AU735692B2 - Foetal cell analysis - Google Patents

Description

-1- FOETAL CELL ANALYSIS The present invention relates to methods of foetal cell analysis as well as to kits for use in such methods.

It is often desirable to pre-natally analyse foetal cells to detect chromosome aneuploides, disorders or conditions in the foetus. It is also desirable for any undesirable aneuploides, disorders or conditions to be detected as early as possible in the development of the foetus, so that if desired and appropriate the pregnancy can be terminated. Conventional techniques such as elective chorionic villus sampling (CVS) involve removing tissue such as trophoblast tissue directly from the foetus. The principle disadvantage of such techniques is that they can result in foetal loss.

What is required, therefore, is a method which is essentially non-invasive and which does not carry any appreciable risk of foetal loss. Summary of the Invention We have now found that reliable analysis of foetal cells can be carried out by isolating at least two types of foetal cells from a sample of maternal blood. By suitably labelling o: foetal cells they can easily and simply be isolated and can then be used in conventional analyses.

Accordingly, the present invention provides a method of analysing foetal cells, the method comprising isolating two or more types of nucleated foetal cell from a maternal sample.

In particular, in a first aspect of the present invention there is provided a method of analysing foetal cells, the method comprising isolating nucleated foetal erythrocytes and trophoblasts from a maternal sample.

In a second aspect of the present invention there is provided an agent for binding and/or labelling and/or signalling for use in a method of the invention.

21172-OO.DOC/ACW -la- In a third aspect of the present invention there is provided the use of Mab 340, or an active derivative thereof, in a method of isolating at least two types of nucleated foetal cell.

In a fourth aspect of the present invention there is provided the use of an EGFr binding agent in a method of isolating foetal trophoblasts.

In a fifth aspect of the present invention there is provided a kit for use in the method of the invention which comprises at least one trophoblast binding agent optionally in association with a labelling agent and/or a signalling agent.

In a related aspect, there is provided a method for analysing foetal cells which comprises: a) obtaining a maternal sample; 15 b) contacting the sample from a) with a trophoblast binding agent; c) contacting the sample with an erythrocyte binding agent; and d) carrying out one or more biochemical and/or genetic analysis steps on the cells isolated in b) and c).

The cells are preferably isolated from the peripheral 21172-00.DOC/ACW WO 97/30354 PCT/GB97/00443 2 maternal blood, and desirably the different cell types are isolated from the same maternal sample.

Preferably maternal blood is sampled from a pregnant human at between eight and sixteen weeks gestation, and desirably at ten weeks.

Preferably foetal trophoblast cells are isolated prior to isolation of nucleated erythrocytes. The trophoblasts may be isolated by contacting the maternal blood with a trophoblast binding agent prior to subsequent labelling, identification and/or removal. For example, the binding agent may comprise an antibody such as a monoclonal, polyclonal or genetically engineered antibody or active derivatives of any of these. Alternatively other suitable ligands could be used.

Preferably the binding agent binds to the the 170kD epidermal growth factor receptor (EGFr) antigen or to its 150kD cleavage product. In one particularly preferred embodiment the binding agent is the monoclonal antibody Mab 340 (Durrant et al, Prenatal Diagnosis, 14:131-140 (1994)) or an EGFr binding derivative thereof.

The Mab 340 antigen has been deposited with the European Collection of Cell Cultures, CAMR (Centre for Applied Microbiology Research) (ECACC) under provisional accession no. 97021428.

Thus, the present invention also provides antibodies to the EGFr for use in binding cells and or cellular fragments or clusters from samples of peripheral blood or other tissue specimens for application in prenatal diagnosis. Preferred is the antibody Mab 340 described WO 97/30354 PCT/GB97/00443 3 herein and functional equivalents to Mab 340. It will be obvious to those skilled in the art that any antibody, or functional equivalents thereof, with binding specificity to EGFr will be efficacious in this application. The antibodies may be complete immunoglobulin molecules, but they may be Ig fragments for example monovalent or divalent Ig entities such as Fab fragments, single chain Fv's etc. Preferred antibodies are those recognising epitopes to the extracellular domain of the EGFr such as Mab 340. It will be obvious to those skilled in the art that antibodies with binding specificity to other domains of the EGFr normally present either within the cellular membrane or present on the cytoplasmic face of the membrane may be embodied in this invention.

Also included in the present invention are peptide or other synthetic mimetic molecules able to bind the EGFr and likewise function to facilitate enrichment and or purification of EGFr bearing cells, cellular fragments or clusters for the purpose of prenatal diagnostic screening.

As described above, Mab 340 is a particularly advantageous binding agent for use in the methods of the invention. We have now sequenced the variable regions, of both the heavy and light chains, of the antibody and so the invention also includes methods wherein the the EGFR binding derivative of Mab 340 comprises at least the CDR regions of one or other of the light or heavy chain variable regions of Mab 340. In particular the EGFR binding derivative of Mab 340 will further comprise one or more of the framework regions of one or other of the light or heavy chain variable regions of Mab 340.

WO 97/30354 PCT/GB97/00443 4 In addition, the skilled person will appreciate that this sequence information can be used to construct moieties which mimic Mab 340, eg peptides or proteins which although not having the full sequence of Mab 340, nevertheless include the CDRs and optionally the framework regions of the variable portions of Mab 340.

In another embodiment an affinity medium, eg a solid medium to which the EGFr binding agent will bind can be used. For example the medium may comprise paramagnetic beads or a magnetic colloid such as 51(Cr)-sodium chromate labelled MG63 cells. Thus, for example, paramagnetic beads can be coated with Mab 340 which will in turn bind to trophoblast cells in the sample. The cells can then be isolated using a magnet. Alternatively, the beads themselves can be labelled with an agent which binds to an EGFr binding agent, for example where the EGFr binding agent is an antibody the beads may be labelled with rabbit anti-mouse antiserum. In this example, therefore, the anti EGFr antibody will bind to trophoblasts and then the beads bind to the antibody and once again a magnet can then be used to isolate the cells.

The magnetic colloid concentration may be in the order of 1/80 and lgg/ml antibody. Preferably the magnetic colloids are pre-labelled with agent prior to introduction to the blood sample. Preferably the colloid/sample mixture is incubated at approximately room temperature for about thirty minutes.

Also included in the present invention is the combined use of two or more EGFr binding agents, eg antibodies or derivatives thereof capable of binding the EGFr.

WO 97/30354 PCT/GB97/00443 Combined use may be simultaneous use of two or more binding agents to different epitope clusters or serial application of successive binding agents to different epitope clusters. Binding agents may include combinations of monoclonal antibodies preferably mAb 340, or derivatives thereof in use with any other currently existing or future monoclonal antibody with a different binding specifity on the EGFr surface to mAb 340.

Combinations of binding agents may include antibody or antibody derivatives in combination with other antibody or antibody derivatives. Combinations of binding agents may include antibody or antibody derivatives in combined use with non-antibody molecules which may be synthetic ligands with functionalised domains, or non-covalently attached functional groups. Combinations of binding agents may consist of entirely of non-antibody molecules capable of binding EGFr.

The erythrocytes may be isolated using erythrocyte labelling agents, such as antibodies which selectively bind foetal erythrocytes. One example of such an antibody is CD71 antibody. The labelled erythrocytes may then be separated by passing the blood through a medium to which the label is directly or indirectly attracted, for example to reversibly bind therewith. Preferably the label comprises anti-transferrin antibody, desirably a monoclonal antibody. The medium may comprise paramagnetic beads coated with an antibody attractant, such as rabbit anti-mouse antiserum.

Alternatively or additionaly the label may comprise ferromagnetic particles coated with an anti-transferrin antibody, desirably monoclonal, and the medium may comprise a MACS column.

WO 97/30354 PCT/GB97/00443 6 Foetal erythrocytes may be subjected to an initial separation by passing the blood sample down a density gradient, such as a triple gradient.

The methods of the present invention may further comprise biochemical and/or genetic analysis -of isolated foetal cells, principally for the detection of chromosome aneuploides, conditions or disorders.

In one embodiment one or more genetic sequences of the foetal cells are amplified for example using the polymerase chain reaction (PCR) or other suitable amplification techniques, to facilitate analysis.

A

specific sequence on the Y chromosome may be amplified when analysing the sex of a foetus. Preferably fluoresence in situ PCR of mRNA for foetal haemoglobin in foetal erythrocytes and/or human chorionic gonadotrophin (HCG) in trophoblasts may be used.

Preferably a hybridisation techique is used to detect the foetal sequence(s), for example a technique preferably comprising fluoresence in situ hybridisation

(FISH).

The present invention further provides an agent for binding and/or labelling for use in the methods of the present invention.

The agent may be an antibody, such as a monoclonal, polyclonal or genetically engineered antibody or an active derivative of any of these. Alternatively, the agent can be a ligand or chemical which can associate and preferably bind to the surface of foetal cells. In a preferred emvodiment the agent will bind to the the 170kD epidermal growth factor receptor (EGFr) antigen or to its -7- 150kD cleavage product. As already discussed herein Mab 340 is a particularly advantageous agent and thus an agent comprising Mab 340 or an active derivative thereof (for example a derivative which comprises at least the CDRs of the variable regions of the light or heavy chains of Mab 340) is particularly preferred.

In addition, the binding/labelling reagent may comprise a foetal erythrocyte binding agent.

In a related aspect there is provided a primer for use in the amplification of a target nucleotide sequence of a foetal cell.

The primer may be hybridisable for amplification of some or all of the sequence coding S. for foetal haemoglobin. A further primer may be hybridisable for amplification of some or all of a sequence coding for human chorionic gonadotrophin.

S. In a further related aspect there is provided a pair of primers for use in the amplification of a target nucleotide sequence of a foetal cell.

Unless the context clearly requires otherwise, throughout the description and the claims, the words 'comprise', 'comprising', and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of "including, but not limited to".

Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of common general knowledge in the field.

Description of the Invention The present invention provides a method for the enrichment of a minority population of cells in the peripheral circulation and their subsequent analysis at the molecular genetic level. In the preferred embodiment this invention is to be used for the capture and Sanalysis of circulating foetal cells for the purpose of prenatal diagnosis of disease and 21172-GO.Do/ACW 7apreferably using Mab 340. It is disclosed that Mab 340 most likely recognises and binds an epitope in the extracellular domain of the EGFr. One further embodiment therefore may be the use of this technology in the enrichment and subsequent analysis of a minority population of malignant cells such as squamous carcinoma cells or any tumour cell expressing the EGFr on its surface.

,IIn-nnrT/A CW -8- The EGFr is a transmembrane glycoprotein of I 7OkD with tyrosine kinase activity. The latter is activated following ligand binding leading to autophosphorylation of the receptor and ultimately stimulation of cell *0O@ 0 9@O@ 000s 0 0@SS

S.

S

05055

S

5 0 B. 0 S. St S S. @0 06 0

S

55 S S S

'SOS

esSeSS 5 0 21 172-OO.DOC WO 97/30354 PCT/GB97/00443 9 proliferation. Over-expression of the EGFr has been reported in a number of human malignancies including cancer of the breast, brain, bladder, head and neck, pancreas and lung. Histological and biological study of several human tumour biopsies and cell lines has shown that overexpression of this receptor is often accompanied by the production of one or more of the known ligands for the receptor namely TGFa and/or EGF. Such observations have lead to the suggestion that an autocrine loop may be responsible for the growth of tumours of this type.

The invention will now be described with reference to the following examples, which should not be construed as limiting the invention.

The examples refer to the figures, in which: FIGURE 1: shows silver stained SDS-PAGE analysis of 340 antigen purifications from.

immunoaffinity chromatography; FIGURE 2: shows a saturation curve and scatchard plot of radioligand binding assays showing that I125 EGF binds to 719T cells; and FIGURE 3: shows the results of a competitive binding assay of EGF and Mab 340 with I125 EGF to 719T cells.

EXAMPLE 1 Trophoblast cells were isolated from the whole blood of women in the first generally one third of the pregnancy using a specific monoclonal antibody, 340 (Durrant et al, supra) incubated with the blood sample and passed through WO 97/30354 PCT/GB97/00443 a separating medium comprising paramagnetic beads coated with rabbit anti-mouse antiserum. Nucleated red blood cells were isolated by separating whole blood on a triple density gradient and staining with either ferromagnetic particles coated with an anti-transferrin monoclonal antibody and separated on a mini MACS column or staining with an anti-transferrin monoclonal antibody and paramagnetic beads coated with rabbit anti-mouse antiserum.

The two isolated cell types were sexed using a nested PCR for a specific sequence on the Y chromosome (found in males only) and the sex confirmed by displaying the metaphase chromosomes (karyotyping) of chorionic villus samples.

Foetal cells were isolated from nineteen patients between ten to fourteen weeks into pregnancy who were undergoing elective chorionic-villus sampling for the detection of foetal aneuploides. Elective chorionic villus sampling is the conventional method of obtaining trophoblast tissue for analysis of human foetal DNA. The chorion is biopsied either by transcervical or transabdominal routes. The principal disadvantage of this known technique, which the present invention obviates, is that direct biopsys can cause foetal loss.

When both trophoblasts and nucleated erythrocytes were isolated foetal sex was correctly predicted in 92% of patients, which included correct diagnosis of five out of six male pregnancies. One pregnancy was diagnosed on both trophoblasts and nucleated erythrocytes, two were only detected with trophoblasts and two on nucleated erythrocytes alone. No false positives (male signal from WO 97/30354 PCT/GB97/00443 11 a female pregnancy) were determined with either trophoblasts or nucleated erythrocytes even with the highly sensitive nested PCR technique which is very prone to contamination. These results show that it is possible to isolate both trophoblasts and nucleated red blood cells from the same sample of maternal blood, and that the technique of isolating and analysing both provides for significantly increased sensitivity for pre-natal determination of foetal aneuploides, conditions and disorders.

In a second study, forty six peripheral blood samples were taken following elective chorionic villus sampling.

Table 1 shows the results obtained, which whilst showing some reduction in sensitivity and specificity relative to the intial study, still confirm the conclusion that isolating two foetal cell types from maternal blood in accordance with the present invention results in high sensitivity in the detection of foetal aneuploides, conditions or disorders.

WO 97/30354 PCT/GB97/00443 12 TABLE 1: Comparison of the sensitivity and specificity of sorting different foetal cell types from maternal blood FOETAL CELLS CORRECT

CORRECT

SORTED DIAGNOSIS OF A DIAGNOSIS OF MALE PREGNANCY FEMALE PREGNANCY (SENSITIVITY)

(SPECIFICITY)

NO. NO. TROPHOBLASTS 9/24 38 18/21 86 NUCLEATED RED 7/18 39 11/13 BLOOD CELLS TROPHOBLASTS AND NUCLEATED RED 10/18 56 10/12 83 BLOOD CELLS The sens'itivity in determining a male pregnancy in the second study with nucleated erythrocytes alone was 38% and with trophoblasts was 39%, whereas isolating and anaylsing for both correctly predicted a male pregnancy in ten out of eighteen cases or a sensitivity of 56%.

The specificity (83-86%) determined by the number of false positives i.e. incorrect diagnosis for male pregnancy was very similar whichever foetal cell was selected. Of the ten male pregnancies which were correctly diagnosed three were diagnosed on nucleated erythrocytes alone, three were diagnosed only on trophoblasts and four were positive on both cell types.

The concentration of foetal cells in maternal blood is particularly low. As few as 20 foetal cells per 20ml of maternal blood may be present, although this number appears to increase due to placenta malformation in Down's pregnancies.

WO 97/30354 PCT/GB97/00443 13 Isolated foetal cells are outnumbered by a thousand fold excess of maternal cells which makes identification of the cells with fluorescent in situ hybridisation analysis very difficult to interpret. Identification of the foetal cells by fluorescence in situ polymerase chain reaction (PCR) of mRNA for foetal haemoglobin in erythrocytes and human chorionic gonadotrophin (HCG) in trophoblasts allows more accurate fluorescent in situ hybridisation analysis (FISH).

In an alternative technique, in an attempt to further improve sensitivity and to try and isolate cells which would be amenable to detection of chromosome aneuploides, disorder and conditions by fluorescent in situ hybridisation staining, magnetic colloids are used to isolate the cells. Initial studies were performed with 51(Cr)-sodium chromate labelled MG63 cells which express high levels of the 340 trophoblast antigen. Optimal isolation and analysis was obtained with a ferrofluid concentration of 1/80 and lg/ml 340 monoclonal antibody.

Optimal incubation was at room temperature for thirty minutes and pre-labelling the ferrofluid with the antibody proved the most efficient labelling protocol.

Using these parameters 74-80% of MG63 cells were isolated and analysed from blood.

Furthermore fluorescent in situ hybridisation was successfully performed on cells isolated using magnetic colloids. Isolation using magnetic colloids can be followed by PCR and FISH for foetal sex determination.

It is to be appreciated that the isolation and analysis of at least two foetal cell types can be used in the analysis of the cell types for any chromosome WO 97/30354 PCT/GB97/00443 14 aneuploides, disorder, condition or other characteristic.

For example, the cells can be analysed for disorders such as Down's syndrome.

EXAMPLE 2-Sequencing of 340 antibody 5x10 6 hybridoma 340 cells were pelleted and mRNA isolated using TRIzol T reagent according to the manufacturers instructions (Life Technologies, Inc. Paisley Scotland).

DNA/RNA hybrid was formed using Ready-To-Go TM T-primed First-Stand kit (Pharmacia, Sweden). PCR was carried out using primer sets specific for the mouse heavy and light chain variable regions (Jones, S. T. and Bending, M., Bio/Technology, 9:88 (1991)). The PCR products were cloned into pCRII (Invitrogen, Netherlands) and six individual clones sequenced from both directions using the Applied Biosystems automated sequencer model 373A.

The VH and VL sequences are shown below; single amino acid codes are used and the CDRs are underlined. The sequences have been compared with the Kabat database of proteins of immunological interest to identify the variable region gene families used and to establish their uniqueness.

To support the sequence data the antibody chains were separated by reducing SDS-PAGE, western blotted onto PVDF paper according to protocols provided with the Applied Biosystems protein sequencer model 473A, and 10 cycles of sequence analysis were carried out on each chain.

Protein sequencing data have been corroborated by DNA sequence analysis as below.

WO 97/30354 PCT/GB97/00443 P-rotOih Segiidnce. of: rigibld R64ibji: bf:140 monoclo L-ntibody:, ::::::-Fiiinew6rk-A::.

EVQLVE.SGGGLVKAGGSLKUCAASGFA-FD:,:T.Y.DMS::.:.WV:RQTPEKRLF-WV.A'...-

I CDR-2::: F I YIGSG'G:::-.DRTYYPD'TVKG::.RFIISR.DNd MYL Q L-N Z T P A I I C D R 3 i= .4 HY.GHYVDYAV-D.Y:': W(-3QGTSVT I I Ptb

C

I 'DTVL.TQ A RA SV RASLAVSL-GQR- SK STSGYS.YM.H.:::W..N I LVS-NLES:::OV-P G GSGT-EP,.TLNIHPVEEED'A.A-.T-.Y..YC::::Q I Fra=work*4 :FGGGTK-LEIK:: I I I WO 97/30354 WO 9730354PCT/GB97/00443 16 DNA Senuence of Heavy Chain Variable Reion of 340 monoclonal antibody

GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAGGCTGGAGGGTCCCTGA

AACTCTCCTGTGCAGCCTCTGGATTCGCTTTCGATACCTATGACATGTCTTGGGT

TCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCATACATTGGTAGTGGTGGT

GATAGAACCTACTATCCAGACACTGTGAAGGGCCGATTCACCATTTCCAGAGACA

ATGGCAAGAACACCCTGTATTTGCAATTGAJACAGTCTGAGTCTGAGGACACAGC

CATGTATTACTGTGCAAGACATTATGGTCACTACGTGGACTATGCTGTGGACTAC

TGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA

DNA Sequence of Light Chain Variable Region of 340 monoclonal antibody

GACATTGTGCTGACACAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGG

CCACCATCTCATACAGGGCCAGCAAAAGTGTCAGTACATCTGGCTATAGTTATAT

GCACTGGAACCAACAGAAACCAGGACAGCCACCCAGACTCCTCATCTATCTTGTA

TCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAG

AGTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATGCTGCAJACCTATTACTG

TCGAATGGGTACCTCGGGGACACGAAAA

Exmpnle 3 Identification of the antigen recognised by 340 antibody Method for-protein sequence analysis of 340 antigten: 30-40g of placenta was washed in PBS containing phenyl methyl suiphonyl, chopped finely, homogenized, lysed in 1% NP-40 lysis buffer and centrifuged at l0,OO0xg for l0mins. The supernatant was collected and loaded onto a CNBr-activated mAb 340 sepharose column (2mg mAb/mi gel) Eluted fractions were assessed for 340 antigen content by SDS-PAGE and protein assay. Fig 1 shows a sample of a concentrated concntrtedimmuno-affinity-purified34anie 340 antigen WO 97/30354 PCT/GB97/00443 17 preparation separated by SDS-PAGE and silver stained. The molecular weight of the proteins are 170 and 150 KDa Following SDS-PAGE of the immunoprecipitated protein, the gel was western blotted onto PVDF (ProBlot Applied Biosystems) according to the protocols supplied with the blotting membrane. The blot was stained with coomassie blue and destained with 10%(v/v)Methanol Acetic acid.

The bands were excised from the blot and protein sequenced obtained using an Applied Biosystems protein sequencer model 473A.

Result of protein sequence analysis of 340 antigen: The N-terminal amino acid sequence was LEEKKVCQG. This peptide shares identity with the mature N-terminal sequence of epidermal growth factor receptor (EGFr). A competition binding assay using iodinated EGFr ligand (EGF) and mAb 340 was established to corroborate the finding from the peptide sequence analysis.

Method for I-125 EGF binding assay: Cells were harvested with Trypsin/EDTA and washed twice in RPMI 1640 medium before being resuspended at 5 x 5 /ml. 1001 of cell suspension were mixed with 100 pl of I125 EGF (Amersham; 100 ICi/gg, 50 gCi/ml) at different concentrations and incubated at 37°C for 1 hour. Cells and bound EGF were separated by centrifugation and washed 2 times in ice-cold Phosphate buffered saline (PBS) containing 0.1% bovine serum albumin (BSA). Nonspecific binding was measured by adding 100-fold excess of cold EGF.

Method for I-125 EGF binding mAb340 inhibition assay: x 104 cells per tube were mixed with increasing WO 97/30354 PCT/GB97/00443 18 concentrations of EGF and mAb 340 respectively at 4 0 C for min. Then 20 pg of I-125 EGF (2.2x10 5 cpm/ng) were added to each tube and incubated at 4°C for a further hours. Other steps were as previously described.

Results of binding assays: Radioligand binding assays show that 1125 EGF can bind to the 791T cells. A saturation curve was obtained and a non-linear scatchard plot reflects the presence of populations of receptors with varying affinities for EGF (Fig 2).

Data are consistent with an estimated EGFr density on 791T cells of 20,000 binding sites per cell.

Data from the inhibition experiments is consistent with an interpretation that the 340 mAb is a competitive inhibitor of EGF binding to EGFr (Fig 3).

The EGF receptor from A431 cells was first purified in 1980 by the use of affinity chromatography The purified receptor had an apparent molecular mass of 150 KDa; however, subsequent purification methods that eliminated calcium from the buffers indicated the actual mass to be 170 KDa. Most cell homogenates contain a calcium-activated protease that cleaves the native molecule of 170 KDa to the lower molecular mass of 150 KDa. I-125 EGF binding assays have shown there are two sub-populations of EGFr with different affinities.

The experimental results presented herein are consistent with the conclusion that the 340 antigen is the EGFr and the mAb 340 is a competitive inhibitor of EGF to the receptor.

WO 97/30354 PCT/GB97/00443 19 Example 4 Foetal cell sorting with internal antigens Method for Foetal cell sorting with internal antigens: Ferrofluid was diluted before use (typically 1/40 1/80). Cells were fixed in 1% paraformaldehyde for minutes and then permeabilised in 70% Ethanol for minutes. Ferrofluid was labelled with antibody (anti- HbF, anti-G6PDH) for 30 minutes at room temperature prior to Incubating with the fixed and permeabilised cells for 5 mins at 37 C and 55 mins at room temperature. Labelled cells were sorted on an Immunicon magnet for 5 minutes prior to washing.

Method for combined Immunocytochemistry/FISH: Immunicon ferrofluid was diluted 1/40-1/80 and labelled with biotinylated antibody for 30 mins at room temperature. The cells to be sorted were added for a further 30 mins and then sorted on an Immunicon magnet.

Sorted cells were fixed in Acetone (neat) or Paraformaldehyde for 10 minutes and dropped onto microscope slides and air dried. The slides were incubated with 20% normal rabbit serum in Tris Buffered Saline (TBS) for 30 mins prior to washing x2 in TBS for minutes. Bound antibody was detected using avidin/biotin peroxidase complex and DAB substrate.

Specific chromosomes were detected by the fluorescence in situ hybridisation (FISH) technique and commercially available fluorescence hybridisation probes and protocols provided by the manufacturer.

Method for confirmation of trophoblasts Foetal trophoblasts sorted by the methods above were subjected toa PCR analysis for the presence of DNA encoding HCG. Primers used were as follows; WO 97/30354 PCT/GB97/00443 5' hCG 5' CTG GCT GTG GAG AAG 3'; 3' hCG 3' AGT CGG GAT GGG CTT 3' hCG 3' GAG TGC ACA TTG ACA G Thermal cycling conditions using primers and (2) comprised a hot start at 80°C for 5 -minutes followed by addition of Taq polymerase and 30 cycles of 94°C for 1 minute, 55 C for 1 minute and 72°C for 1 minute. This gave a 230bp product which was further amplified using primers and and conditions as above to give a 230bp product indicative of the presence of HCG DNA from foetal trophoblasts.

Example 5: Optimal sorting for trophoblasts and nucleated red blood cells Mononuclear cells were isolated on percol from whole blood of women in the first one third of pregnancy.

Trophoblasts were isolated using biotinylated monoclonal antibody 340 which is coated onto ferrofluid and incubated with the mononuclear cells. Labelled cells are sorted on a magnet, washed and dropped onto slides.

Unsorted mononuclear cells are fixed and permeablised in 1% paraformaldehyde 70% ethanol. Nuclear red blood cells are isolated using a biotinylated specific monoclonal antibody (anti-HbF, anti-G6PDH) which is coated onto ferrofluid. Labelled cells are sorted on a magnet, washed and dropped onto slides. Isolated foetal cells are then stained by immunohistochemistry/

FISH.

Method of cell sorting on an internal antigen using a foetal cell surrogate: These experiments have been performed using a foetal cell WO 97/30354 PCT/GB97/00443 21 surrogate, in this case tumour cell line COLO 205 and sorting using cytokeratin 18 (C18) as the internal antigen.

COLO 205 cells were harvested and counted with viability assessed by tryphan blue exclusion. 5x10 6 cells were labelled with 2 MBqs of tritiated thymidine 3

H)

(Amersham, UK) and incubated at 37°C for at least 6 hours (usually overnight). Cells were harvested and washed twice in RPMI medium (Life Technologies, Paisley Scotland). Cells were recounted and viability assessed by tryphan blue exclusion. Cells (105) were collected by centrifugation and fixed by resuspension in iml 1% (w/v) paraformaldehyde and incubation at 4°C for 20 minutes.

Following fixation, cells were collected by centrifugation and permeabilised by resuspension in iml of 70% ethanol and a further 20 minute incubation at 4°C.

Cells were collected by centrifugation and resuspended in 500gl RPMI.

Ferrofluid (immunocon corp, Huntingdon Valley, PA, USA) was diluted as required (usually 1/80) and labelled with anti-cytokeratin 18 antibody (C18, Sigma, Poole, Dorset) for 30 minutes at room temperature in a volume of 50041.

The antibody concentrations were varied as part of the validation experiments, from 1/50 and 1/200. The ferrofluid/antibody mixture was added to the fixed cells, mixed by gentle shaking, and incubated at 37°C for minutes followed by incubation for a further 55 minutes at room temperature. Cells were sorted using the Immunocon sorting system and pipetted into lumaplates (Canbarra Packard) for 'H counting using a scintillation counter.

WO 97130354 WO 9730354PCT/GB97/00443 22 Results of cell sortinct on an internal antigen using a foetal cell surrocgate (Table 2'j: All experiments were performed in triplicate. Data shown for experiments using C18 antibody at 1/100 dilution and ferrofluid at 1/80. Data for control cells (C18 negative) revealed <10% sorting efficiency (not shown).

TABLE 2 SAMPLE COUNTS COUNTS COUNTS MEAN (cpM 3 H) (cpu 3 H) (cpu 3 H) COUNTS Expt. 1 Expt. 2 Expt. 3

FERROFLUID/

0 Ab/CELLS 17710 21586 22520 20605 WASH 15262 13144 12118 13508

SORTED

SAMPLE 80572 94400 97022 90665

TOTAL

COUNTS 113544 129494 131660 124768 -or tin efficienc.~±1y= 73% sorted cell counts/total counts=

Claims (34)

1. A method of analysing foetal cells, the method comprising isolating nucleated foetal erythrocytes and trophoblasts from a maternal sample.

2. A method as claimed in claim 1 wherein the nucleated foetal erythrocytes and trophoblasts are isolated from peripheral maternal blood.

3. A method as claimed in claim 1 and 2 wherein the nucleated foetal erythrocytes and trophoblasts are isolated from the same sample.

4. A method as claimed in any one of claims 1 to 3 wherein the sample is taken from a human female at between eight to sixteen weeks gestation, preferably at ten weeks.

5. A method as claimed in any one of claims 1 to 4 wherein foetal trophoblasts are isolated prior to isolation of nucleated foetal erythrocytes.

6. A method as claimed in any one of claims 1 to 5 wherein the trophoblasts are isolated by contacting the maternal sample with a trophoblast binding agent. 10 20 o 20 oo *o

7. A method a claimed in claim 6 wherein the trophoblast binding agent comprises an antibody.

8. A method as claimed in claim 7 wherein the antibody is a monoclonal, polyclonal or genetically engineered antibody or an active derivative of any of these.

9. A method as claimed in any one of claims 6 to 8 wherein the agent binds to the 170kD epidermal growth factor receptor (EGFR) antigen or to its 150kD cleavage product.

10. A method as claimed in claim 9 wherein the agent is the monoclonal antibody Mab 340 or an EGFr binding derivative thereof.

11. A method as claimed in claim 10 wherein the EGFr binding derivative of Mab 340 comprises at least the CDR regions of one or other of the light or heavy 10 chain variable regions of Mab 340.

12. A method as claimed in any one of claims 6 to 11 wherein the binding agent is itself associated with a labelling agent. 15

13. A method as claimed in claim 12 wherein the labelling agent is solid phase and/or is magnetic.

14. A method as claimed in claim 13 wherein the labelling agent is paramagnetic beads or a magnetic colloid.

S A method as claimed in any one of claims 6 to 14 wherein the binding agent itself is labelled or capable of being labelled or is associated with a signalling agent.

16. A method as claimed in claim 15 wherein the binding agent is biotinylated and can be then labelled with an avidin/biotin peroxidase complex and DAB.

17. A method as claimed in any one of claims 1 to 16 wherein the erythrocytes are O\ isolated using one or more erythrocytes binding agents.

18. A method as claimed in claim 17 wherein at least one of the one or more binding agents is an antibody which binds to foetal erythrocytes.

19. A method as claimed in claim 17 or claim 18 wherein the foetal erythrocytes are subjected to an initial separation by passing the blood sample down a density gradient, eg. a triple gradient.

A method as claimed in any one of claims 1 to 19 which further comprises one or more biochemical and/or genetic analysis steps of the isolated foetal cells.

21. A method as claimed in claim 20 wherein the method comprises the step of analysing the sex of the foetus.

22. An agent for binding and/or labelling and/or signalling for use in a method as 15 defined in any one of claims 1 to 21.

23. An agent as claimed in claim 22 modified by any one or more of the features of claims 6 to 17 or 18. 20

24. The use of Mab 340, or an active derivative thereof, in a method of isolating at least two types of nucleated foetal cell.

The use as claimed in claim 24 modified by any one or more of the features of any one or more of claims 12 to 17.

26. The use of an EGFr binding agent in a method of isolating foetal trophoblasts.

27. A kit for use in a method as claimed in any one of claims 1 to 21 which Scomprises at least one trophoblast binding agent optionally in association with 3 a labelling agent and/or a signalling agent. -26-

28. A kit as claimed in claim 27 wherein the trophoblast binding agent is Mab 340 or an active derivative thereof.

29. A kit as claimed in claim 27 or claim 28 which further comprises an erythrocyte binding agent, such as an antibody.

A method of analysing foetal cells comprising isolating nucleated foetal erythrocytes and trophoblasts from peripheral maternal blood, substantially as herein described with reference to any one of the examples but excluding comparative examples.

31. An agent for binding and/or labelling and/or signalling when used in a method of analysing foetal cells comprising isolating nucleated foetal erythrocytes and trophoblasts from peripheral maternal blood, substantially as herein described with 15 reference to any one of the examples but excluding comparative examples.

32. The use of Mab 340 or an active derivative thereof in a method of isolating at least two types of foetal cell, substantially as herein described with reference to any one of the examples but excluding comparative examples.

33. The use of an EGFr binding agent in a method of isolating foetal trophoblasts,, substantially as herein described with reference to any one of the examples but excluding comparative examples.

34. A kit when used in a method of analysing foetal cells, comprising isolating nucleated foetal erythrocytes and trophoblasts from peripheral maternal blood, substantially as herein described with reference to any one of the examples but excluding comparative examples. DATED this 4th day of April 2001 UNIVERSITY OF NOTTINGHAM 6, Attorney: DAVID A. ADAMTHWAITE SFellow Institute of Patent and Trade Mark Attorneys of Australia 3S, of BALDWIN SHELSTON WATERS

21172-OO.DOC/W