2 617 3-4 70 :polymorphic base C or T misc binding 1481. .1500 99-26173-470. mis 1, misc binding 1502. .1521 99-26173-470 .mis2, complement primer Tbind 1033. .1052 upstream amplification primer primer Tbind 1570. .1589 downstream amplification primer, misc binding 1489. .1513 99-26173-470 probe complement <400> 203 tgtctcctct gaaataataa atctatccat tgtaatctaa aatcaatcca t gtat tat cc cccatgttaa gtctgttact cccatttcta gaaataaatg t tact cctct gttcaagacc ataattttct ttaacagtat aaaagaatcc ggcaaaactc ctctcagcta ttcacatact ttttattttt tcatcaaatt tctcttctgc ttaaatatgc cctcttggtt tttgaaagag tatccttact cca caact gc ttactgaact tagcattaga atcatcctac tctaatattt atgcatttct aaattgcaac tctatttgtc ttttataagt tggggataaa ccatctctcc tgtgttatcc agaacatctt ctctagctat tatccttctc tgagaaagta ctatctgcag ctcctagtgc tactcaggga cacatcctcc aaataattac tgaattaatt ccattctctc 120 180 240 300 360 420 480 W0005851 0 [htto:/Mvww.getthepatent.com/Logjn.dog/Sexam.support/Fetch/Default.dogjW0005851 0.cpc?fromCache= 1 part=maintoolbar--botqoml Page 700 of 737 WO 00/58510 PCT/iBOO/00435 ttggaccctt catgacctgc tatttggcat gcatcgaaat ttatagtgac tgatttgatg gcaatgcttg tggacagagt tctttgtatt attactatca atcactcaag atcatagttc cacct aaggg agacatgatt gt ca aaa tga agatgaacaa catgtaacta ycaatgatgg t tgaaaaagc tgcctcattt tgccctttaa ttgtttaacc gtggcttaga tttcatgaag gctgtcttgc aaatctatgc gtagggaaag catctcatac aggaagtgaa tctgacaaat gtcagcatta cacaagattc ggtacatgtg tgcactcatc tccccacctc attgtccaac agtttgctga tcctttttta tctatcattg ataaacatac tgatgcagaa cttctccaga t tctaaacagg aagtgatcaa tcaaattttc actttaaacc gatatatt-tg ttcagccaaa gtgtttcctt ggcttgtctc taaatataat tagcaaataa tttaagcatt attttctcta tttcaagtat aaggtaatgt caaacagctt atttatagac cttggctcaa at gggt at tt ctttaaaata tatctctttg atatttgttc ctattaatct ttgttcaata agaatttcat ttctctctgg taggtagaag taa ccaga ca ttctcccaac ggaatttttc atggggtaca tactctagtg cctctgttca cagaatgt gc aacctgtcat ccaacaggcc tcccacttat gaatgatggt tgtctgcata atggacattt atgtgcgtgt actgctggga tctgcctcca tgtttgtccc actcaagatt ataataaatt taccatttac ggtttctaat cactaatagt acttgggaag tata aa aCa g agatttgtga tcattggcaa atgtagaaag tgtggaacgt tgataatatg ttctacattt ttaaggtata atgataatat caacgagaca acttgtttgt gtgcgattct aatttctgta atggcttttt ttctgcataa attacctcat gctgaggcca ggtgggatct cagtcttctt tcttcactgc aacagggtgt caggaactca gttttagaat tcttcctgga ttcctataat agttttgtta ctacattagg ccagcgtgtg gagtgagaac ttccagcttc gtatcccatg gggtaggttc gtctttatag cagtaatgtt ctcctttctg cagtaacaaa ctgttttcag tgtatttttt ccaaccagta tgagagtatt actcagttgg aatattcctt aagaagatga ttaagcaacg actaaaatat aaatagtcat tttcatggat ttctacctct gtgtttttag agcaaatggc tatctcttcc tgaatgcagt tttcttcaga cattgcttaa aataattcct tattcctctt gtaaatgcca ccttattcca aacttggggt gatctgaata ggtttcatac atctgctcag tgttggtatt tagtggtcag taactcaatg tgtacccata ttattattat cataggtata tattcctcct atgtccccct acgcgatgtt atccatgtcc gcgtatatgt caagtctttg tagaataatt acaaatgatg ttcaatgcat ctgttcttgt ttcttatcct actacaaagt ccctttatgc aatacgttaa tattcgggta tcatcacatg atggtctttc gctgcttttc tagtttgctt aaactttgga agatttgttc tctttaccta tttttctatg aaagagctgg attgagattt gtcttttctc atccaacaat tgtcttttta gcttatcctt accatttggc ccagcacct t gcaaatgaga agagaagact cagggataag ctgatgaatt atgagaagtg attttcattt gggtagtatt aatccttaat gaacaggcta tattatactt catgtgccat aatgctatcc ccccatgtcc tggttttcta ctgcaaagga gccacatttt ctgttgtgaa tataatcctc gccaccctgc gggacaatag cacggtcacc acccgtatag ggtaaagtta gatcatcttt ctattccatg ccattagaag tatttgtgtt tgagaattag agactcctta aatgataaat agggccgttt cttattttta cctattacac ttaatttttt caattagagt tccggggtaa aggaaactct tctctttctt ttacaccaca ggatacaaca caacttacaa aatcatttct tgactgctgt gaatgcattt gatattgtac aaaggaaagt ttgcatacca catggatgag tgaacacaag cataataaaa gaatgtcaac taagttccgg ggtggtttgc ctcccctagc atgtgttctcttcttgtgtt catgaactca ctttatccaa tagtgctgca tgagagaaca agaaaagagc ttttaaaagt 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 204 3001

DNA

Homo Sapiens allele 1501 99-26267-524 :pol misc_binding 1481. .1500 99-26267-524 .misl, misc Tbinding 1502. .1521 99-26267-524 .mis2, ymorphic base C or T complement W00058510 a http:/www.g etthe patent. com/Log in.d oq/$exa m.su po rt/FetcIDefa ult.doMVO005851 0.cpc?fromCactie= 1 part= ma intoolba r--boftoml Page 70 1 of 737 WO 00/58510 PCTJIBOO/00435 <220> <221> primer -bind <222> 983. .1002 <223> upstream amplification primer <220> <221> <222> <223> <220> <221> <222> <223> primer rbind 1553. .1573 downstream amplification primer, complement misc binding 1489. .1513 99-26267-524 probe <400> 204 tggggttcct ctgtgagata ggttcattat ggccttgctg agggagattg ttcttaaata tctcacattg ttataaattc tattccatgg gaactgaaca gtggggtggg gttaatgggt gtgcacatgt aatgtaatta ttcgtgatct ttgggtaaac ccctgtacca cataaatgtt gcattttaca tgtccctaat ttagaagaaa ttttctaaat agtcattata tcttctctat cattaaaaaa yatgggtgtt attttggcaa t tt ttatc ca cattgactaa aagat tgaaa gacaccacat ctggccatta atctgtttca ca ga tcat at tatatgtgta ataaataaaa tgtatataat tactatatta ttaatactgg ataaccacaa tttgaagcag gccaaatcag gaagttaaat cattgacaaa attcttgctt agtcattaac taaccttgta aatgtcatag atcacctttg aaaataattt aagttttgtt tcctgaacct ttgttttgaa tcaatgtctc tgtatatgtg atgagaacac gggagggggg gcagcacacc accctaaaac ttatttgtag ggaagacctt cacttaactt atgaaatgag aattattgaa tgtaattttt aataaacgta ggctttcatt tactatactt aaaaggctta tctgttactg atacaagctg ctttttgttt aggcttttct caccaaaata tttttaatga aatggtttgg gagttcatgc acttacaata gaaagcttga ttgtgtgtat taaataatat tattaaatat tttacattat tatattaatt gtttagctct taaaaataat acctcttcta taggcactgt aagtaattta gtgccaaata ttattactat tcagtgttca tctaaattct tacccaccaa ctttaagaga caagtaattc cccagttttg cagtttcctt tataataacg ttgtttaaga ccacattttc atggacacag agggctagca aacatggcac ttaaagtata tagaaataat aatccgactc cacttgtaaa ctcctgggta atatggagtc actcaattat aagaaaggaa tttttgatat cagtgaagtt tgatttttaa caaaaaaatc atttttccca ctggcaacaa ttttaaataa tacaaattat atattttatg ggtagtggat acacatactt tgtggatatt aaaggaattt atatataaaa a tat acat ta acattatata acattatatt ataattatta agagtttaaa agtggtgaca agtgacgtat gatttttcct ctaatgtctt tcttaaattg cctgttaaat ttagttaatg cacttcactt caccatgtgc ttcagcaatt atcctgccta ttatgtaata atctgtaaaa aatatcaacc gtcatttaaa ttagtccagt gaaggggaac ttaggagata atgtatacgt ataaaataaa agtagagaga ttgtttctta atgaaagtat gaaaagtgct attactaacc cctttaagtt agcacacata tttgctacca ataattgtct actcactgtg agtgtaatgc atattatcac gtgccacatt aaaaaattgg tgatatcata gtcctcgaat cacatgtggg tgtgggcaac cttagtaatt tgtgtgtgtg tggaatatat catataaata attttactat catatataaa atttaaaagt ttttcaggga ctaatgataa attcacaaca tttctctggg gctgtgaagt gaatactagc aaaaataatt tcttagagaa ggatccttga tcagcagtca tccacgaagg agtacacaga gctttgtaat tgcttcatat acgtaacact atgtaattat ctatcattgt atcacacacc tacctaatgt atgtaacaaa ataaaataaa ggtagtgtga taatttagag taatgaatgc tcataaacgg ttataaaaaa tagtcacaat ctgacaaggg t tgact tgt g aacttatttt aaatattcat ctttgtcata attacaattt gctgaaaagt ggatagaaat atgtaaataa taagaatgta atggtgttga tgtggtgaaa tatatttgtt tatgcacgaa gtatatatta tgtatattta ataattttat atatataaca gggaaaaact tctc tttgt a ctaatattta ctgtttaaac tgaagaaatt gactttgaat tttatttttt ttggaaaggc gcaagtcccc tgat aggaat cca gagaaca cccacaaaga ctccaggtgc cttaaaacat gaagtttgta gcctggcata ggctgcatag tggtcattga gggccctgtt taaatgaaga cctgcacatt ataaaataaa tatggtagaa aagcagggct atcacagggt gtatgtgtta acaagcaaat tagtagaaat gttattgatt atatgggtaa atgatctatg agaaggtgtt ttgtgataaa ctttaacttt ctctaagttc atttcatgtt taagaccgta caatgttgaa atggattgct tcaccataga ggcagttaat accttttccc tatatgtgta tacattatat agtttaataa tatataattt tttattatag gttatctctg ctgaggacat ttcataagta gaggtgcata aaaatattcc actttgaatt t aat acat ta agggaagctc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 W0005851 0 [httpJtwwW.oettheoatent.comlLogin.dog/$examsupportFetchDefault.doqWOOO5851 0.rpc?fromCaclie= 1 part=maintoolbar--botom Paae 702 of 737 WO 00/58510 PCT/IBOO/00435 agaactctgg ggttgcagtg ttagaatcat ataatacaga a 401 gtgaccaaga taggcagaga ggattgtaag agtgaggaag agaggaagtg agcaaatctg cctaaaggct acatgtaatc atctcataca cgtggtgtac tttaggttat gcaaaaaaaa aaaaaaaaaa agaaaagaaa aaaactcaaa ttgtaaaatc ctccattcta cctacaccaa cagctcacac acttcttttt 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 205 3001

DNA

Homo Sapiens allele 1501 99-26284-394 :polymorphic base G or A misc -binding 1481. .1500 99-26284-394 .misl, misc -binding 1502. .1521 99-26284-394 .mis2, complement primer -bind 1874. .i894 upstream amplification primer, complement primer bind 1460. .1480 downstream amplification primer misc -binding 1489. .1513 99-26284-394 probe <400> 205 acagtgtca t ctctgaaatc acttgtttcc tctccataga aatgtgtttg ctcactctgc gccacactga aacttcccag agatctgggg agaaatactg ccaaatcaaa gtaaactgac tggataagta gaaagggaga gaacatcttt agttgatgtg tgagagcatg cgatcagttt aatgcagatt atttgcatgt tgggaactac aacttagcag caagaagtac aattacatcc ttttggggtt ccttatatta tactggagct gcggggctgg agaccccagg cttatttgtt ggatgtgcat gtgttaacca aatgatacca aaacattctg gaggaatata act gggaaag ggtaaaggat atggttttga agaaaaaaat tctaagctct ctaataagtt agctccaggg gggttctggg aaactttact atcccctttc aggcatgctt gcagaaacct ccttccctca gctgattcct tgaccttcag gcctcagtaa gagataaagt gctcttctga gctgtagaga tgtattatta tctaaatgga tcgcattgga gtttgtaaca tgaaaatatt aaaaggtgag cagagattct ctcagggaaa ctttgcaggt accttttttt t tgaagagat taccccgtcc ctagctttgg ttagaaatat acctgggaac gtagtgccca caagaaccat aagctgaaaa tcagatggga tcttccaggg agctcctatt agataaatgt gaaaggtgaa ataaatatat gaggaaacca taatgggtgt atacatatca gattccataa tactgatgca tgtgaggagg ccttccagag tgcacgtagt tgtgaagtaa ccagtgggtt tgcaagaacc catataaaaa gcagaacctg gagtcagttg atacatgcgc cccacaaaac tctggggagg gcagtgcaag tacagagaaa attaaacata gcaggaggca aaagtgcaaa ttgatgaaaa aatcgcccag acctcaggtg gcgcaacacc acttcggtgt tattataatt agattgtact tatgttcact gtgaaaagat ctctttcccc gacatggagt gcagaactgc taagaactta tctggtatga caaaaatttt caccagtgaa gagacaaaaa aatatatcag ggatgtttga aggaagcctg tgtcttgcgt tgaaggagaa cggcttgcgg gggcccatga aggagcacct ctcctctgag 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 W0005851 0[http:/Mw. etthe atent. co moAin.d og/Sexam. support/FetchIDefa ult.dog =0005851 0. cpc?fromC ache= 1 part=m a intool ba r--botomI Page 703 of 7 37 WO 00/58510 PCTIiBOO/00435 tgagatggaa tgattgtgac atatgaacag tccttttgtt rttccaacca tgaggagggg gagctaattg gttatgacta taaactaaca cttccttgtt tgaataagca tccttctgcc acctgctggt ggagaagatg cactcttcta tggtactaat tgttgcacag tgtgcttttt cttttgtttt accataatta tatttaggcc gggaaggaaa gacactgtga tcttcctaaa caaaacagtt ttctgctgtc taaaaatgtt ttactttcta.

tggccgctct g aatcacaagg tgtgttgaga tactgaaaca tagtaagagg atgccctctg tgttggttac agtgaaaaaa tggatt tgta ctaggaccac tcaaaaacgg tttgctgagt aaatacttta agggtgtata acggcagtga agccttgtcc attattccca acagcataag aacaactaca tccttttcta taatgggaag aaaaatgcag gtgaggccaa accacat tga gacaggcact a aa gatat tt tccactcttg aaatttaact ataatcattt actactttta atgtttttag ataagcaaga tgggacaat t taagacagtt ttttctctgg ttttgcaggg tattttatta gttaagagat tcttggcact tctcttggag gaatgcacca aataaaaact agcaagatag tgatattagc tgttttaact tttcgcaaag gagcagtgag ccagaagcaa aggtagactg ctgtttctat gggagagagt ccacacactt gctaactctt tggctcttta tattcaatta.

ccctctcaat ttgggaggat atccaagttt tctgctagta cagaggagag aagtgctaaa atactggcct cctgatgcgg caaggtcatc agaataaaat ttccagaaca gt taaaaggt tacatatccc gatgatgccc acactttgtg ccaccaaaga aatcagagtt taaccgtgct catttcatcc atgaaaactg gtctgaacta gtgagaatta cggggaatga ctcagaatct cctgatgggg tctgctgcag gatacacccg accttgaaat ataccttgca atctttcaat ttaaggatac aggattcttg aataaattca acattagctg agtggaagca tatgcaaaaa gtcgggacat taacttgatg gatcattgca cccttccata acatcatttg aaatacaaaa aagggttcct taatactacc tgacgtaaaa tactaaaatc gaatattatt ttttcaaaat cagaccagca aggcattctg cagaatgtta cccttgtaac ggccctgaac ggcgtggctg attctgcacc cagataccca ggggaatcca ccaagccata attttagata ttataaaaat caaggaagaa tgatgaacat accaccagga gagaagccaa gaaaaatgat gttgagagat agt gggaaag gagcgtggga aacaaatgag ttaagcttgt cccaatacat tgagttttaa agtatcactt tagaatcaaa agtatttaat atctgacagg tggatgagat gtatacccag cccagggctc aatttgggct tgaatactgc gatcctagga tgagtggagg ctcttggaaa cactcactgc gaaaaaaaa ttaaaatqtt tatatatatc aaccattcag gacattaaaa.

ttagaaggtc 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> 206 3001

DNA

Homo Sapiens allele 1501 99-26559-315 polymorphic base A or G misc Tbinding 1481. .1500 99-26559-315 .misl, misc binding 1502. .1521 99-26559-315 .mis2, complement primer Ibind 1187. .1207 upstream amplification primer primer bind 1650. .1670 downstream amplification primer, complement misc-binding W0005851 0 http:/Mvww. etthepatentcom/Login.dog/Sexam.support/Fetr-h/Default.dogiWO00585 10.cpc?fromCache= 1part=maintoolbar--boftoml Paqe 704 of 737 WO 00/58510 PCTIBOOIOO435 <222> 1489. .1513 <223> 99-26559-315 probe <220> <221> misc feature <222> 539. .540,592,784,833,850,881, 1592, 1631,1682,1852,1873,1962 <223> n=a, g, c or t <400> 206 atcacatgca atatagaaag gaaattttaa aagagctgag gctcatgaag gaatactggt actcagtagc tacaagacag cacctaactg aaaaatacat gccctttcaa taacaagttt ttatcatctc gtcnt aat ga gatcaagccn aaaagtccaa tctcaaccag tcacaactga gctgctaaat aatgtcagta atgagtggta aagttgtgtg ttgggcagtg ttttgtagct tagtgtgacg rtcacttctg tttdtggata ttgggaacaa t nga gt tact aagtcccatc ttcctcatct accaaaatca cactaggcca aaggaagttc agattcttcc cagtttcttc gagaagagaa tttgggtttt aatccccaca taaagtcatt tcttgtaaac aagattaaaa tgtttaagtg catttcactc ctctttggcc tgcatcaaga atgggcttgg gggtcaccac actgttcatc actctgagac a <210> 207 <211> 3001 gtagcttgaa caatttatca tatagtgtgg aggggaattg gaatcgcctt ctctaagaca atgcacagtg tgtcaaagta aaacttaagg cagatcaagg ggtaacaaac aaatacagaa tgaggcagca ctgtagcact gaaatctacc cgaaatagaa aggtgatttg atagaatagt atcttacaat gtgtcaattt agtgtactat acaaaagaga aataagaggc cttttttttt aggggaaaga acaggtactg aacagctatg nctagctcat ttttacttgt cagtgtctgt gttctacatg aanttataga tatgaaatgt cctgacaagt actatacatc ctagaccaca tgccatcttg tcaccatcat aatgccattg gtctctgtgt ctaaaggaga cagattaagg atga ttctt c tggtattcag tttacttctt aactaccatc ccagcgtgtg acacatattg acttgattat ctatggagta atcattggtg tggtcaatac tggcagaatc cagaagcata tggataaaag tattttctgg ccaatccatt ggttagttga cagatatcag gtaaaaacaa tgagcacata ataaaaccat tcagcatgga aggtggtctt tgtcattggc gataggtcca ccactgggca ggaagtagct gcactgggtg tttttttaat a gaa aa ttat aacatacttt ttttctccct ttttttttta gtaagtgaat atgtggatac ttgcaatgaa tcaagactcc acagagaaca atccagatca aaagttagat gtgatggagc gctatgcagg ctctgaatct ctgtcttctg tctgaaagaa gagaatgcca aggattactt gccttttgag aaatctcaag ccactttgaa aaaccattaa cccgaccttg ccaggttcca atctcaaaca acgtgcaact ttctgatttc tgaccaatct tgaagcagta ttaggtaaga atggatttac aaagtatatg tgtgctgtta aaatgtcagc aaaggtccag agtttttcaa ctaattctct gagtcattat caagagaaaa agaaatatcc ctgcaacctc aattgagttg tagcacattc aggtat taga caatgacaat gatgttccac tttgqcagtg gctggcattt gccctcaatc gctagaaatt tagataatgt tactcaaata gggttgattc atcaggaatg gtggcatatc ttctagttgc anctcccata atctgcccct ttttccatcc gccttgagga gacacatcag ctcaggtaat cagggggagg gctctctgta tttccaaatg tgccatcttg tcttggagaa gggccagact ctatttcctt ttggccaatt accatttaaa tctgatcttt ttgttcaaag gttttacaat aattgacttt aatagttatc caagttatca ttatcttctc ctgcatgttt aataatagtc attttaaaag tacattgtct ggtgatatta tggaggagag aagtgtggag caaatacttc atgaatatca tcattaaata caccagaaga aagatgtagg ttgcccctgg taagtgttgg catgctcagt gaggtctatg naatatgaaa acctcatcta cctagaaaca aacaggtaaa caaataatta ctggaagaaa tatagtcaac accattcaat aggcattcag gcccaagaat agcttcttaa aagaggctta ctatagaaag cttacaagaa tttccaagga ggatgagacg tctccccatt actgcataat gnccccctgc aggaagtctc ctgggaactt gagaagagaa tggcagtttc caaggtatcc ctgttttcag tcttccgcct acaatttggt gccacagggc tttttacttt gtgccacatc tgctcaatt t taacctcgta cagctggcag agactctggt tcttttcttt acacttagat gctgaatcag tgtttaatat tttggctaac atcataaaaa agtgtgctca atgcatggct acaagagttt gcaatgaagt ,atacacatnn tricaggcttt taaaacagca gaagaagaaa agatgtgaga aangcataga acaatgaaag acatagtagt tacttcattg gacaagaaat tttgacccaa aaaaggtgca ctccaaatt t gcaggtgatc tctccttcca cctgtgtctg atacccacac ggatagttag agcatggat t aataactgca agacaaagca aatcatcagc gnttcccacc acccgagagt ccttgcaatg attgattgaa cctccttgtt tgccatcttg ctagcctgat t tgggaa tat taaccccagg atgttttctc gattaagatt ttagcttccc cagccttatt tctgcattct tatctcttgt tcttgaagct ctattgtaat atgtttcctg gtgtatttgc acattacagt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 W0005851 0 [http:/&vww.etth~epatent.com/Logig.dog/$exam.support/Fetch/efaut.doqNVO005851 0.cpc?fromCar-he= 1pDan=maintoolbar--botoml Page 705 of 737 WO 00/58510 PCTIiBOO/00435 <212> DNA <213> Homo Sapiens <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-26769-256 polymorphic base A or T misc binding 1481. .1500 99-26769-256.misl, <220> <221> misc-binding <222> 1502. .1521 <223> 99-26769-256.mis2, complement <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer -bind 124 9. .1i267 upstream amplification primer primer Ibind 1707. .1727 downstream amplification primer, misc_binding 1489. .1513 99-26769-256 probe complement <400> 207 tctgcctgcc catcagtgag cgcctgggta gttctgactc agagatgtgt gctgtgactc tccacttgca gtgtgtggtg agtatgcaca ttctgttttc tgaagttcca cattacacat at tgcagttg attttctcat gagaaaagaa gaggcaggaa acgaatttac tccagaatct gcggttccga tagattttct cttgttcact ctaaaactcc ttttcagctc agtagcactc agccccttca wgcaacttta acaagcctct gcctgctgaa acaaactcat tctgtcatat ggttgtctgt ctatagacct cttgttgcta ggatgtgtgt t ga tct gtt t cattttttca ttatcatggt at t ttggga a ttcttgaata gaaaaaaata ggccaatatt actttttaaa ccttttagaa acaacaataa ggagggcaga aggaagagac taaatcaggc ttctttggtt cttccagtct ttctggtgta tttttaaaat tccaactttt tgctgactt t aggcattcac ccatcccaca gtttccaggc cacagccatt cctctccttg tcacattcta ctgtgtctgg aattcttact tattctagac ctctggggaa actacctctc aattaaggct gtgtatctcc atacaaggat gtacacatta gtgaggttta ttctagctcc aattaatcag tttatgtttc tgagaaagat gaagaaaaag aacttagaga tggaatgtta tctttattat catcttattg tcttctaatt tttccctctt tttaaacttg attgccattt aaagttttgt tatttacata tcaagcagct tttatgttcc agtaaacctg ttcgaccaat tacacagtag atttatggct tcactcaaaa gttccatggg ttgtggcaga tcagagaaat ccattgttta gtcatcagaa tctcaggata tcaaatccat aaagaacact tcttcataag a ata tgtgt t ggaagaggaa aggaagaaga gtagagacat ggcacagaca atcatcattt aaaattcttt tgaaatttga acttgttgaa attgtaaagc cct tcaagct cctcagtctt gttcaaacca catgtgagtt gtgtacagct c acct cttt t ataatgttgg gcagatgtga agtccctagg atgtatggat caaaactgtt aatggcagac gtgtagttgt atagaaacac ttttgcagat caatgtaaaa ctgttcccat ttaccagttc ttagtgtttc atttttatat caacagcata gcaagaaaaa tgttgggatt cacagagagt gcagtatttt gtaaatataa ctttcgttct tccaacagct ttagatcctt agttcccggg ctactagtcc ccacatttat tctgaatcat caagtttcac ctatacctct ggctctttca tttcatactt aagactt tat ggacaaagac tcaaggaact atttaaaatt gtgtgtgtgt taagatacta tactattagt gtttgcccta gagaaggaaa tttagctctc ccttcccttg gaatttaaca agaaggaggg tgaatgacga ttcaaattaa tgggttttta ctgagagcag tctattctca cagcgtgcta ttttcatttg tggtttttac ctcttttgcc catttgtcac gctgaagaca gcactcaact aagtcaaaaa tatatctagt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 W0005851 0 [htt:twww.getthepatent.rom/Loglndog/$exam.suprport/Fetch/Default.dogNVO005851 0.cpc?fromCache= 1 part=maintoolbar--bottom] Page 706 of 737 WO 00/58510 PCT/EB00100435 caagaccctg cttgaaactt ttgtgatagc tgacatcctg ctataaagct aaaacacagt caatcttact atgatgctct tccccttgag aagaaggtct atgt tggacc aaggctgaga aaaaacacaa ctaagggtaa tttgtttacc gaaatttaga tgcacccttt aaaactcacc tacttattac caaaaggaaa gagaataatc tatgttactt tgcagctcat catttgttct cactgcacta ttaaacttct tcttgtcaat tgatcacaaa aattcctttt ctccttattg cattactgct gcttgcacat gacacatctt tcaactgtcc tgagatagat atgccttggt ggcacgtttc ttttattgtg tttattggcc taaaaaataa ctgcaggcat cccaagtttt tctctgtctt ctaatctacc cctacctata caaaatggta ctttcctttg attctatttc cctctaggat ctggagaccg gttaaaacat aaagaaagct aagtcagcaa caaaatctgg gcccctcaat aaaggccaag tatatcaggc ctgggttggg tatgaaaaat aaacaacaca 405 ttatcttctt accaaattga atttatgtgC atttgcacat taaacattcc tatggtgtct ggattcaagc cacatgtaga tccaattttt cggcaggggt cgtcatataa ggaaagtgtt ctttccataa agacacacag gccatttaat tacgatccag act caccggg gaaatagcag aaatcaaaac aaaaaacctg acctctttta ctcttactct tactgttata atactcaaga acatgctctc ggaattgtct tgtaacatcc ccatctccca atttttaaaa cccgcctctg ttatgcacct actcctaccc aaccatcaga actgctgcag ctggtaagaa tgagagagta aagatgggga tgtctgcctt aacaatctgc caccataaga ccaaatcatt ctactcccat gagtgctgaa tttatgtaaa ataattaaga tcctttctag cagtctgttt tgctctacct taaatgacta tgctgccatt gtgcctgccg ttacaacaaa gaatgaagtt gatctgagta aattcagcta tagggaagtc agaatcatga aatctgtcca agaaggacaa gcatagattg atgcattcca 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 ttaaatcact caatttattg tttaaaaatt gaatgcagaa aactgtgagt <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> 208 3001

DNA

Homo Sapiens allele 1501 99-26772-268 polymorphic base C or T misc binding 1481. .1500 99-26772-268 .misl, misc Tbinding 1502. .1520 99-26772-268 .mis2, complement primer bind 1235. .1254 upstream amplification primer primer -bind 1702. .f722 downstream amplification primer, complement <221> misc binding <222> 1489. .1513 <223> 99-26772-268 probe <400> 208 gcctccaaag ccatggggaa ctgtgagtca gttaaacatc ttttctttat aaattacccc agtctcagtt atttcttcat agcagcatga gaacagacta atacaacagc cctcagtaaa aactgtgcta gtaaatttca gtagtttctc actgaagtct ctgttgaagt cagtcttaat catcaaaact gtaaaccaaa tcttccactt tcaaatgtgt tctaaagcaa aatgttcaaa W0005851 0 http:/Iwww.getthepatent.comfLogin.do /SexamsuprtFetc,/efaultdoAANOO0585 1 0.pc?fromCache-- 1 art=ma intoolbar--bottom] Page 707 of 737 WO 00/58510 PCT/IBOO/00435 tttctaacta tgatctcttc ctcctcctct agttggtatg aaaattagat tttgggagaa gttgctatac atttctcttt catctaagtc ttcccaacac atgttgtcat tcaaatccct caccagatac ttttgattca taagatagaa ttattagtaa atgaacagat cctcctcctc tcaatgagaa aataagcatt cttagaaatg yatagttaaa tctctattac acatataatt tcgactccct tcctgttcaa catttttgca tttggaaaaa ctgaaagtta agcagaagac tttttcttca catacactgt tgatcatggt gtttttagga gtttgtttgt ttaaaataag agtgttaatt ggactttccc ctactcagat tcttaaattc caaatataag catccctact tatggtttga attgctttct tttcctcccc gaaatattgt tatcaaacat ttacgtttga tcttccacta tagttgcata caagatcttc gacatgagag ttatgcaatt ttcacttact tccgctataa aaaatttgag tgctggagtg cctacctgtg agccccttaa ctgtgaatta aatgatctct tttacagtgt ataactccag atccacacgt tatgtttatt t catct t ct c ctacagaaaa attctaaaat catatttgaa acactaaaag ggctttctct gtaactgcaa aaatcctgct gtctgcaaca aataagtcat aagtggaggc tctacaaaga ttgatgttca atatgaattt tt tt cacat t ttcttgtagt agcgtttgcc tatctttaaa t tgt ggt aa t tt tcta ttt c catattgttt agaatcacaa tacattttag ctttaaaaag cattctttat tctgcttgct tattgattta tcaaacctgc tactcttgca acttgttgtt aagacataac aagatcctca aggttcttta tagtaaaatg ttgccaaatt tttgaatata agatgggacc agtttgttat tgataccttc ttatggacat cacagtctgt aaagcgaaaa tttaaacgta gtaaagacta aaatgcaccc ccagtggagg ataattatcc tacaactaaa atttcaattt aaccaacatt acaagggtat gcaactttct aatcttctca cacttttata tcaattttac tatgtcttca caggacattt tgattatgtg catgttaagc t taa tat gt t tgcattcaga ctttgccttt cttttctttt catttgaaag attttttatt cctttgagtc atcaaattac tttttttata taatgtgaat acatttcaaa atcatttatt ttgagtttgg agatctcttt 406 aaaaacggca tgaatacaat tacataataa aattggaatg accacatatt taaaattcag cacatagtaa aagaacatgg tcccacaaag tttaagaggt tgaaagagtg tgccttgtta cct tgtt tcc ggtattctgt at gat ttct a agacggctga agaacatttt atgtatgcgt aggagcttaa acagaagtat aataatttaa aggtatattt tcaatttaat ccttagccac catcctaatt gtgagtgcta tatttttgta tgtttttgta catcccaaat ttttgactat ttttttgtcc caacattaca actgcattca gaggatatta tttttttggt acttttttct aattcaccag gctaaggcaa aattttggta tgattgtttg atgctttgta ctgttctatt gaactaatgt tgtttgtttg tttgctcttc tcttttttaa ttctgcttat ttttttttcc gttttatgtc gtgttagcta aaagcttcat tttcaagaac aagtctgaag taaaaacttg ttgatgtgtt atttaataat agtttattat cgaggctgca acagccatga tacagcagca atgcataaaa ggcaatatga ctaactttgt gattttgtag aatctcacat cacagaagcc ttgtaaaaat tttaccctgt caatccatgt aactgaagga tctttaaaaa tggatCcaga ggaagctcat tttttctctt ttcttcatta attcgatttg tttattttat tttctgggat gtttgttggg gtctagtttt atcagagtaa ttttggcaga tgaagccatc tattgttgct gt t tatgtt t ttggtgtaca ttttctgggg ttttcttttt t ctt tt tgt g tttctattaa ttagtctagt tatagtcatg aggaaaatgt ttattccctt atgctagtag gtaaaaattt aattttgaca ca att tca ag tgttttatgg cccttatagc ggaaaattaa aaattaatta aaaagtgagt agaaggccct gccaaataaa caaaatgaac tgtaatattt aactgatgaa ccactgccac aatacatata gttgatatac agtgacaatg ccaagaattt gtagattact gcctattcaa atgatcaaat tatatataaa cttttcttta gagctaactc tcagaaatat aaaggaagct ctcaaatgct gaaatggttt aatttccact gtaagagttt ttgtttgttt tactggctcc ggttggggtg atctgctccc tgttatagat ttccaggatt attacaagaa tctctaataa cagcct aact tgtgatatct accttttcta ttatttaaat tgcaaataca 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> 209 3001

DNA

Homo Sapiens allele 1501 99-26776-209 :polymorphic base G or T misc_binding 1481. .1500 99-26776-209 .misl, W0005851 0 fhttp:/ww.getthepatent.comILogin.dog/$examsuportFech/efaut.doiWVO005851 0.cpc?fromCache= 1 part=maintoolbar--boftoml Page 708 of 737 WO 00/58510 <220> <221> misc -binding <222> 1502..1521 <223> 99-26776-209.mis2, complement PCTIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> primer -bind 12 94. .1i314 upstream amplification primer primer Ibind 1755. .1775 downstream amplification primer, complement misc -binding 1489. .1513 99-26776-209 probe <400> 209 agtaataata gaattagcat gttattaata ggaaactaac tagcctgtgg ttattaatgt ctggaagcag ctaataatgt ttttcagatc ccatcacata gattataatg tacaatagAt acaatcagat aaagcaggca tcaacaaagt ccatgtatta catggtggaa gcctaattca ctaaggcgca tgccagtggg atcagggttg atgcaaaatg atcaattgtc ctacctccag cacctcactc kactttcact gttaatatgg ctatcttcct tgattatttg ccaggctgta ggtagatagg agcaatcagt agtcacagta tttctaagag taatctacat aagtatgaaa ggtgaatcac aaacatatat gttctctgga acttagggaa tgtaaaattt gtggctcatg catagaatta ttatcacttc ttgatactat ttgcccagta tcttcattat ggtagtaact gtgttttatc aataacattt agaagcatca acttttggca cacattaaat gcaaagccaa gagataaaaa aacagaaaag tgactatgtc tgcactgtat tcaattatta cagagttaga tgctcatgat caaaattcaa aaattcctat cagctctttt catattactt acagtcagaa tgtattattt ttgcttgtat tctctcttaa tagaaaagtt ccagtataaa atccctgcaa caggcaatat ctcccctctg ttcaatttct aaataatgag ataatttttc gtaaatctta aaaaaagaca gggtttgctc accagatgtc attattcatt ggaagaagaa c tat at acat ctgagctctt ttatagattt tgtcaccatt agtattgaaa tttgttacag tcaaaagaaa agtcactaac acatcccaat gcattgttag tttaaggatt tttaagaacc ctcaaacaaa cacatccttt tccaggataa aaggaagaga tatatggata tccat at tt t aataaaaaat cattgttcac attttggcaa attggccccc agtatcagtt ctttatagct tctttccatc cttgctccag tacttacact atgctatctc agtttcatct cctcctggac aaatcctggc atctatatat ctatggaatg tagatttttc tacatcttaa atttttagta tcaagcttag taaatgcact atcagttgat ctgagttcaa ttcttgcctc tattaaatga ttgcaaaatg gtaattttct tcctacctaa ttacataaaa ttattaccca catctccctt tggattcttt aattgaagtg gatcttacag agaacttgtt aaaatatgta acaatattca accatgtcct agccaatctg attcctgcaa aaaccacatc taaatccatt ctaaatcaca gatggaattt t gtagcct cc aataacgagg tgctatgttt gtggccatcc catctacagt atcgataaca tcttgttcct gcttaagtca tccatgaaat acctttgcag tacaaactca acacagtaaa taa tgaat ta tgtgaaagca aatggtctta atttcttttt agcttagaat ttgactggat tttaatattt atgtgagtca atcccatgaa tcaattttct gttaatttta tatatatggt aagcaaaata ttctcatgta accaagtata gcttgtatgt gggcagcatc gatctctgat aatgcgttac caatggttct agaaatgcaa tgtttactag agtataattt cttggtggca gacactatcc gccagggtaa tactattaga taaattaaat acactaggag caggccggat cagacagtac caacatcaaa aatgccatcc ttcttgacac catcagttca tggatgactt agggaagtgt ttcctccctt attcctctac gttgtattta at cagggtac tgctcaaaga atttcttcct gaagtgaatc tactgatagt tgatcttgtt aagagaacta gattgaaaag catttgaagt gtatatggta agatactgag tgcctctcaa taaagctcct cccagtcact atagaagtaa ataatattaa gcccctaaaa a a aga ga agg tcattttggt tatatgcaat atcagtaaag caaagtgtgg gt tcct agac tcctccaagt gatgaattta caaagatgca gccatggagc atactgccag t gaggtc t ta aacaaattta ccagtgt tat atgtttaaat ttactgcaga ggctctagga accataaatg tctccaaggc tgtccttctc cat cat ct ga atattcgcat gtctggctca cactattctc caccagtgaa agatgaagac aacacccctt gatgcagaag tcatttaatg aaattttata ttctgaaaga agtatgtttt gacgaaaagt caaaacatgt tttaaagctt cagctctata ttttctcgtt agaaccctgt gcatggctat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 W0005851 0 http:/Iwww.gethepatent.comlLo in.dog/Sexam.support/Fetchloefault.dog/W0005851 0.cpc?fromCache= 1 rart=maintooIbar--botomj Page 709 of 737 WO 00/58510 PCTfiIBOO/00435 aaaaatgcat gacccacaga acacatacac gagatcaaca gtgataccac atgcaataat catgtgtagg cctaaaactg t CtCaagggat tacacacata acacatacac gactatttca tgggggcata gtcaaaacaa gacagaggct ctataaaata t t ttgt aat g tgatgaaatt acatacacac atctcatcct tgggatctct aaggttaaaa atacagaaac taaagtctac gaaatgtcct tcataaacct gagtggctgg cattatgatc ctgtattgtt ataaatacat cctgtaattt taaaacaacc gtgtcttgac aagcgcaccc gaaaccggta t tgt act ata tcttacaact gggctattga ccactcagtt aaacagtgtt tgtattggtg gtgcacatgc aaatctgaat gttgagcaag gcacatgaat tagtggtaag tttctgtgaa tatttttgtt 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <22 0> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222>' <2 23> <220> <221> <222> <223> 210 3001

DNA

Homo Sapiens allele 1497 9 9-26 7 79-4 37 :polymorphic base G or C misc Tbinding 1477. .1496 99-26779-437 .misl, misc Tbinding 1498. .1517 99-26779-4 37 .mis2, complement primer bind 1072. .1089 upstream amplification primer primer -bind 1548. .1568 downstream amplification primer, complement misc -binding 1485. .1509 99-26779-437 probe <400> 210 atattagtgg acgacccaac agcaaaataa attactatca attgatgata caaagctctc gatcctagtg gtattagaaa tggaacgcta cactgagata aaattttaca at ttt cct ag aaagaagaaa agaaaaatat agcaaaagaa aaaggggata aacactccta actatgtacc catacgttac caaaaatgta gacaaagtag aaagtatcaa aaatgaatgc agaatctggc aatgcaatat ccctcatttg gacaatatag taataattct aaaattccaa ccacaagaaa aaatacatta cattagtgaa aagatggtca aaagtttatg ctaattaaaa ttataagcat tatgctatgg atttatggaa tttaagaagg caaaaacccc acagtttttc ttgaataatg atgcagaata ttgaactatg ctccgatcac ttgtcataaa aattagaaaa aaaataacaa gctgtattta tttctcattg acctaataac ggtagaaagt gttttaaatg a ga aact aa g gagattgttg caaaataata acaaaactaa cagtaaataa ctatcatcaa tacattttaa aaagaaatcc aatggtttta ttaaacaata acttttaaca tattgaaaac tgttggacaa ataagggagt agaaagtcaa gtaagaatgg aaaagacaca aagtatgttg gtagataaag aatgtttaaa aggaaactag tagaagaact cttggtctaa aaaattgccc caacaaactt aattaaaatc cattaggaca gatctaactc ggtatatctt agtagagttc caatttatga aatatattgg attaaaaagc aatagttgaa atgtgtctgg aaggtcattt tactcagtag agaaatctat tggaaaaaca ttactatttg ttggaacatt aaaataatta actgatagta tatctcagtc tacacttctt gctaactcta agagtgataa aaagagctta agcccaaatt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 W0005851 0 flhttp:/Iwww.getthepa tent. com/Log in.dog/Sexa m. support/Fetch/DefaultdOgINVO005851 0.cpc?frOmCa che= 1 pa rt=m a i Modba r--bofto ml Page 710 of 737 WO 00/58510 PCT/EBOO/00435 gatggaacta caatagtcca ttgacattta acaatggttc cgtaaatcaa agttgtgttt ttgatcaaat ttagaaatta gtattttgaa agcagtattc caaatcaatg aagtaagtga aaatcaacaa gaccaggaaa attcctcaaa agaaatgtct acctgataaa taaatgtttt tagctaaata aaatgtaaca tgtaaattaa gatggaaaat atacatggat tgaataaata aaattactat gttggccagc aatttgaata aagctacagt gggagtccag cagtcttttc attatatacc cgagtttggt gcaagtggcc a aaaggtgaaa t tgagt aag t tagaatccaa aacttacata ggagcatcta tgagccataa ttaatgtaat aattatatgc atgaaagaaa agggagaaa t acttcagata agaaataatg atctgattct attacaagcg ggacacaaat aatatctatt tgatatcttc tcctccaagg agcttattta tcaatatgta aaacataaca ggacaacaca tcatatacat catcttgttt.

aggtttaata tcattctaaa taaaaatttc aatcactaga attcaaacac aacaaatgta catatgtaag aagttttaaa aacaaacata tagaataaca gaagagagag ctctcaattt tttttgactt tactttcttt gacaagtgtt tagaaatcaa atctaaataa atagaaccac ttgttgcact ctaccttaag aggattagat ttcagaagac acactcacaa tcacaaattt acttgtgaaa aaaaactcta ccaggaacaa atgttggtgg agaaaaaagt tagaatagta cttattctaa aaatacacat atggttgaaa taaactcaat atacatgttc agtttagtat atggggtact atatagtcat ttggaacaat aaaataaaat aagctgaaga tgaaaaaatt attatatttg tcaagaaaga aggcaacata tacaatgatt ttaagggcac cattaacata taacaaaggt ctcatgaggc aacacatgaa actaccaata aagttagaaa tagttattga ccatgacttt gtagtttcta caaaagcatg actctgggta catccgaaat tctaaaaatg gaactattaa atatttgtat gtaataatat aacctataca atacagaaat gattaataat caaaatccta aaaagcaagt ttgcagaact ggcatcaaga ttaatttttg tataatcttt tccacccatt cataaatgga ctcaacatca cagattccag tacagaaaac tacaaatggt ttatcaagac ataaaatata aatgaattca aaatgctgaa aaaaaataga aacttgtgag atacaattaa aataaagcaa aataagtaaa tataatcctc cagtgtagat tgctcatctt aatgaaacaa catatataac tccacttcac gttagttcag atactagtaa ataacatttg atatttctaa ggattacata gctaaatgcc gcagaattcc tacttggaat tgacttctag gaagcaaata gcaaatatgc tcaacaaatg taatgtacca cacttctcaa ctcagagaaa gaccactctt tttgacccac cccagactta gtaagcccat tacacatata aatccaccct atcccaatat gaattasata atgcagataa agacaggcct agtaaaccta atggaaaaca tagccatact gagttgaatc aatggaatgg attcagctta aataaaagac cacatctttc taactttgga caattaaata agacaaatat tagaaattaa catacataaa aattctccct ttttgtcaga agtaaaaata acttattata gacaataatt aagagtaatc tattggaaca tacacacaca aagaagacat tgcaaatcaa 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 300 1.

<210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> 211 3001

DNA

Homo Sapiens allele 1501 99-26781-25 :polymorphic base G or T misc -binding 1482. .1500 99-26781-25.misl misc -binding 1502. .1521 99-26781-25 .mis2, complement primer bind 1477. .1497 upstream amplification primer primer Ibind 1905. .1925 WOO005851 0 -[http0Jtwww.getthe patent. com/Log in.do /Sexam.suiport/Fetchfiefaultdog/WO005851 0.cpc?fromCachie=1 part=maintoolbar--bottoml Page 711 of 737 WO 00/58510 410 <223> downstream amplification primer, complement PCTIiBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> misc -binding 1489. .1513 99-26781-25 probe misc feature 21,2754. .275 n=a, g, c or t <400> 211 atatgctcat caataattga gcgtggtggc ggtcaggaaa taaaaaaaaa tgtagcccca cttgcagtga tctcaaaaaa t cat tat ttc catccacttt cactgctata gtagttaccc gaatctccat tttgttgttt ttggcttact gtagctggga atgaggtttt atcttagcct tacttgttta catcaatttt ttttaacttt atttgtatat gta agc aga c ctaatatcca gtcttctttc ktatgtacaa taaattgtta caactgtaca tggtggagat atcccaggct aagtagttga tttgtatctt caaaattcca ccaaatattt ctctcatctc aatctgatag gcccgtattc atcccactca tcttctactg agaagaggaa tcgctccctc aaaacacttc aatacaattg ataagatacc ggctccattt ccctttcagt tctcttgctc ttccaagctt acaaagctta tgcagtttaa tgtgtttttg ttttccattc tcacgcctgt tcaagaccat aaaaagaaaa gctactcggg gtcgagatcg aaaaaaaata attctttttc ttggtcaatg aacatgcatg agaagcaaga actgtttttc ttgttttgag gcaacctctg ttacagacac gccatattgg cccacagtgc cattcccatc ttttttgatt cgttttcctg cttcttttga aacccacaga taat ctacaa tcagctcatt tttactgtta tataaaaaac attgtataaa ggaaaaaatg gatggtaaca ttactacgac gtttcagtgt tcattagcaa cattgtgtct tcactcataa gaactccatc tttttctcga cactccagat gttgttattt gtcagcactg tcatcatatc cttggcaccc ccaatatggg aatattcatt cacactccct ggatactctt agcattttgt cctttcctgt gggcacaata aatggcaatc ngtcgtcata ttgagt tact aataccagca cctggctaac agaaaaaaaa aggctgaggt cgccactgca ataataatgg atggctaata ggcatttagg tgcaagtgtc ttgctggatc acagtagttg cctcactctg cctcctgggt ccatcaccac ccaggctagt tgggattgca agcagtgtag gtggccattc ataatttgtg gagttgtctc gtgagagaaa ggaacacaaa tcttgtacca tagtaatttg taaaaatcag tcattaaatt actcttaagg aaaacacatg atgcatcctc ttttcaaact tctttttatg ttttcccaaa cagataactt aatatctcat gttgcagtgg ggactgcttc aaaatattta aaaaccagtc catctgccta tgggcttctt atgcaataaa tgagtagatt cttactgctc ctgtcattga tacaacatgc ctcctacaac ccttatctat gcacactgac gcttagctcc tcacctagaa ctttgggagg aaggtgaaac aaannttagc gggagaatgg ctccagcctg tctccaactc ttccacggtg ctggttccat tttttcatat aaatggtagt cactaggttt t tgcccaggc tcaagtgatt gcctggctaa ctcgaactcc ggcatgagcc aagtgctccc tcacaggagt acattgagca t tcat gt cct atatttgcaa caaatcagca catgcgccat gtgattaaaa caggcagagg cccaggagtc tcattgccag tggaaaatat actgctgtta ttgtttctcc tgatgctaga tctcaaaaaa cggtttttaa ccttaaaact aggccacatt ttatcagggt ccaaatggtt ctgctctttg acacggtgct tgcctgccat gagcaaatgg ttcttctaaa ttatcaaatc tcctacttac tctatttgtg ttccaaaaaa tgaaaaactc aattaccaga cacttatccg cagtggtctc ccgaggtggg cctgactcta cgggcatggt cgtgaacctg ggcaatacag catccacgtt tataaatact atttttgcaa aataacttat tctacttttg cttgtttctt tagagtgcag ttcctgcctc tttttgtatt tgacctcaag accgtgcctg tttccacacc aaagtggtat ttttttcatg ttgcccactt actatgtatc agatcatttt agtaaggaga agcacttaat ccctcctgac tcattttctc atctgatata agggctgaaa ctagaacaag tctaggtcac gagattattc aaaaaaaaaa ttcccctgga ct gagcctt t gcctttggga tact caagt t atgacacaag gaatcacccc tgacaacttc ccagtttcag caagtgaaga aggaatcgtt atcagtgacc ttcttcatag ttgtcttctt ccttaaagtt tatgtgatct tttctctctc tgagaacata caacagctgg cggataacga ctaaaaatac ggcgggcgcc ggaggcggag cgagactccc gctatgaatg acattttctt ttgcgaattg tttcctctgg gttatttaag tgtttttggt tagcatgatc agcttcctga tttggtagag tgatctgccc cctgtggttg atccatccaa ctcattgtgg tttcttgacc tttgagcaaa tgacaaagga ttttccatgt aagtatcttg gaaataattc tgccttaatt atgtataaaa ctctgattac ggactttgcc attagtacta ttgaaatgag tcccgctctc aaaaagaatt aatgcaaagg cttcttcagt aaataccatc tttgcctcat catagatcac ttcctctctc ccaccttaag ggcactaaaa agtggagata gggtcacaca tcatccttgc cagt ttctcc caccagctgc ttaaggtgcc catccttttc tgacatttat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 W0005851 0 [httpi/www.getthepatent.com/Locgin.dog/Sexam.suppoort/Fetch/Default.doqNV0005851 0.cpc?fromCache= 1part=maintoolbar--botom Page 712 of 737 WO 00/58510

C

<210> 212 <211> 3001 <212> DNA <213> Homo Sapiens PCT/EB00100435 3001 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-26782-300 :polymorphic base A or G misc Tbinding 1482. .1500 99-26782-300 .misl misc Tbinding 1502. .1521 99-26782-300 .mis2, complement primer bind 1202. .1221 upstream amplification primer primer bind 1695. .1715 downstream amplification primer, complement misc Tbinding 1489. .1513 99-26782-300 probe <400> 212 aactaaaaat aaatcattaa atgactctta acaaaaacac gacatgcatc tgtttttcaa caatcttttt tctttttccc taacagataa atcaatatct cgagttgcag gatggactgc tttaaaatat ctgaaaacca atccatctgc ccctgggctt gggatgcaat atttgagtag cctcttactg cttctgtcat tgttacaaca tgtctcctac ataccttatc atcgcacact aacacatatc cagcaggcag attcccagga aggtcattgc atgtggaaaa ctcactgctg actttgtttc atgtgatgct aaatctcaaa cttcggtttt catccttaaa tggaggccac ttcttatcag ttaccaaatg gtcctgctct ctaacacggt ctttgcctgc aaagagcaaa attttcttct ctcttatcaa tgatcctact tgct ctatt t aacttccaaa tattgaaaaa gacaattacc ccagttgaca aggccctcct gtctcatttt cagatctgat tatagggctg ttactagaac tcctctaggt agagagatta aaaaaaaaaa taattcccct actctgagcc attgcctttg ggttactcaa gttatgacac ttggaatcac gcttgacaac catccagttt tggcaagtga aaaaggaatc atcatcagtg tacttcttca gtgttgtctt aaaccttaaa ctctatgtga agatttctct tctccactga gactgcctta ctcatgtata atactctgat aaaggacttt aagattagta cacttgaaat ttctcccgct aaaaaaaaga ggaaatgcaa tttcttcttc ggaaaatacc gtttttgcct aagcatagat cccttcctct ttcccacctt cagggcacta agaagtggag gttgggtcac acctcatcct tagcagtttc cttcaccagc gttttaaggt tctcatcctt ct ct gacat t ggagtttcac attcaactgt aaatggtgga tacatcccag gccaagtagt ctatttgtat gagcaaaatt ctcccaaata attctctcat aggaatctga agtgcccgta atcatcccac cattcttcta cacagaagag ctctcgctcc aagaaaacac aaaaatacaa ataataagat acaggctcca tgcccctt tc tcctctcttg tgcttccaag gccacaaagc ttctgcagtt tatccatcct agatgggt ca acaattgtat gatggaaaaa gctgatggta tgattactac cttgtttcag ccatcattag tttcattgtg ctctcactca taggaactcc ttctttttct tcacactcca ctggttgtta gaagtcagca ctctcatcat ttccttggca ttgccaatat accaatattc tttcacactc agtggatact ctcagcattt ct tcct tt cc ttagggcaca taaaatggca ctcaacgctg aatgtaacat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 W0005851 0[httoJi/Aww. etthe patent. comI~og in.d og/$exa m. suppawFetch/Defa ut. dogNVO005851 0.cpc?fro mCache= 1 part= ma i Mod ba r--botoml Pa qe 713 of 737 WO 00/58510 PCT/IBOO/00435 rtccaaaaca agttctggat tgtcctcctc ttttcaaaat ctttactggt caagactggg aggaggcctc gdagcaggca agactttttc tacctcctac agatttgggt ttgagtgtcg cagcaaaccc tgtacttcac acct tctaaa aataaatcag ccctctacct tgtattatta aatatatgct atacaataaa gggtattgtt tgtttaatgt atctagtatc tgacactaaa tttatttaaa g gacctcttgt aatattattt ctccctagcc ccatccatac ctactgacta taatttataa acaattatga agataacatg actatcacaa cgggtccctc gaggacacgg tcttctcagg aaagt ccaca accatcaaaa gtgtcagcta tagtaataac tcccgtcaat ctgttaaatc atgcacatgg cattttgttt tatagaaaag atttataggt agtttattct ttggttatgt a at ta atcga cctcctctgt acccaaattc aatatattag ctctctttct gctatattac agaaaaacag tggcagaagg tgcaggaaac gaacagtgca ccacaacacg ccaaaacata attttctttc cagttggcag t gtga cat cc catgaaagca tatcttctag tgcttcatac tgatcataaa tcaaaaccag taacagtacc tcttagtttc aaaattattt gtatgactat aaataatata gtttaaaaat 412 gtacgccctt ccaaagcaaa caagtatggc tcaatgccat tccattttcc gtttaacaga caaaggggga ttctccttta gggtgcgggg tggggattat tcactagctt ttgagtactc ctccctgctg tttgtgtggg agtatctaat ctaaatctaa tcatataata taatccttca tatctaaagt agaatttgag ttgaaaaaaa ttcctgtgac atatatggga aatgtgggat a ata aga aa a cttactttca atat tt gaat caagtcttcc atgtcctatt tactgctttg ctcacagttc gcaaaggcac taaaactatg aacctgcccc gagagctaca cttattttac tactcaaggt tgtggttcag cctgtgtatt caataaaaac atgggggaga ctttaaagtt aagttagtga taagtgacct ctctctaatt ctaaacatgc taaacatatt tatatatatc aatttattct tggaattttt ttttaaactc caaacaatct tcacctatat gcatttaacc aagaaatacc cacatggctg gtcttacatg agatctcatg atggttcaat attcgagatg agatctcatc aactccaccc tgcatttcac atct gctt tc atccttaata ggggacctag ttaaaagtac gatccaaata ttcgaatatc tttcttactt atttgtaaat aaatatgatt attttgttat tttaaataat aacattttta 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <22 1> <222> <223> <220> 213 3001

DNA

Homo Sapiens allele 1501 99-26783-81 polymorphic base A or T misc Tbinding 1481. .1500 99-26783-81 .misl, misc Tbinding 1502. .1521 99-26783-81 .mis2, complement primer Ibind 1421. .1440 upstream amplification primer primer Ibind 1857. .1877 downstream amplification primer, complement misc -binding 1489. .1513 99-26783-81 probe W0005851 0 [ltqp/www.getthepatent.comLogin.dog/5exam.supportJFetciIDefaultdogi00058 5 1 0.cpc'?fromCache= 1 part~maintoolbar--bottom] Page 714 oft737 WO 00/58510 PCTIBOO/00435 <221> misc feature <222> 2988. .2989 <223> n=a, g, c or t <400> 213 gaaaatggaa aataagagtg aaaactgtat acaagacctg aatgacagga gatctacatg ctgatagaga ccctattgtg accttaattt tttacctaga tgtttcacag tgcaaatata tacactgcct gaaagtcata tgagctgctt ttaacataga attttgtaaa gaacacattc gcttgatagt attggaaaaa aaatctcctt gacaaagggg gaactggagt gagtatgaaa aaataagaat wtacttcatg tagagattct cctaatgacc taaacaaaga ctgctaactg cagatttctt tttgatagtt aataagttac aaaaagcact at tgta aaa g atcccatttt aatagagaca ttattgctaa gattttctag aatgctgatc agcttatgag tat aat tgca ttgtatatct agacaagcag gaattttact agcttttgat tcatactcgg gccagctttc ctaccaatat ctaatacatc tttttaacat tcattattta agactatcaa aatgtaagag ggggccctat aatcacacag cgtggttagg taacacaaag ggatgatata ttttcaattt catttggtat taggaatatt cttccagtgc tcacattata tgttgagcgc tagttgtact caaactctac taggagcatg agaaacttcA tgtaacaaat ttggcagaaa ttcatgggaa ttcaatttct ctgatcaact tatacaaatt tctagagcct t ga gca tgga tggtggagca tatgtttaaa ataaactgat caatgggcca gaa tgt g tta at tat ca ca a ttagtcacag gagctgtaaa agaagaagta agatagacgg ttatatgatg aacatttagt agacaatgac tgaagtctac ctctgggaag tagatcttac t taat tgca c atgttgtaaa gtttaaattt ttaatcagta tcctggtgga actcatattg tataccaaaa ttttagtctt agttatatat gactatcaac acaggttcag cctgtattta gtcaaaggat gcagggagaa cagcccttta tttattgtga aaataagagt gaattgtgct tgtaaaaatt catttctgtg caatgaatta ttttgcatct ggagggaaag agtgataaaa attccaatta ttat ataaga tcaatgaaat caaaggtaaa atatgtaaaa ataggaggat ttcatgaacc ttgcacataa acacatgatt agatagaaat atctgaattg gcactggatt ctggcgccaa ccccataatt acttttttaa atgttcagta agaagctcga aattttcttt ttttaagcat tgtctaaaaa aggtgggaaa aaaatataaa ctctattact aagtcactaa tttaaaaact caacttggct ttaaattgac gaaagaagtt tagagttgag aaacaaacta tgacacatgg atggaatctc aaaaaaaaaa cccaaaggaa gatgtcatga actaaagaaa tagaaaaaga aatgctgaaa gcagtgccac agtagcaaac attttaacta taacaatcat tggtaggaaa tagaacaatt atattacaaa ggaaagtgtg ggagacctta ccacattaac gaaaaatatt aggccccagg ttgtgatgaa cagactaagc gtcaatgcat tcactattga taggaatgag gagacctggg taggagttag tctctgaaag gtttcgggac aatatggtag ccacctatag caagtctttg aaaaattgat atttatggtc aagtcatgca taatattaga aaggtagata aaattatgac cagaagcaac aagcatgaag tccaaatagc aatagttttt gtttggaaca aaccctaaaa ctagtgatgt actaattttg attttgattg cagaatgctc aaaattaaga gaattagacc taatacagat tgtctcttgc aaaaaaaaaa aaaaaaataa catctaagca accttgaatt agtgtctaat ggtgtaacaa agaaagactg taagataagg aaaataattt cttgtcacgg catctcacat agaaaagagg agctagtcaa gct at gtgt c gcattcattc caattgggaa cttttcttct accaaactga gctgacctat taatgtgcaa agcacgaatc gaacactcag acggaagttt ctgtgacctg gcttaaagga gct ttct at c taatacaaac aactagaaga aattctttca ctcctggaag cccaaacata tgatatgata aaatatttca tttCcctttc cagatactta agctaaaaaa acacaaaatg tgattattgc tcctttgtgc ttttttaagt acaaaaaaaa a gagca tct C ttttaagaaa gtctgcttgc attcaaatgg aataagaaag accaaataaa caaggctcct catttgatag atgccccctt aaaaaacnlt cagatgtaag aaaataaatg tgcacgaaag atcaagtcag tgtacataat ctgaagaatg caagtgccaa aagatttgtc aatggttaaa tgaaaatatc ttgctattga gaaatcaaat taagcactgt atcctcaccg aataattgca acacaatgtt agattagcta gtatcaaagt acaaagaaat tattaaaggg tgggagacag tccattttgg ct gt t ggtga ttgctaattc cacttgcata atattggatt agcaagtttc cttgtgaaaa ccacaagtaa attagaaaaa tttgctctct tacaatgctt ttaacttgtg aaaaagtaaa cccatctcgt gtttgaagga agaattcacc acagactgca ttagtttcCC aaagtctgac atgagaagtC atagaccttt acaccaagct tattcctgat gcttggggaa ttaagtgact aaatgctctg gccaagaaaa ctgataaagg atttaagaga 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> 214 <211> 3001 <212> DNA <213> Homo Sapiens <220> W0005851 0 [http:Avww.getthepatent.com/Login.dog/Sexam.supportFetchDefaut.doQNVO005851O0cpc?fromCachie=l1part=maintoolbar--botomlPage 715 of 737 WO 00/58510 PCTIBOOIOO435 <2 21> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <2 23> <220> <221> <222> <223> <220> <221> <222> <223> allele 1501 99-26787-96 polymorphic base A or G misc Tbinding 1482. .1500 99-26787-96.misl misc Tbinding 1502. .1521 99-26787-96 .mis2, complement primer bind 1406. .1425 upstream amplification primer primer bind 1872. .1892 downstream amplification primer, complement misc Tbinding 1489. .1513 99-26787-96 probe misc feature 2873 n=a, g, c or t <400> 214 cacgacgatc cgcacatgaa atttgtatga ttttactgtg agactttatc tgttaacaat ttgtgaactc tggatagtgc aattttttaa caaattcata ctgcttctag attaatttta gaagaagcca caaggtccaa gctctccaat ccctttcaca tct tcat tt t acagttgggt atcacacaca tatgattgga gctcctatag aat tcaattc aaaagatttc tcctccattt tttgcattcg rtgaagaagg tggagagct c tatataccgc tctcacacac gttggatttc tattctgaat attaataaat tatgccaaga agtttcacag acagacctgt agatgtcaca tacaatgaag tcacctaaac gaggtagata aacataaaca ttatgtaaat ttgatctgtg ccccagagca catgtgcacg gtaccttttg aagacaaagg gtggcactca attccaaaaa cacctggtac accaacataa aaatgtgagg tagcgtctgg ggaaatatgt caggacaggg tggagttgga aatttcagga agaccaggaa aagttacagt gctgcttctt gt caattctc gtacttttat tttatgtgtt ttccttgata tactggataa gatgattcag tttatccaga ctattacttc tttctcattt gctgccgtgg atagcgttgc cttctccttc cgttaccttc aaactgggac actactcgca actgtgcatt aagtagacat aatctgaggc accgttcatt gacgaaaata taaaggtcag tgagtgctct cagagggaga tggccctcta gtccttggag caagaagtag tcaagatggg aacacacatg tgtgttatct tgaacttcat ttgtaaagct ataaaagagt attaacttta gctggctaat ataacttata taatgagtgt taacattcgc aggacccttc tgacaagttc atattaatag atcccaaact ttcactcaca cccaaccttc attcttgttt tttagggtgc atcatggaac gactgcattt ctcaggcatg gttttttgaa cactcagcag cgctggaccg ag tt c tccca tgacactgtc cgaggctaac agaaaagaac actaaacaca caatttaatt tcgcatcata gttctagaga caatctttaa aaagaaacat agatttgtta ttaatcagac cagaatacca agaaaggtta ctttcattct cctccactta agtcactatt agtgcgtctt atagagtagg actgtagttc tggcttcatg gtgtgcactt agactcaaac atagtatgaa ttaaagcagg agaatagttg agcagattt t gatcttctct tgagccctca acttggacaa cagcctcctg gtagtgtttc ttaatgggta acatattcat attggggtgc tgaaaatgct agaaagggca atggaaatac ttgttttttt ttaaagccta tttttgggca agacttagaa ttcagaacct gagcatcact agttataaag ctgttttttc agtaagtgat tctagcctac cttgtacata ctttctagta tttaaactaa gtgcaaagaa ggagaggtag aaggtggaga ggggtgaagg gccaattgtc aggacatggg aaagggaacc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 W0005851 0 h ttp:/tww.etthepa tent. com/Logn.d ogLSexa M. SupotedefutogW051 _.~~rmaIe art=maintoolbar--boftom] Page 716of 737 WO 00/58510 PCT/IBOO/00435 ttaggtgagg cttgccaccc atgcagcaca ctctctctca ctgctgtctt caaaagcctt tggcgtatct gtgggacggg cagaacaggt at tgt gtgt g caaagcagcc ggagcaaaat ttaaaaaatc tgttgcaaat ttattttgtt ttcttattat tatgaatcat ccataaattt cttggtataa cttgcttctg tttttttttt ctcggtcact g ctgctctctt agcgccacta acatagaatt agtgaagcat gagcatttct agaaggcaat gagaaggtga gcatggaggt tgaaaatgtt t t tctacccc tatcttcatt caaaaatgtc cat ct ccaat agattcaaga ttcttcctat ccatcaagga agagtaaaat aatcactcag gtttttacca gtcttgcctc ttgagtcaaa gcaacctctg caaatgaagg ccagcagctt caccact cca tgctgtagta gtactgagca cactattgtt taaaggccgg gaggtagaag accaataaac tccctaccca tgaataagat aaacttgaaa ttgaaacagt agatagaaaa taatggatag acttgggacc ttttctgcca aatgtactag tcttcctcct catacaattt ctctcactct ccttccctgg 415 gaattctcag gt agaaaaaa agaaaaagga agtctataga ctttatagag attttctttt agggctgaag gaggtcctgt atgtgagcca ttgtgtttgt gtgggtatca taaaaataat cttactatgc agcactaaat gaagtaatta cacaacccat agtcttagta tgtttatacc acattattgc attctattca gtctcttagg tcaaacaatt agaaggccga atattttaaa agaagtgagg aaacatgcat attattttca tacaaatgag tgcagacagg agtgggggcc gcaaagattt aatttcaatt gcgaactttt tagtaatata ctcgtacaag ggataaattg tacaactaag ttgttttctt ggacactttt aaatatctcc aatattcttc caggaacaaa ttggagtaca ctcttgcctc ggactgacgg tggggaatac attgtattat acatgtgtaa ttaatcttta gaaagatgct gatggagaga tgatggggct acaatttctg acagacattt aggcaaagag attttttaat ttagtatttc gagagggaaa atgatacttt taagcagaat ct tt cct tac attgttaaat taattatctc agntttttgt gtggcacgat agcctcctga 1740 1800 1860 1.920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> 215 3001

DNA

Homo Sapiens allele 1501 9 9-2 678 9-2 01 :polymorphic base C or T misc Tbinding 1482. .1500 99-26789-201 .misl misc_binding 1502. .1521 99-26789-201 .mis2, complement primer bind 1301. .1319 upstream amplification primer primer Ibind 1771. .1791 downstream amplification primer, complement <221> misc-binding <222> 1489. .1513 <223> 99-26789-201 probe <400> 215 taatcgccat gtgtcagaga gagatctctt gggaagtgat tggatcatgg ggacagattt cttcctggct gttctcatga tagtgagggt tctcattctc acaagatcta atggtttttt taaacgtgtg ttgcacttcc cccttcacct ctctctcctg acaccatgtg aagaagatcc W0005851 0 http:/Mwww.getthepatentcom/L gin.dog/Sexam. supp~ortIetchIDefa ult.dogAN0005851 0.crpc?fro mCache= 1 Dart= m ain taooba r--botom Pagje 717 of 737 WO 00/58510 PCT/BOOIOO435 ttgcttcccc cctgttaagc CtCaggtagt tgaataagaa tgaaaaaatg ttcccaaagc ctgatttcct cca at tgct g ttatatatat gtgtgtgtgt attacttgta caaagagtat aaaatggtat aaatattttt catgccgtta aaagccaacc ttagacctag ataaagaaat aaagaaacaa gccaccgtgc tattttaatt cttattcagc yagagcaaga gataatatat accatgtcat gtcaaaaaat ctcattgcta ctaaaacttt ggtggcagtt ttacaataat tgttctttgt tttcaaatga ttattgtcct acaacacaga tatttattat cagaaaataa ttacatatat atggatatct cattctattg taaacatact ggactttaag tttataacta taqagaccaa gatctttgtg acaaaaaaag gtgtagtctg caaaacatgt g tttgtctaac ctgtggaact tcct tatagc atgggtgtgc aaatctgtag cagcacaact ctggaccctt agccgtatat atatatatat gtgtgtgttt aaaacaaaat taatgaatgg tcagctaaat aatgtaagac aaacaatgga accagaaaat tgttaatcta cat tgt gcaa catttgctat catactgttt gttgacattg tttcttcatt gttaaatgtt tctgagtccc tccattctaa aatatgagtg gaagaggttg atggtatcaa agttttggat atcagttttg ttgataaaat gagtaacgtt tttatacttc ttatcaagtc atatgcatga atcacctagt atgtttactg acattattat tgctcacatt actctcaaac atatatattc gagatgacct caagccatgt tgtctataac aagaatgaag agccct ctgc tagtgaaata accatgatgg gtaagtcaat agtgtgaaaa atgcatgcac catgcagact t gaa aat tt c tcgaatggga ttctcaggga atatatatat gtgtgtgtgt taaattatta ttaatgcatt ctttcaaaat ttgagtagtt atgttgcaat tccaaaatat ctcatgaaaa ttaattactc aatgaagcta tctcaaataa atttataaat ggttgtattt gccccaaatg aaatgcaagt gtattagaaa ttatttaatc tatatatact gctctcttga taagaatact attctcactt gaatttgtac ttattttttc agttacctga ccttcttttt ttatatatat atagaaatta ttataaattt attaatcggt ttaagattat ctttctgaaa tattaaatac ggtggactta ttgaacttga agaagaatat aacaagaaat ctctgtatac ctgcaaaaaa taagcttcct taaacctctt tggactaaga acacacacac gcctaaaatg ctgaagttaa acttctcggt ctagtatatt atatatatgt gtttgtgcag catatggttt agcaaagtga gagtggttta ct taaggaat cacaaatcta ttcagttagg cagcttatta gtagattttg aaagataatt cttgaaccat agtattataa ttaaaagttc aaagtttaat cacttttatt caagacttct ctatttttta gactaaagac tgtgtttttt ttaaacctac ccaagtttcc atttgaccta tgcaatattt agttgatatt tgtatatgaa ttataatgat cacatagctc aggtatagca atgaacaaat tattcaaaaa cttctgaatt atgtagttta aaaagtgaaa catttgcgtg gactgggctt ttttagggac acatcaattg aaaaaaaggc gaggcctccc ttcctcataa catgtctgat acacacacac cttgaaaaaa cccatcaaac tcttctaaaa atctaaaaat gtgtgtgtgt tatggtgttt cctccagctt ttctgacttt agaaaggttt tgtttagatg acattgtagg ataattaatc aatggaat tc tggtgaaaat aaaatcaact aattaaatat tgtgtgggaa aactgttgtg tagaaatatt cagcgaaaga tttctgtctc aa aaa t taaa attgactgta catgatgcag ctgacactgg atttttattg aaatagacac atctatggat tctaaacaaa tttgcatgtt atagtcacac cagtattaat aagttataag caggccatgc aggtttatta aaagctat tt taatatccaa aggatataat ttttctattc ggatatatgt actcatgcgg agcaaaacaa cttcactaat agtcatgctt attacccagt gtgtaattgt ctgtgtcaaa tagaaagatt ttaattcctt ttatatgggc tcagcagaaa gtgtgtgtgt gtatataatt tggatcactt tgacaaacta tcacaactaa agctcaaatg agagagaaaa caaattctgt aaccatcaca ttcacttatg ggcatagagg ttaggtgtga atctgtgctg actggctata ctaacctgtt tactttatac ttagtgatgg aaattggccc gctttacaga ttaattggag tttctataat atgactgact atttttgttc atattgccat tgtataagcc atatatatct ttatgagaaa attgtagtat tagcaatata gtatccctcc atgtgaaaag acttgctctg cctcattatt aaaaaaacat acagtacctg aggatggtta ttttttagtg cctgtcttcc ttagcacgtt 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <22 1> <222> <223> <220> <221> <222> <223> 216 3001

DNA

Homo Sapiens allele 1501 99-27297-280 :polymorphic base T or C misc Tbinding 1481. .1500 99-27297-280 .misl, W0005851 0 http:/ Aw.getthepa tent. co m/L gi.d og/$exa m.su pportIFetch/Defa ult. doqNVO005851 0 cpc~fro mC ache= 1 part= ma intool ba r--bottomjf Page 718 of 737 WO 00/58510 PCTIIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc binding 1502. .1521 99-27297-280.mis2, complement primer Ibind 1761. .1779 upstream amplification primer, complement primer bind 1206. .1224 downstream amplification primer misc Tbinding 1489. .1513 99-27297-280 probe <400> 216 gaatgtatgt acactaagaa actttgtcat cttctacatc aggacttagt aacaccttca tacaggattg ttcattttcc agcccatatg ccccctccca ggaaattgat gtgtccttgg aataaaaacc aaatcttcaa gacaagtccc aactactagg cttaagttaa tcctgcatat ggaaggtcca attatgcaat attgact cat tttactcatg tctagaatgc catatataac catgcctatt yaacacatac taattaatca tgagcaaaga tttatgagat accagggcta aacagaccat tatcttgggg atagacatag ttattcctgt catgtaagta tgaaggtaac ataacaaaca tactgtacgc ttaggaagtg cctccagtca aactgacatg gtattccatt cttcctggta gtactcactg actagtacat aattaaacaa gtcaatagat actt t tca tg tgatttcaaa t caa taat ga cctccatctc gtgtcagaca ttatatgata tcttaacagt tgatttccat ctactcttca ctttgttgcc gtgtaattca accgtaaaat aagctaccta gagctgaaat tccttttcta gaattcattc tattcaagtt ataaaattat tcaagtacat aacctaatga cattacaacc actagaattc tggtccatct ct tcat tg tg gggaacacac atggaaccca tctgaaggta ctctgaattt cttaacagtt taagcagtat aaggaaggct tgtattatta ggtcctctgg tctgcctcat atttcttgct tgattgaaga tcttggatgt cat a acatt g ttcatgaagt gagacatcat gctttctacc ccaggctttg atatgaaatt ctgaaagtaa tttccttcta ggcctagttt tagtcttaaa ggttgtttca ttttcacaaa cctaaattta ttgactccag ttatttgata aattttaggg tttgcattgt acatttttca ccagt gagat ttatgaaggt atcaggcttt gtgaagtaaa agtacactgc ttgaattaaa atcagtattt ggagcattca ctgagaaatg gacctgaatc cactttcaat agtctaaaca attttagata atatgctaca aaaaattgac agcagcagca tccagtctcc ttattttatt ggaagaggac taacaatatt ctatgaatcc aagttgaaaa ggaatgagaa accaaattac tgtgagagtc atttagaagt attcttttta tttctgcaat tatcttttaa tcatttccat agttttcttc tgaattctgg ccttaatgtt tgcagctttc atgaaattca tcttttattt aggcaaaaat ttcttgtttc aaaatatact accattacta tcatgcctcc tgcaaagcaa cagttgccaa aacgttttca gtataacata actgcagata ccatagtgta gggtgaacag aatgatacta tcaagatt ta tatttaccca ttttgaaata gaaaatcaat atatttttaa cataagcaat ataccattca tcacaataaa acctacgagt tgagaagaaa atattcggct ttttcttaca atgctgctcc tgcatacgac at caa aaat t ctatcctctc aaatacaatg cagtcatttt aataatttaa gtggtaattc cttctccgtc ctttaaactg atcttctact atctgctagc ct tgcctgta attacaaact aaatttctgt attctctcat cttatctccc aaaatgggta aatgtatgtt tttgatgtag tgagtctcta aaagaaatat atgatgccaa agatgtttat actgtttctt accggctgat tatttttcta ct tcagcatc gagaaaagac agaagagccg gggtcaaatc tttgcaaata gtatgtttcg tattttgttt cattttatta tgcaataaaa caagctgtta ctgtatttta catcagaagc ggatggcttc agcctctctt agtccttcaa tatttatcac tatgacccca taagccgtaa at ttat atga taatatagta aataacattg atattaatga tctccttctt cctattccag ttgggcaaaa acttctctgt aaatggggat tcctcattca agattattga' cattatcaac aacaatgtct gaggaaaact ccagagcact ccttttgctc agtaagagtg gtagtattta aaccttactt gtttgacaac ttctatgaaa aaccagctct aatgtattct cattagtttt atgaagactg caatttcaaa aaggatttgg cat ga tgaga tatctacctt gacaccaaca tacctattca aataatatgc caaaatagca atttaaaagt agtcgaggga taaagtgttt tgattttata taagctgatt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 W0005851 0 rhtt:/twww.getthepatent.comILogin.dog/Sexam.supportFetc1/Defaut.doMVO005851 0.cpc?fromCar-he= 1 part=maintoolbar--bottomj Page 719 of 737 WO 00/585 10 PCT/EBOO/00435 aaacattttc attgccacta caatgagtga ttcatccagt caacatttta atcactgagc ttcctgtgtt tagaaacttt gtatttttta a attatgtctt ttatcatgat acaactgagc ttactgaggg ttctcacttg atagttgcag ccaagccttg cat at ttat a tattaatttt ctgtaggcac caccttgatt cttaatatca actctgaagg atacacagaa acccagaggg gcaaaagcca ccactattca cattgatcta 418 tttctctgca ctgaaccatt ataacgtcta tatatttttt tccctcaaag tatgctagac aaacagcat c ctgatgctag aggatacctt gggttaacaa ttggctattt taacattctt gcatatgtaa tcaccacctt atgcatagct cttcatgcta ctagcatggt tgtcacacag tgtcatcttc ctccatcagt caatgttcac agaggtcaga attaatcctc atgtatttag agttcctttt attcaagaaa ctgaattaat 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 217 3001

DNA

Homo Sapiens allele 1501 99-27306-108 :polymorphic base C or T misc -binding 1481. .1500 99-27306-108 .misl, misc -binding 1502. .1521 99-27306-108 .mis2, complement primer -bind 1395. .i4 upstream amplification primer primer -bind 1822. .1842 downstream amplification primer, misc Tbinding 1489. .1513 99-27306-108 probe complement <400> 217 aggcactcat gaggtgctcg caatgggagg aaatgatgtt ttcttgtctc tatgttctaa caatatttac aatgacaaca tccacaacct taatgactca cacaattcat ataatggttg gaaagcttta tacacttttg attttactca ctgacatata agccacttgt aaggaaatct aagggagtac ttaaaacaaa atgctttata aaaaattatt catattagaa caatgtgcat aaaagcaggt cctaataaaa tgttttgttt aaaaagcctt caa at ggat t tactcttttt ccaatgattt aatcttccaa aaattgtaag ggcttcttgt atttatctta acgtacttat gggcggcttc gggtattcca attaaatcat tacgtgataa gagaagaaat taaagcttta aaggtatatg tgcagataac tttaaagttt taatgaaaag tatagcatca acattggcat agttaagaag gagtttcctg atttttattt atttccatta agagct gcag aagacctttt ccaaaaaatt catattagtt ggcgttgctt ttttcatgtc aaaaaaatgg tatggatatc cttgtgatgt gcactaatct tgcattggtc aatttattat gcctttgcct gaagttaggc atttctcctt tacaaataaa ttttcagact gattttgtag ttaagttgtt tcattaaaat aatatttttg agctttttca caagcctcac ctttgttctt gtaatctgaa atcttgcact atttggagaa ctttattcag tttgactgta aatgcctttt gaaaggcaca a gt tga tct t ttatattgat t gt t tatt aa aactatattt cctatctctt ttcaatatat agagatatgg catacgaccc acgatatgaa tcgaataaat tattgatttt ctaatataag acatatcaca W0005851 0 http:/www etthepatent.com/Lo i n.d og/Sexm uorttFetch/Defa ut.d og1W0005851 0.epc?fro mCache= 1 part= ma intoo Ibar--bofto ml Pa qe 720 of737 WO 00/58510 PCT/iBOO/00435 ttcaagtatt aatccttgaa gactggctca tcatttctgt ttcagctcac taggggctga tgactaagtt tttcccagga ctcggcttct ytaaccatgc tgtgagcacc aaacgtgaac acccaaccca aaggaactat.

cttttcttct tatttttgta ttctaagact tagtaaaaat cacagatgca ggctgaaaca aggtgagcac aagttactta tacttatttt ggtgtgcaac attagttaac tgtgtgagat aacattaact tgcatttggg ggggacttct tactggaata aactatactt aaaatagcta acagatttta ctgacatttt t cggaaactgt agct tgagtt cttcattcat cagt tg tt ct agctccaaca cattctttca gtgtgacttc gtgtgaagtg actgtggtac cctgtgtttt ctctaagggt acagaagagc ctaagactct actgatttac c ca ct atact aagtaagttg ttacatttat atgtaatcct aacctgtaat catctggaag agtgactgac ctatattgta ttccagcttt at gatatt t t atatccatca aaggatactt gaaatcacaa tcacagcttt tggaatttgg atgacccatt aggcattatt aaaaatcaaa tatgttctta caatacttca gaaactttgc tgctactggc ttttgaggaa ttcaagtaga atgcatgggt gaaaaggaga ct cagga cat gtgaagacac cat cccgtaa ttaggaacac ccgaaatccc catatatttt atccctgcct ttttctatcc cccctagaac tagactctga taaaaaatat agtattgctt gcagtggctg attcttcttc atataacagc tattaataac atagaagtat gatatacata ctacaattag aagacccatc tgctgtatat tccacatctt caattttgct atattctaaa agacacaaat at aa tagtt t ttataaactt gaagccagaa 419 ttgatagata aatagctact gtctgccaaa agtggtgttc gcttctcctc catgccaata tcattctcat gatagatgtt atatccacag tgtttactat acttcgagaa taagactcct tttaaccatc aaattgtaat aagctcagtc cccgacacca aatcctatta cttggaaaag aaacgcatct ttctcctttt agattgggat agggatgcaa actagacaaa tat caaatgt ttaacatttg tctcagcaaa taaattccca attttcacat ttttgttttt gtt cat gacc agaacaaaga ctgtacagga atttttgaaa taattctgtg agttttccaa gtccgttgtt tgcccaaatg cctaaaaagg aagaaaacca aggctcaaga gggaatctga agcacactca tgaaaaagga tatggaccct ccacagccaa tcagataaat cctgctatga agtgggattg agcca catt g acaccacacc tcgctacatc ttgtggcaat ggaagattct tctttcttca gcaataaatg taaatatgta taagattagt ggaatgatta catgtgtgtg ttataactga accaataggt cctttttgtt tatttaaaaa tggactttat atcataaata tgacacattt tattttctgt tgtatttttc atttctactt ttcccgaagt tggtgaaact aagaagctag tcacatgctg tttaattaca agttttattt gagctatggc tgacgacgtc ttgaaagctt tgagcaatgg ctcactcccc tgggaaggat gaaagagtaa atgtacttgt caatgtagag tattaaaatt ttaatgaaat cctctgcagt ctttccctag tgtatacaat tacaataagt atacattcaa ccagaatcaa tgtgtttgtg gcaatacaga gatttctgag gtaaaaagat aaaaagttgt ttttggtgtc tatttaccaa ccctgtgcta gaaagccatt acttaaatag 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> 218 3001

DNA

Homo Sapiens allele 1501 99-27312-58B polymorphic base A or C misc binding 1481. .1500 99-27312-58 .misl, misc_binding 1502. .1521 99-27312-58 .mis2, complement primer -bind 1445. .1i463 upstream amplification primer primer-bind W0005851 0 fttQ twwwelhe patentco m/Login.dog/$exa m.su pporletch/Default. d oqNV0058 51 0.cpc?fromCache= 1 part= ma intoolba r--bottom] Page 721 of 737 WO 00/58510 <222> 1940. .196042 <223> downstream amplification primer, complement PCT/EBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> misc binding 1489. .1513 99-27312-58 probe misc feature 83,95,495 n=a, g, c or t <400> 218 atcctcctgc t ga t tt ttct cttgctctgt ctcctgggtg cgccaccacg gtttgctagg tgttgagatt tgtagagatg tccacctgcc ccatatcttg cttctctgtg tgacattctc at cctgtccc tttgccttct ttttctacgt aaatacatta actaaaaatg tatgtgagat ct gaagcaag ctgatccaat ccagtggaac ttatgttaaa aaggcattag tattacctga catcactgtt mggagaggaa tcagcagatc ccacagtggc aggtgcttac tcctgaagct caatgcacag gcaggcattt ctctaaaaac caaactcata attaaatttt gaagctgaga agagt caaac ttttcagaga gaact ggaaa taaaacacag acctggcaag tgact cccac tacatgctgc gggtaacatt acacacggac tatctcagaa attttattta tacatatgaa taagaagaaa ctcagcctct tttcgtttct tgcccaggct cacgccattc cccagctaat atggt ctcga acaggtgtga gtgtctccat tcagnccttc cctgaactat atctccatct atgcttaaaa ttgctgacta gaacgttaca ctaaccaaga tctttgtata gct gtgt tcc actttgcaag caaacactcc aatagactca aatccactac ggaaataaaa tcaaacaact attataatgt acgatgtgat atggaagctt tagcatttaa cttaatttaa gagcctttgt taaatatcct tgtgctcaat cacagtgggc agaggcaaac tagctttcat ctaaataact cagagacaca ccgggcaacc ctggcatctc atggtgagta aaaggggctt aattagaagt act cagaaaa tctcttacaa ttttgctaga attctctctt ttaagtaagg aaacaattgc tttaataaac ggaaaaagtg caagtagttg ttntctttaa ggagtgcagt tcctgcctca tttttgtgtt tctcctgacc gccaccgggc atagcaccca caaattgctg taaaatacct ggcagccaaa tctt caggta aacacaactt atgaaatgaa accagtgagc gaaagaccat atccaccatg ttacaatgac agaacccctt gtcaggctct tgaaaggcag caaatattaa ttatgtacaa tctatcaata ctccacattt aaatggtaag actaaattgt aatttcccac ctttctgtat gacattttca aagcatttga cacaggagaa aggttctttt tacatgtcag ctcttggggt ttaaacttat tggctctgaa ctgtaagtgc ggaaaa cat g gtatctccct ctctgtgaat ctgaggctga aggtttcaag gatgaatttt cagttctacc atactattct ttggatataa actttaaaac ttatacagga ggaccacagg ctttnttttt ggcgcgat ct gcctcccgag ttttaataga ttgtgatcca ccggctgtct ggctggtctt ggatgacaag gttatctggc taaactttta gcttgtcatc gctctcaccc t ctat cat gc ctgagttaag agtgtcctca cacccctcac ctt tcagaat tttcataaac tcagaaagta ttatcccttc cagctgtttt ttcttcagga ttagctactg tacagagaga atcacttatt actggctcca tcctctttac atgtgagatt gaattggtca tgcaggaaat tgaatgatat caccttaccg cgattgttct aaaaactata ccaagaccat t cca gct ct c aggtaaatca ttaatatcac aaattttgta gtataacaga catttggatc agagacagac gcatggtgcc ctt aaatgat tgagtatgat aatctctgaa atctttattt aacgttccca tgtgtgtcac tttttttttt tggctcactg tagctgggac gagagatggg cccgccttgg ggctgatttt aaactcctgg tgtaagtcac cttccactca aaaccacata agtctcagaa tgtctcataa caaattattg aacagcctga ct tgt at ttt tgcattttag taatgatttg cgccctggac gagaggaaat aactcacatg taaaatgt ct tccacagaaa tcataaaaaa aatgtgatct tttgttcaga gagtactaac cttgcaaaga ctcccctttg ttgccactta aacgaaaatg tcgctgctgc tttctatgat aagcaatcat atattcatct atctgaaaat gtcttgttgg aattcccaga aaggaatttt gtgagcacag ttatctgtgt taaaacatac acaatttaca cagcagggga ccttagaatc atgaatgact attgagattt tcaaaggtaa taggaatttg catgcctggc gaggcagagt caagctctgc tacaggcacc gtttcaccgt cctcccaaat ttaaagtttt gctcaagtga cgctccactt gcatttaatc aaatctatcc ataattaaaa cagtctcttt tataactgta ctcgtttggg gtctgaggag gtgttcagat ttcccattca agaaggcttt caaaatctac cagattttta actaatatgt gtcggcagct ttattcacaa ccacattttg agtttgataa tgtggtcaca tgcttaccga tgctgccagc aaatggggcc ctggcatgta acagtggtac cgtgtttaag gtattaactt t acaa ct gca aggagagaac ctgtgctgtc agttaagtga aaatagttat tgaatttctc ccactctctt agccacatat a ca cact gaa ggaatgtaga tgaaaacagc aaaaaacaat ttatttaaaa acatgaagat acatatttgt 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 W0005851 0 http:/Mwww.getheatent.comIL 1n.dog/Sexam. support[Fetch/Defa UIt. d ogiWO00585 1 0.cpc?fromC ache= 1 ~a rt= m aintool ba r--bottom1 Page 722 of 737 WO 00/58510 PCT/BOOOO435 421 ggttttggca attatacgta gaacctctgg aatacatcta caaaacagat gttttagagg 3000 g 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 219 3001

DNA

Homo Sapiens allele 1501 9 9-2 732 3-372 :polymorphic base G or C misc Tbinding 1481. .1500 99-27323-372 .misl, misc Tbinding 1502. .1521 99-27323-372 .mis2, complement primer bind 1132. .1150 upstream amplification primer primer bind 1610. .1628 downstream amplification primer, misc Tbinding 1489. .1513 99-27323-372 probe complement <400> 219 ttttaaagca tggttatcta ttttttgtgt tccacaaggc tccccgacac attgggggcc cat cac t tca tcttcaataa attcctcatt atggttatca.

cgttcacatt tttttttata ttcttttatg gtccaaataa ttaagaaaat atcaagcaga.

tctccttgta tttggcagtg atatggtaag tgcggagaac aaataaact t attaatagag tccatgtgac gaaaacatga cattttactg ctgtggtata ccccaaatct atcgactggg ggctgat tag actctgaggg tttctttttc taaatatttc ttatcccttt tactcctgat ccatctcctt gctggttcac tactgaataa gtgtttatat ctcattcaga.

tacttaccaa agcaaatgta gaaaacccat cagagttgtg agctgctttg ttattgtatt atgggttaat tatgagaatt aaagctataa aaaggtttcc acagaccacc gtactttgtg gtggcttggc tgctggctgg aggcccctgg cagaaacact actatttctt tttctaaatt agtgttattt tggttatctt tcaaaatgtc aat ttaaaaa t aa ttgt tgg aagtaagttg gttgtttggt tatctatatt ggagggttta ataaattggt ccatatggtc atgtctatga aatttttata tgcaatacag tctttagaat tatttgtttt ccaacattta tagggcttgg agggaccggc cagtgtgttg attttttaca ggcagctaag ctaatccttt ccattttatt ctttcttagt tccatttctt ttactttgcc tactttatca.

ggtttttttg tttaaaaatt agacattagc tacccctgtt ccggtttctc ttggtcaaac tgaga cccac gaatgtgggt ctatttcttt tgccactctc tagtacatcc aataaataat gtgacttaaa caggaatggc attttcattt agatctcaac gttaaataag ctgcatttta.

gtttccactt atacttaagg cttcttatat caccgagcct atttttgaaa tggtgggagg tttgtgtgtt ctggaccaaa agtatttact actaggaaag tctgtaccct aaaattagag agcagttctg ttgtttttta ttcctttgac ctttgctttc agaacttttc gccaaagata ataataatta tcatctctgt ccaaggcagc tgcggctgtc ttttatacta tttgttggtt attttatttc tgcttttaat aagcgctata ctttgctctc t ttat tt tca tacccgtgat ttttgaaagg tttaccacac aatgtctgct aaatcttgtc tgttgcaatg gtatctggct tgtacatggg ctgtatcatg cattaagaat attgatctac ctgtctctat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 W0005851 0[http:/tww#.getthepa tent. co m/L gin.do /Sexam.supportFetch/Default.dogAN000585 10.cpc?fromCache=l1part~maintoolbar--botomJ Page 723 of 737 WO 00/58510 PCTIiBOO/00435 tcctatctct stttgttatt taaagacgga ctgattatgg ggaaacaat t tgacttgcca tagtgatttc cagctttatc ctaaaaatat ctacataaga gagtactttt agcatctgat tatgtgtata aagcaaaaac tcccttttca tattatacat tgggtaattt cgggaaactt ggccagatgc atgggggaaa gtgattacaa acattctaca gacacgcttt tagttgactt tgcatgcatt aatgaatcaa

C

ttaattgata tatatttctt gaagaggaat taccaaagtt atttgttctg atatatttct ctaaatttcc aactaaaata taatataagc agtgcttaga taaataactc aaattaaaaa tatatatata taaaacttca ctaaaacata ctcaactgca atgaaagaga agaatcataa ttataaaact agtcctccat ttcaaaatga gctttcaatt gttactacag gtttccataa tgcatatact agataggagt ttccaggctc caaactaaag agaggtgagt gcagcacgtc ccttcttcct gctgtagtta tgttgttaca taagaaagtt tattaaacaa gcaaagatac aaaagctgac gtatcattat ggtatataaa ttaagatttt agatattttc ttaatctaat gctttgattg cagaagaaaa atcagatctc aatccaatca gattgtgtgg ttctgacaat agcattaaga ctactgtttg ggaggatggg aaatttggga tcatgagtcc gctgtattca ctgacttggg tttcaacagc gcccagtgat aattaattta attttgaata aaatgaagag agggcagaaa aattataaat acagt tgagc atgttaaata gtatgcaaat caggaaaatg cattatataa ttcacatggc actcacagtt gcaggagaga ctgagactca cctcccatca ggacacagag taaatatatt gacagagtct aatct gact t aagtatttgg taattcacca ttgcagttaa atggcaaatc agatcctttc tcctttgcat atatttacac tctctaactt tgtgattttt cagctaacta catctactaa aagaaggtac aactcatttg tgtagatggc atcagcatga ttactgagta taccaagtgc tatacagaaa ctgcagtgct tggagtgcaa ctccctgtca ggcttctccc ccataccata attttagtct tcattataaa tagagacacg tacaagagta gcacttctgg tccttttcat tatgcttggt catgctcccc tgatattttg aggttggtga tttttaatct atgggaatag ctatcataaa aaagtttatc ttaagactgt tatatttgag tggaaatata tatatttcct tcttccatat atatcttaaa tacacgagac ggagaggcct gcaagagaaa tgagaacagc ttgacacatg ccaccaactc gggaatattt tgttagaata ttctttcaaa taagcctaga tcaatggctt 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <22 1> <222> <223> <220> <221> <222> <223> 220 3001

DNA

Homo Sapiens allele 1501 99-27335-191 :polymorphic base A or C misc Tbinding 1481. .1500 99-27335-191 .misl, misc -binding 1502. .1521 99-27335-191 .mis2, <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> complement primer Ibind 1322. .1342 upstream amplification primer primer Ibind 1768. .1788 downstream amplification primer, misc_binding 1489. .1513 99-27335-191 probe complement W0005851 0 [hft D:twww. etthepa tent. com/Log in.dog/Sexa m .SUPortfFetch/Defa ult. d og/O005851 0 Cpc?fro mCache= 1 part= m aintoo lba r-bottom1 Page 724 of 737 WO 00/58510 PCTJIBOO/00435 <400> 220 tctctgaagg gagaagagag atgatcagtt ct tgaaagaa aactacaaaa tttactgtta tttctggttg attcttttaa gt aaaagagg tttttaagat gttcttatat cttaaaattt ttccataggt ataggaaatg cacttttgaa aagcaagaaa tgtgaggccc tctctccaag aaagaatagc taaagaagac ttaaagtttt gtttcactct tctacctt tt ttagaacaac agaaatatta mtaatgatgt taaaaaatgg acattgtgta gattgctggc ttgaaattta gcacacatag ttcaaattgc tgataatgtt tcaccatgca gatagtctca attgtggaat tataaaatgc ttgatagata aaggctgcca cttgaagttt attgtatagg tagaagatag atgggaataa ttttcccata gaagactgta tcatgagcaa ggacatagac ggaatgagga cttccttata tatgatgaat a atgagatcac aaaattcttt ctgggcaatt ctttcaagta gaaactttta tattttgtaa ttttttaaag atatttcttt ataactatta tt att t tgat ttaccaaaac tatatataaa gaataaagat cctatatttt taatgcatag aggaacaaaa ttgctgtttt agct t tgct t tattagactg ataggtatca ttctgtttgt agcttttaga ttatggatga aaaatatacc gtctataagt attagagatt ttactttata gcagaacagt caaagacaat tggaaaagaa gaaaaaagtc aaacattccc ttcattctct tatatttttc tattatatta tgtgattgtc aactcaactg ctttctctac ttgaatagca ggtttagcct tgtcattaat agatccatga gtaaatgtta tttcaaaaat ggagttttgc gtgtccattt cttggcttct caatatgcct atgacctggc tttctaaaag caaggaagtt aagtctgcat tatgagtgag cttatccaag tctgaatcaa ttttcttttt aaactggaaa catatattga atagaaaacc taagaggcat ttcctctgtc attgaatgtt ggatttttta ctttgggact ttacttcctc gaactgaagg cataaggtcg tttgtaattt tttgtataag atagaaaaaa t tact tt gt a cctagtt tgc acgtgagagc ttataaaaac ttttgtgtgt gtaaacaatg tctgaactat taaaattagt ttcctttaaa aaatgctcat ttaaaaatta t caatatgaa accctataga aataatctct tatcactgag taataagagt aacatagcta aattattacc atatctataa ctatcaccaa ccagagagaa gtctgtagtc tagtgt ctaa tatcatcaag atgctataat gtaaataaaa attacttgtc ctcaggatga agttattcgt tcagtccatc tagtagagag ttattgcatt cctctaaagt tgtgccatta agtaaaaatg ataattagtt ccttgatagc cctgttttgc tcttataatg taggttcttg tgaaattata tcctatttgt aaaatacatt aagaaactct taaggtttct gctgaaaata gattacttac gacctggata tggattaatg aaagcattct aatagaagat ttaagtcact tctttctcac ataatattca ggttttcttt aaaaacaaaa cccaacaata gcagacacct caactaagaa atagaaaagc tt tgaaaaag tattgcactt aaatgaagaa gaatacaaag gccagcatgg ttcatactaa aatcctgttt aagaagataa tactcaagtg tgcttaccac acagctgtct accattccca aatattttaa taacagttgg aatgatttat ttgcttgatt actgatgtct gtaaatctga tctctacttt ttggtttact ggagaacaaa tattaagtgt caggtttcca atcttgtgat ccaaataaat tttgatttat ataatgtttt ccttaatata caatgtaggt tatccagttt atgacaat ct agtttttctt ttgctaattt catggatcat tacaacttag aattatgggt taacttcata tttaacacaa aacttaatat tcctggaatt ttataaggga atggaagaaa tcatcaaatt ttaaaaagag ttttaatgta tatcacaaag gcctgacact ggaaacat tc aatatacatg agcagtctga tgatgatgac agcattattt aataattatc taataatttt ccagagaacc ttaatcctta caaggtagag tttttttaag actatgcatg tattcataaa ccattgat gt gttcactata aagatactta caacatatta tttgtaatta gtctacgaga ttagcattaa ttttttcaat aatgccatga acatagatgg aaagggacca ttatgtaact aaagcaccag gcttaatcag cacaattaga aatatgttat tgatgacctg tacttgaact ggtataaatg aacttctcgt tgcctgagtc cattatctgg tattttttta gtggaggttg tagtttaata gaaggagcat cacagatttt aaattatagc aagtacaaag aaaagatttc ttaaacttat ttataggtca tcaaacgttt aaccttgatg agaaactact gcttatgttt caaacaatct caagcattat aaattctagt agaagattct agtgagtaaa-.

agacctgtct atatgacata ataaaaatct tccgagctcc ctttacactc taattcaata tggaaatacg aaacactgat tgcagttaaa atcaattgtg tttaagaaat tgtgaaacta gatattattt tcattaattt agccatagat atcctaggta gcgtattata ctattcatca aacctgcctc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980.

2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> 221 3001

DNA

Homo Sapiens allele 1501 99-27345-189 :polymorphic base C or G W0005851 0[httpnJfwww.g etthepa tent.com/Lo i n.d og/Sexam .SU WortiFetch/Defa A. dog NVO00585 1 0.cpc?fromCa rhe= 1 part= m ain tooIba r--bottoml Page 725 of 737 WO 00/58510 PCTIIBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc Tbinding 1481. .1500 99-27345-189.misl, misc binding 1502. .1521 99-27345-189.mis2, complement primer bind 1672. .1689 upstream amplification primer, complement primer -bind 1139. .1159 downstream amplification primer misc binding 1489. .1513 99-27345-189 probe misc feature 803 n-a, g, c or t <400> 221 atgaaatttt tttgtcctgt aagcagacac aggtaagtgt acagtatatg atattgtaag agtaggtttg acatgccaat ttatttttgt agaagtatgt aattaaacat aggtaataca aatggaatca cct gaaaaca caacttcctc ggcattgtag tgtagggtga gctgcacaga acattattac agaatttatc tacagtatgc aacagaaaaa gaggaagggg tagaaggacc ttctagtgaa sct gagaaga gggaacactt ttaactccaa tgtgggttac tttacaaatt taaaatttac aataatcatt tccattagga gtaaatgaaa caagaaagt t aattttccag ttgttaaatt cagctttaat gtgtcatatg aagtctaatg attttctatt aatgttagca atttttagtg taccaattct atgcatacaa ggatgtgact tccttttact tacttcgtct aggggtttcc cagtgctgtt atagaaatct ggtgtctgct atgtcactca ttaccgtacg gcagggccag tgcttttgga ggacatcata tgctaccgta actcagaagg acccagttct aagaaataac cttttaaaaa aagataataa aatataaaaa caagttaata gactcatgtt ctaatactag taatcatatg t cat at t tgt actacttatt aaacacattc tatacactct tcatatttct ttaataatgt cccaccatga ctgttgcacc actatctatg tgngttgaag gactgggtat tcagtaactc cattaagcaa tcgttttctt attagttcat gcatcaggca cgttgtgaag tattttataa ctttattgtt ctaacactct gtttcagttt gttataaaaa taattccaat gtccctactc aaattacctg ttttatgaag ataaaatagg taatcaaata ttggaagaca gcatgctagc gaaatgaagc atcttacatc ttagttgtaa tttacctgca aaacggggaa aaattttgcc attttttgtg tatttttgtc gcaaatcata ccatctccac ggttatgcca caagtcaaaa actaatgtga cactctggat gtgtagtgct tctatggttt ttagactttc ctgtgctaga ct tgcagttt aaattacaac tcccaggctg gctggcacct tcactgggcc atgaaacacc ccggttttaa atgagctaac gtggaagaag aaatcacttc ccaataaaat ttggataatc aggagagtaa tgttgtttat cactgcttag atctactcta atggattaaa tggaagacat aggaatttat tattattttt ttatatccaa acaagtgtct cctacagtag ttgttaatgt gcaggaaaca tctggctaag tctaaatgat gaggccaata atggtagtgt taattgtaac atttattcat tgctgagctg tccagaaaac tacaagttct tgccatcatt cctgaaaatt ctaaaaatta taatttagat gtcataagta tagaactcta acatataggt ataaaagcag attttaaaac aacttcaccc gtatgtactc cttttaggac ttttctcatg ttccctgtca ataaagtttt gctccaaaaa aaaatatttg attgtagttt gaaagttatg caatttgaat ggacataaag actaaagacc ttggtgaagt ggactggcac gtggtatgca caactactcc tcttctcatt tgagatgtta ttactcaaac acccaagaaa aagcaaatgc gataaatact ctgggtcctg ctgaatcatt tatagttgat atggtaatat cagagtaaaa gctaaatccg attcaataca gcaaaagata ggtctgtctc ataaaattgt 120 180 240 300 3 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 W0005851 0 T htwww.getthepatent.com/Login.do /SexamsuportFetch/DefautdoN051 0Cpc?fromCarhe=l part=maintoolbar--boftoml Page 726 of 737 WO 00/58510 PCTIBOOIOO435 caataaacag cttgcttaat tcacagagtt tgcctaaaac cacatagcaa gaaatgtata atgaattttg ttttaaaaag gaatagttaa acctatacaa cagaattaca taagtacatc gacccaaaag aatattattt ttcgtaacat taaccagtta ggt cgccaga catttggaca a tataatatcc cttgattgta gggaaggctg tgtgctcagt aagggaaagc accactgcac taaagggct t aaagataaat accacaaaat gaactcctat atataacccc taaacaaatg ctcatcagca aaccacagaa tatgccaaat tatgtattac cactagggga aatgaaaatg ctagttggta tgggaatgca tataagagaa aattgctctg catt gttcct ccagtaggct tcttcgtcaa taaatgtttt ggaaaatata aagtcaacac aatattccac tttattgcag gatgaatgga aggaatgagg tacaaattct tcataataca gtcggggagg ttttagaact tattggtcag gtttattata caaagcttaa aaaagaaaat tcctctgtac gaccctcatt ctctactgtc ccaagttcaa tttacatctt ttaaaaggaa tgctcattat ctctattgac cagacaaact taccatcatg tttaaaaatt taaatcctta aggaacaacg agagagagga tgttcttgtt agaaaaaaaa agctaagctc caccacaaat tgatgcctct ccattacatc acacaataag aatgtgtact atttgacaac aat agcacac atatccaaaa aatagccaaa gtggtatggg tgttacaatg ttacacaata gagacagaag gcttaatggt agtggttaca gcggggaaca acttgataac ataggaatag gt tat tagcc tctgaattgg tatcagcaaa cat cgtctgt tataaaaaag agatttatat acaacaaaca aaacctgaaa agttggaaac catacggtgg tgaagaaagt agtcacattc gccgact ggt aagtggcttt aatattgtga 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210O> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 222 3001

DNA

Homo Sapiens allele 1501 99-27349-267 :polymorphic base G or A misc -binding 1502. .1521 99-27349-267 .misl, complement misc Tbinding 1482. .1500 99-27349-267 .mis2 primer -bind 1748. .f767 upstream amplification primer, complement primer bind 1337. .1355 downstream amplification primer misc binding 1489. .1513 99-27349-267 probe misc feature 182,8 48,1501,2206,2397 n-a, g, c or t <400> 222 gatgccaggc aatgtgcaaa tctgcagttg ctgcaccgtg cggtggctga gacttttcca cataatttta agtgggaagt aggttaggtg gcaactttga acaagaaaaa tatgaagtga W0005851 0[h ttp:/Aww.g etthe patent. comfLog in.doglSexa m.s pport/Fetch/Default.dog/WO005851 0.cpc?fromCache~ 1part=maintoolbar--boftoml Page 727 of 737 WO 00/58510 PCTIBOO/00435 taaatgtgcg angtgcatat tttcacccaa atgtaactaa attgttttac gt gaaacaaa atgcctgtac ttaaatacta tcttctttat ttttctattt aaaaaaatta gcttcataaa ctttaaantt agattaatct gtaaatctaa tattttaaag tcttttttga atatggaaaa agagtattga gttcctgcct agggctgact gatgaagcag taatttgaac rtaatctcgg ttggtaagtt tgttttagta agctaattca taaacttggt taatttcaaa tgggtttgtg ggttgaagtg agatttaaca tagaaccctc acggtggctc tcaagagatc aaattagctg gagaatcacc ccagcctggg aaagaaaaag agaaaagtca aatgtctcct tcatctttaa tatgttttgt tgaagagttt tatacatttt ttaaggagtt aaagctacag cactgaaaga t tgtgcatgtt caggacctgg caaatagtta gctgaaaaca tttcactgaa taccaataac atatatagac cagcacctca atgcttctca tattttctac catacctaac ccaataacta ttgcttatta taccaagtaa tataaggaaa taatttcaaa atgttaggat tgtttgccct agaaagagg gagaatattc gagtatgcga ctgccagggg ttgaatgtga tttagaacaa ttattactgg ggatttaaag tggatatggg tggcactgaa gagcagataa gtggcatgtt gagatgaaga agattatcac atatttggag acgcctgtaa aaggccatcc ggcatggtgg tgaacccagg tgccagagca aaaaagaaag aaaggaacct ttgtaacaca taggcataca tttaagctaa catgttactg atgaaattga tcaacaacta aaatttggag agaaacatct t gggggtggg acagctaaag tgatttctca tggaaatccc gtggtcagcc tggctgatga atatatgcaa taaaagggca ctccactgct ttaattattc atgccagcaa tttaaataga ctatatgaga gactttatag actaaggaaa agaagaaatt agatgataaa caaggtgaat gaatgcagaa t ga aat tgag agtgtgcttg ccttcaatag ttaagggagc aggtggttta acagaaggga aaaaggacac aacaagacag gctggtacaa tgagttttgc cattgggcaa tttgttaatt gagagaaata aagggaggtg tcctagtact tggccaacat tgtgcacctg aggcagaggt agact gtgt c caggCaaagg acataaggaC actcatttat aggaatgttc aacgttgata tat gtat agt tcttagacag tactgcaata gaggagaatt cagatattaa 426 tgggtacgct gacaggatgt catatataca cttactagag atagcatatg tcgagacaaa tcatttccaa tagaatttca cctattgcaa atattcct ca caatgatgag tttatatcga gaatctattc tctcattgga aatattaaaa atttcagatg ttttgctagg aatgcattgt aagtgaagat caccttcaag aaatggaggg ctcctgactg aacatgataa ggctaaaaag gggaaatgag aaaagacatt ggagtagagt ttaaggtaga gttgaaccta ttagaagtct ttctgaagag agaaagaatg gtatacaaaa ttgggaggcc ggtgaaaccc tagtaccagc tgcagtgagc aaaaaaaaaa aaacagaaga aacatgaggt tagggaaaag acttactctc cctagaacta gatataattc aggtaattaa tattcagcag tggtttctgt ctaaattgtg cacatgcact ccaacttaaa tatatacatg ct caga at tt caaatctatg ttacacttat cataataaag tatcagaatc accaatagta ataaatgttt ctaaatagat aaaaatccca taggtcttta gagataagac tgacaataaa attcaattac tactaggact ggagaaggta t cagaagaag cagcgatgaa gtaggatatg cctatctgta gaaactatga aatctagagt ggaaagttat gcagagacaa aaaaaccaaa aacaaaagaa ttgggtttga ggaactaaaa aactgtgacc agatagtcca aaggagcagg gaggtgggca tatctnttct tacttgggag cgagatcatg aaaaaaaaaa aaagtcaagg cagattacag ccaatattta agacatttct tttttgcaaa tagcaaattg gtttgacatc cacaaggcat ttggagaacc tggaccaatc cacgtgtgta aaaaaataga atgttatcaa ccaattcttc tcaaatgtag atacacacat tacctatact tgtgtagcat aatatatatt agcacatttt tttgtgctta aagacatatt ggggat aaaa caacat aaaa agtatactta tttcaataaa aaaaagatga attgttaatc ttatttttct cacgtcaact agagcgaaaa ttatgttgga t ct aggatca tagaagcctg gaagggctca gcttaacctt gctgaatgct ttagaggaaa agaccaagtg ct caggaaat tgaagtcatg gggaagatct caggccaggc gatcacgagg aaaaatacaa gctgaggcag ccgctgcact aaaaaangga ttttttttta tgcataaaac tgttttgctt atttttaaaa tattattcac ctgtcataag agtcttgcac ctggccacaa actgaagacc ccccttgcgc 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> 223 3001

DNA

Homo Sapiens allele 1501 99-27352-197 :polymorphic base C or G misc Tbinding 1502. .1520 W0005851 0 rhttD:/Iwww.a efttlenatent. co m/Lain.d oa/Sexa m. su oortFetchDefa ult. douAiWOO585 1 O.c3c?fromCa rhe= 1 pa rt=ma intool bar--bottoml Paa e 728 of 737 WO 00/58510 PCTIIIBOO/00435 <223> 99-27352-197.misl, complement <220> <221> <222> <223> misc binding 1481.' .1500 99-27352-197 .mis2, <220> <221> primer -bind <222> 1677. .1697 <223> upstream amplification primer, <220> <221> primer -bind <222> 1250.-1269 <223> downstream amplification primer <220> <221> misc Tbinding <222> 1489. .1513 <223> 99-27352-197 probe <220> <221> misc feature <222> 365,1072,1760,2273,2939 <223> n=a, g, c or t :omplement <400> 223 tgtattttta gccatgcatt ca at tcat ta ccggtt cagg gtttgttgtt agtggctcat aaggnatcga attagccagg gaatcagttg ccacaaagcg gatcaaagag actgaaagtg tatcttcttg tgtaacacta cttcactgta aacctctact ttatttattt tcctactttt gtaacttaaa acaatgaagc cacatttcag ggctgtgagg ctcatgctgt taaatgaaac ctgtaagatg sgttttctaa ttttagtact gttgcctgaa catcacataa tcttggcaat tgttgcactt aatcaataaa attacagaga aggacgagca gaagaggctt aaaagtcttc agcaacacaa acattttttg gtcaaattat gttggtggtg gcctgtaatc gaccatcctg cgtggtggcg aacccaggag agactccatc cctatgccct catctcatgt gtagggatag ccttgctcag actgtcttgt ttagatcatg ttcctggagc ctaaggtagt tggcattcca aaagctataa gaaaatgttt ttctttattc acagcgacat ataaaatatt taatcaaatt tcacagccat tgtctgaaac agggctctgc tagtctctgg tggatagagn ttctttacaa ataacaaaaa gccttttaca ctgtgttgga tgagtccaca ggatgatgat agaatataag tgtatcagaa gtatag-caat gtggttttgt ccagcacttt gccaacatgg ggcgcctgta gcggaggttg tcaaaagaaa gttcttccca tctagaggcc cactcttccc tgcttggcat tggtatgaaa gcgtgctaaa tcctgggcct gagaagaat g agagaacaga tgttggcaca ctggtttgaa ttttgtttta cctttagccg ggtatgtatt ttaaaggcga gtgagtaatg tagctaccac tataaactta gtacatttac acctagagtt tttttaacat aagagtatat gttttcttcc ggctctgttt ttcttcctgg ggtgtgtaga gctggttaca gcttcagggt atctgaagga ttttgaaaaa gggaggccca tgaaaccccg gtcccagcta cagtgagcct aaaaaaagga gtgtagggct atggcaattt ataat ttgaa acactaggtg atacaatttt acatccagta gcagt ggaga ctgaagctat gaatccaaac ctttgcagca agttcaaaac atggtagcat tttccattag tttccctgac taggagccct gcatctggcg gtgattgctt cttatttatc aagggtaata caaaggagat ct tat at t ta gctttcaact aggcagtcca tcataatcag atttcacatc ttgttttgag aacacttgtg aagtctcaag tttcttgata gaaatttgcg ggtgggtgga tctctactaa ctcaggaggc agatcgcacc aaaagaaatt gttttttgac gcggcacgta cttcagaata cttaacagtg aaaaacagaa aggagtgttc acaatgtgtc gcacttaaag tcagtgctta ctttgttatc aagctaaagc aacgacatag acatttatgc aggatatgtt aaaaaaggaa act cgggaac agctgcctgg ct at ttat tg aaagaggcta acaagtgtat aatttttttt gagacgttaa cactaagggg aatagcacat cgattaatga aaccactggt gaatagatgc tagggtgaac agagacaatt ggcccggcac tcacgaggtc aaatacaaag tgaggcagag actgcactgg tgcttagaca cggaacatgg agatcaccaa tcgtgtaggc at tagaat cc aaataaaaca tcttatttat cgcagttatt cnaattatta tgttttaaaa tatttgtcta ttcaaacgga gacatctgag ctggtattct tgagatattg gaatcattca gcctgctaag tctttttaag gat gcaccca tacagttctt gtaattcagc tagggctgtg agaaaataaa caattccttt cccgtgt gaa ggatgccagg 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 W0005851 0 [http:llwww. etthe patent. co m/Login. dog/Sexa m. su portFethlDefault.ogNVOOO585 1 0.cpc?fromCar-he= 1 part--ma intoolbar--bottom] Page 729 of 737 WO 00/58510 PCT/IBOO/00435 caatgtgcaa aagtgggaag gtgtgcatgt tcaggacctg acaaatagtt agctgaaaac ctttcactga ataccaataa catatataga acagcacctc tatgcttctc ttattttcta acatacctaa accaataact tttgcttatt t atctgcagtt taggttaggt ttgggggtgg gacagctaaa atgatttctc atggaaatcc agtggtcagc ctggctgatg catatatgca ataaaagggc actccactgc cttaattatt catgccagca atttaaatag actatatgag gctgcaccgt ggcaactttg gtgggtacgc ggacaggatg acatatatac ccttactaga catagcatat atcgagacaa atcatttcca atagaatttc tcctattgca catattcctc acaatgatga atttatatcg agaatctatt 428 gcggtggctg aacaagaaaa tcacatgcac tccaacttaa atatatacat gctcagaatt gcaaatctat attacactta acataataaa atatcagaat aaccaatagt aataaatgtt gctaaataga aaaaaatccc ctaggtcttt agacttttcc atatgaagtg t ca cgt gtgt aaaaaaatag gatgttatca tccaattctt gtcaaatgta tatacacaca gtacctatac ctgtgtagca aaatatatat tagcacattt ttttgtgctt aaagacatat aggggataaa acataatttt ataaatgtgc aangtgcata atttcaccca aatgtaacta cattgtttta ggtgaaacaa tatgcctgta tttaaatact ttcttcttta tttttctatt taaaaaaatt agcttcataa tctttaaant aagattaatc 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 224 3001

DNA

Homo Sapiens allele 1501 99- 27 353-105 :polymorphic base T or C misc binding 1502. .1521 99-27353-105 .misl, misc -binding 1482. .1500 99-27353-105. mis2 complement primer bind 1584. .1604 upstream amplification primer, complement primer -bind 1085. .1105 downstream amplification primer misc -binding 1489. .1513 99-27353-105 probe misc feature 794, 1501, 2189, 2702 n-a, g, c or t <400> 224 tggagatgct ttggttattg catttttcag gatcacctga gacctcattt aagaattttt ttttcattca ttctctgaaa gagttcccta tttgatttcc tttgggtgag gcaatgcgat aaataggatg agcatagaat ttagagatgg atttacctgc cttatcatat gaagcctacc attcacttag atatacaatt ttgagcctat tattattcat tccttagcct gactcctact tcgtaaaaaa tacaggtaaa atccctgcct acagaagttt tgtaagtatt aaattaaatt 120 180 240 300 W0005851 0 [httplt/www etthe patent. comI~ag in.dog/Sexam.SU WortFetchDefau it. dog/WO005851 0. rPc?fromCache= 1 part= ma intool ba r--boftoml Page 730 of 737 WO 00/58510 PCT/EBOO/00435 ttatatataa agtttcaaat ccaggcatct accactggtg aatagatgcc agggtgaacc gagacaattg gcccggcaca cacgaggtca aatacaaaga gaggcagagg ctgcactggc gcttagacag ggaacatgga gatcaccaat cgtgtaggct ttagaatccc aataaaacaa cttatttatt gcagttattt yaattattag gttttaaaaa atttgtctac tcaaacggag acatctgagc tggtattctt gagatattgc aatcattcac cctgctaagt ctttttaagg atgcacccac acagttcttt taattcagct agggctgtga gaaaataaaa aattccttta ccgtgtgaag gatgccaggc cataattfta taaatgtgcg angtgcatat tttcacccaa atgtaactaa attgttttac gtgaaacaaa a atgttgtata ttggttgctt gtattt ttaa ccatgcatta aattcattaa cggttcaggg tttgttgttg gtggct catg aggnatcgag ttagccaggc aatcagttga cacaaagcga atcaaagagc ctgaaagtgc atcttcttgg gtaacactac ttcactgtaa acctctactt tatttatttt cctacttttc taacttaaat caatgaagca acatttcagg gctgtgaggt tcatgctgta aaatgaaaca tgtaagatgt gttttctaat tttagtactt ttgcctgaaa atcacataat cttggcaatt gt tgcactt t atcaataaaa ttacagagag ggacgagcac aagaggcttt aatgtgcaaa agtgggaagt tgtgcatgtt caggacctgg caaatagtta gctgaaaaca tttcactgaa taccaataac tatgtatata tgaagaatct aaagtcttcg gcaacacaaa cattttttgt tcaaattatg ttggtggtgg cctgtaatcc accatcctgg gtggtggCgg acccaggagg gactccatct ctatgccctg atctcatgtt tagggatagc cttgctcagt ctgtcttgtt tagatcatgg t cct ggagct taaggtagtg ggcattccaa aagctataat aaaatgtttc t ct ttatt ct cagcgacatc taaaatattg aatcaaattt cacagccatg gtctgaaact gggctctgct agtctctggg ggatagagna tctttacaat taacaaaaaa ccttttacag t gt gt tgga g gagtccacat tctgcagttg aggttaggtg tgggggtggg acagctaaag tgatttctca tggaaatccc gtggtcagcc tggctgatga cacagtatat actatgaatt gatgatgatg gaatataagg gtatcagaag t'atagcaata tggttttgtt cagcactttg ccaacatggt gcgcctgtag cggaggttgc caaaagaaaa ttcttcccag ct agaggcca actcttccca gcttggcata ggtatgaaaa cgtgctaaaa cctgggcctg agaagaatgc gagaacagag gttggcacac tggtttgaaa tttgttttaa ctttagccgt gtatgtattt taaaggcgat tgagtaatgg agctaccacg ataaacttac t acat tt aca cctagagttc ttttaacatc agagtatatg ttttcttcca gctctgtttt tcttcctgga ctgcaccgtg gcaactttga tgggtacgct gacaggatgt catatataca ctt act agag atagcatatg tcgagacaaa acatataaag ctgtaagtct gtgtgtagat ctggttacaa cttcagggta tctgaaggat tttgaaaaag ggaggcccag gaaaccccgt tcccagctac agtgagccta aaaaaaggaa tgtagggctg tggcaatttg taatttgaac cactaggtgc tacaatttta catccagtaa cagtggagaa tgaagctatg aatccaaact tttgcagcac gttcaaaaca tggtagcata ttccattaga ttccctgaca aggagcccta catctggcga tgattgctta ttatttatcc agggtaataa aaaggagata ttatatttaa ctttcaactg ggcagtccac cataatcaga tttcacatcc cggtggct ga acaagaaaaa cacatgcact ccaacttaaa tatatacatg ctcagaattt caaatctatg ttacacttat tctagcgcag gggcaggagc tgttttgaga acacttgtgg agtctcaagt ttcttgataa aaatttgcgg gtgggtggat ctctactaaa tcaggaggct gat cgcacca aaagaaattt ttttttgacc cggcacgtaa ttcagaatat ttaacagtga aaaacagaaa ggagtgttct caatgtgtcc cacttaaagc cagtgcttat tttgttatct agctaaagct acgacatagg catttatgcc ggatatgttt aaaaaggaag ctcgggaacg gct gcct ggt tatttattgg aagaggctat caagtgtatg attttttttt agacgttaaa actaaggggc atagcacatc gattaatgag gacttttcca tatgaagtga cacgtgtgta aaaaaataga atgttatcaa ccaattcttc tcaaatgtag atacacacat 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 234.0 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> 225 3001

DNA

Homo Sapiens allele 1501 99-27360-14 2 :polymorphic base G or T misc_binding 1482. .1500 99-27360-142 .misl W0005851 0 [http:/wwgetthepatent.com/Login.dogSexam.support/Fetch/Default.dogNVO005851 0.cpc?fromCache=l1part~maintoolbar--botom] Paqe 731 of 737 WO 00/58510 PCT/EBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc Tbinding 1502. .1521 99-27360-142.mis2, complement primer Ibind 1361. .1381 upstream amplification primer primer -bind 1793. .1812 downstream amplification primer, misc binding 1489. .1513 99-27360-142 probe complement <400> 225 ttgtttcata actctcaatg tggaattttc t caga tt t tc gactgtattt ttaagaaaat catgtccttt aggacaaaaa acttggacat ggagggatag caacatggca cttaaagtat agaactccca aagattgaag ttgacataca tctttgtaac gcttggtggc gtatgccaat taaaatatca cttataaaga attgtattac atgagttatt gaaatttaag ggttacattt aaaatattat kaaatcatcc agaaaaatca cttttaatca aaaattagag ttcttagtac ctt tct t tgt cttcattata cgctaatttt aaaaaaaaac gttagaagac ctggcctaaa atgatctgtt tgactggttt cctagggaaa cattgcatag gaggtagctg ggagaaaatc ttaattccaa atcagatacc tcgcacacct cacttgtggt agattaggaa atctatctca gtggcacata gtagggacat accaaacact cggaagggga cattaggaga catgtataca aataaaaaaa ttatgagttg gttggaaatg at caatacaa agagagatgt gaaaaacact cacttaaacc cccataagaa aatggaatca tagggtttca tgtgatttat agtgtaaaaa cgctaggttg tttggtaagt tatatatttc aagtttataa tctctgcact agttgcaaac cacaggctaa acaaaacaat ccatttaaca gtaagatcct tagaattcaa taagaataaa gaaaatattt gaatgagcat ctgttgacca tgtatttaag aatatgccag ctggcagctc att caacaaa aaagagtggg attaggtggt gtctgtgttt gtcatgtggg tgctcaattt agaacaaaca tacaccaagg ggatgaagct gaatgttctc acatcacata tatacctaat tatgtaacaa tatggtagct taaaattgta gaggcaacat acattttgct ttaatatgaa gcctaaatcc attttaaaat ttgaaaat ca ggaatatgtt ttaaaactgg tctatcttaa gtgacaatta gcaataaaat tacttaaaaa aatatatttt actatgtcta ttaacacagg acccttgaaa ggagacagac ttcagtgttt agaatacatt gaaaagtttc attttctgag atggcctaat caaaaaatta tttgcatata cagtaaccca tttatttttt tgatgatgga tgacacattg acccctgaaa aggcacataa ctgtgttcac tgacttgcac cactcaaaca gt at ctaact tcaaaatatg aatactatgc ggaaaccatc actcataggt ccagggcctg gt aaatga cg acctgcacat gtctgaatat acactttgag tctctgatat gatacaataa ataaatgatg tttggggctg ttcccttttc aataaatttt tcaaaaagat attttctcta ttaattttgc aaaatcttta tatccatata ttttggcaca agattttttt tatttacaaa ccttaggata tccatctagt tgagcagtca ttgaagtatt gaaaatcaat actattttat ttttttttta ttccataatg gtcatctttt taaataaata ctgcacagca gattacacag gaaaagctgt aaaaagttca tgtgtacttg t tat tt t tgt tgtgatgctg ttgtcacatg atttcggatt ttctaaacct tccatcagtg atccataaaa attctcagca ggcaattgaa ttgtggggtg agttaatggg tgtgcacatg .tatctaaata aagtaaagaa gcttttccct tagctagaga catagtagat aaatttgctg ttataataaa tgaattatac ctttgtcaat ctttttttgt cttcttttta cataaccaaa at tacataat tcttgtgttc ctaactccat atcactgtgt tttacaaaaa ccagtcatct aggtaacaag tgtaacaatg tccccaacac ggtttcatgt caatatttta tgagtggtaa ccttaatttt aattactttg cagcctgtaa gtcctcattg caaaatcaat gtgactcaag tttttcctga caacatagat gtgaatccac aggtcaggtg ttggagcatt gtgaatatga atagattgga aggatgagtt aactatcgca caatgagaac gggggagggg tgcagcacac taccctagaa cataggatat ggatggagta gatataatat tattattatg agcttaattt atttcaaaat ttacaattat ttcatgtatt tataactatc attttggtta aatatatctg agtagatcaa tcattcccct cttttgaaga ctttgtttta cagagcatga ttggagaat c agctctccac cccctctacc ttcttagcaa tcattttgta gttacagatg tgattacaaa atgcagagca tttccaacct taaataatct tttctatgaa tgtaactaaa atttagggga tacaaagaca cctacacatt tcatcaaaca 120 180 240 300 360 420 480 540 600 660 720 780 840.

900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 W0005851 0 [http:/A/ww.getthepatent.comfIo-qindo/$exam.suportFetch/Default.dogNVO005851 0.cpc?fromCar-he=1pDan=maintoolbar--boftoml.Paqe 732 of 737 WO 00/58510 PCTIIBOO/00435 cagggcaaat atttgcctga tgcatatgta ttagctgcat cctttttcat ggtgtcgcat acagaatctg t atattcagaa ggaaaacgtt aaagaaaagc tcacaatgac tgttgttcaa tccagactgt gtacgctgct caatggagat t aca tt tat g gtatcaaaat attgcagtga aggaagataa tggtagtgtt attttcagca atttccttcc atggtatata ctaactgtgc cctcatagct atttcaatat tccacatata gtctatgctt tgccaattca cacatgtcta cggaaagtag tgctttgcca ttcccttgct aattattggt cctcccagcc agaattatta cacacacata gacacaagtg cagtttgctg tgcataacat ctagcacttc tcctccttgg 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 226 3001

DNA

Homo Sapiens allele 1501 99-27361-181 polymorphic base A or G misc Tbinding 1482. .1500 99-27361-18 1.misl misc Tbinding 1502. .1521 99-27361-181 .mis2, complement primer Ibind 1322. .1340 upstream amplification primer primer bind 1815. .1834 downstream amplification primer, complement misc Tbinding 1489. .1513 99-27361-181 probe <400> 226 gtgactcaag tttttcctga caacatagat tgccaattca.

cacatgtcta cggaaagtag tgctttgcca.

ttcccttgct aattattggt cctcccagcc ctgccagtgc tgatgaagca tatgagaaat ttgtcgggat tgtgagtaaa attttatgtt gccctctgta.

taaaattttt tacaaagaca cctacacatt tcatcaaaca agaattatta cacacacata.

gacacaagtg cagtttgctg tgcataacat ctagcacttc tcctccttgg acaatgtgag agctaaacaa catttctata taaggaaatt ctattaatgc ttaagcctat aaatatcatt acctctctga ggagaaaatc ttaattccaa cagggcaaat atttgcctga tgcatatgta ttagctgcat cctttttcat ggtgtcgcat acagaatctg tggtatgact tggtattatg ggttatactg tctgtaggtg tattcaatga atagcagaat gatataagtt tcctaaataa ataattgaga attcaacaaa aaagagtggg atattcagaa ggaaaacgtt aaagaaaagc tcacaatgac tgttgttcaa tccagactgt gtacgctgct gttacagaaa aggaatcaga tttaatagcc taagaaccca catcatagca taataatctt agtttccaag taacaataca atttgaaatc acccctgaaa aggcacataa caatggagat tacatttatg gt atcaaaat at tgcagtga aggaagataa tggtagtgtt attttcagca cattagaggg ttgctaaaag taaaaaggca aagttagaaa aataaaatca gtagcaatga ga caaagcag cctgtttgtt atcacacaag tgtgtacttg ttatttttgt atttccttcc atggtatata ctaactgtgc cctcatagct atttcaatat tccacatata.

gtctatgctt aacagaaatg catgcatatt aataataata aaaacatctt gattttttta taccaaatta tgtgactaaa tttacacttt gaaagcaata 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 W0005851 0 [httpJtwww.getthepatent.com[Login.doq/SexamsuportFetc/Defaut.doQMW0005851 0.cpc?fromCache= 1 part~maintoolbar--bottom] Page 733 of 737 WO 00/58510 PCT/EBOO/00435 tgctttttat acaaatctgc at tgtactga ttgtggaaca tcattcttat ctgatgggcc ttttgggaat rctagtgact tgttgaccat acggacatta gaattgcttg ttgttttgct t gt cat gat a ctgtgaatgg gacattcatg tataattttc ttgtagtaga gatttgtaga taaagaccct aaaatgtaaa taaaaagcat tatagataaa cttgaaagct catctacaag acgatgtgga attatgaatt aaatgtctcc ccgcct agt t ctccccttaa aaagtaagtt tttagctttg caaatgattt a ttgcatatag ccaaaaaaag ttttatttaa tatgttatca gccatatctg cagaaatggc aaagaattga agaagaatcc tcttgacatg ctgatcatga tagtctcaca tttgaatgga aatagacatt agactcaaga ctaatattt t tgagtagaag aatatggatt ggtcatttgt aaatctgagg taaaggattt ttatagttgt atttactttg agtgatgttt aggtaagaat aaacaatctt attttataga tatttctata agcctatcac agcccttttc aaatacattt aaattatact ttctagtact catgttcttt tgtgcaaacc caaaaagttc cattaatcat taattatgac tttctgttaa tttgtgcatc cttctctcag ccattggtca caatgtttga gctaataagt agaatgttag t accaaaagc cttattactc tatctatttt ctgtccttga cctttccagg ttttttaaaa aatcaacagg ctagatgaaa aatttatttt tgatagcatc acattttctg aaaaaaattg gagcgt aat c ctttggaaaa cttcctagat tatctagagt tctcctccca actcacagaa t aca ga aaat atgcctacaa tcattaaaaa tgccagccta aagtgataat ttgctcctaC atttttcttt caagcctgga ttgcaaacag agtaaattcc tggtgatgga aataggaaaa gacaaagcaa atcctaatgt atacatttgt aaaccaatat ataaccgaag ataacatttt tggtatttga aaaatttaat gcagcagatc aaaaaaaaaa aatttccagt aatgtttaat tttcaaatca aaatgacaaa tgtagctgag tatgaacaaa caagctgtgt cat cagct tt ttaaagccct ctagaagtgg attagattaa gctttgtgct tgtaatatgg agtggtactt tctaaataaa tgctatttca actctaatgt gcagctttgt aagaaatttg agtgaccata cattgcatgc caggctaata tcattggaaa ataatgttta caaagctctg tcatacagtc tgcttttgta caagacaaac gatcactaga aaccctcttt tgtatatttt aaaaaaaaaa atgtacgtat taatcatttg accattttta aaaggattat taaatagcag tataattgtt tcattattat ccttaaagcc ttactctcct gtggactggc attatgggaa tcaaaacagt tgagaggtaa cttcttaaaa tagaattgca tacttggtgg caactgatta gcaaaaaggc ggataactca gagtatggat ctgtcccaag gagttaaagt ctaattc~gt gttcaatgca aagtgtttgg ttctcctgtt tatttttgat tacacaatta ggacagtaag cacctttccc tttctaagag aaaaatttaa ttaaagcaag ctttttcaat acttatatta caaaattatt aat gtgaagc tatatttaca ggt gccgctg cttttctctc cccctcacct taatgaatgg aacatttccc agtgagaaca 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> 227 3001

DNA

Homo Sapiens allele 1501 99-27365-421 polymorphic base C or T misc Tbinding 1482. .1500 99-27365-421 .misl misc -binding 1502. .1521 99-27365-421 .mis2, complement primer Ibind 1081. .1099 upstream amplification primer primer Ibind 1590. .1609 downstream amplification primer, complement W0005851 0 [http1/twww.getthepatent.com/Login.dog/Sexam.support/FetchDefautdoqNVO005851 0.cpc?fromCache= 1part=maintoolbar--boftoml Page 734 of 737 WO 00/58510 PCT/IBOO/00435 <220> <221> misc-binding <222> 1489. .1513 <223> 99-27365-421 probe <400> 227 tCttttcttt gcacaaatgt cctcctgagt tcttctttaa tagctcaggc ctgcatccta ctcctggaga ctataagttt tagtgctcat ggtatcttta ggtgttctct ccagttccca tgagaatacc accaaggaga ggaatgggag aatgcttttg acttaccatt agatctgtgt ttatcctaag ccctggtaag atgaaatcaa tgcagtgact caaacatttg aatacaaaat atagtttaag ygaatttaaa gtggttggaa aggtgactgc caaatgtcct ggggccatat ctgcaaaaat cgcctacagg gaccgggctt tgggaactaa gataagccaa agcgagaaga agctcttgac attgccttct gtttgttttg tagcagtgcc gtatggtaag tttggtgagg gacctgaata catttccaca agggatgtgc at caagcaag cgagtcttta ccagctgtgt ataagtcatc attctcccac a cttttctttc agctcactgc agctaagact cgttttgtag gatcttccca ctcaatatca aggggttaaa tcagaataat tccttttgag tttttttttt taaaattttt gtaacacaga agacattgga gatataaact ttagttatct ccgtaccctg ctgcattgca gaagggtcaa tggaaacaga aaatctcctc tatatgaaat tcatgggtgc agaaatgctc taatcataga aagtgaataa acttaacaga tggaaacagt aaaacagagt gct ctat t tg tttgtttgta agccactgcc acagggaagc gctttggaaa actaaaatgc agctgcaagc gggtgattga tcaagcacgg gtagctctaa tttgacccaa agagctagat caggaaagaa ctgaaactgc gggagaaaac tagcacccta aggcacagtg aaattgttga tcgatcaagc gaggtaacaa ctctctctag atttcagtgg tttctcaatc aaactcaacc acaagtgtgt agatgaggtt cctcagcctt gtttattttt aagagaatgc gccttttttt t gggt cagcg aataagagat tctctcttaa catttgtttt agagagtcac tctatagtgt gttaaaacag cttaaaagtt atggatatca atacaaggaa acatatgggc ttgaaaattt ttaaaatgtt cttcagatta atagttaagt agaaagaaga tacattaaat ttatttgtga attgtttctc gacaagattc gttctaaaat t gt t tcaact ccacaatacc agctggagac tgtggggcaa catctggtag tgtcagtgac ggaagtgctg agggaggagg gtccttaaaa atagcttgga gaacctggta aggataatga ttcagttccc gaacgcacat t ccagtgaga caattccttg gtgttgcgat cccagaatag ggcctcctac agtaaggcag agatgtagtc tcaccctgtc tcctgggctc gcctggcttt ttactatgtt ccaaaatgct atgagctcac aagatgaatg ttccctaaga tttctagtca gcca tt cat c ttatgtattt catctaaata ttactgat ca aagctt t tga ttaacagctt tgtaatatca tgacttgaat ggattttgta atgtaagcag gagtcagata ggagtaat ct gaacaatata ggtgattgct taatatagtg aagacagaga cctgaccact aagggtacaa taagtagagc tcattatctg catactttac ttggaagtag ccatgagatg gaaataccaa gtcatggatg cagcatggct tggttttgaa taacccaact agact cagac gtttaaattt gcacagtaag gctctgcctc gt tggaaa tc ggaaattatc gggaagtgag tgcaaagaaa cagtcatgac agctcttctt tagcaggaaa caggtcttac atccaggctg aagcaatatt tttttttttt gcccaggttg ggatttacaa cagtcatgga tttgactcct gtcctgatcc ttttctgtgg tgatttttat atttctctca catacacagt gggagtcctg gcttacacta ctttaataca atcggtactg agcaatagat gtactggact cttgagcatg gtctgaagtg gcacttaggt aaatttgagg gaggagattt ccaaaaaacc aatcagcaat gagtaaaaat taaaagacaa cataagactc caaaagttct ctctgctgcc gaactgcgcc gctgaaccaa ttaaataagg gagagaacca aaccgaaagt atgggcgata acagcctcgg cggtggctgt atcttctgta tcaaagggtt aggaactagg tctctctcat aggttgagcg tgcctctttg ggcagtgt ct agaacagaat agggcaggtt ttgggagctt cagctgtatg ttgcccctgt aagtacagtg tctgcctcag ttcttcttct gtaaattcct gcatgagcca tgaaaactga tccttttctt taggtaccag gccggatgag tgataataca tgtcaaaatt agtctctgtg agcagatctt tacaattttg taaagtatct tgaataaatt acatgtattg agaaaatatt tacttcaatt ttctgctgga aaccatgcag agcaaaagtg aaaagaaaga cacaagagaa acaagacaac actcagtaaa tgacttggag actgtgaaaa acaatgctga tcacaatagc tcacgcaggc acagaatcca cagtgagtgg cggggctatc caatgcgtgc gaaagactgc atgctgacag gtgtggtttt gtctcggttc ggtaaacgat ggaaaggtac gaatcactat gatttcacgt tgaaagtgac gcatatagtt tgagaacacc atgagtttag cagttgagtg ccaattgtaa ggattatcta 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <210> 228 <211> 526 <212> DNA <213> Homo Sapiens W0005851 0[h ttpJ/www.qetthe patent. comILo indo /$exam. suppo rtFetchDefa ut.d OgIWVUU!J! Iu.cpc?tromu;acnle= 1 parl=mailooloar--bottoml Page 735at Ti WO 00/58510 PCTIEBOO/00435 <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> allele 484 99-27680-484 :polymorphic base G or T misc binding 464. .483 99-27680-484 .misl, misc Tbinding 485. .504 99-27680-484 .mis2, complement primer -bind l..18 upstream amplification primer primer bind 509. .52 6 downstream amplification misc binding 472. .496 99-27680-484 probe misc feature 57 n-a, g, c or t primer, complement <400> 228 ggagacaaaa taaaatccag gctatatact catcttgaag cactagctgt acaccacctt gctttggcac tactcacttc ttakattggg aatcacggca tatactaata ttaaaattgt tgtacaatt c ttccataata gagttgtaca aatttttccc tcagtcccaa tgcccttcct aattacaaat ccttgaaata ttttattgtg agtgacattc gagcct ggaa gtgccaaggc tctgccagaa cccaggtaga ctgtgcttct tataaaagct cctctataat gtaaataaat agtgcattta gagctattca ccagaacatg gtgccctaat tgtttgaagc actccacact aaaaattacc aacatttttt ataaaatctg tgatgttgtg cttaaaacac ctgccctctt tcaaaccctt ccttatggaa tactca tcaaatntta atgtatttta ccatagtaac caaccatcac gacgggaaga tcacttccaa ctgctgttcc tccccccaga <210> <211> <212> <213> <220> <221> <222> <223> <220> <221> <222> <223> <220> 229 3001

DNA

Homo Sapiens allele 1501 99-27912-272 polymorphic base C or T misc binding 1481. .1500 99-27912-272 .misl, W0005851 0 [httpJww.qetthepatent.rom/Login.dog/SexamsuportFetchDefauIt.doqNVVO0058510.cpc?fromCar-he= 1part=maintoolbar--bottom] Page 736 of 737 WO 00/58510 PCTJIBOO/00435 <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> <220> <221> <222> <223> misc -binding 1502. .1521 99-27912-272.mis2, complement primer Ibind 1230. .1250 upstream amplification primer primer bind 1659. .Y679 downstream amplification primer, misc -binding 1489. .1513 99-27912-272 probe misc feature 1929,2531,2954 n-a, g, c or t complement <400> 229 tccaagaaga aagagcagtt ttcaaacgtc tctgctgatt tttgaccaaa acaactttca aaagacgaag gagcattaag ttaatgataa attatcctaa ttattttttg ctgggctcac agtagctggg gcagagacgg cccacct cag tgatgttttt tttcagttag agtgtccgga cctccattaa ggttttaata tttccttttc aaagagtatg ttcttaatct agacttagat acctataatg ytaaattgtg agagctacct attgtcttct aggaaaacat tctgacctct agagccgttc atatcctggt tgctcctang catgcctgaa gtatattcct tgataatgac tttcatacaa aacaatattg gtcagtgttt ggtcaagaag taactgaatg gaaatgttat tatctggaca atagggaatt actttgggtc gaatgcagaa taaacatctt gtgaaaatat agat ggagga tgcaagctct actaggggcg ggtttcactg cctcccaaag aattaattaa tctttaatct catatttgga aaatgtgtct tctgctgatt t ct tt t ttt t ccttttcttt ttgacttttg ctgtaatgtt ttacccctaa tgaatgtgtg ccttgactat gtgaataata gcttgaattt gaatcctagt actggctcct tagaggtctc ttggtgcctc ctcaacttct ttatccttta tagattgaat tgtgggagag gttcataggg cagt t tgaac aatttcctct aggaccgccc ctcatccaga ccttttggtt tcacagtttg tatgtgttct taaactatgc ggtaaaaatg attaggttat gtctcgctgt gcct cccagg cccaccacca tgttagccag tgctgggatt tcagatttct ctaaagcaat aaatccatct aattcaaata tgtcttttaa tcccagacat t tcagtgtct ttcaatgttg aataattaat aacaatgaga ctgtaagact aaacttttgt aaactttcct gacacatttg aattattcta tacttcgtca caggctatgg caacaacagt ctatgtctag tgttttataa acatttatat agctaataag aataataaga ccaaatactg tatatgggag acacgaaaaa aacatcctca caggcaagtt catctagaac tagtgggaag attaacattg tgtatttctt gttttattta gt cgcccagg tt cacgccat tgcccggcta gatggtctca acaggcgtga taaaaatata gaagttattc aagagaaatg ttaaaaatct taactttcag aagccccaca ggcaaaagaa tctcatccat tacttaaaag aacaatgaca gaagttgtag tgctatgttg tggagactgg taaaaccat c aggccacaaa gtcccattgc tcttcctact tttaacagac gtagtgtcca gaggagaagg tggatgttat taaaaaggaa aaatgggaat gaaaaaagcc atagtcagct gagcaagttg taaacacacc gacacataaa acctagaact cactgtgttt aaaaaactat ttaatagaaa ttttatttta ctggagtgca tctcctgcct attttgtttt atctctgacc gccaccacgc taatttgtct aaccataact aaactatgaa gaatttataa aattaatttt aggtgaaaag taat tgtaaa ccagtttttc gtaatgtcta agttaactaa ttgtttctta ggaaatcagt attcatggca gctctttggg tgtaccaaat ttgtagaaac tggttatctc ttcattttct catgcagata gtaccaaaac ctaaggaaga agagttgaaa tgtttgtgga aatctagttc ttttgttcta ctttactcac agtaataatg attaatcatg ccataatggc ggtctataat atttgacaag attttaaaga ttttatttat gtggcgtgat cagcctcccg tgtattttta tcgtgatctg ccggcctaga ggctccttta caagtaacaa catttatata gaattttagt gtgtaaatat gcatgcagat attaagagga ctgtgctata tgctcaaaca tatggatcct, gatttaacac ttggccttaa aattctcttt actactggct attgtccaga tgtgcttctt aagctacagc atgggagact ttgatataat act taggggg ggctttcaat caatatctct aaaatgctat 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 W0005851 a P ttp Jfww.g etthe patent. com/Log in.dog/Sexam.su pport/Fetch/Defau It. do NVO005851 0.cpg?fro mCache= 1!part=m a intoolbarE-bottoml Page 77 f 37 WO 00/58510 PCTIBOO/00435 cacataggtt cttttcccca gtagcagtag actattgaag aaggtgtgga aggcacagca gacaagtggt taatacaagt cacaggacag ccagttttta caaaacacaa atttactata g <210> 230 <211> 18 <212> DNA gacctaaaat aatgaccagc ggaaaaaaaa tatatagatg nctagttgga aagaagtgag ttagttggtt tatttttact gaactatgct gagagctata attttcacca gagritcctag tttaaataat ataaaaacct caaccttgac ctttagagcc attgggaaaa aatcttgaag catattctta tgatcttggt agtttaagtt taaaaaacta aaacacaaat tgtaagagga taaactcttt attgattaag agagtctcat tgggatatgt ttttatataa taagccctaa ttttccagga ataagtatgc cttggtctta aggatttttt tcacagatgc atcatgattg tgatacactt caaatcaagt tggagtctct gatttaaggg taaaatacct ttagcaaa ct acaagtaatt ttagtcctag aactgaccta tctcagctat aagattctac gactctggta ttgtttctat ttgttagact aagtagtgat tagatatttc ttggttttgc tggtttaata cctggaacaa tatggtttaa ttataccatc ctaccatttc catagtcaat tcccattgga 2340 2400 2460 2520 2580 2640 2700 2760 2820 2880 2940 3000 3001 <213> Artificial Sequence <220> <223> sequencing oligonucleotide PrimerPU <400> 230 tgtaaaacga cggccagt <210> 231 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sequencing oligonucleotide PrimerRP <400> 231 caggaaacag ctatgacc

Claims

1. An isolated, purified or recombinant polynucleotide or the complement thereof selected from the group consisting of: an isolated polynucleotide comprising the polynucleotide sequence of nucleotide position 213818 to 243685 of SEQ ID No. 1, or the complement thereof; an isolated polynucleotide comprising any of the polynucleotide sequences of SEQ ID No. 2 to 26; an isolated polynucleotide comprising a polynucleotide encoding any of the polypeptide sequences of SEQ ID No. 27 to an isolated polynucleotide comprising a polynucleotide having at least identity with any of the polynucleotide sequences of SEQ ID No. 2 to 26; an isolated polynucleotide comprising a polynucleotide that hybridizes under stringent conditions with any of the polynucleotide sequences of SEQ ID No. 2 15 to 26; an isolated polynucleotide comprising any of the polynucleotide sequences of SEQ ID No. 44 to 53; an isolated polynucleotide comprising a fragment of at least 15 nucleotides of any of the polynucleotides specified in and 20 an isolated polynucleotide comprising a fragment of at least 15 nucleotides of any of the polynucleotides specified in comprising any of the biallelic markers A85 to A219.

2. A recombinant vector, host cell, or non-human host animal comprising a polynucleotide according to claim 1.

3. An isolated, purified or recombinant polynucleotide of claim 1 attached to a solid support.

4. An array of polynucleotides comprising at least one polynucleotide according to claim 1. -265- A method of genotyping or diagnosis comprising determining the identity of a nucleotide at any one of the biallelic markers shown as A85 to A219, or the complement thereof in a biological sample.

6. A method of estimating the frequency of an allele of a biallelic marker in a population comprising: genotyping individuals from said population for said biallelic marker according to the method of claim 5; and determining the proportional representation of said allele marker in said population.

7. A method of detecting an association between a genotype and a trait, comprising the steps of: determining the frequency of at least one biallelic marker in a trait positive population according to the method of claim 6; determining the frequency of at least one biallelic marker in a control population 15 according to the method of claim 6; and determining whether a statistically significant association exists between said genotype and said trait.

8. A method of estimating the frequency of a haplotype for a set of biallelic markers in a population, comprising: 20 genotyping at least one biallelic marker according to the method of claim 5 for each individual in said population; genotyping a second biallelic marker by determining the identity of the nucleotides at said second biallelic marker for both copies of said second biallelic marker present in the genome of each individual in said population; and applying a haplotype determination method to the identities of the nucleotides determine in steps a) and b) to obtain an estimate of said frequency.

9. A method of detecting an association between a haplotype and a trait, comprising the steps of: estimating the frequency of at least one haplotype in a trait positive population according to the method of claim 8; -266- estimating the frequency of said haplotype in a control population according to the method of claim 8; and determining whether a statistically significant association exists between said haplotype and said trait.

10. A method according to claim 7 or 9, wherein said trait is schizophrenia or bipolar disorder, predisposition to schizophrenia or bipolar disorder, an early onset of schizophrenia or bipolar disorder, or a beneficial response to or side effects related to treatment against schizophrenia or bipolar disorder, or a symptom of schizophrenia or bipolar disorder.

11. A method of determining whether an individual is at risk of schizophrenia or bipolar disorder, comprising: genotpying at least one biallelic marker according to the method of claim 5; and correlating the result of step a) with a risk of developing schizophrenia or bipolar disorder. 15 12. A diagnostic kit comprising a polynucleotide according to claim 1.

13. A purified or isolated sbg 1 polypeptide selected from the group consisting of: a polypeptide comprising any of the polypeptide sequences of SEQ ID No. 27 to a polypeptide comprising a polypeptide encoded by any of the polynucleotide 20 sequences of SEQ ID No. 2 to 26; a polypeptide comprising a polypeptide encoded by a polynucleotide having at least 70% identity with any of the polynucleotide sequences of SEQ ID No. 2 to 26; a polypeptide comprising a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions with any of the polynucleotide sequences of SEQ ID No. 2 to 26; a polypeptide comprising a fragment of at least 6 contiguous amino acid residues of any of the polypeptides specified in to

14. An isolated or purified antibody composition capable of selectively binding to a polypeptide of claim 13. -267- A method for the screening of a candidate substance that interacts with a sbgl polypeptide, wherein said method comprises the following steps: providing a polypeptide according to claim 13; obtaining a candidate substance; bringing into contact said polypeptide with said candidate substance; detecting the complexes formed between said polypeptide and said candidate substance.

16. A method for screening molecules that modulate the expression of a sbgl polypeptide, wherein said method comprises the following steps: cultivating a prokaryotic or eukaryotic cell that has been transfected with any of the polynucleotide sequences according to claim 1 to bringing into contact the cultivated cell with a molecule to be tested; quantifying the expression of the protein encoded by said polynucleotide sequence. 15 17. A polynucleotide according to claim 1 substantially as herein described with reference to the examples. "18. A method according to claim 5 substantially as herein described with reference to the examples.

19. A method according to any one of claims 6 to 9 or 11 substantially as herein 20 described with reference to example Dated this THIRTEENTH day of OCTOBER 2004. Genset Applicant Wray Associates Perth, Western Australia Patent Attorneys for the Applicant