AU7672394A - Human chemokine polypeptides - Google Patents

Abstract

Human chemokine polypeptides and DNA (RNA) encoding such chemokine polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such chemokine polypeptides for the treatment of leukemia, tumors, chronic infections, autoimmune disease, fibrotic disorders, wound healing and psoriasis. Antagonists against such chemokine polypeptides and their use as a therapeutic to treat rheumatoid arthritis, autoimmune and chronic inflammatory and infective diseases, allergic reactions, prostaglandin-independent fever and bone marrow failure are also disclosed.

Description

Human Chemokine Polypeptides

This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are human chemokine beta-4 and human chemokine beta-10, sometimes hereinafter referred to as "Ck/3-4" and "Ck0-10", collectively referred to as "the chemokine polypeptides". The invention also relates to inhibiting the action of such polypeptides.

Che okineε are an emerging super-family of small secreted cytokineε that are structurally and functionally related. All chemokines exhibit 25 to 75% homology at the amino acid level and contain spatially conserved cysteine residues as do the polypeptides of the present invention. Members of the "C-X-C branch" (according to the position of the first two cysteines in the conserved motif), also known as neutrophil-activating peptide (NAP)/lL-8 family, exert pro-inflammatory activity mainly through their action on neutrophils (e.g., IL-8 and NAP-2) , whereas members of the " C-C branch" family appear to attract certain mononuclear cells. Members of the "C-C branch" include PF4, MIPs, MCPε, and the chemokine polypeptides of the present invention. Numerous biological activities have been assigned to this chemokine family. The macrophage inflaπimatory protein la and Iβ are chemotactic for distinct lymphocyte populations and monocytes (Schall, T.J., Cytokine, 3:165 (1991)), while MCP-1 has been described as a specific monocyte chemo- attractant (Matsuεhima, K., et al., J. Exp. Med., 169:1485 (1989)). The common function of thiε chemokine family iε their ability to stimulate chemotactic migration of diεtinct sets of cells, for example, iirimune cells (leukocytes) and fibroblasts. These chemokines are also able to activate certain cells in this family.

The immune cells which are reεponsive to the chemokines have a vast number of in vivo functions and therefore their regulation by such chemokines is an important area in the treatment of diseaεe.

For example, eosinophils destroy parasites to lessen parasitic infection. Eosinophils are also responsible for chronic inflammation in the airways of the respiratory system. Macrophages are responsible for suppressing tumor formation in vertebrates. Further, basophils release histamine which may play an important role in allergic inflammation. Accordingly, promoting and inhibiting such cells, has wide therapeutic application.

In accordance with one aεpect of the present invention, there are provided novel polypeptides which are Ck/3-4, and Ck3-10, as well as fragments, analogs and derivatives thereof. The polypeptides of the present invention are of human origin.

In accordance with another aspect of the present invention, there are provided polynucleotides (DNA or RNA) which encode such polypeptides.

In' accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant technigues. In accordance with yet a further aspect of the present invention, there iε provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes, for example, to treat solid tumors, chronic infections, auto-immune diseases, psoriasis, asthma, allergy, to regulate hematopoiesis, and to promote wound healing.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.

In accordance with yet another aspect of the present invention, there are provided antagoniεt/inhibitorε to such polypeptideε, which may be used to inhibit the action of such polypeptides, for example, in the treatment of auto-immune diseases, chronic inflammatory and infective diseases, histamine-mediated allergic reactions, prostaglandin- independent fever, bone marrow failure, silicosiε, sarcoidoεiε, hyper-eoεinophilic syndrome and lung inflammation.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 displays the cDNA sequence and corresponding deduced amino acid sequence of Ckj8-4. The initial 24 amino acids represent the deduced leader sequence of Ck3-4 such that the putative mature polypeptide compriseε 72 amino acids. The standard one-letter abbreviation for amino acids iε used.

Figure 2 displays the cDNA sequence and corresponding deduced amino acid sequence of Ck/3-10. The initial 23 amino acids represent the putative leader sequence of Ck/3-10 such that the putative mature polypeptide compriseε 75 amino

-3-

SUBSTITUTE SHEET (RULE 26> acids. The standard one-letter abbreviation for amino acids is used.

Figure 3 displays the amino acid sequence homology between Ck3-4 and the mature peptide of eotaxin (bottom) .

Figure 4 displays the amino acid sequence homology between Ck/3-10 (top) and human MCP-3 (bottom).

In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides) which encode for the mature Ck3-4 polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75848 on July 29, 1994 and for the mature Ck3-10 polypeptide having the deduced amino acid sequence of Figure 2 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75849 on July 29, 1994.

The polynucleotide encoding Ck3-4 was discovered in a cDNA library derived from a human gall bladder. CkjS-4 iε εtructurally related to the chemokine family. It contains an open reading frame encoding a protein of 116 amino acid residues of which approximately the first 24 amino acids residues are the putative leader sequence such that the mature protein comprises 92 amino acids. The protein exhibits the highest degree of homology to eotaxin with 20% identity and 37% similarity over the entire coding sequence. It is also important that the four spatially conserved cysteine residues in chemokines are found in the polypeptides of the present invention.

The polynucleotide encoding Ck/3-10 was discovered in a cDNA library derived from nine week early human tiεεue. Ck_/3- 10 is εtructurally related to the chemokine family. It contains an open reading frame encoding a protein of 98 amino acid residues of which approximately the first 23 amino acids residues are the putative leader sequence εuch that the mature protein compriseε 75 amino acidε. The protein exhibits the highest degree of homology to MCP-3 with 65% identity and 77% similarity over the entire coding sequence.

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- εtranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptideε may be identical to the coding sequence shown in Figures 1 and 2 or that of the deposited clones or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptides as the DNA of Figures 1 and 2 or the depoεited cDNAs.

The polynucleotides which encodeε for the mature polypeptideε of Figures 1 and 2 or for the mature polypeptides encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding εequence εuch aε a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as intronε or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptideε.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding εequence.

The preεent invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figures 1 and 2 or the polypeptide encoded by the cDNA of the deposited clones. The variant of the polynucleotides may be a naturally occurring allelic variant of the polynucleotides or a non-naturally occurring variant of the polynucleotides.

Thus, the present invention includes polynucleotides encoding the same mature polypeptides as shown in Figures 1 and 2 or the same mature polypeptides encoded by the cDNA of the deposited clones as well as variants of εuch polynucleotideε which variantε encode for a fragment, derivative or analog of the polypeptideε of Figureε 1 and 2 or the polypeptides encoded by the cDNA of the depoεited clones. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants .

As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figures 1 and 2 or of the coding sequence of the deposited clones. As known in the art, an allelic variant iε an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not subεtantially alter the function of the encoded polypeptide.

The preεent invention also includes polynucleotides, wherein the coding sequence for the mature polypeptides may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions aε a εecretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotideε may alεo encode for a psoprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.

Thus, for example, the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).

The polynucleotideε of the preεent invention may alεo have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention. The marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptides fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the εequenceε. The preεent invention particularly relateε to polynucleotideε which hybridize under εtringent conditions to the hereinabove-described polynucleotides . As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotideε which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain εubεtantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figures 1 and 2 or the deposited cDNA.

The depoεit(ε) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organiεmε for purpoεeε of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admisεion that a depoεit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of εequenceε herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to chemokine polypeptides which have the deduced amino acid sequences of Figures 1 and 2 or which has the amino acid sequence encoded by the depoεited cDNA, as well as fragments, analogs and derivatives of such polypeptides.

The terms "fragment," "derivative" and "analog" when referring to the polypeptides of Figures 1 and 2 or that encoded by the depoεited cDNA, meanε polypeptideε which retain essentially the same biological function or activity aε εuch polypeptides. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The chemokine polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or a synthetic polypeptideε, preferably recombinant polypeptideε.

The fragment, derivative or analog of the polypeptides of Figures 1 and 2 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residueε are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid reεidue) and εuch εubεtituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such aε a compound to increaεe the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such aε a leader or εecretory εequence or a εequence which iε employed for purification of the mature polypeptide or a proprotein εequence. Such fragmentε, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it iε naturally occurring) . For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexiεting materialε in the natural εyεtem, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and εtill be isolated in that such vector or composition is not part of its natural environment.

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the Ck/3-4 and Ck3-10 genes. The culture conditions, εuch aε temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expresεing a polypeptide. Such vectors include chromosomal, nonchromosomal and εynthetic DNA εequences, e.g., derivatives of SV40; bacterial plasmidε; phage DNA; baculoviruε; yeaεt plaεmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used aε long aε it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA εynthesis. As representative examples of εuch promoterε, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P_L promoter and other promoterε known to control expreεεion of geneε in prokaryotic or eukaryotic cellε or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate εequenceε for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to expresε the protein.

Aε representative examples of appropriate hosts, there may be mentioned: bacterial cells, εuch aε E. coli, Streptomyceε, Salmonella typhimurium; fungal cellε, εuch aε yeaεt; inεect cells such as Drosophila and Sf9; animal cells such as CHO, COS or Bowes melanoma; plant cells, etc. The selection of an appropriate host is deemed to be within the εcope of thoεe εkilled in the art from the teachingε herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructε comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequenceε, including, for example, a promoter, operably linked to the εequence. Large numberε of suitable vectors and promoterε are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNHlδa, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used- aε long aε they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P_R, P_L and trp. Eukaryotic promoters include CMV immediate early, HSV thy idine kinase, early and late SV40, LTRs from retroviruε, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the preεent invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated tranεfection, or electroporation. (Daviε, L. , Dibner, M. , Battey, I., Baεic Methods in Molecular Biology, (1986)).

The constructs in host cells can be uεed in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide εyntheεizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoterε. Cell-free tranεlation εyεtemε can alεo be employed to produce εuch proteinε uεing RNAε derived from the DNA constructs of the present invention. Appropriate cloning and expreεsion vectors for use with prokaryotic and eukaryotic hoεtε are deεcribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the diεclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elementε of DNA, uεually about from 10 to 300 bp that act on a promoter to increaεe its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Generally, recombinant expresεion vectorε will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoterε can be derived from operonε encoding glycolytic enzymeε εuch as 3-phosphoglycerate kinaεe (PGK), σ-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination εequenceε, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic εpace or extracellular medium. Optionally, the heterologouε εequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expresεed recombinant product.

Uεeful expreεεion vectorε for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination εignals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hostε for tranεformation include E. coli, Bacilluε εubtiliε. Salmonella typhimurium and various εpecies within the genera Pseudomonas, Strepto yces, and Staphylococcus, although others may also be employed aε a matter of choice.

As a representative but nonlimiting example, useful expreεεion vectors for bacterial use can compriεe a εelectable marker and bacterial origin of replication derived from commercially available plaεmidε compriεing genetic elementε of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEMl (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sectionε are combined with an appropriate promoter and the εtructural εequence to be expressed.

Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical diεruption, or uεe of cell lyεing agentε, εuch methodε are well know to those skilled in the art.

Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expreεεion εyεtems include the COS-7 lines of monkey kidney fibroblastε, deεcribed by Gluz an, Cell, 23:175 (1981), and other cell lineε capable of expreεεing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites. polyadenylation site, εplice donor and acceptor εiteε, tranεcriptional termination sequences, and 5' flanking nontranscribed εequences. DNA sequenceε derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

The chemokine polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocelluloεe chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding εteps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The chemokine polypeptides of the preεent invention may be a naturally purified product, or a product of chemical εynthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycoεylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

The chemokine polypeptides may be uεed to inhibit bone marrow εtem cell colony formation as adjunct protective treatment during cancer chemotherapy and for leukemia.

The chemokine polypeptides may also be used to inhibit epidermal keratinocyte proliferation for treatment of psoriasis, which is characterized by keratinocyte hyper- proliferation.

The chemokine polypeptides may also be used to treat solid tumors by εtimulating the invaεion and activation of host defense cells, e.g., cytotoxic T cells and acrophages . They may also be used to enhance host defenses against resistant chronic infections, for example, mycobacterial infections via the attraction and activation of microbicidal leukocytes.

The chemokine polypeptides may alεo be uεed to treat auto-immune diεeaεe and ly phocytic leukemiaε by inhibiting T cell proliferation by the inhibition of IL2 bioεynthesis.

Ck/3-4 and Ck_/3-10 may alεo be uεed in wound healing, both via the recruitment of debriε clearing and connective tiεsue promoting inflammatory cells and also via its control of excessive TGF/3-mediated fibrosis. In this same manner, Ck/3-4 and Ck/3-10 may also be used to treat other fibrotic disorders, including liver cirrhosis, osteoarthritis and pulmonary fibrosis. The chemokine polypeptideε also increase the presence of eosinophils which have the diεtinctive function of killing the larvae of parasites that invade tisεueε, aε in εchiεtoεomiasis, trichinosis and ascariasis. They may also be used to regulate hematopoiesis, by regulating the activation and differentiation of various hematopoietic progenitor cells .

Chemokines may also be employed aε inhibitors of angiogenesis, therefore, they have anti-tumor effectε.

The chemokine polypeptides of the present invention are also useful for identifying other molecules which have similar biological activity. An example of a screen for this is isolating the coding region of the genes by using the known DNA sequence to synthesize oligonucleotide probes. Labeled oligonucleotides having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The present invention also relates to a diagnostic assays for detecting altered levels of the polypeptideε or the mRNA which provides the message for such polypeptides, both quantitatively and qualitatively. Such assays are well- known in the art and include an ELISA assay, the radioimmunoassay and RT-PCR. The levels of the polypeptides, or their mRNAs, which are detected in the assays may be employed for the elucidation of the significance of the polypeptideε in various diseases and for the diagnosis of diseases in which altered levels of the polypeptideε may be εignificant.

This invention provides a method for identification of the receptors for the polypeptides. The gene encoding the receptors can be identified by expression cloning. Polyadenylated RNA iε prepared from a cell responsive to the polypeptideε, and a cDNA library created from thiε RNA iε divided into poolε and used to transfect COS cells or other cells that are not responsive to the polypeptides. Transfected cells which are grown on glass slides are exposed to the labeled polypeptides . The polypeptideε can be labeled by a variety of means including iodidation or inclusion of a recognition site for a εite-εpecific protein kinaεe. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive poolε are identified and sub-pools are prepared and retransfected using an iterative sub-pooling and reεcreening process, eventually yielding a single clones that encodes the putative receptor. As an alternative approach for receptor identification, the labeled polypeptideε can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to x-ray film. The labeled complex containing the receptors of the polypeptides can be excised, reεolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of generate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.

-17- This invention provides a method of screening drugs to identify those which enhance (agoniεtε) or block (antagonists) interaction of the polypeptides to their identified receptors. An agonist is a compound which increases the natural biological functions of the polypeptides, while antagonistε eliminate εuch functionε. As an example, a mammalian cell or membrane preparation expressing the receptors of the polypeptides would be incubated with a labeled chemokine polypeptide, eg. radioactivity, in the presence of the drug. The ability of the drug to enhance or block this interaction could then be measured.

Potential antagoniεtε include antibodieε, or in some cases, oligonucleotides, which bind to the polypeptides. Another example of a potential antagonist is a negative dominant mutant of the polypeptides. Negative dominant mutants are polypeptideε which bind to the receptor of the wild-type polypeptide, but fail to retain biological activity.

An aεεay to detect negative dominant mutantε of the polypeptides include an in vitro chemotaxis assay wherein a multiwell chemotaxis chamber equipped with polyvinylpyrrolidone-free polycarbonate membranes is used to measure the chemoattractant ability of the polypeptides for leukocytes in the presence and absence of potential antagonist/inhibitor or agonist molecules.

Antisenεe constructs prepared using antisense technology are also potential antagonists. Antiεenεe technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example", the 5' coding portion of the polynucleotide εequence, which encodeε for the mature polypeptideε of the preεent invention, iε uεed to design an antisenεe RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple- helix, see Lee et al., Nucl. Acids Reε., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al.. Science, 251: 1360 (1991)), thereby preventing tranεcription and the production of the polypeptides. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the polypeptides (antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotideε aε Antiεenεe Inhibitors of Gene Expreεεion, CRC Preεε, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the polypeptides.

Another potential antagonist is a peptide derivative of the polypeptideε which are naturally or εynthetically modified analogε of the polypeptideε that have loεt biological function yet εtill recognize and bind to the receptors of the polypeptides to thereby effectively block the receptors. Examples of peptide derivatives include, but are not limited to, small peptides or peptide-like molecules.

The antagonists may be employed to inhibit the chemotaxis and activation of macrophages and their precursors, and of neutrophils, basophilε, B lymphocyteε and some T cell subsets, e.g., activated and CD8 cytotoxic T cells and natural killer cells, in auto-immune and chronic inflammatory and infective diseaεeε. Examples of auto-immune diseases include rheumatoid arthritis, multiple εcleroεis, and insulin-dependent diabetes. Some infectious diseases include silicoεis, εarcoidoεiε, idiopathic pulmonary fibrosis by preventing the recruitment and activation of mononuclear phagocytes, idiopathic hyper-eoεinophilic syndrome by preventing eosinophil production and migration, endotoxic shock by preventing the migration of macrophages and their production of the chemokine polypeptides of the present invention. The antagonists may also be used for treating atherosclerosis, by preventing onocyte infiltration in the artery wall.

The antagonists may also be used to treat histamine- mediated allergic reactionε by inhibiting chemokine-induced mast cell and basophil degranulation and release of hiεtamine.

The antagonists may also be uεed to treat inflammation by preventing the attraction of monocyteε to a wound area. They may also be used to regulate normal pulmonary macrophage populations, since acute and chronic inflammatory pulmonary diseases are associated with sequestration of mononuclear phagocytes in the lung.

Antagonists may also be used to treat rheumatoid arthritis by preventing the attraction of monocyteε into synovial fluid in the joints of patientε. Monocyte influx and activation plays a significant role in the pathogeneεiε of both degenerative and inflammatory arthropathies.

The antagonists— ay be used to interfere with the deleterious caεcadeε attributed primarily to IL-1 and TNF, which preventε the bioεyntheεis of other inflammatory cytokines. In this way, the antagonists may be uεed to prevent inflammation. The antagoniεts may alεo be used to inhibit proεtaglandin-independent fever induced by chemokines.

The antagonists may alεo be uεed to treat cases of bone marrow failure, for example, aplaεtic anemia and myelodyεplaεtic εyndrome.

The antagoniεts may alεo be uεed to treat aεthma and allergy by preventing eoεinophil accumulation in the lung. The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.

The chemokine polypeptides and agonists or antagonistε of the preεent invention may be employed in combination with

-20- a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of adminiεtration.

The invention alεo provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticalε or biological productε, which notice reflects approval by the agency of manufacture, use or sale for human adminiεtration. In addition, the polypeptideε of the preεent invention may be employed in conjunction with other therapeutic compounds.

The pharmaceutical compoεitionε may be adminiεtered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, intratumor, subcutaneous, intranasal or intradermal routeε. The polypeptideε are administered in an amount which is effective for treating and/or prophylaxis of the εpecific indication. In general, the polypeptideε will be adminiεtered in an amount of at leaεt about 10 μg/kg body weight and in most cases they will be adminiεtered in an amount not in exceεε of about 8 mg/Kg body weight per day. In moεt cases, the dosage iε from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routeε of adminiεtration, symptoms, etc.

The chemokine polypeptideε and agoniεts or antagonistε may be employed in accordance with the present invention by expresεion of εuch polypeptides in vivo , which is often referred to as "gene therapy."

Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo , with the engineered cells then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo . These and other methods for administering a polypeptide of the preεent invention by εuch method εhould be apparent to thoεe skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.

The sequenceε of the preεent invention are alεo valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomeε according to the present invention is an important firεt εtep in correlating those sequenceε with genes associated with diseaεe.

Briefly, εequenceε can be mapped to chromoεomeε by preparing PCR primerε foreferably 15-25 bp) from the cDNA. Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomeε. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the preεent invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-εorted chromosomeε and preselection by hybridization to construct chromosome εpecific-cDNA librarieε.

Fluorescence in situ hybridization (FISH) of a cDNA clones to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. Thiε technique can be uεed with cDNA aε εhort as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with εufficient signal intenεity for εimple detection. FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 iε better, and more than 4,000 is probably not necesεary to get good reεultε a reasonable percentage of the time. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library) . The relationship between genes and diseases that have been mapped to the same

-23- chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).

Next, it is necesεary to determine the differenceε in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative geneε. (This assumes 1 egabase mapping resolution and one gene per 20 kb) .

The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, aε well aε Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be uεed to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodieε (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liεε, Inc., pp. 77-96).

Techniqueε described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of thiε invention.

The preεent invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The εtarting plasmids herein are either commercially available, publicly available on an unrestricted basiε, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmidε to thoεe deεcribed are known in the art and will be apparent to the ordinarily skilled artisan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposeε, typically 1 μg of plaεmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and subεtrate amountε for particular reεtriction enzymeε are εpecified by the manufacturer. Incubation times of about 1 hour at 37 °C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments iε performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide εtrandε which may be chemically εyntheεized. Such εynthetic oligonucleotideε have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the process of forming phosphodieεter bondε between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligaεe ("ligase") per 0.5 μg of approximately equimolar amountε of the DNA fragmentε to be ligated.

Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

Example 1 Bacterial Expression and Purification of Ckfl-4 The DNA sequence encoding for Ck_/3-4, ATCC # 75848, is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the procesεed Ck3-4 protein (minuε the putative signal peptide εequence). Additional nucleotides corresponding to Ck/3-4 were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' CCCGCATGCAAGCAGCAAGCAACTTT 3' contains a SphI restriction enzyme site (bold) followed by 17 nucleotides of Ck_/3-4 coding εequence (underlined) starting from the second nucleotide of the sequenceε coding for the mature protein. The ATG codon iε included in the SphI site. In the next codon following the ATG, the first base is from the SphI site and the remaining two bases correspond to the second and third base of the first codon of the putative mature protein. As a consequence, the first base in this codon is changed from G to C compared with the original sequenceε, resulting in an E to Q substitution in the recombinant protein. The 3' sequence, 5' AAAGGATCCCATGTTCTTGACTTTTTTACT 3' contains complementary sequenceε to a BamHl site (bold) and is followed by 21 nucleotides of gene specific sequences preceding the termination codon. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-70 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE-70 encodes antibiotic resistance (Amp^r), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a riboεome binding εite (RBS), a 6- Hiε tag and restriction enzyme siteε. pQE-70 was then digested with SphI and BamHl. The amplified sequences were ligated into pQE-70 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. Figure 8 showε^' a εchematic repreεentation of this arrangement. The ligation mixture was then used to transform the E. coli strain available from Qiagen under the trademark M15/rep 4 by the procedure described in Sambrook, J. et al.. Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresεeε the lad repreεεor and also confers kanamycin resiεtance (Kan^r) . Tranεformantε are identified by their ability to grow on LB plates and ampicillin/kanamycin reεistant colonies were εelected. Plasmid DNA was isolated and confirmed by restriction analysis. Cloneε containing the deεired conεtructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The 0/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.⁶⁰⁰) of between 0.4 and 0.6. IPTG ( "Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lad represεor, clearing the P/O leading to increased gene expresεion. Cellε were grown an extra 3 to 4 hourε. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HC1. After clarification, solubilized Ck3-4 was purified from this solution by chromatography on a Nickel- Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)). Ck/3-4 ( >98% pure) was eluted from the column in 6 molar guanidine HC1 pH 5.0. Protein renaturation out of GnHCl can be acco pliεhed by εeveral protocols (Jaenicke, R. and Rudolph, R. , Protein Structure - A Practical Approach, IRL Preεε, New York (1990)). Initially, step dialysis is utilized to remove the GnHCL. Alternatively, the purified protein iεolated from the Ni-chelate column can be bound to a εecond column over which a decreaεing linear GnHCL gradient iε run. The protein iε allowed^' to renature while bound to the column and is subsequently eluted with a buffer containing 250 mM Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and 10% Glycerol. Finally, soluble protein is dialyzed against a storage buffer containing 5 mM Ammonium Bicarbonate.

Example 2 Bacterial Expression and Purification of Ck3-10

The DNA sequence encoding for Ck_/3-10, ATCC # 75849, is initially amplified uεing PCR oligonucleotide primerε corresponding to the 5' and 3' sequenceε of the processed Ck/3-10 protein (minus the signal peptide sequence) and the vector sequenceε 3' to the Ck_/3-10 gene. Additional nucleotides corresponding to Ckj8-10 were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' CCCQCATGCAGCCAGATGCACTCAACG 3' contains a SphI reεtriction enzyme site (bold) followed by 19 nucleotides of Ck3-10 coding sequence (underlined) starting from the sequenceε coding for the mature protein. The ATG codon iε included in the SphI εite. The 3' sequence, 5' AAAGGATCCAGTCTTCAGGGTGTGAGCT 3' contains complementary εequenceε to a BamHl εite (bold) and iε followed by 19 nucleotideε of gene specific sequenceε preceding the termination codon. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expresεion vector pQE-70 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE-70 encodes antibiotic resistance (Amp^r), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/0), a ribosome binding site (RBS), a 6- Hiε tag and reεtriction enzyme sites. pQE-70 was then digested with SphI and BamHl. The amplified sequences were ligated into pQE-70 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. Figure 10 shows a schematic representation of thiε arrangement. The ligation mixture was then used to transform the E. coli strain available from Qiagen under the trademark M15/rep 4 by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copieε of the plasmid pREP4, which expresses the lad repressor and also conferε kanamycin reεiεtance (Kan^r). Tranεformantε are identified by their ability to grow on LB plateε and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysiε. Cloneε containing the deεired conεtructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.⁶⁰⁰) of between 0.4 and 0.6. IPTG ( "Isopropyl-B-D-thiogalacto pyranoεide") was then added to a final concentration of 1 M. IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours. Cellε were then harveεted by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HC1. After clarification, εolubilized Ck/3-10 waε purified from this solution by chromatography on a Nickel- Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)). Ck3-10 ( >98% pure) waε eluted from the column in 6 molar guanidine HCl pH 5.0. Protein renaturation out of GnHCl can be accompliεhed by εeveral protocolε (Jaenicke, R. and Rudolph, R. , Protein Structure - A Practical Approach, IRL Press, New York (1990)). Initially, step dialysiε iε utilized to remove the GnHCL. Alternatively, the purified protein isolated from the Ni-chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is run. The protein is allowed to renature while bound to the column and is subεequently eluted with a buffer containing 250 mM I idazoie, 150 mM NaCl, 25 mM Triε-HCl pH 7.5 and 10% Glycerol. Finally, εoluble protein iε dialyzed againεt a εtorage buffer containing 5 mM Ammonium Bicarbonate. The protein waε then analyzed on an SDS-PAGE gel Example 3 Expression of Recombinant Ckfi-4 in COS cells

The expresεion of plasmid, Ck/3-4 HA is derived from a vector pcDNAl/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resiεtance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire Ck/3-4 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expresεion iε directed under the CMV promoter. The HA tag correεpond to an epitope derived from the influenza hemagglutinin protein aε previouεly deεcribed (I. Wilεon, H. Niman, R. Heighten, A Cherenεon, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy iε deεcribed aε followε:

The DNA sequence encoding for Ck_/8-4, ATTC. # , waε constructed by PCR on the original EST cloned using two primers: the 5' primer 5' GGAAAGCTTATGTGCTGTACCAAGAGTTT 3' contains a Hindlll εite followed by 20 nucleotideε of Ck3-4 coding sequence starting from the initiation codon; the 3' sequence 5' CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTAACATGGTTCCTTGACTTTTT 3' contains complementary sequences to Xbal site, translation stop codon, HA tag and the last 20 nucleotides of the Ck/3-4 coding sequence (not including the stop codon). Therefore, the PCR product contains a Hindlll εite, Ck/3-4 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with Hindlll and Xbal restriction enzyme and ligated. The ligation mixture was transformed into E. coli εtrain SURE (available from Stratagene Cloning Syεtemε, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resiεtant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant Ck/3-4, COS cells were tranεfected with the expreεεion vector by DEAE-DEXTRAN method. (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expresεion of the Ck/3-4 HA protein was detected by radiolabelling and immunoprecipitation method. (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with ^3SS-cysteine two days post transfection. Culture media were then collected and cellε were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). both cell lysate and culture media were precipitated with a HA εpecific monoclonal antibody. Proteinε precipitated were analyzed by SDS-PAGE.

Example 4 Expreεεion of Recombinant Ck/3-10 in COS cells

The expression of plasmid, Ck/3-10 HA is derived from a vector pcDNAl/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin reεiεtance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire Ck/3-10 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression iε directed under the CMV promoter. The HA tag correεpond to an epitope derived from the influenza hemagglutinin protein aε previouεly deεcribed (I. Wilεon, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizeε the HA epitope.

The plaεmid conεtruction εtrategy iε deεcribed as followε:

The DNA εequence encoding for Ck/3-10, ATTC. # 75849, waε constructed by PCR on the original EST cloned using two primers: the 5' primer 5' GGAAAGCTTATGAAAGTTTCTGCAGTGC 3' contains a Hindlll site followed by 19 nucleotides of Ck_/3-10 coding sequence starting from the initiation codon; the 3' εequence 5' CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGG GTAAGTCTTCAGGGTGTGAGCT 3' contains complementary sequenceε to Xbal εite, tranεlation εtop codon, HA tag and the laεt 19 nucleotideε of the Ck3-10 coding sequence (not including the stop codon). Therefore, the PCR product contains a Hindlll site, Ck|S-10 coding εequence followed by HA tag fuεed in frame, a tranεlation termination stop codon next to the HA tag, and an Xbal site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with Hindlll and BamHl reεtriction enzyme and ligated. The ligation mixture waε tranεformed into E. coli strain SURE (available from Stratagene Cloning Syεte ε, 11099 North Torrey Pineε Road, La Jolla, CA 92037) the tranεformed culture waε plated on ampicillin media plateε and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by reεtriction analyεiε for the presence of the correct fragment. For expression of the recombinant Ck/3-10, COS cells were transfected with the expresεion vector by DEAE- DEXTRAN method. (J. Sambrook, E. Fritεch, T. Maniatiε, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Preεε, (1989)). The expreεεion of the Ck/3-10 HA protein waε detected by radiolabelling and immunoprecipitation method. (E. Harlow, D. Lane, Antibodieε: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with ³⁵S-cysteine two days post transfection. Culture media were then collected and cells were lyεed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and culture media were precipitated with a HA specific monoclonal antibody. Proteins precipitated were analyzed by SDS-PAGE.

Example 5 Cloning and expression of Ckθ-10 using the baculovirus expression system

The DNA sequence encoding the full length Ck/3-10 protein, ATCC # 75849, was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:

The 5' primer has the εequence 5' CGCGGGATCCTTAACCTTCAACATGAAA and contains a BamHl restriction enzyme site (in bold) followed by 12 nucleotideε resembling an efficient signal for the initiation of translation in eukaryotic cells (J. Mol. Biol. 1987, 196, 947-950, Kozak, M.), and just behind, is the first 6 nucleotides of the Ck/3- 10 coding sequence (the initiation codon for translation "ATG" iε underlined) .

The 3 ' primer has the εequence 5 ' CGCGGGTACCTTAACACATAGTACATTTT and contains the cleavage site for the restriction endonuclease Asp781 and 19 nucleotides complementary to the 3' non-translated sequence of the Ck/3-10 gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonucleases BamHl and Asp781 and then purified again on a 1% agarose gel. This fragment is designated F2.

The vector pRGl (modification of pVL941 vector, discussed below) is used for the expression of the Ck/3-10 protein using the baculovirus expresεion εyεtem (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expresεion vector containε the εtrong polyhedrin promoter of the Autographa californica nuclear polyhedroεiε viruε (AcMNPV) followed by the recognition εiteε for the reεtriction endonucleaεeε BamHl and Aεp781. The polyadenylation εite of the εimian viruε (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin εequenceε are flanked at both εideε by viral εequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRGl εuch aε pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summerε, M.D., Virology, 170:31-39).

The plaεmid waε digeεted with the reεtriction enzymeε BamHl and Asp781 and then dephoεphorylated uεing calf inteεtinal phoεphatase by procedures known in the art. The DNA waε then isolated from a 1% agarose gel. This vector DNA is deεignated V2.

Fragment F2 and the dephoεphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli HB101 cells were then transformed and bacteria identified that contained the plaεmid (pBacCk/3-10) with the Ck3-10 gene uεing the enzymeε BamHl and Aεp781. The εequence of the cloned fragment waε confirmed by DNA sequencing.

5 μg of the plasmid pBacCk/3-10 were cotransfected with 1.0 μg of a commercially available linearized baculovirus ( "BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA. ) using the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)). lμg of BaculoGold™ virus DNA and 5 μg of the plaεmid pBacCk/3-10 were mixed in a εterile well of a microtiter plate containing 50 μl of εerum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) . Afterwardε 10 μl Lipofectin plus 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tisεue culture plate with 1ml Grace' medium without εerum. The plate waε rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27°C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.

After four days the supernatant was collected and a plaque assay performed similar as described by Summerε and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologieε Inc., Gaithersburg) waε uεed which allowε an easy isolation of blue stained plaques. (A detailed description of a "plaque aεsay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .

Four days after the serial dilution of the viruεeε waε added to the cellε, blue εtained plaqueε were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then reεuεpended in an Eppendorf tube containing 200 μl of Grace's medium. The agar was removed by a brief centrifugation and the εupernatant containing the recombinant baculoviruεeε waε used to infect Sf9 cellε seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4°C.

Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells were infected with the recombinant baculoviruε V-Ck/3-10 at a multiplicity of infection (MOI) of 2. Six hourε later the medium waε removed and replaced with SF900 II medium minuε ethionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 μCi of ³⁵S-methionine and 5 μCi ³⁵S cysteine (Amersham) were added. The cells were further incubated for 16 hourε before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly deεcribed.

SEQUENCE LISTING

(1) GENERAL INFORMATION: (i) APPLICANT: LI, ET AL.

(ii) TITLE OF INVENTION: Human Chemokine Polypeptideε

(iii) NUMBER OF SEQUENCES: 4

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,

CECCHI, STEWART & OLSTEIN

(B) STREET: 6 BECKER FARM ROAD

(C) CITY: ROSELAND

(D) STATE: NEW JERSEY

(E) COUNTRY: USA

(F) ZIP: 07068

(V) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 INCH DISKETTE

(B) COMPUTER: IBM PS/2

(C) OPERATING SYSTEM: MS-DOS

(D) SOFTWARE: WORD PERFECT 5.1

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE: Submitted herewith

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA

(A) APPLICATION NUMBER:

(B) FILING DATE: (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: FERRARO, GREGORY D.

(B) REGISTRATION NUMBER: 36,134

(C) REFERENCE/DOCKET NUMBER: 325800-183

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 201-994-1700

(B) TELEFAX: 201-994-1744

(2) INFORMATION FOR SEQ ID NO:l: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 291 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

ATGTGCTGTA CCAAGAGTTT GCTCCTGGCT GCTTTGATGT CAGTGCTGCT ACTCCACCTC 60

TGCGGCGAAT CAGAAGCAGC AAGCAACTTT GACTGCTGTC TTGGATACAC AGACCGTATT 120

CTTCATCCTA AATTTATTGT GGGCTTCACA CGGCAGCTGG CCAATGAAGG CTGTGACATC 180

AATGCTATCA TCTTTCACAC AAAGAAAAAG TTGTCTGTGT GCGCAAATCC AAAACAGACT 240

TGGGTGAAAT ATATTGTGCG TCTCCTCAGT AAAAAAGTCA AGAACATGTA A 291

(3) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 96 AMINO ACIDS

(B) TYPE: AMINO ACID

(C) STRANDEDNESS:

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: PROTEIN (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Cys Cys Thr Lys Ser Leu Leu Leu Ala Ala Leu Met Ser Val

-20 -15 -10

Leu Leu Leu His Leu Cys Gly Glu Ser Glu Ala Ala Ser Asn Phe

-5 1 5

Asp Cys Cys Leu Gly Tyr Thr Asp Arg lie Leu Hiε Pro Lyε Phe

10 15 20 lie Val Gly Phe Thr Arg Gin Leu Ala Aεn Glu Gly Cyε Aεp lie

25 30 35

Aεn Ala lie lie Phe Hiε Thr Lyε Lyε Lys Leu Ser Val Cys Ala

40 45 50

Aεn Pro Lyε Gin Thr Trp Val Lyε Tyr lie Val Arg Leu Leu Ser

55 60 65

Lys Lyε Val Lyε Asn Met

70

(4) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 297 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

ATGAAAGTTT CTGCAGTGCT TCTGTGCCTG CTGCTCATGA CAGCAGCTTT CAACCCCCAG 60

GGACTTGCTC AGCCAGATGC ACTCAACGTC CCATCTACTT GCTGCTTCAC ATTTAGCAGT 120

AAGAAGATςT CCTTGCAGAG GCTGAAGAGC TATGTGATCA CCACCAGCAG GTGTCCCCAG 180

AAGGCTGTCA TCTTCAGAAC CAAACTGGGC AAGGAGATCT GTGCTGACCC AAAGGAGAAG 240

TGGGTCCAGA ATTATATGAA ACACCTGGGC CGGAAAGCTC ACACCCTGAA GACTTGA 297 (5) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 98 AMINO ACIDS

(B) TYPE: AMINO ACID

(C) STRANDEDNESS:

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: PROTEIN

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4 :

Met Lys Val Ser Ala Val Leu Leu Cys Leu Leu Leu Met Thr Ala

-20 -15 -10

Ala Phe Asn Pro Gin Gly Leu Ala Gin Pro Asp Ala Leu Asn Val

-5 1 5

Pro Ser Thr Cys Cys Phe Thr Phe Ser Ser Lys Lyε lie Ser Leu

10 15 20

Gin Arg Leu Lyε Ser Tyr Val lie Thr Thr Ser Arg Cyε Pro Gin

25 30 35

Lys Ala Val lie Phe Arg Thr Lys Leu Gly Lys Glu lie Cys Ala

40 45 50

Aεp Pro Lyε Glu Lyε Trp Pal Gin Asn Tyr Met Lys His Leu Gly

55 60 65

Arg Lys Ala Hiε Thr Leu Lys Thr

70 75

Claims (30)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide selected from the group consisting of:

(a) a polynucleotide encoding a Ck/3-4 polypeptide having the deduced amino acid sequence of Figure 1 or a fragment, analog or derivative of said polypeptide;

(b) a polynucleotide encoding a Ck/3-4 polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75848 or a fragment, analog or derivative of said polypeptide.

(c) a polynucleotide encoding a Ck/3-10 polypeptide having the deduced amino acid εequence of Figure 2 or a fragment, analog or derivative of said polypeptide; and

(d) a polynucleotide encoding a Ck/3-10 polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75849 or a fragment, analog or derivative of said polypeptide.

2. The polynucleotide of Claim 1 wherein the polynucleotide iε DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide iε RNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide iε genomic DNA.

5. The polynucleotide of Claim 2 wherein said polynucleotide encodeε Ck3-4 having the deduced amino acid εequence of Figure 2.

6. The polynucleotide of Claim 2 wherein εaid polynucleotide encodes Ck/3-10 having the deduced amino acid sequence of Figure 3.

7. ' The polynucleotide of Claim 2 wherein εaid polynucleotide encodeε a Ck/3-4 polypeptide encoded by the cDNA of ATCC Depoεit No. 75848.

8. The polynucleotide of Claim 2 wherein εaid polynucleotide encodeε a Ck/3-10 polypeptide encoded by the cDNA of ATCC Depoεit No. 75849.

9. The polynucleotide of Claim 1 having the coding εequence of Ck3-4 aε shown in Figure 1.

10. The polynucleotide of Claim 1 having the coding sequence of Ck/3-10 as shown in Figure 2.

11. The polynucleotide of Claim 2 having the coding sequence of Ck_/3-4 deposited aε ATCC Depoεit No. 75848.

12. The polynucleotide of Claim 2 having the coding sequence of Ck/3-10 deposited as ATCC Deposit No. 75849.

13. A vector containing the DNA of Claim 2.

14. A host cell genetically engineered with the vector of Claim 13.

15. A procesε for producing a polypeptide compriεing: expressing from the host cell of Claim 14 the polypeptide encoded by said DNA.

16. A procesε for producing cellε capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 13.

17. An isolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having Ck_/3-4 activity.

18. An isolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having Ck/3-10 activity.

19. A polypeptide selected from the group conεiεting of (i) a Ck/3-4 polypeptide having the deduced amino acid εequence of Figure 1 and fragmentε, analogs and derivativeε thereof (ii) a Ck/3-4 polypeptide encoded by the cDNA of ATCC Deposit No. 75848 and fragments, analogs and derivatives of εaid polypeptide (iii) an Ck_/3-10 polypeptide having the deduced amino acid εequence of Figure 2 and fragmentε, analogε and derivativeε thereof; and (iv) an Ck3-10 polypeptide encoded by the cDNA of ATCC Depoεit No. 75849 and fragments, analogε and derivatives of εaid polypeptide.

20. The polypeptide of Claim 19 wherein the polypeptide is Ck/3-4 having the deduced amino acid εequence of Figure 1.

21. The polypeptide of Claim 19 wherein the polypeptide is Ck/3-10 having the deduced amino acid εequence of Figure 2.

22. Antibodieε against the polypeptides of claim 19.

23. Antagonistε againεt the polypeptideε of claim 19.

24. A method for the treatment of a patient having need of Ck/3-4 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 19.

25. A method for the treatment of a patient having need to inhibit Ck/3-4 comprising: adminiεtering to the patient a therapeutically effective amount of the antagoniεt of Claim 23.

26. A method for the treatment of a patient having need of Ck/3-10 compriεing: adminiεtering to the patient a therapeutically effective amount of the polypeptide of claim 19.

27. A method for the treatment of a patient having need to inhibit Ck/3-10 compriεing: adminiεtering to the patient a therapeutically effective amount of the antagoniεt of Claim 23.

28. A pharmaceutical co poεition compriεing any one of the polypeptideε of Claim 19 and a pharmaceutically acceptable carrier.

29. The method of Claim 24 wherein said therapeutically effective amount of the polypeptide is adminiεtered by providing to the patient DNA encoding εaid polypeptide and expreεεing said polypeptide in vivo.

30. " The method of Claim 26 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo .