MXPA97005624A - Ligandos for receivers similar to the - Google Patents

Abstract

Polypeptides are described which bind to one or more EPH-like receptors, particularly the HEK4 receptor. The polypeptides are designated as HEK4 binding proteins. Also described are nucleic acids encoding HEK4 binding proteins, and expression vectors, host cells and methods for the production of the polypeptides. Polypeptides are useful to modulate the growth and / or differentiation of a variety of tissues, including those of the liver, kidney, lung, skin, digestive tract and nervous system and can be used to regenerate damaged or diminished tissues to treat cancer or nerve system disorders

Description

LINKS FOR SIMILAR RECEIVERS TO EPH The invention relates to polypeptides which bind to one or more receptors similar to EPH. More particularly, the invention relates to polypeptides that bind to the HEK4 receptor, to the nucleic acids encoding them and to the expression vectors and host cells for the production of the polypeptides.

BACKGROUND OF THE INVENTION The response of cells to their environment is often mediated by growth factors and differentiation, soluble proteins. These factors exert their effects by binding to and activating transmembrane receptors. This reaction is the initial event in a cascade that culminates in a biological response by the cell. An important class of transmembrane receptors are receptor tyrosine kinases (PRK receptors, reviewed in van der Geer et al Ann, Rev. Cell, Biol. 10, 251-337 (1994).) PTKs consist of an extracellular domain which interacts specifically with a ligand that recognizes the receptor, a membrane generating domain, and an intracellular domain which hosts the tyrosine kinase activity.

REF. 25186 receptors are activated by ligand-mediated dimerization followed by autophosphorylation of tyrosine residues in the cytoplasmic domain. The receptor PTK can then in turn phosphorylate substrate molecules in the signal transduction pathway, leading to a cellular response. The PTK family of receptors can be divided into a number of subfamilies based on the general structure of the extracellular domain and the relationships of the amino acid sequence within the catalytic domain. Currently, the largest known subfamily of receptor tyrosine kinase proteins is that of receptors similar to EPH, which consists of at least 13 members. Members of this subfamily include the following: EPH (Hirai et al., Science 238, 1717-1725 (1987)), ECK (Lindberg et al., Mol.

Cell. Biol. 10, 6316-6324 (1990)), Ce 4, Cek5, Cek6, Cek7, Cek8, Cek9, CeklO (Pasquale, Cell Regulation 2, 523-534 (1991); Sajjadi et al., The New Biologist 3, 769-778 (1991); Sajjadi and Pasquale, Oncogene 8, 1807-1813 (1993), Eek, Erk (Chan and Watt, Oncogene 6, 1057-1061 (1991)), Ehkl, Ehk2 (Maisonpierre et al., Oncogene 8, 3277-3288 (1993 )), HEK (PCT Application No. WO93 / 00425; Wicks et al., PNAS 89, 1611-1615 (1992)), HEK2 (Boh et al., Oncogene 8, 2857-2862 (1993)), HEK5, HEK7, HEK8, HEK11 (North American Patent No. of Series 08 / 229,509) and HTK (Bennett et al., J. Biol. Chem. 269, 14211-14218 (1994)). Until recently, no ligands have been identified for any member of the EPH subfamily. A ligand for the Eck receptor was described in PCT Application No. WO 94/11020 and Bartley et al. (Nature 3_68, 558-560 (1994)) and B61 was first identified as a polypeptide encoded by a cDNA of unknown function (Holzman et al., Mol Cell Biol. 10, 5830-5838 (1990)). Ligands have also been reported for the Elk and Ehkl receptors (PCT Application No. W094 / 11384, Davis et al., Science 266, 816-819 (1994)). More recently, a polypeptide (ELF-1) was identified from a cDNA library from the middle and deep parts of the mouse embryo brain that has been reported to be a ligand for Mek4 and Sek (Chen and Flanagan, Cell 79, 157 -168 (1994) Many attempts have been made to purify soluble factors from complex biological fluids in cell-based bioassays of the response to stimulation by factor.These include increased cell growth or survival, increased DNA synthesis, a chemotactic response , or some other consequences downstream of receptor activation.Autophosphorylation of the receptor has also been used as an assay to detect cell stimulation.A method for the isolation of ligands based on direct detection of the cell has recently been described. receptor / ligand binding and the use of receptor affinity chromatography by purification (Bartley et al., supra). Here we report the application of this method to purify, sequence and clone olecularly one of the family of ligands that correspond to the EPH subfamily of receptor tyrosine kinases. Although the EPH subfamily is the largest known receptor PTK subfamily, a few ligands have been identified that bind to and activate the receptor of the EPH subfamily. Therefore, one objective is to identify additional ligands for the receiving PTKs of the EPH subfamily. These ligands would be useful for modulating the responses of cells containing receptors of the EPH subfamily.

BRIEF DESCRIPTION OF THE INVENTION The present invention relates to polypeptides capable of binding to one or more PTK receptors similar to EPH. More particularly, the invention provides polypeptides that bind to the HEK4 receptor, but that also bind to other members of the PTK subfamily of receptors similar to EPH. These polypeptides are known as HEK4 binding proteins (HEK4 BP). In one embodiment, the polypeptide binds to and activates the HEK4 and ECK receptors. Also encompassed by the invention are nucleic acids encoding HEK BP and nucleic acids that hybridize to the nucleic acids of HEK4 BP and the polypeptides encoding them having at least one of the biological properties of a HEK4 BP. The biologically active HEK BP fragments and analogs and nucleic acids encoding them as well as the fusion proteins comprising HEK4 BP are also encompassed by the invention. Expression vectors and host cells for the production of biologically active HEK4 BP and processes for the production of HEK4 BP using the expression vectors and host cells are also within the scope of the invention. Also, antibodies that specifically bind to HEK4 BP are provided. The polypeptides of the invention are useful to modulate (i.e., increase or decrease) the growth and / or differentiation of cells that contain the EPH subfamily receptor, particularly cells that express HEK4 or ECK receptors. Based on the expression levels of HEK4, ECK, and HEK4 BP in a variety of tissues, HEK4 BP is expected to be useful for modulating growth and / or differentiation, for example of tissues of the liver, kidney, lung, skin or neural. The administration of HEK4 BP to mammals is useful in the treatment of disorders of the nervous system and in the regeneration of damaged or diminished tissues. Antagonists of HEK4 BP are also useful for the treatment of cancers.

DESCRIPTION OF THE FIGURES Figure 1. Selection with BIAcore of the media not conditioned on the HEK4-X surface. The concentrated samples of the cell-conditioned media were selected on a HEK4-X surface as described in Example 2. The number of samples of conditioned media gave a signal within each range of resonance units (RU) shown in FIG. histogram The samples that bound more than 200 RU are summarized in Table 1. Figure 2. Purification of HEK4 Binding Protein from conditioned media A498. Profile of the CLAP column in Inverted Phase C4 of the HEK4 BP (a); SDS-PAGE analysis of the pooled fractions of the indicated peaks observed in column C4. Figure 3. Sequence of the cDNA of the HEK-4 binding protein. The nucleic acid sequence of the cDNA clone of the human HEK-4 binding protein containing the entire coding sequence together with the estimated amino acid sequence is shown. The cDNA clone predicts a protein between 213 and 228 amino acids, depending on which of three potential start codons are used.

The sequence is numbered such that the predicted mature N-terminal amino acid is residue 1, with the putative signal peptide (underlined) extending from residues -19 to -1. Figure 4. Purification of the binding protein Recombinant HEK-4. Profile of the CLAP column in Phase Inverted C4 of the recombinant HEK4 BP (a); SDS-PAGE analysis of the C4 fractions in the vicinity of the A2? 4 peak. The fractions were identified by the elution times of column C4. Figure 5. Expression of the binding protein of HEK-4- in human tissues. The expression of the mRNA of the HEK-4 binding protein in human tissues was examined by Northern blot analysis as described in Example 6. A spot containing 2 μg of polyA + mRNA isolated from each of several Clontech tissues was obtained (Palo Alto, CA) and hybridized with the cDNA probe of HEK-4 binding protein labeled with 3P. Figure 6. Stimulation of tyrosine phosphorylation of receptors similar to EPH by HEK BP bound to the membrane. CHO cells expressing the recombinant HEK4 receptor and the endogenous ECK were treated with cells that were transfected with an expression vector containing the cDNA of HEK4 BP or vector without cDNA. After lysis, the HEK4 receptor (a) or the ECK receptor (b) were immunoprecipitated. The immunoprecipitates were fractionated by PAGE, electro-shortened, and probed with antiphosphotyrosine antibodies. Figure 7. Stimulation of tyrosine phosphorylation by soluble HEK4 BP. The cells were treated with conditioned media (CM) or recombinant HEK4 BP, with (+) or without (-) agglutination of the antibody, and tested for activation of the HEK4 receptor. a) Concentrated media twelve times were compared with 2μg / ml of HEK4 BP. (b) A binder that compares the dose response and unbonded HEK4 BP. Figure 8. Relative affinity of HEK4 BP for the HEK4, ECK and HEK8 receptors. A competition assay was performed to measure the binding of HEK4 BP to the immobilized HEK4 receptor in the presence of increasing concentrations of soluble HEK4, ECK, and HEK8 receptors as described in Example 8. The line identified as "Cl 50" was plotted at a value of UR that corresponds to the concentration of HEK4 BP which is 50% of the control UR value (without competitor).

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to polypeptides capable of binding to one or more PTK receptors similar to EPH, and, more particularly, they are capable of binding to a human homologue of the PTK receptor similar to EPH. To date, eight human homologs of the receptors similar to EPH, ECK, HTK, HEK2, HEK, HEK5, HEK7, HEK8 and HEKll have been identified. The characteristics of the different HEK receivers are described in the North American Application Serial No. 08 / 229,509, co-pending and commonly assigned, incorporated herein by reference. The polypeptides of the present invention preferably bind to the HEK4 receptor and are referred to herein as HEK4 binding proteins (HEK4 BP). The HEK4 receptor is a glycosylated 135 kDa tyrosine kinase protein previously identified as a HEK receptor by Wilks et al. supra, and is the human homologue of the Cek 4 and Mek 4 receptors identified in chicken and mouse, respectively. Polypeptides capable of binding to the HEK4 receptor also activate the receptor by inducing autophosphorylation of the receptor, an event that initiates the transmission of a signal from the cell surface to the nucleus. The activation of the HEK4 receptors leads to the modulation of the growth and / or differentiation of the cells that contain the HEK4 receptor. HEK4 BP also binds to and activates other receptors similar to EPH as described below. A HEK4 binding protein of the conditioned medium of the cell line A498 has been identified and isolated by the methods generally described in US Pat. No. 08 / 145,616, relevant portions of which are incorporated herein by reference, and are described in more detail in Example 2. Briefly, a gene coding for the extracellular domain of HEK4 was constructed and expressed as described in Example 1. The extracellular domain of the purified HEK4 was immobilized on an integrated microcircuit and BIAcore detector. Concentrated conditioned media from 102 different cell lines were selected for binding to the extracellular domains of the HEK4 receptor by surface plasmon resonance. This procedure identified the conditioned medium of the different cell lineages shown in Table 1 that has one or more factors that interact with the HEK. The A498 cell line was chosen as a source for the HEK4 ligand and a protein that binds to the HEK4 was purified as described in Example 2. The HEK4 binding protein purified and isolated from the conditioned medium of the A498 cells have three forms of molecular weights 21, 25 and 27kD on non-reducing SDS-polyacrylamide gels. These forms represent the glycosylation and C-terminal processing variants. HEK4 BP has the amino acid sequences shown in Table 2 for the peptides generated by cleavage with cyanogen bromide or trypsin.

The cDNA clones of the HEK4 binding protein were obtained from a human placental cDNA library as described in Example 3. The cDNA rel sequence of the human HEK4 binding protein is shown in Figure 3. Upon sequencing of the cDNA and mapping the carboxyterminal peptide map of the protein derived from the A498 cells, a major secreted form of the HEK4 binding protein had an amino terminal serine residue as shown in Figure 3 and a proline residue carboxy terminal at position 179. An alternative secreted form having a carboxy terminal alanine residue at position 177 was also detected. Alternative forms of HEK4 BP, including membrane bound forms, can also be synthesized. The recombinant HEK4 binding protein was expressed in CHO cells transfected with the cDNA encoding HEK4 BP as shown in Figure 3. The soluble HEK4 BP was purified as described in Example 4 and showed to bind to the HEK4 receptor by BIAcore analysis. The purified soluble HEK4 BP activated the HEK4 receptor and this activation was amplified by the agglutinated ligand antibody (Figure 7). Activation of the HEK4 receptor was also observed after contact of CHO cells expressing HEK4 BP with CHO cells expressing the HEK4 receptor (Figure 6).

Therefore, the recombinant HEK4 binding protein binds and activates PTK receptors similar to EPH. The invention provides a purified and isolated polypeptide, called HEK4 binding protein, capable of binding to at least one EPH-like receptor. In one embodiment, the polypeptide is capable of binding to the HEK4 receptor. The HEK4 binding protein is mammalian and is preferably human. The purified HEK4 binding protein is substantially free of other proteins and has a molecular weight of about 21 to 27 kD on non-reducing SDS-PAGE. The HEK4 BP has at least approximately 70% homology with the amino acid sequence as shown in Figure 3 (SEQ ID NO: 1) and is capable of binding to at least one receptor similar to the EPH. Preferably, HEK4 BP has the amino acid sequence shown in Figure 3 (SEQ ID NO: 1). The binding of a receptor similar to EPH by HEK4 BP may or may not result in activation of the receptor. The binding and activation of the receptor similar to EPH can be effected by HEK4 BP in either soluble or membrane bound forms, or both. It should be further understood that the binding and activation of the receptor by HEK4 BP is not restricted to the HEK4 receptor, but that HEK4 BP can also bind to and activate other members of the EPH-like receptor family. As described in the Example:, = HEK4 binding protein has been shown to activate both HEK4 and ECK receptors. The HEK4 binding proteins of the invention are preferably characterized as being a prokaryotic or eukaryotic expression product of an exogenous DNA sequence, ie, the HEK4 binding protein is a recombinant protein. Exogenous DNA is the DNA that encodes the HEK4 binding protein and includes cDNA, genomic DNA and synthetic (manufactured) DNA. The HEK4 binding protein can be expressed in cells of bacteria, yeast, plants, insects or mammals in culture or in transgenic animals using the appropriate DNA expression vectors for the given host cells. Expression of the recombinant HEK4 binding protein in CHO cells is described in Example 3 of the specification. HEK4 BP is also provided in higher order dimeric or oligomeric state wherein the multimeric HEK4 BP is capable of binding and / or activating similar receptors to the EPH. The soluble HEK4 BP multimers are selected from the group consisting of HEK4 BP / immunoglobulin chimeras, HEK4 BP agglutinated by treatment with anti-HEK4 BP antibodies, and HEK4 BP monomers covalently and non-covalently linked. The agglutinated HEK4 BP is described in Example 7B and the HEK4 BP chimeras were constructed using standard recombinant DNA techniques. The HEK4 BP monomers covalently and non-covalently bound were produced using crosslinking reagents and procedure readily available to one skilled in the art. The polypeptides of the present invention include the biologically active fragments and analogs of HEK4 BP. Fragments of HEK4 BP encompass amino acid sequences that have truncations of one or more amino acids of the sequence shown in Figure 3 or SEQ ID NO: 1, where the truncation may originate from the amino terminal, carboxy terminal, or of the interior of the protein. Analogs of the invention involve an insertion or substitution of one or more amino acids within the sequence as shown in Figure 3 of SEQ ID NO: 1. The fragments and analogs will have at least one biological property of the binding protein. of HEK4, typically the ability to bind to at least one receptor similar to the EPH. Also encompassed by the invention are such chimeric polypeptides comprising the amino acid sequence of HEK4 BP fused to heterologous amino acid sequences. Such heterologous sequences encompass those, which when formed in a chimera with HEK4 BP, retain one or more biological or immunological properties of the HEK4 BP. In one embodiment, an HEK4 BP / chimeric immunoglobulin protein is encompassed, wherein the chimeric molecules can be added to multimeric forms of the HEK4 BP for receptor binding and activation. An example is a chimera of the HEK4 BP and the Fc region of the IgG. An isolated nucleic acid encoding the HEK4 binding protein is also provided by the invention. The nucleic acid is selected from the group consisting of: a) the nucleic acid shown in Figure 3 (SEQ ID NO: 1); b) nucleic acids that hybridize under 6XSSC and 65 ° C conditions with the coding regions as shown in Figure 3 (SEQ ID NO: 1); c) the nucleic acids that degenerate to the nucleic acids of (a) and (b). The nucleic acids can be cDNA, genomic DNA or Synthetic DNA (manufactured). It should be understood that the hybridization conditions specified herein allow one skilled in the art to estimate the degree of mismatch between a given nucleic acid and a nucleic acid comprising the coding region as shown in Figure 3 (SEQ ID NO: 1) and that such conditions can be varied by changing the salinity, temperature and / or duration of the incubation or by adding organic solvent in any of the steps of 1-washing or hybridization and still permit obtaining an equivalent level of mismatch during hybridization. Therefore, it was contemplated that the nucleic acids of the invention include those that hybridize to coding regions in Figure 3 under conditions equivalent to those 6XCCS and 65 ° C. The nucleic acid sequences encoding the HEK4 binding protein can have an amino terminal leader sequence and a sequence for annealing to the carboxy terminal membrane or, alternatively, they can have one or both of the removed sequences. The encoded polypeptides should have at least one of the biological properties of HEK4 BP. The nucleic acids of the invention will be operably linked to the nucleic acid sequences to express a HEK4 binding protein. The sequences required for expression are known to those skilled in the art and include promoter and amplifier sequences for the initiation of transcription, transcription termination sites, ribosomal binding sites, and sequences that direct secretion of the polypeptide. A general description of the nucleic acid sequences that serve to direct the expression of exogenous genes is found in Methods in Enzymology v. 185. D. V. Goeddel, ed. Academic Press, Ine, New York (1990). The sequences that direct the expression of the HEK4 binding protein can be homologous or heterologous. A variety of expression vectors can be used to express HEK4 binding protein in prokaryotic or eukaryotic cells in culture. One such vector is the pDSRa described in PCT Application No. WO90 / 14363 which was used to express HEK4 BP in CHO cells (see Example 3). In addition, vectors for tissue-specific expression of HEK4 binding protein in transgenic animals and virus-based gene transfer vectors for the expression of HEK4 binding protein in human cells in vivo are available. r? ^ i.i'j ', - v:? -, read that coding for regions of the HEK4 binding protein can be modified by substitution of the preferred codons for optimal expression in an appropriate host cell using the procedures available for those skilled in the art. Plasmid pDSRa containing the nucleic acid sequence coding for HEK4 BP as shown in Figure 3 has been deposited with the American Type Culture Collection, Rockville, MD, under the Access No.. A host cell transformed or transfected with the nucleic acids encoding the HEK4 binding protein is also encompassed by the invention. Any cell that produces a polypeptide having at least one of the biological properties of HEK4 BP can be used. Specific examples include cells of bacteria, yeast, plants, insects or mammals. In addition, the HEK4 binding protein can be produced in transgenic animals. Transformed or transfected host cells and transgenic animals are obtained using materials and methods that are routinely available to one skilled in the art. The host cells can contain the nucleic acid sequences having the full-length gene for the HEK4 binding protein including a leader sequence and a C-terminal membrane walking sequence (as shown in Figure 3) or, Alternatively, it may contain nucleic acid sequences that lack one or both of the leader sequence and the sequence of C-terminal membrane walking. further, fragments of nucleic acid, variants and analogs that code for a polypeptide capable of binding the HEK4 receptor can also be resident in the host expression systems. The polypeptides of the invention are produced by growing transformed or transfused host cells under conditions with suitable nutrients to express HEK4 BP and isolate the resulting polypeptides. Antibodies that bind specifically to the HEK4 binding proteins of the invention are also encompassed. Antibodies can be produced by immunization with the full length (unprocessed) HEK4 binding protein or its mature forms or a fragment thereof. The antibodies can be polyclonal or monoclonal and can be human or murine derivatives. The antibodies of the invention can also be recombinants, such as the chimeric antibodies having the urine constant regions on the light and heavy chains replaced by the sequence of the human constant region; or antibodies grafted with the region determining complementarity (CDR) wherein only the CDR is of murine origin and the rest of the antibody chain has been replaced by human sequences. The invention also provides a pharmaceutical composition comprising a therapeutically effective amount of the HEK4 binding protein and a pharmaceutically acceptable adjuvant. Examples of pharmaceutically acceptable adjuvants include diluents (Tris, acetate or phosphate buffers), carriers (human serum albumin), solubilizers (Tween, polysorbate), preservatives (thimerosol, benzyl alcohol) and antioxidants (ascorbic acid) . A more extensive study of the components typically found in pharmaceutical compositions appears in Remingto's Pharmaceutical Sciences 18 l of. A. R. Gennaro, ed. Mack, Easton, PA (1990). As used herein, the term "therapeutically effective amount" refers to the amount of HEK4 binding protein that provides a therapeutic effect for a given condition and administration regimen. The therapeutically effective amount may vary from 0.01 μg / kg of body weight to 10 mg / kg of body weight and may be determined by one skilled in the art. The HEK4 binding protein can be administered by injection, either subcutaneously, intravenously or intramuscularly, or by oral or nasal administration. The route of administration to be chosen will depend on several variants, including the nature and severity of the condition being treated and the pharmacokinetic properties of the HEK4 binding protein preparation. The HEK4 binding protein can be formulated to be delivered in a particular form, for example, it can be modified with water-soluble polymers, such as polyethylene glycol to improve the properties for nasal administration to improve the serum half-life after injection; or it can be incorporated into particulate preparations of polymeric compounds (e.g., liposomes) for controlled release over a prolonged period of time. The expression of the HEK4 receptor and the HEK4 BP in various tissues are reported in Examples 6A and 6B, respectively. The mRNA of the HEK4 receptor was the most abundant in the human placenta and was also detected in the tissues of the heart, brain, lung, liver, muscle and kidney. The HEK4 BP mRNA was the most abundant in the adult human brain, kidney and placenta and was detected at low levels in the heart, lung, liver, spleen, prostate, testis, ovary, small intestine, muscle, pancreas and colon. These patterns of expression suggest that activation of the HEK4 receptor by HEK4 BP modulates the growth and / or differentiation of a variety of target cells, particularly those of the brain, heart, lung, liver, muscle and pancreas, wherein the expression of both receptor as well as the ligand was detected. In addition, Wicks et al., Supra has reported that HEK4 receptor mRNA in pre-B and T cell lineages suggesting a role for HEK4 BP in hematopoiesis. As described in Example 7, HEK4 BP also activates the ECK receptor in a cell-cell autophosphorylation assay. The Eck receptor mRNA is the most abundant in the lung, small intestine, kidney, ovary and adult rat skin with lower levels detected in the brain, spleen and submaxillary gland (Linsberg and Hunter, supra). Recently, Eck has been shown to be expressed in the nervous system of the primary mouse embryo (Becker et al., Mech, Dev 47, 3-17 (1994), Ganju et al., Oncogene 9, 1613-1624 (1994). ). These observations suggest that ECK receptor activation of HEK4 BP can modulate the growth and / or differentiation of cells expressing ECK, such as those of the lung, intestine, kidney, skin and nervous system. Therefore, HEK4 BP is useful to modulate (i.e., increase or decrease) the degree of growth / differentiation of the target cells in various tissues. The target cells will have at least one receptor that is activated by the HEK4 BP where the receptor is preferably a member of the subfamily of PTK receptors of the EPH. Potential therapeutic uses for HEK4 BP are described below. One aspect of the invention is the use of HEK4 BP to modulate cell growth and differentiation in the nervous system. HEK4 BP can be used to maintain or restore cellular function in the nervous system of a mammal that has been reduced or eliminated by disease or damage or is at risk of diminishing or being eliminated by disease or damage. Target cells include neurons and equal cells. Conditions that can be treated by HEK4 BP include central nervous system conditions such as Alzheimer's disease, Parkinson's disease, multiple sclerosis, stroke and Huntington's disease and disorders of the peripheral nervous system such as amyotrophic lateral sclerosis (ALS) and peripheral neuropathies. Physical damage to the spinal cord and peripheral neurons can also be treated with HEK4 BP. Another aspect of the invention is the modulation by HEK4 BP of the growth and differentiation of the tissues of the digestive tract (including the large and small intestine), liver, lung, pancreas, muscle and hematopoietic. This activity of HEK4 BP may be particularly useful in the regeneration of tissues in that and other sources that have been damaged or diminished by disease or damage. It has been observed that the subfamily of EPH-like receptors and their corresponding ligands are highly expressed in some lineages of carcinoma cells (see for example, PCT Application No. WO94 / 11020 for the expression of the ECK receptor and the binding protein of ECK in lineages of human carcinoma cells). Thus, another aspect of the invention is the treatment of cancers using HEK4 BP antagonists to block cell proliferation. Such cancers are equally associated with organs that express HEK4 receptors and / or ECK receptors. Antagonists of HEK4 BP can be any compound that blocks the biological activity of HEK4 BP and can include, but is not limited to, the following: antibodies that bind either to HEK4 BP or to a receptor of the EPH subfamily that is activated by the HEK4 BP so that the receptor / ligand interaction is prevented; HEK4 BP that binds but does not activate the receptor similar to EPH; and soluble EPH-like receptors that bind to HEK4 BP. It was contemplated that the small mimetic molecules of the antagonists described above are encompassed by the invention. In addition for in vivo applications, HEK4 BP can also be used ex vivo to amplify cell populations before transplantation. It was contemplated that HEK4 BP can promote growth in cells of the digestive tract, liver, lung, bone marrow, kidney, or neurons (and gual cells) of the central and peripheral nervous systems, so that the amplified population can be introduced again in a patient who needs such therapy. Such so-called "cell therapy" is useful in replenishing cells after damage or decrease and may be appropriate under conditions where systemic administration of HEK4 BP is not preferred. HEK4 BP can be used alone or in combination with other therapeutic agents for the treatment of cancer, neurological disorders, diseases of the digestive tract, liver or lung, and for the ex vivo expansion of cell populations. HEK4 BP can be used in conjunction with other chemotherapeutic drugs or with radiation therapy for the treatment of cancer, or with other neurotrophic factors such as brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), neurotrophin 3 (NT -3), nerve growth factor (NGF), or glial derived neurotrophic factor (GDNF) for neurological disorders; or with tissue growth factors such as platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), epidermal growth factor (EGF), hepatocyte growth factor (HGF) or growth of keratinocytes (KGF) for the restoration of damaged or diminished tissues. The isolated nucleic acids of the present invention are useful reagents for the detection and quantification of DNA and / or RNA encoding HEK4 BP by standard hybridization methods such as those described in Sambrook et al. Molecular cloning. A Laboratory Manual, 2d ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). These reagents allow the determination of the potential of the different cell types to express HEK4 BP and the related polypeptides and are also useful for detecting abnormalities in the genes coding for HEK4 BP or in the sequences that control c-HEK4 BP expression. The nucleic acids of the invention are also useful for controlling the expression levels of HEK4 BP. The so-called "antisense" nucleic acids are hybridized to the strands of DNA and / or RNA encoding the HEK4 BP in such a way that they block the transcription or translation of the nucleic acid sequences of the HEK4 BP. The introduction of antisense nucleic acids of HEK4 BP into cells overexpressing HEK4 BP is appropriate when overexpression leads to undesirable physiological effects, such as excessive cell proliferation. Antibodies that bind specifically to HEK4 BP are useful reagents for the detection and quantification of HEK4 BP in biological samples using immunoassays (Western blots, RIA, ELISA) that are conventional to the art. The presence of HEK4 BP may be indicative of cell proliferation or cell proliferation potential, and high levels may be a signal of abnormal cell growth typically associated with cancer. In addition, the antibodies of the invention can also be useful therapeutic reagents that act as agonists or antagonists of the activity of HEK4 BP. The antibodies can bind to HEK4 BP so that they directly or indirectly block the binding of HEK4 BP to the EPH receptor (either HEK4 or ECK). Alternatively, antibodies can bind to HEK4 BP in a manner that promotes receptor binding and activation, for example by "binding" HEK4 BP in higher dimeric or multimeric forms to allow more efficient binding and activation of the antibody. receiver. The antibodies can be monoclonal, polyclonal or recombinant. The following examples are offered to more fully illustrate the invention, but do not limit the scope thereof.

EXAMPLE 1 Production of the extracellular domain of the HEK4 receptor (HEK4-X) A cDNA clone encoding the HEK4 receptor tyrosine kinase protein was isolated from a human fetal brain cDNA library (Stratagene, La Jolla, CA) as described in co-pending and commonly owned US Patent No. 08 / 229,509. . The sequence of this clone was identical to that of Figure 1 cf of Wicks et al., Supra with the following exceptions. Wicks reported the TTA of the sequence at nucleotides 1618-1620, while the isolated HEK4 receptor clone as described here had the TTC sequence at those positions. However, the sequence of the protein predicted by Wicks et al. Specifies a phenylalanine residue in this position, which is inconsistent with an "A" at nucleotide 1620 (TTA codes for leucine while TTC codes for phenylalanine).

Also, nucleotides 1529 to 1531 of the sequence of Wicks et al. they are absent in the sequence obtained here. This change does not affect the translational reading frame, but eliminates the estimated glutamine residue at position 478 of the Wicks sequence. The effect of these differences on the biological activity of the receptor or the ability to bind to the ligand is unknown. The cDNA clone of the HEK4 receptor was used as a standard in a polymerase chain reaction (PCR) designed to amplify a DNA fragment encoding the ligand binding domain of the HEK4 receptor. The primers used are: 433-26) 5 '• GGATCTAGAGCACCAGCAACATGGATTGT 3 (SEQ ID NO: 3) 409-10) 5 'TCGGTCTAGATCATTATTGGCTACTTTCACCAGAGAT 3' (SEQ ID NO: 4) These primers produce a fragment of 1656 nucleotides in length that codes for a protein of 540 amino acids. The estimated protein consists of the complete extracellular domain of the HEK4 receptor of the terminal amino acid but does not include the transmembrane region. The 1656 nucleotide fragment was digested with restriction endonuclease Xbal and ligated to the pDSRa expression vector which had been digested with the same enzyme. The resulting expression plasmid was introduced into CHO cells by calcium phosphate mediated tranfection (Cellphect, Pharmacia, Piscataway, NJ). The individual colonies were selected based on the expression of the dihydrofolate reductase (DHFR) gene, which resides on the expression plasmid. The expression of the HEK4 gene was verified by hybridization of the RNA in solution (Hunt et al., Hematol, 19, 779-784 (1991)) and / or by Western staining with antibodies directed against amino acids 22-148 of the extracellular domain. of HEK4. The expression of HEK4 was amplified by growing the selected clones in 100 nM methotrexate. One of the pDSRa / HEK4-X clones was chosen for large-scale production. Twenty-four rotating bottles were seeded at a density of approximately 2xl07 cells / bottle in 200 ml of each of Dulbecco's Minimum Essential Media (DMEM) supplemented with non-essential amino acids (IX NEAA, Gibco), 100 nM methotrexate, IX of penicillin / streptomycin. / glutamine (IX PSG, Gibco) and 10% fetal bovine serum. The cells reached confluence at 3-4 days at which time the media was changed to DMEM / NEAA / PSG without serum. The conditioned media of the cells were harvested after seven days, concentrated, and diafiltered against 10 mM Tris-HCl, pH 8.5. The concentrated media was loaded onto a Q-sepharose FF ion exchange column (Pharmacia) and the bound material was eluted with a linear gradient of NaCl from 0 to 0.5 M in 10 mM Tris-HCl, pH 8.5. The fractions were analyzed by SDS-PAGE and Western spotting using a polyclonal rabbit antibody directed against residues 22-148 of the external domain of HEK4. Fractions containing the HEK4-X protein were pooled, concentrated and loaded onto an S-200 column (Sepharoyl S-200, Pharmacia). Fractions from this column were analyzed as previously done and those containing HEK4-X were pooled.

EXAMPLE 2 A. Purification of HEK4-X Binding Activity The use of the BIAcore ™ instrument (Pharmacia Biosensor, Piscataway, NJ) for detecting the immune activity of the receptor in cell-conditioned medium, concentrate (Bartley et al., Supra) was previously described. Here a similar strategy was used to select the binding activity of HEK4 as described below.

The surface of a BIAcore detector microcircuit was activated by injection of 0.2 M l-ethyl-3- (3-dimethylaminopropyl) carbodiimide-HCl and 0.05 M N-hydroxysuccinimide at a flow rate of 5 μl / min. Purified HEK4-X was applied at a concentration of 250 μg / ml to the activated surface in two 50 μl injections at the same flow rate. The unreacted binding sites were blocked by injection of 1M ethanolamine, pH 8.5. The surface was washed overnight in 10 mM HEPES, 150 mM NaCl, 3.4 mM EDTA, 0.005% Tween 20, pH 7.4 until the basal level was stable. Typically, the immobilization resulted in 6000-8000 resonance units (UR) of HEK4-X attached to the detector microcircuit. Samples of conditioned media were collected from 108 cell lineages that grew either without fetal bovine serum (FBS) or in the presence of 0.5% FBS. The conditioned media produced under serum-free conditions was adjusted to 0.5% FBS before further processing. The media was filtered, concentrated 25 times, and stored in aliquots at -80 ° C. The 30 μl samples of each medium were injected onto the surface of the HEK4-X at a flow rate of 5 μl / min and the binding response was measured 20 seconds after the conclusion of each injection. Among the samples, the surface was regenerated with injections of 10-15 μl of 25 mM 3- (cyclohexylamino) -1-propanesulfonic acid, pH 10.4. Samples of concentrated conditioned media that showed junctions with resonance units of 200 or more are listed in Table 1.

Table 1 Cell lineage Description Union (resonance units) HCT-116 human colon carcinoma 911 human M-14 human elanoma 337 LS174T colon adenocarcinoma 316 human A498 kidney carcinoma 274 human A172 human glioblastoma 269 PK (15) 1 porcine kidney 234 JEG-1 human carcinoma 220 Y-79 human retinoblastoma 216 HT 1080 human fibrosarcoma 200 The five conditioned media that presented the greatest union were selected for further investigation. When soluble dextran was added to the samples before injection to reduce non-specific binding, signals from the conditioned media HCT116 and LS174T were greatly reduced. A172 cells proved to grow with difficulty / were unstable for large-scale production of conditioned media. Based on these experiments and the affinity chromatography of the pilot scale receptor, the cell line A498 (ATCC No. HBT 44) was chosen as the best source of conditioned media for the purification of an HEK4 binding protein. A HEK4 receptor affinity column was prepared by immobilizing HEK4-X on Sepharose 4B activated with CNBr (Pharmacia). The purified HEK4-X was dialyzed against 0.1 M NaHCO3, 0.5 M NaCl, pH 8.3 and brought to a final concentration of 2 mg / ml. The immobilization of HEK4-X was carried out at a ligand density of 1 mg / mL according to the method of Kenny et al. (New Protein Techniques, J. M. Walker, ed. The Humana Press, Clifton, NJ 1988). Forty liters of conditioned media of A498 produced in media containing 0.5% serum were concentrated 40 times, diafiltered against PBS and 0.02% NaN 3, and loaded onto the Sepharose column with HEK4-CNBr. The column was washed with PBS and the bound material was eluted with 50 mM sodium acetate, 0.5 M sodium chloride, pH 4.0. The fractions were collected in 1 mM CHAPS and loaded directly onto polyacrylamide gels. Thus, 6 gels were either stained with silver for analysis or stained on PVDF membranes (Problot, Applied Biosystems, Foster City, CA) in preparation for the sequence of the N-terminal amino acids (Fausset & amp;; Lu, 1991). Elution fractions of pH 4.0 from the Sepharose column with HEK4-CNBr had three major protein species with molecular weights of 21, 25 and 27 kD, which were not evident in the loaded or washed fractions. Fractions containing these three proteins were pooled, concentrated in the presence of CHAPS and applied to a Vydac C4 inverted phase CLAP column (4.6 x 150 mm). The column was eluted with a gradient of acetonitrile (26-35%) in 0.1% trifluoroacetic acid. The fractions were collected, the volume was reduced under vacuum, and analyzed for the HEK4 binding protein. The three major peaks detected by absorbance at 214 nm were pooled and analyzed by SDS-PAGE (see Figure 2). Further purification of the three isoforms of the HEK4 BP was obtained by re-applying the proteins to the same C4 column.

B. Sequencing of the peptides A sample of the initial purification of conditioned media from A498 cells was subjected to protein sequencing. The sample was analyzed on SDS-PAGE and stained on a PVDF membrane. The gel band identified as HEK4 binding protein was excised and analyzed for 5 cycles on an Applied Biosystems 477A protein sequencer. This did not produce any sequence indicating that the protein was blocked at the N-terminus. The sample was then treated with cyanogen bromide and applied again to the sequencer. A tentative sequence of the excised sample was obtained assuming that the highest yield in each cycle belongs to the same peptide. With this assumption, the recovery was too small to produce the untrustworthy sequence after 10 cycles. The sequence obtained in this manner is shown as peptide # 1 in Table 2.

Table 2 Peptide No. Amino Acid Sequence Val-Asn-Phe-Asp-Gly-Tyr-Ser-Ala-Arg-Asp (SEQ ID NO: 5) 2 Val-Phe-Asp-Val-Asn-Phe-Lys -Val-Glu-X- Ser-Leu-Glu-Pro-Ala-Asp (SEQ ID NO: 6) 3 Ala-Val-Ala-Asp-Arg-Tyr-Ala-Val-Tyr-Trp-Asn-Ser- Ser-Asn-Pro-Arg-Phe-Gln-Arg-Gly-Asp-Tyr-His-Ile-Ile-Val-X-Ile-Asn-X-Tyr (SEQ ID NO: 7) The subsequent analysis of the samples cleaved with cyanogen bromide, separated then by SDS-PAGE indicated that position 9 of peptide # 1 was a cysteine residue at position 6 of peptide # 2 was aspartic acid. It was subsequently found that position 25 of peptide # 3, by sequencing the DNA, was of aspartic acid. Sequence data shown in peptides # 2 and # 3 in Table 2 were obtained by analysis of tryptic digestion of the protein followed by separation of the resulting peptides on a C4 micropore column. These experiments were performed with larger quantities of starting material and therefore produced a more reliable sequence and allowed 20-30 sequencing cycles to be carried out. The comparison of the peptide sequences in Table 2 with B61 suggests that they present fragments of a related protein. It is therefore concluded that the HEK4 binding protein is another ligand for the subfamily of EPH-like kinases.

EXAMPLE 3 A. Cloning and Sequencing of the cDNA Encoding the HEK4 Binding Protein The amino acid sequences obtained from the peptides of the HEK4 BP as shown in Table 2 were used to design oligonucleotide primers. Primers 702-3 and 633-11 were used in a PCR reaction with A498 cDNA randomly primed as a standard. 702-3) 5? GAYMGNTAYGCNGTNTAYTGG 3 '(SEQ ID NO: 8) 633-11) 5 'RTANCCRTCRAARTTNACCAT 3' (SEQ ID NO: 9) The 175 base pair fragment amplified by those primers was sequenced and found to be closely related to B61. This fragment was then radiolabeled with 32 P by random priming and used as a probe to select a cDNA library for clones containing the full-length HEK4 BP cDNA. A cDNA library of human placenta primed with oligo-dT from Stratagene (La Jolla, CA) was cultured at a density of 30,000 plates / plate of 150 mm. The replicas of the plates arranged on the plates were made on GeneScreen ™ hybridization transfer membranes (New England Nuclear, Boston, MA) according to the manufacturer's instructions. Two replicates of the filters were made for each plate. The filters were prehybridized in 6X SSC, IX Denhardts buffer, 50 μg / ml salmon testis DNA, 1% SDS at 65 ° C for 4 hours followed by hybridization with the 32 P-labeled probe for 12 hours under the same conditions. After hybridization, the filters were washed twice, 1 hour each, in 0.2X SSC, 0.5% SDS at 65 ° C and exposed to a Kodak XAR film overnight with an intensifying screen. The comparison of the two filters made of each plate showed that five plates were positive in both replicas. The phage around each positive plate was removed, resuspended in buffer and cultured again at a low density to produce well-defined plates for secondary selection. Individual plates that were positive after selection (using the same primary selection method) were extracted. The inserts of these phages were transferred to the pBluescript plasmid by in vivo cleavage according to the manufacturer's description (Stratagene). Three of the five inserts were identical and contained the entire coding region of the HEK4 BP while the other two represented overlapping clones. A consensus sequence was assembled using the data from the three inserts that contained the entire coding region and are shown in Figure 3. The cDNA sequence of the HEK4 BP predicts for a protein of between 213 and 228 amino acids, depending on which of the three possible starter codons is used. Based on the rules for translation of vertebrate mRNAs (Kozak Cell 44, 283-292 (1986)), the third ATG, en bloc is an improbable initiator, although the first ATG, which is the one further upstream , it is more likely to be the main start codon. As for B61, HEK4 BP has hydrophobic amino acids on both terminal amino and carboxy termini. These probably function as membrane secretion and anchor signal sequence, respectively. Like B61, HEK4 BP apparently has both soluble and membrane bound forms. Although we were not able to obtain the N-terminal protein sequence data, the breaking of the signal peptide can be predicted to produce a mature protein with a serine at position 1 (Figure 3). Based on the peptide map and mass spectrometric analysis, proline 179 (Figure 3) appears to be the C-terminal amino acid in the main soluble form found in media conditioned by A498 cells. An alternative form with alanine 177 (Figure 3) was also detected at the C-terminus.

B. Expression of the recombinant HEK4 BP The clone of the HEK4 BP cDNA shown in Figure 3 was inserted into the plasmid vector pDSRa for expression in mammalian cells. The recombinant plasmid was transfected into Chinese hamster ovary (CHO) cells by calcium phosphate precipitation and the cells containing the plasmid were selected to be believed in DMEM (high in glucose, GIBCO, Bethesda, MD), IX of penicillin / streptomycin / glutamine (PSG), non-essential amino acid IX (NEAA) with a content of 10% fetal bovine serum (FBS), but lacking HT supplement (HT supplement: 10 mM hypoxanthine sodium, 1.6 mM thymidine). The expression of HEK4 BP in several clones was evaluated by the level of HEK4 receptor binding activity in each conditioned medium with clone cells as determined by BIAcore (Pharmacia Biosensor, Piscataway, NJ). This correlates well with the level of HEK4 BP in the clones as determined by Northern blot hybridization. One CHO / HL6 clone was a significantly better promoter of recombinant HEK4 BP than the others and was chosen for additional work. The expression of HEK4 BP by CHO / HL6 was amplified 2 to 4 times by treatment with increasing amounts of methotrexate up to 100 nM over a period of several weeks. After amplification, the cells expressing HEK4 BP were expended and transferred to rotary bottles for the production of the conditioned media to be used as a source for the purification of the recombinant protein. A total of 100 revolving bottles were plated with CH0 / HL6 cells at 107 cells per bottle. Cells were grown to confluence (approximately 4 days) in DMEM (high in glucose, GIBCO, Bethesda, MD), IX PSG, IX NEAA, and 10% FBS. After the growth phase, the media was removed and replaced with the same media but with 0.5% more than 10% FBS. 3 days later, the media was collected, filtered to remove any cellular debris, and stored frozen at -80 ° C.

EXAMPLE 4 Purification of the recombinant HEK4 BP Approximately 20-25 liters of conditioned medium from the CHO / HL6 cells were thawed at room temperature and filtered. The medium was concentrated and diafiltered against 10 mM Tris-HCl, pH 8.5 (4 ° C) using a membrane with a molecular weight cut-off of 10,000. The diafiltrate was applied to a column of Q-Sepharose, High Performance and subsequently eluted with a linear gradient of NaCl (0-0.3 M) in 10 M Tris-HCl, pH 8.5. The fractions were analyzed for the presence of HEK4 BP by immunostaining using an antibody generated against HEK4 BP without unfolding in E. coli, or by binding to the HEK4 receptor immobilized on a microcircuit of BIAcore dedector. Fractions containing HEK4 BP were pooled, concentrated and pointed to a gel filtration column. (Superdex 75, 5 x 85 cm, PBS, 3 mL / min). The fractions containing HEK4 BP were further purified by CLAP inverted phase C4 (Vydac 214TP 4.6 x 250 mm, 2.9 mL / min using a gradient of acetonitrile (22-44%) in 0.1% t-luoroacetic acid. column and SDS-PAGE analysis of the peak fractions are shown in Figure 4. Fractions were evaporated under vacuum and formulated in 0.25 M Trie-HCl, 2 mM CHAPS, pH 7.5.

EXAMPLE 5 A. Production of Antibodies for the HEK Receptor Antibodies directed against the extracellular domain of HEK4 BP were produced using standard media (Harlow and La, Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988)). The cDNA encoding amino acids 22-148 of the HEK4 receptor was inserted into the pATH vector (Yansura, 1990) in the same translacinal reading frame as the TrpE gene. The resulting plasmid was introduced into the host strain E. coli resulting in the expression protein of the HEK4 / TrpE fusion protein. The bacterial cell lysates were fractionated by preparative SDS-PAGE and the band containing the HEK4 / TrpE fusion was excised. Crushed silica gel was used to immunize rabbits according to standard protocols (Harlow and Lane, supra). The antiserum generated by this method recognized both the HEK4 / TrpE antigen and the recombinant HEK4-X produced in the CHO cells. Antibodies to the 12 C-terminal amino acids of HEK4 (the sequence is cys-leu-glu-thr-gln-ser-lys-asn-gly-pro-val-pro-val) were produced by the same method (Harlow and Lane, supra) using a synthetic peptide chemically linked to keyhole limpet hemocyanin (KLH) as the antigen. The antiserum was purified by passing it over a column after which the peptide antigen had been immobilized using a SulfoLink kit (Pierce, Rockford, IL). These antibodies were able to specifically recognize the HEK4 receptor by Western blotting.

B. Production of Antibodies for HEK4 BP The HEK4 BP cDNA was used as shown in Figure 3 as a standard for PCR with primers 819-31 and 819-28 to produce a polypeptide fragment encoding amino acids 1-179 of HEK4 BP (Figure 3 ). 819-31) 5 'GGAGGACATATGAGCCAGGACCCGGGCTCCAAG 3' (SEQ ID NO: 10) 819-28) 5 'GAAGAAGGATCCCTATGGCTCGGCTGACTCATGTAC 3' (SEQ ID NO: 11) The PCR fragment was cloned into the expression vector pCFM1656 using the Ndel and BamHI sites included in the primers. The resulting recombinant plasmids were transformed into E. coli FM5 (ATCC No. 53911) and the truncated HEK4 BP was expressed as insoluble inclusion bodies. The inclusion bodies were solubilized and the HEK4 fragment purified by polyacrylamide gel electrophoresis with SDS was used as an antigen in rabbits. Antisera were generated and characterized as described (Harlow and La, supra) and recognized HEK4 BP expressed in CHO cells by Western blot analysis.

EXAMPLE 6 A. HEK4 receptor expression pattern the expression of the HEK4 receptor mRNA in rat and human tissues had previously been previously reported in co-pending and commonly owned US Patent Application Serial No. 08 / 229,509, relevant portions of which have already been incorporated herein by reference. The results of these studies are summarized in Table 3.

TABLE 3 Tissue Distribution of HEK4 Receptor Tissue: Human Brain Rat ++ Heart + bd Kidney bd Liver + bd Lung + + Muscle + bd Ovary nt bd Pancreas + nt Placenta +++ nt Stomach nt nd Testis nt Timo nt bd bd = later detection nt = not tested In studies in human tissue, the mRNA of the receptor HEK4 is most abundantly expressed in placenta, with lower levels in heart, brain, lung, and liver.

Previous studies on HEK4 receptor mRNA in cell lineages found expression in a pre-B cell lineage and two T-cell lineages (Wicks et al., 1992).

B. Expression pattern of HEK4 BP The expression of HEK4 BP mRNA in human tissues was examined by Northern blot analysis. A Northern blot containing 2 μg of polyA + was obtained from each of the indicated tissues of Clontech (Palo Alto, CA) and hybridized with a HEP4 probe labeled with 32 P. As shown in Figure 5, the HEK4 BP mRNA was expressed at high levels in adult human tissue, kidney and placenta. Easily detectable levels can also be found in heart, lung, liver, spleen, prostate, testis, ovary, small intestine and colon. The presence in HEK4 BP mRNA in different tissues is consistent with the idea that this factor is important for the differentiation, development, and / or maintenance of a variety of cell types.

EXAMPLE 7 A. Activation of the HEK4 BP of the receptors of the EPH subfamily by cell-cell phosphorylation The main marker of receptor activation for all known receptor tyrosine kinase proteins is autophosphorylation (van der Geer et al., Supra). To determine whether HEK4 BP can activate the HEK4 receptor, a cell-cell autophosphorylation assay was performed. The recipient cells were CHO cells transfected with HEK4 receptor cDNA which had been harvested from the serum by medium incubations with 0.5% serum for 16 hours. The donor cells were CHO cells transfected with HEK4 BP cDNA (see Example 3B) or CHO cells that had been transfected with vector alone. The donor cells were detached from the surface of their growth vessels in phosphate-buffered saline and added to the recipient cells for 30 minutes at 37 ° C. After washing, the recipient cells were used in modified RIPA buffer (10 mM sodium phosphate, pH 7.4, 150 mM sodium chloride, 0.1% sodium dodecyl sulfate, 1% NP-40, 1% deoxycholate, 10 mg / ml aprotein, 5mM EDTA, 200 mM sodium orthovanadate). The receptors were immunoprecipitated from the cell lysate, and were prepared by electrophoresis on polyacrylamide gel with SDS as described previously (Bartley et al., Supra). After electrophoresis and electroplating to membranes, immunoprecipitates were tested with antiphosfortirosin antibodies (4G10, UBI, Lake Placid, NY). Immune complexes were detected by horseradish peroxidase-conjugated secondary reagents using chemiluminescence as described by the manufacturer (ECL, Amersham). As shown in Figure 6, cells expressing HEK4 binding proteins were able to stimulate tyrosine phosphorylation on both HEK and ECK receptors. Control cells do not stimulate the forforylation of any receptor. The results show that HEK4 BP can activate both HEK4 and ECK receptors.

B. Activation of the HEK4 Receiver by HEK4 BP Soluble To determine whether soluble recombinant HEK4 BP could activate the HEK4 receptor, CHO cells transfected with HEK4 receptor cDNA were transfected with conditioned media from CHO cells expressing HEK4 BP (see Example 3B) or with purified recombinant HEK4 BP (see Example 4). The cells were harvested from the serum by incubation in medium with 0.5% serum for 16 hours before the treatments. The treatments were for 30 minutes at 37 ° C, after which the cells were lysed in modified NP40 buffer (50 mM Tris, pH 8.0, 150 mM sodium chloride, 1% NP40, 10 mg / ml aprotinin, 5 mM EDTA, 200 mM sodium orthovanadate), the HEK4 receptor was immunoprecipitated, and prepared for electrophoresis on polyacrylamide gel with SDS as described previously (Bartley et al., supra). After electrophoresis and electrospinning to the membranes, the immunoprecipitates were probed with antiphosphotyrosine antibodies (4G10, UBI, Lake Placid, NY). Immune complexes were detected by secondary reagents conjugated with horseradish peroxidase using chemiluminescence as described by the manufacturer (ECL, Amersham). As shown in Figure 7, the recombinant HEK4 BP was solubilized in conditioned medium and the purified HEK4 receptor was subsequently purified. This activity was amplified by the pretreatment of the conditioned media by purified HEK4 BP with the antibodies in Example 5B which had been affinity purified on a column of HEK4 BP. The antibodies (-50 μg / ml) were incubated by conditioned media or purified HEK4 BP at 4 ° C for 1 hour, before treatment of the CHO cells expressing the HEK4 receptor.

EXAMPLE 8 Affinity of HEK4 BP for Receptors Similar to EPH The competence to measure the differences in the binding of HEK4 BP to different receptors similar to the EPH. The HEK4 BP that was purified was incubated with various concentrations of any of the HEK4, HEK8 or ECK soluble receptors and the binding of the mixture to the HEK4 receptor mobilized by BIAcore was analyzed. The concentration of the soluble receptor that inhibited the binding of 50% HEK4 BP was called IC50. IC50 values allow a comparison of the relative affinity of HEK4 BP for related receptors. The IC50 values were determined as follows. Analysis of the binding of HEK4 BP to the immobilized HEK4 receptor showed a linear response in the range of 60 to 500 ng / ml. Various amounts of purified extracellular domains of HEK4, ECK, or HEK8 were incubated with 0.250 μg / ml of HEK4 BP prepared as described in Example 4 in solutions containing 100 μg / ml BSA, 10 mM HEPES, 0.15 M NaCl. , 3.4 mM EDTA AND 1 mg / ml of soluble dextran, pH 7.4. These solutions were incubated for at least 30 minutes at 3 ° C before injection. The protein concentration of the receptor patterns was confirmed in the BCA protein assay. Duplicates of each sample were tested in parallel with standard curves on two different days. All surfaces were regenerated to within 10 RU of the basal with 25 mM CAPS and 1M NaCl pH 10.4. The average binding response was plotted against the concentration of soluble receptor (Figure 8) providing IC50 values of 0.55 ug / ml for HEK4, 5.0 ug / ml for ECK, and 10.5 ug / ml for HEK8. Thus, HEK4 BP binds preferably to the HEK4 receptor compared to the other two members of the EPH family, ECK and HEK8. The invention that has been described is that which is considered the preferred modernity, this is not limited to the described modalities, but on the contrary, it seeks to cover the different modifications and equivalents included within the spirit and scope of the appended claims, scope of which according to the broadest interpretation to cover all the modifications and equivalents.

SEQUENCE LIST (1. GENERAL INFORMATION: (i) APPLICANT: Amgen Inc. (ii) TITLE OF THE INVENTION: Ligands for recipients similar to the EPH (iii) SEQUENCE NUMBER: 11 (A) ADDRESS: Amgen Inc. (B) STREET: 1840 Dehavilland Drive (C) CITY: Thounsand Drive (D) STATE: California (E) COUNTRY: USA (F) ZIP CODE: 91320-1789 (iv) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIUM: Flexible disk (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAM: Patentln Relay # 1.0, Version # 1.25 (vi) DATA OF THE CURRENT APPLICATION: (A) APPLICATION NUMBER: (B) DATE OF SUBMISSION: (C) CLASSIFICATION: (viii) INFORMATION FROM THE MANDATORY / AGENT (A) NAME: Winter, Robert B. (C) REFERENCE NUMBER / FILE: A-325 NFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1728 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 175..858 (ix) FEATURE: (A) NAME / KEY: mat_peptide (B) LOCATION: 232..858 (ix) FEATURE: (A) NAME / KEY: sigjpeptide (B) LOCATION: 175.231 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: JM..I, »... As» .. (JVJ * < J \ 4 SCJC - »» ... C .. -SSJ ««. «.« ... A. ... A ..TA .TTATATTTAT TTGGCOCCCG CTCTCTCTCT GTCCCTTTGC CTGCCTCCCT CCC7CCGGA CCCCGCTCTC TCCCCGGAGT GGCGCGTCGG GGGCTCC3CC GCTGGCC? GG C3TG ATG -19 TTG CAC GTG GAG ATG TTG ACG CTG GTG TTT CTG GTG CTC TGG ATG TGT 0 Lau His Vai Glu Mac Leu Thr Leu Val Pha L u Val Leu Trp Mac Cys -15 -10 -5 GTG TTC AGC CAG GAC CCG GGC TCC AAG GCC GTC 3CZ GAC CGC TAC 3: Pha Ser Gln Asp Pro Gly Sar Lys Wing Val Wing Asp Arg Tvr Aa 1 5 10 GTC TAC TGG AAC AGC AGC AGC AAC CCC AGA TTC CAG AGG GGT CAT CAT Val Tyr Trp Asn Sar Sar Asn Pro Arg Pha Gln Arg Gly Asp Tyr your 1S 20 23 30 ATT GAT GTC TGT ATC AAT GAC TAC CTO GAT GTT TTC TGC CCT CAC TAT - t lia Asp Val Cys lia Asn Asp Tyr Lau Asp Val Pha Cys Pro His Tyr 35 40 45 GAG GAC TCC GTC CCA GAA GAT AAG ACT GAG CGC TAT GTC CTC TAC ATG Glu Asp Sar Val Pro Glu Asp Lys Thr Glu Arg Tyr Val Lau Tyr Mac 50 55 60 GTG AAC TTT GAT GGC TAC AGT GCC TGC GAC CAC ACT TCC AAA GGG TTC Val As n Phe Asp Gly Tyr Sar Ala Cys Asp HIS Thr Sar Lys Gly Pha «5 70 75 AAG AGA TGG GAA TßT AAC CGG CCT CAC TCT CCA AAT GGA CCG CTG AAG: .3 Lys Arg Trp Glu Cys Asn Arg Pro His Sar Pro Asn Gly Pro Lau Lys ßO 85 90 TTC TCT GAA AAA TTC CAG CTC TTC ACT CCC TTT TCT CTA GGA TTT GAA; ß. Pha Sar Glu Lys Pha Gln Lau Pha Thr Pro Pha Sar Lau Gly Pnß Glu 95 100 105 0 TTC AGG CCA GGC CGA GAA TAT TTC TAC ATC TCC TCT GCA ATC CCA GAT i '. t Pha Arg Pro Gly Arg Glu Tyr Pha Tyr lie Sar Sar Ala lia Pro Asp 115 120 125 AAT GGA AGA AGG TCC TGT CTA AAG CTC AAA GTC TTT GTG AGA CCA ACÁ ÍS " Asn Gly Arg Arg Sar Cys Lau Lys Lau Lys Val Pha Val Arg Pro Thr 130 135 140 AAT AGC TGT ATG AAA ACT ATA GGT GTT CAT GAT CGT GTT TTC GAT GTT *: "Asn Sac Cys Mßt Lys Thr lia Gly Val His Asp Arg Val Pha Asp Val 145 150 155 AAC GAC AAA GTA GAA AAT TCA TGA GAA CCA GCA GAT GAC ACC GTA CAT 75 Asn Asp Lys. Val Glu Asn Sar Lau Glu Pro Wing Asp Asp Thr Val His 160 165 170 GAG TCA GCC GCA CCA TCC CGC GGC GAG AAC GCG GCA CAA ACA CCA AGG 3: Ciu Ser Ala Glu Pro Sar Arg Gly Glu Asn Ala Ala Gin Thr Pro Arg 175 180 185 190 ATA CCC AGC CGC CTT TTG GCA ATC CTA CTG TTC CTC CTG GCG ATG CTT 34J: ie Pro Ser Arg Leu Leu Wing Xla Lau Lau Pha Lau Lau Wing Mac Lau 195 200 205 TTG ACTA TTA TAGCACAGTC TCCTCCCATC ACTTGTCACA GAAAACATCA 3 8 Leu Thr Lau GGGTCTTGGA ACACCAGAGA TCCACCTAAC TGCTCATCCT AAGAAGOGAC TTGTTATTGG 958 GTTTTGGCAG ATGTCAGATT TTTGTTTTCT TTCTTTCAGC CTGAATTCTA AGCAACAACT 1019 TCAGGTTGGG GGCCTAAACT TGTTCCTGCC TCCCTCACCC CACCCCGCCC CACCCCCAGC 1073 CCTGGCCCTT GGCTTCTCTC ACCCCTCCCA AATTAAATGG ACTCCAGATG AAAATGCCAA 138 ATTGTCATAG TGACACCAGT GGTTCGTCAG CTCCTGTGCA TTCTCCTCTA AGAACTCACC 11 8 TCCGTTAGCG CACTGTGTCA GCGGGCTATG GACAAGGAAG AATAGTGGCA GATGCAGCCA 1253 GCGCTGGCTA GGGCTGGGAG GGTTTTGCTC TCCTATGCAA TATTTATGCC TTCTCATTCA 1313 GAACTGTAAG ATGATCGCGC AGGGCATCAT GTCACCATGT CAGGTCCGGA GGGGAGGGCC 13": TATCCCCCTA TCCCAGGCAT CCCAGACGAG GACTGGCTGA GGCTAGGCGC TCTCATGATC 1433 CACCTGCCCC GGGAGGGCAG CGGGGAAGAC AGAGAAAAGC AAAACGCATT CCTCCTCAGC 1498 TCCACCCACC TGGAGACGAA TGTAGCCAGA GAGGAGGAAG GAGGGAAACT GAAGACACCG 1SS3 TGGCCCCTCß GCCTTCTCTC TGCTAGAGTT GCCGCTCAGA GGCTTCAGCC TGACTTCCAG 16 3 CGGTCCCAAC AACACCTACT AATTCTTCTC CACTCCTTCA TOOCTGGGAC AGTTACTGGT 1673 TCATATGCAA GT ?? AGATGA CAATTTACTC AACAAAAAAA AAAGGAATTC 1728 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 228 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 Mee Lau His Val Glu Mat L «u Thr Lau to Pha Lau Val Lau Trp Mac -19 '. -15 -10 -5 : «/ S val Phe Sar Gln Asp Pro Gly Ser Lys Wing Val Wing Asp Arg Tyr i 5 10 Wing Val Tyr Trp Asn Sar Ser Asn Pro Arg Phe G n Arg Gly Asp Tyr 15 20 25 s: le Asp Val Cys: Asn Asp Tyr Lau Asp Val Pha Cys Pro His 30 35 40 45 Tyr Glu? Sp Sar Val Pro Glu Asp Lys Thr Glu Arg Tyr Val Lau Tyr 50 55 60 Mac Val Asn Phe Asp Gly Tyr Be Ala Cys Asp His Thr Ser Lys Gly 65 70 75 Phe Lys Arg Trp Glu Cys Asn Arg Pro His Sar Pro Asn Gly Pro Leu 80 85 90 Lys Phe Ser Glu Lys Phe Gln Leu Phe Thr Pro Pha Sar Lau Gly Phe 95 100 105 Glu Pha Arg Pro Gly Arg Glu Tyr Phß Tyr Ha Sar Sar Ala Ha Pro 110 115 120 125 Asp Asn Gly Arg Arg Sar Cys Lau Lys Lau Lys val Pha Val Arg Pro 130 135 140 Thr Asn Sar Cys Mac Lys Thr Ha Gly Val His Asp Arg Val Pha Asp 145 150 155 Val Asn Asp Lys Val Glu Asn Ser Lau Glu Pro Ala? Sp Asp Thr Val 160 165 170 His Glu Sar Ala Glu Pro Sar Arg Gly Glu Asn Ala Ala Gln Thr Pro 175 180 165 Arg Ha Pro Sar Ar? Lau Lau Ala Ha Lau Lau Pha Lau Lau Wing Mac 190 193 200 205 Lau Lau Thr Lau | 2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: GCATCTAGAG CACCAGCAAC ATGGATTGT 29 (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4 TCGGTCTAGA TCATTATTGG CTACTTTCACCAGAGAT "37 ! 2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: Val Asn Phe Asp Gly Tyr Ser Ala Arg Asp 1 5 10 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 16 amino acids (B) TYPE: amino acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: Val Phe Asp Val Asn Phe Lys Val Glu Xaa Ser Leu Glu Pro Wing Asp 1 5 10 15 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 31 amino acids (B) TYPE: amino acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: Wing Val Wing Asp Arg Tyr Wing Val Tyr Trp Asn Ser Ser Asn Pro Arg 1 5 10 15 Phe Gln Arg Gly Asp Tyr His He He Val Xaa He Asn Xaa Tyr 20 25 30 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8: GAYMGNTAYG CNGTNTAYTG G 21 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: RTANCCRTCR AARTTNACCAT 21 (2) INFORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10: GGAGGACATA TGAGCCAGCA CCCGGGCTCC AAG 33 (2) INFORMATION FOR SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11: GAAGAAGGAT CCCTATGGCT CGGCTGACTC ATGTAC 36 It is noted that in relation to this date, the best known by the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. Having described the invention as above, property is claimed as contained in the following:

Claims (36)

1. CLAIMS 1. A purified and isolated polypeptide capable of binding to at least one EPH-like receptor, characterized in that the receptor is a HEK4 receptor.
2. 2. The polypeptide according to claim 1, characterized in that the binding results in the activation of the similar EPH receptor.
3. 3. The polypeptide according to claim 1, characterized in that it is human.
4. 4. The polypeptide according to claim 1, characterized in that it is substantially free of other human proteins.
5. 5. The polypeptide according to claim 1, characterized in that it has in glycosylated form an apparent molecular weight of approximately 21-27 kD in non-reducing SDS-PAGE.
6. 6. The polypeptide according to claim 1, characterized in that it is a product of the prokaryotic or eukaryotic expression of an exogenous DNA sequence.
7. 7. The polypeptide according to claim 6, characterized in that the exogenous DNA is cDNA, genomic DNA or synthetic DNA.
8. 8. The polypeptide according to claim 1, characterized in that it has at least about 70% homology with the amino acid sequence as shown in Figure 3 (SEQ ID NO: 1).
9. 9. The polypeptide according to claim 1, characterized in that it has an amino acid sequence of Figure 3 (SEQ ID NO: 1).
10. 10. The polypeptide according to claim 9, characterized in that it also comprises methionine residue in the -1 position.
11. 11. The polypeptide according to claim 1, characterized in that it is soluble or is bound to a cell surface.
12. 12. The polypeptide according to claim 1, further characterized in that it is capable of binding to the ECK receptor.
13. 13. The polypeptide according to claim 1, characterized in that it is multimeric.
14. 14. The polypeptide according to claim 13, characterized in that it is selected from the group consisting of: an immunoglobulin chimera, an antibody agglutinated protein, and protein monomers covalently and non-covalently linked. ID. An isolated nucleic acid encoding a polypeptide capable of binding to at least one receptor similar to EPH, characterized in that the nucleic acid is selected from the group consisting of: a) the nucleic acid shown in Figure 3 (SEQ. ID NO: 1). b) nucleic acids that bind to 6XSSC and 65 ° C conditions with the coding region of Figure 3 (SEQ ID NO: 1); and c) the nucleic acids that are regenerated from the nucleic acids of (a) and (b). 16. The nucleic acid according to claim 15, characterized in that it is cDNA, genomic DNA or synthetic DNA. 17. A polypeptide, characterized in that it is encoded with the nucleic acids according to claim 15. 18. The nucleic acids according to claim 15, characterized in that they include one or more preferred codons for the expression Escherichia coli. 19. A biologically functional plasmid or viral vector, characterized in that it includes the nucleic acid according to claim 15. 20. A prokaryotic or eukaryotic host cell, characterized in that it is transformed or stably transfected with a DNA vector according to claim 19. 21. The host cell according to claim 20, characterized in that it is a CHO cell. 22. The host cell according to claim 20, characterized in that it is Escherichia coli. 23. A process for the production of a polypeptide capable of binding to at least one EPH-like receptor, characterized in that it comprises growing under suitable nutrient conditions prokaryotic or eukaryotic host cells transformed or transfected with the nucleic acid according to claim 15 and isolating the polypeptide products of the expression of nucleic acids in the vector. 24. A pharmaceutical composition, characterized in that it comprises a therapeutically effective amount of the polypeptide according to claim 1, and a pharmaceutically acceptable adjuvant. 25. The composition according to claim 24, characterized in that the polypeptide is of human origin. 26. An antibody or fragment thereof, characterized in that it binds specifically to the polypeptide according to claim 1. 27. The antibody according to claim 26, characterized in that it is a monoclonal antibody. 28. A method for activating at least one receptor similar to EPH, characterized in that it comprises contacting the receptor with the polypeptide according to claim 1. 29. A method for modulating the growth or differentiation of cells, characterized in that it comprises contacting the cells with the polypeptide according to claim 1. 30. The method according to claim 29, characterized in that the cells are kidney, lung, liver, skin, digestive tract, gual, nervous, or hematopoietic cells. 31. A method for maintaining or restoring cellular function in the nervous system of a mammal, characterized in that it comprises administering a therapeutically effective amount of the polypeptide according to claim 1. 32. A method for regenerating damaged or diminished tissue in a mammal, characterized in that it comprises administering a therapeutically effective amount of the polypeptide according to claim 1. 33. The method according to claim 32, characterized in that the tissue is liver, lung, digestive tract or nervous system. 34. A method for detecting the presence of a polypeptide capable of binding to at least one EPH-like receptor in a biological mixture, characterized in that it comprises: contacting the same with the antibody according to Claim 26 under the conditions that allow the antibody join the polypeptide; and detecting the binding of the polypeptide to the antibody. 35. a method for detecting the presence of a polypeptide capable of binding to at least one EPH-like receptor, characterized in that it comprises: contacting the sample with the nucleic acid in accordance with Claim 15, under conditions that allow hybridization; and detection of nucleic acid hybridization. 36. An anti-sense nucleotide sequence, characterized in that it hybridizes to the nucleic acid, according to Claim 15, in such a way that it stops the transcription or translation of the nucleic acid.