AU773347B2 - Recombinant anti-tumor RNASE - Google Patents

Description

RECOMBINANT ANTI-TUMOR RNASE This application is a divisional of AU 32074/99, the entire contents of which are incorporated herein by reference.

BACKGROUND OF THE INVENTION Ribonucleases such as ribonuclease A ("RNase and their cytotoxicity towards tumor cells were discovered in the 1960s (reviewed in Roth, Cancer Res.

23:657-666 (1963)). In the 1970s, human serum was also discovered to contain several RNAses that are expressed in a tissue specific manner (Reddi, Biochem. Biophys. Res.

Commun. 67:110-118 (1975); and Blank, et al., HUMAN BODY FLUID RIBONUCLEASES: S aDETECTION, INTERRELATIONSHIPS AND SIGNIFICANCE, pp203-209 (IRL Press, London, 1981)).

Further to these early studies was the discovery that an anti-tumor protein S from oocytes of Rana pipiens had homology to RNAse A (Ardelt, et al., J. Biol. Chem.

256:245-251(1991)). This protein was termed ONCONASE®, Alfacell Corporation, N.J.

See also Darzynkiewicz, et al., Cell Tissue Kinet. 21:169-182 (1988); Mikulski, et al., Cell Tissue Kinet. 23:237-246 (1990); and U.S. Patent No. 4,888,172).

Phase I and Phase I/II clinical trials of ONCONASE® as a single therapeutic agent in patients with a variety of solid tumors (Mikulski, et al., Int. J of Oncology 3: 57-64 (1993)) or combined with tamoxifen in patients with advanced pancreatic carcinoma have been completed (Chun, et al., Proc. Amer. Soc. Clin. Oncol.

14:210 (1995)) and the protein has been found to be efficacious in pancreatic, renal cell, and prostate cancers as well as mesothelioma.

Conjugation of ONCONASE® to cell-type-specific ligands was found to increase its potency towards tumor cells (Rybak, et al., Drug Delivery 1:3-10 (1993)).

2 Taken together, these results indicated that ONCONASE® has properties advantageous to the generation of a potent selective cell killing agent.

Development of Onconase® conjugates for human therapeutics has been slow. Onconase® is derived from amphibian tissue and trace contaminants present in the purified preparation stimulate undesirable immune responses in humans. This side-effect has led to production of a recombinant form of the protein (Newton, et al., Protein Engineering 10:463-470 (1997) and PCT published application WO 97/38112).

However, expression of active recombinant Onconase® has been problematic. Onconase® requires a pyroglutamic acid at the N-terminus for activity.

10 Unfortunately, Onconase@ with a N-terminal glutamine is not expressed by bacteria but accumulates in insoluble inclusion bodies. To increase bacterial expression of soluble Onconase®, methionine has been appended to the N-terminus. However, this modification of the protein prevents the formation of the pyroglutamic acid necessary for activity.

Therefore, it has been necessary to engineer Onconase@ with an N-terminal methionine 15 only to remove it for activity. The cleaved and the uncleaved proteins must then be separated to obtain a pure composition of high purity and activity.

Other problems have arisin in the manufacture of Onconase®-based fusion proteins. It has been difficult to fuse recombinant Onconase® in frame to ligand binding moieties and retain proper folding of both the Onconase® and the ligand binding moiety.

20 This has limited the use of Onconase® in targeted cell killing to only those compounds that can be chemically conjugated.

Thus, there exists in the art a need for recombinant ribonucleases that can be expressed in bacteria and retain activity. Furthermore, there exists a need for a ribonuclease with anti-tumor activity that retains its activity when produced as a single chain fusion protein. This invention fulfills these and other needs.

SUMMARY OF THE INVENTION This invention provides for new recombinant ribonuclease proteins. The proteins, unlike Onconase®, are expressed well by bacteria without an N-terminal methionine. This is due largely to the presence of a signal peptide that is cleaved by the bacteria. The ribonucleases are then secreted into the bacterial media. The soluble

I

3 expression of these ribonucleases allows the proteins of this invention to be fused inframe with ligand binding moieties to form cytotoxic fusion proteins.

Specifically, the present invention provides a cytotoxic reagent comprising a recombinant ribonuclease linked to an antibody directed against a cell surface antigen on a cancerous B cell, wherein the recombinant ribonuclease has measurable ribonuclease activity; an amino terminal end beginning with a glutamine; a leucine at position 11; an asparagine at position 21, a threonine at position 85, and a histidine at position 103, such positions being determined with reference to those specified amino acid positions of SEQ ID NO:2; and substantial identity to SEQ ID NO:2.

In a preferred embodiment, the antibody is directed against CD22. Preferably, the antibody is LL2. More preferably, the LL2 antibody is humanized or is a single chain antibody.

15 The present invention also provides a cytotoxic reagent comprising a recombinant ribonuclease encoded by a nucleic acid comprising SEQ ID NO:14 and conservative variants thereof linked to an antibody directed against a cell surface antigen on a cancerous B cell.

The present invention also provides a method of killing cancerous B cells comprising contacting cells to be killed with a cytotoxic reagent comprising a recombinant ribonuclease linked to an antibody directed against a cell surface antigen on a cancerous B cell, wherein the recombinant ribonuclease has an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, and SEQ ID NO:26.

Also encompassed within this invention are cytotoxic reagents comprising the ribonucleases with or without the conservative substitutions listed above linked to a ligand binding moiety. In one embodiment, the linkage is through a covalent bond.

In a preferred embodiment, the covalent bond is at the carboxy terminus of the ribonuclease.

In one aspect of this embodiment, the ribonucleases of this invention are linked to hCG. This has been found to be efficaceous against Kaposi's Sarcoma cells.

In another aspect of this embodiment, the ligand binding moiety is an antibody directed against a cell surface antigen present on a cancer cell. In a preferred aspect, the antibody is a recombinant single chain antibody directed against a cell surface antigen on a cancerous B cell, in particular, CD22. In a most preferred aspect, the ligand binding moiety is LL2.

In yet another embodiment, a method is provided which prepares a substantially pure ribonuclease of this invention. In addition, the method can be used to purify a cytotoxic reagent of this invention. The method comprises: contacting a ribonuclease with an (His) 6 histidine tag and a methionine at position 7 with an effective concentration of a cleaving agent such that the ribonuclease is cleaved after the carboxy ."group of methionine at position 1; (ii) passing the ribonuclease through a Ni"-NTA agarose column; and (iii) eluting the substantially pure ribonuclease from the column. In a preferred embodiment, the cleaving agent is CNBr.

In still another embodiment of this invention, pharmaceutical compositions are provided which comprise a ribonuclease expressed from recombinant DNA. The ribonucleases are selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24 and SEQ ID NO:26 in a pharmaceutically acceptable carrier. In one aspect of this embodiment, the pharmaceutical composition also contains an antineoplast, preferably Adriamycin.

In another embodiment, pharmaceutical compositions are provided which 20 comprise the ribonucleases of this invention linked to a ligand binding moiety. As above, the pharmaceutical composition may contain an antineoplast, preferably Adriamycin.

In yet another embodiment of this invention, a method is provided for killing cancer cells. The method comprises contacting cells to be killed with a ribonuclease expressed by recombinant DNA and having a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24 and SEQ ID NO:26. In addition, the method also comprises contacting cells to be killed with a cytotoxic reagent comprising the ribonucleases listed above linked to a ligand binding moiety. In a preferred embodiment, the cancer cell to be killed is a malignant B cell and the ligand binding moiety is an antibody. In a preferred aspect, the antibody is a single chain antibody directed against CD22. In a most preferred embodiment, the antibody is LL2.

DETAILED DESCRIPTION OF THE INVENTION I. Definitions Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide one of skill with a general dictionary of many of the terms used in this invention.

Although any methods and materials similar or equivalent to those described herein can be 10 used in the practice or testing of the present invention, the preferred methods and materials are described. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. The headings provided herein are not limitations of the various aspects or embodiments of the 15 invention which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

The terms "isolated," "purified" or "biologically pure" refer to material that is substantially or essentially free from components which normally accompany it as found 20 in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified. In particular, an isolated ribonuclease nucleic acid is separated from open reading frames that flank the ribonuclease gene and encode proteins other than ribonuclease. The term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. Particularly, it means that the nucleic acid or protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure.

"Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have similar binding properties as the reference nucleic acid and are metabolized in a 6 manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer, et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka, et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini, et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.

10 The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.

15 Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

"Conservatively modified variants" applies to both amino acid and nucleic 20 acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence.

As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid.

Conservative substitution tables providing functionally similar amino acids are well known in the art.

10 The following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine Serine Threonine 2) Aspartic acid Glutamic acid 3) Asparagine Glutamine 15 4) Arginine Lysine Isoleucine Leucine Methionine Valine and 6) Phenylalanine Tyrosine Tryptophan (see, Creighton, Proteins (1984)).

"Pyroglutamic acid" is the cyclized internal amide of L-glutamic acid with 20 the following structure: 0

COOH

H

As used herein a "nucleic acid probe or oligonucleotide" is defined as a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. As used herein, a probe may include natural A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.). In addition, the bases in a probe may be joined by a linkage other than a phosphodiester 8 bond, so long as it does not interfere with hybridization. Thus, for example, probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. It will be understood by one of skill in the art that probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. The probes are preferably directly labeled as with isotopes, chromophores, lumiphores, chromogens, or indirectly labeled such as with biotin to which a streptavidin complex may later bind. By assaying for the presence or absence of the probe, one can detect the presence or absence of the select sequence or subsequence.

10 A "labeled nucleic acid probe or oligonucleotide" is one that is bound, either covalently, through a linker, or through ionic, van der Waals or hydrogen bonds to a label such that the presence of the probe may be detected by detecting the presence of the label bound to the probe.

"Amplification" primers are oligonucleotides comprising either natural or 15 analog nucleotides that can serve as the basis for the amplification of a select nucleic acid sequence. They include, polymerase chain reaction primers and ligase chain reaction oligonucleotides.

The term "recombinant" when used with reference, to a cell, or nucleic acid, or vector, indicates that the cell, or nucleic acid, or vector, has been modified by the 20 introduction of a heterologous nucleic acid or the alteration of a native nucleic acid, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.

The term "identical" in the context of two nucleic acids or polypeptide sequences refers to the residues in the two sequences that are the same when aligned for maximum correspondence, as measured using one of the following "sequence comparison algorithms." One example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng Doolittle, J. Mol. Evol. 35:351-360 (1987). The method used is similar to the method described by Higgins Sharp, CABIOS 5:151-153 (1989). The program can align up to 300 sequences of a maximum length of 5,000. The multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster can then be aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences can be aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments. The program can also be used to plot a dendrogram or tree representation of clustering relationships. The program is run 10 by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison. Another example of an algorithm that is suitable for determining sequence similarity is the BLAST algorithm, which is described in Altschul, et al. J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information .15 (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul, et al, supra). These initial neighborhood word hits act as seeds 20 for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negativescoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.

The BLAST program uses as defaults a wordlength of 11, the BLOSUM62 scoring matrix (see Henikoff Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments of 50, expectation of 10, M=5, and a comparison of both strands.

The BLAST algorithm performs a statistical analysis of the similarity between two sequences (see, Karlin Altschul, Proc. Nat'1. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.

For example, a nucleic acid is considered similar to an ribonuclease nucleic acid if the smallest sum probability in a comparison of the test nucleic acid to an ribonuclease nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001. Where the test.nucleic acid encodes a ribonuclease polypeptide, it is considered similar to a specified ribonuclease -nucleic acid if the comparison results in a smallest sum probability of less than about 0.5, and more preferably less than about 0.2.

The phrase "substantially identical" in the context of two nucleic acids or polypeptides thus typically means that a polynucleotide or polypeptide comprises a ''...sequence that has at least 60% sequence identity, preferably at least 80%, more preferably at least 90% and most preferably at least 95%, compared to a reference sequence using the local homology algorithm of Smith Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman Wunsch, J. Mol. Biol. 48:443 (1970), by 15 the search for similarity method of Pearson Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection. One indication that two nucleic acid sequences or polypeptide are substantially identical is that the polypeptide which the 20 first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid. Thus, a polypeptide is substantially identical to a second polypeptide, for example, where the two peptides differ only by a conservative substitution. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions.

The phrase "determined with reference to" in the context of identifying changes in amino acid sequence means that the amino acid as indicated in the sequence listing at that position is changed to the amino acid indicated. For example, in some embodiments of this invention the methionine corresponding to position 23 of SEQ ID NO:2 is changed to a leucine. In SEQ ID NO:2, a methionine is at position 23. In SEQ ID NO:8, the methionine at position 23 in SEQ ID NO:2 corresponds to a methionine at position 24 which has been changed to a leucine.

11 The phrase "selectively hybridizes to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture total cellular) DNA or RNA. The phrase "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target subsequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY--HYBRIDIZATION WITH NUCLEIC PROBES, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993).

Generally, stringent conditions are selected to be about 5-10°C lower than the thermal o* melting point for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as 15 the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30*C for short probes to 50 nucleotides) and at least about 60°C for long probes greater than 20 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents as formamide.

"Antibody" refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof which specifically bind and recognize an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.

An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino 12 acids primarily responsible for antigen recognition. The terms variable light chain (V) and variable heavy chain (VH) refer to these light and heavy chains respectively.

Antibodies exist, as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'z a dimer of Fab which itself is a light chain joined to VH-CHI by a disulfide bond.

The F(ab)' 2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the dimer into an Fab' monomer. The Fab' monomer is essentially an Fab with part of the hinge region (see, FUNDAMENTAL IMMUNOLOGY, 3D ED., Paul 1993). While various antibody fragments are defined in 0.0 terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies or those synthesized de novo 15 using recombinant DNA methodologies single chain Fv).

The phrase "single chain Fv" or "scFv" refers to an antibody in which the heavy chain and the light chain of a traditional two chain antibody have been joined to form one chain. Typically, a linker peptide is inserted between the two chains to allow for proper folding and creation of an active binding site.

20 The term "linker peptide" includes reference to a peptide within an antibody binding fragment Fv fragment) which serves to indirectly bond the variable heavy chain to the variable light chain.

The term "contacting" includes reference to placement in direct physical association. With regards to this invention, the term refers to antibody-antigen binding.

An "anti-ribonuclease" antibody is an antibody or antibody fragment that specifically binds a polypeptide encoded by the ribonuclease gene, cDNA, or a subsequence thereof.

An "immunoconjugate" is an antibody molecule in which the constant region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class, effector function and/or species, or an entirely different molecule which confers new properties to the chimeric antibody, an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced or exchanged with a variable region having a different or altered antigen specificity.

A "fusion protein" or when a molecule is "linked" to another refers to a chimeric molecule formed by the joining of two or more polypeptides through a bond formed one polypeptide and another polypeptide. The bond may be covalent or noncovalent. An example of a covalent bond is the chemical coupling of the two polypeptides to form peptide bond. Examples of non-covalent bond are hydrogen bonds, electrostatic interactions and van der Waal's forces.

If the bond is by a peptide bond, the fusion protein may be expressed as a 10 single polypeptide from a nucleic acid sequence encoding a single contiguous fusion protein. A single chain fusion protein is a fusion protein having a single contiguous polypeptide backbone.

A "ligand" or a "ligand binding moiety", as used herein, refers generally to all molecules capable of specifically delivering a molecule, reacting with or otherwise .i 15 recognizing or binding to a receptor on a target cell. Specifically, examples of ligands include, but are not limited to, immunoglobulins or binding fragments thereof, lymphokines, cytokines, cell surface antigens such as CD22, CD4 and CD8, solubilized S* e receptor proteins such as soluble CD4, hormones, growth factors such as epidermal growth factor (EGF), and the like which specifically bind desired target cells.

The phrase "specifically (or selectively) binds" to an antibody or "specifically (or selectively) immunoreactive with," when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein at least two times the background and do not substantially bind in a significant amount to other proteins present in the sample. Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. For example, antibodies raised to ribonuclease with the amino acid sequence encoded in SEQ ID NO:2 can be selected to obtain only those antibodies that are specifically immunoreactive with ribonuclease and not with other proteins, except for polymorphic variants, alleles, and closely related interspecies homologs of ribonuclease. This selection may be achieved by subtracting out antibodies that cross react with molecules such as Onconase®. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, Harlow Lane, ANTIBODIES, A LABORATORY MANUAL, (1988), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity). Typically a specific or selective reaction will be at least twice background signal or noise and more typically more than 10 to 100 times background.

"Cytotoxicity", as used herein, refers to the inhibition of protein synthesis in human tumor cells, HS578T (ATCC No. HTB 126) using the protocol described in Rybak, et al., JNCI 88:747-753 (1996). A "cytotoxic reagent" of the present invention will have a relative 50% inhibitory concentration (IC 5 o) at least 50% that of an equimolar amount of the polypeptide of SEQ ID NO:2. More preferably, the relative will be at least 60% or 70% that of the polypeptide of SEQ ID NO:2, and even more preferably, at least 100%.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a S• context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

II. Introduction This invention provides highly active and cytotoxic ribonuclease molecules which can be used to selectively kill and target cells, particularly tumor cells. In some embodiments the molecules are designed to fold into more cytotoxic molecules and in 30 other embodiments, the molecules are designed for better expression in bacteria.

0.0" The ribonucleases of this invention are isolated from members of the genus Rana. SEQ ID NO:1 represents the nucleic acid sequence of a RNAse derived from a Rana pipiens liver mRNA library. The corresponding amino acid sequence is represented by SEQ ID NO:2 (RaPLR1). SEQ ID NO:6 is the amino acid sequence of RaPLR1 but with a methionine at the 1 position. SEQ ID NO:4 is the amino acid sequence of RaPLR1 but with a leucine at position 23 (instead of methionine). SEQ ID 14a NO:8 represents the sequence shown in SEQ ID NO:4 but with a methionine at the 1 position. SEQ ID NO:9 represents a protein with the amino acid sequence of SEQ ID NO:8 but with a six histidine residue tag at the amino terminus. SEQ ID NO:11 represents RaPLR1 with serine at the N-terminus and SEQ ID NO:13 represents RaPLR1 with a serine at the 2 position and a methionine at the 1 position. SEQ ID NO:28 is the amino acid sequence of RaPLRI with the signal peptide at the Nterminus.

In addition to ribonuclease derived from Rana pipiens, this invention also encompasses ribonucleases derived from Rana catesbeiana oocytes. Although the amino acid sequence of Rana catesbeiana oocyte RNAse (RaCORI) has been known since 1989 (Nitta, et al.. J. Biochem. 106:729 (1989); Okabe, et al., J. Biochem 109:786 (1991); Liao, Y, Nucl., Acids Res. 20:1371 (1992); Nitta, et al., Glycobiology 3:37 (1993); Liao, Y. Wang, Eur. J. Biochem. 222:215 (1994); Wang, et al., Cell Tissue Res. 280:259 (1995); Liao, et al., Protein Expr. Purif 7:194 (1996); and Inokuchi, et al., Biol. Pharm. Bull. 20:471 (1997)), genomic DNA or mRNA which encodes the oocyte RNAse has not been discovered. An object of this invention was to 10 deduce the nucleic acid sequence encoding this RNAse and express the RNAse recombinantly.

SEQ ID NO:14 represents the nucleic acid sequence of RaCORI but modified to use the preferred codons for E. coli, the expression system exemplified in this invention. SEQ ID NO:15 is the corresponding amino acid sequence. SEQ ID NO:17 is 15 the same amino acid sequence as SEQ ID NO:15 but with a methionine at the 1 position.

SEQ ID NO:19 is the amino acid sequence of SEQ ID NO:15 but with leucines substituted for methionines at positions 22 and 57. SEQ ID NO:21 is the same as SEQ ID NO:19 except for a methionine at the 1 position. SEQ ID NO:22 is the same as SEQ ID NO:21 except six histidine residues have been appended to the N-terminus. Finally, SEQ ID NO:24 represents RaCOR1 but with a serine at the N-terminus and SEQ ID NO:26 is the same as SEQ ID NO:24 except a methionine is at the 1 position.

Preferably, the ribonuclease molecules will have an amino terminal end selected from the group consisting of: Gin- Met-Gin; Met-Ser; Met-Thr; Tyr, and Pyroglutamic acid-.

Further, it is preferred that the ribonuclease molecules be modified so that the methionine of amino acid position 23 of SEQ ID NO:2 is deleted or replaced by Leu.

In one embodiment of the invention, the methionines at position 22 and 57 of SEQ ID are also replaced by a leucine.

In other alternative embodiments, the ribonuclease molecules will be fused at either the carboxyl or amino end to a ligand binding moiety, such as a single chain Fv which recognizes a cell surface antigen on a tumor cell. Other ligand binding moieties include, but are not limited to, other antibody fragments, receptors, antigens, lectins, cytokines, lipopolysaccharides and any other compound that binds to a cell.

Comparisons of the ribonuclease sequences provided here can be made to i. described sequences in the pancreatic RNAse A superfamily. Many of such members are 10 known and include, but are not limited to, ONCONASE® (Ardelt, W. et al., J. Biol.

Chem. 266:245 (1991)); eosinophil derived neurotoxin (EDN) and human eosinophil cationic protein (ECP) (Rosenberg, et al., J. Exp. Med. 170:163 (1989)); angiogenin (Ang) (Fett, J.W. et al., Biochemistry 24:5480 (1985)); bovine seminal RNase (Preuss, et al., Nuc. Acids. Res. 18:1057 (1990)); and bovine pancreatic RNase (Beintama, et al., Prog.

15 Biophys. Mol. Biol. 51:165 (1988)). Amino acid sequence alignment for such RNAses are set out in Youle, et al., Crit. Rev. Ther. Drug. Carrier Systems 10:1-28 (1993).

III. Numbering of Amino Acid Residues S* .o The amino acid sequence positions described herein, unless otherwise indicated, use as a frame of reference the RNAse sequences of the respective SEQ ID .o NOS: in the SEQUENCE LISTING. Residue numbers indicate the distance from the amino terminus. The amino acid sequence for SEQ ID NO:2 and for SEQ ID NO:15 are set forth in the SEQUENCE

LISTING.

IV. RNAse Proteins The present invention includes RNAse proteins comprising a polypeptide of SEQ ID NO:2 and 15 and conservative variants thereof. The polypeptides of the present invention (SEQ ID NO:2 and 15 and conservative variants thereof) demonstrate cytotoxic activity, as defined herein. The RNAse proteins of the present invention may be limited to the polypeptides of SEQ ID NO:2 and 15 and conservative variants thereof, or may be inclusive of additional amino acid residues linked via peptide bonds to the carboxy and/or amino termini of the polypeptide. Preferably, the conservative variants of SEQ ID NO:2 and 15 comprise a glutamine residue capable of spontaneous cyclization to pyroglutamic acid at the 1 position.

The RNAse proteins of this invention optionally are translated by the host cell with a signal peptide attached. The signal peptide is shown in SEQ ID NO:28. The presence of this sequence allows the host cell, in particular E. coli, to secrete soluble protein. In this configuration, the presence of a N-terminal methionine is not necessary for bacterial expression and the N-terminal residue is a glutamine or pyroglutamic acid. One of skill will recognize that other signal peptides may be appended to the RNAse proteins of this invention. The choice of signal peptide will depend on the expressing cell, the 10 protein being expressed and the preference of the practitioner.

The polypeptide of SEQ ID NO:2 or conservatively modified variants thereof may have a leucine or other hydrophobic residue substituting for the methionine at position 23. The polypeptide of SEQ ID NO: 15 or conservatively modified variants thereof may have a leucine or other hydrophobic residue substituting for the methionine at 15 positions 22 and 57. Those of skill will recognize that a polypeptide lacking a methionine is typically not subject to specific cleavage using cyanogen bromide.

Proteins of the present invention can be produced by recombinant expression of a nucleic acid encoding the polypeptide followed by purification using standard techniques. Typically, the RNAse proteins are encoded and expressed as a contiguous chain from a single nucleic acid. The length of the RNAse proteins of the S. present invention is generally less than about 600 amino acids in length.

Recombinant RNAse proteins can also be synthetically prepared in a wide variety of well-known ways. Polypeptides of relatively short size are typically synthesized in solution or on a solid support in accordance with conventional techniques. See, e.g., Merrifield, J Am. Chem. Soc. 85:2149-2154 (1963). Recombinantly produced or synthetic polypeptides can be condensed to form peptide bonds with other polypeptides or proteins formed synthetically or by recombinant methods. Various automatic synthesizers and sequencers are commercially available and can be used in accordance with known protocols. See, Stewart Young, SOLID PHASE PEPTIDE SYNTHESIS, 2d. ed., Pierce Chemical Co. (1984).

A. RNAse Proteins Comprising Amino Terminal Methionine The present invention also includes RNAse proteins comprising: 1) a polypeptide of SEQ ID NO:2 or SEQ ID NO:15 and conservatively modified variants thereof, and 2) a methionine at position 1 (see, SEQ ID NO:6 and SEQ ID NO:17).

Isolated nucleic acids coding for the RNAse proteins of the present invention are also provided. Preferably, as in SEQ ID NO:2 and 15, the position 1 residues of the polypeptides are glutamines. Various embodiments of the polypeptide of SEQ ID NO:2 and 15 and conservative variants thereof may be employed in this aspect of the invention.

Those of skill will understand that an N-terminal methionine or 10 formylmethionine (collectively, "methionine") is typically required for protein synthesis in a bacterial host cell. The N-terminal methionine may be directly linked to the amino acid of position 1 of the polypeptides of the present invention where position 1 is not methionine via a peptide bond. Alternatively, the methionine is indirectly or directly linked to the amino acid of position 1 of the polypeptides of the present invention via a 15 plurality of peptide bonds from a contiguous chain of amino acid residues. The residues, S extending and inclusive of the amino terminal methionine to the amino acid directly linked via a peptide bond to the amino terminal amino acid residue of the polypeptide, constitute an amino terminal peptide. Thus, the amino terminal peptide consists of all amino acid residues linked to position 1 of SEQ ID NO:2 or 15 or conservatively modified variants thereof. The N-terminal peptide is at least one amino acid residue in length a methionine residue) or may be 5, 10, 20, 50, 100, 200, 300, 400, or more amino acids in length.

The N-terminal peptide may comprise a signal sequence for transport into various organelles or compartments of the host cell, or for transport into the surrounding media. The N-terminal peptide may also encode sequences which aid in purification such as epitopes which allow purification via immunoaffinity chromatography, a plurality of histidine residues, or sequences recognized by endoproteases such as Factor Xa. The Nterminal peptide may also recognize extracellular and intracellular targets, such as telomerase.

19 B. Making the RNAse Protein The present invention is also directed to methods of making the RNAse polypeptides of SEQ ID NO:2, SEQ ID NO:15 and conservative variants thereof. The polypeptides of the SEQ ID NO:2 and 15 and conservative variants thereof may conveniently be assayed for cytotoxicity or anti-viral HIV-1) inhibition by methods disclosed herein.

1. Expressing the RNAse Protein This invention relies on routine techniques in the field of recombinant 10 genetics. Basic texts disclosing the general methods of use in this invention include Sambrook, et al., MOLECULAR CLONING, A LABORATORY MANUAL, 2ND ED. (1989); Kriegler, GENE TRANSFER AND EXPRESSION: A LABORATORY MANUAL (1990); and Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (1994)).

For nucleic acids, sizes are given in either kilobases (kb) or base pairs (bp).

15 These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kilodaltons (kD) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from ***published protein sequences.

Oligonucleotides that are not commercially available can be chemically synthesized according to the solid phase phosphoramidite triester method first described by Beaucage Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), using an automated synthesizer, as described in Van Devanter, et al., Nucl. Acids Res. 12:6159-6168 (1984).

Purification of oligonucleotides is by either native acrylamide gel electrophoresis or by anion-exchange HPLC as described in Pearson Regnier, J. Chrom. 255:137-149 (1983).

The sequence of the cloned genes and synthetic oligonucleotides can be verified after cloning using, the chain termination method for sequencing double-stranded templates of Wallace, et al., Gene 16:21-26 (1981).

In one embodiment of the invention, a RNAse of SEQ ID NO:4, 8, 9, 13, 17, 21, 22, 26 and conservative variants thereof wherein the nucleic acids encode an amino terminal methionine, are expressed in a host cell. Various aspects of the polypeptides of the present invention which have been previously described may be utilized in this aspect of the invention. By "host cell" is meant a cellular recipient, or extract thereof, of an isolated nucleic acid which allows for translation of the nucleic acid and requires an amino terminal methionine for translation of the nucleic acid into its encoded polypeptide.

Eukaryotic and prokaryotic host cells may be used such as animal cells, insect cells, bacteria, fungi, and yeasts. Methods for the use of host cells in expressing isolated nucleic acids are well known to those of skill and may be found, for example, in Berger Kimmel, GUIDE TO MOLECULAR CLONING TECHNIQUES, METHODS IN ENZYMOLOGY VOL.

152, Academic Press, Inc., San Diego, CA (Berger); Sambrook, et al., MOLECULAR CLONING A LABORATORY MANUAL (2ND ED.) VOL. 1-3 (1989) and CURRENT 10 PROTOCOLS IN MOLECULAR BIOLOGY, F.M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley Sons, Inc., (1997 Supplement) (Ausubel). A variety of host cells and expression vectors are available from commercial vendors, or the American Type Culture Collection (Rockville, MD).

Accordingly, this invention also provides for host cells and expression vectors comprising .15 the nucleic acid sequences described herein.

Nucleic acids encoding RNAse proteins can be made using standard recombinant or synthetic techniques. Nucleic acids may be RNA, DNA, or hybrids thereof. Given the polypeptides of the present invention, one of skill can construct a variety of clones containing functionally equivalent nucleic acids, such as nucleic acids 20 which encode the same polypeptide. Cloning methodologies to accomplish these ends, and sequencing methods to verify the sequence of nucleic acids are well known in the art.

Examples of appropriate cloning and sequencing techniques, and instructions sufficient to direct persons of skill through many cloning exercises are found in Berger Kimmel; Sambrook et al.; and F.M. Ausubel et al. (all supra). Product information from manufacturers of biological reagents and experimental equipment also provide information useful in known biological methods. Such manufacturers include the SIGMA chemical company (Saint Louis, MO), R&D systems (Minneapolis, MN), Pharmacia LKB Biotechnology (Piscataway, NJ), CLONTECH Laboratories, Inc. (Palo Alto, CA), Chem Genes Corp., Aldrich Chemical Company (Milwaukee, WI), Glen Research, Inc., GIBCO BRL Life Technologies, Inc. (Gaithersberg, MD), Fluka Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland), Invitrogen, San Diego, CA, and Applied Biosystems (Foster City, CA), as well as many other commercial sources known to one of skill.

The nucleic acid compositions of this invention, whether RNA, cDNA, genomic DNA, or a hybrid of the various combinations, are isolated from biological sources or synthesized in vitro. Deoxynucleotides may be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage Caruthers, Tetrahedron Letts. 22(20):1859-1862 (1981), using an automated synthesizer, as described in Needham-VanDevanter, et al., Nucleic Acids Res.

12:6159-6168 (1984).

10 In one embodiment of the invention, the amino acid sequence of RaCOR1, *which had been previously published, was used to deduce a nucleic acid sequence and, using the preferred codon for the expressing cell, synthesized. For example, the RaCOR1 nucleic acid sequence was prepared from the published amino acid sequence of the native RNAse and the preferred codon usage by E. coli.

o. 15 To generate the full length nucleic acid sequence, overlapping ole oligonucleotides, representing both the sense and nonsense strands of the gene and usually 40-120 bp in length, were synthesized chemically. These DNA fragments were then annealed, ligated and cloned. For example, from the published amino acid sequence of ribonuclease from Rana catesbeiana oocytes, a series of oligonucleotide primers were 20 prepared. These primers (SEQ ID NO:32-41) were used to generate the 5' and 3' ends of ribonuclease. The two regions of nucleic acid were then ligated to form the complete coding sequence. An advantage of this method is that mutations are relatively easy to engineer. To do so, one changes the nucleotides within the synthetic primer to correspond to the codon that translates to the desired amino acid.

One of skill will recognize many other ways of generating alterations or variants of a given nucleic acid sequence. Such well-known methods include site-directed mutagenesis, PCR amplification using degenerate oligonucleotides, exposure of cells containing the nucleic acid to mutagenic agents or radiation, chemical synthesis of a desired oligonucleotide in conjunction with ligation and/or cloning to generate large nucleic acids) and other well-known techniques. See, Giliman Smith, Gene 8:81-97 (1979), Roberts, et al., Nature 328:731-734 (1987) and Sambrook, Innis, Ausubel, and Berger (all supra).

In another embodiment of the present invention, site directed mutagenesis is used to change an interior methionine to a leucine. The nucleic acid sequence is changed by synthesizing an oligonucleotide primer that contains the mutation. The primer is hybridized to a nucleic acids of SEQ ID NO:1 and SEQ ID NO:14 and a new sequence amplified. After suitable rounds of amplification (approximately 20-30), the overwhelming majority of the sequences contain the mutation. The amplification product with the mutation is ligated into an expression vector and the RNAse with the mutation expressed.

Most commonly, polypeptide sequences are altered by changing the 10 corresponding nucleic acid sequence and expressing the polypeptide. However, polypeptide sequences can also be generated synthetically using commercially available peptide synthesizers to produce any desired polypeptide (see, Merrifield, and Stewart Young, supra).

One of skill can select a desired nucleic acid or polypeptide of the invention 15 based upon the sequences provided and upon knowledge in the art regarding ribonucleases generally. The physical characteristics and general properties of RNAses are known to skilled practitioners. The specific effects of some mutations in RNAses are known.

S: Moreover, general knowledge regarding the nature of proteins and nucleic acids allows one of skill to select appropriate sequences with activity similar or equivalent to the nucleic acids and polypeptides disclosed in the sequence listings herein. The definitions section herein describes exemplary conservative amino acid substitutions.

Finally, most modifications to nucleic acids and polypeptides are evaluated by routine screening techniques in suitable assays for the desired characteristic. For instance, changes in the immunological character of a polypeptide can be detected by an appropriate immunological assay. Modifications of other properties such as nucleic acid hybridization to a target nucleic acid, redox or thermal stability of a protein, thermal hysteresis, hydrophobicity, susceptibility to proteolysis, or the tendency to aggregate are all assayed according to standard techniques.

To obtain high level expression of a cloned gene, such as those cDNAs encoding ribonuclease, it is important to construct an expression vector that contains a strong promoter to direct transcription, a transcription/translation terminator, and a ribosome binding site for translational initiation. Suitable bacterial promoters are well 23 known in the art and described, in Sambrook et al. and Ausubel et al. Bacterial expression systems for expressing ribonuclease are available in, E. coli, Bacillus sp., and Salmonella (Palva, et al., Gene 22:229-235 (1983); Mosbach, et al., Nature 302:543- 545 (1983). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.

The promoter used to direct expression of a heterologous nucleic acid depends on the particular application. The promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription 10 start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the ribonuclease-encoding nucleic acid in host cells. A typical 15 expression cassette thus contains a promoter operably linked to the nucleic acid sequence encoding ribonuclease and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Depending on the expression system, the nucleic acid sequence encoding ribonuclease may be linked to a cleavable signal peptide sequence to promote secretion of the encoded protein by the transformed cell.

Such signal peptides would include, among others, the signal peptides from tissue plasminogen activator, insulin, and neuron growth factor, and juvenile hormone esterase of Heliothis virescens. Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.

In addition to a promoter sequence, the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.

The particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET15b, pET23D, and 24 fusion expression systems such as GST and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, 6-his.

For example, the cDNA of the RNAses of this invention were inserted into pETlld and the pET15b vectors. These vectors comprise, in addition to the expression cassette containing the coding sequence, the T7 promoter, transcription initiator and terminator, the pBR322 ori site, a bla coding sequence and a lad operator.

The vectors comprising the nucleic acid sequences encoding the RNAse molecules or the fusion proteins may be expressed in a variety of host cells, including E.

coli, other bacterial hosts, yeast, and various higher eukaryotic cells such as the COS, CHO and HeLa cells lines and myeloma cell lines. In addition to cells, vectors may be expressed by transgenic animals, preferably sheep, goats and cattle. Typically, in this expression system, the recombinant protein is expressed in the transgenic animal's milk.

The recombinant nucleic acid will be operably linked to appropriate expression control sequences for each host. For E. coli this includes a promoter such as 15 the T7, trp, or lambda promoters, a ribosome binding site and preferably a transcription *.termination signal. For eukaryotic cells, the control sequences will include a promoter and preferably an enhancer derived from immunoglobulin genes, SV40, cytomegalovirus, etc., and a polyadenylation sequence, and may include splice donor and acceptor sequences.

The expression vectors or plasmids of the invention can be transferred into the chosen host cell by well-known methods such as calcium chloride transformation for E. coli and calcium phosphate treatment, liposomal fusion or electroporation for mammalian cells. Cells transformed by the plasmids can be selected by resistance to antibiotics conferred by genes contained on the plasmids, such as the amp, gpt, neo and hyg genes.

Once expressed, the RNAse protein can be purified according to standard procedures of the art, including ammonium sulfate precipitation, column chromatography (including affinity chromatography), gel electrophoresis and the like (see, generally, R.

Scopes, Protein Purification, Springer-Verlag, N.Y. (1982), Deutscher, Methods in Enzymology Vol. 182: Guide to Protein Purification., Academic Press, Inc. N.Y. (1990)).

2. Cleaving the RNAse Protein After translation in the host cell, the RNAse which comprises a signal peptide is cleaved within the bacterial periplasm. Thus, no further manipulation of the protein is required for activity. For proteins with an amino terminal methionine, if a Nterminal glutamine or pyroglutamic acid is desired, the protein is treated with a cleaving agent or a combination of cleaving agents to remove the methionine. By "cleaving the amino terminal methionine" is meant cleaving the amino terminal methionine or amino terminal peptide from the polypeptides of SEQ ID NO:6, 8, 9, 13, 17, 21, 22, 26 and conservative variants thereof. Thus, by "cleaving the amino terminal methionine", a 10 polypeptide of SEQ ID NO:2, 4, 11, 15, 19, 24 or conservative variants thereof is generated, optionally linked via peptide bonds to additional residues at the carboxy or amino terminus.

The cleaving agent may be a proteolytic enzyme such as an exopeptidase or endopeptidase (collectively, "peptidase") or a chemical cleaving agent. Exopeptidases 15 include aminopeptidase M (Pierce, Rockford, IL) which sequentially remove amino acids from the amino-terminus. Cleavage of the amino terminal methionine by exopeptidases may be controlled by modulating the enzyme concentration, temperature, or time under which the cleavage takes place. The resulting mixture may be purified for the desired protein by means well known to those of skill, for example, on the basis of length by electrophoresis. The chemical cleaving agent, cyanogen bromide, is conveniently employed to selectively cleave methionine residues.

The cleaving agent employed to cleave the amino terminal methionine will typically be chosen so as not to break a peptide bond within the polypeptide of SEQ ID NO:2 and 15 or conservative variants thereof. Alternatively, use of a particular cleaving agent may guide the choice of conservative substitutions of the conservative variants of the polypeptides of the present invention. For example, the sequence of the native protein of SEQ ID NO:2 contains a methionine at position 23. As shown in SEQ ID NO:4 and SEQ ID NO:8, this methionine was changed to a leucine to prevent cleavage of the RNAse polypeptide chain with a 1 methionine by CNBr. Similarly, the native protein of SEQ ID NO:15 contains 2 internal methionines, one at position 22 and the other at position 57. As shown in SEQ ID NO:19 and 21, these methionines corresponding to position 22 and 57 26 in SEQ ID NO:15 were changed to leucines to prevent cleavage of the polypeptide chain when the N-terminal methionine was cleaved from the remainder of the protein.

The polypeptides of this invention may be purified to substantial purity by standard techniques, including selective precipitation with such substances as ammonium sulfate; column chromatography, immunopurification methods, and others. See, for instance, R. Scopes, PROTEIN PURIFICATION: PRINCIPLES AND PRACTICE, Springer-Verlag: New York (1982), U.S. Patent No. 4,673,641, Ausubel, and Sambrook.

C. Purification ofRNAsefrom Bacterial Cultures 10 In the case of secreted proteins, the RNAses of this invention can be isolated and purified from the broth in which the expressing bacteria have been grown without having to resort to the cell lysis methods detailed below.

1. Purification of Protein from Bacterial Periplasm 15 It is anticipated that RNAse expression from E. coli may be low and the protein is exported into the periplasm of the bacteria. The periplasmic fraction of the bacteria can be isolated by cold osmotic shock in addition to other methods known to skill in the art (see Ausubel, and Trayer, H.R. Buckley, III, J. Biol. Chem.

245(18):4842 (1970)).

To isolate proteins from the periplasm, the bacterial cells are centrifuged to form a pellet. The pellet is resuspended in a buffer containing 20% sucrose. To lyse the cells, the bacteria are centrifuged and the pellet is resuspended in ice-cold 5 mM MgSO 4 and kept in an ice bath for approximately 10 minutes. The cell suspension is centrifuged and the supernatant decanted and saved. The proteins present in the supernatant can be separated from the host proteins by standard separation techniques well known to those of skill in the art.

27 2. Purification of Inclusion Bodies When recombinant proteins are expressed by the transformed bacteria in large amounts, typically after promoter induction; but expression can be constitutive, the proteins may form insoluble aggregates.

Purification of aggregate proteins (hereinafter referred to as inclusion bodies) involves the extraction, separation and/or purification of inclusion bodies by disruption of bacterial cells, typically but not limited by, incubation in a buffer of about 100-150 pig/mL lysozyme and 0.1% Nonidet P40®, a non-ionic detergent. The cell suspension can be ground using a Polytron® grinder (Brinkman Instruments, Westbury, 10 Alternatively, the cells can be sonicated on ice. Alternate methods of lysing Sbacteria are described in Ausubel and Sambrook and will be apparent to those of skill in the art.

The cell suspension is centrifuged and the pellet containing the inclusion bodies resuspended in buffer, 20 mM Tris-HC1 (pH 1 mM EDTA, 150 mM NaCl 15 and 2% Triton-X 100®, a non-ionic detergent. It may be necessary to repeat the wash step to remove as much cellular debris as possible. The remaining pellet of inclusion bodies may be resuspended in an appropriate buffer 20 mM sodium phosphate, pH 6.8, 150 S*mM NaCI). Other appropriate buffers will be apparent to those of skill in the art.

Following the washing step, the inclusion bodies are solubilized by the addition of a solvent that is both a strong hydrogen acceptor and a strong hydrogen donor (or a combination of solvents each having one of these properties); the proteins that formed the inclusion bodies may then be renatured by dilution or dialysis with a compatible buffer. Suitable solvents include, but are not limited to urea (from about 4 M to about 8 formamide (at least about 80%, volume/volume basis), and guanidine hydrochloride (from about 4 M to about 8 Some solvents which are capable of solubilizing aggregate-forming proteins, for example SDS (sodium dodecyl sulfate), formic acid, are inappropriate for use in this procedure due to the possibility of irreversible denaturation of the proteins, accompanied by a lack of immunogenicity and/or activity.

Although guanidine hydrochloride and similar agents are denaturants, this denaturation is not irreversible and renaturation may occur upon removal (by dialysis, for example) or dilution of the denaturant, allowing re-formation of immunologically and/or biologically active protein.

28 After solubilization, the protein can be separated from other bacterial proteins by standard separation techniques.

D. Standard Protein Separation Techniques 1. Solubility Fractionation Often as an initial step and if the protein mixture is complex, an initial salt fractionation can separate many of the unwanted host cell proteins (or proteins derived from the cell culture media) from the recombinant protein of interest. The preferred salt is ammonium sulfate. Ammonium sulfate precipitates proteins by effectively reducing the i: 10 amount of water in the protein mixture. Proteins then precipitate on the basis of their solubility. The more hydrophobic a protein is, the more likely it is to precipitate at lower ammonium sulfate concentrations. A typical protocol is to add saturated ammonium sulfate to a protein solution so that the resultant ammonium sulfate concentration is between 20-30%. This will precipitate the most hydrophobic of proteins. The precipitate 15 is discarded (unless the protein of interest is hydrophobic) and ammonium sulfate is added to the supernatant to a concentration known to precipitate the protein of interest. The precipitate is then solubilized in buffer and the excess salt removed if necessary, either through dialysis or diafiltration. Other methods that rely on solubility of proteins, such as cold ethanol precipitation, are well known to those of skill in the art and can be used to fractionate complex protein mixtures.

2. Size Differential Filtration If the size of the protein of interest is known or can be estimated from the cDNA sequence, proteins of greater and lesser size can be removed by ultrafiltration through membranes of different pore size (for example, Amicon or Millipore membranes).

As a first step, the protein mixture is ultrafiltered through a membrane with a pore size that has a lower molecular weight cut-off than the molecular weight of the protein of interest. The retentate of the ultrafiltration is then ultrafiltered against a membrane with a molecular cut off greater than the molecular weight of the protein of interest. The recombinant protein will pass through the membrane into the filtrate. The filtrate can then be chromatographed as described below.

29 3. Column Chromatography Proteins can be separated on the basis of their size, net surface charge, hydrophobicity and affinity for ligands. In addition, antibodies raised against proteins can be conjugated to column matrices and the proteins immunopurified. All of these methods are well known in the art.

It will be apparent to one of skill that chromatographic techniques can be performed at any scale and using equipment from many different manufacturers Pharmacia Biotech).

In a preferred embodiment of this invention, the proteins are expressed from 10 E. coli with a six histidine residue tag joined via a peptide bond to a 7 methionine. After the protein is purified to homogeneity as in Newton, et al., Biochemistry 35:545 (1996), the protein is cleaved at the 7 methionine as described above. The CNBr is removed and the mixture applied to a Ni 2 -NTA agarose column. The flow-through material is the cleaved product of interest.

E. Cyclization Upon cleavage of the N-terminal methionine and other residues of the amino terminal peptide, a protein comprising the polypeptide of SEQ ID NO:2 or 15 or a conservatively modified variant thereof is generated. The glutamine residue of SEQ ID NO:2 or 15 is caused to cyclize by any number of means, including spontaneously or by catalysis, to a pyroglutamyl residue. Spontaneous hydrolysis of amino terminal glutamine residues to their pyroglutamyl form is well known to the skilled artisan and its rate may be hastened by, for example, increasing the temperature. See, Robinson, et al., J. Am.

Chem. Soc. 95:8156-8159 (1973). Cytotoxicity or anti-viral activity of the resultant RNAse protein may be assessed by means herein disclosed and well known to the skilled artisan.

VII. Ligand Binding Moieties The polypeptides and proteins of the present invention may also be joined via covalent or non-covalent bond to a ligand binding moiety. The RNAse molecule may be joined at the amino or carboxy terminus to the ligand or may also be joined at an internal region as long as the attachment does not interfere with the respective activities of the molecules. Immunoglobulins or binding fragments thereof single-chain Fv fragments) may conveniently be joined to the polypeptides of the present invention.

Vaughan, et al., Nature Biotechnology 14:309-314 (1996).

A. Chemically Conjugated Fusion Proteins In one embodiment, the RNAse molecule is chemically conjugated to another molecule a cytotoxin, a label, a ligand, or a drug or liposome). Means of chemically conjugating molecules are well-known to those of skill.

The procedure for attaching an agent to an antibody or other polypeptide 10 targeting molecule will vary according to the chemical structure of the agent. Polypeptides S" typically contain a variety of functional groups; carboxylic acid (COOH) or free amine (-NH groups, which are available for reaction with a suitable functional group on an RNAse molecule to bind the other molecule thereto.

Alternatively, the ligand and/or RNAse molecule may be derivatized to 15 expose or attach additional reactive functional groups. The derivatization may involve attachment of any of a number of linker molecules such as those available from Pierce Chemical Company, Rockford Illinois.

o A "linker", as used herein, is a molecule that is used to join two molecules.

The linker is capable of forming covalent bonds to both molecules. Suitable linkers are 20 well known to those of skill in the art and include, but are not limited to, straight or branched-chain carbon linkers, heterocyclic carbon linkers, or peptide linkers. Where both molecules are polypeptides, the linkers may be joined to the constituent amino acids through their side groups through a disulfide linkage to cysteine). However, in a preferred embodiment, the linkers will be joined to the alpha carbon amino and carboxyl groups of the terminal amino acids.

A bifunctional linker having one functional group reactive with a group on a particular agent, and another group reactive with an antibody, may be used to form a desired immunoconjugate. Alternatively, derivatization may involve chemical treatment of the ligand, glycol cleavage of the sugar moiety of a glycoprotein antibody with periodate to generate free aldehyde groups. The free aldehyde groups on the antibody may be reacted with free amine or hydrazine groups on an agent to bind the agent thereto.

(See U.S. Patent No. 4,671,958). Procedures for generation of free sulfhydryl groups on polypeptides, such as antibodies or antibody fragments, are also known (See U.S. Pat. No.

4,659,839).

Many procedure and linker molecules for attachment of various compounds including radionuclide metal chelates, toxins and drugs to proteins such as antibodies are known. See, for example, European Patent Application No. 188,256; U.S. Patent Nos.

4,671,958, 4,659,839, 4,414,148, 4,699,784; 4,680,338; 4,569,789; and 4,589,071; and Borlinghaus, et Cancer Res. 47:4071-4075 (1987) which are incorporated herein by reference. In particular, production of various immunotoxins is well-known within the art and can be found, for example in "Monoclonal Antibody-Toxin Conjugates: Aim-ing the :10 Magic Bullet," Thorpe, et MONOCLONAL ANTIBODIES IN CLINICAL MEDICINE, Academic Press, pp. 168-190 (1982), Waldmann, Science 252:1657 (1991), U.S. Patent Nos. 4,545,985 and 4,894,443.

In some circumstances, it is desirable to free the RNAse from the ligand when the chimeric molecule has reached its target site. Therefore, chimeric conjugates :15 comprising linkages which are cleavable in the vicinity of the target site may be used when the effector is to be released at the target site. Cleaving of the linkage to release the agent from the ligand may be prompted by enzymatic activity or conditions to which the immunoconjugate is subjected either inside the target cell or in the vicinity of the target site. When the target site is a tumor, a linker which is cleavable under conditions present at the tumor site when exposed to tumor-associated enzymes or acidic pH) may be -used.

A number of different cleavable linkers are known to those of skill in the art. See U.S. Pat. Nos. 4,618,492; 4,542,225, and 4,625,014. The mechanisms for release of an agent from these linker groups include, for example, irradiation of a photolabile bond and acid-catalyzed hydrolysis. U.S. Pat. No. 4,671,958, for example, includes a description of immunoconjugates comprising linkers which are cleaved at the target site in vivo by the proteolytic enzymes of the patient's complement system. In view of the large number of methods that have been reported for attaching a variety of radiodiagnostic compounds, radiotherapeutic compounds, drugs, toxins, and other agents to antibodies one skilled in the art will be able to determine a suitable method for attaching a given agent to an antibody or other polypeptide.

B. Recombinant Fusion Proteins In a preferred embodiment, the chimeric fusion proteins of the present invention are synthesized using recombinant DNA methodology. Generally this involves creating a DNA sequence that encodes the fusion protein, placing the DNA in an expression cassette under the control of a particular promoter, expressing the protein in a host, isolating the expressed protein and, if required, renaturing the protein.

In one embodiment, the ribonucleases of the invention are fused in frame to single chain antibodies. For tumor cell killing, the antibodies typically specifically bind to a target on the tumor cell. In other embodiment, the fusion proteins comprise a ligand which binds to a receptor on a tumor cell. For example, hCG binds and is cytotoxic to Kaposi's Sarcoma cells. By making a fusion protein comprising hCG and the ribonucleases of this invention, a compound that binds to the tumor cells and is more cytotoxic than hCG alone can be achieved.

DNA encoding the fusion proteins of this invention, as well as the 15 recombinant RNAse molecules themselves, may be prepared by any suitable method, °including, for example, cloning and restriction of appropriate sequences or direct chemical synthesis by methods such as the phosphotriester method of Narang, et al. Meth. Enzymol.

S68:90-99 (1979); the phosphodiester method of Brown, et al., Meth. Enzymol. 68:109-151 (1979); the diethylphosphoramidite method of Beaucage, et al., Tetra. Lett. 22:1859-1862 (1981); and the solid support method of U.S. Patent No. 4,458,066.

In a preferred embodiment, DNA encoding fusion proteins or recombinant RNAse proteins of the present invention may be cloned using DNA amplification methods such as polymerase chain reaction (PCR). If two molecules are joined together, one of skill will appreciate that the molecules may be separated by a peptide spacer consisting of one or more amino acids. Generally the spacer will have no specific biological activity other than to join the proteins or to preserve some minimum distance or other spatial relationship between them. However, the constituent amino acids of the spacer may be selected to influence some property of the molecule such as the folding, net charge, or hydrophobicity.

The nucleic acid sequences encoding the recombinant RNAse molecules or the fusion proteins may be expressed in a variety of host cells, including E. coli, other bacterial hosts, yeast, and various higher eukaryotic cells such as the COS, CHO and HeLa 33 cell lines and myeloma cell lines. The recombinant protein gene will be operably linked to appropriate expression control sequences for each host. For E. coli, this includes a promoter such as the T7, trp, or lambda promoters, a ribosome binding site and preferably a transcription termination signal. For eukaryotic cells, the control sequences will include a promoter and preferably an enhancer derived from immunoglobulin genes, cytomegalovirus, etc., and a polyadenylation sequence, and may also include splice donor .and acceptor sequences.

The expression vectors or plasmids of the invention can be transferred into the chosen host cell by well-known methods such as calcium chloride transformation for 1 0 E. coli and calcium phosphate treatment or electroporation for mammalian cells. Cells transformed by the plasmids can be selected by resistance to antibiotics conferred by genes contained on the plasmids, such as the amp, gpt, neo and hyg genes.

Once expressed, the recombinant RNAse or fusion proteins can be purified according to standard procedures of the art, as described above, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (see, generally, R. Scopes, PROTEIN PURIFICATION, Springer-Verlag, N.Y. (1982), Deutscher, METHODS IN ENZYMOLOGY VOL. 182: Guide to Protein Purification., Academic Press, Inc. N.Y. (1990)). Substantially pure compositions of at least about to 95% homogeneity are preferred, and 98 to 99% or more homogeneity are most preferred for pharmaceutical uses. Once purified, partially or to homogeneity as desired, the polypeptides may then be used therapeutically.

VIII. Uses of RNAse The molecules of this invention, both the fusion proteins and RNAse alone can be used for a variety of uses.

A. Anti-Tumor Drug The RNAse molecules are uniquely adapted for gene therapy applications.

They can be fused to other therapeutic agents, for example, they could be fused to an anti- B cell lymphoma antibody, an anti-transferrin receptor antibody or an anti-colon cancer antibody. As mentioned above, native Onconase® has anti-tumor effects in vivo and preferentially kills rapidly dividing cells stimulated by serum or growth promoting agents such as ras. The RNAses of this invention can be used in a similar manner. The RNAses of this invention are readily internalized in the cell. Their activity can be further facilitated by joining them to a nuclear localization signal (NLS) and the like to redirect the molecules within the cell. Of particular use in tumor cells would be to target telomerase, an enzyme subject to degradation by ribonuclease.

Telomerase is being investigated as a "universal cancer target." It is an RNA protein that is located in the nucleus. It has been shown that antisense to telomerase RNA can inhibit the function of the enzyme and block the growth of cancer cells (Feng, et aL, Science 269:1236 (1995)). Previous studies have shown RNase can destroy the 10 activity of the enzyme when incubated with a cell extract containing telomerase. Thus a RNAse molecule can be made, which when administered to a person with cancer, would be routed to the nucleus of cells.

In a gene therapy protocol, a vector containing an expression cassette which encodes for the RNAses of this invention can be used either to infect cells ex vivo, for example hematopoietic cells in lymphoma or leukemia, or to infect cells in vitro.

Recently, there has been a lot of activity in synthesizing retroviral vectors with chimeric coat proteins. The chimeric proteins typically comprise two domains, one of which is embedded in the viral coat and is of retroviral origin. The second domain is heterologous to the virus and is a member of a binding pair. For example, the second domain consists of a single chain Fv fragment which binds to a tumor cell surface marker or it is the ligand to which an antibody expressed on the cell surface binds. Other binding pairs, not necessarily monoclonal antibodies and their ligands will be apparent to those of skill.

Studies with Onconase® have indicated other potential uses. It has been found that Onconase® synergizes with ras in microinjection studies. Onconase® does not synergize with ras when it enters the cell via its own routing but requires a CAAX motif to localize ras at the plasma membrane (C=Cys, A an aliphatic amino acid, X S,M,C,A, or Q, an example is Cys-Val-Ile-Met (SEQ ID NO:29)). Importantly this type of sequence has been shown to target heterologous proteins to the plasma membrane (Hancock, et al., EMBO J. 10:4033 (1991)). The RNAses of this invention have identical uses.

B. Targeted Fusion Proteins The RNAses of this invention can be joined to a ligand binding moiety that is specific for tumor cells. Examples of such ligand binding moieties include, but are not limited to, monoclonal antibodies directed against tumor cell markers such as heregulin, CD22, PSA, etc.; cytokines that target tumor cells, such as tumor necrosis factor; and other tumor cell binding proteins, including hCG.

In addition, one of skill will recognize that two cytotoxic factors can be joined to one ligand binding moiety. For example, the RNAses of this invention can be joined to a monoclonal antibody directed against a tumor cell marker which is also joined 10 to a synthetic drug with cytotoxic activity, such as paclitaxel or methotrexate.

Finally, the fusion proteins of this invention find use as cytotoxic agents against cells other than tumor cells. For example, the RNAses of this invention are joined to ligand binding moieties that specifically target B cells which secrete antibodies directed against self. Thus, the RNAses of this invention are useful in the treatment of 15 autoimmune diseases.

IX. Pharmaceutical Compositions S: The molecules and fusion proteins employing them of this invention are useful for parenteral, topical, oral, or local administration, such as by aerosol or transdermally, for prophylactic and/or therapeutic treatment. The pharmaceutical compositions can be administered in a variety of unit dosage forms depending upon the method of administration. For example, unit dosage forms suitable for oral administration include powder, tablets, pills, capsules and lozenges. It is recognized that the subject molecules and fusion proteins and pharmaceutical compositions of this invention, when administered orally, must be protected from digestion. This is typically accomplished either by complexing the protein with a composition to render it resistant to acidic and enzymatic hydrolysis or by packaging the protein in an appropriately resistant carrier such as a liposome. Means of protecting proteins from digestion are well known in the art.

The pharmaceutical compositions of this invention are particularly useful for parenteral administration, such as intravenous administration or administration into a body cavity or lumen of an organ. The compositions for administration will commonly comprise a solution of the chimeric molecule dissolved in a pharmaceutically acceptable 36 carrier, preferably an aqueous carrier. A variety of aqueous carriers can be used, e.g., buffered saline and the like. These solutions are sterile and generally free of undesirable matter. These compositions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of therapeutic molecule in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the patient's needs.

Thus, a typical pharmaceutical composition for intravenous administration would be about 0. 1 mg to 10 mg per patient per day. Dosages from 0. 1 mg up to about 100 mg per patient per day may be used, particularly when the drug is administered to a secluded site and not into the blood stream, such as into a body cavity or into a lumen of an organ. Actual methods for preparing parenterally administrable compositions will be known or apparent to those skilled in the art and are described in more detail in such publications as REMINGTON'S PHARMACEUTICAL SCIENCE, 15th ed., Mack Publishing Company, Easton, Pennsylvania (1980).

The compositions containing the present recombinant RNAse molecules or the fusion proteins or a cocktail thereof with other proteins) can be administered for therapeutic treatments. In therapeutic applications, compositions are administered to a patient suffering from a disease, in a cytotoxic amount, an amount sufficient to kill cells of interest. An amiount adequate to accomplish this is defined as a "therapeutically effective dose." Amounts effective for this use will depend upon the severity of the disease and the general state of the patient's health.

Single or multiple administrations of the compositions may be administered depending on the dosage and frequency as required and tolerated by the patient. In any event, the composition should provide a sufficient quantity of the proteins of this invention to effectively treat the patient.

Although the present invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

X. Examples A. Example 1: Expression Pattern of RNAse in Rana pipiens Tissues A DNA sequence corresponding to amino acid residues 16-98 of Onconase® was cloned by PCR amplification of Rana pipiens genomic DNA and sequenced. The sequence, consisting of 252 bp of DNA encoding the ribonuclease was designated Rana clone 9. Total cellular RNA was isolated from either male or 10 female Rana pipiens tissues using RNA STAT-60 (TEL-TEST Inc.) according to the manufacturer's protocol. Poly A+ containing mRNA was prepared using an Oligotex mRNA kit (Qiagen). Poly RNA was size fractionated on a 1% agarose gel "i containing 6% formaldehyde and blotted onto Nitran® nylon membranes (Schleicher Schuell) in 10X SSC overnight. The membrane was rinsed in 2X SSC for 5 min, air dried and the RNA was cross linked to the membrane by exposure to UV light (Ultra-Lum) for 2 min. The RNA blot was hybridized at 42°C for 16-18 hours with a ["P]-labeled DNA probe prepared from 30 ng of Rana clone 9 insert using the oligo labeling kit from Amersham. After hybridization, the RNA blot was washed twice in IX SSC, 1% SDS for 20 min at 42 0 C. The blot was exposed to X-ray film for 4 days. The molecular size of mRNA was estimated using 0.24-9.5 kb RNA molecular weight markers (BRL).

Since Onconase® is isolated in large quantities from the oocytes of Rana pipiens, it was assumed that high levels of RNAse RNA would be present in the mRNA from oocytes. Surprisingly, mRNA reacting with Rana clone 9 was not detected in Rana pipiens oocyte, heart, lung and kidney tissues. The only mRNA signal detected with Rana clone 9 was a strongly hybridizing 3.6 kb RNA in mRNA isolated from Rana pipiens liver. As a protocol control, the same northern blot was probed with a ["P]-labeled human actin cDNA. Actin mRNA was detectable in all of the tissues. In another northern analysis with four-fold more liver poly mRNA, a second weakly hybridizing mRNA of about 950 bp was detected.

To confirm that RNAse mRNA was present in Rana pipiens liver but not in oocytes, RT-PCR was performed using total RNA isolated from Rana pipiens liver and oocytes and with the degenerate primers used in the cloning of the Rana clone 9 insert.

Total RNA was isolated from Rana pipiens liver and oocytes. The procedure of Chen, et al., Oncogene 12:741 (1996) was used. Briefly, PCR was carried out under the following conditions: 94 0 C for 5 minutes and then 30 cycles of denaturation at 94C for 1 min, annealing for 2 min at 55 0 C, and primer extension for 1 min at 72 0

C.

The degenerate forward primer used AG(GA)GATGT(GT)GATTG(TC)GATAA(CT)ATCATG-3' (SEQ ID NO:30)] with the reverse degenerate primer AAA(GA)TG(CA)AC(AT)GG(TG)GCCTG(GA)TT(CT)TCACA-3' (SEQ ID NO:31)].

The PCR products were analyzed on a 1.5% agarose gel and stained with 10 ethidium bromide. the PCR product obtained from liver was subcloned into PCR3 vector by TA cloning (Invitrogen) and sequenced.

A band of the expected size of about 250 bp was generated in the liver RNA but not oocyte RNA, consistent with the result from northern blot analysis. To ensure that the 250 bp band represented RNAse cDNA, this PCR product was subcloned 15 and its DNA sequence determined with the Sequenase v. 2.0 kit (United States Biochemical).

Bases 1, 7, 13, 23 and 235 of the PCR product differed from the sequence of Rana clone 9. With the exception of the change at base 23, all of the other base changes were within the degenerate primer sequences. The difference at base 23 is an A to T transition which results in conservative amino acid change from threonine to serine, and could be due to polymorphism of the RNAse gene or a PCR error.

B. Example 2: Expression of RNAse in Rana pipiens To determine if RNAse is present in Rana pipiens oocytes or other tissues, protein extracts were isolated from various Rana pipiens tissues and separated on a 4-20% Tris-Glycine SDS- containing polyacrylamide gel. The protein extracts were transferred to a nitrocellulose membrane using IX transfer buffer (Novagen) at 250 mA for 45 min. The membrane was probed with primary and secondary antibodies as described in Chen, et al., Oncogene 12:241 (1996). The primary anti-Onconase® antibody was used at 1:100 dilution. The detecting antibody (horseradish peroxidase labeled donkey anti-rabbit Ig (Amersham)) was used at 1:2500 dilution. The antibodies were visualized using an ECL detection kit from Amersham.

The western blot analysis demonstrated that a protein of the correct size (12 kDa) was present in extracts from oocytes. Other tissues, including liver, did not contain a 12 kDa protein that reacted with the anti-Onconase@ antibody. High molecular weight bands were also observed. These represented other forms of Onconase® glycosylated or multimeric) or represented related members of the pancreatic ribonuclease A amphibian superfamily. It had been previously determined that the anti-Onconase® antibody cross reacts with other pancreatic type RNAses such as bovine pancreatic ribonuclease as well as two human RNAses; eosinophil-derived neurotoxin and angiogenin.

10 C. Example 3: Isolation and cloning of cDNA from Rana pipiens liver mRNA Liver poly RNA was purified twice using the poly Pure kit (Ambion). The cDNA library was constructed using a ZAP-cDNA synthesis kit and Gigapack II gold packaging extracts according to the manufacturer's protocol (Stratagene).

The library contained about 1.5 x 106 pfu from 5 pg of liver poly RNA and was 15 amplified once according to Stratagene's protocol. The library titer after amplification was 9 x 10 9 pfu/mL. About 3 x 10' plaques were screened by using a 32 P]-labeled insert of Rana clone 9 following Stratagene's procedure. Positive clones (3alb, 4alb and were excised from the lambda ZAP II vector and subcloned into pBluescript SF- vector.

Plasmid DNA was prepared using the Qiagen spin plasmid miniprep kit.

Clone 5alb was digested with KpnI and HindIII to generate 3' and protruding ends, and digested with exonuclease III to generate 5alb deletion clones.

Overlapping deletions were generated according to the manufacturer's instructions with the Erase-a-Base system (Promega). The size of DNA inserts from the deletion clones were estimated from agarose gel analysis, and the selected clones were sequenced using the T7 promoter primer. The cDNA of clone 4alb, the 5' end of clone 3alb and part of the clone 5alb were sequenced using T3, T7 and appropriate primers. All the sequencing reactions were performed using the Sequenase v. 2.0 kit (United States Biochemical) and dATP (>1000 Ci/mmole, Amersham). Both strands of clone 5alb were sequenced.

Clone 5alb cDNA (SEQ ID NO:27) which was about 2.8 kb in size, contained an open reading frame (ORF) at the 5' end. The deduced amino acids at positions 1-23 were characteristic of a signal peptide with a charged amino acid within the first 5 amino acids, a stretch of at least 9 hydrophobic amino acids to span the membrane, and a cysteine at position 23. The putative signal peptide sequence was followed by a highly conserved but not identical amino acid sequence compared to Onconase@. There were four amino acid differences between the ORF of clone 5alb and Onconase® including amino acid residues 11, 20, 85 and 103. With the exception of a conservative change at amino acid residue 11, all the other amino acid conversions are between polar and charged amino acid residues.

1D. Example 4: Cloning and Expression of RaPLR1 10 Oligonucleotide primers were designed to clone the cDNA sequence of Rana pipiens liver RNAse (RaPLRI) as a [met-1] fusion protein as well as to modify the primary amino acid structure by changing the N-terminal amino acid residue following the initiating methionine from glutamine to serine ([Met-(-1)]RaPLR1(QlS). Thus, the recombinant RNAses obtained from the bacteria in this expression system contain an extra methionine at the amino terminal end Amplification of these sequences was carried out in a thermal cycler and the DNA was cloned into an expression vector using methodology previously described in Newton, et al., The plasmids were expressed in B121(DE3) E. coli and the recombinant S proteins were isolated from inclusion bodies as described (Newton, et al., supra) before being applied to a CM Sephadex C-50 column. Final purification to homogeneity as assessed by gel electrophoresis was achieved by size exclusion chromatography.

*9*

C

E. Example 5: Assembly of Synthetic RaCORI Gene The following oligonucleotides were synthesized: G CAACACTATCATGGACAACAACATCTACATCGTTGGTGGTCAG-3' (SEQ ID NO:32) CTACTGTTAAACGTATCTGCACTGGTGTTATC-3 (SEQ ID NO:33)

'-ATCTGCACTGGTGTTACTAACATGAACGTTCTGTCTACTACTCGTTTCCAGCTG

AACACTTGCACTCGTAGTTCTATCACTCCGCGTCCGTGCCCG-3 (SEQ ID NO:34) '-GTTGATAACACCAGTGCAGAT-3' (SEQ ID NO:3 5'-ATCTGCACTGGTGTTATCAAC-3' (SEQ ID NO:36)

'-ACTCCGCGTCCGTGCCCGTACTCTTCTCGTACTGAAACTAACTACATCTGCGTT

~:AAATGCGAAAACCAGTACCCGGTTCATTTCGCTGGTATCGG-3' (SEQ ID NO:37) 5 '-ATATATCTAGAAATAATTTTATTTA.ACTTTAAGAAGGAGATATACATATGCAG A ACTGGGCTACTTCCAG-3' (SEQ D NO:3 8) '-CGCGCCGGATCCCTACTACGGGCAACGACCGATACCAGCGAAATGAAC-3' :15 (SEQ ID NO:39) -CAoAACTGGGGTACTTrTCCAGCAGAAACATATCATCAACACTCCGATGATCTG CAACACTATCCTGCAGAACAACATCTACATCGTTGGTGGTCAG-3' (SEQ ID

'-ATCTGCACTGGTGTTATCAACCTGAACGTTCTGTCTACTACTCGTTTCCAGCTG

AACAC-rrGCACTCGTACTTCTATCACTCCGCGTCCGTGCCCG-3' (SEQ ID NO:4 PCR reactions were performed containing: 1X reaction buffer (100 mM Tris-HCl, pH 8.3, 500 mM KC1, 1.5 MM MgC1 2 0.4 mM nucleotides; units Amplitaq(O DNA polymerase; gdvI oligonucleotides (SEQ ID NO:32-41) in the combinations listed below; and water to adjust to 100 4L final volume.

The thermal cycler conditions were as follows: 94 0 C for 5 min preinicubation then cycles at 94*C for I min; 550 for 2 mini; and 72'C for 2 mini. The first PCR reaction contained SEQ ID NO:32, 33 and 35, which comprised the 5' half of the RNAse gene.

42 The second PCR reaction contained SEQ ID NO:34, 36, and 37 which comprised the 3' half of the gene. For the proteins wherein positions corresponding to positions 22 and 57 of SEQ ID NO:15 were changed to leucines, the first reaction was with SEQ ID NO:33, and 38 to synthesize the 5' half of the gene and the second was with SEQ ID NO:36, 37 and 38 to synthesize the 3' half of the gene.

The PCR products were purified using the Geneclean® II kit from Bio 101, Inc. Vista, CA) according to the manufacturer's instructions. The following PCR reactions were performed under conditions as above to assemble the complete gene as shown in Figure 1. To assemble the non-mutated gene, SEQ ID NO:38 and 39 were added to the 10 purified PCR products. To assemble the gene with the methionine to leucine mutation, ~SEQ ID NO:40 and 41 were used.

The assembled genes were purified by the GeneClean® procedure, cleaved with the endonucleases XbaI and BamHI overnight and ligated into the pET-11d vector.

The DNA was sequences, expressed and the protein purified as described in Newton, et 15 al., Biochemistry 35:545 (1996). The nucleotide sequence of the non-mutated synthetic gene is shown in SEQ ID NO:14. The amino acid sequence of the gene product is as shown in SEQ ID The clone containing the mutations was subsequently modified by PCR to insert an NdeI restriction site for ligation into the pET-15b vector (which encodes a six histidine tag as well as a thrombin cleavage site at the 5' end of the expression cassette insertion point) by using primers as shown in SEQ ID NO:39 and 5'-GGATTCCATATGCAGAACTGGGCTATTTTCCAG-3' (SEQ ID NO:42). The PCR methods were as shown above.

F. Example 6: Purification of RNAse with Mutations The purified Rana catesbeiana proteins of Example 5 contained a six histidine tail at the N-terminus. The protein was treated with CNBr as described by Gross Witkop, J. Biol. Chem. 237:1856 (1962). In brief, the protein (dissolved in 0.1 N HC1) was treated with 100-fold molar excess of CNBr for 24 hours at ambient temperature.

CNBr cleaves on the carboxyl side of methionine residues; the mutated protein contains only one methionine at the 1 position. The CNBr was removed by lyophilization and the protein dissolved in 0.1 M Tris-HCl, pH 7.5. The soluble protein was applied to a Ni 2 43 NTA agarose column (Qiagen) to remove the uncleaved protein from the +1 Gin cleaved protein. The His tail bound to the Ni 2 -NTA column and the cleaved RNAse was found in the flow-through. Elution of the column yielded the His-containing cleavage product and non-cleaved (His), (SEQ ID NO:43) containing protein. Densitometry analysis of cleaved and non-cleaved protein demonstrated that 50% of the protein was cleaved by CNBr.

The mutated protein was allowed to cyclize at the N-terminus to form pyroglutamic acid by dialysis in 0.2 M KPO 4 buffer. An amino end group analysis was performed to ensure the presence of a blocked NHz-terminus.

10 G. Example 7: Analysis of RNAse Activity "-The methods used to assay the recombinant RNAses of this invention were done as described in Newton, et al., Protein Engineering 10:463 (1997). Briefly, ribonuclease activity using high molecular weight RNA and tRNA was determined at 37C by monitoring the formation of perchloric acid-soluble nucleotides. The buffer was 0.16 S: 15 M Tris-HCl, pH 7.5 with 1.6 mM EDTA and 0.2 mg/mL human serum albumin (HSA).

Ribonuclease activity was assayed according to DePrisco, et al., Biochemica et Biophysica Acta 788:356 (1984) and Libonati Floridi, Eur. J. Biochem. 8:81 (1969) by measuring the increase with time in absorbance at 260 nm. Incubation mixtures (1 mL of 10 mM imidazole, 0.1 M NaCI, pH 7.0) contained substrate and appropriate amounts of enzyme solution at 25 0 C. Final substrate concentration in the assays was 0.33 mg/mL tRNA.

Each assay was repeated 2-6 times and the average value was used in data treatment.

Kinetic parameters were obtained with the aid of the data analysis program of Cleland, Methods of Enzymol. 63:103 (1979).

The results of the assay is shown in Table I.

44 Table I. Ribonuclease Activity RNAse Activity RNAse (units/mg protein) Fold Increase native Onconase® 9 recombinant Rana catesbeiana RNAse 200 22 recombinant Onconase® (Q1S) recombinant Rana pipiens RNAse (Q1S) 2.5 1.7

S

The cytotoxicity of the RNAses of this invention was determined by measuring the protein synthesis of tumor cells in the presence of the RNAse. Protein synthesis was measured as previously described in Rybak, et al., J. Biol. Chem.266:21202 (1991). 0.1 mL of cells (2.5 x. 104 cells/mL) were plated into 96-well microtiter plates in Dulbecco's Minimum Essential Medium supplement with 10% heat-inactivated fetal bovine serum (A-FBS); additions were made in a total volume of 10 pL; and the plates 15 were incubated at 37 0 C for the times indicated. Phosphate-buffered saline (PBS) containing 0.1 mCi of ["C]-leucine was added for 2-4 hours, and the cells were harvested onto glass fiber filters using a PHD cell harvester, washed with water, dried with ethanol and counted in a scintillation counter. The results are expressed in Table II as percent of 1 4 C]-leucine incorporation in the mock-treated wells.

Recombinant Onconase® with a methionine at the 1 position was not very cytotoxic since correct hydrogen bonding at the active site is fostered by the pyroglutamic acid N-terminus of the native protein (Newton, et al., Protein Engineering 10:463 (1997)).

In the four human tumor cell lines tested, the recombinant Rana pipiens liver RNAses were more active than recombinant Onconase®. It appears that the four amino acid differences in RaPLRl change the active site configuration such that is does not display the degree of dependence Onconase® has on the N-terminal pyroglutamic acid residue for correct hydrogen bonding at the active site.

Similarly, RaCORI was also more cytotoxic than recombinant Onconase®.

Again, most likely this is due to an active site that is not dependent on the N-terminal pyroglutamic acid for correct hydrogen bonding.

9. 9 9** to** 9.

S

a to V *S99 0.0 99 Table 11 Cytotoxicity in human tumor cells of recomlbinant RNAses (IC 50 (nM)) Cell Line Tumor type 1rec Onconase® rec; RaPLRl Fold rec RAPLR jFold rec; RACOR Fold 1.Increase jQIS [Increase Increase SF539 Glioma 29,200 2,300 13 417 70 1,300 22 HS578T Breast >8,300 8,300 >1 670 >8 2,500 >3 ACHN Kidney 26,700 3,300 8 1,580 17 1,000 11 Malme Melanoma 25,000 580 43 750 33 1,000 MCF7 Breast >8,300 320 26 It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference for all purposes.

e.

.o Page(s) 147- L are claims pages they appear after the sequence listing SEQ ID NO: Sequence 1 Rana pipiens liver ribonuclease cDNA (RaPLR I) 2 Rana pipiens liver ribonuclease amino acid (RaPLRI) 3 Ranapipiens ribonuclease cDNA with Met23Leu (recombinant RaPLR I Met 23Leu) 4 Rana pipiens ribonuclease amino acid with Met23Leu (recombinant RaPLRI Met 23Leu) Rana pipiens ribonuclease cDNA with Met at position 1 (recombinant Met(-1) RaPLR1) 6 Rana pipiens ribonuclease amino acid with Met at position I (recombinant Met(- 1) RaPLRl) 7 Rana pipiens ribonuclease cDNA with Met at position 1 and Met24Leu (recombinant Met(-1) RaPLRI Met23Leu) 8 Rana pipiens ribonuclease amino acid with Met at position I and Met24Leu (recombinant Met(-l) RaPLRI Met23Leu) Rana pipiens ribonuclease amino acid with (His) 6 Met at position 7 and Met3OLeu (recombinant Met(-l) RaiPLR1 Met23Leu-(HiS) 6 *10 Rana pipiens ribonuclease cDNA with GinI Ser (recombinant RaPLR 1 Q IS) 11 Ranapipiens ribonuclease amino acid with GinISer (recombinant RaPLRI Qi S) 12 Ranapipiens ribonuclease cDNA with Met at position 1 and Gln2Ser (recombinant Met(-l1) RaPLRLI Q IS) 13 Rana pipiens ribonuclease amino acid with Met at position I and G~n2Ser **(recombinant Met(-l1) RaPLR1I Q IS) 14 Rana catesbeiana oocyte ribonuclease synthetic gene cDNA (RaCORl) Rana catesbeiana occyte ribonuclease synthetic gene amino acid (RaCORI) 16 Rana catesbeiana ribonuclease cDNA with Met at position 1 17 (recombinant Met(-1) RaCORI) 17 Rana catesbeiana ribonuclease amino acid with Met at position I (recombinant Met(-1) RaCORI) 18 Rana catesbeiana ribonuclease cDNA with Met22Leu and MetS 7Leu (recombinant RaCORI Met22Leu Met.57Leu) 19 Rana catesbeiana ribonuclease amino acid with Met22Leu and MetS 7Leu (recombinant RaCORi Met22Leu MetS 7Leu) Rana catesbeiana ribonuclease, cDNA with Met at position 1, Met23Leu and MetS 8Leu (recombinant Met(- 1) RaCORI Met22Leu Met57Leu) 21 Rana catesbeiana ribonuclease amino acid with Met at position 1, Met23 Leu and Met58Leu (recombinant Met(- 1) RaCORI Met22Leu Met57Leu) 22 Rana catesbeiana ribonuclease, amino acid with (His) 6 Met at position 7, Met23Leu and Met58Leu (recombinant Met(- 1) RaCOR I Met22Leu Met57eu-(His) 6 23 Rana catesbeiana ribonuclease, cDNA with GinI Ser (recombinant RaCOR I Q IS) 24 Rana catesbeiana ribonuclease, amino acid with Gin I Ser (recombinant RaCORI Q IS) Rana catesbeiana ribonuclease cDNA with Met at position I and G~n2Ser (recombinant Met(- 1) RaCOR I Q IS) 26 Rana catesbeiana ribonuclease amino acid with Met at position I and Gln2Ser (recombinant Met(-.1) RaCOR I Qi IS) 27 Ranapipiens ribonuclease Clone 5al b cDNA insert 28 Rana pipiens ribonuclease Clone 5a l b amnino acid with signal peptide 29 CAAX motif to target heterologous proteins to the plasma membrane Rana pipiens forward degenerate primer 31 Rana pipiens reverse degenerate primer 32 Rana catesbeiana ribonuclease, synthetic gene (RaCORI) oligonucleotide 33 Rana catesbeiana ribonuclease synthetic gene (RaCORI) oligonucleotide 34 Rana catesbeiana ribonuclease synthetic gene (RaCORI) oligonucleotide Rana catesbefana ribonuclease synthetic gene (RaCORI) oligonucleotide 36 Rana caresbelana ribonuclease synthetic gene (RaCORI) oligonucleotide 37 Rana catesbeiana ribonuclease synthetic gene (RaCORI) oligonucleotide S38 Rana catesbeiana ribonuclease synthetic gene (RaCORI) oligonucleotide 39 Rana catesbeianci ribonuclease synthetic gene (RaCORI) oligonucleotide Rana cat esbeiana ribonuclease synthetic gene (RaCORI) oligonucleotide **41 Rana catesbeiana ribonuclease synthetic gene (RaCORI) oligonucleotide 42 Rana catesbeiana insertion primer for NdeI restriction site .*43 six histidine residue tag at amino terminus SEQ ID NO:l/2 oNA sequence l inear 312 b.p.

Cgg Ccc acg ttt cag crp leu thr phe gin atg tca aca aac ttg met ser rhr asn leu cca gtg aag gcc ac pro val lys ala lie ccc cat ccc tc gat.

phe cyr leu ser asp act aat aca et tclr thr asn dir phe cys cat cgc his cys aag aag cac ceg lys lys his leu tcc cac tgc aag phe his cYs lys tgc aaa gga att cys lys gly le tgc aat gta aca cys asn val chr gCa act tgt gag val thr cys; glu aca aac ace egg gat thr asn* chr arg asp gac aag aac act te-t asp lys asn chr phe ata gcC tee aaa aat ile ala ser lys asn age agg ccc tgc aag ser arg pro cys lys aat caa gct cca gt-a asn gin ala pro val gtt gac cgt aac val asp cys asn ate cat tea ege ile tyr ser arg gtg Cta act ace val leu tOe the cat aaa tea aag cye lys leu lys eat ttc gtg ggt his phe va2. g1Y 0* 0O S 0@S 0 00 S. S

S

SS

00 S

S.

eg S 0 6S 050005 *000 0 0 RaPLRI 4 SEQ ID N'O:3/4 DNA sequence 315 b. p. linear caA gac rgg cct acg, ctc cag aag aag cac ccg aca aac acc cgg gat gtc gac tgc gin asp trp, leu th~r phe gin lys lys his leu th~r asn th~r a rV asp val asp cys aat aat acr ccg tca aca aac Ctg r-tc cac tgc aag gaTZ aag aac aec crc ace tat tea asn asn ile leu ser thr asn leu phe his cys lys asp lys asn chr phe ile Cyr ser cgr. cct gag cca gtg aag gcc atc tgt- aaa gtga atc ata gcc tcc a aa aar. gc-g tta act arg pro glu pro val lys ala le cys lys gly Ile Ile ala ser lys asn val leu thr acc cc gag cct cat ccc ccc gat tgc aac gra aca age agg cct tgc aag tat aaa r- La thr s er glu phe ty r leu ser asp cys asn val thr ser arg pro cys lys cyr lys Ileu aag aaa teA act aa c aca ttt tgt gta aCt tgE gag ZaC czaa gCt cca gta car- ctc gtg lys lys ser thr asn thr phe cys val thr cys glu asn gin ala pro val his phe val :ggc gcc gga cat tgc o o. gly valI gly his cys recombinant RaPLRl Met23Leu o.

.o.

o o SEQ ID NO:5/6 DNA seqluence 315 b.p.

linear arcg met aatacn egC a rg ace thr .aag lys g ly caa gaC gin asp aac ac asn ie cct gag pro g ku tct gag ser clu aaa tca lys ser gCe gga valI gly ctt aeg ttc eag leu thr phe gin tca aca aac ttg ser thr asn leu gtg aag gcc atc val lys ala ile tat etc tct gat tyr leu ser asp aat aca Ctt tgt asn rhr phe cys tgC eys aag aag eac lys lys his tcc eac tge phe his cys tgr- aaa gga Cys lys gly tgc: aat gtr-a cys asn val val thr eYS aca aac ace thr asn th-r gac: aag aac aso lys asn ata gee tec ile ala ser age agg eet ser arg pro aat eaa get asn gin ala egg gat arg asp act ttt thr phe aaa. aat lys asn tgc aag Cys lys eea gta pro vai recombinant Met(-1) RaPLRl SEQ ID MQ7/8 CNA% sequence linear 315 b.p.

c aa gac gin asp aat. aCC asn ile ccE gatg pro glu CCc gag s glu aaa C.Ga lys ser gcC gga Val gly r9g :rP ccg 1 eu eca pro.

Ec phe act thr cat his ccc acg, t E, cag aag aag leu chr phe gin lys lYS cca aca aac ccg EcC cac ser thr asn leu phe his grg aag gec acc cgt- aa~a val lys ala le cys lys cat cc-c ccr gar-t c aatcyr I u ser asp cys asn aac aca Etc cgt- gtca act asn thr phe cys val th-r cgc eys cac ccg aca aac aec egg gat gct gac his leu rhr asn L.hr arg asp val asp cgc nag ga aag aac act ccc acc cAc cys lys asp lys asn chr phe ile cyr gga act aca gee tcc azaz aac gcg tc gly Ile Ile aia ser lys asn val leu gt-a aca agc agg ccc cgc aag cat aaa val c1h.r ser arg pro cys lys Cyr lys cgc- Tg ac Cara get eca gca car tcc eys g3.u asn giln ala pro val his pne recombinant IMat(-1) RaPLR1 Met23Leu SEQ ID NO:7/9 DNA sequence 31.5 b.p. lna atcg CaA PC tgg ctt acg trt-t cag aag aag cac ctg aca, aac acc C99 gaG gtCt gac tCgC, (Hs m et gin asp txp leu thzr phe gin lys lys his leu rthr asn th r ax"Y alp v1al ap cYS aat. aac aCt. ctg tCA aca aac ttg ttC C3C t9gC aag ga c aag aac act tc atcc cat tca asn asn ile leu sef tchr asn leu ph. h-is cys lys asp lys asn thr phe ile cyr s er cgC ect gag cca gtg aag gcc atc tcgt aaa 97a ac gca gcc tcc aaa aaC. gc-g Cta act :arg pro glu pro val lys ala ile cys lys gl y Ii ii. ala s er lys asn val 3.eu thr acc p-tr gag tcct.at ctcC tct gat cgc aat. gc-a aca agc agq ccC. cgC aag cat. aaa tta **thr 'ser glu phe tyr leu s ex asp cys asn val tlix s ex arg pro cys lys cyr lys. leu aag ax act aat aca cttC tgct gca. act tct gag amc cira gct- cca qgca cat ccc gcg lys lys ser t±hr asn Cthr phe cys val Cthr cys glu asn gin ala pro val his ph. va~l ggt gtc. gga cat t gly val gly his cl s recombinant Met(-l) RaPLRI Met23eu-(His 6 SEQ ID NO:lQ/ll oNA sequence 315 b.p.

1 inear tea gac tgg ctt aeg ttt eag aag aag cac ser asp trp leu thr phe gin lys ].ys h~is aat aac ate atg tca aca aac ttg ttc cac tgc asn asn ile met ser thr asn leu phe his cys cgt ct gag cca gtg aag gee ate tgt aaa gga arg pro glu pro val lys ala le cys lys gly acc c: gag ttt tat ecC tet gat tge aat gta thr sex glu phe tyr leu ser asp cys asn val aag aaa tca act aat aca ttt tgt gta act tgt lys lys ser thr asn thr phe cys val thr cys ggr. gtc gga cat tgc gly val gly his cys ctg aca aaC ace egg gat gtc gac tgt ieu thr asn thr arg asp val asp CYS aag gac aag aae act ttt ate tat tea lys asp lys asn rthr phe ile tyr ser act ata. gcc tcc aaa aat gtg tta act le le ala ser lys asn val leu thr aca age agg cct tgc aag tat aaa cta t Lr ser arg pro cys lys tyr lys leu gag aaz caa get cca gta cat ttc grg glu asn gin ala pro vaJ. his phe val recombinant RaPLRI QiS SEQ ID NO:12/13 D)NA sequence 315 b.p.

linear acg tca gac C-gg mec. ser asp trP aac. aat atc actg asn asn ile mec.

cg. cct gag cca arg pro glu pro acc tct gag rC~CC ctir ser glu phe aag aaa tca act .lys lys ser cthr gcc gga cat.

.gly val gly his crc. acg ctrtc cag aag aag cac cctg leu thir phe gin lys lys his leu cca aca aac ctcg ttrc cac etgc aag ser tr~h asn ieu phe his cys lys gctg aag gcc actc ctgc aaa gga atr val lys ala ile cys lys gly le t~at ctc tcc gat. c.c aac gma aca cyr leu ser asp cys asn val th~r aac. aca c~ctc cg: gcta act. tgc gag asn thr pthe cys' val th~r cYs 91U tgc cys aca aac acc Cgg gat. gr-r. gaC tgtthr asn rthr arg asp val asP cys gac aag aac act. ctt aCC tat C~Ca asp lys asn thr phe le tyr ser acta gcc tcc aaa aaC. 9t9 ttca act le ala ser lys asn val leu cthr agc -agg, ccc. cgc aag cac. aaa tta ser a-rg pro cys lys cyr lys 1Lu aac caa gct cca gza cat tcc 9C9g asri gin ala pro val his phe val recombinant Met(-1) RaPLR1 QiS SEQ ID NO:14/15 linear DNA sequence 330 b.p.

CkG AAC TOO oCC A(7r TC CAG CAG AA4A CAT ATC ATC A-AC ACT CCC AMC XTC TOC MAC ACT gin asn t.rP ala thr phe gi n gin lys his Ile lie asn thr pro Ile Ilie cys asn thr AMC AM GAC M.C AAC AMC TAC AMc GIT GCT OC CAG TCC AAA COT cET MAC ACrT 'rC A-IC Bie mec asp asn asn Ile cyr ile ra I gly gly gin cys lys arg val asn thr pne Ile A-Ic 'TTr GCT A=T ACT GTI' M CT ATC 'ICC ACT OCT CIT MTC AAC ATC M.C MT OTM .ile sear ser ala h~r thr val lye ala Ile cys thr gly val Ile an met an val ieu 'TTr ACT ACT CCT TC OG C-O MAC ACrT 'CC ACT COT ACT 7-T A'IC ACT CCC CUT CCC IC Sear thr thr arg phe gIn leu asn thr cys thr arg thr ser le thr pro arg pro eys CCC TAa 'TC7 TiCT COT ACT GAA ACT AAC TAC ATC 'ICC AAA 'ICC C.AA MAC CAG TAC CCC p ro y r sec set arg rhr gu chr asn cyr ie cys valI lye cys glu asn gin cyr pro C-T! CAT TIC OCT COT ATC CT COT 'ICC CCC val his phe ala gly Ile gly arg cys pro Rana catesbeitafa synt.hetic gene t ranslated amino acid sequence SEQ ID NO: 16/17 DMA sequence 333 b.p. linear ATO CA AAC =C C ACT 7M~ CAGC cG~ AMA CAT ATC MTC AAC ACT CCG ATC ATC TCC AAC met gin asn trp ala chr phe gin gin lys his ile ile asn thr pro Ilie Ile cys asfl ACT AlT AlT CAC MAC AAC ATC TAC Mt CT C G=W CAC TGC MAA CDT =I AAC ACT TIC thr le mt asp asn asn le cyr ie val gly g1Y gin cys: lys a rg val asn c2hr phe AlT r T WrCI Acr AC? GI AAA =C Alt Tcc Acr =T =I Alt AC AC MC T ile le ser ser ala thr thr val lys aia le c,'s thr g1Y val le asn met asn val CmD Tcr ACT ACT COT MI CAC ClT AAc AcT T= cC C ACT 7 T A C I ACT CCC CTF COO ieu ser thr rthr arg phe gin ieu asn ethr cys thr arg thr ser ile thr pro arg pro 'ICC CMC TAC IC T C= ACT GA A= AAC TAC AlT TtC G=I MAA= 'C.A AM C CAG TAC cys pro tyr ser ser arg thr glu thr asn tyr le cys val iys cys giu asn gin Cyr ccG crr CAT rmT CT CoT Alt GCC cc? 'CC CCG pro val his phe ala giy lie gly arg cys pro (Met- Rana catesbeiaia gene &translation of expressed protein SEQ ID NO:18/19 DtA sequence 333 b.p. lna CAG AC CCT ACr TIC CAG CAG AMA CAT? AC ATC AMC ACr =C AMC ATC TGC MAC gin asri tip ala thr phe gin gin lys his le le asn thr Pro le le cys asn Acr MTC CIG GAC MAC MAC MC TAC PLIC IT CMT CAC AAA CGT =I MC ACr IC tA'.r le ieu asp asn asn le tCyr le val g1Y gly gin cys lys arg v.1 as n rchr phe C- AM C= OTCT C CIT MA GCI AMC I= Aa CT AMt AAC CIC MAC =I ile le ser ser ala thr th val iYs ala ile cys thi gly vzai le a=n ieu asn a CTG 'I=I ACT ACT CC= TIC cAc cmC AC ACT =G ACT CCT ACT WI' AIC ACT CCG aC? caC eu ser rchr tthr arc Phe gin leu a= thr cys tr arg thkr ser le thr Pro azV PCO ~CCC TAC T=T =C CCT ACr GAiL ACT MAC TAC AlT 'CC ITr AAA TM~ GAiL MC OkG TAC cys pro tyr ser ser arg thr giu thr asn cyr le cys val lys cys giu asn gin cyr CCC GT CAT TMC CC? =I AlT GC CC? 'ICC CCC pro val his phe ala gly le gly arg cys pro Rana catesbeiala gene with two mutationls to regenerate pyrogJ.ucamic acid N-cerminla Met 22 Leu Met 57 Leu SEQ ID llO:20/21..

linear CM sequenCe 333 b.p.

pja M? AMC GG G~ ACT M~ CAG CG AM CAT ATC MC ACT =C A C ATC WiC MC -cnir asn trP ala Lh~r phe gin gin lys his le le asn t.hr pro Ile Ile cys asn.

crcG)C C M AC ACM crr GGT =r CAIG MCA =C CIT ACACt 'IIM thr Ile leti asp asfl aszl Ile cyr Ile val giy gly gin cys yarvlas rhrpe ATC )'1C TirCT GT xCT XCT CIT j cr K& Ca AMW MrAC C CIC AMC C't Ile le ser ser ala Lh~r rthr va]. lys ala Ile cys t.hr gly val Ile asn ieu asn va] ciGT= 'ircr ACT -Y 'ETC CAai C~ ic~rg tr ACT Ia leu spr rthr rhr arg phe gin lau asn Cr r cs~ r h e AM 'i G GAA CM. J lys progi asflg r 'icc CCC TA Cr T 'CT CGT ACT GM hCT WC TAC MAT GC =I c-ys prm eyr ser ser arg thr glu thr asn cyr ile cYs va41 Am C XA XAC lys cys glu asn gin ryr 4 CCc; c-ri CAT 'TC C M T 't caM CGT ICC =C pro val his phe ala g1Y Ile gly arg cys pro (1Met-(-I) IRana catesbeiafla gene with two mutations to regenerate pyroghitacC acid N-terminal Met 22 Lau Met 57 Leu SEQ ID NO:20/22 linear Dt4A sequence 333 b.p.

(His) 6 m~ CwMC A~cT cr Tx~ acA cc MA CAT m' ATc M ACT C= MT MT =C AC met aln asn trp ala thr phe gin gin lys his Lie ile asn Lkir Pro ile Ile cys asn ACr TC M~C GAC MAC MAC ATC TAC KIC MI CT =T CAG TOZ MAA CCT IT MAC Wcr TMC thr Ile ieu asp asn asn Ile cyr Ile val gly gly gin cys tyr arg val. asn thr phe .IC AC TCr TCT wr ACT ACT CIT Ile le aer ser ala thr chr val M.A CCC AE 7=C ACT =C Mr M MC =CIC M T lys ala le cys thr'gly val le asn lau a&sn v-1 =IC ACT ACT MI CAG =I AkC ACT =IC AC? CCT ACrT 'Cr AC ACT C03 CCT CC) leu ser th~r thr. arg phe gin ieu asn Lh~r cys t2hr erg thr ser Ile Lh~r pro arg pro ICC CCC TAC ICr 'ICC CC'? ACT GMA cys pro tyr ser ser arg rthr giu AC? MC TAC =I =C IT MA TWC GM WC CaG TAC thr asn tyr Ile cys val lys cys glu asn gin tyr CCCTCAT TC OCT =C AIC =C cm' C C pro val his phe ala gly lie gly arg cys pro (me tRania catesbeiana gene with two mutations to regenerate py-roglutamlic acid DIArermiflal Met 22 Leu Me~t 57 Leu (His) 6 SEQ ID NO:23/24 DNA sequence 333 b.p. lna M A MC ACT TIC CAG CAG AAA CAT ATC ATC AAC ACT COO A C ATIC OC AAC ser asn crp ala rthr phe gin gin lyc his le le asn rhr pro le ile cys asn Acr AmC A-m GAC ~c M~C iTc TAC A=t Grr =C =CT cAc TGc MAA 03T GTT M~C Acr TIc thr le met asp asn asn le cyr le val. giy gly gin cys lys arg val asn thr phe AKIt Kit TOrTCIT GCT ACr ACT CTI' AMA =rI Alt ICC ACT CC~r GIT Alt AMC Kit MC =T *le le ser ser ala th~r thr val lys ala le cys thr gly val ile asn met asn val :Ct ITr ACT ACT MCT TMC CAC CrC MAC ACT =C ACr CT ACrT 'Cr AlT ACr COG O:T C03 eu ser th~r thr arg phe gin leu asn thr cys th~r arg .h~r ser Ile thr pro arg pro TrCC CMG TAC IT= ITT CGT AC' GM ACr MAC VC MCt ICC Gr MAA 7MC GMA MC CAG TAC cys pro tyr ser ser arg thr giu thr asn tyr le cys vai lys cys giu asn gin Cyr .CCC CIT CAT TIM C =C AltC CCT TGIC COG pro val his phe ala gly lie gly erg cys pro QIS Rana catesbelafla genie serine in 1. position) 16 SEQ ID NO:25126 MkI sequence 333 b.p. linear AM .TrCA AC TG G~r ACr =I CAC CAG AMA CAT MTC A=C MC ACr CMC MC ATC TC AAC met ser asn trp ala thr phe gin gin lys his le Ile asn th- pro le le cys asn ACT ATC ATC GAC MAC MAC A=C TAC AMC CT!' =T CT CAC GC =AA CCT MC ACTTC thr Ile met asp asn asn le Cyr Ile val gly giy gin cys lys arg val asn t2hr phe A7C AT-- TCT OCT ACT ACr-' AMA C ATC =C ACrT T! C MAC A= MC CT" ile Ile ser ser ala thr thr val lys ala Ile- cys thr gly va I le asn met asn Val *.*CCT=T ACT ACT CT T7C CAG CMC AAC ACT =C ACr =T ACrT= 'I I C ACT Cc CC? Ca; l eu ser thr rthr arg phe gin leu asn thr cys thr arg thr ser Ile thr pro arg pro 7WC CCC TAC =1C 7=t CC? ACT GMA ACT MAC TAC A=C TOC CIT MAA 'ICC GAA MC CAG TAC *cys pro ryr ser ser arl I hr glu ch. as -yr le cys val lys cys giu asn gin Cyr! ~CCC CIT' CAT =I CC! CT MwCC? CCT TGC C pro val his phe ala gly Ile gly arg cys pro (MeC-(-1)l QIS Rana catesbeiana gene (serine in 1 Dosition) SEQ ID NO:27/28 1 atcagCtgCt catcgCCLga ccaagCtgCC ttccatctga agcaatattt 51 atatacaaCC CctcCtatat ataaaggccC gatcacgacLt. ccagaatgt a.

a a a 6* a a a.

a a a.

a.

a a a. a a a.

a..

a as.

a a a .aaa a 101 CtccaaaatC ctcaCCtc~c.

P K F 5 FL- 151 cataagtccC tatgtcaaga H K 5 L. C- Q D 201 aaacacccgg gatgttgact N TR D VD C 251 actgcaagga caagaacacC C K D K NT 301 gccatctgta aaggaaCtat AlI C K Gi1l 351 gtCCtatctc tctgaCtgca F Y L S D C N 401 taaagaaatc aactaataca K K S TN T 451 gtacaCttcg Cgggtgtcgg V H F V G V G 501 atgtgataag cagctgcaag 551 actaaCCCtg cataaaCLCC 601 caacagggag ccaagcacag 651 aaagtcacac tggaccgctg 701 agacaaaaac agcagagCtg 751 tcaattgggg atggagtcca 801 aagcatgtgg ccggtgcaca 851 cgggctcgct gtggtggtgc 901 ggctgtcccc cc~cctgtgg 951 gggtgggagg cctggagaga 1001 ggcagcatcg gggaggggaa 1051 actgcatgac cagagtggaa 1101 accagaggga tctgtgccca 1151 Cggttatggt aaccgctccc 1201 CCttggtct gcggctccct 1251 gcaCCtctcc accgcctttg 1301 tggccageca Cggcr-caCt 1351 tCtgtcggcg gtggactgtt 1401 ggttccttgc cacctcctgg 1451 agcgcCtagt ggatgcagtg 1501 gtgcaagaaa aaatatCCtc 1551 aggaagttg agcacattca 1601 tccaaagttc acagtctat 1651 gagcagagga caaatctatq 1701 ttatattga ttgaagataz 1751 aaaattaata cataacagct 1801 atagtCCtaa acgtaaaat2 1851 atcaCtaaat CttacctatE 1901 cgctggtgct gtccCCCcas 1951 tgcatgtaca ggagtgaCgt 2001. agttcaagtg Cgagtggctt 2051 gtgcgggggt ctccgCCtg 2101 gegccgttcc Ctcagagcat ctggcttacg W LT gtaataatat NN I tttatctaCC F IY S agcctccaaa A SK a Cgtaacaag VT S tCttgtgtaa F C V T acattgctag XiC aaattatttt ccccagagCt aaagtaaac C ctactgcact ggaagcgcag CgtgagaC CC gtacacatgg cggcggttga gggc Cgtgga attttcaaaC gggctgggCt gatggcagag gccttcccc agctgtttgg ctgtccacgg gctccgtgC tcccattgt CC gaattcCC a atctgtgctt aaactcCggt ataCtrctcC cgttctaggg tgcctttagt gcdacaaaaa tcttcttCCC c atgtattatz tgttttacct ggtgagaccc agccctgtgc :Catcacagct gagccacgat ggcgcaggac atgcgtgggt CCtcagaaga a F QK K catgtcaaca a M S T cacgtcctga R P E aatgtgttaa N V L T caggccttgc.

cttgtgagaa C E N aaatatgttt gaagtgaatt taccggtagt aaggagccaa cagatgacca atccgggagg ggaaccgCCC ggaaagatag gccaaaggtg cagagggagc agc Cgacgtg cagatccagg ccgctgcagt tccctgatgt gggtgttttc ccctcatgga tggcactgtc catgtgtgC C catggattcc tccaatctCg gattaccatc *cacccaattg aaaatgagtg *aaatccaccc LaacCttacct *atttcctaaa Lccacagcagc t aaagtggaa *atgcgcCtct -tgcgaacggc *ccggccagtc -gatgtcgCC -actgggggaa -gacgtcacta ctgatatCtg cagttgCCCC gagtctcacC T, T F A LgcacctgaC H L T LacCtgtccC tLF H ;ccagtgaag P VK :tacctctga T SE iagtataaat Y K L tcaagctcca Q AP gacaacaggg tactaaagac aagaaaatcC agtaattata aatgagaaac tggcggggag gCggtg tcggaCtggc gtggggaga C tgcggaccag gccggggCtg aagcatggtc ggccggggag ggcccgtttC gggctcCgca gggggggtgg gcagCgagtC ggttgcatgC atcCtcggtC CC CtCC CCCC atccaatcat ggtatcCatC caac Cgcac C cattaCCCCC actgaaCtaC CaCtgtaatc aaar-gCtaaa gtaaactcC caggaatggc ggctcccgtg acagagttag ccaaacatgt tagCatgggt gctgcatcCa 2151 2201 2251.

2301 2351 2401 2451 2501 2551 2601 2651 2701 2751 2801 2851 aa~ g aa t atc tgggtaagcc gcagtagcaa aatcttacct gtcttaaaaa gct~cccccaC gce.cgaccgt cagatgtcg acgatcagag cattcaatgt atcatcaggt tggaccgtat agagacccat aaaaa tcctaaacaa ttattgtagg actttaacac atgtagggat atagetggttg ggctaggata acatgagtag taaatagcgt cgtatgcacg agatgctcag catatgccta.

ggcagccaac aggaacagca tgtgggtat tgr-catatta ggagatagtt cttacctata ggtaaaaatc cggcatagct gcgtgtttat gaggagagca ggctgacata aaagtagttg aaaataagat gcacag.at.c cacatgaggc caaggagcaa tggtaatgtg tggccctcca agtgatacat cagacatatg tgggcggatg atctgcccga aggagaaagg aagaagccac ccaccataaa cacaccaggc ccaaaggagg ctcagctatc' acataattac aacaaccaaa tggctaaaaa acagtaccta atgcatggga aaaccaCac ttaaagtaaa ggcc tgcagg accagatctc gggagataag ttgggatagg tggaaa.ca aagttaatag gtggccccag acaagagtat aaaaaaaaaa 000 0 *00 5* 0* *506 0 0* @5 06 0

S

@000 @000 0 500505

S

0006 S S

Claims (15)

1. A cytotoxic reagent comprising a recombinant ribonuclease linked to an antibody directed against a cell surface antigen on a cancerous B cell, wherein the recombinant ribonuclease has measurable ribonuclease activity; an amino terminal end beginning with a glutamine; a leucine at position 11; an asparagine at position 21, a threonine at position 85, and a histidine at position 103, such positions being determined with reference to those specified amino acid positions of SEQ ID NO:2; and substantial identity to SEQ ID NO:2. *S

2. The cytotoxic reagent of claim 1, wherein the antibody is directed against *CD22.

3. The cytotoxic reagent of claim 2, wherein the antibody is LL2.

4. The cytotoxic reagent of claim 3, wherein the LL2 antibody is humanized.

5. The cytotoxic reagent of claim 3, wherein the LL2 antibody is a single chain antibody. 00"

6. A cytotoxic reagent comprising a recombinant ribonuclease encoded by a nucleic acid comprising SEQ ID NO:14 and conservative variants thereof linked to an antibody directed against a cell surface antigen on a cancerous B cell.

7. A cytotoxic reagent of claim 6, wherein the antibody is directed against CD22. *0

8. A cytotoxic reagent of claim 7, wherein the antibody is LL2.

9. The cytotoxic reagent of claim 8, wherein the LL2 antibody is humanized.

The cytotoxic reagent of claim 8, wherein the LL2 antibody is a single chain antibody. 48

11. A method of killing cancerous B cells comprising contacting cells to be killed with a cytotoxic reagent comprising a recombinant ribonuclease linked to an antibody directed against a cell surface antigen on a cancerous B cell, wherein the recombinant ribonuclease has an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, and SEQ ID NO:26.

12. The method of claim 11, wherein the antibody is directed against CD22.

13. The method of claim 12, wherein the antibody is LL2.

14. The method of claim 13, wherein the LL2 antibody is humanized.

15. The method of claim 13, wherein the LL2 antibody is a single chain antibody. o* e° «o o