CA2198219A1 - Human chemokine polypeptides - Google Patents

Abstract

Human chemokine polypeptides and DNA (RNA) encoding such chemokine polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such chemokine polypeptides for the treatment of leukemia, tumors, chronic infections, autoimmune disease, fibrotic disorders, wound healing and psoriasis. Antagonists against such chemokine polypeptides and their use as a therapeutic to treat rheumatoid arthritis, autoimmune and chronic inflammatory and infective diseases, allergic reactions, prostaglandin-independent fever and bone marrow failure are also disclosed.

Description

WO 9fifOS856 2 1 9 ~ ~ 1 q PCTlUSg l/09~8 ~
.

Human _ ~ine Polypeptides This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are human chemokine beta-4 and human chemokine beta-10, sometimes hereinafter referred to as "Ck~-4" and "Ck~-10", collectively referred to as "the chemokine polypeptides". The invention also relates to inhibiting the action of such polypeptides.
Chemokines are an emerging super-family of small secreted cytokines that are structurally and functionally related. All chemokines exhibit 25 to 75~ homology at the amino acid level and contain spatially conserved cysteine residues as do the polypeptides of the present invention.
Members of the "C-X-C branch" ~according to the position of the first two cysteines in the conserved motif), also known as neutrophil-activating peptide (NAP)/IL-8 family, exert pro-inflammatory activity mainly through their action on neutrophils (e.g., IL-8 and NAP-2), whereas members of the "C-C branch" family appear to attract certain mononuclear cells. Members of the "C-C branch" include PF4, MIPs, MCPs, and the chemokine polypeptides of the present invention.

2l~8~
W0~6~U58~ PC1~lS~Io~

Numerous ~iologica' activities have been asslgned to this chemokine family. The macrophage inflammatory protein lc and 1~ are chemot~ctic for distinct lymphocyte populations and monocytes ~Schall, T.J., Cytokine, 3-165 (1991)), whlle MCP-l has beer, described as a specific monocyte chemo-attractant (Matsushima, K., et al., J. Exp. ~ed., 169:1485 (1989)). The common function of this chemokine family is their ability to stimulate chemotactic migration of distinct sets of cells, for example, immune cells (leukocytes~ and fibroblasts. These chemokines are also able to activate certain cells in this family.
The irnmune cells which are responsive to the chemokines have a vast number of in vivo functions and therefore their regulation by such chemokines is an important area in the treatment of disease.
For example, eosinophils destroy parasites to lessen parasitic infection. Eosinophils are also responsible for chronic inflammation in the airways of the respiratory system. ~acrophages are responsible for suppressing tumor formation in vertebrates. Further, basophils release histamine which may play an important role in allergic inflammation. Accordin~ly, promoting and inhibiting such cells, has wide therapeutic application.
In accordance with one aspect of the present invention, there are provided novel polypeptides which are Ck~-4, and Ck~-10, as well as fragments, analogs and derivatives thereof. The polypeptides of the present invention are of hurnan origin.
ln accordance with another aspect of the present invention, there are provided polynucleotides IDNA or RNA) which encode such polypeptides.
In accordance with yet a further aspect of the present invention, there is provided a process for producins such polypeptides by recombinant techniques.

W096/05856 PCT~jS9~/09~8~

In accordance with yet a further aspect of the preEent invention, there i8 provided a process for utilizing such polypeptides, or polynucleotides r?nco~;ng such polypeptides for therapeutic purposes, for example, to treat solid tumors, chronic infections, auto-immune diseases, psoriasis, asthma, allergy, to regulate hematopoiesis, and to promote wound healing.
In accordance with yet a further aspect of the present invention, there are provided ent; ho~ i eE against such polypeptides.
In accordance with yet another aspect of the present invention, there are provided antagonist/inhibitors to such polypeptides, which may be used to inhibit the action of such polypeptides, for example, in the treatment of auto-immune di.seases, chronic inflammatory and infective diseases, histamine-mediated allergic reactions, prostaglandin-in~ep~nr~ent fever, bone marrow failure, silicosis, sarcoidosis, hyper-eosinophilic syndrome and lung inflammation.
These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.
The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 displays the c3NA sequence and corresponding deduced amino acid sequence of Ck~-4. The initial 24 amino acids represent the deduced leader sequence of Ck~-4 such that the putative mature polypeptide comprises 72 amino acids. The standard one-letter abbreviation for amino acids is used.
Figure 2 displays the cDNA sequence and corresponding deduced amino acid sequence of Ck~-10. The initial 23 amino acids represent the putative leader sequence of Ck~-10 such that the putative mature polypeptide comprises 75 amino SuesTlTuTEsHE~T(F.~ 2~

~ I q ~
W096~0~6 PCT/~S~4t!ig~84 .

acids. The standard one-letter abbreviation for amino acids is used.
Figure 3 displays the amino acid sequence homology between Ck~-4 and the mature peptide of eotaxin ~bottom).
Figure 4 displays the amino acid sequence homology between Ck~-lO (top~ and human ~CP-3 ~bottom).
In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides~
which encode for the mature Ck~-4 polypeptide having the deduced amir.o acid sequence of Figure l or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75848 on July 29, 1994 and for the mature Ck~-lO polypeptide having the deduced amino acid sequence of Figure 2 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75849 on July 29, 1994.
The polynucleotide encoding Ck~-4 was discovered in a cDNA library derived from a human gall bladder. Ck~-4 is structurally related to the chemokine family. It contains an open reading frame encoding a protein of 11~ amino acid residues of which Ppproximately the first 24 amino acids residues are the putative leader sequence such that the mature protein comprises 92 amino acids. The protein exhibits the highest degree of homology to eotaxin with 2C~
identity and 37~ similarity over the entire coding sequence.
It i5 also important that the four spatially conser~ed cysteine residues in chemokines are found in the polypeptides of the present invention.
The polynucleotide encoding Ck~-10 was discovered in a cDNA library derived from nine week early human tissue. Ck~-is structurally related to the chemokine family. It contains an open reading frame encoding a protein of 98 amino acid resldues of which approximately the ~irst 23 amino acids residues are the putative leader sequence such that the mature protein comprises 75 amino acids. The protein 21 ~ ~ 7 t ~ PCTIUS9~1Os~8~
~096l0~5~6 ~ exhibits the highest degree of homology to ~CP-3 with 65 identity and 77% similarity over the entire coding sequence.

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding ~anti-sense) strand. The coding sequence which encodes the mature polypeptides may be identical to the coding sequence shown in Figures 1 and 2 or that of the deposited clones or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptides as the DNA of Figures 1 and 2 or the deposited cDNAs.
The polynucleotides which encodes for the mature polypeptides of Figures 1 and 2 or for the mature polypeptides encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence~ and non-coding sequence, such as introns or non-coding sequence 5~ ar.d/or 3~ of the coding sequence for the mature polypeptides.
Thus, the term '~polynucleotide encoding a polypeptide~
encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and~or non-coding sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figures 1 and 2 or the polypeptide encoded by the cDNA of the deposited clones. The 2~g2~
Wo9(ilU~8~ PCT/I~S91/1i')18~
.

variant of the polynucleotides mzy be a naturally occurring allelic variant of the polynucleotides or a non-naturally occurring variant of the polynucleotides.
Thus, the present invention includes polynucleotides encoding the same mature polypeptides as shown in Figures 1 and 2 or the same mature polypeptides encoded by the cDNA of the deposited clones as ~ell as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptides of Figures 1 and 2 or the polypeptides encoded by the cDNA of the depositeà
clones. Such nucleotide variants include deletion variants, substitutior. variants and addition or insertion variants.
As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figures 1 and ~ or of the coding sequence of the deposited clones. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptides may be fused in the same reading frame to a polynucleotide se~uence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein havins a prosequence i8 a proprotein and is an inactive form of the 2 ~ l q W096/05856 pcT~s9~los~8~
.

protein. Once the prosequence is cleaved an active mature protein remains.
Thus, for example, the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the meture polypeptides fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50~ and preferably 70~
identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditionE to the hereinabove-described polynucleotides . As herein used, the term "stringent conditions" means hybridization will occur only if there is at ieast 95% and preferably at least 97~ identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figures l and 2 or the deposit'ed cDNA.
The deposit~s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Wo'~6l05~56 ~ PC'Tn~s~lil9~4 Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides contained in the deposited material6, as well as the amino acid sequence of the polypeptidee encoded thereby, are incorporated herein by reference and are controlling in the event of any confiict with any description of sequences herein. A license may be required to ma~e, use or sell the deposited materials, and no such license ie hereby granted.
The present invention further relates to chemo~ine polypeptides which ha~e the deduced amino acid sequences of Figures 1 and 2 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptides.
The terms "fragment,' "derivative and UanalogR when referring to the polypeptides of Figures l and 2 or that encoded by the deposited cDXA, means polypeptides ~hich retain essentially the same biological function or activity as such polypeptides. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The chemokine polypeptides of the present invention m~y be recombinant polypeptides, natural polypeptides or a synthetic polypeptides, preierably reco~binant polypeptides.
The fragment, derivative or analog of the polypeptides of Figures 1 and 2 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid re~idue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or ~iij one in which one or more of the amino acid residues includes a substituent group, or ~iii) one in which the mature polypeptide is fused ~ith another compound, such as a compound to increase the half-life of the 2 ~ ~7 1 ~f W0~610S856 ~ PCT~Sg4/Os484 polypeptide ~for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
Host cells are genetically engineered ~transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformar.ts or amplifying the Ck~-4 and Ck~-10 genes. The culture conditions, such as _g_ ~ 1 ~82 ~ ~
W09~s~6 PCTi~59~ 9~8~
.

temperature, p~ and the like, are those previou51y used with the host cell selected for expression, and will be apparent tO the ordinarily skiiled artisan.
The polynucleotides of the present invention may be employed for producins polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is replicable and viable in the host.
The appropriate 3NA sequence may be inserted into the vector by a veriety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction endonuclease site( B ) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The DNA se~uence in the expression vector is operatively linked to an appropriate expression control sequence~s) ~promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: ~TR or S~40 promoter, the ~ coli. lac or trp, the phage lambda promoter and other promoters known to control expression of genes in prok.aryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome bir.ding site for translation initiation and a transcription terminator.
The vector may also include appropriate sequences for amplif~;ing expression.
In addition, the expression vectors preferably contain one or more selectable marker genes to pro~ide a phenotypic trait for selection of transformed host cells such as 2 1 ~2 1 ~
U~096105856 PCT~S9~1(19~81 dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomvces, Salmonella typhimurium: fungal cells, such as yeast; insect cells such as Droso~hila and Sf9; animal cells such as CHO, COS or Bowes melanoma; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
~ ore particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDl0, phagescript, psiXl74, pbluescript SK, pbsks, pNH8A, pN~16a, pNHl8A, pNH46A (Stratagene); ptrc99a, p~K223-3, pX~233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pS~2CAT, pOG44, pXTl, pSG (Stratagene) pSV~3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used~ as long as they are replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other ~ ~ 9~ ~ 9 WO ~610~8~6 PCTIUS9~O~
.

vectors ~ith selectable markers. Two appropriate vectors are p~232-8 and pCM7. Particular named bacterial promoters include lacI, lac~, T3, T7, gpt, lambda PR~ Pl and trp.
Eukaryotic promoters include C~ immediate early, HS~
thy~idine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a further ~m~n~im~nt, the present inventior. reLates to host cells containing the above-described constructs. The host cell car, be a higher eukaryotic cell, such as a m~ n cell, or e lo~er eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Ir.troduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation. ~Davis, L., Dibner, N., 3attey, I., ~asic Methods in Molecular Biolo~y, ~lg86~).
The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
~ ture proteins can be expressed in mammalien cells, yeast, bacteri2, or other cells under the control of appropriate promoter8. Cell-free translation s~ste~s can also be e~ployed to produce such proteins using RNAs derived from the DN~ constructs of the present invention.
Appropriate cloning and expression vectors for use ~ith prokaryotic and eukaryotic hosts are described by Sambrook, et al., ~olecular Cloning: A ~aboratory ~anualf Second Edition; Cold Spring Harbor, N.Y., ~1989~, the disclosure of which is hereby incorporated by reference.
Trar.scription of the DNA encoding the polypeptides of the preser.t invention by higher eukaryotes is increased by 2 1 ~21~
WO 9610585fi PCT/I-~9~l~9J#~
.

inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcriptior..
Examples including the SV~0 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhar.cers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGR), a-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin o' replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella tyDhimurium and various species W096t058s6 2 I Q~ P~T~IS9~m9~8~

within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden~ and pGEMl (Promega 3iotec/ Madison, WI, USA). T~ese pBR3~2 ~bac~bone' sections are combined with an appropriate promoter and the structural sequence to be expressed.
Following transformation of a suitable host s~r~in and growth of the host strain to ar. appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resultins crude extract retained for further purification.
Microbial cells employed in expression of proteins can ~e disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skllled in the art.
Various mammalian cell culture systems can also be employed to express rer~;n~nt protein. Examples of mammalian expres6ion systems include the COS-7 lines of monkey kidney fi~roblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressins a compatible vector, for example, the C127, 3T3, CH0, ~e~a and BH~ cell lines. Mammalian expression vectors will comprise an orisin of replication, a suitable promoter and enhancerl and also any nece6sary ribosome binding sites, WO 9fi~058~ 2 1 ~ 8 ~ 1 9 PCT~S9~109~
~
polyadenylation site, splice donor end acceptor sites, transcriptional termination sequences, and 5~ flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may oe used to provide the reguired nontranscribed genetic elements.
The r~h~ kin~ polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extrac~ion, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC~ can be employed for final purification steps.
The chemokine polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and r ~ n cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial methionine amino acid residue.
The chemokine polypeptides may be used to inhibit bone marrow stem cell colony formation as adjunct protective treatment during cancer chemotherapy and for leukemia.
The chemokine polypeptides may also be used to ir.hibit epidermal keratinocyte proliferation for treatment of psoriasis, which is characterized by keratinocyte h.yper-proliferation.
The chemokine polypeptides may also be used to treat solid tumors by stimulating the invasion and activation of host defense cells, e.g., cytotoxic T cells and macrophages.

W(~ 9hlO51~!i6 2 5 9 3 2 ~ ~ PC T/U~ S,g~8~
.

They may also oe used to enhance host defenses against resistant chronic infections, for example, mycobacterial infections via the attraction and activation of microbicidal Leukocytes.
The chemokine polypeptides may also be use~ to treat auto-immune disease and lymphocytic leukemias by inhibiting T cell proliferatior. by the inhioition of ~L2 biosynthesis.
Ck~-4 and Ck~-10 may also be used in wound healing, both via the recruitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGF~-mediated fibrosis. In this same manner, Ck~-4 and Ck~-10 may also be used to treat other fibrotic disorders, including liver cirrhosis, osteoarthritis and pulmonary fibrosis. The chemokine polypeptides also increase the presence of eosinophils which have the distinctive function of killing the larvae of parasites that invade tissues, as in schistosomiasis, trichinosis and ascariasis.
They may al50 be used to regulate hematopoiesis, by regulating the activation and differentiation of various hematopoietic progenitor cells .
Chemokines may also be employed as inhibitors of angiogenesis, t~erefore, they have anti-tumor effects.
The ~h~ polypeptides of the present invention are also useful for identifying other molecules which have similar biological activity. An example oi a screen for this is isolating the coding region of the genes by using the known D~A sequence to synthesize oligonucleotide probes.
~a~eled olLgonucleotides having a sequence complementary to that of the gene6 of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
The present invention also relates to a diagnostic assays for detecting altered levels of the polypeptides or the mRNA which provides the message for such polypeptides, both quantitatively and qualitatively. Such assays are well-WO~/058~6 PCT~S~/09~8~

known in the art and include an ELISA assay, the radio; -o~Rsay and RT-PCR. The levels of the polypeptides, or their mRNAs, which are detected in the assays may be employed for the elucidation of the significance of the polypeptides in various di6eases and for the diagnosis of diseases in which altered levels of the polypeptides may be significant.
This invention provides a method for identification of the receptors for the polypeptides. The gene encoding the receptors can be identified ~by expression cloning.
Polyadenylated RNA is prepared from a cell responsive to the polypeptides, and a cDNA library created from this RNA i6 divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides.
Transfected cells which are grown on glass slides are exposed to the labeled polypeptides. The polypeptides can be labeled by a variety of means including iodidation or inclusion of a recognition site for a site-specific protein kinase.
Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified and sub-pools are prepared and retransfected using an iterative sub-pooling and rescreening process, eventually yielding a single clones that encodes the putative receptor.
As an alternative approach for receptor identification, the labe~ed polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to x-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide frasments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of generate oligonucleotide probes to screen a c3NA library to identify the genes encoding the putative receptors.

r7~ r~

W0~.10s8s6 2 ~ ~Z I ~ P~ S9~109~8~ ~

This invention provides a method of screening drugs to identify tho~e which enhance tagonists) or block (antagonists) interaction of the polypeptides to their identified receptors. An agonist is a compound which increases the natural biological functions of the polypeptides, while antagonists eliminate such functions. As an exampie, a mammalian cell or membrane preparation expressing the receptors of the poiypeptides would be incubated with a labeled chemokine polypeptide, eg.
radioactivity, in the presence of the drug. The ability of the drug to enhance or block this interaction could then be measured.
Potential antagonists include antibodies, or in some cases, oligonucleotides, which bind to the polypeptides.
Another example of a potential antagonist is a negative dominant mutant of the polypeptides. Negative dominant mutants are polypeptides which bind to the receptor of the wild-type polypeptide, but fail to retain biological activity.
An assay to detect negative dominant mutants of the polypeptides include an ir vItro chemotaxis assay wherein a multiwell chemotaxis chamber equipped with polyvinylpyrrolidone-free polycarbonate membranes is used to measure the chemoattractant ability of the polypeptides for leukocytes ir. the presence and absence of potential antagonist~inhibitor or agonist molecules.
Antisense constructs prepared using antisense technology are also potential antagonists. Antisense technology can be used to control gene expression through trlple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNP. or RNA. For example; the 5 r coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA
oiigonucleotide of from about 10 to 40 base pairs in length.

- =

Zl ~
W09~ 8S6 1~ 8~1 ~ PCT~S9~109484 A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple- helix, see Lee et al., Nucl. Acids Res., 6:3073 ~1979); Cooney et al, Science, 2~1:456 (1988~; and Dervan et al., Science, 251:
1360 (1991)), thereby preventing transcription and the production of the polypeptides. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the polypeptides (antisense - Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the polypeptides.
Another potential antagonist is a peptide derivative of the polypeptides which are naturally or synthetically modified analogs of the polypeptides that have lost biological function yet still recognize and bind to the receptors of the polypeptides to thereby effectively block the receptors. Examples of peptide derivatives include, but are not limited to, small peptides or peptide-like molecules.
The antagonists may be employed to inhibit the chemotaxis and activation of macrophages and their precursors, and of neutrophils, basophils, B lymphocytes and sOme T cell subsets, e.g., activated and C38 cytotoxic T
ceLls and natural killer cells, in auto-immune and chronic inflammatory and infective diseases. Examples of auto-immune diseases include rheumatoid arthritis, multiple sclerosis, and insulin-dependent diabetes. Some infectious diseases include silicosis, sarcoidosis, idiopathic pulmonary fibrosis by preventing the recruitment and activation of mononuclear phagocy'tes, idiopathic hyper-eosinophilic syndrome by preventing eosinophil production and migration, endotoxic shock by preventing the migration of macrophages and their production of the chemokine polypeptides of the presen~

2 ' 982 ~f7~
~096~0~56 PCT~'S9~10~8~
.

invention. The antagonist6 may also be used for treating atherosclerosis, by preventing monocyte infiltration in the artery wall.
The antagonists may also be used to treat histamine~
mediated allergic reactions by inhibiting chemokine-induced mast cell and basophil degranulation and release of histamine .
The antagonists may also be used to treat ir.flammation by preventing the attraction of monocytes to a wound area.
They may also be used to regulate normal pulmonary macrophage populations, since acute and chronic inilammatory pulmonary diseases are associated with sequestration of mononuclear phagocytes in the lung.
~ ntagonists may also be used to treat rheumatoid arthritis by preventing the attraction of monocytes into synovial fluid in the joints of patients. ~onocyte influx and activation plays a significant role in the pathogenesis of both degenerative and inflammatory arthropathies.
The antagonib~y llia~ be used to interfere with the deleterious cascades attributed primarily to IL-~ and ~NF, which prevents the biosynthesis of other inflammatory cyto~.ines. In this way, the antagonists may be used to preYent inflammation. The antagonists may also be used to inhibit prostagLandin-independent fever induced by chemokines.
The antagonists may also be used to treat cases of bone marrow failure, for example, aplastic anemia and myelodysplastic syndrome.
The antagonists may also be used to treat asthma and allergy by preventing eosinophil accumulation in the lung.
The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
The chemokine polypeptides and agonists or antagonists of the present invention may be employed in combination with E 26) WO~1058~6 ~1 9~ PCT1l1Sg410948~

a sultable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container~s) can be a noSice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, intratumor, subcutaneous, intranasal or intradermal routes. The polypeptides are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the polypeptides will be administered in an amount of at least about lO ~g~kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about lO ~g~kg to about l mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
The chemokine polypeptides and agonists or antagonists may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.' Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or ~NA~ encoding a 2 ~ q82 1 q Wo ~10~6 PCT~ 09~
.

polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such ~,ethods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA
encoding the polypeptide of the present invention may be administered to a patient for engineering cells in ViYo and expression of the polypeptide in vivo. ~hese and other methodb for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineerin~ cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
The sequences of the present invention are also valuable for cnromosome identification. ~he sequence is speci~ically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. ~ew chromosome marking reagents based on actual sequence data Irepeat polymorphism6) are presently available for marking chromosomal location. ~he mapping of DNAs to chromo60me6 according to the present invention is an important first step in correlating those sequences with genes associated with disease.
Briefly, sequences can be mappeà to chromosomes by preparing PCR primers ~?referably 15-25 bp) from the cDNA.
Computer analysis of tne cDNA is used to rapidly select primers that do not span more than one exon in the genomic W096/~856 PCT/US9~/0Y18~

DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in sltu hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific--cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA
clones to a metaphase chIl s~--l spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 500 or 600 bases;
however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same ~-r~ ~5.

2 1 ~82 ~ ~
W096/Os8~6 PCT~I~94/(19~#~
.

chromosomal region are then identified through linkage an~lysis (coinheritance of physically adjacent genes~.
Next, it is necessary to determine the differences in the cD~A or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the diseese could be one of between 50 and 500 potential causative genes. ~This assumes 1 megabase mapping resolution and one gene per 20 .b~.
The polypeptides, their fragments or other derivatives, or anaiogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an ar.imal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by ~nnt;nsnus cell line 2 1 ~821 9 w096l~)s856 PCT~iS9~ 9~8~

cultures can be used. Examples include the hybridoma technique ~Kohler and Milstein, 197S, Nature, 256:495-497), the trioma technique, the human 3-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the Esv-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention.
The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and~or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the 3NA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~1 ~ 1 9~
W096~x56 PCT~/Os~4 .

of buffer solution. For the purpose of isolating DNA
fragments for plzsmid construction, typically 5 to 50 ~g of DNA are digested wlth 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D.
et al., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A bynthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146~. Unless otherwlse provided, ligation may be acco~plished using know~
buffers and conditions with 10 unit~ to T4 DNA ligase ~''ligaseU) per 0.5 ~g of approximately equimolar amounts of the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed a8 described in the method of Graham, F. and Van der Eb, A., ~'irology, 52:456-457 (1973).

~ m~le I
Bacterial Exoression and Purification of CkB-4 21 ~8~ 9 ~096/05856 PC~IIJS9~109~8~
.

The DNA sequence encoding for Ck~-4, ATCC # 75848, i9 initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the processed Ck~-4 protein (minus the putative signal peptide sequence).
Additional nucleotides corresponding to Ck~-4 were added to the 5~ and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' CCCGCATGCAAGCAGCAAGCAACTTT 3' contains a SphI restriction enzyme site ~bold) followed by 17 nucleotides of Ck~-4 coding sequence lunderlined~ starting from the second nucleotide of the sequences coding for the mature protein. The ATG codon is included in the SphI site.
In the next codon following the ATG, the first base is from the SphI site and the rr--i n; ng two bases correspond to the second and third base of the first codon of the putative mature protein. As a consequence, the first base in this codor, is changed from G to C compared with the original sequences, resulting in an E to Q substitution in the re~ ~in~nt protein. The 3' sequence, 5~
AAAGGATCCCAT~lr~ A~ ACT 3' contains complementary sequence6 to a BamHl site (bold) and is followed by 21 nucleotides of gene specific sequences preceding the termination codon. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-70 ~Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311~. pQE-70 encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-70 was then digested with SphI and BamH1. The amplified sequences were ligated into pQE-70 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. Figure 8 show6 a schematic representation of this arrangement. The ligation mixture was then used to transform the E. coli strain available from Qiagen under the trademark M15/rep 4 by the procedure described in Sambrook, J. et al., Moiecular ~ 1 9~2 1 9 ~096~8~6 PCT~iss~/~)9~

Cloning: A Laboratory ~anual, Cold Spring Laboratory Press, ~1~893. M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance ~Kan'). Trans~ormants are identifieà by ~sheir ability to grow on LB plates and ampicillin~kara~ycin resistant colonies were selected. Plasmid DNA was isolated and con~irmed by restriction analysis. Clones contair.ing the desired constructs were grown overnight (C/~) in liquid culture in L3 media supplemented with both Amp ~lO0 ug~ml) and Xar, ~25 ugjml~. The ~ culture is used to inoculate a large culture at a ratio of l:100 to 1:250. The cells were grown to an optical density 600 (O.D.~) of between 0.4 and 0.6. IPTG ~'Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/0 leading to increased gene expression. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubili~ed Ck~-4 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binr~ing by proteins containing the ~-His tag tHochuli, E. et al., J.
Chromatography 411:177-184 ~1984)~. Ck~-4 ( ~98~ pure) was eluted from t~e column in 6 molar g~n;r~ine HCl pH 5Ø
Protein renaturation out of Gn~.Cl can be accomplished by several protocols (Jaenicke, R. and Rudolph, R., Protein Structure - A Practical Approach, IRL Press, New York ~1990)). Initially, 5tep dialysis is utilized to remove the GnHCL. Aiternatively, the purified protein isolated from the Ni-chelate column can be bound to a second column over which a decre~sing linear GnHCL gradient is run. The protein is allowed to renature while bound to the column and is subsequently eluted with a buffer containing 250 Imida~ole, 150 mM NaCl, 25 mM Tris-HCl 2H 7.5 and 10 2 ~ 9~ 1 9 W0~6l058~6 PCT~S'~109S8~
.

Glycerol. Finally, soluble protein is dialyzed against a storage buffer containing 5 mM Ammonium Bicarbonate.
Example 2 Bacterial Expression and Purification of Ck~-10 The DNA sequence encoding for Ck~-10, ATCC # 75849, is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the processed Ck~-10 protein ~minus the signal peptide sequence) and the vector sequences 3' to the Ck~-10 gene. Additional nucleotides corresponding to Ck~-10 were added to the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the sequence 5' CCCGCATGCAGCCAGATGCACTCAACG 3' contains a SphI restriction enzyme site ~bold) followed by 19 nucleotides of Ck~-10 coding sequence ~underlined) starting from the sequences coding for the mature protein. The ATG
codon is included in the SphI site. The 3' sequence, 5' AAAGCATCCAGTCTTCAGGGTGTGAGCT 3' contains complementary sequences to a BamHl site ~bold) and is followed by 19 nucleotides of gene specific sequences preceding the termination codon. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-7C ~Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE-70 encodes antibiotic resistance ~Amp'), a bacterial origin of replication ~ori), an IPTG-regulatable promoter operator ~P/0), a ribosome binding site ~RBS), a 6-His tag and restriction enzyme sites. pQE-70 was then digested with SphI and BamH1. The amplified sequences were ligated into pQE-70 and were inserted in frame with the 6equence encoding for the histidine tag and the R13S. Figure 10 shows a schematic representation of this arrangement. The ligation mixture was then used to transform the E. coli strain available from Qiagen snder the trademark M15/rep 4 by the procedure described in Samorook, ~. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989~. M15/rep4 contains multiple copies of the plasmid 2 1 ~ 9 WO96/~ 56 PCT~59~1~948~
.

pREP4, which expresses the lacI repressor and also confers kanamycin resistance ~anr). Transformants are identified by their a~ility to grow on L~ plates and ampicillin~kanamycin resistant colonies were selected. Plasmid DNA was isolated, and confirmed ~y restriction analysis. Clones containing the desired constructs were grown overnight ~OJN) in liquid culture in LB media supplemented with both Amp ~lO0 ug/ml) and Ran (25 ug/ml). The O/~ culture is used to inoculate a large cult~re at a ratio of l:lO0 to 1:~50. The cells were grown to an optical density 600 ~O.D.~) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside~) was then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expres~ion. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 ~olar Guanidine HCl. After clarification, solubilized Ck~-10 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins cont~ining the 6-~is tag ~ochuli, E. et al., a.
Chromatosraphy 411:177-184 ~1984)). CX~-10 ~ >98% pure) was eluted from the column in 6 molar ~lPn;~;n~ HCl pH 5Ø
Protein renaturation out of GnHCl can be accomplished by several protocols ~Jaenicke, R. and Rudolph, R., Protein Structure - A Practica~ Approach, IRL Press, New York ~19~0)~. InLtially~ step dialysis is utilized to remove the GnHCL. Alternatively, the purified protein isolated from the Ni-chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is run. The protein is allowed to renature while bound to the column and is subsequently eluted with a buffer containing 250 mM
Imidazoie, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and lO~
Glycerol. Finally, soluble protein is dialyzed again~t a storage buffer containing 5 mM Ammonium Bicarbonate. The protein was then analyzed on an S~S-PAGE gel w0~6l0sXs6 ~19 ~ PCT~iS94/ll9484 Example 3 Expression of Recombinant Ck~-4 in COS cells The expression of plasmid, Ck~-4 HA is derived from a vector pcDNAI~Amp ~Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-4 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to ar. epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H.
Nim~n, R. Heighten, A Cherenson, M. Connolly, and R. ~erner, 1984, Cell 37, 767). The infusion of hA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as follows:
The DNA sequence encoding for Ck~-4, ATTC. #
, was constructed by PCR on the original EST
cloned using two primers: the 5' primer 5' GGAAAGCTTATGTGCTGTACCAAGAGTTT 3' contains a HindIII site followed by 20 nucleotides of Ck~-4 coding sequence starting from the initiation codon; the 3' sequence 5' CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTAACAl~bllcbllGACTTTTT
3' contains complementary sequences to XbaI site, translation stop codon, HA tag and the last 20 nucleotides of the Ck~-4 coding Gequence ~not including the stop codon). Therefore, the PCR product contains a HindIII site, Ck~-4 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an XbaI site.
The PCR amplified ~NA fragment and the vector, pcDNAI/Amp, were digested with HindIII and XbaI restriction er.zyme and ligated. The ligation mixture was transformed into E. coli ~' t 9~ t ~
~0961058~6 ~ PCT~IS'~ 8~

strain SU~E (availabie from Stratagene Cloning Systems, 1109g North Torrey Pines Road, La Jolla, CA 9203~) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from trans~ormants and ~mi n~d by restriction analysis for the presence of the correct fragment. For expression of the recombinant CkB 4, COS cells were transfected with the expression vector by DEAE-DEXTRAN method. ~J. Sambroo~, E.
Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the Ck~-4 EA protein was detected by radiolabelling and immunoprecipitation method. (E. Harlow, ~. Lane, Antibodies:
A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with 35S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1~ NP-40, 0.5~ DOC, 50mM
Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). both cell lysate and culture media were precipitated with a ~A
specific monoclonal antibody. Proteins precipitated were analyzed by SDS-PAGE.

Example 4 Expression of ~ecombinant CkB-10 in COs cells The expression of plasmid, Ck~-10 HA is derived from a vector pcnNAIfAmp ~Invitrogen) contalning: 1~ SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A ~NA
fragment encoding the entire Ck3-10 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag oorrespond to an epitope derived from the influen~a hemagglutinin protein as previously described (I. Wilson, ~.

21 9~2 ~ ~
~'096~0S8~6 PCT~TS9~11\9~X~

Niman, R. Heighten, A Cherensor., M. Connolly, anà R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as follows:
The DNA sequence encoding for Ck~-10, ATTC. # 75849, was constructed by PCR on the original EST cloned using two primers: the 5' primer 5' GGAAAGcTTATGAAAGTTTcTGcAGTGc 3' contains a HindIII site followed by 19 nucleotides of Ck~-10 coding sequence starting from the initiation codon; the 3' sequence 5' CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGG
GTAAGTCTTCAGGGTGTGAGCT 3' conteins complementery sequences to XbaI site, translation stop codon, HA tag and the last lg nucleotides of the Ck~-10 coding sequence ~not including the stop codon). Therefore, the PCR product contains a HindIII
site, Ck~-10 coding sequence followed by HA tag fused in frame, a translation terminetion stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with HindIII and BamH1 restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratager.e Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected.
Plasmid DNA W2S isolated from transforments and r~mi nr~r~ by restriction analysis for the presence of the correct fragment. For expression of the recombinant Ck~-10, COS
cells were trensfected with the expression vector by DEAE-DEXTRAN method. ~J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Leboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the Ck~-10 sYA
protein was detected by radiolebelling end immunoprecipitetion method. (E. Herlow, D. Lene, Antibodies:
A Leboratory Manual, Cold Spring Herbor Leboretory Press, ~ t ~
W09~0~8~6 PCT~S9~109~84 (1988)). Cells were labelled for 8 hours with 355-cysteine two days po6t transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1~ NP-40l Q.1~ SDS, 1~ NP-40, 0.5% DOC, 50mM
Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and culture media were precipitated with a ~A
specific monoclonal antibody. Proteins precipitated were analyzed by SDS-PAGE.

Exam~le 5 Clonina and expression o~ ~kR-lo using the baculovirua ression svstem The DNA sequence encoding the full length Ck~-10 protein, ATCC # 75849, was amplified using PCR
oligonucleotide primer6 corresponding to the 5' and 3' sequences of t~e gene:
The 5' primer has the se~uence 5' C&CGOGATCCTT~ACCTTCAAC TGAAA and contains a 3am~I restriction enzyme site ~in bold) followed by 12 nucleotides resem'oling an efficient signal for the initiation of translation in eukaryotic cells ~J. ~ol. Biol. 1987, 196~ 947-950, ~ozak, and sust ~ehind, is the fir6t 6 nucleotides of the Ck~-10 coding se~uence ~the initiation codon for tran61ation "ATG" is underlined).
The 3' primer has the sequence S' CGCGGGTACCTTAACACATAGTACATTTT and contains the cleavage site for the restriction endonuclease Asp781 and 19 nucleotides complementary to the 3' non-translated sequence of the Ck~-10 gene. The amplified sequences were isolated from a 1 agarose gel using a commercially available kit ~"Geneclean,"
8IO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonucleases 3am~I and Asp781 and then purified again on a 1~ agarose gel. Thi6 fragment is deslgnated F2.
The vector pRGl ~modification of p~L941 vector, discussed below) i6 u6ed for the expression of the Ck~-10 wo g6~0s8~6 2 ~ ~ ~ 2 ~ ~ PCT~S9~fll948~

protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555).
This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus tAcMNPV) followed by the recognition sites for the restriction endonucleases BamHI and Asp781. The polyadenylation site of the simian virus ~SV)40 is used for efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactosidase gene from E.coli i~s inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIM1 ~Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
The plasmid was digested with the restriction en~ymes BamHI and Asp781 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1% agarose gel. This vector DNA
is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli HBlO1 cells were then transformed and bacteria identified that contained the plasmid ~pBacCk~-10) with the Ck~-10 gene using the enzymes BamHI and Asp781. The sequence of the cloned fragment was confirmed by DNA sequencing.
5 ~g of the plasmid pBacCk~-10 were cotransfected with 1.0 ~g of a commercially available linearized baculovirus ("BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method ~Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 ~1987~).

W0~6~s8s6 ~1 ~ 8 ~ ~ ~ PCT~S~ln9~4 .

l~g of ~aculoGold~ virus DNA and 5 ~g of the plasmid pBacCk~-10 were mixed in a sterile well of a microtiter plate containing 50 ~l of serum free Grace's medium ~Life Technologies Inc., Gaithersburg, ~D~. ~fterwards 10 J~l Lipofectin plus 90 ~l Grace's medium were added, mixed and incubated for 15 minutes at room temperature. 1'hen the transfection mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in 2 35 mm tissue culture plate with lml Grace' medium without serum. The plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27~C. After ~ hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10~ fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27~C for four days.
After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" ~Life Technologies Inc., Gaithersburg~ was used which allows an easy isolation of blue stained plaques. (~
detailed description of a ~plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-1 C ) .
E'our days after the serial dilution of the Viruses wa8 added to the cells, bl~e stained plagues were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tu~e containing 200 ~l of Grace's medium. The aqar was removed by a brief centrifugation and the supernatant containins the recombinant baculoviruses was used to infect Sfg cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4~C.
Sf9 cells were grown in Grace's medium supplemented with 10~ heat-inactivated F8S. The cells were infected with the 2 1 ~ 8 2 1 q PCT~S9~11)9484 ~ recombinant baculovirus V-Ck~-l0 at a multiplicity of infection ~MOI) of ~. Six hours later the medium was removed and replaced with SE900 II medium minus methionine and cysteine tLife Technologies Inc., Gaithersburg). 42 hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine (Amersham) were added. The cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
~ umerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

~ Oi~t Q
W096/05856 ~ PCTIUS94109484 ~yu~N~: LISTING

~1) GENERAL INFORMATION:
ti) APPLICANT: LI~ ET AL.

(ii~ TITLE OF INVENTION: Human Chemokine Polypeptides ~iii) NUMBER OF SEQUENCES: 4 (iv) CORRESPONDENCE ADDRESS:

A) ADDRESSEE: CARELLA, BYRNE, BAIN~ GILFILLAN~
CECCHI, STEWART & OLSTEIN
~B) STREET: 6 BECKER FARM ROAD
~C) CITY: ROSELAND
~D) STATE: NEW JERSEY
~E) COUNTRY: USA
(F) ZIP: 07068 tv) L~ U'l'~ RT~.AT)ART.T~. FORM:
~A) MEDIUM TYPE: 3.5 INC~ DISKETTE
~B) COMPUTER: IBM PS/2 ~C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Submitted b.erewith (C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER:
(B) FILING DATE:

2 1 9 8 2 1 ~ PCTIUS94/09484 WO 'IhlO5856 ~viii ~ ATTORNEY/AGENT INFORMATION:
( A ) NA7.~E: FERRI~RO, GREGORY D .
(B) REGISTRATION NUMBER: 36,134 ( C ~ RE FE RE NCE ~DOC7:~E T NU7~BE R: 3 2 5 8 0 0 -13 3 (ix) TELECO7MMUNICATION INFOR7'1ATION:
(A) TELEP7.~0NE: 201-954--1700 ~B) TELEFAX: 201--994-1744 ( 2 ) INFORMATION FOR SEQ ID NO: l:
( i ) SEQUENCE CHARACTERISTICS
(A) LENGT73: 291 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C~ sTRANnT~n7yEss: SINGLE
(D) TOPOLOGY: LINEAR

( ii ) Mr)T~p~crTrlT~ TYPE: CDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

AI~rl~l~l~ CCAAGAGTTT ~L-~l~l GCTTTGATGT CAGTGCTGCT ACTCCACCTC 60 TGCGGCGAAT r'~ ~ AAGCAACTTT GACTGCTGTC TTGGATACAC AGACCGTATT 120 CTTCATCCTA AATTTATTGT GGGCTTCACA CaGCAGCTGG rr~r~c~ cTaTGAcATc 18Q
AATGCTAI'CA TCTTTCACAC ~a~r~a~r ll~l~l~l~L GCGCAAATCC a~a~ 240 TGGGTGAAAT ATATTGTGCG TCTCCTCAGT AaAAAAGTCA AGAACATGTA A 291 ( 3 ) INFORMATION FOR SEQ ID NO: 2:
~i) SEQUENCE C7.~ARACTERISTICS
~A) LENGT7.;1: 96 A7.~INO ACIDS
~B) TYPE: AMINO ACID
C ) STRANDEDNESS:
~ D ) TOPOLOGY: LINEAR

( ii ) MOLECULE TYPE: PROTEIN

21a~
W096/058~6 PC'T~S94/1l9~W
.

(xi) S~UENC~ DESCRIPTION- SEQ ID NO:2:

Met Cys Cys Thr Lys Ser Leu Leu Leu Ala Ala Leu Met Ser Val Leu Leu Leu His Leu Cys Gly Glu Ser Glu Ala Ala Ser Asn Phe Asp Cys Cys Leu Gly Tyr Thr Asp Arg Ile Leu His Pro Lys Phe Ile Val Gly Phe Thr Arg Gln Leu Ala Asn Glu Gly Cys Asp Ile Asn Ala Ile Ile Phe His Thr ~ys Lys Lys Leu Ser Val Cys Ala g5 50 Asn Pro LYB Gln Thr Trp Val Lys Tyr Ile Val Arg Leu Leu Ser S~ 60 65 Lys Lys Val Lys Asn Met (4) INFORMATION FOR SEQ ID NO:3:

(i) ~i~;yU~;Ni,:~; CHARACTERISTICS
~A) LENGTH: 297 BASE PAIRS
(13) TYPE: NUCLEIC ACI D
~C) sTRANn~nN~ss: SINGLE
(D) TOPOLOGY: LINEAR

or.~cr7r.r~ TYPE: cD~A

(xi) ~yU~N~: DESCRIPTION: SEQ ID NO:3:

ATGAAAGTTT CTGChG~GCT Y~L~1~L~ CTGCTCATGA CAGCAGCTTT 5AArCCCrDr. 60 GGhCTTGCTC AGCCAGATGC ACTCAhCGTC CCATCTACTT &CTGCTTCAC ATTTAGCAGT 12D
AhGAAGATCT CCTTGCAGAG GCTGAAGAGC TATGTGATCA rrDrrDr.r~r. GTGTCCCCAG 180 AAGGCTGTCA TCTTCA~AAC CAAACTGGGC AhGGAGATCT GTGCTGACCC ~''~'~'~ 240 TGGGTCCAGA ATTATATGAA ACACCTGGGC CGGAAAGCTC ArArrr~r~ GACTTGA 297 2 ~ 9~2 1 9 WO9fi,'0~8~6 PcT~1s9~9484 (5) INFORMATION FOR SEQ ID NO:4:
(i~ SEQUENCE CHARACTERISTICS
(A) LENGTH: 9E AMINO ACIDS
(B~ TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: PROTEIN

~xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Met Ly6 Val Ser Ala Val Leu Leu Cys Leu Leu Leu Met Thr Ala Ala Phe Asn Pro Gln Gly Leu Ala Gln Pro Asp Ala Leu Asn Val Pro Ser Thr Cys Cys Phe Thr Phe Ser Ser Lys Lys Ile Ser Leu Gln Arg Leu Lys Ser Tyr Val Ile Thr Thr Ser Arg Cys Pro Gln Lys Ala Val Ile Phe Arg Thr Lys Leu Gly Lys Glu Ile Cys Ala Asp Pro Lys Glu Lys Trp Pal Gln Asn Tyr Met Lys ~is Leu Gly Arg Lys Ala His Thr Leu Lys Thr

Claims (30)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide selected from the group consisting of:
(a) a polynucleotide encoding a Ck.beta.-4 polypeptide having the deduced amino acid sequence of Figure 1 or a fragment, analog or derivative of said polypeptide;
(b) a polynucleotide encoding a Ck.beta.-4 polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75848 or a fragment, analog or derivative of said polypeptide.
(c) a polynucleotide encoding a Ck.beta.-10 polypeptide having the deduced amino acid sequence of Figure 2 or a fragment, analog or derivative of said polypeptide; and (d) a polynucleotide encoding a Ck.beta.-10 polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75849 or a fragment, analog or derivative of said polypeptide.

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide is genomic DNA.

5. The polynucleotide of Claim 2 wherein said polynucleotide encodes Ck.beta.-4 having the deduced amino acid sequence of Figure 2.

6. The polynucleotide of Claim 2 wherein said polynucleotide encodes Ck.beta.-10 having the deduced amino acid sequence of Figure 3.

7. The polynucleotide of Claim 2 wherein said polynucleotide encodes a Ck.beta.-4 polypeptide encoded by the cDNA of ATCC Deposit No. 75848.

8. The polynucleotide of Claim 2 wherein said polynucleotide encodes a Ck.beta.-10 polypeptide encoded by the cDNA of ATCC Deposit No. 75849.

9. The polynucleotide of Claim 1 having the coding sequence of Ck.beta.-4 as shown in Figure 1.

10. The polynucleotide of Claim 1 having the coding sequence of Ck.beta.-10 as shown in Figure 2.

11. The polynucleotide of Claim 2 having the coding sequence of Ck.beta.-4 deposited as ATCC Deposit No. 75848.

12. The polynucleotide of Claim 2 having the coding sequence of Ck.beta.-10 deposited as ATCC Deposit No. 75849.

13. A vector containing the DNA of Claim 2.

14. A host cell genetically engineered with the vector of Claim 13.

15. A process for producing a polypeptide comprising:
expressing from the host cell of Claim 14 the polypeptide encoded by said DNA.

16. A process for producing cells capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 13.

17. An isolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having Ck.beta.-4 activity.

18. An isolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having Ck.beta.-10 activity.

19. A polypeptide selected from the group consisting of (i) a Ck.beta.-4 polypeptide having the deduced amino acid sequence of Figure 1 and fragments, analogs and derivatives thereof (ii) a Ck.beta.-4 polypeptide encoded by the cDNA of ATCC Deposit No. 75848 and fragments, analogs and derivatives of said polypeptide (iii) an Ck.beta.-10 polypeptide having the deduced amino acid sequence of Figure 2 and fragments, analogs and derivatives thereof; and (iv) an Ck.beta.-10 polypeptide encoded by the cDNA of ATCC Deposit No.
75849 and fragments, analogs and derivatives of said polypeptide.

20. The polypeptide of Claim 19 wherein the polypeptide is Ck.beta.-4 having the deduced amino acid sequence of Figure 1.

21. The polypeptide of Claim 19 wherein the polypeptide is Ck.beta.-10 having the deduced amino acid sequence of Figure 2.

22. Antibodies against the polypeptides of claim 19.

23. Antagonists against the polypeptides of claim 19.

24. A method for the treatment of a patient having need of Ck.beta.-4 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 19.

25. A method for the treatment of a patient having need to inhibit Ck.beta.-4 comprising: administering to the patient a therapeutically effective amount of the antagonist of Claim 23.

26. A method for the treatment of a patient having need of Ck.beta.-10 comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 19.

27. A method for the treatment of a patient having need to inhibit Ck.beta.-10 comprising: administering to the patient a therapeutically effective amount of the antagonist of Claim 23.

28. A pharmaceutical composition comprising any one of the polypeptides of Claim 19 and a pharmaceutically acceptable carrier.

29. The method of Claim 24 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

30. The method of Claim 26 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.