AU710559B2 - The use of a bmp protein receptor complex for screening bone metabolism actives and cells co-transfected with a type II bmp receptor and a type I bmp receptor - Google Patents
The use of a bmp protein receptor complex for screening bone metabolism actives and cells co-transfected with a type II bmp receptor and a type I bmp receptor Download PDFInfo
- Publication number
- AU710559B2 AU710559B2 AU39713/95A AU3971395A AU710559B2 AU 710559 B2 AU710559 B2 AU 710559B2 AU 39713/95 A AU39713/95 A AU 39713/95A AU 3971395 A AU3971395 A AU 3971395A AU 710559 B2 AU710559 B2 AU 710559B2
- Authority
- AU
- Australia
- Prior art keywords
- leu
- ser
- thr
- brk
- bmp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5041—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Toxicology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to a method for determining whether a compound is capable of binding to a BMP receptor kinase protein complex, the method comprising introducing a sample comprising the compound to the BMP receptor kinase protein complex and allowing the compound to bind to the BMP receptor kinase protein complex, wherein the BMP receptor kinase protein complex is comprised of a BMP type I receptor kinase protein and the BMP receptor kinase protein BRK-3. The invention further relates to a method for determining the concentration of a BMP receptor ligand in a clinical sample, the met-hod comprising introducing the sample comprising the ligand to a BMP receptor kinase protein complex and allowing the ligand to bind to the BMP receptor kinase protein complex, wherein the BMP receptor kinase protein complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3. The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for the BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I receptor kinase protein. The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for a soluble or incomplete BMP type I receptor kinase protein and a soluble or incomplete BMP receptor kinsase protein BRK-3. The invention further relates to a method for determining whether a test compound produces a signal upon binding to a BMP receptor protein complex.
Description
WO 96/14579 PCTIUS95/14027 1 THE USE OF A BMP PROTEIN RECEPTOR COMPLEX FOR SCREENING BONE METABOLISM ACTIVES AND CELLS CO-TRANSFECTED WITH A TYPE II BMP RECEPTOR AND A TYPE I BMP RECEPTOR TECHNICAL FIELD The present invention relates to the field of bone formation and development.
Specifically, the present invention relates to the use of a new bone morphogenetic protein type II receptor, together with a bone morphogenetic type I receptor, for screening bone metabolism actives. The invention further relates to cells co-transfected with DNA coding for this receptor and DNA coding for a type I bone morphogenetic protein receptor.
BACKGROUND
Humans and other warm-blooded animals can be afflicted by a number of bonerelated disorders. Such disorders range from bone fractures, to debilitating diseases such as osteoporosis. While in healthy individuals bone growth generally proceeds normally and fractures heal without the need for pharmacological intervention, in certain instances bones may become weakened or may fail to heal properly. For example, healing may proceed slowly in the elderly and in patients undergoing treatment with corticosteroids transplant patients). Osteoporosis is a condition in which bone hard tissue is lost disproportionately to the development of new hard tissue. Osteoporosis can generally be defined as the reduction in the quantity of bone, or the atrophy of skeletal tissue; marrow and bone spaces become larger, fibrous binding decreases, and compact bone becomes fragile. Another bone related disorder is osteoarthritis, which is a disorder of the movable joints characterized by deterioration and abrasion of articular cartilage, as well as by formation of new bone at the joint surface.
While a variety of treatments are available for such bone-related disorders, none of the treatments provide optimum results. One of the difficulties facing individuals who treat bone-related disorders is a lack of complete understanding of bone metabolism and of the bone-related disorders. A key to such understanding is identifying and characterizing each of the components involved in bone growth. Bone morphogenetic proteins (BMPs) have been demonstrated to play a role in bone formation and development M. Wozney, Molec. Reproduct. and Develop., 32: 160-167 (1992)).
Furthermore, the role of BMPs may not be limited to their role in bone. The finding that the BMPs are found at significant concentrations in other tissues such as brain, kidney, stratified squamous epithelia, and hair follicle Wall, M. Blessing, C.V.E.
Wright, and B.L.M. Hogan, J. Cell Biol., 120: 493-502 (1993); E. Ozkaynak, P.N.J.
WO 96/14579 PCT/US95/14027 2 Schnegelsberg, D.F. Jin, G.M. Clifford, F.D. Warren, E.A. Drier, and H. Oppermann, J.
Biol. Chem., 267: 25220-25227 (1992); K.M. Lyons, C.M. Jones, and B.L.M. Hogan, Trends in Genetics, 7: 408-412 (1991); V. Drozdoff, N.A. Wall, and W.J. Pledger, Proceedings of the National. Academy of Sciences, 91: 5528-5532 (1994)) suggests that they may play additional roles in development and differentiation. In support of this, BMPs have recently been found to promote nerve cell differentiation and to affect hair follicle formation Basler, T. Edlund, T.M. Jessell, and T. Yamada, Cell, 73: 687- 702 (1993); V.M. Paralkar, B.S. Weeks, Y.M. Yu, H.K. Kleinman, and A.H. Reddi, J.
CellBiol., 119: 1721-1728 (1992); M. Blessing, L.B. Nanney, L.E. King, C.M. Jones, and B.L. Hogan, Genes Dev., 7: 204-215 (1993)).
A BMP initiates its biological effect on cells by binding to a specific BMP receptor .expressed on the plasma membrane of a BMP-responsive cell. A receptor is a protein, usually spanning the cell membrane, which binds to a ligand from outside the cell, and as a result of that binding sends a signal to the inside of the cell which alters cellular function.
In this case, the ligand is the protein BMP, and the signal induces the cellular differentiation.
Because of the ability ofa BMP receptor to specifically bind BMPs, purified BMP receptor compositions are useful in diagnostic assays for BMPs, as well as in raising antibodies to the BMP receptor for use in diagnosis and therapy. In addition, purified BMP receptor compositions may be used directly in therapy to bind or scavenge BMPs, thereby providing a means for regulating the activities of BMPs in bone and other tissues.
In order to study the structural and biological characteristics of BMP receptors and the role played by BMPs in the responses of various cell populations to BMPs during tissue growth/formation stimulation, or to use a BMP receptor effectively in therapy, diagnosis, or assay, purified compositions of BMP receptor are needed. Such compositions, however, are obtainable in practical yields only by cloning and expressing genes encoding the receptors using recombinant DNA technology. Efforts to purify BMP receptors for use in biochemical analysis or to clone and express mammalian genes encoding BMP receptors have been impeded by lack of a suitable source of receptor protein or mRNA.
Prior to the present invention, few cell lines were known to express high levels of high affinity BMP receptors which precluded purification of the receptor for protein sequencing or construction of genetic libraries for direct expression cloning. Availability of the BMP receptor sequence will make it possible to generate cell lines with high levels of recombinant BMP receptor for biochemical analysis and use in screening experiments.
The BMPs are members of the TGF-P superfamily. Other members of the TGF-p superfamily include TGF-P, activins, inhibins, Millerian Inhibiting Substance, and the Growth and Differentiation Factors (GDFs). As expected, the receptors for various WO 96/14579 PCT/US95/14027 3 members of the TGF-3 superfamily share similar structural features. Receptors of the TGF-P ligand superfamily are typically classified into one of two sub-groups, designated as type I and type II. The type I and type II receptors are classified as such based on amino acid sequence characteristics. Both the type I and type II receptors possess a relatively small extracellular ligand binding domain, a transmembrane region, and an intracellular protein kinase domain that is predicted to have serine/threonine kinase activity (Lin and Moustakas, Cellular and Molecular Biology, 40: 337-349 (1994); L.S.
Mathews, Endocrine Reviews, 15: 310-325 (1994); L. Attisano, J.L. Wrana, F. L6pez- Casillas, and J. Massague, Biochimica et Biophysica Acta, 1222: 71-80 (1994)).
The type I receptors cloned to date belong to a distinct family whose kinase domains are highly related and share 85% sequence similarity Koenig et al., Molecular and Cellular Biology, 14: 5961-5974 (1994)). The intracellular juxtamembrane region of the type I receptors is characterized by an SGSGSG motif 35-40 amino acids from the transmembrane region, and the carboxy terminus of these receptors is extremely short Koenig et al., Molecular and Cellular Biology, 14: 5961-5974 (1994); L. Attisano, J.L. Wrana, F. Lopez-Casillas, and J. Massague, Biochimica et Biophysica Acta, 1222: 71-80 (1994)). The extracellular domain of the type I receptors contains a characteristic cluster of cysteine residues, termed the "cysteine box", located within 25-30 amino acids of the transmembrane region, and another cluster of cysteine residues, termed the "upstream cysteine box", located after the putative signal sequence B. Koenig, et al., Molecular and Cellular Biology, 14: 5961-5974 (1994); L.
Attisano, et al., Biochimica et Biophysica Acta, 1222: 71-80 (1994)).
In contrast to the type I receptors, the kinase domains of the type II receptors are only distantly related to one another. The SGSGSG motif found in type I receptors is not found in type II receptors. Also, the "upstream cysteine box" of type I receptors is not present in type II receptors. Furthermore, while all of the activin type II receptors contain a proline-rich sequence motif in the intracellular juxtamembrane region, there is no characteristic sequence motif that is common to all type II receptors Mathews, Endocrine Reviews, 15: 310-325 (1994)). The length of the carboxy terminus of the type II receptors is considerably variable, with the longest known carboxy terminus being found in the BMP type II receptor, DAF-4 Estevez, L. Attisano, J.L. Wrana, P.S. Albert, J.
Massague, and D.L. Riddle, Nature, 365: 644-49 (1993)), that was cloned from the nematode C. elegans. The extracellular domain of the type II receptors contains a single cysteine box located near the transmembrane region. Aside from the presence of the cysteine box, there is little sequence similarity amongst the extracellular domains of the type II receptors for TGF-P, activin, and BMPs.
Signaling by members of the TGF-p ligand superfamily requires the presence of WO 9&/14579 PCTIMS9&n4o- 4 both type I and type 11 receptors on the surface of the same cell Mathews.
Endocrine Reviews. 1S: 310-325 (1994); L. Attisano. J.L. Wrana. F. Ltpez-Caalas. and I. Massagui. Riochiewica et Biophysca AMt 1111: 71-80 (1994)). The SBips are members of the TGF-3 ligand superfamily,. given the high degree of structural siniaritv among these family members. it is expected that their receptors will be structuralv and Ojnctionally related to the TGF-3 and activin receptors. It is anticipated that. like the TGF-3 and activin receptor system Massagui. L. Attisano. and J.L. Wana, Trends it Cell BlolpVj' 4: 172-178 (1994)). both a BNT type I receptor and a S13P type 11 receptor will be needed in order to transduce a BMP signal within a cell or tissue. Hence. there is a need for a mammalian type 11 SBiP receptor kinase protein in addition to the type I receptors that have already been cloned.
Three distinct manmmalian type L~ receptors have been reported for the BM[Ps Bone Morphogenetic Protein Receptor Kinase-1 (herein referred to as "B RK-1") (see U.S.S.N. 08/158,735 filed November 24, 1993 by J.S. Cook, et al. (published family equivalent AU application No. 12594/95); and B.B. Koenig et al, Molecular and Cellular Biology 14: 5961-5974 (1994)), ALK-2, and ALK-6, BRK-1 is the mouse homologue of ALK-3, which has also been demonstrated to bind BMP-4 as does ALK- ALK-2 binds BMP-7 (see P. ten Dijke, H, Yamashita, T.K. Sampath, A.H. Reddi, M.
~:Estevez, D.L. Riddle, H. Ichijo, C-H Heldin, and K. Miyazono, J. Biological Chemistry, 269: 16985-16988 (1994)). It is also postulated that ALK-6 is the mouse homologue of the chicken receptor Bone Morphogenetic Protein Receptor Kinase-2 (herein :referred to as "BRK-2") (also referred to as RPK-1) Sumitomo T. Saito, and T.
Nohno, DNA Sequence 3: 297-302 (1993)). The rat homologue of BRK-1 has also been cloned, as BMPR-Ia Takeda, S. Qida, H. Ichijo, T. limura, Y. Marnoka, T.
Amagasa and S. Sasaki, Biochemical and Biophysical Research Communications, 204: 203-209 (1994)).
In co-pending application U.S.S.N. 08/334,179 filed November 4, 1994 by :Rosenbaum and Nohno (published family equivalent AU application No. 41392196) a novel mammalian BMP type HI receptor (referred to as "BRKis descuibed and claimed. Prior to the cloning of the BRK-3 receptor, the only type II receptor for BMP-2 and BM[P4. named DAF-4, was cloned from the nematode C clegrzns Estevez, L. Attisano, J.L. Wiuna. P.S. Albert, J. Massaguc. and D.L. Riddle.
Nature, 365: 644-9 (1993)). Because of the large evolutionary distance between the nemnatode and mammals, it has not been possible to use the DAF-4 cDNA as a probe with which to cln the mamnmalian DAF-4 homologue. This implies that the DNA sequence of the mammalian type 11 receptor for BMVPs is substantially divergent from that of DAF-4.
and it was therefore necessary to cln a mammalian type 11 receptor for the BM~s.
The BMP receptor kinase protein BRX-3 of the co-pending application provides a mammalian type 11 receptor which enables the formation of a complex with a BMP type I
A
receptor. This complex. which is described in detail below, is capable of binding BMPs with high affinity, and is therefore useful for identifying compounds having BMP receptor affinity. The complex of the present invention will also enable the formation of a high affinity complex that is competent for signaling a response to BMPs in concert with the mammalian type I receptor(s) for BMPs. The mammalian BMP receptor complex is therefore more relevant for the identification of novel compounds which interact with the BMP receptor. and which will be useful as therapeutic agents in humans and other mammals. than is a receptor complex that is composed of the nematode type II receptor and the mammalian type I receptor.
OBJECTS OF THE PRESENT INVENTION :O It is an object of the present invention to provide a method for identifying compounds capable of binding to a BMP receptor kinase protein complex.
It is also an object of the present invention to provide a method for determining the 15 amount of a compound capable of binding a BMP receptor kinase protein complex in a sample.
It is also an object of the present invention to provide a host cell comprising a recombinant expression vector encoding a BMP type II receptor kinase protein and a recombinant expression vector encoding a BMP type I receptor kinase protein comprising 20 said BMP receptor kinase protein complex.
It is also an object of the present invention to provide a method for determining whether a test compound produces a signal upon binding to a BMP receptor protein complex.
I q -j v. 6 SUMMARY OF INVENTION The present invention relates to a method for determining whether a compound is capable of binding to a BMP receptor kinase protein complex, the method comprising introducing a sample comprising the compound to the complex and allowing the compound to bind to the complex, wherein the complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3, wherein the BMP receptor kinase protein BRK-3 has the amino acid sequence: SEQ ID NO:2 or soluble fragment thereof; SEQ ID NO:4 or soluble fragment thereof; or SEQ ID NO:8 or soluble fragment thereof.
The invention further relates to a method for determining the concentration of a BMP receptor ligand in a clinical sample, the method comprising: a. combining the clinical sample comprising the ligand with a BMP 15 receptor kinase protein complex and a labeled BMP; b. allowing the labeled BMP to bind to the complex in the presence of the sample; and c. comparing with a standard curve prepared with known concentration of a BMP ligand; 20 wherein the BMP receptor kinase protein complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3, wherein the BMP receptor kinase protein BRK-3 has the amino acid sequence: SEQ ID NO:2 or soluble fragment thereof; SEQ ID NO or soluble fragment thereof; or S 25 SEQ ID NO:4 or soluble fragment thereof; or SEQ ID NO:8 or soluble fragment thereof.
The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for the BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I receptor kinase protein.
The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for a soluble BMP type I receptor kinase protein and a soluble BMP receptor kinsase protein BRK-3.
The invention further relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for an incomplete BMP type I receptor kinase protein and an incomplete BMP receptor kinsase protein BRK-3.
d 6a The invention further relates to a method for determining whether a test compound produces a signal upon binding to a BMP receptor protein complex, the method characterized in that it comprises: labeling BMP receptor protein complex expressing cells with 32p, wherein the cells have been transfected with a DNA sequence coding for BMP receptor kinase protein BRK-3 and a DNA sequence coding for a BMP type I receptor kinase protein; culturing: a first set of the cells in the presence of the test compound, and (ii) a second set of the cells in the absence of the test compound; c) quantitating via autoradiography any phosphorylated proteins produced from step and comparing the amount of phosphorylated proteins quantitated in step from the first set of cells to the amount of phosphorylated proteins a S 15 quantitated in step for the second set of cells, S* wherein the BMP receptor kinase protein BRK-3 has the amino acid sequence: SEQ ID NO:2 or soluble fragment thereof; SEQ ID NO:4 or soluble fragment thereof; or SEQ ID NO:8 or soluble fragment thereof.
20 BRIEF DESCRIPTION OF THE DRAWINGS Figure shows the DNA sequence of the degenerate oligonucleotide primers used in the PCR amplification of t-BRK-3. The nucleotide bases adenine, thymine, cytosine.
and guanine are represented by A, T. C and G respectively. The letter N represents the presence of an equal mixture of A, T, C, and G at that site. The primers are derived from the sequence of the TGF-B type II receptor Lin. X.F. Wang.
E. Ng-Eaton, R.A. Weinberg, and H.F. Lodish, Cell. 68: 775-785 (1992)).
Figure 2 shows the construct pJT4-hBRK3T, used for transient mammalian expression of t-BRK-3.' CMV, cytomegalovirus early promoter/enhancer; R. the 'R" element from the long terminal repeat of human T-cell leukemia virus-1; SP. an intron splice site from the SV40 virus; T3, promoter region from the T3 bacteriophage; T7, o 6b promoter region from the T7 bacteriophage; poly A. region from the SV40 virus directing polyadenylation of the message. SV40 OR!. origin of replication from the SV40 virus.
Amp. anipicillin resistance gene for selection in E. coli.
Figure 3 shows the construct pJT4-J I59F, used for transient mammalian expression of BRi(- 1. Abbreviations are the same as those in Figure 2.
Throughout the description and claims of the specification, the word "comprise" and grammatical variations of the word, such as "comprising" and "1comprises" is not intended to preclude the presence or addition of other additives, components, integers or steps.
S..6 WO 96/14579 PCT/US95/14027 7 Figure 4 shows the construct pJT3-BRK2, used for transient mammalian expression of BRK2. Abbreviations are the same as those in Figure 2.
Figure 5 shows the construct pJT4-Daf4, used for transient mammalian expression of the C. elegans receptor DAF-4. Abbreviations are the same as those in Figure 2.
Figure 6 shows whole cell binding of 12 5 I]-BMP-4 to t-BRK-3 expressed in COS-7 cells, in the presence or absence of the type I receptors BRK-1 and BRK2. Bars represent specific binding of 12 5 I]-BMP-4, normalized to cell number. Left to right, NIH3T3 embryonic fibroblasts; COS-7 cells; COS-7 cells transfected with the vector pJT- 4 alone (designated 'hnock'); COS-7 cells transfected with BRK-1 alone, BRK-1 plus or 20 pg of t-BRK-3, BRK-2 alone, BRK-2 plus 10 or 20 pg of t-BRK-3, and t-BRK-3 alone (20 ig).
Figure 7 shows crosslinking of [1 2 5 I]-BMP-4 to COS-1 cells transfected with t- BRK-3, in the presence or absence of the type I receptors BRK-1 and BRK-2. Molecular weight standards are shown on the left. Labels on the right indicate the bands which migrate at the predicted molecular weights of t-BRK-3, BRK-1, and BRK-2 crosslinked to 12 5 I]-BMP-4. Left to right, the lanes represent COS-1 cells transfected with BRK-1 alone; BRK-1 plus 2 pg/ml t-BRK-3; BRK-1 plus 4 pg/ml t-BRK-3; BRK-2 alone; BRK- 2 plus 2 pg/ml t-BRK-3; BRK-2 plus 4 Gg/ml t-BRK-3; t-BRK-3 alone at 2 pg/ml; and t- BRK alone at 4 pg/ml. Volume ofDNA mixture is 4 ml. In this figure, "BRK-3*" is t- BRK-3.
Figure 8 shows an immunoprecipitation of t-BRK-3 and the C. elegans type II receptor DAF-4 expressed in COS-1 cells and crosslinked to 12 5 1]-BMP-4 in the presence or absence of the type I receptors BRK-1 or BRK-2. Molecular weight standards are shown on the left; areas shown at the right indicate labeled protein bands migrating at the predicted molecular weight of DAF-4, t-BRK-3, BRK-1, or BRK-2 crosslinked to 12 5 I]-BMP-4. Antiserum 1379 was used for COS-1 cells transfected with BRK-1 in the presence or absence of type II receptors, and antiserum 1380 for COS-1 cells transfected with BRK-2 in the presence or absence of type II receptors. For all others, antiserum is listed in parentheses. Left to right, NIH3T3 embryonic fibroblasts (1379), followed by COS-1 cells transfected with BRK-1 alone; BRK-1 plus DAF-4; BRK-1 plus t-BRK-3; BRK-2 alone; BRK-2 plus DAF-4; BRK-2 plus t-BRK-3. This is followed by NIH3T3 cells (1380), followed by COS-1 cells transfected with DAF-4 alone (1379), and t-BRK-3 alone (1380). In this figure, "BRK-3*" is t-BRK-3.
Figure 9 shows an immunoprecipitation of COS-1 cells transfected with BRK-2 and t-BRK-3 and crosslinked to 12 5 I]-BMP-4 at a concentration of 210 pM, in the presence or absence of excess unlabeled competitors as indicated. Antiserum 1380 is used. Duplicate lanes at left show no unlabeled competitor added, followed by addition of WO 96/14579 PCT/US95/14027 8 (left to right) 10 nM BMP-4; 10 nM BMP-2; 10 nM DR-BRMP-2; and 50 nM TGF-3 1 In this figure, "BRK-3*" is t-BRK-3.
Figure 10 shows the construct pJT6-mBRK-3L, used for transient mammalian expression of mouse BRK-3. Abbreviations used are the same as those for Figure 2.
Figure 11 shows the construct pJT6-mBRK-3S, used for transient mammalian expression of mouse BRK-3. In this construct, most of the untranslated 3' region has been removed. Abbreviations used are the same as those for Figure 2.
Figure 12 shows whole cell binding of 12 5 I]-BMP-4 to mouse BRK-3 expressed in COS-1 cells, in the presence or absence of the type I receptor BRK-2. Bars represent specific binding of 12 5 I]-BMP-4, normalized to cell number. Constructs used for mouse BRK-3 are pJT6-mBRK-3L and pJT6-mBRK-3S; for BRK-2, the construct is pJT3-BRK- 2. Both constructs contain the complete coding region of mouse BRK-3. In pJT6mBRK-3S,an A-T rich region in the 3' untranslated region has been deleted. Left to right, COS-1 cells transfected with the vector pJT-6 alone (designated 'mnock'); pJT3- BRK-2 alone; the construct pJT6-mBRK-3S alone; pJT6-mBRK-3L alone; pJT3-BRK-2 plus pJT6-BRK-3S; and pJT3-BRK-2 plus pJT6-BRK-3L.
Figure 13 shows crosslinking of [1 2 5 I]-BMP-4 to m-BRK-3 in the presence and absence of type I BMP receptors. COS-1 cells are transfected with the cDNA for BRK-3 using the construct pJT6-mBRK-3S, and/or with cDNAs for BRK-1 (using pJT4-J159F) or BRK-2 (using pJT3-BRK-2). The cells are then allowed to bind [125I]- BMP-4, crosslinked with disuccinimidyl suberate, and subjected to SDS gel electrophoresis. Position of molecular weight standards is indicated on the left. Left to right: COS-1 cells transfected with BRK-1 alone; BRK-1 plus m-BRK-3; m-BRK-3 alone; BRK-2 plus m-BRK-3; BRK-2 alone; and vector alone. Bands identified with BRK-1, BRK-2, and BRK-3 are indicated on the right.
Figure 14 shows immunoprecipitation of m-BRK-3 in the presence and absence of type I BMP receptors. COS-1 cells are transfected with the cDNA for m-BRK-3 using the construct pJT6-mBRK-3S, and/or with cDNAs for BRK-1 (using pJT4-J159F) or BRK-2 (using pJT3-BRK-2). The cells are then allowed to bind 12 5 I]-BMP-4, crosslinked with disuccinimidyl suberate, immunoprecipitated with antibodies to BRK-1 or BRK-2, and subjected to SDS gel electrophoresis. Antisera used are indicated below the lanes: PI, preimmune; 1379, for cells transfected with cDNA for BRK-1; 1380, for cells transfected with cDNA for BRK-2. Position of molecular weight standards is indicated on the left. Left to right, COS-1 cells transfected with BRK-1 plus m-BRK-3 (preimmune serum); BRK-1 alone; BRK-1 plus m-BRK-3; BRK-2 plus m-BRK-3; BRK-2 alone; and BRK-2 plus m-BRK-3 (preimmune serum).
Figure 15 shows a map of the insert of pHSK1040. This construct contains the WO 96/14579 PCT/US95/14027 9 complete coding region of human BRK-3 in BLUESCRIPT II SK
DESCRIPTION
The present invention answers the need for a method for determining whether a compound has BMP receptor affinity. The method comprises introducing a sample comprising a test compound to a BMP receptor kinase protein complex and allowing the compound to bind to the BMP receptor kinase protein complex, wherein the receptor complex comprises a BMP type I receptor kinase protein and the BMP type II receptor kinase protein designated herein as "BRK-3". The invention also answers the need for a host cell that is co-transfected with an expression vector comprising a DNA sequence that codes for BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I receptor kinase protein. Also provided is a method for determining the concentration of a BMP receptor ligand in a clinical samnple, the method comprising introducing the sample comprising the ligand to a BMP receptor kinase protein complex and allowing the ligand to bind to the receptor complex, wherein the receptor complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3. The invention also answers the need for a host cell that is co-transfected with an expression vector comprising a DNA sequence that codes for a soluble BMP receptor kinase proten BRK-3 and an expression vector comprising a DNA sequence that codes for a soluble BMP type I receptor kinase protein. The invention also answers the need for a host cell that is co-transfected with an expression vector comprising a DNA sequence that codes for an incomplete BMP receptor kinase proten BRK-3 and an expression vector comprising a DNA sequence that codes for an incomplete BMP type I receptor kinase protein.
As used herein, "human BMP receptor kinase protein-3" or "h-BRK-3" means a protein having the amino acid sequence SEQ ID NO:2, as well as proteins having amino acid sequences substantially similar to SEQ ID NO:2, and which are biologically active in that they are capable of binding a BMP molecule (including, but not limited to BMP-2, DR-BMP-2, BMP-4, and/or BMP-7), or transducing a biological signal initiated by a BMP molecule binding to a cell, or crossreacting with antibodies raised against h-BRK-3 protein, or peptides derived from the protein sequence of h-BRK-3 or m-BRK-3 (see below), or forming a complex with a BMP type I receptor, or co-immunoprecipitating with a BMP type I receptor when antibodies specific for either h-BRK-3 or a BMP type I receptor are used.
As used herein, "truncated human BMP receptor kinase protein" or "t-BRK-3" means a protein having amino acid sequence SEQ ID NO:4, or a sequence having the properties described above for BRK-3.
WO 9&14579 WO 964579PT/tTS9S,14027, As used herein. "mouse BMP receptor kinase protein" or "rn-BPj-3" means a protein having amino acid sequence SEQ ID NO:8. or a sequence having the properties described above for BRK-3.
As used herein, "BMP receptor kinase protein BRK-3" or "BRK-3" refers individually and collectively to the receptor proteins h-BRK-3. t-BRK-3t. and m-BRK-3 (and soluble and incomplete fragments thereof). described above, as well as BMP receptor kinase proteins substantially similar to h-BRK-3. t-BRK-3. and m-BRK-3 (and soluble and incomplete fragments thereof). Such receptor proteins, DNA sequences coding for the proteins, and recombinant expression vectors comprising said DNA are described and claimed in U.S.S.N 08/334, 179 filed on November 4, 1994 (published family equivalent AU Application No. 41392/96) by Rosenbaum and Nahno.
As used herein, a "BMP Type I Receptor Kinase" is a protein capable of binding BMP-2, BMP-4 and/or other known BMPs, and bears sequence characteristics of a type I receptor including, but not limited to, an extracellular ligand binding domain containing a cysteine box and an upstream cysteine box. an SGSGSG motif, designated the GS domain.
in the intracellular juxtamembrane region. an intracellular kinase domain that is greater *than about 85% similar to other type I receptors for other ligands in the TGF-3 superfamily, and/or a relatively short carboxy terminus. As used herein. "BN{ Type I Receptor Kinase" also includes receptor proteins having the characteristics of a BMP type I receptor as described in the literature, such as in: B.B. Koenig et al.. Molecular and .ellular Biology. 14: 5961-5974 (1994): L. Attisano. et al.. Biochimica el Biophysica Acia. 1222: 7 1-80 (1994); J. Massagui, L. Attisano, and J. L. Wrana, Trends in Cell Biology. 4: 172-178 (1994): and ten Dijke. et al., J. Biological Chemisrry. 269: 16985- 16988 (1994).
9. Examples of BMP type I receptors include, but are not limited to: BRK- I (B.B.
Koenig et al., Molecular and Cellular Biology. 14: 5961-5974 (1994). the rat homologue of w-hich is BMPR-Ia Takeda, S. Qida. H. Ichijo, T. limura, Y. Maruoka, T. Anagasa.
9 and S. Sasaki, Biochem. Biophys. Res. Communica., 204: 203-209 (1994)); BRK-2. also refred to as RPK-1I Sumitomo. T. Saito, and T. Nohno, DNA Sequence. 3: 297-302 (1993), and postulated to be the chicken homologue of A.LK-6 ten Dijke. H.
Yamnashita. H. Ichijo. P. Franzi, M. Laiho, K. Miyazono. and Heldin, Science.
264: 101-104 (1994)); ALK-2. which has been shown to be a receptor for BMP-7 (ten Dijke ct al.. J. Biological Chemisriy. 269: 16985-16988 the Xcnopus BMP type I receptor that binds BMP-2 and BMP4 and which is involved in mesoderm induction PJ.M. Graff, R.S. Thies. J.J. Song. AIJ Celeste. and D.A. Melton, Cell, 79: 169-179 and type I receptors from Drosophila that bind the decapentapliegic peptide.
which is the Drosophila homologue of BMP-2 and BN'P-4. These Drosophila receptors are designated 25DI. 25D2. and 43E Xie. A.L. Finelli. and R.W. Padgett, Science.
IN
WO 96/14579 PCTIUS95/14027 11 263: 1756-1759 (1994); A. Penton, Y. Chen, K. Staehling-Hampton, J. L. Wrana, L. Attisano, J. Szidonya, J. A. Cassill, J. Massague, and F.M. Hoffmann, Cell, 78: 239-250 (1994); and T. J. Brummel, V. Twombly, G. Marques, J. L. Wrana, S.
J. Newfeld, L. Attisano, J. Massague, M. B. O'Connor, and W. M. Gelbart, Cell, 78: 251- 261 (1994)). Preferred BMP type I receptors useful in the present invention include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:12 (BRK-1), SEQ ID NO: 16 (soluble BRK-1); SEQ ID NO:20 (incomplete BRK-1); SEQ ID NO:14 (BRK-2); SEQ ID NO:18 (soluble BRK-2); and SEQ ID NO:22 (incomplete BRK-2).
As used herein, "soluble fragment" refers to an amino acid sequence corresponding to the extracellular region of BRK-1, BRK-2, or BRK-3 which is capable of binding BMPs. Soluble fragments include truncated proteins wherein regions of the receptor molecule not required for BMP binding have been deleted. Examples of such sqluble fragments for BRK-3 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:6; SEQ ID NO:10; amino acid residues 1- 150 depicted in SEQ ID NO:2; amino acid residues 1-150 depicted in SEQ ID NO:8; or polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO:5; SEQ ID NO:9; nucleic acid residues 409-858 depicted in SEQ ID NO:1, or nucleic acid residues 17-466 depicted in SEQ ID NO:7.
Examples of soluble fragments for BRK-1 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:16; amino acid residues 1-152 in SEQ ID NO:12; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO:15; or polypeptides encoded by nucleic acid residues substantially similar to 11-466 in SEQ ID NO: 11.
Examples of soluble fragments for BRK-2 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:18; amino acid residues 1-126 in SEQ ID NO:14; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO: 17; or polypeptides encoded by nucleic acid residues substantially similar to 355-732 in SEQ ID NO:13.
As used herein, "incomplete receptor kinase fragment" refers to an amino acid sequence corresponding to the extracellular, transmembrane, and intracellular juxtamembrane region of BRK-1, BRK-2, or BRK-3 which is capable of binding BMPs in a manner similar to the full-length receptor, but which is incapable of signalling due to deletion of the intracelular kinase domain. Examples of such incomplete receptor fragments for BRK-3 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO: 24; SEQ ID NO:26; amino acids 1-200 in SEQ ID NO:2; amino acids 1-200 in SEQ ID NO:8; polypeptides encoded by WO 96/14579 PCT/US95/14027 12 nucleic acid residues substantially similar to SEQ ID NO: 23; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO: 25; polypeptides encoded by nucleic acid residues substantially similar to 409-1008 in SEQ ID NO: 1; or polypeptides encoded by nucleic acid residues substantially similar to 17-616 in SEQ ID NO:7.
Examples of incomplete receptor fragments for BRK-1 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID amino acid residues 1-231 in SEQ ID NO:12; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO: 19; or polypeptides encoded by nucleic acid residues substantially similar to 11-703 in SEQ ID NO: 11.
Examples of incomplete receptor fragments for BRK-2 include, but are not limited to, polypeptides having the amino acid sequences substantially similar to SEQ ID NO:22; amino acid residues 1-201 in SEQ ID NO:14; polypeptides encoded by nucleic acid residues substantially similar to SEQ ID NO: 21; or polypeptides encoded by nucleic acid residues substantially similar to 355-957 in SEQ ID NO: 13.
'As used herein, a "BMP receptor kinase protein complex" is the combination of a BMP type I receptor and BMP receptor kinase protein BRK-3. The combination of the type I and BRK-3 receptors includes, but is not limited to, a combination of the type I and BRK-3 receptors in solution as soluble fragments); a combination of the receptors as soluble fragments) attached to a solid support; or a combination of the receptors as full-length or incomplete fragments) within a cell membrane oftransfected cells.
As used herein, "digit-removed BMP-2" and "DR-BMP-2" refer to a fragment of BMP-2 protein wherein the amino terminus of mature BMP-2 has been removed by mild trypsin digestion Koenig et al., Molecular and Cellular Biology, 14: 5961-5974 (1994)).
As used herein, "isolated", in reference to the receptor protein of the present invention or DNA sequences encoding said protein, means that the protein or DNA sequence is removed from the complex cellular milieu in which it naturally occurs, and said protein is expressible from said DNA sequence in a cell that does not naturally express it when operably linked to the appropriate regulatory sequences.
As used herein, "substantially similar" when used to define either amino acid or nucleic acid sequences, means that a particular subject sequence, for example, a sequence altered by mutagenesis, varies from a reference sequence by one or more substitutions, deletions, or additions, the net effect of which is to retain biological activity of the BRK-3 protein. Alternatively, nucleic acid sequences and analogs are "substantially similar" to the specific DNA sequence disclosed herein if the DNA sequences, as a result of degeneracy in the genetic code, encode an amino acid sequence substantially similar to the reference amino acid sequence. In addition, "substantially similar" means a receptor protein that will WO 96/14579 PCT/US95/14027 13 react with antibodies generated against the BRK-3 protein or peptides derived from the protein sequence of BRK-3.
As used herein, "biologically active" means that a particular molecule shares sufficient amino acid sequence similarity with the embodiments of the present invention disclosed herein to be capable of binding detectable quantities of BMP-2 or BMP-4, or transmitting a BMP-2 or BMP-4 stimulus to a cell, for example, as a component of a hybrid receptor construct. Preferably, a biologically active BRK-3 receptor complex within the scope of the present invention means the receptor protein kinase complex is capable of binding 12 5 1]-BMP-4 with nanomolar or subnanomolar affinity (Kd approximately equal to 10-9M). Preferably, the affinity is from about lx10-12M to 1x10-9M, with a proportion of binding sites exhibiting a Kd less than 10-12M.
As used herein, "operably linked" refers to a condition in which portions of a linear DNA sequence are capable of influencing the activity of other portions of the same linear DNA sequence. For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor which participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked means contiguous and, in the case of secretory leaders, contiguous in reading frame.
As used herein, "ATCC" means American Type Culture Collection, Rockville, Maryland.
As used herein, "bone morphogenetic protein 2" or "BMP-2" means a peptide encoded by a DNA sequence contained in ATCC No. 40345 (see ATCC/NIHT REPOSITORY CATALOGUE OF HUMAN AND MOUSE DNA PROBES AND LIBRARIES, sixth Edition, 1992, p. 57, hereinafter "ATCC/NIH REPOSITORY CATALOGUE"). Isolation of BMP-2 is disclosed in U.S. Patent No. 5,013,649, Wang, Wozney and Rosen, issued May 7, 1991; U.S. Patent No. 5,166,058, Wang, Wozney and Rosen, issued November 24, 1992; and U.S. Patent No. 5,168,050, Hammonds and Mason, issued December 1, 1992; each of which is incorporated herein by reference.
As used herein, "bone morphogenetic protein 4" or "BMP-4" means a peptide encoded by a DNA sequence contained in ATCC No. 40342 (see ATCC/NIH REPOSITORY CATALOGUE). Isolation of BMP-4 is disclosed in U.S. Patent No. 5,013,649, Wang, Wozney and Rosen, issued May 7, 1991, incorporated herein by reference.
As used herein, "bone morphogenetic protein 7" or "BMP-7" means a peptide encoded by a DNA sequence contained in ATCC No. 68020 and ATT 68182 (see ATCC/NIH Repository Catalogue), where the cDNA in ATCC 68182 is claimed to contain all of the nucleotide sequences necessary to encode BMP-7 proteins. Isolation of WO 96/14579 PCT/US95/14027 14 BMP-7 is disclosed in U.S. Patent 5,141,905, issued August 25, 1992, to Rosen, et al., which is incorporated herein by reference.
As used herein, "DNA sequence" refers to a DNA polymer, in the form of a separate fragment or as a component of a larger DNA construct, which has been derived from DNA isolated at least once in substantially pure form, free of contaminating endogenous materials and in a quantity or concentration enabling identification, manipulation, and recovery of the sequence and its component nucleotide sequences by standard biochemical methods, for example, using a cloning vector. Such sequences are preferably provided in the form of an open reading frame uninterrupted by internal nontranslated sequences (introns) which are typically present in eukaryotic genes.
Genomic DNA containing the relevant sequences could also be used. Sequences of nontranslated DNA may be present 5' or 3' from the open reading frame, where the same do not interfere with manipulation or expression of the coding regions. DNA sequences encoding the proteins provided by this invention can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic gene which is capable of being expressed in a recombinant transcriptional unit.
As used herein, "recombinant" means that a protein is derived from a DNA sequence which has been manipulated in vitro and introduced into a host organism.
As used herein, "microbial" refers to recombinant proteins made in bacterial, fungal yeast), or insect expression systems.
As used herein, "recombinant expression vector" refers to a DNA construct used to express DNA which encodes a desired protein (for example, BRK-3) and which includes a transcriptional subunit comprising an assembly of 1) genetic elements having a regulatory role in gene expression, for example, promoters and enhancers, 2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and 3) appropriate transcription and translation initiation and termination sequences. Using methodology well known in the art, recombinant expression vectors of the present invention can be constructed. Possible vectors for use in the present invention include, but are not limited to: for mammalian cells, pJT4 (discussed further below), pcDNA-1 (Invitrogen, San Diego, Ca) and pSV-SPORT 1 (Gibco-BRL, Gaithersburg, MD); for insect cells, pBlueBac III or pBlueBacHis baculovirus vectors (Invitrogen, San Diego, CA); and for bacterial cells, pET-3 (Novagen, Madison, WI). The DNA sequence coding for a BRK-3 protein receptor kinase of the present invention can be present in the vector operably linked to regulatory elements.
The present invention relates to a host cell co-transfected with an expression vector comprising a DNA sequence that codes for BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I WO 96/14579 PCT/US95/14027 receptor kinase protein. In one embodiment, the expression vector for the BRK-3 protein comprises a DNA sequence coding for the h-BRK-3 receptor protein, or a soluble or incomplete fragment thereof (The DNA can be genomic or cDNA.) Preferably the h- BRK-3 protein is coded for by the nucleic acid sequence SEQ ID NO: 1; the soluble fragment thereof is preferably coded for by the nucleic acid sequence SEQ ID NO: 5, the incomplete receptor fragment is preferably coded for by nucleic acid SEQ ID NO:23. In another embodiment, the expression vector for the BRK-3 protein comprises a DNA sequence coding for the t-BRK-3 protein. (The DNA sequence can be genomic DNA or cDNA.) Preferably the DNA sequence is SEQ ID NO:3. In another embodiment, the expression vector for the BRK-3 protein comprises a DNA sequence coding for the m- BRK-3 protein, or a soluble or incomplete fragment thereof. (The DNA sequence can be genomic DNA or cDNA.) Preferably the m-BRK-3 protein is coded for by the DNA sequence SEQ ID NO:7; the soluble fragment is preferably coded for by the PNA sequence SEQ ID NO:9; the incomplete fragment is preferably coded for by the DNA SEQ ID In a preferred embodiment of the present invention, the host cells of the present invention are co-transfected with the plasmid construct pJT6-mBRK-3L and the plasmid construct pJT4-J159F [BRK-1] or plasmid construct pJT3-BRK-2 [BRK-2], thereby resulting in co-expression of m-BRK-3 and BRK-1, or m-BRK-3 and BRK-2, respectively. In another preferred embodiment, the host cells of the present invention are co-transfected with the plasmid construct pJT6-mBRK-3S and the plasmid construct pJT4-J159F [BRK-1] or plasmid construct pJT3-BRK-2 [BRK-2], thereby resulting in coexpression of m-BRK-3 and BRK-1, or m-BRK-3 and BRK-2, respectively. In another preferred embodiment, mammalian host cells are co-transfected with the plasmid construct, pJT4-hBRK3T and the plasmid construct pJT6-J159F [BRK-1] or plasmid construct pJT3-BRK-2 [BRK-2], thereby resulting in co-expression of t-BRK-3 and BRK- 1, or t-BRK-3 and BRK-2, respectively. Transfection with the recombinant molecules can be effected using methods well known in the art.
As used herein, "host cell" means a cell comprising a recombinant expression vector described herein. Host cells may be stably transfected or transiently transfected within a recombinant expression plasmid or infected by a recombinant virus vector. The host cells include prokaryotic cells, such as Escherichia coli, fungal systems such as Saccharomyces cerevisiae, permanent cell lines derived from insects such as Sf-9 and Sf- 21, and permanent mammalian cell lines such as Chinese hamster ovary (CHO) and transformed African green monkey kidney cells (COS).
In one embodiment, the present invention relates to a method that is useful for identifying compounds capable of binding to a BMP receptor kinase protein. In another WO 96/14579 PCT/US95/14027 16 embodiment, the invention relates to a method that is useful for determining the concentration of a BMP receptor ligand BMP-2, BMP-4, or BMP-7, or another asyet identified BMP receptor ligand) in a clinical sample. In each of these methods, a sample comprising a putative ligand or a known ligand is introduced to a BMP receptor kinase protein complex, wherein the receptor complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3. Preferably, the BRK-3 receptor kinase protein is h-BRK-3, having an amino acid sequence SEQ ID NO:2, or the soluble fragment thereof having an amino acid sequence SEQ ID NO:6 or the incomplete fragment thereof having an amino acid sequence SEQ ID NO:24. Also preferred is the receptor protein m-BRK-3 having an amino acid sequence SEQ ID NO:8, or the soluble fragment thereof having an amino acid sequence SEQ ID NO:10 or the incomplete fragment thereof having an amino acid sequence SEQ ID NO:26. Also preferred is the receptor protein t-BRK-3 having an amino acid sequence SEQ ID NO:4.
For example, BMP concentration in a sample can be determined by radioreceptor assay, in which unlabeled BMP in the sample competes with labeled tracer BMP for binding to the BRK-3 receptor complex. As the amount of BMP in the sample increases, it reduces the amount of labeled BMP which is able to bind to the receptor protein complex comprising BRK-3 and the type I receptor. Comparison with a standard curve prepared with known concentrations of unlabeled BMP allows accurate quantitation of BMP concentration in the sample. Labeling of tracer BMP is preferably done by iodination with 12 5 1]Nal. BRK-3 can be expressed in the outer membrane of a stable cell line which also expresses the BMP type I receptor kinase, or supplied as a soluble fragment in solution with a soluble type I receptor fragment, or as a soluble fragment covalently attached to a solid support in conjunction with a type I receptor covalently attached to a solid support. To perform the assay, unlabeled BMP from the sample and labeled tracer BMP compete for binding to the receptor until equilibrium is reached. The receptor-BMP complex is then isolated from free ligand, for example by washing (in the case of an adherent cell line), rapid filtration or centrifugation (in the case of a nonadherent cell line or receptor bound to a solid support), or precipitation of the receptor-ligand complex with antibodies, polyethylene glycol, or other precipitating agent followed by filtration or centrifugation (in the case of a soluble receptor). The amount of labeled BMP in the complex is then quantitated, typically by gamma counting, and compared to known standards. These methods have been described in the literature using other receptors Williams, Med. Res. Rev., 11: 147-184 (1991); M. Higuchi and B.B.
Aggarwal, Anal. Biochem., 204: 53-58 (1992); M.J. Cain, R.K. Garlick and P.M.
Sweetman, J. Cardiovasc. Pharm., 17: S150-S151 (1991); each of which are incorporated herein by reference), and are readily adapted to the present BRK-3 receptor/BMP system.
WO 96/14579 PCT/US95/14027 17 Such a radioreceptor assay can be used for diagnostic purposes for quantitation of BMP in clinical samples, where such quantitation is necessary.
The methods of the present invention is also useful in high-throughput screens to identify compounds capable of binding to BRK-3, or a homologous receptor protein, that is complexed to a BMP type I receptor kinase protein. In such a method, the higher the affinity of the compound for the BRK-3/type I complex, the more efficiently it will compete with the tracer for binding to the complex, and the lower the counts in the receptor-ligand complex. In this case, one compares a series of compounds within the same concentration range to see which competed for receptor binding with the highest affinity.
This invention is useful for determining whether a ligand, such as a known or putative drug, is capable of binding to and/or activating the receptors encoded by the DNA molecules of the present invention. Transfection of said DNA sequence into the cell systems described herein provides an assay system for the ability of ligands to bind to and/or activate the receptor complex encoded by the isolated DNA molecules.
Recombinant cell lines, such as those described herein, are useful as living cell cultures for competitive binding assays between known or candidate drugs and ligands which bind to the receptor and which are labeled by radioactive, spectroscopic or other reagents.
Membrane preparations containing the receptor isolated from transfected cells are also useful for competitive binding assays. Soluble receptors derived from the ligand binding domain of the receptor can also be employed in high-throughput screening of drug candidates. Functional assays of intracellular signaling can act as assays for binding affinity and efficacy in the activation of receptor function. In addition, the recombinant cell lines may be modified to include a reporter gene operably linked to a response element such that a signal sent by the receptor turns on the reporter gene. Such a system is especially useful in high throughput screens directed at identification of receptor agonists.
These recombinant cell lines constitute "drug discovery systems", useful for the identification of natural or synthetic compounds with potential for drug development.
Such identified compounds could be further modified or used directly as therapeutic compounds to activate or inhibit the natural functions of the receptor encoded by the isolated DNA molecule.
The soluble receptor protein complex of the present invention can be administered in a clinical setting using methods such as by intraperitoneal, intramuscular, intravenous, or subcutaneous injection, implant or transdermal modes of administration, and the like.
Such administration can be expected to provide therapeutic alteration of the activity of the BMPs.
The nucleotide sequences disclosed herein, SEQ ID NO:3 and SEQ ID NO:1, WO 96/14579 PCT/US95/14027 18 represent the sequence of the DNA that codes for t-BRK-3 and h-BRK-3, respectively, isolated from human skin fibroblasts. SEQ ID NO:7 represents the DNA sequence coding for m-BRK-3 receptor protein from mouse NIH3T3 cells. These sequences could be readily used to obtain the cDNA for BRK-3 from other species, including, but not limited to, rat, rabbit, Drosophila, and Xenopus. These sequences could also readily be used to obtain the cDNA for other BMP type II receptors from mouse and other species listed above which are capable of binding BMPs in a complex with the type I receptors. These cDNA sequences can also be readily used to isolate the genomic DNA for BRK-3. This would permit analysis of the regulatory elements controlling receptor gene expression, which may offer new opportunities for therapeutic intervention and disease diagnosis. The nucleotide sequences are also useful to determine the distribution of the BRK-3 receptor in normal tissues and in disease states, which allows an assessment of its physiological role in vivo.
The present invention further relates to a method for determining whether a test compound produces a signal upon binding to a BMP receptor protein complex. Such a method comprises employing the BMP receptor protein complex in a protein phosphorylation assay. Protein phosphorylation assays are generally known in the art.
Hardie, "Protein Phosphorylation A Practical Approach", IRL Press: Oxford, New York, Tokyo, (1993), incorporated herein by reference, provides a general overview of phosphorylation assays. The method for determining whether a test compound produces a signal upon binding to the BMP receptor protien complex comprises labeling BMP receptor protein complex expressing cells with 3 2 p, wherein the cells have been transformed with a DNA sequence coding for BMP receptor kinase protein BRK-3 and a DNA sequence coding for a BMP type I receptor kinase protein; culturing a first set of the cells in the presence of the test compound, and (ii) a second set of the cells in the absence of the test compound; quantitating via autoradiography any phosphorylated proteins produced from step and comparing the amount of phosphorylated proteins quantitated in step from the first set of cells to the amount of phosphorylated proteins quantitated in step for the second set of cells.
For purposes of illustrating a preferred embodiment of the present invention, the following non-limiting examples are discussed in detail.
Example 1 Generation of PCR Fragments In order to generate a PCR fragment of type II receptors related to the TGF-B type II receptor, primers shown in Figure 1 are designed from the kinase domains of the TGF- type II receptor. For the first round of PCR, the primers are TSK-1, derived from kinase domain II, and TSK-2, derived from kinase domain VIII. The template DNA WO 96/14579 PCT/US95/14027 19 consists of cDNA prepared from mRNA isolated from human skin fibroblasts from a 9 month old male. The PCR reaction, carried out in a total volume of 50 pl, contains approximately 0.2 gg of this cDNA, primers TSK-1 and TSK-2 at a concentration of iM, stocks of all four deoxynucleotides at a concentration of 0.2 mM each, 1.5 unit of DNA polymerase from Thermus thermophilus (hereafter, Tth polymerase) (Toyobo, Osaka, Japan) and reaction buffer for the Tth polymerase (Toyobo, Osaka, Japan). After an initial melting period of 1 min at 94 0 C, the temperature cycle is carried out as follows for 35 cycles: melting, 92 0 C for 40 sec; annealing, 48°C for 40 sec; extension, 75 0 C for sec. After the 35th cycle, the reaction is held at 75°C for an additional 5 min to complete the extension.
Several bands are amplified, including some in the area of 470 base pairs (bp) corresponding to the predicted sequence length of a type II receptor homologous to the TGF-B type II receptor. Accordingly, fragments in this size range are recovered frQm an agarose gel using QIAEX (Qiagen, Chatsworth, CA; a kit for gel purification of DNA fragments, including activated silica spheres and buffers) according to the manufacturer's instructions, then resuspended in 10 mM Tris, pH 8.0, 1 mM EDTA (TE) in a volume of jl.
To reduce the background from fragments amplified from cDNAs not related to the TGF-8 type II receptor, a second round of PCR is carried out using 'hested" primers based on conserved regions of the TGF- type II receptor located within the 470 bp region amplified in the first round. The nested primers are AVR-5, derived from kinase domain IV of the TGF-1 type II receptor, and TSK-4, derived from kinase domain VIB (Figure The template consists of an aliquot (0.5 l) of the PCR fragments isolated from the first round of PCR. To this is added the primers AVR-5 (5 gM) and TSK-4 gM), all four deoxynucleotides (0.2 mM each), 1.5 units of Tth DNA polymerase, and reaction buffer for the Tth DNA polymerase, in a total volume of 50 pl. The temperature cycle program is executed exactly as described above for the first round of PCR. Agarose gel electrophoresis of the PCR reaction products shows amplification of a band in the range of 300 bp, as expected. This fragment is isolated using QIAEX.
In order to subclone the PCR product of the second PCR reaction, the purified fragment is phosphorylated using polynucleotide kinase and ligated to the cloning vector pGEM7Zf (Promega, Madison, WI) which has previously been cut with Sma I and dephosphorylated. The ligation mix is used to transform E. coli XL1-Blue (Stratagene, La Jolla, CA). When the transformation mix is plated on agar containing isopropyl-B-Dthiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl-B-D-galactoside (X-gal), colonies are obtained which lack blue color, indicating the presence of an insert. Plasmid DNA is prepared from a selection of these colonies. Three of the candidate plasmids, designated WO 96/14579 PCTUS95/14027 HSK7-1, HSK7-2, and HSK7-4 are found to have inserts of the expected size (300 bp).
Upon sequencing of the inserts, the 300 bp insert from HSK7-2 is found to encode a portion of a novel kinase that is predicted to be a novel member of the TGF-B receptor superfamily. Accordingly, the HSK7-2 PCR fragment is used as a probe to isolate the full-length receptor clone.
Example 2 Isolation of human t-BRK-3 cDNA In order to locate the cDNA corresponding to the 300 bp insert in HSK7-2, a cDNA library is constructed from the same mRNA used to isolate the PCR fragment.
This is accomplished using the SUPERSCRIPT Choice System (Life Technologies, Gaithersburg, MD; a kit for cDNA synthesis, including primers, adapters, SUPERSCRIPT II RNAse H- Reverse Transcriptase (Life Technologies, Gaithersburg MD; a modified form of reverse transcriptase from Moloney murine leukemia virus), enzymes, nucleotides, buffers, and gel filtration columns) according to the manufacturer's instructions, except that 180 units of RNase inhibitor (Takara, Kyoto, Japan) is added to the first strand synthesis. The template is mRNA (4 tg) from human skin fibroblasts from a 9 month old male. A total of 4 pg ofcDNA is obtained after first and second strand synthesis. This is followed by the addition of Eco RI adapters (supplied with the kit) which contain internal Not I and Sal I sites. The Eco RI-adapted cDNA is then phosphorylated and subjected to size fractionation according to the manufacturer's instructions, using gel filtration columns provided with the kit.
The size fractionated cDNA is ligated into the Eco RI site of the phage ,gt 10, and packaged in vitro with GIGAPACK II Gold Packaging Extract (Stratagene, La Jolla, CA; a restriction-minus in vitro packaging extract for high-efficiency construction of cDNA libraries in X phage) according to the manufacturer's instructions. A total of 8.1 x 105 phages are obtained.
The library is screened on ten HYBOND Nylon membranes (Amersham, Arlington Heights, IL; nylon membranes optimized for immobilization of nucleic acids), at a density of 1 x 105 plaques/filter. The insert from HSK7-2 is labeled with the MULTIPRIME
DNA
Labeling System (Amersham, Arlington Heights, IL; a kit for random primer labeling of DNA, including Klenow DNA polymerase, primers, and buffers) according to the manufacturer's instructions. The labeled probe is allowed to hybridize to the library filters in 50% formamide, 6X SSPE (lx SSPE 0.14 M NaCI, 8 mM sodium phosphate, 0.08 mM EDTA, pH 5X Denhardt's solution (IX Denhardt's 0.02% Ficoll type 400, 0.02% polyvinylpyrrolidone, 0.02% BSA), 0.5% sodium dodecyl sulfate (SDS), and 100 gg/ml denatured salmon sperm DNA at 42 0 C for 12 hr. The blot is then washed in 2X SSPE, 0.1% SDS three times at room temperature (15 minutes each), followed by a 1 hr WO 96/14579 PCT/US95/14027 21 wash at 42 0
C.
After three rounds of screening, 3 independent clones are obtained. One of the clones, designated HSK723, is found to encode the same sequence as the HSK7-2 insert.
Complete DNA sequence is obtained for this clone. The cDNA from this clone is designated t-BRK-3.
Example 3 t-BRK-3 Sequence Analysis The DNA sequence of this t- BRK-3 clone is shown in SEQ ID NO:3, and the deduced protein sequence of t-BRK-3 in SEQ ID NO:4. The t-BRK-3 open reading frame derived from clone HSK723 encodes a protein of at least 583 amino acids. No stop codon is observed to be located in-frame in the 3' region of the HSK723 cDNA, indicating that this clone is incomplete at the 3' end. It is thus designated t-BRK-3.
The deduced protein sequence of t-BRK-3 shown in SEQ ID NO:4 is searched against all translated protein sequences in GenBank Release 84.0, dated August 15, 1994, using a standard Needleman-Wunsch algorithm Needleman and C.D. Wunsch, J.
Mol. Biol. 48: 443-453 (1970)), and is found to represent a novel sequence.
Analysis of the predicted protein sequence reveals a predicted structure of a TGF- 0 type II superfamily member transmembrane serine/threonine kinase. The predicted single transmembrane region encompasses residues 151-172 in SEQ ID NO:4. Three potential N-linked glycosylation sites are located at amino acid residues 55, 110, and 126 in the predicted extracellular domain. Amino acids 116-123 in SEQ ID NO:4 contain the cluster ofcysteine residues called the "cysteine box" that is a characteristic of receptors for ligands of the TGF-0 superfamily. The cysteine box of t-BRK-3 is identical in 6 of 8 amino acid residues to the cysteine box of the DAF-4 type II receptor for BMP-2 and BMP-4. However, the overall sequence identity of t-BRK-3 to DAF-4 in the extracellular domain is only 7.1%.
Amino acids 200-504 (in SEQ ID NO: 4) in the predicted cytoplasmic region of t- BRK-3 contains all of the consensus sequences that characterize a protein kinase domain with predicted specificity for serine/threonine residues K. Hanks, A.M. Quinn, and T.
Hunter, Science, 241: 42-52 (1988)).
Example 4 Construction of expression vectors for t-BRK-3.
BRK-1, BRK-2, and DAF-4 In order to express t-BRK-3 in mammalian cells, it is subcloned into the vector pJT4, designed for transient expression. The pJT4 vector, optimized for transient expression in COS cells, includes the cytomegalovirus early promoter and enhancer, which gives very efficient transcription of message; an element from the long terminal repeat WO 96/14579 PCT/US95/14027 22 of the human T-cell leukemia virus-1, which has been shown to increase expression levels further; an intron splice site from SV40, which is believed to enhance message stability; a multiple cloning site; a polyadenylation signal derived from SV40, which directs the addition of a poly A tail to the message, as is required for most eukaryotic mRNA; and the SV40 origin of replication, which permits the replication of the plasmid to extremely high copy number in cells which contain the SV40 large T antigen, such as COS cells. In addition, for manipulation and amplification of the vector in bacteria, the vector contains an E. coli origin of replication and an ampicillin resistance gene. Insertion of the truncated human BRK-3 cDNA into pJT4 is accomplished as follows.
Since no stop codon had been identified in the 3' region of the kinase domain, PCR is performed to insert a stop codon to permit translation of the protein. Accordingly, a PCR primer is designed to insert two stop codons after nucleotide 2028 in SEQ ID NO: 3, thus terminating the kinase after Ile 540 in SEQ ID NO: 4. This is chosen to correspond to the length of the activin type II receptor Mathews and W.V. Vale, Cell, 65:.973-982 (1991)), so that it should be sufficient for proper folding of the kinase domain. The stop codons are followed by a Kpn I site. The complete sequence of the primer (which includes the reverse complement of nucleotides 2013-2028 in SEQ ID NO:3) is 5' ACG CGG TAC CTC ACT AAA TTT TTG GCA CAC GC A second primer is designed as an exact match to the t-BRK-3 sequence in the area of the Afl III site (nucleotides 1618-1637 in SEQ ID NO:3), having the sequence 5' GTA GAC ATG TAT GCT CTT GG The template for the reaction is clone HSK723, described in example 2, which contains the cDNA for t-BRK-3 in BLUESCRIPT II SK (Stratagene, La Jolla, CA; a 2.96 kb colony-producing phagemid derived from pUC 19).
PCR is carried out using the GENE AMP PCR Kit with AMPLITAQ
DNA
Polymerase (Perkin Elmer, Norwalk, CT; a kit containing components necessary for amplification of DNA using the polymerase chain reaction, including AMPLITAQ, a recombinant modified form of the DNA polymerase from Thermus aquaticus (Perkin- Elmer, Norwalk CT), nucleotides, and buffers), according to the manufacturer's instructions, using a GENE AMP PCR System 9600 Thermocycler (Perkin Elmer, Norwalk, CT). An initial melting at 95 0 C for 5 min is followed by 20 cycles of the following program: melting at 95 0 C for 1 min, annealing at 50 0 C for 1 min, and extension at 72°C for 1 min. After the last cycle, the temperature is held at 72°C for an additional 2 min to complete extension.
The resulting amplified band, at the expected size of 400 bp, is isolated from an agarose gel and digested with Afl III and Kpn I. Meanwhile, the cDNA for t-BRK-3 is digested with Eco RV and Afl III, and the vector pJT4 is digested with Eco RV and Kpn I. These three isolated fragments are ligated in a single step to give the construct pJT4- WO 96/14579 PCT/US95/14027 23 hBRK3T, shown in Figure 2. To confirm that no errors are introduced during PCR, the region from the Afl III site to the KpnI site at the 3' end is sequenced using the TAQ DYE DEOXY Terminator Cycle Sequencing Kit (Applied Biosystems, Foster, CA; kit containing components for automated DNA sequencing using the dideoxy terminator method, including AMPLITAQ, nucleotide mix, dye-labeled dideoxy nucleotide terminators, and buffers) and an Applied Biosystems Model 373A Automated DNA Sequencer. No errors are found.
To determine the effects of co-expression of t-BRK-3 with type I BMP receptors, it is necessary to co-express the cDNA for t-BRK-3 with the cDNA for BRK-1 or the cDNA for BRK-2. The DNA sequence for mouse BRK-1 is shown in SEQ ID NO: 11, and the deduced amino acid sequence for mouse BRK-1 is shown in SEQ ID NO: 12.
The DNA sequence for chicken BRK-2 is shown in SEQ ID NO: 13, and the deduced protein sequence shown for chicken BRK-2 is shown in SEQ ID NO: 14.
For mammalian expression of BRK-1, the plasmid pJT4-J159F is used.
Construction of this plasmid is described in U.S.S.N. 08/158,735, filed November 24, 1993 by Cook, et al. and B.B. Koenig et al., Molecular and Cellular Biology 14: 5961- 5974 (1994); ATCC 69457. Briefly, the construct containing the BRK-1 cDNA subcloned in BLUESCRIPT SK is linearized with the restriction endonuclease Alf III, and the overhanging end filled in using DNA Polymerase I Klenow fragment. The linearized plasmid is then digested with Not I, liberating the insert from the plasmid. The insert is then subcloned into the pJT4 expression vector at the Not I and EcoRV sites.
The blunt end generated by the Klenow reaction is compatible with the EcoRV site, which is also a blunt end; ligation eliminates the Eco RV site. The construct pJT4-J159F is shown in Figure 3.
For mammalian expression of BRK-2, its cDNA is subcloned into the vector pJT3.
This vector is identical to pJT4, described in this example, except that the multiple cloning site is in the opposite orientation, and an additional Not I site is present at the 5' end of the multiple cloning site. The cDNA for BRK-2 (see S. Sumitomo, et al., DNA Sequence 3: 297-302 (1993)), originally obtained in the vector pRc/CMV (Invitrogen, San Diego, CA; a mammalian expression vector), is excised by digestion with Kpn I and Xho I. It is subcloned into pJT3 at the Kpn I and Sal I sites. This regenerates a Kpn I site at the end of BRK-2, while the Xho I and Sal I sites are destroyed. The resulting construct is designated pJT3-BRK-2 and is shown in Figure 4.
For mammalian expression of DAF-4, the type II BMP receptor from Caenorhabditis elegans Estevez, L. Attisano, J.L. Wrana, P.S. Albert, J. Massague, and D.L. Riddle, Nature, 365: 644-9 (1993), the cDNA is obtained in BLUESCRIPT
II
and subcloned into pJT4 as follows. A 2.4 kb fragment containing the daf-4 cDNA is WO 96/14579 PCT/US95/14027 24 excised by digestion with Dra I and Apa I. This fragment is subcloned into pJT4 at the Sma I and Apa I site. The Apa I site is regenerated, while the Dra I and Sma I sites are destroyed. This construct is designated pJT4-Daf4, and is shown in Figure For mammalian expression of m-BRK-3, see Example 10, below.
Example Mammalian expression of t-BRK-3. BRK-1. BRK-2, and DAF-4 Transient expression of BRK-3 in mammalian cells using pJT4-hBRK3T is carried out in COS-7 cells (ATCC CRL 1651) using electroporation or COS-1 cells (ATCC CRL 1650) using DEAE Dextran (Pharmacia Biotech, Piscataway, NJ).
COS-7 cells are grown to confluence in Dulbecco's Modified Eagle (DME) high glucose media supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah), nonessential amino acids (GIBCO, Gaithersburg, MD), and glutamine, then trypsinized to release cells from the plate. The detached COS-7 cells are pelleted in a tabletop centrifuge, then resuspended in fresh media at a concentration of 6.25 x 106 cells/ml. The cell suspension (5 x 106 cells, 0.8 ml) is transferred to the cuvette of a BioRad GENE PULSER electroporation system (BioRad, Hercules, CA). The purified plasmid containing the receptor DNA of interest (10 ug for pJT4-J159F and pJT3-BRK2 and/or 20 Ag for pJT4-hBRK3T) is added to the cuvette, and the cells subjected to electoporation at kV/cm, with a capacitance of 25 pFd. Cells are then plated (400,000 cells per well for 12 well plates and 5 x 106 cells for 100 mm plates) and allowed to recover. Fresh media is supplied after 24 hr. At 48 hr, cells are ready to be tested for binding of BMP-4.
For transient expression of BMP receptors in COS-1 cells, the cells are grown to approximately 50%-80% confluence in DME high glucose media supplemented with fetal bovine serum (HyClone, Logan, Utah), nonessential amino acids, and glutamine in 100 mm plates. The cells are washed twice with 37 0 C serum-free DME media, after which 4 ml of DNA mixture is added to each 100 mm plate. The DNA mixture contains DME, 10% Nu-Serum (Collaborative Biomedical Products, Bedford, MA), 400 lig/ml DEAE-Dextran (Pharmacia, Piscataway, NJ), 0.1 mM chloroquine (Sigma, St. Louis, MO), and the cDNAs of interest: for t-BRK-3, 16 ug pJT4-hBRK3T; for BRK-1, 8 ug pJT4-J159F; for BRK-2, 8 jg pJT3-BRK2; for DAF-4, 16 jg pJT4-Daf4. The cells are then incubated at 37 0 C with the DNA mixture for 3 hr. The solution is aspirated and the cells are incubated with 4 ml of a solution containing 10% dimethylsulfoxide (DMSO) in Dulbecco's phosphate buffered saline without calcium or magnesium (PBS; Life Technologies, Gaithersburg, MD). After 2 min, the DMSO solution is aspirated, the cells are washed with the growth media described above, and fresh media is returned to the plates. The transfected cells are split into 12 well plates 24 hr post transfection for whole cell binding or cross linking. After 48 to 68 hr the cells are suitable for binding analysis.
WO 96/14579 PCT/US95/14027 Example 6 Generation of the Radiolabeled BMP-4 Ligand [125I]-BMP-4 is prepared using IODOBEADS (Pierce, Rockford, IL; immobilized chloramine-T on nonporous polystyrene beads). Lyophilized BMP-4 (2 pig) is taken up in 50 ul of 10 mM acetic acid and added to 450 pl of phosphate-buffered saline (PBS) (Sigma, St. Louis, MO) on ice. To the tube is added 500 pCurie of 1251 (Amersham, Arlington Heights, IL) (2200Ci/mmol) in 5 pl, and one IODOBEAD. The reaction is incubated on ice for 10 min with occasional shaking. The reaction is then terminated by removal of the reaction from the IODOBEAD. To remove unreacted 1251, the mixture is applied to a PD-10 gel filtration column (Pharmacia, Piscataway, NJ) previously equilibrated in 10 mM acetic acid, 0.1 M NaCI, 0.25% gelatin. The resulting labeled protein is >95% precipitable by trichloroacetic acid, indicating that all 1251 is protein bound, and has a typical specific activity of 4000 to 9000 Ci/mmol.
Alternatively, BMP-4 is labeled with 1251 by the chloramine-T method (C.A.
Frolik, L.M. Wakefield, D.M. Smith, and M.B. Sporn, J. Biol. Chem., 259: 10995-11000 (1984)). BMP-4 (2 pg) is taken up in 5 pl of 30% acetonitrile, 0.1% trifluoracetic acid (TFA) plus an additional 5 pl of 1.5 M sodium phosphate, pH 7.4. Carrier free 1251 (1 mCi, 9 pl) is added, together with 2 ul of a chloramine T solution (100 pg/ml). An additional 2 pl of the chloramine T solution is added at 2.0 min and at 3.5 min. After minutes, the reaction is stopped by the addition of 10 pl of 50 mM N-acetyl tyrosine, 100 pl of 60 mM potassium iodide, and 100 pl of 11M urea, 1 M acetic acid. After a minute incubation, unreacted iodine is removed on a PD-10 gel filtration column (Pharmacia, Piscataway, NJ) run in 4 mM HCI, 75 mM NaCI, 1 mg/ml bovine serum albumin (BSA). The resulting labeled protein is >95% precipitable by trichloroacetic acid, indicating that all 125I is protein bound, and has a typical specific activity of 3000-8000 Ci/mmol.
Example 7 Characterization of BMP-4 Binding to t-BRK-3 Binding of BMP-4 to t-BRK-3 can be demonstrated by whole cell binding of radiolabeled BMP-4, and by covalent crosslinking of radiolabeled BMP-4 to the receptor.
These two methods are described in detail below.
a. Whole Cell Binding: COS-7 or COS-I cells are transfected with pJT4-hBRK3T as described in example After transfection, cells are seeded into 12 well plates and the binding experiments are carried out at 48 to 68 hr. At that time, cells are washed once with binding buffer (50 mM HEPES, pH 7.4, 128 mM NaCI, 5 mM KCI, 5 mM MgSO4, 1.2 mM CaCl2, 2 mg/ml BSA), then equilibrated in the same buffer at 4 0 C for 30 60 min with gentle shaking.
WO 96/14579 PCT/US95/14027 26 The buffer is then aspirated, and to each well is added 500 p1 of binding buffer (40 C), containing [1 2 5 T]-BMP-4 tracer (100 400 pM), as well as varying concentrations of unlabeled BMP-2, BMP-4, or other unlabeled ligand, depending on the assay. For determination of nonspecific binding, BMP-4 is added to the binding buffer at a final concentration of 10 to 50 nM. To prevent degradation of ligand during the incubation, a protease inhibitor cocktail is also added, to give a final concentration of 10 pg/ml leupeptin, 10 pg/ml antipain, 50 pg/ml aprotinin, 100 pg/ml benzamidine, 100 ug/ml soybean trypsin inhibitor, 10 pg/ml bestatin, 10 pg/ml pepstatin, and 300 pM phenylmethylsulfonyl fluoride (PMSF). The cells are incubated for 4 hr at 4°C with gentle shaking. At the end of the incubation period, the buffer is aspirated, and the cells are rinsed 4 times with 1 ml washing buffer (50 mM HEPES, pH 7.4, 128 mM NaCI, 5 mM KCI, 5 mM MgSO4, 1.2 mM CaCl2, 0.5 mg/ml BSA). After the final wash is aspirated, 200 pl of solubilization buffer (10 mM Tris Cl, pH 7.4, 1 mM EDTA, 1% Tritgn X- 100) is added to each well and incubated at room temperature for 15 30 min. The solubilized cells are then transferred to fresh tubes and counted in a Packard Model 5005 COBRA Gamma Counter (Packard Instruments, Meriden, CT).
Results are shown in Figure 6, which shows specific binding of [1 2 5 I-BMP-4 to NIH3T3 cells (ATCC CRL 1658), which display significant endogenous binding of BMP- 4, and COS 7 cells transfected with the cDNA for t-BRK-3 in the presence and absence of BRK-1 and BRK-2. t-BRK-3 is capable of binding 12 5 1]-BMP-4 when expressed alone (bar on far right), at a level similar to that seen for BRK-1 and BRK-2 expressed alone.
Binding of 12 5 I]-BMP-4 is increased by co-expression of t-BRK-3 with BRK-1, and to a greater extent by co-expression of t-BRK-3 with BRK-2.
b. Covalent Crosslinking: Bifunctional crosslinking reagent disuccinimidyl glutarate (DSG) (Pierce, Rockford, IL) is used to covalently crosslink bound radiolabeled ligand to its receptor by reaction with free amino groups on lysine residues in the two proteins. Following the crosslinking, cellular proteins are separated by gel electrophoresis, and radioactive bands visualized. The labeled bands represent the receptor selectively "tagged" with the radiolabeled ligand. In this procedure, cells are transfected with the cDNA for BRK-3, and/or BRK-1 or BRK-2, as described in example 5, then seeded into 12 well plates. At 48 68 hr after transfection, the cells are washed, equilibrated, and incubated with [125 BMP-4 and competing unlabeled ligands as described in this example for whole cell binding studies. After completion of the 4 hr incubation with ligand, the cells are washed two to three times at 4 0 C with 2 ml of binding buffer having the same composition as described above, except that no BSA is added. To each well is then added 1 ml of fresh BSA-free binding buffer, followed by freshly prepared DSG to a final concentration of WO 96/14579 PCTIUS95/14027 27 135 gM. After swirling gently to mix the DSG, the plates are incubated for exactly minutes at 4 0 C with gentle shaking. At this point the media is aspirated and the cells washed with 3 ml detachment buffer (10 mM Tris base, 0.25 M sucrose, 1 mM EDTA, 0.3 mM PMSF) or PBS. Solubilization buffer (50 tl) is then added to each well and the cells are allowed to solubilise for 30 45 minutes at 4°C with shaking. An aliquot of the sample pl) is transferred to a fresh tube and 5 pl of 5X sample loading buffer (0.25 M TrisC1, pH 6.8, 10% SDS, 0.5 M DTT, 0.5% bromophenol blue, 50% glycerol; purchased from Five Prime Three Prime, Boulder, CO) is added. The samples are boiled for 5 min and centrifuged (13,0000 x g, 5 min). The supernatants are loaded onto 7.5% SDSpolyacrylamide gels (Integrated Separation Systems, Natick, MA) and subjected to electrophoresis. The gels are stained in 0.12% Coomassie Blue R250, 5% methanol, acetic acid; destained in 5% methanol, 7.5% acetic acid; then dried. Radioactivity on the dried gel is visualized and quantitated on a PHOSPHORIMAGER (Molqcular Devices, Sunnyvale, CA, a device for quantitation of radioactivity using stable phosphor screens), or subjected to autoradiography using Kodak X-OMAT AR autoradiography film (Kodak, Rochester, NY).
Results are shown in Figure 7. When t-BRK-3 is expressed alone in COS-1 cells, no crosslinked band is seen. Expression of BRK-1 alone results in a crosslinked band at a molecular weight of 78 kD, corresponding to the predicted molecular weight of BRK-1 plus the monomer molecular weight of BMP-4. Co-expression of t-BRK-3 and BRK-1 results in the appearance of a band of similar size to that for BRK-1, as well as a new crosslinked band at 94 kD, corresponding to the predicted molecular weight of t-BRK-3 plus the monomer molecular weight of crosslinked BMP-4. Similarly, expression of BRK- 2 alone yields a single crosslinked band at 75 kD, corresponding to the predicted molecular weight of BRK-2 plus the crosslinked BMP-4 monomer. Co-expression of t- BRK-3 with BRK-2 yields a crosslinked band corresponding to that seen for BRK-2 alone, as well as a new crosslinked band at 94 kD, again corresponding to the predicted molecular weight of t-BRK-3 plus the monomer molecular weight of crosslinked BMP-4.
Thus, crosslinking of 12 5 1]-BMP-4 to t-BRK-3 is observed only in the presence of a coexpressed type I BMP receptor.
Example 8 Demonstration of Complex Formation with Type I BMP Receptors Receptors of the TGF-B receptor family have been shown to form complexes involving a type I and a type II receptor Attisano, J.L. Wrana, F. Lopez-Casillas, and J. Massague, J. Biochim Biophys. Acta, 1222: 71-80 (1994)). In order to demonstrate that the type II BMP receptor t-BRK-3 can form a complex with the type I BMP receptors BRK-1 and BRK-2, COS-1 cells are co-transfected with the cDNA for t-BRK-3 WO 96/14579 PCT/US95/14027 28 and BRK-1, or t-BRK-3 and BRK-2, as described in Example 5. The receptors are crosslinked to [1 2 5 I]-BMP-4, then subjected to immunoprecipitation with antibodies specific for the type I receptors BRK-1 and BRK-2. If antibodies specific for a type I receptor precipitate not only the type I receptor crosslinked to 12 5 1]-BMP-4, but also BRK-3 crosslinked to [1 2 5 I]-BMP-4, this indicates that the two receptors must be forming a complex, as expected for type I and type II receptors having the same ligandbinding specificity.
Antibodies specific for the type I receptors BRK-1 and BRK-2 are generated using as antigen the peptide LNTRVGTKRYMAPEVLDESLNKNC Koenig, et al., Molec. Cell. Biol., 14: 5961-5974 (1994)). This peptide is based on the amino acid sequence of BRK-1 in the intracellular kinase domain, amino acids 398-420 in SEQ ID NO: 12, with the addition of a cysteine at the C terminus to permit conjugation of the peptide. Comparison of the amino acid sequence of the kinase domain of BRK-1 with the kinase domain of the Raf protein suggests that this region of BRK-1 corresponds to a region of the Raf kinase which was used to make highly specific antibodies Kolch, E.
Weissinger, H. Mischak, J. Troppmair, S.D. Showalter, P. Lloyd, G. Heidecker, and U.R.
Rapp, Oncogene, 5: 713-720 (1990)). This peptide is conjugated by standard methods to keyhole limpet hemocynanin, and used to immunize three New Zealand White rabbits (Hazleton Washington, Vienna, VA). The resulting antisera are evaluated for their ability to recognize the original peptide coated on plastic, using an antibody capture ELISA. The antisera are designated 1378, 1379, and 1380. These antibodies are shown to immunoprecipitate BRK-1 from COS-7 cells transfected with the cDNA for BRK-1, using the procedure detailed in this example Koenig, et al., Mol. Cell. Biol., 14: 5961- 5974 (1994)). Because the sequence of BRK-2 is nearly identical to that of BRK-1 in this region, these antibodies are subsequently tested for their ability to immunoprecipitate BRK-2 as well, and are found to be effective for this purpose. Antibody 1379 gives superior results for immunoprecipitation of BRK-1, and antibody 1380 is preferred for immunoprecipitation of BRK-2.
In the immunoprecipitation procedure, COS-7 or COS-1 cells are transfected with the cDNA for t-BRK-3 and/or BRK-1, BRK-2, or DAF-4 as described in Example 5, and plated into 100 mm dishes. They are then crosslinked to 12 5 I]-BMP-4 as described in example 7, except that the incubation with 12 5 I]-BMP-4 and unlabeled ligand is carried out in a total of 4 ml, instead of 500 tl, and all other volumes are increased accordingly.
Following the crosslinking, cells are washed three times with ice-cold PBS, then lysed with 1 ml of RIP buffer (20 mM TrisCl, pH 8.0, 100 mM NaCl, 1 mM Na2EDTA, Nonidet P-40, 0.5% sodium deoxycholate, 10 mM sodium iodide, and 1% bovine serum albumin) for 10 min. The lysate is centrifuged in a microcentrifuge at 13,000 rpm for WO 96/14579 PCTIUS95/14027 29 min at 4°C. The supernatant .is transferred to a fresh tube and made 0.1% in SDS. To remove any existing antibody present in the lysate, 50 pl of PANSORBIN (Calbiochem, La Jolla, CA; a 10% solution of Staphylococcus aureus) is added. After a 30 minute incubation at 4°C, the lysate is centrifuged as before, and the supernatant again transferred to a fresh tube.
The primary antibody-1379 when cells are transfected with t-BRK-3 and BRK-1; 1380 when cells are transfected with t-BRK-3 and BRK-2-is then added to the tube at a final dilution of 1:100, and incubated for 2 hr on ice or overnight at 4 0 C. To precipitate the complex of antigen:primary antibody, 25-50 pl of PANSORBIN is then added and incubated 30 min on ice. The complex is pelleted at 13,000 rpm for 10 min in a microcentrifuge and the supernatant discarded. The pellet is washed twice in RIP buffer containing 0.1% SDS, and once in TNEN buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% NP-40). The pellet is resuspended in 25 pI of IX sample loading buffer. (Alternatively, the pellet may be washed twice with TNEN buffer, with similar results.) The sample is boiled for 5 min, centrifuged for 5 min, and subjected to gel electrophoresis after loading of the samples onto a 7.5% SDS-polyacrylamide gel.
Results of this experiment are shown in Figure 8, which shows the results of immunoprecipitations on COS-1 cells transfected with t-BRK-3 in the presence or absence of BRK-1 or BRK-2. Cells transfected with t-BRK-3 alone, crosslinked to 12 5
I]-BMP-
4, and immunoprecipitated with antibody 1380 show no radiolabel in the immunoprecipitate, as expected since t-BRK-3 does not crossreact with this antibody.
Cells transfected with BRK-1, crosslinked, and immunoprecipitated with antibody 1379 show a single labeled band at 78 kD, consistent with the predicted molecular weight of BRK-1 plus the cross-linked monomer of BMP-4. Immunoprecipitation of cells cotransfected with BRK-1 and t-BRK-3 yields the same band seen with BRK-1 alone, plus an additional labeled band at 94 kD, consistent with the predicted molecular weight of t- BRK-3 plus the crosslinked BMP-4 monomer. (A less intense band at 120 kD is also observed.) The fact that antibodies to BRK-1 precipitate not only BRK-1, but t-BRK-3 as well in these cells indicates complex formation between BRK-1 and t-BRK-3. Similarly, cells transfected with BRK-2, crosslinked to 12 5 I]-BMP-4, and subjected to immunoprecipitation with antibody 1380 show a labeled band at 75 kD, consistent with the predicted molecular weight of BRK-2 plus the crosslinked monomer of BMP-4.
Immunoprecipitation of cells co-transfected with BRK-2 and t-BRK-3 yields the same band seen with BRK-2 alone, plus a strongly labeled band at 94 kD, consistent with the predicted molecular weight of t-BRK-3 plus the crosslinked monomer of BMP-4. As expected, this band co-migrates with the larger labeled band in cells co-transfected with BRK-1 and t-BRK-3. (A less intense band at 120 kD is also observed.) Again, the fact WO 96/14579 PCT/US95/14027 that an antibody to BRK-2 precipitates not only BRK-2 but t-BRK-3 as well in these cells strongly indicates that BRK-2 and t-BRK-3 form a complex. Thus, t-BRK-3 forms a complex with two different type I BMP receptors, as expected for a type II BMP receptor.
A second immunoprecipitation experiment is carried out to test the ligand specificity of the t-BRK-3 receptor complex for BMP-2, BMP-4, and TGF-3 1
A
derivative of BMP-2 designated 'digit -removed"BMP-2 (DR-BMP-2) is also tested; DR- BMP-2 is prepared by mild trypsin digestion of BMP-2 to remove the amino terminus, and shows significantly reduced nonspecific binding to whole cells Koenig, et al., Molec.
Cell. Biol., 14: 5961-5974 (1994)).
COS-1 cells are co-transfected with the cDNA for BRK-2 and t-BRK-3 as described in Example 5, crosslinked to 12 5 I]-BMP-4, and subjected to immunoprecipitation with antibody 1380 as described in this example, except that an excess of unlabeled ligand (10 nM BMP-4, 10 nM BMP-2, 10 nM DR-BMP-2, or 5,0 nM
TGF-B
1 is added to the incubation at the same time as the [1 2 5 I]-BMP-4. The results are shown in Figure 9. When no competing unlabeled ligands are present, two labeled bands are observed, at 75 kD and 94 kD, consistent with crosslinked BRK-2 and BRK-3 respectively, as seen in Figure 8. In the presence of excess unlabeled BMP-4, BMP-2, or DR-BMP-2, however, these bands are completely abolished, demonstrating that these ligands compete effectively with 12 5 I]-BMP-4 to bind to the complex, and that all these ligands show specific binding to the BRK-2 and BRK-3 receptor complex. However, the presence of 50 nM TGF-B 1 has no effect on the labeled bands, indicating that TGF-81 does not bind to the same site as 12 5 I]-BMP-4. This shows that the BRK-2/t-BRK-3 complex binds specifically to BMP-2 and BMP-4 and does not bind TGF-B.
Example 9 Isolation of Mouse BRK-3 In order to isolate the full-length mouse homologue of BRK-3, a cDNA library is constructed from NIH3T3 mouse embryonic fibroblasts (ATCC CRL 1658). Total RNA (1.26 mg) is isolated from the cells using a Total RNA Separator Kit (Clontech, Palo Alto, CA). Messenger RNA (81 jg) is isolated from this total RNA (1 mg) using the mRNA Separator Kit (Clontech, Palo Alto, CA). An aliquot of the mRNA (4 jg) is used to make cDNA library using the SUPER SCRIPT Plasmid System for cDNA Synthesis and Plasmid Cloning (Life Technologies, Gaithersburg, MD) according to the manufacturer's instructions. The resulting library contained approximately 4.9 x 105 primary colonies, and is divided into 98 pools, each containing 5000 colonies.
The initial screen of the library is accomplished by Southern blotting. Plasmids are purified from each of the 98 pools, using QIAGEN columns (Qiagen, Chatsworth, CA).
DNA from each pool (approximately 5 ig) is digested with Mlu I to release the cDNA WO 96/14579 PCT/US95/14027 31 insert, then run on a 1% agarose gel. The gel is denatured for 30 min in 0.6 M NaCI, 0.4 N NaOH, then neutralized 30 min in 1.5 M NaCI, 0.5 M Tris, pH 7.5. The DNA is then transferred overnight to a HYBOND Nylon membrane (Amersham, Arlington Heights, IL) using 10XSSC as the transfer buffer (1XSSC 0.15 M NaCI, 0.015 M sodium citrate, pH Human t-BRK-3 is cut with EcoRV and Afl III to give a 1.5 kb fragment. The fragment is randomly labeled with alpha[ 3 2 P]-dCTP having a specific activity of 3000 Ci/mmol (NEN Research Products, Boston, MA), using a PRIME-IT II Random Primer Labeling Kit (Stratagene, La Jolla, CA; a kit for random primer labeling of DNA, including Klenow DNA polymerase, primers, and buffers). The labeled probe is allowed to hybridize to the Southern blot for 18 hr at 42 0 C in hybridization buffer (Sigma, St.
Louis, MO) consisting of 50% deionized formamide, 5 X SSPE (lx SSPE 0.14 M NaCI, 8 mM sodium phosphate, 0.08 mM EDTA, pH IX Denhardt's solutions, and 100 gg/ml of denatured salmon testis DNA. The blot is then washed in 0.25X SSPE, sodium dodecyl sulfate (SDS), two times at 42 0 C for 15 min each, then two times at 65 0
C
for 20 min each. The blot is then exposed to Kodak X-OMAT AR autoradiography film for 18 hr at -80 0 C. Development of the film shows five positive pools, as judged by the presence of a labeled band of approximately 2.5 kb.
For secondary screening, plates are streaked with the E. coli stocks from the five positive pools (5000 colonies/plate). A HYBOND nylon membrane is placed on top of the plate so that the bacterial colonies are transferred to the filter. The colonies are then allowed to recover at 37 0 C for 2-3 hr. The filter is soaked in 10% SDS for 3 min, then transferred to 1.5 M NaCI, 0.5 M NaOH for 5 min, neutralized in 1.5 M NaCl, 1.5 M Tris, pH 7.5 for 5 min, and washed in 2X SSC. To remove proteins, the blots are then shaken with 50 tg/ml ofproteinase K (Boehringer Mannheim, Indianapolis, IN) in 0.1 M Tris, pH 7.6, 10 mM EDTA, 0.15 M NaCI, 0.02% SDS at 55 0 C for 1 hr. The human BRK-3 fragment (Eco RV-Afl III) is labeled and the blots hybridized, washed, and subjected to autoradiography exactly as described above for the primary screening.
Colonies which corresponded to labeled spots on the autoradiograph are streaked on plates for tertiary screening, which is performed exactly as described above for secondary screening. Four positive clones are isolated. One clone, pSPORT1/N89-5, is found to have the largest insert size, 2.9 kb.
The inserts from the four positive clones are sequenced using the TAQ DYE DEOXY Terminator Cycle Sequencing Kit and an Applied Biosystems Model 373A Automated DNA Sequencer. Comparison of the four sequences shows that three of the four are identical at the 3' end, and all four align with the coding region of human BRK-3 at the 5' end. The longest clone, pSPORT1/N89-5, aligns with the human BRK-3 WO 96/14579 PCT/US95/14027 32 sequence approximately 600 pairs from the beginning of the coding region.
To generate more sequence information, the insert from pSPORTI/N89-5 is digested with EcoRI and Sca I, and the resulting 1.4 kb fragment is subcloned into BLUESCRIPT II at the Eco RI and Hinc II sites. pSPORT1/N89-5 is also digested with Eco RI and Eco RV and the resulting 2.1 kb insert subcloned into the same vector at the same sites. Finally, the plasmid is digested with Sca I and Not I, and subcloned into the same vector at the Hinc II and Not I sites. Sequencing of these three constructs yields the complete sequence of the insert from pSPORT1/N89-5.
The missing 600 base pairs at the 5' end of the coding region is cloned using the RACE System for Rapid Amplification of cDNA Ends (Life Technologies, Gaithersburg, MD). An antisense primer is designed corresponding to the known sequence of pSPORT1/N89-5, having the sequence 5'CTG TGT GAA GAT AAG CCA GTC 3' (the reverse complement ofnucleotides 968-948 in SEQ ID NO:7). After first strand synthesis of cDNA from 1 gg of NIH3T3 mRNA, a poly C tail is added to the newly synthesized cDNA using terminal deoxynucleotidyl transferase, according to the manufacturer's instructions. The primer above is used to amplify the 5' end of the BRK-3 cDNA, together with the Anchor Primer supplied with the kit, having the sequence 5' (CUA)4 GGC CAC GCG TCG ACT AGT ACG GGI IGG GII GGG IIG 3' (where I inosine and U=uracil). PCR was performed using the GENE-AMP PCR Kit with AMPLITAQ DNA Polymerase. An initial melting period at 95°C for 5 min was followed by 35 cycles of the following program: melting at 95 0 C for 1 min, annealing at 55°C for 1 min, and extension at 72 0 C for 2 min. After the last cycle, the reaction was held at 72 0 C for 5 min to complete extension. To reduce background from nonspecific primer binding, a second round of PCR is performed using the nested primer 5' CAA GAG CTT ACC CAA TCA CTT G again derived from the known sequence of the insert from pSPORT1/N89-5 (the reverse complement of nucleotides 921-900 in SEQ ID NO: together with same anchor primer used in the first round of PCR.
The amplified products of the second PCR reaction in the size range of 600-1000 bp are digested with Ecl XI and Sal I and subcloned into BLUESCRIPT II at the Ecl XI and Sal I sites. The inserts are then sequenced, yielding an additional 600 bp of sequence which align with the coding region of human t-BRK-3. Three separate clones, designated R6-8B2, R6-11-1, and R6-11-2, are sequenced with identical results.
In order to assemble a full length clone of mouse BRK-3, a Sal I site is first placed at the 5' end of clone R6-11-1 as follows. A primer is synthesized which contains a Sal I site followed by nucleotides 1-20 of the sequence of R6-11-1; the sequence of the primer is 5' CAC ACG CGT CGA CCA TGA CTT CCT CGC TGC ATC G This is used together with the M13 reverse primer, 5' AAC AGC TAT GAC CAT G in order to WO 96/14579 PCTIUS95/14027 33 amplify a DNA fragment using plasmid DNA from clone R6-11-1 as the template. PCR was performed using the GENE-AMP PCR Kit with AMPLITAQ DNA Polymerase. An initial melting period at 95C for 5 min was followed by 35 cycles of the following program: melting at 95°C for 1 min, annealing at 55 0 C for 1 min, and extension at 72 0
C
for 2 min. After the last cycle, the reaction was held at 72 0 C for 5 min to complete extension. The fragment amplified from R6-11-1, together with the insert from pSPORTl/N89-5 (230 ng), is then subcloned in to BLUESCRIPT II as follows.
The amplified fragment from R6-11-1 is digested with Sal I and Ecl XI The insert from pSPORT1/N89-5 is digested with Ecl XI and Pst I. The vector BLUESCRIPT II is digested with Sal I and Pst I: The three fragments are combined in a three-way ligation using T4 DNA ligase (3 hr, 25 0 C) and used to transform electrocompetent E. coli, strain using a BIO-RAD Gene PULSER (BIO-RAD, Hercules, CA) according to the manufacturer's instructions. A positive colony is selected and is designated pBLUESCRIPT-mBRK3. Sequencing of the 5' portion of the insert that was amplified by PCR shows a sequence identical to that of clone R6-11-1, indicating that no mutations are introduced during the amplification.
For mammalian expression, m-BRK-3 is subcloned into the mammalian expression vector pJT6. This vector is a derivative of pJT3, described in example 4 above, in which the Not I site at the 5' end of the multiple cloning site has been deleted, and a spacer inserted between the Pst I and BamHI restriction sites in the multiple cloning site. To accomplish the subcloning, m-BRK-3 is excised from pBLUESCRIPT-mBRK3 using Not I and Sal I, then subcloned into pJT6 at the Not I and Sal I sites to generate pJT6mBRK3.
However, resequencing of the 3' end of pJT6-mBRK3 and the original cDNA in pSPORT1/N89-5 results in an altered reading frame at the 3' end, and shows that the stop codon is actually located 3' to the Pst I site. Thus, pJT6-mBRK3 does not contain a stop codon. Accordingly, two new constructs are prepared as follows.
First, pJT6-mBRK3 is digested with Spel (site at position 2306 in SEQ ID NO: 7) and Not I (in the multiple cloning site of pJT6), removing the 3' end of the insert. The longest clone isolated during the screening of the NIH-3T3 library, pSPORT1/N89-5, is also digested with Spe I and Not I. The 1.2 kb fragment liberated from pSPORT1/N89-5 is subcloned into the Spe I/Not I digested pJT6-mBRK3, regenerating both sites. This construct is designated pJT6-mBRK-3L, and contains the entire 3' end of the pSPORT1/N89-5 clone. A map of the construct is shown in Figure The 3' end of the clone contains 403 nucleotides in the untranslated region 3' to the stop codon. This region is very A-T rich, which might possibly lead to decreased expression levels. To remove this region, a second construct is prepared. The WO 96/14579 PCT/US95/14027 34 pSPORTI/N89-5 plasmid is digested with Hind III (site at nucleotide 3168 in SEQ ID NO: 7, 21 bases 3' to the stop codon). The linearized plasmid is treated with Klenow fragment of DNA polymerase (Boehringer Mannheim, Indianapolis, IN) to fill in overhangs, then cut with Spe I to liberate an 863 bp fragment at the 3' end of the insert.
At the same time, pJT6-mBRK3 is digested with Not I. The linearized plasmid is treated with Klenow fragment, then cut with Spe I, releasing the 3' end of the insert. The Not I/Spe I digested pJT6-mBRK3 is then ligated to the fragment liberated from pSPORT1/N89-5 by Hind III/Spe I. This regenerates the Spe I site; the Hind III and Not I sites are destroyed. The resulting construct is designated pJT6-mBRK3S, and is shown in Figure 11.
The construct pJT6-mBRK-3S is also constructed directly from the partial cDNA clone of m-BRK-3, pSPORTI/N89-5, and the construct containing the 5' end of the cDNA, clone R6-11-1. This is accomplished by digestion of clone R6-11-1 with Sal I and Ecl XI, digestion of pSPORTI/N89-5 with Ecl XI and Hind III, and digestion of BLUESCRIPT II SK with Sal I and Hind III. These fragments are then subjected to a three-way ligation to generate the full length m-BRK-3 cDNA in the BLUESCRIPT II vector. The full length cDNA is then excised from this construct using Sal I and Not I, then subcloned into the Sal I and Not I sites of the pJT6 vector. The resulting plasmid has exactly the same cDNA for BRK-3 as does pJT6-mBRK3S described in the above example. However, it carries additional vector sequence at the 3' end of the cDNA, comprising the region between the Hind III and Not I sites in the multiple cloning site of BLUESCRIPT II WO 96/14579 PCT/US95/14027 Example Sequence analysis of mouse BRK-3 The DNA sequence of the full length mouse BRK-3 insert from pJT6-mBRK3L is shown in SEQ ID NO: 7, and the deduced protein sequence is shown in SEQ ID NO: 8.
The deduced amino acid sequence of mouse BRK-3 is searched against all translated protein sequences in GenBank release 84.0, dated Aug. 15, 1994, using a standard Needleman-Wunsch algorithm Needleman and C.D. Wunsch, J. Mol. Biol., 48: 443- 453 (1970)). It is found to be a unique sequence. It encodes a protein of 1038 amino acids. Comparing mouse BRK-3 with the truncated human receptor over the region encoded by t-BRK-3 (amino acids 1-582 in SEQ ID NO:4; amino acids 1-582 in SEQ ID NO: the two receptors are 98% identical in sequence. Like t-BRK-3, m-BRK-3 contains a predicted transmembrane region encompassing amino acids 151-172. As with t-BRK-3, the intracellular domain contains all of the consensus sequences that characterize a protein kinase domain with predicted specificity for serine/threonine residues (S.K.
Hanks, A.M. Quinn, and T. Hunter, Science, 241: 42-52 (1988)). The kinase domain is followed by an extremely long carboxy terminus (534 amino acids). Indeed, due to the presence of this carboxy terminus, the intracellular domain in BRK-3 (866 amino acids) is much larger than that of any other receptor in the TGF-1 receptor family. It is nearly twice as long as the intracellular domain of DAF-4 (490 amino acids), which has the longest intracellular domain known in the TGF-B family until the present invention.
Example 11 Demonstration of [1 2 5 11-BMP-4 binding to m-BRK-3 In order to demonstrate that [1 2 5 I]-BMP-4 binds specifically to m-BRK-3, COS-1 cells are transfected as described in Example 5 using the constructs pJT6-mBRK-3S and pJT6-mBRK-3L. In addition, the cells are also co-transfected with cDNA for the type I receptor BRK-2, using the construct pJT3-BRK-2, to determine whether the presence of a type I BMP receptor affects binding of 12 5 ]-BMP-4. Whole cell binding with [1251]- BMP-4 is carried out as described in Example 7.
The results are shown in Figure 12, which shows specific binding of 12 5 I]-BMP-4 normalized to cell number. When cells are transfected with mouse BRK-3 alone, using either of the two constructs tested, specific binding of 12 5 I]-BMP-4 is increased to 4-7 times the level seen with mock transfected cells. Transfection of BRK-2 alone shows increased binding at a similar level to that seen with mouse BRK-3 alone. When cells are co-transfected with BRK-2 as well as mouse BRK-3, the binding is further increased to 9- 11 times that of mock-transfected cells, consistent with the results obtained with BRK-2 in combination with t-BRK-3 (Figure 6 in Example 7 above).
As an additional demonstration that m-BRK-3 binds to[ 12 5 I]-BMP-4, a WO 96/14579 PCT/US95/14027 36 crosslinking experiment is carried out. COS-1 cells are transfected with the cDNA for m- BRK-3, using the construct pJT6-mBRK-3S, and/or with cDNAs for BRK-I (using pJT4-J159F) or BRK-2 (using pJT3-BRK-2) as described in Example 5. The transfected cells are incubated with [1 2 5 I]-BMP-4 and crosslinked as described in Example 7, except that disuccinimidyl suberate (DSS) is used as the crosslinking agent rather than disuccinimidyl glutarate. The results of such an experiment are shown in Figure 13. Cells transfected with m-BRK-3 alone show no crosslinked band, consistent with the results obtained with t-BRK-3 (Figure Cells transfected with the cDNA for BRK-1 alone show a single species migrating at an apparent molecular weight of 81 kD, consistent with the predicted molecular weight of BRK-1 plus the crosslinked BMP-4 monomer. Cells transfected with the cDNAs for BRK-1 and m-BRK-3 show three labeled bands, one of which is consistent with the band seen with BRK-1 alone (81 kD). The other bands migrate with an apparent molecular weight of 159 kD and 128 kD. The larger of these is consistent with the predicted molecular weight of m-BRK-3 plus the crosslinked BMP-4 monomer. Note that the intensity of the crosslinked band identified with BRK-1 is considerably increased, compared to that seen with BRK-1 alone.
Similarly, transfection of cells with the cDNA for BRK-2 alone yields a crosslinked band migrating at an apparent molecular weight of 78 kD, consistent with the predicted molecular weight of BRK-2 plus the crosslinked BMP-4 monomer. In cells transfected with the cDNAs for BRK-2 and mBRK3, the 78 kD species identified with BRK-2 is observed, as well as crosslinked bands at 159 kD and 128 kD, comigrating with the higher molecular weight bands seen in cells transfected with the cDNAs for BRK-1 and m-BRK- 3. As with BRK-1, the intensity of crosslinking to the band identified with BRK-2 is considerably increased compared to that seen with BRK-2 alone. Finally, no labeled bands are observed in cells transfected with vector alone.
An immunoprecipitation experiment is carried out to demonstrate the ability of m- BRK-3 to form a complex with type I BMP receptors. COS-1 cells are transfected with the cDNA for m-BRK-3, using the construct pJT6-mBRK-3S, and/or with cDNAs for BRK-1 (using pJT4-J159F) or BRK-2 (using pJT3-BRK-2) as described in Example The transfected cells are incubated with [1 2 5 1]-BMP-4, crosslinked and subjected to immunoprecipitation with antibodies to the appropriate type I receptor or preimmune serum as described in example 8, except that DSS is used as the crosslinking agent rather than disuccinimidyl glutarate. The results of this experiment are shown in figure 14. In cells transfected with cDNA for BRK-1 alone, a single band is precipitated by antibodies to BRK-1, migrating at an apparent molecular weight of 81 kD. In cells transfected with cDNAs for BRK-1 and m-BRK-3, antibodies to BRK-1 precipitate the 81 kD band, which is now increased in intensity. In addition, however, a band migrating at an apparent WO 96/14579 PCT/US95/14027 37 molecular weight of 159 kD is observed, consistent with the predicted molecular weight of m-BRK-3 plus crosslinked BMP-4 monomer. Similarly, in cells transfected with cDNA for BRK-2 alone, antibodies to BRK-2 precipitate a labeled species migrating at an apparent molecular weight of 78 kD. In cells transfected with cDNAs for BRK-2 and m- BRK-3 and precipitated with antibodies to BRK-2, the 78 kD band identified with BRK-2 is again observed, at increased intensity. In addition, a labeled species is seen at 159 kD, consistent with m-BRK-3 and comigrating with the higher molecular weight band seen in cells transfected with cDNAs for BRK-1 and m-BRK-3. In cells transfected with cDNAs for BRK-2 and m-BRK-3, an additional labeled band is observed at 94 kD. As a control, cells are transfected with the cDNAs for BRK-1 and m-BRK-3, or BRK-2 and m-BRK-3, then subjected to immunoprecipitation with preimmune sera (lanes far left and far right); no labeled bands are observed.
This experiment shows that when m-BRK-3 is co-expressed with the type I ,BMP receptors BRK-1 or BRK-2, antibodies which precipitate the type I receptor also precipitate m-BRK-3. Thus, m-BRK-3 can form a complex with either of these mammalian type I BMP receptors, as expected for a mammalian type II BMP receptor.
This is consistent with results obtained with t-BRK-3 described in Example 8 above.
Example 12 Isolation of full length human BRK-3 cDNA Since clone HSK723, described in Example 2, does not contain an in-frame stop codon, it is desired to obtain additional sequence 3' to the end of this cDNA.
Accordingly, the human foreskin fibroblast library prepared in Example 1 is rescreened with the HSK7-2 PCR fragment, using labeling and screening conditions exactly as described in Example 2. This results in isolation of a longer clone, designated pHSK1030, which contains additional human BRK-3 sequence (total of 3355 base pairs) subcloned in BLUESCRIPT Sequencing of the insert from pHSK1030 discloses a coding region of 982 amino acids, but the insert still does not contain an in-frame stop codon.
The remainder of the coding region is cloned by PCR as follows. Two forward primers are derived from the plus strand of clone pHSK1030. The sequences of these primers are as follows: primer RPK3-1, 5' CCTGTCACATAATAGGCGTGTGCC-3' (identical to nucleotides 1998-2021 in SEQ ID NO:1); primer RPK3-2, CGCGGATCCATCATACTGACAGCATCG 3' (which incorporates a BamHI site followed by nucleotides 2078-2095 in SEQ ID NO:1). Two additional primers are derived from the minus strand of ?gtl0. These primers are: G10F1, GCTGGGTAGTCCCCACCTTT 3' and G10F2, 5' GAGCAAGTTCAGCCTGGT 3'.
The human fibroblast cDNA library prepared in Example 1 is used as the template for PCR. The library (0.3 pg) is incubated with the RPK3-1 and GI0F1 primers (1 pM WO 96/14579 PCT/US95/14027 38 each), Tth polymerase 1.2 units), all four deoxynucleotides (200 pM each) buffer for the Tth polymerase, and water in a total of 50 pl. Conditions for the PCR cycle are as follows: initial melting at 94 0 C for 2 min, followed by 20 cycles of melting, 94 0 C for min annealing, 52 0 C for 2 min; and extension, 72 0 C for 3 min. After cycle 20, the sample is held at 72 0 C for an additional 8 min to insure complete extension.
To increase specificity and reduce background, a second round of nested PCR is carried out. The incubation mixture is the same as described in this example for the first round, except that an aliquot of the first PCR reaction (0.5 pl) is used as the template; and RPK3-2 and G10F2 primers are used, instead of RPK3-1 and G10F1. Conditions for the PCR run are identical to those described in this example for the first round of PCR.
The second round of PCR results in the amplification of a 1.6 kb fragment, which is isolated from an agarose gel by QIAEX. This fragment is digested with EcoRI and BamHI, and subcloned into BLUESCRIPT at the EcoRI and Bam HI sites., The resulting construct, pHSK723-3U, is sequenced and found to encode the remaining coding region of BRK-3 with an in-frame stop codon.
In order to assemble the full length human BRK-3, the inserts from pHSK1030 and pHSK723-3U are joined at a unique Stu I site (located at nucleotide 3219 in SEQ ID NO:1) in the vector BLUESCRIPT II This yields the complete construct pHSK1040, which contains the complete coding sequence of human BRK-3. The pHSK 1040 is shown in Figure 15. The DNA sequence of human BRK-3 is shown in SEQ ID NO: 1, and the deduced amino acid sequence for human BRK-3 is shown in SEQ ID NO: 2.
The amino acid sequence of human BRK-3 (SEQ ID NO:2) is compared to the amino acid sequence for m-BRK-3 (SEQ ID NO:8) and found to be 96.7% identical.
Example 13 Use of the BRK-3 in a ligand binding assay for the identification of BMP receptor agonists and antagonists Identification ofligands that interact with BRK-3 can be achieved through the use of assays that are designed to measure the interaction of ligands with BRK-3. An example of a receptor binding assay that is adapted to handle large numbers of samples is carried out as follows.
COS-1 cells are transfected with the cDNA for m-BRK-3 using the construct pJT6-mBRK-3L as described in example 11 above, except that cells are grown in a 12 well culture dish. At 48-68 hr after transfection, the cells are washed once with 1.0 ml binding buffer (50 mM HEPES, pH 7.4, 128 mM NaCI, 5 mM KCL, 5 mM MgSO4, 1.2 mM CaCI2, 2 mg/ml BSA), then equilibrated in the same buffer at 4°C for 60 min. with gentle shaking. After equilibration, the buffer is aspirated, and to each well is added WO 96/14579 PCT/US95/14027 39 500 pl of 4 0 C binding buffer containing [1 2 5 I]BMP-4 tracer (100-400 pM) in the presence or absence of varying concentrations of unlabeled test compounds putative ligands), for a period of 4 hours at 4 0 C with gentle shaking. For determination of nonspecific binding and complete displacement from the BMP receptor complex, BMP-2 is added at a final concentration of 10 nM. To prevent degradation of ligand, a protease inhibitor cocktail is also added, to give a final concentration of 10 gg/ml leupeptin, gg/ml antipain, 50 gg/ml aprotinin, 100 pg/ml benzamidine, 100 pg/ml soybean trypsin inhibitor, 10 pg/ml bestatin, 10 gg/ml pepstatin, and 300 pM phenylmethylsulfonyl fluoride (PMSF). At the end of the incubation period, the buffer is aspirated, and the cells are rinsed 4 times with 1 ml washing buffer (50 mM HEPES, pH 7.4, 128 mM NaCI, mM KCI, 5 mM MgSO4, 1.2 mM CaCl2, 0.5 mg/ml BSA). After the final wash is aspirated, 200 pl of solubilization buffer (10 mM Tris Cl, pH 7.4, 1 mM EDTA, 1% (v/v) Triton X-100) is added to each well and incubated at room temperature for 15-30 min.
The solubilized cells are then transferred to fresh tubes and counted in a Packard Model 5005 COBRA Gamma Counter (Packard Instruments, Meriden,
CT).
Test compounds which interact with the m-BRK-3 receptor are observed to compete with binding to the receptor with the 12 5 I]BMP-4 tracer in the cells expressing m-BRK-3, such that less 12 5 I]BMP-4 tracer is bound in the presence of the test compound in comparison to the binding observed when the tracer is incubated in the absence of the novel compound. A decrease in binding of the 12 5 I]BMP-4 tracer by at the highest concentration of the test compound that is studied demonstrates that the test compound binds to m-BRK-3.
Similar results are obtained when other, related BRK-3 protein receptor kinases of the present invention are used according to the method of this example.
Example 14 Use of m-BRK-3 and BRK-2 in a ligand binding aay for the identification ofBMP receptor agonists and antagonists Identification of ligands that interact with BRK-3 complexed to a type I BMP receptor can be achieved through the use of assays that are designed to measure the interaction of the ligands with this BMP receptor complex. A receptor binding assay that uses the m-BRK-3/BRK-2 complex and is adapted to handle large numbers of samples is carried out as follows.
COS-1 cells are transfected with the cDNAs for m-BRK-3, using the construct pJT6-mBRK-3L, and BRK-2, using the construct pJT3-BRK-2, as described in example 11 above, except that the cells are grown in a 12 well culture dish. The DNA mixture used to transfect the cells contains 2 pg/ml of pJT3-BRK-2 and 4 gg/ml of pJT6-mBRK- 3L. At 48-68 hours after transfection, the cells are washed once with 1 ml binding buffer WO 96/14579 PCT/US95/14027 mM HEPES, pH 7.4, 128 mM NaCI, 5 mM KCL, 5 mM MgSO4, 1.2 mM CaCl2, 2 mg/ml BSA), then equilibrated in the same buffer at 4 0 C for 60 min with gentle shaking.
After equilibration, the buffer is aspirated, and to each well is added 500 4l of 4 0 C binding buffer containing 12 5 I]BMP-4 tracer (100-400 pM) in the presence or absence of varying concentrations of test compounds putative ligands), for a period of 4 hours at 4 0
C
with gentle shaking. For determination of nonspecific binding and complete displacement from the BMP receptor complex, BMP-2 is added at a final concentration of 10 nM. To prevent degradation ofligand, a protease inhibitor cocktail is also added, to give a final concentration of 10 jg/ml leupeptin, 10 ig/ml antipain, 50 jg/ml aprotinin, 100 pg/ml benzamidine, 100 ug/ml soybean trypsin inhibitor, 10 pg/ml bestatin, 10 pg/ml pepstatin, and 300 iM phenylmethylsulfonyl fluoride (PMSF). At the end of the incubation period, the buffer is aspirated, and the cells are rinsed 4 times with 1 ml washing buffer (50 mM HEPES, pH 7.4, 128 mM NaCI, 5 mM KCI, 5 mM MgSO4, 1.2 mM CaC 1 2, 0.5 mg/m BSA). After the final wash is aspirated, 200 pl of solubilization buffer 10 mM Tris Cl, pH 7.4, 1 mM EDTA, 1% Triton X-100) is added to each well and incubated at room temperature for 15-30 min. The solubilized cells are then transferred to fresh tubes and counted in a Packard Model 5005 COBRA Gamma Counter (Packard Instruments, Meriden,
CT).
Test compounds which interact with the m-BRK-3/BRK-2 receptor complex are observed to compete for binding to the receptor complex with the 12 5 I]BMP-4 tracer, such that less 12 5 I]BMP-4 tracer is bound in the presence of the test compound in comparison to the binding observed when the tracer is incubated in the absence of the novel compound. A decrease in binding of the 12 5 I]BMP-4 tracer by 2 30% at the highest concentration of the test compound that is studied demonstrates that the test compound binds to the m-BRK-3/BRK-2 receptor complex.
Similar results are obtained when the other BRK-3 protein receptor kinases of the present invention, or homologues thereof, are used in combination with BRK-2 or other BMP type I receptors.
Example Use ofm-BRK-3 and BRK-2 in a sinaling assay for the identification of BMP recepto agonists and antagonists Identification ofligands that signal upon interaction with BRK-3 complexed to a type I receptor can be achieved through the use of assays that are designed to measure the activation of the receptor protein kinase domain after binding of the ligand to the receptor complex. An in vivo phosphorylation assay that measures changes in phosphorylation of proteins that are immunoprecipitated by antibodies to the BRK-2 Type I receptor in cells that express the mBRK-3/BRK-2 complex is WO 96/14579 PCT/US95/14027 41 carried out as follows.
COS-1 cells are transfected with the cDNAs for m-BRK-3, using the construct pJT6-mBRK-3S, and BRK-2, using the construct pJT3-BRK-2, as described in Example 11 above, except that cells are grown in a T175 flask (Falcon) The DNA mixture used to transfect the cells contains 2ug/ml of pJT3-BRK-2 and 4 gg/ml of pJT6-mBRK-3S. 24 hours after transfection, the cells are plated into 100 millimeter tissue culture dishes, allowed to attach to the plates for at least 5 hours, and then the media is changed to DMEM Life Technologies, Inc., Gaithersburg MD) containing 1% fetal bovine serum (HyClone, Logan, UT), and 2 mM -Lglutamine, 0.1 mM MEM nonessential amino acids solution; and grown in this low serum media for an additional 12-18 hours. These serum-starved cells are washed three times with ten milliliters per dish of phosphate-free Dulbecco's modified Eagle's medium (DMEM, Life Technologies, Inc., Gaithersburg, MD) supplemented with 2 mM L-glutamine, 0.1 mM MEM nonessential amino acids solution, and mM HEPES buffer, pH 7.4. Three milliliters per dish of supplemented phosphatefree DMEM and 0.8-1.0 milliCuries per dish of 3 2 p] orthophosphoric acid (DuPont New England Nuclear, Wilmington, DE) are then added to the cells, which are incubated at 37°C in 95% air 5% C02 for 3 hours. Following incubation, the cells are treated with appropriate concentrations of ligand stimulators such as BMP-4 for 5 minutes at 37°C. Treated cells are washed three times with ten milliliters per dish of 4 0 C 50 mM Tris-buffered saline solution (Sigma, St. Louis, MO) and lysed for ten minutes at 4°C in one milliliter per dish of P-RIP buffer (20 mM Tris pH 8.0, 100 mM sodium chloride, 1 mM disodium ethylenediaminetetraacetic acid, 0.5% Nonidet 0.5% sodium deoxycholate, 10 mM sodium iodide, 1% bovine serum albumin, 50 mM sodium fluoride, 30 mM tetrasodium pyrophosphate, 250 mM sodium orthovanadate, and 1 mM phenylmethylsulfonyl fluoride (all reagents from Sigma, St.
Louis, The lysates are clarified by centrifugation at 10,000 X g for ten minutes and sodium dodecyl sulfate (Sigma, St. Louis, MO) is added to 0.1% final concentration from a 10% stock solution (the resulting buffer is called P-RIPS:
P-
RIP supplemented with 0.1% sodium dodecyl sulfate). 100 pl of PANSORBIN (a solution of S. aureus cells; Pansorbin: Calbiochem, La Jolla, CA) is added and tubes are incubated for 30 minutes on ice. The PANSORBIN is removed by centrifugation at 10,000 X g for three minutes and the supernatants are transferred to new tubes containing a 1:100 dilution of rabbit anti-BRK-2 polyclonal antisera obtained as described in Example 8 above, except that the BRK-2 antibody that is used for this assay is generated against the peptide ARPRYSIGLEQDETYIPPC which is based on the amino acid sequence of BRK-2 in the intracellular WO 96/14579 PCT/US95/14027 42 juxtamembrane region, comprising amino acids 155-172 in SEQ ID NO: 14, with the addition of a cysteine at the C terminus to permit conjugation of the peptide, as described in Example 8, above. Following an overnight incubation at 4°C, microliters of Pansorbin is added and incubated for an additional 30 minutes at 4 0
C.
The Pansorbin-bound complexes are pelleted by centrifugation at 10,000 X g for three minutes and the pellets are washed three times with P-RIPS buffer and once with P-TNEN buffer (20 mM Tris pH 8.0, 100 mM sodium chloride, 1 mM disodium ethylenediaminetetraacetic acid, 0.5% Nonidet P-40, 50 mM sodium fluoride, 30 mM tetrasodium pyrophosphate, 250 mM sodium orthovanadate, and 1 mM phenylmethylsulfonyl fluoride). The pellets are then resuspended in 20 microliters per tube of SDS-PAGE sample buffer (5 Prime-3 Prime, Boulder, CO: 50 mM Tris pH 6.8, 2% sodium dodecyl sulfate, 0.1 M dithiothreitol, 0.1% bromophenol blue, glycerol), heated at 95 0 C for five minutes, and pelleted by centrifugation at 10,000 X g for three minutes. The supernatants are electrophoresed through a 12.5%, or 15% SDS-polyacrylamide gel (Integrated Separation Systems, Natick, MA) at a current of 35 milliamps per gel in an electrophoretic running buffer consisting of 25 mM Tris pH 8.5, 192 mM glycine, and 0.1% sodium dodecyl sulfate (Integrated Separation Systems, Natick, MA). The gels are fixed for 15 minutes in a methanol/10% acetic acid solution, dried, and either exposed for autoradiography at -80 0 C or subjected to PhosphorImager analysis (Molecular Dynamics, Sunnyvale,
CA).
Test compounds which are agonists of the BRK-2/BRK-3 receptor complex will cause an increase in phosphorylation of the proteins immunoprecipitated by antibodies to the BRK-2 receptor, as judged by an increased labeling of the proteins with [32p]. In order to test for antagonist activity, test compounds are added in the presence of a fixed concentration of BMP-4 or another BMP receptor agonist. Test compounds which are antagonists of the BRK-2/BRK-3 complex will cause a decrease in the labeling of the proteins present in the BRK-2 immunoprecipitate in comparison to that observed after stimulation of the cells with only the fixed concentration of BMP-4, or another BMP receptor agonist.
Deposit of BRK-3. t-BRK-3 and m-BRK-3 E. coli transformed with pJT4-J159F (SEQ ID NO:11 subcloned into expression vector pJT4) was deposited with the ATCC on October 7, 1993, and assigned ATCC Designation No. 69457.
E. coli transformed with pJT4-hBRK3T (SEQ ID NO:3 subcloned into expression vector pJT4) was deposited with the ATCC on August 16, 1994 and assigned ATCC designation No. 69676.
E. co/i transformed with pJT6-mBRK-3S (SEQ DD NO: 7 subcloned into expression vector pJT6) was deposited with the ATCC on September 28. 1994 and assigned ATCC designation No. 69694.
E. co/i transformed with PJT6-MBRK-3L (SEQ ID NO:7 subcloned into expression vector pJT6) was deposited with the ATCC onl September 28. 1994 and assigned ATCC designation No. 69695.
E. co/i transformed with pHSK 1040 (SEQ ID NO: I subcloned into BLUESCRIPT 11 was deposited with the ATCC on October 12. 1994. and assigned ATCC designation No. 69703.
All publications mentioned hereinabove are hereby incorpjorated in the-ir entimati I"' *4 4* *4
I
4*54 4* *4 a.
Ba.
*4* a
B
a.
*9 B .4 94 0 reference. 7 Y It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to one skiled in the art and are to be included in the spirit and purview of this 15 application and scope of the appended claims.
WO 96/14579 PCT/US95/14027 44 SEQUENCE
LISTING
GENERAL INFORMATION: APPLICANT: ROSENBAUM, JAN S.
(ii) TITLE OF INVENTION: THE USE OF A BMP PROTEIN RECEPTOR COMPLEX FOR SCREENING BONE METABOLISM ACTIVES AND CELLS CO-TRANSFECTED WITH A TYPE II BMP RECEPTOR AND A TYPE I BMP RECEPTOR (iii) NUMBER OF SEQUENCES: 26 (iv) CORRESPONDENCE
ADDRESS:
ADDRESSEE: THE PROCTER GAMBLE COMPANY STREET: 11810 EAST MIAMI RIVER ROAD CITY: ROSS STATE: OH 0 COUNTRY: USA ZIP: 45061 COMPUTER READABLE
FORM:
MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM:
PC-DOS/MS-DOS
SOFTWARE: Patentln Release Version #1.25 (vi) CURRENT APPLICATION
DATA:
30 A) APPLICATION NUMBER: FILING DATE:
CLASSIFICATION:
(Viii) ATTORNEY/AGENT
INFORMATION:
NAME: CORSTANJE, BRAHM J.
5 REGISTRATION NUMBER: 34,804 REFERENCE/DOCKET NUMBER: Case 5474R (ix) TELECOMMUNICATION
INFORMATION:
TELEPHONE: 513-627-2858 TELEFAX: 513-627-0260 INFORMATION FOR SEQ ID NO:1: SEQUENCE
CHARACTERISTICS:
LENGTH: 3601 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: Linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY:
CDS
LOCATION: 409..3525 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CGCCCCCGA CCCCGGATCG AATCCCCGCC CTCCGCACCC TGGATATGTT TTCTCCCAGA CCTGGATATT TTTTTGATAT CGTGAAACTA CGAGGGAAAT AATTTGGGGG ATTTCTTCTT 120 GGCTCCCTGC TTTCCCCACA GACATGCCTT CCGTTTGGAG GGCCGCGGCA CCCCGTCCGA 180 GGCGAAGGAA CCCCCCAGC CGCGAGGGAG AGAAATGAAG GGAATTTCTG CAGCGGCATG 240 AAAGCTCTGC AGCTAGGTCC TCTCATCAGC CATTTGTCCT TTCAAACTGT ATTGTGATAC 300 GGGCAGGATC AGTCCACGGG AGAGAAGACG AGCCTCCCGG CTGTTTCTCC GCCGGTCTAC 360 TTCCCATATT TCTTTTCTTT GCCCTCCTGA TTCTTGGCTG GCCCAGGG ATG ACT TCC 417 Met Thr Ser WO 96/14579 PCTIUS95/14027 1 TCG CTG CAG CGG CCC TGG CGG GTG CCC TGG CTA CCA TGG ACC ATC CTG 465 Ser Leu Gin Arg Pro Trp Arg Vat Pro Trp Leu Pro Trp Thr Ile Leu 5 10 15 CTG GTC AGC ACT GCG GCT GCT TCG CAG AT CAA GAA CGG CTA TGT GCG 513 Leu Vat Ser Thr Ala Ala Ala Ser Gin Asn Gin GLu Arg Leu Cys Ala 35 A A5 20 25 TTT AAA GAT CCG TAT CAG CAA GAC CTT GGG ATA GGT GAG AGT AGA ATC 561 Phe Lys Asp Pro Tyr Gin Gin Asp Leu GLy lie GLy GLu Ser Arg lie 45 TCT CAT GAA AAT GGG ACA ATA TTA TGC TCG AAA GGT AGC ACC TGC TAT 609 Ser His Giu Asn Giy Thr ILe Leu Cys Ser Lys Gly Ser Thr Cys Tyr 60 GGC CTT TGG GAG AAA TCA AAA GGG GAC ATA AT CTT GTA AAA CAA GGA 657 Gvy Leu Trp Giu Lys Ser Lys Gy Asp lie Asn Leu Vat Lys Gin GLy 75 TGT TGG TCT CAC ATT GGA GAT CCC CAA GAG TGT CAC TAT GAA GAA TGT 705 Cys Trp Ser His Ile GLy Asp Pro Gin Gtu Cys His Tyr Gtu Giu Cys 85 90 95 GTA GTA ACT ACC ACT CCT CCC TCA ATT CAG AAT GGA ACA TAC CGT TTC 753 Vat Vat Thr Thr Thr Pro Pro Ser lie Gin Asn Gty Thr Tyr Arg Phe 100 105 110 115 1 TGC TGT TGT AGC ACA GAT TTA TGT AAT GTC AAC TTT ACT GAG AAT TTT 801 Cys Cys Cys Ser Thr Asp Leu Cys Asn Vat Asn Phe Thr Gtu Asn Phe 120 125 130 CCA CCT CCT GAC ACA ACA CCA CTC AGT CCA CCT CAT TCA TTT AAC CGA 849 Pro Pro Pro Asp Thr Thr Pro Leu Ser Pro Pro His Ser Phe Asn Arg 135 140 145 GAT GAG ACA ATA ATC ATT GCT TTG GCA TCA GTC TCT GTA TTA GCT GTT 897 Asp Giu Thr lie lie lie Ata Leu Ala Ser Vat Ser Vat Leu Ala Vat 150 155 160 TTG ATA GTT GCC TTA TGC TTT GGA TAC AGA ATG TTG ACA GGA GAC CGT 945 Leu Ile Vat Ala Leu Cys Phe Gly Tyr Arg Met Leu Thr Gly Asp Arg 165 170 175 AAA CAA GGT CTT CAC AGT ATG AAC ATG ATG GAG GCA GCA GCA TCC GAA 993 Lys Gin Gly Leu His Ser Met Asn Met Met Gtu Aia Ala Ala Ser Glu 180 185 190 195 CCC TCT CTT GAT CTA GAT AAT CTG AAA CTG TTG GAG CTG ATT GGC CGA 1041 Pro Ser Leu Asp Leu Asp Asn Leu Lys Leu Leu GLu Leu lie Gly Arg 200 205 210 GGT CGA TAT GGA GCA GTA TAT AAA GGC TCC TTG GAT GAG CGT CCA GTT 1089 GLy Arg Tyr GLy Ala Vat Tyr Lys Giy Ser Lau Asp Giu Arg Pro Val 215 220 225 GCT GTA AAA GTG TTT TCC TTT GCA AAC CGT CAG AAT TTT ATC AAC GAA 1137 Ala Vat Lys Vat Phe Ser Phe Ala Asn Arg Gin Asn Phe lIe Asn GLu 230 235 240 AAG AAC ATT TAC AGA GTG CCT TTG ATG GAA CAT GAC AAC ATT GCC CGC 1185 Lys Asn lie Tyr Arg Vat Pro Leu Met GLu His Asp Asn lie Ala Arg 245 250 255 TTT ATA GTT GGA GAT GAG AGA GTC ACT GCA GAT GGA CGC ATG GAA TAT 1233 Phe lie Vat Gty Asp Giu Arg Vat Thr Ala Asp Gly Arg Met Glu Tyr 260 265 270 275 TTG CTT GTG ATG GAG TAC TAT CCC AAT GGA TCT TTA TGC AAG TAT TTA 1281 Leu Leu Vat Met Giu Tyr Tyr Pro Asn GLy Ser Leu Cys Lys Tyr Leu 280 285 290 WO 96/14579 PCT/US95/14027 46 AGT CTC CAC ACA AGT GAC TGG GTA AGC TCT TGC CGT CTT GCT CAT TCT 1329 Ser Leu His Thr Ser Asp Trp Vat Ser Ser Cys Arg Leu Ala His Ser 295 300 305 GTT ACT AGA GGA CTG GCT TAT CTT CAC ACA GAA TTA CCA CGA GGA GAT 1377 Vat Thr Arg Gly Leu Ala Tyr Leu His Thr Gtu Leu Pro Arg Gly Asp 310 315 320 CAT TAT AAA CCT GCA ATT TCC CAT CGA GAT TTA AAC AGC AGA AAT GTC 1425 His Tyr Lys Pro Ala I 3e Ser His Arg Asp Leu Asn Ser Arg Asn Vat 325 330 335 CTA GTG AAA AAT GAT GGA ACC TGT GTT ATT AGT GAC TTT GGA CTG TCC 1473 Leu Vat Lys Asn Asp Gly Thr Cys Vat lie Ser Asp Phe GLy Leu Ser 340 345 350 355 ATG AGG CTG ACT GGA AAT AGA CTG GTG CGC CCA GGG GAG GAA GAT AAT 1521 Met Arg Leu Thr Gly Asn Arg Leu Vat Arg Pro GLy Gtu Gtu Asp Asn 360 365 370 GCA GCC ATA AGC GAG GTT GGC ACT ATC AGA TAT ATG GCA CCA GAA GTG 1569 Ala ALa Ile Ser Gtu Vat GLy Thr Ite Arg Tyr Met Ala Pro Gtu Vat 375 380 385 CTA GAA GGA GCT GTG AAC TTG AGG GAC TGT GAA TCA GCT TTG AAA CAA 1617 Leu Gtu GLy Ala Vat Asn Leu Arg Asp Cys GLu Ser Ala Leu Lys Gin 390 395 400 GTA GAC ATG TAT GCT CTT GGA CTA ATC TAT TGG GAG ATA TTT ATG AGA 1665 Vat Asp Met Tyr Ala Leu Gly Leu lie Tyr Trp GLu Ile Phe Met Arg 405 410 415 TGT ACA GAC CTC TTC CCA GGG GAA TCC GTA CCA GAG TAC CAG ATG OCT 1713 Cys Thr Asp Leu Phe Pro Gy GLu Ser Vat Pro Gtu Tyr GIn Met Ala 420 425 430 435 TTT CAG ACA GAG GTT GGA AAC CAT CCC ACT TTT GAG GAT ATG CAG GTT 1761 Phe Gn Thr GLu Vat GLy Asn His Pro Thr Phe Gtu Asp Met GIn Vat 440 445 450 CTC GTG TCT AGG GA AAA CAG AGA CCC AAG TTC CCA GAA GCC TGG AAA 1809 Leu Vat Ser Arg Gu Lys Gin Arg Pro Lys Phe Pro GLu Ala Trp Lys 455 460 465 GAA AAT AGC CTG GCA GTG AGG TCA CTC AG GA ACA ATC GAA GAC TGT 1857 OLu Asn Ser Leu Ala Vat Arg Ser Leu Lys Gu Thr lIe Gu Asp Cys 470 475 480 TGG GAC CAG GAT GCA GAG GCT CGG CTT ACT GCA CAG TGT GCT GAG GAA 1905 Trp Asp Gn Asp Ala Glu Ala Arg Leu Thr Ala Gn Cys Ala Gu Gu 485 490 495 AGO ATG GCT GAA CTT ATG ATG ATT TGG GAA AGA AAC AAA TCT GTG AGC 1953 Arg Met Ala Gtu Leu Met Met lIe Trp Glu Arg Asn Lys Ser Vat Ser 500 505 510 515 CCA ACA OTC AAT CCA ATG TCT ACT OCT ATG CAG AAT GAA COC AAC CTO 2001 Pro Thr Vat Asn Pro Met Ser Thr Ala Met GIn Asn Otu Arg Asn Leu 520 525 530 TCA CAT AAT AGG CGT GTG CCA AAA ATT GGT CCT TAT CCA GAT TAT TCT 2049 Ser His Asn Arg Arg Vat Pro Lys Ite Oly Pro Tyr Pro Asp Tyr Ser 535 540 545 TCC TCC TCA TAC ATT GAA GAC TCT ATC CAT CAT ACT GAC AGC ATC GTG 2097 Ser Ser Ser Tyr lIe Glu Asp Ser Ile His His Thr Asp Ser lIe Vat 550 555 560 AAG AAT ATT TCC TCT GAG CAT TCT ATG TCC AGC ACA CCT TTG ACT ATA 2145 Lys Asn lIe Ser Ser Gtu His Ser Met Ser Ser Thr Pro Leu Thr lIe 565 570 575 GGG GAA AAA AAC COA AAT TCA ATT AAC TAT GAA CGA CAG CAA OCA CAA 2193 GLy Gtu Lys Asn Arg Asn Ser Ile Asn Tyr GCu Arg GIn GIn Ala GIn WO 96/14579 PCT/US95/14027 47 580 585 590 595 GCT CGA ATC CCC AGC CCT GAA ACA AGT GTC ACC AGC CTC TCC ACC AAC 2241 Ala Arg Ile Pro Ser Pro GLu Thr Ser Vat Thr Ser Leu Ser Thr Asn 600 605 610 ACA ACA ACC ACA AAC ACC ACA GGA CTC ACG CCA AGT ACT GGC ATG ACT 2289 Thr Thr Thr Thr Asn Thr Thr Gly Leu Thr Pro Ser Thr Gly Met Thr 615 620 625 ACT ATA TCT GAG ATG CCA TAC CCA GAT GAA ACA AAT CTG CAT ACC ACA 2337 Thr ILe Ser Glu Met Pro Tyr Pro Asp Glu Thr Asn Leu His Thr Thr 630 635 640 AAT GTT GCA CAG TCA ATT GGG CCA ACC CCT GTC TGC TTA CAG CTG ACA 2385 Asn Vat ALa GLn Ser lie Gly Pro Thr Pro Vat Cys Leu GLn Leu Thr 645 650 655 GAA GAA GAC TTG GAA ACC AAC AAG CTA GAC CCA AAA GAA GTT GAT AAG 2433 GLu GLu Asp Leu Glu Thr Asn Lys Leu Asp Pro Lys Giu Vat Asp Lys 660 665 670 675 AAC CTC AAG GAA AGC TCT GAT GAG AAT CTC ATG GAG CAC TCT CTT AAA 2481 Asn Leu Lys Giu Ser Ser Asp GLu Asn Leu Met Glu His Ser Leu Lys 680 685 690 CAG TTC AGT GGC CCA GAC CCA CTG AGC AGT ACT AGT TCT AGC TTG CTT 2529 Gin Phe Ser GLy Pro Asp Pro Leu Ser Ser Thr Ser Ser Ser Leu Leu 695 700 705 TAC CCA CTC ATA AAA CTT GCA GTA GAA GCA ACT GGA CAG CAG GAC TTC 2577 Tyr Pro Leu lie Lys Leu Ala Vai GLu Ala Thr Gly Gin Gin Asp Phe 710 715 720 ACA CAG ACT GCA AAT GGC CAA GCA TGT TTG ATT CCT GAT GTT CTG CCT 2625 Thr Gin Thr ALa Asn GLy GiLn ALa Cys Leu ILe Pro Asp Vat Leu Pro 725 730 735 ACT CAG ATC TAT CCT CTC CCC AAG CAG CAG AAC CTT CCC AAG AGA CCT 2673 Thr Gin Ile Tyr Pro Leu Pro Lys Gin Gin Asn Leu Pro Lys Arg Pro 740 745 750 755 ACT AGT TTG CCT TTG AAC ACC AAA AAT TCA ACA AAA GAG CCC CGG CTA 2721 Thr Ser Leu Pro Leu Asn Thr Lys Asn Ser Thr Lys GLu Pro Arg Leu 760 765 770 AAA TTT GGC AGC AAG CAC AAA TCA AAC TTG AAA CAA GTC GAA ACT GGA 2769 Lys Phe GLy Ser Lys His Lys Ser Asn Leu Lys Gin Vat GLu Thr GLy 775 780 785 GTT GCC AAG ATG AAT ACA ATC AAT GCA GCA GAA CCT CAT GTG GTG ACA 2817 Vat Ala Lys Met Asn Thr ILe Asn Ala Ala GLu Pro His Vat Vat Thr 790 795 800 GTC ACC ATG AAT GGT GTG GCA GGT AGA AAC CAC AGT GTT AAC TCC CAT 2865 Vat Thr Met Asn Gly Vat Ala GLy Arg Asn His Ser Vat Asn Ser His 805 810 815 GCT GCC ACA ACC CAA TAT GCC AAT GGG ACA GTA CTA TCT GGC CAA ACA 2913 Ala Ala Thr Thr Gin Tyr ALa Asn Gly Thr Vat Leu Ser GLy Gin Thr 820 825 830 835 ACC AAC ATA GTG ACA CAT AGG GCC CAA GAA ATG TTG CAG AAT CAG TTT 2961 Thr Asn ILe Vat Thr His Arg Ala Gin GLu Met Leu Gin Asn GLn Phe 840 845 850 ATT GGT GAG GAC ACC CGG CTG AAT ATT AAT TCC AGT CCT GAT GAG CAT 3009 Ile Gly GLu Asp Thr Arg Leu Asn Ile Asn Ser Ser Pro Asp GLu His 855 860 865 GAG CCT TTA CTG AGA CGA GAG CAA CAA GCT GGC CAT GAT GAA GGT GTT 3057 Glu Pro Leu Leu Arg Arg GLu GLn Gin Ala Gly His Asp Glu Gly Vat 870 875 880 WO 96/14579 PCTIUS95/14027 48 CTG GAT CGT CTT GTG GAC AGO AGO GAA COG CCA CTA GAA GOT GGC CGA 3105 Leu Asp Arg Leu Val Asp Arg Arg Oiu Arg Pro Leu Glu Gly Gly Arg 885 890 895 ACT AAT TCC AAT AAC MAC AAC AGC AAT CCA TGT TCA GMA CMA GAT OTT 3153 Thr Asn Ser Asn Asn Asn Asn Ser Asn Pro Cys Ser GiU Gin Asp Vat 900 905 910 915 CTT GCA CAG GOT GTT CCA AOC ACA GCA GCA OAT CCT GGG CCA TCA MAG 3201 Leu ALa Gin GLy Vat Pro Ser Thr Ala Ala Asp Pro GLy Pro Ser Lys 920 925 930 CCC AGA AGA GCA CAG AGG CCT MAT TCT CTG GAT CTT TCA GCC ACA AAT 3249 Pro Arg Arg Ala Gin Arg Pro Asn Ser Leu Asp Leu Ser Ala Thr Asn 935 940 945 OTC CTG GAT GOC AGC AOT ATA CAG ATA GOT GAG TCA ACA CMA GAT GGC 3297 Val Leu Asp Gly Ser Ser Ilie Gin Ile GLy Oiu Ser Thr Gin Asp Gly 950 955 960 AAA TCA OGA TCA GOT GMA MG ATC MAG AAA COT OTO AMA ACT CCC TAT 3345 Lys Ser GLy Ser Oly Oiu Lys Ilie Lys Lys Arg Vat Lys Thr Pro Tyr 965 970 975 TCT CTT MAG COO TOG COC CCC TCC ACC TOG OTC ATC TCC ACT GAA TCO 3393 Ser Leu Lys Arg Trp Arg Pro Ser Thr Trp Vat Ilie Ser Thr Giu Ser 980 985 990 995 CTG GAC TOT GMA OTC MAC AAT AAT GGC AOT AAC AGO OCA OTT CAT TCC 3441 Leu Asp Cys Giu Vat Asn Asn Asn Oly Ser Asn Arg Ala Vat His Ser 1000 1005 1010 AAA TCC AOC ACT OCT OTT TAC CTT GCA GMA OGA GOC ACT OCT ACA ACC 3489 Lys Ser Ser Thr Aia Vat Tyr Leu Ala Oiu Oty Gly Thr Ala Thr Thr 1015 1020 1025 ATO OTO TCT AMA OAT ATA OGA ATO MAC TOT CTO TOAATOTTT TCMAGCCTAT 3542 Met Val Scr Lys Asp Ilie Gly Met Asn Cys Leu 1030 1035 OOAOTGAMAT TATTTTTTGC ATCATTTMAA CATOCAGMOG ATGTTTMAAA AAAAAMAAA 3601 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 1038 amino acids TYPE: amino acid TOPOLOGY: Linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Thr Ser Ser Leu Gin Arg Pro Trp Arg Vat Pro Trp Leu Pro Trp 1 5 10 Thr Ilie Leu Leu Vat Ser Thr Ala Ala Ala Ser Gin Asn Gin Glu Arg 20 25 Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp Leu OLy Ilie Gly OLu 40 5r Arg Ilie Ser His Oiu Asn oLy Thr Ilie Leu Cys Ser Lys Gly Ser 6550 55 Thr Cys Tyr GLy Leu Trp Giu Lys Ser Lys Gly Asp Ilie Asn Leu Vat 70 75 Lys Gin GLy Cys Trp Ser His Ilie Gly Asp Pro Gin Oiu Cys His Tyr 90 Giu Oiu Cys Vat Val Thr Thr Thr Pro Pro Ser Ilie GIn Asn OLy Thr 100 105 110 WO 96/14579 PCTJUS95/14027 Tyr Arg Phe Cys Cys Cys Ser Thr 115 120 Glu Asn Phe Pro Pro Pro Asp Thr 130 135 Phe Asn Arg Asp Glu Thr lie lie 145 150 Leu Ala Vat Leu lie Vat Ala Leu 165 Asp Leu Cys Asn Vat Asn Phe Thr 125 Thr Pro Leu Ser Pro Pro His Ser 140 Ile Ala Leu Ala Ser Vat Ser Vat 155 160 Cys Phe Gly Tyr Arg Met Leu Thr 170 175 GLy Asp Arg Lys GIn GLy Leu His Ser Met Asn Met Met Gtu Ala Ala 180 185 190 Ala Ser Gtu Pro Ser Leu Asp Leu Asp Asn Leu Lys Leu Leu Gtu Leu 195 200 205 Ile Gly Arg Gly Arg Tyr GLy Ala Vat Tyr Lys GLy Ser Leu Asp Gtu 210 215 220 Arg Pro Vat Ala Vat Lys VaL Phe Ser Phe Ala Asn Arg GIn Asn Phe 225 230 235 240 lie Asn Gtu Lys Asn Ile Tyr Arg Vai Pro Leu Met Giu His Asp Asn 245 250 255 Ile Ala Arg Phe Ile Vat GLy Asp Glu Arg Vat Thr Ala Asp Gly Arg 260 265 270 Met Gtu Tyr Leu Leu Vat Met Gtu Tyr Tyr Pro Asn Gly Ser Leu Cys 275 280 285 Lys Tyr Leu Ser Leu His Thr Ser Asp Trp Vat Scr Ser Cys Arg Leu 290 295 300 Ala His Ser Vat Thr Arg Gly Leu Ala Tyr Leu His Thr Gtu Leu Pro 305 310 315 320 Arg Gty Asp His Tyr Lys Pro Ala lie Ser His Arg Asp Leu Asn Ser 325 330 335 Arg Asn Vat Leu Vat Lys Asn Asp Giy Thr Cys Vat lie Ser Asp Phe 340 345 350 GLy Leu Ser Met Arg Leu Thr GLy Asn Arg Leu Vat Arg Pro Giy Gtu 355 360 365 GLu Asp Asn Ala Ala lie 5cr Gtu Vat Gly Thr lIe Arg Tyr Met Ala 370 375 380 Pro Giu Vat Leu Gt~u Gly Ala Vat Asn Leu Arg Asp Cys Giu Ser Ala 385 390 395 400 Leu Lys GIn Vat Asp Met Tyr Ala Leu GLy Leu lie Tyr Trp G~u lie 405 410 415 Z% Phe Met Arg Cys Thr Asp Leu Phe Pro Giy G~u Ser Vat Pro G~u Tyr 420 425 430 Gin Met Ala Phe GIn Thr Giu Vat GLy Asn His Pro Thr 435 440 445 Met Gin Val Leu Vat 5cr Arg Gtu Lys Gin Arg Pro Lys 450 455 460 Ala Trp Lys Gtu Asn Ser Leu Ala Vat Arg Ser Leu Lys 465 470 475 Gtu Asp Cys Trp Asp GIn Asp Ala G~u Ala Arg Leu Thr 485 490 Ala Gtu Gtu Arg Met Ala Gtu Leu Met Met lIe Trp G~u Phe Gtu Asp Phe Pro Gtu G~u Thr lIe 480 Ala Gin Cys 495 Arg Asn Lys WO 96/14579 PCTIUS95/14027 500 505 510 Ser Val Ser Pro Thr Val Asn Pro Met Ser Thr Ala Met Gin Asn Glu 5515 520 525 Arg Ash Leu Ser His Asn Arg Arg Vat Pro Lys Ilie Giy Pro Tyr Pro 530 535 540 Asp Tyr Ser Ser Ser Ser Tyr Ilie Gtu Asp Ser Ilie His His Thr Asp 545 550 555 560 Ser Ile Vat Lys Asn lie Ser Ser Giu His Ser Met Ser Ser Thr Pro 565 570 575 Leu Thr Ilie Giy Giu Lys Asn Arg Ash Ser Ile Ash Tyr Giu Arg Gin 580 585 590 Gin Ala Gin Aia Arg Ilie Pro Ser Pro Giu Thr Ser Vai Thr Ser Leu 59 600 '605 Ser Thr Asn Thr Thr Thr Thr Asn Thr Thr Gly Leu Thr Pro Ser Thr 610 615 620 Gly Met Thr Thr Ilie Ser Giu Met Pro Tyr Pro Asp Gtu Thr Asn Lou 625 .630 635 640 His Thr Thr Asn Vat Aia Gin Ser Ilie Giy Pro Thr Pro Vat Cys Leu 645 650 655 Gin Leu Thr Giu Giu Asp Leu Giu Thr Asn Lys Leu Asp Pro Lys Giu 660 665 670 Vat Asp Lys Ash Leu Lys Giu Ser Ser Asp Giu Ash Leu Met Giu His 675 680 685 Ser Leu Lys Gin Phe Ser Gly Pro Asp Pro Leu 5cr Ser Thr Ser Scr 690 695 700 Scr Leu Leu Tyr Pro Leu Ilie Lys Leu Ala Vat Giu Ala Thr Gly Gin 705 710 715 720 Gin Asp Phe Thr Gin Thr Ala Asn Gty Gin Ala Cys Lou Ilie Pro Asp 725 730 735 Vat Leu Pro Thr Gin Ile Tyr Pro Leu Pro Lys Gin Gin Asn Leu Pro 740 745 750 Lys Arg Pro Thr 5cr Leu Pro Lau Asn Thr Lys Asn Ser Thr Lys Giu 555 760 765 Pro Arg Lau Lys Phe Gly Ser Lys His Lys Ser Asn Leu Lys Gin Vai 770 775 780 Gtu Thr GLy Vat Ala Lys Met Asn Thr Ile Asn Ala Ala Giu Pro His 785 790 795 800 Vat Val Thr Vat Thr Met Asn Gly Vat Ala Giy Arg Ash His Ser Vat 805 810 815 Asn 5cr His Ala Ala Thr Thr Gin Tyr Ala Ash Gly Thr Vat Lou Ser 820 825 830 GLy Gin Thr Thr Asn lie Vai Thr His Arg ALa Gin Giu Met Lou Gin 65835 840 845 Ash Gin Phe lie Gly Giu Asp Thr Arg Lou Ash lie Asn Ser Ser Pro 850 855 860 Asp Gtu His Giu Pro Lou Lou Arg Arg Glu Gin Gin Ala Gly His Asp 865 870 875 880 Giu Giy Vat Lou Asp Arg Lou Vat Asp Arg Arg Giu Arg Pro Lou Glu 885 890 895 WO 96/14579 PCTfUS95/14027 51 Gly GLy Arg Thr Asn Ser Asn Asn Asn Asn Ser Asn Pro Cys Ser GLu 900 905 910 GLn Asp Vat Leu Ala Gin Gly Vat Pro Ser Thr Ala ALa Asp Pro GLy 915 920 925 Pro Ser Lys Pro Arg Arg Ala Gin Arg Pro Asn Ser Leu Asp Leu Ser 930 935 940 Ala Thr Asn Vat Leu Asp GLy Ser Ser Ile Gin Ile Gly GLu Ser Th- 945 950 955 960 Gin Asp Gly Lys Ser GLy Ser Gly Gtu Lys Ile Lys Lys Arg Vat Lys 965 970 975 Thr Pro Tyr Ser Leu Lys Arg Tip Arg Pro Ser Thr Tip Vat Ile Ser 980 985 990 Thr Giu Ser Leu Asp Cys Giu Vat Asn Asn Asn Gly Ser Asn Arg Aia 995 1000 1005 Vat His Ser Lys Ser Ser Thr Ala Vat Tyr Leu Ala Giu Gly Giy Thr 1010 1015 1020 Ala Thr Thr Met Vat Ser Lys Asp lie Gly Met Asn Cys Leu 1025 1030 1035 INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 2156 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 409..2154 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CGCCCCCCGA CCCCGGATCG AATCCCCGCC CTCCGCACCC CCTGGATATT TTTTTGATAT CGTGAAACTA CGAGGGAAAT GGCTCCCTGC TTTCCCCACA GACATGCCTT CCGTTTGGAG GGCGAAGGAA CCCCCCCAGC CGCGAGGGAG AGAAATGAAG AAAGCTCTGC AGCTAGGTCC TCTCATCAGC CATTTGTCCT GGGCAGGATC AGTCCACGGG AGAGAAGACG AGCCTCCCGG 4n TTCCCATATT TCTTTTCTTT GCCCTCCTGA TTCTTGGCTG TGGATATGTT TTCTCCCAGA AATTTGGGGG ATTTCTTCTT GGCCGCGGCA CCCCGTCCGA GGAATTTCTG CAGCGGCATG TTCAAACTGT ATTGTGATAC CTGTTTCTCC GCCGGTCTAC GCCCAGGG ATG ACT TCC Met Thr Ser TCG CTG CAG CGG CCC TGG CGG GTG CCC TGG CTA CCA TGG ACC ATC CTG Ser Leu Gin Arg Pro Tip Arg Vat Pro Tip Leu Pro Trp Thr lie Leu s 10 CTG GTC AGC ACT GCG GCT GCT TCG CAG AAT CAA GAA CGG CTA TGT GCG Leu Vat Ser Thr Ala Ala Ala Ser Gin Asn Gin Giu Arg Leu Cys Ala 25 30 TTT AAA GAT CCG TAT CAG CAA GAC CTT GGG ATA GGT GAG AGT AGA ATC Phe Lys Asp Pro Tyr GIn Gin Asp Leu GLy Ile GLy Giu Ser Arg lie 45 WO 96/14579 PCTIUS95/14027 TCT CAT Ser His GGC CTT GLy Leu TGT TGG Cys Trp GTA GTA Val Vat 100 TGC TGT Cys Cys CCA CCT Pro Pro GAT GAG Asp GLu AAT GGG ACA ATA TTA TGC Asn GLy Thr lie Leu Cys 60 GAG AAA TCA AAA GGG GAC GLu Lys Ser Lys Gly Asp CAC ATT GGA GAT CCC CAA His lie GLy Asp Pro GLn 90 ACC ACT CCT CCC TCA ATT Thr Thr Pro Pro Ser ILe 105 AGC ACA GAT TTA TGT AAT Ser Thr Asp Leu Cys Asn 120 GAC ACA ACA CCA CTC AGT Asp Thr Thr Pro Leu Ser 135 140 ATA ATC ATT GCT TTG GCA lie He ILe Ala Leu Ala 155 TCG AAA Ser Lys ATA AAT Ile Asn GAG TGT Glu Cys CAG AAT Gin Asn 110 GTC AAC Vai Asn 125 CCA CCT Pro Pro TCA GTC Ser Val GGT AGC GLy Ser CTT GTA Leu Val 80 CAC TAT His Tyr 95 GGA ACA GLy Thr TTT ACT Phe Thr CAT TCA His Ser TCT GTA Ser Vat ACC TGC TAT Thr Cys Tyr AAA CAA GGA Lys Gin Gly GAA GAA TGT GLu Glu Cys TAC CGT TTC Tyr Arg Phe 115 GAG AAT TTT Glu Asn Phe 130 TTT AAC CGA Phe Asn Arg 145 TTA GCT GTT Leu Ala Vat 160 TTG ATA GTT GCC TTA TGC TTT GGA TAC AGA ATG TTG ACA GGA GAC CGT Leu ILe Vat Ala Leu Cys Phe Gly Tyr Arg Met Leu Thr GLy Asp Arg 165 170 175 AAA CAA GGT CTT CAC AGT ATG AAC ATG ATG GAG GCA GCA GCA TCC GAA Lys Gin Gly Leu His Ser Met Asn Met Met Glu Ala ALa Ala Ser GLu 180 185 190 195 CCC TCT CTT GAT CTA GAT AAT CTG AAA CTG TTG GAG CTG ATT GGC CGA Pro Ser Leu Asp Leu Asp Asn Leu Lys Leu Leu Glu Leu lie Gly Arg 4 200 205 210 GGT CGA TAT GGA GCA GTA TAT AAA GGC TCC TTG GAT GAG CGT CCA GTT Gly Arg Tyr Gly Ala Vai Tyr Lys Gly Ser Leu Asp GLu Arg Pro Vai 215 220 225 GCT GTA AAA GTG TTT TCC TTT GCA AAC CGT CAG AAT TTT ATC AAC GAA Ala Vat Lys Vai Phe Ser Phe Ala Asn Arg Gin Asn Phe Ile Asn Glu 230 235 240 AAG AAC ATT TAC AGA GTG CCT TTG ATG GAA CAT GAC AAC ATT GCC CGC Lys Asn lie Tyr Arg Val Pro Leu Met GLu His Asp Asn ILe Ala Arg 245 250 255 TTT ATA GTT GGA GAT GAG AGA GTC ACT GCA GAT GGA CGC ATG GAA TAT Phe Ile Vat Gly Asp GLu Arg Vat Thr ALa Asp Gly Arg Met GLu Tyr 260 265 270 275 TTG CTT GTG ATG GAG TAC TAT CCC AAT GGA TCT TTA TGC AAG TAT TTA Leu Leu Vat Met Glu Tyr Tyr Pro Asn GLy Ser Leu Cys Lys Tyr Leu 6 280 285 290 AGT CTC CAC ACA AGT GAC TGG GTA AGC TCT TGC CGT CTT GCT CAT TCT Ser Leu His Thr Ser Asp Trp Vat Ser Ser Cys Arg Leu Ala His Ser 295 300 305 GTT ACT AGA GGA CTG GCT TAT CTT CAC ACA GAA TTA CCA CGA GGA GAT Vat Thr Arg GLy Leu Ala Tyr Leu His Thr GLu Leu Pro Arg Gly Asp 310 315 320 CAT TAT AAA CCT GCA ATT TCC CAT CGA GAT TTA AAC AGC AGA AAT GTC His Tyr Lys Pro ALa lie Ser His Arg Asp Leu Asn Ser Arg Asn Vat 325 330 335 CTA GTG AAA AAT GAT GGA ACC TGT GTT ATT AGT GAC TTT GGA CTG TCC Leu Vat Lys Asn Asp GLy Thr Cys Vat ILe Ser Asp Phe Gly Leu Ser 945 993 1041 1089 1137 1185 1233 1281 1329 1377 1425 WO 96/14579 PCT/US95/14027 340 345 350 ATG AGG CTG ACT GGA AAT AGA CTG GTG CGC CCA GGG GAG GAA Met Arg Leu Thr GLy Asn Arg Leu Vat Arg Pro GLy GLu GLu 360 365 GCA GCC ATA AGC GAG GTT GGC ACT ALa Ala ILe Ser GLu VaL Gly Thr 375 CTA GAA GGA GCT GTG AAC TTG AGG Leu GLu Gly ALa VaL Asn Leu Arg 390 395 GTA GAC ATG TAT GCT CTT GGA CTA Vat Asp Met Tyr Ala Leu GLy Leu 405 410 TGT ACA GAC CTC TTC CCA GGG GAA Cys Thr Asp Leu Phe Pro GLy GLu 420 425 TTT CAG ACA GAG GTT GGA AAC CAT Phe GLn Thr GLu Vat Gly Asn His 440 CTC GTG TCT AGG GAA AAA CAG AGA Leu Vat Ser Arg Glu Lys GLn Arg 30 455 GAA AAT AGC CTG GCA GTG AGG TCA GLu Asn Ser Leu Ala Vat Arg Ser 470 475 TGG GAC CAG GAT GCA GAG GCT CGG Trp Asp GLn Asp Ala GLu ALa Arg 485 490 AGG ATG GCT GAA CTT ATG ATG ATT Arg Met ALa Glu Leu Met Met Ile 500 505 CCA ACA GTC AAT CCA ATG TCT ACT Pro Thr Vat Asn Pro Met Ser Thr 520 TCA CAT AAT AGG CGT GTG CCA AAA Ser His Asn Arg Arg Vat Pro Lys 535 TCC TCC TCA TAC ATT GAA GAC TCT Ser Ser Ser Tyr ILe GLu Asp Ser 550 555 ATC AGA TAT ATG GCA CCA GAA GTG Ile Arg Tyr Met Ala Pro Glu Vat 380 385 GAC TGT GAA TCA GCT TTG AAA CAA Asp Cys GLu Ser ALa Leu Lys GLn 400 ATC TAT TGG GAG ATA TTT ATG AGA Ile Tyr Trp GLu lie Phe Met Arg 415 TCC GTA CCA GAG TAC CAG ATG GCT Ser Vat Pro GLu Tyr GLn Met ALa 430 435 CCC ACT TTT GAG GAT ATG CAG GTT Pro Thr Phe GLu Asp Met GLn Vat 445 450 CCC AAG TTC CCA GAA GCC TGG AAA Pro Lys Phe Pro GLu Ala Trp Lys 460 465 CTC AAG GAG ACA ATC GAA GAC TGT Leu Lys GLu Thr Ile Glu Asp Cys 480 CTT ACT GCA CAG TGT GCT GAG GAA Leu Thr ALa GLn Cys Ala GLu GLu 495 TGG GAA AGA AAC AAA TCT GTG AGC Trp Glu Arg Asn Lys Ser Vat Ser 510 515 GCT ATG CAG AAT GAA CGC AAC CTG Ala Met Gin Asn GLu Arg Asn Leu 525 530 ATT GGT CCT TAT CCA GAT TAT TCT ILe Gly Pro Tyr Pro Asp Tyr Ser 540 545 ATC CAT CAT ACT GAC AGC ATC GTG lIe His His Thr Asp Ser ILe Vat 560 1569 1617 1665 1713 1761 1809 1857 1905 1953 2001 2049 2097 AAG MAAT ATT TCC TCT GAG CAT TCT ATG TCC AGC ACA CCT TTG ACT ATA Lys Asn ILe Ser Ser GLu His Ser Met Ser Ser Thr Pro Leu Thr ILe 565 570 575 GGG GAA AAA AA Gly Gu Lys 580 INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS: LENGTH: 582 amino acids TYPE: amino acid TOPOLOGY: Linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: WO 96/14579 54 Met Thr Ser Ser Leu Gin Arg Pro Trp Arg Val Pro Trp Leu Pro Trp 1 5 10 Thr lie Leu Leu Val Ser Thr Ala Ala Ala Ser Gin Asn Gin Giu Arg 20 25 Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp Leu Gly Ile Gty Giu 40 Ser Arg lie Ser His Giu Asn Gly Thr Ilie Leu Cys Ser Lys Gly Ser 55 Thr Cys Tyr Giy Leu Trp Giu Lys Ser Lys Gly Asp Ile Asn Leu Vat 70 75 Lys Gin Gly Cys Trp Ser His Ilie GLy Asp Pro Gin Giu Cys His Tyr 90 GiU Giu Cys Vat Val Thr Thr Thr Pro Pro Ser lie Gin Asn Giy Thr 100 105 110 Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys Asn Val Asn Phe Thr 115 120 125 Giu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu Ser Pro Pro His Ser 130 135 140 Phe Asn Arg Asp Giu Thr Ilie lie lie Ala Leu Ala Ser Vat Ser Val 145 .150 155 160 Leu Ala Val Leu lie Val Ala Leu Cys Phe GLy Tyr Arg Met Leu Thr 165 170 175 GLy Asp Arg Lys Gin Giy Leu His Ser Met Asn Met Met Glu Ala Ala 180 185 190 Ala Ser Gtu Pro Ser Leu Asp Leu Asp Asn Leu Lys Leu Leu Giu Leu 195 200 205 PCTfUS95/14027 Ilie Gly 210 Arg Pro 225 lie Asn lie Ala Met Giu Lys Tyr 290 Ala His 305 Arg G1ly Arg Asn Gly Leu Arg GLY Arg Tyr Val Ala Vai Lys 230 Giu Lys Asn Ilie 245 Arg Phe Ilie Vat 260 Tyr Leu Leu Vat 275 Leu 5cr Leu His Ser Val Thr Arg 310 ksp His Tyr Lys 325 Wa Leu Val Lys 340 Ser Met Arg Leu GLy Ala Vai Tyr Lys Gly Ser Leu Asp Giu 215 220 Val Phe Ser Phe Ala Asn Arg Gin Asn Phe 235 240 Tyr Arg Vat Pro Leu Met Glu His Asp Asn 250 255 Gly Asp Giu Arg Vai Thr Ala Asp Gly Arg 265 270 Met Giu Tyr Tyr Pro Asn Gly Ser Leu Cys 280 285 Thr Ser Asp Trp Val Ser Ser Cys Arg Leu 295 300 Gly Leu Ala Tyr Leu His Thr Giu Leu Pro 315 320 Pro Ala Ilie Ser His Arg Asp Leu Asn Ser 330 335 Asn Asp Gly Thr Cys Val lie Ser Asp Phe 345 350 Thr GLy Asn Arg Leu Vai Arg Pro Gly Giu 360 365 355 Giu Asp Asn Ala Ala 370 lie Ser Gtu Val Gty 375 Thr lie Arg Tyr Met Ala 380 Pro Giu Val Leu Giu GLy Ala Val Asn Leu Arg Asp Cys Giu Ser Ala 385 390 395 400 WO 96/14579 PCT/US95/14027 Leu Lys Gin Val Asp Met Tyr Ala Leu GLy Leu lie Tyr Trp GLu lie 405 410 415 Phe Met Arg Cys Thr Asp Leu Phe Pro Gly GLu Ser Vat Pro Glu Tyr 420 425 430 Gin Met Ala Phe Gin Thr GLu Val GLy Asn His Pro Thr Phe GLu Asp 435 440 445 Met Gin Val Leu Vat Ser Arg GLu Lys Gin Arg Pro Lys Phe Pro Glu 450 455 460 Ala Trp Lys Glu Asn Ser Leu Ala Val Arg Ser Leu Lys GLu Thr IHe 465 470 475 480 Glu Asp Cys Trp Asp Gin Asp Ala GLu Ala Arg Leu Thr Ala Gin Cys 485 490 495 Ala Glu Glu Arg Met Ala Glu Leu Met Met lie Trp Glu Arg Asn Lys 500 505 510 Ser Val Ser Pro Thr Vat Asn Pro Met Ser Thr Ala Met Gin Asn Glu 5 515 520 525 Arg Asn Leu Ser His Asn Arg Arg Vat Pro Lys lie Gly Pro Tyr Pro 530 535 540 Asp Tyr Ser Ser Ser Ser Tyr lie Glu Asp Ser ILe His His Thr Asp 545 550 555 560 Ser Ile Vat Lys Asn Ire Ser Ser Glu His Ser Met Ser Ser Thr Pro 565 570 575 Leu Thr IHe Gly Glu Lys 580 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 471 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 19..471 (xi) SEQUENCE DESCRIPTION: SEQ ID TTCTTGGCTG GCCCAGGG ATG ACT TCC TCG CTG CAG CGG CCC TGG CGG GTG 51 Met Thr Ser Ser Leu Gin Arg Pro Trp Arg Vat 1 5 CCC TGG CTA CCA TGG ACC ATC CTG CTG GTC AGC ACT GCG GCT GCT TCG 99 Pro Trp Leu Pro Trp Thr Ile Leu Leu Vat Ser Thr Ala Ala Ala Ser 20 CAG AAT CAA GAA CGG CTA TGT GCG TTT AAA GAT CCG TAT CAG CAA GAC 147 Gin Asn Gin Glu Arg Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp 35 CTT GGG ATA GGT GAG AGT AGA ATC TCT CAT GAA AAT GGG ACA ATA TTA 195 Leu Gly ILe Gly GLu Ser Arg ILe Ser His GLu Asn Gly Thr ILe Leu 45 50 TGC TCG AAA GGT AGC ACC TGC TAT GGC CTT TGG GAG AAA TCA AAA GGG 243 Cys Ser Lys Gly Ser Thr Cys Tyr Gly Leu Trp GLu Lys Ser Lys Gly 65 70 WO 96/14579 PCTIUS95/14027 1 r r
C
GAC ATA AAT CTT GTA AAA CAA GGA TGT TGG TCT CAC ATT GGA GAT CCC Asp lie Asn Leu Vat Lys Gin GLy Cys Trp Ser His lie Gly Asp Pro 80 85 CAA GAG TGT CAC TAT GAA GAA TGT GTA GTA ACT ACC ACT CCT CCC TCA Gin Glu Cys His Tyr GLu GLu Cys Val Vat Thr Thr Thr Pro Pro Ser 100 105 ATT CAG AAT GGA ACA TAC CGT TTC TGC TGT TGT AGC ACA GAT TTA TGT IHe Gin Asn Gly Thr Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys 110 115 120 AAT GTC AAC TTT ACT GAG AAT TTT CCA CCT CCT GAC ACA ACA CCA CTC Asn Vat Asn Phe Thr Glu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu 125 130 135 AGT CCA CCT CAT TCA TTT AAC CGA GAT GAG ACA TGA Ser Pro Pro His Ser Phe Asn Arg Asp Glu Thr 140 145 150 INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS: LENGTH: 150 amino acids TYPE: amino acid TOPOLOGY: Linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: Met Thr Ser Ser Leu Gin Arg Pro Trp Arg Vat Pro Trp Leu Pro Trp 1 5 10 Thr Hle Leu Leu Vat Ser Thr Ala Ala Ala Ser Gin Asn Gin Glu Arg 25 Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp Leu Gly lie Gly Glu 40 Ser Arg Ile Ser His Glu Asn Gly Thr lie Leu Cys Ser Lys Gly Ser 50 55 45 Thr Cys Tyr GLy Leu Trp Glu Lys Ser Lys GLy Asp ILe Asn Leu Vat 70 75 0 Lys Gin GLy Cys Trp Ser His ILe Gly Asp Pro GLn Glu Cys His Tyr 0 85 90 Glu Glu Cys Val Val Thr Thr Thr Pro Pro Ser Ile Gin Asn Gly Thr 100 105 110 55 Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys Asn Val Asn Phe Thr 115 120 125 Glu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu Ser Pro Pro His Ser 0 130 135 140 Phe Asn Arg Asp Glu Thr 145 150 (2) INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS: LENGTH: 3508 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: Linear (ii) MOLECULE TYPE: cDNA WO 96/14579 PCTJUS95/14027 57 (ix) FEATURE: NAME/KEY: COS LOCATION: 17. .3133 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: WO 96/14579 PCTIUS95I14027 58 CTTTGCTGGC CCAGGG ATG ACT TCC TCG CTG CAT CGG CCC TTT CGG GTG 49 Met Thr Ser Ser Leu His Arg Pro Phe Arg Vat 1 5 CCC TGG CTG CTA TGG GCC GTC CTG CTG GTC AGC ACT ACG GCT GCT TCT 97 Pro Trp Leu Leu Trp Ala Vat Leu Leu Vat Ser Thr Thr Ala ALa Ser 20 CAG AAT CAA GAA CGG CTG TGT GCA TTT AAA GAT CCA TAT CAA CAA GAT 145 Gin Asn Gtn Giu Arg Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp 35 CTT GGG ATA GGT GAG AGT CGA ATC TCT CAT GAA AAT GGG ACA ATA TTA 193 Leu Sly Ile GLy GLu Ser Arg Ile Ser His GLu Asn Gly Thr lie Leu 45 50 TGT TCC AAA GOG AGC ACG TGT TAT GGT CTG TGG GAG AAA TCA AAA GGG 241 Cys Ser Lys GLy Ser Thr Cys Tyr Gly Leu Trp Slu Lys Ser Lys GLy 65 70 GAC ATC AAT CTT STG AAA CAA GSA TGT TGG TCT CAC ATC GGT SAT CCC 289 Asp lie Asn Leu Vat Lys Gin Gly Cys Trp Ser His Ile GLy Asp Pro 85 CAA GAG TGC CAC TAT GAA GAG TGT GTA STA ACT ACC ACC CCA CCC TCA 337 Gin Giu Cys His Tyr Giu Giu Cys Vat Vai Thr Thr Thr Pro Pro Ser 100 105 ATT CAG AAT GGA ACG TAC CGC TTT TGC TGC TGT AGT ACA GAT TTA TGT 385 lie Gin Asn Sly Thr Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys 110 115 120 AAT STC AAC TTT ACT GAG AAC TTT CCA CCC CCT SAC ACA ACA CCA CTC 433 Asn Vai Asn Phe Thr Giu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu 125 130 135 AGT CCA CCT CAT TCA TTT AAT CGA GAT GAA ACG ATA ATC ATT GCT TTG 481 Ser Pro Pro His Ser Phe Asn Arg Asp Glu Thr lie lie lie Ala Leu 140 145 150 155 GCA TCA GTT TCT GTG TTA GCT GTT TTG ATA GTC GCC TTA TGT TTT GGA 529 Ala Ser Vat Ser Vat Leu Ala Val Leu Ile Vat Ala Leu Cys Phe SLy 160 165 170 TAC AGA ATG TTG ACA GSA GAC CGG AAA CAG GGT CTT CAC AGC ATS MC 5T7 Tyr Arg Met Leu Thr GLy Asp Arg Lys Gin Gly Leu His Ser met Asn 175 180 185 ATS ATG GAG GCG GCA GCA GCA SAG CCC TCC CTT GAC CTG GAT AAC CTG 625 Met Met Stu Ala Ala Ala Ala Giu Pro Ser Leu Asp Leu Asp Asn Leu 190 195 200 AAG CTG CTG GAG CTS ATT GGA CGG GST CGA TAC GGA GCA GTA TAT AAA 673 Lys Leu teu Slu Leu Ile Sly Arg Sty Arg Tyr Sty Ala Vat Tyr Lys 205 210 215 GGT TCC TTG SAT GAG CGT CCA GTT GCT STA AAA STA TTT TCT TTT GCA 721 Sly Ser Leu Asp Glu Arg Pro Vat Ala Vat Lys Vat Phe Ser Phe Ala 220 225 230 235 AAC CGT CAG AAT TTT ATA AAT GAA AAA AAC ATT TAC AGA GTG CCT TTS 769 Asn Arg Gin Asn Phe Ile Asn Stu Lys Asn lie Tyr Arg Vat Pro Leu 240 245 250 ATG GAA CAT SAC AAC ATT SCT CSC TTC ATA STT GSA SAC GAG ASS CTC 817 Met SLu His Asp Asn lie Ala Arg Phe lie Vat Sly Asp Stu Arg Leu 255 260 265 ACT SCA SAC GGC CGC ATG GAG TAT TTG CTT STG ATS SAG TAT TAT CCC 865 Thr Ala Asp Gty Arg Met Glu Tyr Leu Leu Vat Met Stu Tyr Tyr Pro 270 275 280 AAT GSA TCT CTS TGC AAA TAT CTG AST CTC CAC ACA AGT SAT TGG STA 913 Asn Sly Ser Leu Cys Lys Tyr Leu Ser Leu His Thr Ser Asp Trp Vat WO 96/14579 PCTIUS95/14027
AGC
Ser 300
CAC
His
CGA
290 CGT CTG GCT CAT TCT Arg Leu Ala His Ser 305 TTA CCA CGA GGA GAT Leu Pro Arg ply Asp 320 MAC AGC AGG AAT GTC GTG ACT Val Thr CAT TAT His Tyr 325 AGA GGA CTG GCT TAT CTT Arg Gly Leu Ala Tyr Leu 310 315 AAA CCC GCA ATC TCC CAC Lys Pro Ala lie Ser His 330 MAG AAT GAC GGC GCG TGT Lys Asn Asp GLy Ala Cys 345 Arg Asp Leu Asn Ser Arg Asn Vat Leu Val 335 340 GTT ATC AGT GAC TTT GGT TTA Val ILe Ser Asp Phe Gly Leu 350 GTG CGC CCA GGG GMA GAA GAT Val Arg Pro Gly Gtu Gtu Asp 365 370 ATT CGC TAT ATG GCA CCA GAA Ilie Arg Tyr met Ala Pro Gtu 380 385 GAC TGT GAG TCA GCT CTG AAG Asp Cys Giu Ser ALa Leu Lys 400 ATC TAC TGG GAG GTG TTT ATG lie Tyr Trp Giu Vat Phe Met 415 TCT GTA CCA GAT TAC CAG ATG Ser Vat Pro Asp Tyr Gin Met 430 CCC ACA TTT GAG GAT ATG CAG AGG CTA ACT GGA AAT Arg Leu Thr GLy Asn 360 GCT ATA AGT GAG GTT Ala lie Ser Giu Vat 375 GAA GGA GCT GTG AAC Giu Gly Ala Vat Asn 390 GAC ATG TAT GCG CTT Asp Met Tyr Ala Leu 405 ACA GAC CTC TTC CCA Thr Asp Lau Phe Pro 425 CAG ACA GMA GTT GGA Gin Thr Giu Val Gly 440 GTG TCC AGA GAG MAG Vat Ser Ara GOW Lys CGG CTG Arg Leu GGC ACA Giy Thr CIG AGG Leu Arg 395 OGA CTC Gty Lau 410 GGT GMA Giy Giu MAC CAT Asn His CAG AGA 961 1009 1057 1105 1153 1201 1249 1297 1345 1393 1441 1489 1537 1585 1633 1681 1729 177 401 Pro Thr Phe 445 Giu Asp Met Gin Vat Leu 450 G.in Ar- CCC MAG TTC CCA GMA GCC TOG AAA GMA AAT AGC CTG GCA GTG AGG TCA Pro Lys Phe Pro Oiu Ala Trp Lys Giu Asn Ser Leu Ala Vat Arg Ser 460 465 470 475 CTC AAG GAA ACA ATT GMA GAC TGC TGG GAC CAG GAT GCA GAG GCT CGG Leu Lys Oiu Thr Ilie Giu Asp Cys Trp Asp Gin Asp Ala Giu Ala Arg 480 485 490 CTC ACT GCA CAG TGT GCT GAG GAG AGG ATG GCT GMA CTC ATG ATG ATA Leu Thr Ata Gin Cys Ala Giu Giu Arg Met Ala Giu Lau Met Met lie 495 500 505 TGG GAG AGA MAC MAG TCT GTG AGC CCA ACG GTC MAC CCA ATG TCA ACT Trp Giu Arg Asn Lys Ser Vat Scr Pro Thr Vat Asn Pro Met Ser Thr 510 515 520 GCT ATG CAG MAT GMA CGC MAC CTG TCA CAT MAT AGG CGT GTG CCA AAA Ala Met Gin Asn Giu Arg Asn Leu Ser His Asn Arg Arg Vat Pro Lys 525 530 535 ATC GGG CCT TAC CCA GAT TAT TCC TCT TCC TCA TAT ATT GMA GAC TCT lie Gly Pro Tyr Pro Asp Tyr Ser Ser Ser Ser Tyr lie Giu Asp 5cr 540 545 550 555 ATC CAT CAT ACT GAC AGC ATT GTG MAG MAT ATT TCC TCT GAG CAT TCG lie His His Thr Asp Scr Ile Vat Lys Asn Ile Ser Ser Giu His Ser 560 565 570 ATG TCC AGC ACA CCA TTG ACA ATA GGA GMA MG MAT CGA MAT TCA ATT Met Ser Ser Thr Pro Leu Thr lie Gty Giu Lys Asn Arg Asn Ser lie 575 580 585 WO 96/14579 PCTIUS95/14027 AAT TAT GAA CGA Asn Tyr Glu Arg 590 CAG CAA GCA CAA GCT CGA ATC CCT AGC CCA GAA ACA GLn Gin Ala Gin Ala Arg Ile Pro Ser Pro GLu Thr 595 600 AGC GTC Ser Vat 605 ACA AGC CTG TCC ACA AAC ACA ACC ACC ACA AAC ACC ACC GGC Thr Ser Leu Ser Thr Asn Thr Thr Thr Thr Asn Thr Thr GLy 610 615 CTC ACT CCA AGT ACT GGC ATG Leu Thr Pro Ser Thr Gly Met 620 625 GAT GAG ACA CAT Asp Glu Thr His ACC CCT GTC TGC Thr Pro Val Cys 655 CTA GAT CCA AAA Leu Asp Pro Lys 670 AAT CTC ATG GAG I Asn Leu Met GLu 685 CAC GCC His ALa ACC ACT ATA TCT Thr Thr lie Ser 630 ACA AAT GTT GCA Thr Asn Vat Ala 645 ACA GAA GAA GAC Thr GLu Glu Asp 660 GAG ATG CCA TAC Glu Met Pro Tyr CAG TCA ATC GLn Ser lie GGG CCA Gly Pro 650 TTA CAG CTG Leu Gin Leu TTG GAG ACT AAT AAG Leu GLu Thr Asn Lys GAA GTT GAT AAG AAC CTC AAG GAA AGC TCT GAT GAG GLu Vat Asp Lys Asn Leu Lys GLu Ser Ser Asp GLu 675 680 1921 1969 2017 2065 2113 2161 2209 TCT CTG Ser Leu 690 AAG CAG TTC AGT Lys GLn Phe Ser CCA GAC CCA TTG Pro Asp Pro Leu
AGC
Ser 700 AGT ACC ACT TCT Ser Thr Ser Ser TTG CTT TAT CCA Leu Leu Tyr Pro ATA AAG CTC GCA GTG lie Lys Leu Ala Vat 715 GAA GTG ACT GGA GLu Vat Thr Gly CAG GAC TTC ACA CAG GCT GCA AAT GGG CAA GCA Gin Asp Phe Thr GLn Ala Ala Asn GLy GLn Ala TGT TTA ATT CCT GAT GTT CCA CCT Cys Leu lie Pro Asp Vat Pro Pro CAG ATC TAT GLn Ile Tyr CCT CTC CCT AAG Pro Leu Pro Lys 745 TTG AAC ACC AAA Leu Asn Thr Lys 760 CAA CAG AAC GLn GLn Asn 750 CTT CCT AAG AGA Leu Pro Lys Arg ACT AGT TTG CCT Thr Ser Leu Pro 43 AAT TCA ACA AAA GAA CCC CGG Asn Ser Thr Lys Glu Pro Arg 765 770 AAC TTG AAA CAA GTA GAA ACT Asn Leu Lys GLn Vat Glu Thr CTA AAA TTT GGC AAC AAG CAC AAA TCA Leu Lys Phe GLy Asn Lys His Lys Ser 775 GGA GTT GCC AAG ATG AAT ACA ATC AAT GLy Vat Ala Lys Met Asn Thr lie Asn 790 795 785 GCA GCA GAG CCT CAT Ala ALa GLu Pro His 800 GTG GTG ACA GTA Vat Vat Thr Vat ATG AAT GGT GTG Met Asn GLy Vat AGA AGC CAC AAT Arg Ser His Asn 815 GTT AAT TCT CAT Vat Asn Ser His GCC ACA ACC CAG Ala Thr Thr GLn TAT GCC AAT Tyr Ala Asn 825 2353 2401 2449 2497 2545 2593 2641 GGC GCA GTG CCA GCT GGC Gly Ala Vat Pro Ala GLy 830 CAG GCA GCC AAC ATA GLn Ala Ala Asn lie 835 GTG GCA CAT AGG TCC Vat Ala His Arg Ser 840 CAA GAA ATG CTG CAG AAT CAA TTT ATT GGT GAG GAT ACC AGG CTG AAT Gin GLu Met Leu Gin Asn GLn Phe Ile Gly GLu Asp Thr Arg Leu Asn 845 850 855 ATC AAT TCC AGT CCT GAT GAG CAT GAA CCT TTA CTG AGA lie Asn Ser Ser Pro Asp GLu His GLu Pro Leu Leu Arg 860 865 870 CGA GAG CAA Arg Glu GLn 875 CAG GCT GGC CAT GAT GAA GGG GTT CTG GAT CGT TTG GTA GAT AGG AGG Gin ALa GLy His Asp GLu Gly Vat Leu Asp Arg Leu Vat Asp Arg Arg WO 96/14579 PCTIUS95/14027 61 880 885 890 GAA CGG CCA TTA GAA GGT GGC CGA ACA AAT TCC AAT AAC AAC AAC AGC 2737 Glu Arg Pro Leu GLu Gly Gly Arg Thr Asn Ser Asn Asn Asn Asn Ser 895 900 905 AAT CCA TGT TCA GAA CAA GAT ATC CTT ACA CAA GGT GTT ACA AGC ACA 2785 Asn Pro Cys Ser GLu Gin Asp lie Leu Thr Gin Gly Vat Thr Ser Thr 910 915 920 GCT GCA GAT CCT GGG CCA TCA AAG CCC AGA AGA GCA CAG AGG CCC AAT 2833 Ala Ala Asp Pro GLy Pro Ser Lys Pro Arg Arg Ala GLn Arg Pro Asn 925 930 935 TCT CTG GAT CTT TCA GCC ACA AAT ATC CTG GAT GGC AGC AGT ATA CAG 2881 Ser Leu Asp Leu Ser Ala Thr Asn lie Leu Asp GLy Ser Ser lie Gin 940 945 950 955 ATA GGT GAG TCA ACA CAA GAT GGC AAA TCA GGA TCA GGT GAA AAG ATC 2929 Ile GLy Gtu Ser Thr Gin Asp Gly Lys Ser GLy Ser Gly Giu Lys lie 960 965 970 AAG AGA CGT GTG AAA ACT CCA TAC TCT CTT AAG CGG TGG CGC CCG TCC 2977 Lys Arg Arg Vat Lys Thr Pro Tyr Ser Leu Lys Arg Trp Arg Pro Ser 975 980 985 ACC TGG GTC ATC TCC ACC GAG CCG CTG GAC TGT GAG GTC AAC AAC AAT 3025 Thr Trp Vat lie Ser Thr Giu Pro Leu Asp Cys Glu Vat Asn Asn Asn 990 995 1000 GGC AGT GAC AGG GCA GTC CAT TCT AAA TCT AGC ACT GCT GTG TAC CTT 3073 GLy Ser Asp Arg Ala Vat His Ser Lys Ser Ser Thr Ala Vat Tyr Leu 1005 1010 1015 GCA GAG GGA GGC ACT GCC ACG ACC ACA GTG TCT AAA GAT ATA GGA ATG 3121 Aia Giu GLy Gly Thr Aia Thr Thr Thr Vat Ser Lys Asp Ile GLy Met 1020 1025 1030 1035 AAT TGT CTG TGAGATGTTT TCAAGCTTAT GGAGTGAAAT TATTTTTTTG 3170 Asn Cys Leu CATCATTTAA ACATGCAGAA GACATTTAAA AAAAAAACTG CTTTAACCTC CTGTCAGCAc 3230 CCCTTCCCAC CCCTGCAGCA AGGACTTGCT TTAAATAGAT TTCAGCTATG CAGAAATTT 3290 TAGCTTATGC TTCCATAATT TTTAATTTTG TTTTTTAAGT TTTGCACTTT TGTTTAGTCT 3350 TGCTAAAGTT ATATTTGTCT GTTATGACCA CATTATATGT GTGCTTATCC AAAGTGGTCT 3410 CCAAATATTT TTTTMGAA.A AAAGCCCAAA CAATGGATTG CTGATAATCA GTTTGGACCA 3470 TTTTCTAAAG GTCATTAAAA CAGAAGCAAA TTCAGACC 3508 INFORMATION FOR SEQ ID NO:8: SEQUENCE CHARACTERISTICS: LENGTH: 1038 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: Met Thr Ser Ser Leu His Arg Pro Phe Arg Vai Pro Trp Leu Leu Trp 1 5 10 Aia Vai Leu Leu Vai Ser Thr Thr Ala Ala Ser Gin Asn Gin Giu Arg 25 Leu Cys Aia Phe Lys Asp Pro Tyr Gin Gin Asp Leu Gly Ile Gly Giu 40 WO 96/14579 PCT/US95/14027 62 Asp GLu His GLu Pro Leu Leu Arg Arg GLu Gin GLn Ala Gly His Asp 865 870 875 880 GLu Gly Vat Leu Asp Arg Leu Val Asp Arg Arg GLu Arg Pro Leu GLu 885 890 895 GLy Gly Arg Thr Asn Ser Asn Asn Asn Asn Ser Asn Pro Cys Ser Glu 10 900 905 910 GLn Asp ILe Leu Thr GLn Gly Vat Thr Ser Thr Ala ALa Asp Pro GLy 915 920 925 Pro Ser Lys Pro Arg Arg Ala Gln Arg Pro Asn Ser Leu Asp Leu Ser 930 935 940 Ala Thr Asn ILe Leu Asp Gly Ser Ser Ile GLn ILe Gly GLu Ser Thr 945 950 955 960 Gin Asp Gly Lys Ser GLy Ser GLy Glu Lys ILe Lys Arg Arg Vat Lys 965 970 975 Thr Pro Tyr Ser Leu Lys Arg Trp Arg Pro Ser Thr Trp Vat Ile Ser 25 980 985 990 Thr GLu Pro Leu Asp Cys Glu Vai Asn Asn Asn Gly Ser Asp Arg ALa 995 1000 1005 Vat His Ser Lys Ser Ser Thr Ala Val Tyr Leu Ala Glu Gly GLy Thr 1010 1015 1020 Ala Thr Thr Thr Vat Ser Lys Asp ILe Gly Met Asn Cys Leu 1025 1030 1035 INFORMATION FOR SEQ ID NO:9: SEQUENCE CHARACTERISTICS: LENGTH: 469 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: Linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 17..469 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CTTTGCTGGC CCAGGG ATG ACT TCC TCG CTG CAT CGG CCC TTT CGG GTG 49 Met Thr Ser Ser Leu His Arg Pro Phe Arg Vat 1 5 CCC TGG CTG CTA TGG GCC GTC CTG CTG GTC AGC ACT ACG GCT GCT TCT 97 Pro Trp Leu Leu Trp Ala VaL Leu Leu Vat Ser Thr Thr Ala Ala Ser 15 20 CAG AAT CAA GAA CGG CTG TGT GCA TTT AAA GAT CCA TAT CAA CAA GAT 145 Gin Asn Gin GLu Arg Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp 35 CTT GGG ATA GGT GAG AGT CGA ATC TCT CAT GAA AAT GGG ACA ATA TTA 193 Leu Gly Ile Gly Glu Ser Arg ILe Ser His GLu Asn Gly Thr ILe Leu 50 TGT TCC AAA GGG AGC ACG TGT TAT GGT CTG TGG GAG AAA TCA AAA GGG 241 Cys Ser Lys GLy Ser Thr Cys Tyr GLy Leu Trp Glu Lys Ser Lys Gly 65 70 GAC ATC AAT CTT GTG AAA CAA GGA TGT TGG TCT CAC ATC GGT GAT CCC 289 Asp Ile Asn Leu Vat Lys GLn Gly Cys Trp Ser His ILe GLy Asp Pro WO 96/14579 PCT/US95/14027 uo 85 CAA GAG TGC CAC TAT GAA GAG TGT GTA GTA ACT ACC ACC CCA CCC TCA Gin Glu Cys His Tyr Glu GLu Cys Vat Val Thr Thr Thr Pro Pro Ser 95 100 105 ATT CAG AAT GGA ACG TAC CGC TTT TGC TGC TGT AGT ACA GAT TTA TGT lie Gin Asn Gly Thr Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys 110 115 120 AAT GTC AAC TTT ACT GAG AAC TTT CCA CCC CCT GAC ACA ACA CCA CTC Asn Vat Asn Phe Thr GLu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu 125 130 135 AGT CCA CCT CAT TCA TTT AAT CGA GAT GAA ACG TGA Ser Pro Pro His Ser Phe Asn Arg Asp Glu Thr 140 145 150 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 150 amino acids TYPE: amino acid TOPOLOGY: Linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Met Thr Ser Ser Leu His Arg Pro Phe Arg Vat Pro Trp Leu Leu Trp 1 5 10 Ala Vat Leu Leu Vat Ser Thr Thr Ala Ala Ser Gin Asn Gin GLu Arg 20 25 Leu Cys Ala Phe Lys Asp Pro Tyr Gtn GLn Asp Leu GLy ILe Gly Glu 40 Ser Arg lie Ser His GLu Asn Gly Thr lie Leu Cys Ser Lys Gly Ser 55 Thr Cys Tyr Gly Leu Trp GLu Lys Ser Lys GLy Asp ILe Asn Leu Vat 70 75 Lys Gin GLy Cys Trp Ser His ILe GLy Asp Pro Gin GLu Cys His Tyr 90 GLu Glu Cys Val Val Thr Thr Thr Pro Pro Ser ILe GLn Asn GLy Thr 100 105 110 Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys Asn Vat Asn Phe Thr 115 120 125 Glu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu Ser Pro Pro His Ser 130 135 140 Phe Asn Arg Asp Glu Thr 145 150 INFORMATION FOR SEQ ID NO:11: SEQUENCE CHARACTERISTICS: LENGTH: 2402 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: Linear (ix) FEATURE: NAME/KEY: CDS LOCATION: join(11..1609) WO 96/14579 PCTfUS95/14027 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: GAATCAGACA ATG ACT CAG CTA TAC ACT TAC ATC AGA TTA CTG GGA GCC Met Thr Gin Leu Tyr Thr Tyr Ile Avg Leu Leu GLy Ala 1 5 TGT CTG TTC ATC ATT TCT CAT GTT CAA GGG CAG AAT CTA GAT AGT ATG Cys Leu Phe Ile lie Ser His Vat Gin Giy Gin Asn Leu Asp Ser Met 20 CTC CAT GGC ACT GGT ATG AAA TCA GAC TTG GAC CAG AAG AAG CCA GAA Leu His GLy Thr Gly Met Lys Ser Asp Leu Asp Gin Lys Lys Pro GLu 35 40 AAT GGA GTG ACT TTA GCA CCA GAG GAT ACC TTG CCT TTC TTA AAG TGC Asn GLy Vat Thr Leu Ala Pro Giu Asp Thr Leu Pro Phe Leu Lys Cys 55 TAT TGC TCA GGA CAC TGC CCA GAT GAT GCT ATT AAT AAC ACA TGC ATA Tyr Cys Ser Giy His Cys Pro Asp Asp Ala Ile Asn Asn Thr Cys Ile 70 ACT AAT GGC CAT TGC TTT GCC ATT ATA GAA GAA GAT GAT CAG GGA GAA Thr Asn GLy His Cys Phe Ala Ile Ile Giu Giu Asp Asp Gin GLy GLu 80 85 ACC ACA TTA ACT TCT GGG TGT ATG AAG TAT GAA GGC TCT GAT TTT CAA Thr Thy Leu Thr Ser Gly Cys Met Lys Tyr Giu Gly Ser Asp Phe Gin 100 105 TGC AAG GAT TCA CCG AAA GCC CAG CTA CGC AGG ACA ATA GAA TGT TGT Cys Lys Asp Ser Pro Lys Ala Gin Leu Avg Arg Thr lie Giu Cys Cys 110 115 120 125 CGG ACC AAT TTG TGC AAC CAG TAT TTG CAG CCT ACA CTG CCC CCT GTT Arg Thr Asn Leu Cys Asn Gin Tyr Leu Gin Pro Thr Leu Pro Pro Vai 130 135 140 GTT ATA GGT CCG TTC TTT GAT GGC AGC ATC CGA TGG CTG GTT GTG CTC 49 97 145 193 241 289 337 385 '33 481 529 577 625 673 721 769 817 865 Vat lie Giy Pro 145 Phe Phe Asp GLy Ser lie Arg Trp Leu Vat 150 155 ATT TCC ATG GCT GTC TGT ATA GTT GCT ATG ATC ATC TTC TCC lie Ser Met Ala Vat Cys lie Vat Ala Met lie Ile Phe Ser 160 165 170 TTT TGC TAT AAG CAT TAT TGT AAG AGT ATC TCA AGC AGG GGT Phe Cys Tyr Lys His Tyr Cys Lys Ser lie Ser Ser Arg Giy 175 180 185 AAC CGT GAT TTG GAA CAG GAT GAA GCA TTT ATT CCA GTA GGA Asn Arg Asp Leu Giu Gin Asp GLu Ala Phe lie Pro Vat Gly 190 195 200 TTG AM GAC CTG ATT GAC CAG TCC CAA AGC TCT GGG AGT GGA Leu Lys Asp Leu lie Asp Gin Ser Gin Ser Ser GLy Ser Giy 210 215 Vat Leu AGC TGC Ser Cys CGT TAC Arg Tyr GAA TCA GLu Ser 205 TCT GGA Ser GLy 220 TTG CCT TTA TTG GTT CAG CGA ACT ATT GCC AAA CAG ATT CAG ATG GTT Leu Pro.Leu Leu Vat Gin Avg Thr Ile Ala Lys Gin lie Gin Met Vat 225 230 235 CGG CAG GTT GGT AAA GGC CGC TAT GGA GAA GTA TGG ATG GGT AAA TGG Arg Gin Vat Giy Lys Giy Arg Tyr Gly Giu Vat Trp Met GLy Lys Trp 240 245 250 CGT GOT GAA AAA GTG GCT GTC AM OTG TTT TTT ACC ACT GAA GAA GCT Arg Giy Giu Lys Vat Ala Vat Lys Vai Phe Phe Thy Thy Giu Giu Ala 255 260 265 AGC TGG TTT AGA GAA ACA GAA ATC TAC CAG ACG GTG TTA ATG CGT CAT Ser Tvp Phe Arg Olu Thr Giu lie Tyr Gin Thy Val Leu Met Arg His 270 275 280 285 GAA AAT ATA CTT GGT TTT ATA OCT GCA GAC ATT AAA GGC ACT GGT TCC WO 96/14579 PCTIUS95/14027 Glu Asn Ile Leu GLy Phe Ile Ala Ala Asp Ile Lys Gty Thr Gty Ser 290 295 300 TGG ACT CAG CTG TAT TTO ATT ACT GAT TAC CAT GMA MT GGA TCT CTC 961 Trp Thr Gin Leu Tyr Leu Hle Thr Asp Tyr His Olu Asn Gly Ser Lau 305 310 315 TAT GAC TTC CTG AAA TGT GCC ACA CTA GAC ACC AGA GCC CTA CTC MAG 1009 Tyr Asp Phe Leu Lys Cys Ala Thr Leu Asp Thr Arg Ala Leu Leu Lys 320 325 330 TTA OCT TAT TCT OCT OCT TGT GOT CTG TGC CAC CTC CAC ACA GAA ATT 1057 Leu Ala Tyr Ser Ala Ala Cys OLy Leu Cys His Leu His Thr Oiu Ile 335 340 345 TAT GOT ACC CAA GO MAG CCT OCA ATT OCT CAT CGA GAC CTO MAG AOC 1105 Tyr Oiy Thr Gin OLy Lys Pro Ala Ile Ala His Arg Asp Leu Lys Ser 350 355 360 365 MAA MAC ATC CTT ATT MAG AMA AAT OGA AOT TGC TOT ATT OCT GAC CTG 1153 Lys Asn Ile Lau lie Lys Lys Asn Gty Ser Cys Cys lie Ala Asp Lau 370 375 380 GOC CTA OCT OTT AAA TTC AAC AGT OAT ACA AAT GMA OTT GAC ATA CCC 1201 Oly Leu Ala Vat Lys Phe Asn Ser Asp Thr Asn Giu VaL Asp Ile Pro 385 390 395 TTG AAT ACC AGO OTO GOC ACC AAO COO TAC ATO dCT CCA GMA GTG CTO 1249 Leu Asn Thr Arg Vat Oly Thr Lys Arg Tyr Met Ala Pro Oiu Vat Leu 400 405 410 OAT GMA AOC CTG MAT AMA MC CAT TTC CAG CCC TAC ATC ATO OCT GAC 1297 Asp Giu Ser Leu Asn Lys Asn His Phe Gin Pro Tyr Ilie Met Ala Asp 415 420 425 ATC TAT AOC TTT GOT TTG ATC ATT TOG GMA ATO OCT COT COT TOT ATT 1345 lie Tyr Ser Phe Oiy Leu Ilie lie Trp OLu Met Ala Arg Arg Cys lie 430 435 440 445 ACA OGA OGA ATC OTO GAO GMA TAT CMA TTA CCA TAT TAC MAC ATO OTO 1393 Thr Giy Gly lie Vat Oiu Glu Tyr Gin Leu Pro Tyr Tyr Asn Met Vat 450 455 460 CCC AOT GAC CCA TCC TAT GAG GAC ATO COT GAG OTT OTO TOT OTO AMA 1441 Pro Ser Asp Pro Ser Tyr Giu Asp Met Arg Giu Vat Val Cys Vai Lys 465 470 475 COC TTG COG CCA ATC GTO TCT MAC COC TOG MAC AOC OAT GMA TOT CTT 1489 Arg Leu Arg Pro lie Vat Ser Asn Arg Trp Asn Ser Asp Giu Cys Leu 480 485 490 CGA OCA OTT TTG MOG CTA ATO TCA GMA TOT TOG 0CC CAT MAT CCA 0CC 1537 Arg Ala Vat Lau Lys Leu Met Ser Oiu Cys Trp Ala His Asn Pro Ala 495 500 505 TCC AGA CTC ACA OCT TTO AGA ATC MOG MG ACA CTT OCA AMA ATO OTT 1585 Ser Arg Lau Thr Ala Lau Arg Ilie Lys Lys Thr Lau Ala Lys Met Vat 510 515 520 525 GMA TCCCAG OAT OTA MOG ATT TOACMATTMA ACMATTTTOA OOGAOMATTT 1636 Oiu Ser Gin Asp Vai Lys lie 530 AGACTOCMAG MACTTCTTCA CCCMAGGMT OOOTGOGATT AOCATGGMAT AGGATOTTGA 1696 CTTGOTTTCC AGACTCCTTC CTCTACATCT TCACAGGCTG CTMACAOTMA ACCTTACCGC 1756 ACTCTACAGA ATACMAGATT GGMACTTOOA ACTTGMACT TCAMACATGT CATTCTTTAT 1816 ATATOGACAG CTGTGTTTTA MATGTOOOOT TTTTGTOTTT TOCTTTCTTT GTTTTGTTTT 1876 OGTTTTGATG CTTTTTTGOT TTTTATGMAC TGCATCMAGA CTCCMATCCT GATMOMOAT 1936 CTCTOOTCMA CCTCTOOOTA CTCACTATCC TGTCCATAMA OTOOTOCTTT CTOTOMAAGC 1996 WO 96/14579 WO 9614579PCTIUS95/14027 66 CTTAAGAAAA TTAATGAGCT CAGCAGAGAT GGAAAAAGGC ATATTTGGCT TCTACCAGAG AAAACATCTG TCTGTGTTCT GTCTTTGTAA ACAGCCTATA GATTATGATC TCTTTGGGAT ACTGCCTGGC TTATGATGGT GCACCATACC TTTGATATAC ATACCAGAAT TCTCTCCTGC CCTAGGGCTA AGAAGACAAG AATGTAGAGG TTGCACAGGA GGTATTTTGT GACCAGTGGT TTAAATTGCA ATATCTAGTT GGCAATCGCC AATTTCATAA AAGCCATCCA CCTTGTAGCT GTAGTAACTT CTCCACTGAC TTTATTTTTA GCATAATAGT TGTGAAGGcC AAACTCCATG TAAAGTGTCC ATAGACTTGG ACTGTTTTCC CCCAGCTCTG ATTACC INFORMATION FOR SEQ ID NO:12: SEQUENCE CHARACTERISTICS: LENGTH: 532 amino acids TYPE: amino acid TOPOLOGY: linear 00i MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: Met Thr Gin Leu Tyr Thr Tyr lie Arg Leu Lau Gly Ala Cys Leu Phe 1 5 10 Ile Ile Ser His Vat Gin GLy Gin Asn Leu Asp Ser Met Leu His Gly 25 Thr Gly Met Lys Ser Asp Leu Asp Gin Lys Lys Pro Glu Asn Gly Vat 33540 Thr Leu Ala Pro Gtu Asp Thr Leu Pro Phe Leu Lys Cys Tyr Cys Ser 55 Gly His Cys Pro Asp Asp Ala lie Asn Asn Thr Cys lie Thr Asn Gty 65 70 '75 His Cys Phe Ala lie lie GLu Giu Asp Asp Gin GLy Gtu Thr Thr Leu 90 2056 2116 2176 2236 2296 2356 2402 Thr Ser Gly Cys Met Lys Tyr 100 Ser Pro Lys Ala Gin Leu Arg 115 Leu Cys Asn Gin Tyr Leu Gin 130 135 Pro Phe Phe Asp GLy Ser lie 145 150 Ala Vat Cys Ilie Vai Ala Met 165 Lys His Tyr Cys Lys Ser Ilie 180 Leu Giu Gin Asp Giu Ala Phe 195 Leu lie Asp Gin Ser Gin Ser 210 215 Leu Vat Gin Arg Thr lie Ala 225 230 GLy Lys Gly Arg Tyr Gly Giu 245 Lys Vat Ala Vat Lys Vat Phe Giu Gly Ser 105 Arg Thr lie 120 Pro Thr Leu Arg Trp Leu Ile Ile Phe 170 Ser Ser Arg 185 lie Pro Vat 200 Ser Gly Ser Lys Gin Ilie Vat Trp Met 250 Phe Thr Thr Asp Phe Gin Cys Lys Asp 110 Giu Cys Cys Arg Thr Asn 125 Pro Pro Vat Vat lie Giy 140 Vat Vat Lau lie Ser Met 155 160 Ser Ser Cys Phe Cys Tyr 175 Gly Arg Tyr Asn Arg Asp 190 Gly Giu Ser Leu Lys Asp 205 Giy Ser Gly Leu Pro Leu 220 Gin Met Vat Arg Gin Vat 235 240 Giy Lys Trp Arg Gly Giu 255 Giu Giu Aia Ser Trp Phe WO 96/14579 PCTfUS95/14027 67 260 265 270 Arg Giu Thr Giu Ile Tyr Gin Thr VaL Leu Met Arg His GLu Asn lie 275 280 285 Leu GLy Phe Hle Ala Ala Asp lie Lys Gly Thr Gly Ser Trp Thr Gin 290 295 300 Leu Tyr Leu Ile Thr Asp Tyr His Giu Asn Gly Ser Leu Tyr Asp Phe 305 310 315 320 Leu Lys Cys ALa Thr Leu Asp Thr Arg Ala Leu Leu Lys Leu Ala Tyr 325 330 335 Ser Ala Ala Cys Gly Leu Cys His Leu His Thr Giu lie Tyr GLy Thr 340 345 350 Gin GLy Lys Pro Ala Ile Ala His Arg Asp Leu Lys Ser Lys Asn lie 355 360 365 Leu Ilie Lys Lys Asn GLy Ser Cys Cys Ile Ala Asp Leu Gly Leu Ala 370 375 380 Vai Lys Phe Asn Ser Asp Thr Asn Giu Vai Asp lie Pro Leu Asn Thr 385 390 395 400 Arg Vat Gly Thr Lys Arg Tyr Met Ala Pro Giu VaL Leu Asp Giu Ser 405 410 415 Leu Asn Lys Asn His Phe Gin Pro Tyr lie Met Ala Asp Ile Tyr Ser Phe Gly Leu lie lie Trp Giu Met Ala Arg Arg Cys Ilie Thr Giy GLy 4354445 Ilie Val flu Giu Tyr Gin Leu Pro Tyr Tyr Asn Met Val Pro Ser Asp 450 455 460 Pro Ser Tyr Giu Asp Met Arg flu VaL Val Cys VaL Lys Arg Leu Arg 465 470 475 480 Pro lie Vat Ser Asn Arg Trp Asn Ser Asp Glu Cys Leu Arg Ala Val 485 490 495 Leu Lys Leu Met Ser Giu Cys Trp Ala His Asn Pro Ala Ser Arg Leu 500 505 510 Thr Ala Leu Arg lie Lys Lys Thr Leu Ala Lys Met Val GLu Ser Gin 50515 520 525 Asp Val Lys Ile 530 INFORM4ATION FOR SEQ ID NO:13: SEQUENCE CHARACTERISTICS: LENGTH: 2252 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 355. .1863 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GTTTTCCAGC AGACTGATGC TATAAATGCT CCACAACATG GAGAATGGTT TGGGTTGGAA GTAGACTTAA AGACCATCTA TGTGTGGGGA TACCTCCCAC TAGATCAGGC TGCTCAGGGc 120 WO 96/14579 PCT1US95/14027 68 CCCATTCACC ACCTCCAGGG ACGGGGTAGC CACTGCTTCT CTGAGCAACC TGAGCAACTT 180 CCTCACAGTG AAGAGTTCCT CCTGTATCCG AGGGTGGAGT TCATTTCTTT TGTCCTTGGA 240 AGTTGAATAG CAGAAAGGGA CATTTCAGCT TTTCTTGATA AAGGTTACAT CCATTTTACT 300 TAGACTACAA GACGAAGATT TCTGAAAATT GAGATCTTTA GTTTTCTGGA CAAG ATG 357 Met 10 1 CCC TTG CTT AGC TCC AGC AAG TTG AGC ATG GAG AGC AGA AAA GAA GAT 405 Pro Leu Leu Ser Ser Ser Lys Leu Ser Met GLu Ser Arg Lys GLu Asp 155 10 AGT GAG GGC ACA GCA CCT GCC CCT CCA CAG AAG AAG CTG TCA TGT CAG 453 Ser Giu GLy Thr ALa Pro ALa Pro Pro Gin Lys Lys Leu Ser Cys Gin 25 TGC CAC CAC CAT TGT CCT GAG GAC TCA GTC AAC AGC ACC TGC AGC ACT 501 Cys His His His Cys Pro Giu Asp Ser VaL Asn Ser Thr Cys Ser Thr 40 GAT GGC TAC TGC TTC ACC ATA ATA GAA GAA GAT GAT TCT GGT GGA CAT 549 Asp GLy Tyr Cys Phe Thr lie lie Giu GLu Asp Asp Ser Giy Giy His 55 60 TTG GTC ACC AAA GGA TGT CTA GGA TTA GAG GGC TCG GAC TTC CAG TGT 597 Leu Vat Thr Lys Giy Cys Leu GLy Leu Giu Gly Ser Asp Phe Gin Cys 70 75 CGG GAC ACT CCT ATT CCA CAC CAA AGA AGA TCT ATT GAA TGC TGC ACA 645 Arg Asp Thr Pro lie Pro His Gin Arg Arg Ser lie Giu Cys Cys Thr 90 GGC CAA GAT TAC TGT AAC AAA CAT CTT CAC CCA ACG CTG CCA CCA CTG 693 Giy Gin Asp Tyr Cys Asn Lys His Leu His Pro Thr Leu Pro Pro Leu 100 105 110 AAA AAT CGA GAC TTT GCT GAA GGA AAC ATT CAC CAT AAG GCC CTG CTG 741 Lys Asn Arg Asp Phe Aia Giu Giy Asn lie His His Lys Aia Leu Leu 115 120 125 ATC TCG GTG ACT GTC TGT AGT ATA CTA CTG GTG CTT ATC ATC ATA TTC 789 Ile Ser Vai Thr Vat Cys Ser lie Leu Leu Vat Leu lie lie lie Phe 130 135 140 145 TGC TAC TTC AGG TAC AAG CGG CAA GAA GCC AGG CCC CGC TAC AGC ATC 837 Cys Tyr Phe Arg Tyr Lys Arg Gin Giu Ala Arg Pro Arg Tyr Ser Ile 150 155 160 GGG CTG GAG CAG GAC GAG ACC TAC ATT CCC CCT GGA GAA TCC CTG AAG 885 GLy Leu Giu Gin Asp Giu Thr Tyr lie Pro Pro GLy Giu Ser Leu Lys 165 170 175 GAT CTG ATC GAG CAG TCC CAG AGC TCA GOC AGC GGC TCC GGG CTC CCT 933 Asp Leu lie Giu Gin Ser Gin Ser Ser Giy Ser GLy Ser Giy Leu Pro 180 185 190 CTC CTG GTT CM AGG ACC ATA GCA AAA CAG ATT CAG ATG GTA AAA CAG 981 Leu Leu Vat Gin Arg Thr lie ALa Lys Gin lie Gin met Vat Lys Gin 195 200 205 ATT GGA AAA GGT CGC TAT GGG GAA GTC TGG ATG GGA AAG TGG CGT GGC 1029 Ile GLy Lys Gly Arg Tyr Giy Giu Vat Trp Met Gly Lys Trp Arg GLy 210 215 220 225 GAA AAG GTA GCT GTC AAA GTG-TTT TTT ACC ACG GAG GAG GCC AGC TGG 1077 Giu Lys Vat Ala Vat Lys Vat Phe Phe Thr Thr Gtu Giu ALa Ser Trp 230 235 240 WO 96/14579 PCT/US95/14027 69 TTC AGA GAA ACA GAA ATC TAC CAA ACT GTC CTG ATG AGG CAT GAA AAT 1125 Phe Arg GLu Thr Giu Ile Tyr Gin Thr Vat Leu Met Arg His Giu Asn 245 250 255 ATT CTC GGA TTC ATT GCG GCA GAC ATT AAA GGC ACA GGC TCT TGG ACC 1173 lie Leu GLy Phe lie Ala Ala Asp Ile Lys Gly Thr Giy Ser T-p Thr 260 265 270 CAA CTG TAT CTC ATC ACT GAC TAT CAT GAG AAT GGC TCC CTT TAC GAT 1221 Gin Leu Tyr Leu Ile Thr Asp Tyr His Giu Asn GLy Ser Leu Tyr Asp 275 280 285 TAC CTA AAA TCC ACC ACC CTG GAC ACA AAA GGC ATG CTA AAA TTG GCT 1269 Tyr Leu Lys Ser Thr Thr Leu Asp Thr Lys Giy Met Leu Lys Leu Ala 290 295 300 305 TAC TCC TCT GTT AGT GGC TTG TGC CAC CTA CAT ACA GGG ATC TTC AGT 1317 Tyr Ser Ser Vat Ser GLy Leu Cys His Leu His Thr Giy Ile Phe Ser 310 315 320 ACC CAA GGC AAA CCG GCT ATT GCC CAC CGT GAT CTA AAA AGT AAG AAC 1365 Thr Gin Giy Lys Pro Aia Ile Aia His Arg Asp Leu Lys Ser Lys Asn 325 330 335 ATC CTG GTG AAA AAG AAC GGA ACC TGC TGT ATA GCA GAT TTG GGC TTG 1413 Ile Leu Vai Lys Lys Asn Giy Thr Cys Cys Ile Aia Asp Leu Gty Leu 340 345 350 GCT GTT AAA TTT ATT AGT GAT ACA AAT GAG GTA GAC ATC CCT CCA AAC 1461 Aia Vat Lys Phe Ile Ser Asp Thr Asn Giu Vat Asp Ile Pro Pro Asn 355 360 365 ACC CGC GTA GGA ACA AAA CGC TAT ATG CCT CCT GAG GTG CTG GAT GAA 1509 Thr Arg Vat Giy Thr Lys Arg Tyr Met Pro Pro Giu Vat Leu Asp Glu 370 375 380 385 AGC TTG AAC AGA AAT CAC TTT CAG TCG TAC ATC ATG GCT GAT ATG TAC 1557 Ser Leu Asn Arg Asn His Phe Gin Ser Tyr lie Met Ala Asp Met Tyr 390 395 400 AGC TTT GGA CTC ATC CTT TGG GAG ATA GCC AGG AGA TGT GTG TCA GGA 1605 Ser Phe Giy Leu lie Leu Tip Giu Ile Ata Arg Arg Cys Vat Ser Gly 405 410 415 GGA ATA GTG GAA GAA TAC CAG CTC CCA TAT CAC GAC CTT GTC CCC AGT 1653 GLy Ile Vat Glu Giu Tyr Gin Leu Pro Tyr His Asp Leu Vat Pro Ser 420 425 430 GAC CCC TCC TAC GAG GAC ATG AGG GAG ATT GTG TGC ATC AAA AGG CTA 1701 Asp Pro Ser Tyr Giu Asp Met Arg Giu lie Vat Cys lie Lys Arg Leu 435 440 445 CGT CCT TCA TTC CCC AAC AGA TGG AGC AGC GAT GAG TGC CTG CGG CAG 1749 Arg Pro Ser Phe Pro Asn Arg Trp Ser Scr Asp Giu Cys Leu Arg Gin 450 455 460 465 ATO GGG AAG CTC ATG ATG GAG TGC TGG GCC CAT AAC CCT GCA TCC CGG 1797 Met Gty Lys Leu Met Met Giu Cys Trp Ala His Asn Pro Aia Ser Arg 470 475 480 CTC ACA GCC CTA CGA GTC AAA AAA ACA CTT GCC AAA ATG TCA GAG TCG 1845 Leu Thr Ala Leu Arg Vat Lys Lys Thr Leu ALa Lys Met Ser Giu Ser 485 490 495 CAG GAC ATT MG CTC TGATGGAGCA AAAACAGCTC CTTCTCGTGA AGACCCATGG 1900 Gin Asp Ile Lys Leu 500 AAACAGACTT TCTCTTGCAG GCAGAAGTCA TGGAGAGGTG CTGATMGTA CCCTGAGTGC 1960 AGTCATATTT AAGAGCAACT GTTTGTTTGA CAGCTTTGAG GAGACTGTTC TTGGCAAAAT 2020 CAGCTGAATT TTGGCATGCA AGGTTGGGAG AGGCTTATCT GCCCTTGTTT ACACAGGGAT 2080 ATACAGTTTT AGTAACTGGT TTMGGTTAT GCATGTTGCT TTCCGTGAAA GCCACTTATT 2140 WO 96/14579 PCTJUS95/14 0 2 7 ATTTTATTAT TATTGTTATT ATTATTATTT TGATTGTTTT AAAAGATACT GCTTTAAATT 2200 TTATGAAAAT AAAACCCTTT GGTTAGAAGA AAAAAAGATG TATATTGTTA CA 2252 INFORMATION FOR SEQ ID NO:14: SEQUENCE
CHARACTERISTICS:
LENGTH: 502 amino acids TYPE: amino acid TOPOLOGY: linear 00i MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ 10 NO:14: Met Pro Leu Leu Ser Ser Ser Lys Leu Ser Met Gtu Ser Arg Lys Giu 15 10 1 Asp Ser Giu Gly Thr ALa Pro Ala Pro Pro Gin Lys Lys Leu Ser Cys 25 Gin Cys His His His Cys Pro Giu Asp Ser Val Asn Ser Thr Cys Ser 3540 Thr Asp Gly Tyr Cys Phe Thr Ilie lie Gtu Giu Asp Asp Ser Gly Gty 55 His Leu Vat Thr Lys Giy Cys Leu Gty Leu Gtu Gty Ser Asp Phe Gin 70 75 Cys Arg Asp Thr Pro Ile Pro His Gtn Arg Arg Ser lie Giu Cys Cys 90 Thr Gty Gin Asp Tyr Cys Asn Lys His Leu His Pro Thr Leu Pro Pro 100 105 110 Leu Lys Asn Arg Asp Phe Ala Giu Gly Asn Ilie His His Lys Ata Leu 115 120 125 Leu lie Ser Vat Thr Vat Cys Ser lie Leu Leu Vat Leu lie Ite lie 130 135 140 Phe Cys Tyr Phe Arg Tyr Lys Arg Gin Gtu Ala Arg Pro Arg Tyr Ser 145 150 155 160 Ite Gty Leu Giu Gin Asp Gtu Thr Tyr Ile Pro Pro Gly Giu Ser Leu 50165 170 175 Lys Asp Leu Ilie Giu Gin Ser Gin Ser Ser Giy Ser Gty Ser Giy Leu 180 185 190 Pro Leu Leu Vai Gin Arg Thr lie ALa Lys Gin lie Gin Met Vai Lys 195 200 205 Gin lie Gty Lys Giy Arg Tyr Giy Giu Vat Trp Met Giy Lys Trp Arg 210 215 220 Giy Giu Lys Vat Aia Vat Lys Vat Phe Phe Thr Thr Giu Giu Aia Ser 225 230 235 240 Trp Phe Arg Giu Thr Giu lie Tyr Gin Thr Vat Leu Met Arg His Giu 245 250 255 Asn Ilie Leu Gly Phe lie Aia Aia Asp Ilie Lys Gly Thr Gty Ser Trp 260 265 270 Thr Gin Leu Tyr Leu lie Thr Asp Tyr His Giu Asn Giy 5cr Leu Tyr 275 280 285 Asp Tyr Leu Lys Ser Thr Thr Leu Asp Thr Lys Gty Met Leu Lys Leu 290 295 300 Ala Tyr Ser Ser Vat Ser Giy Leu Cys His Leu His Thr Giy lie Phe 305 310 315 320 WO 96/14579 PCT/US95/14027 71 Ser Thr Gin Gly Lys Pro Ala ILe ALa His Arg Asp Leu Lys Ser Lys 325 330 335 Asn ILe Leu Vat Lys Lys Asn Gly Thr Cys Cys He Ala Asp Leu Gly 340 345 350 Leu Ala Vat Lys Phe ILe Ser Asp Thr Asn Glu Vat Asp ILe Pro Pro 355 360 365 Asn Thr Arg Val GLy Thr Lys Arg Tyr Met Pro Pro Glu Vat Leu Asp 370 375 380 Gtu Ser Leu Asn Arg Asn His Phe Gin Ser Tyr ILe Met Ala Asp Met 385 390 395 400 Tyr Ser Phe Gly Leu ILe Leu Trp Glu Ire Ala Arg Arg Cys Val Ser 405 410 415 Gly Gly ILe Vat Glu Glu Tyr Gin Leu Pro Tyr His Asp Leu Vat Pro 420 425 430 Ser Asp Pro Ser Tyr Glu Asp Met Arg GLu Ile Vat Cys ILe Lys Arg 435 440 445 Leu Arg Pro Ser Phe Pro Asn Arg Trp Ser Ser Asp GLu Cys Leu Arg 450 455 460 Gin Met.Gly Lys Leu Met Met Glu Cys Trp Ala His Asn Pro ALa Ser 465 470 475 480 Arg Leu Thr Ala Leu Arg Vat Lys Lys Thr Leu Ala Lys Met Ser Glu 485 490 495 Ser Gin Asp ILe Lys Leu 500 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 469 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 11..469 (xi) SEQUENCE DESCRIPTION: SEQ ID GAATCAGACA ATG ACT CAG CTA TAC ACT TAC ATC AGA TTA CTG GGA GCC 49 Met Thr Gin Leu Tyr Thr Tyr Ire Arg Leu Leu Gly Ala 1 5 TGT CTG TTC ATC ATT TCT CAT GTT CAA GGG CAG AAT CTA GAT AGT ATG 97 Cys Leu Phe Ile ILe Ser His Vat Gin GLy Gin Asn Leu Asp Ser Met 20 CTC CAT GGC ACT GGT ATG AAA TCA GAC TTG GAC CAG AAG AAG CCA GAA 145 Leu His Gly Thr Gly Met Lys Ser Asp Leu Asp Gin Lys Lys Pro Glu 35 40 AAT GGA GTG ACT TTA GCA CCA GAG GAT ACC TTG CCT TTC TTA AAG TGC 193 Asn Gly Vat Thr Leu Ala Pro GLu Asp Thr Leu Pro Phe Leu Lys Cys 55 WO 96/14579 PCT/US95/14027 72 TAT TGC TCA GGA CAC TGC CCA GAT GAT GCT ATT AAT AAC ACA TGC ATA 241 Tyr Cys Ser Gly His Cys Pro Asp Asp Ala Ile Asn Asn Thr Cys lHe 70 ACT AAT GGC CAT TGC TTT GCC ATT ATA GAA GAA GAT GAT CAG GGA GAA 289 Thr Asn Gly His Cys Phe Ala ILe Ile GLu Glu Asp Asp Gin Gly Glu 85 ACC ACA TTA ACT TCT GGG TGT ATG AAG TAT GAA GGC TCT GAT TTT CAA 337 Thr Thr Leu Thr Ser GLy Cys Met Lys Tyr GLu GLy Ser Asp Phe Gin 100 105 TGC AAG GAT TCA CCG AAA GCC CAG CTA CGC AGG ACA ATA GAA TGT TGT 385 Cys Lys Asp Ser Pro Lys Ala GLn Leu Arg Arg Thr Hle Glu Cys Cys 110 115 120 125 CGG ACC AAT TTG TGC AAC CAG TAT TTG CAG CCT ACA CTG CCC CCT GTT 433 Arg Thr Asn Leu Cys Asn Gin Tyr Leu Gin Pro Thr Leu Pro Pro Val 0 130 135 140 GTT ATA GGT CCG TTC TTT GAT GGC AGC ATC CGA TGA 469 Vat lie Gly Pro Phe Phe Asp Gly Ser lie Arg 145 150 INFORMATION FOR SEQ ID NO:16: SEQUENCE CHARACTERISTICS: LENGTH: 152 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: Met Thr Gin Leu Tyr Thr Tyr Ire Arg Leu Leu Gly Ala Cys Leu Phe 1 5 10 lie lie Ser His Val Gin GLy Gin Asn Leu Asp Ser Met Leu His Gly 25 Thr GLy Met Lys Ser Asp Leu Asp Gin Lys Lys Pro Glu Asn Gly Val 40 Thr Leu Ala Pro GLu Asp Thr Leu Pro Phe Leu Lys Cys Tyr Cys Ser 55 Gly His Cys Pro Asp Asp Ala lie Asn Asn Thr Cys ILe Thr Asn Gly 65 70 75 His Cys Phe Ala lie ILe GLu GLu Asp Asp Gin Gly GLu Thr Thr Leu 90 Thr Ser Gly Cys Met Lys Tyr Glu Gly Ser Asp Phe Gin Cys Lys Asp 100 105 110 Ser Pro Lys Ala Gin Leu Arg Arg Thr lie Glu Cys Cys Arg Thr Asn 115 120 125 Leu Cys Asn Gin Tyr Leu Gin Pro Thr Leu Pro Pro Vat Val ILe Gly 130 135 140 Pro Phe Phe Asp GLy Ser Ile Arg 145 150 INFORMATION FOR SEQ ID NO:17: SEQUENCE CHARACTERISTICS: LENGTH: 391 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear WO 96/14579 PCTIUS95/14027 73 (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 11..391 10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: TCTGGACAAG ATG CCC TTG CTT AGC TCC AGC AAG TTG AGC ATG GAG AGC 49 Met Pro Leu Leu Ser Ser Ser Lys Leu Ser Met GLu Ser 1 5 AGA AAA GAA GAT AGT GAG GGC ACA GCA CCT GCC CCT CCA CAG AAG AAG 97 Arg Lys GLu Asp Ser Glu GLy Thr ALa Pro ALa Pro Pro GLn Lys Lys 20 CTG TCA TGT CAG TGC CAC CAC CAT TGT CCT GAG GAC TCA GTC AAC AGC 145 Leu Ser Cys GLn Cys His His His Cys Pro GLu Asp Ser Vat Asn Ser 35 40 ACC TGC AGC ACT GAT GGC TAC TGC TTC ACC ATA ATA GAA GAA GAT GAT 193 Thr Cys Ser Thr Asp GLy Tyr Cys Phe Thr Ile lie GLu Glu Asp Asp 50so 55 TCT GGT GGA CAT TTG GTC ACC AAA GGA TGT CTA GGA TTA GAG GGC TCG 241 Ser Gty GLy His Leu Vat Thr Lys GLy Cys Leu Gly Leu GLu GLy Ser 65 70 GAC TTC CAG TGT CGG GAC ACT CCT ATT CCA CAC CAA AGA AGA TCT ATT 289 Asp Phe Gtn Cys Arg Asp Thr Pro lie Pro His GLn Arg Arg Ser Ite 85 GAA TGC TGC ACA GGC CAA GAT TAC TGT AAC AAA CAT CTT CAC CCA ACG 337 Glu Cys Cys Thr Gly Gin Asp Tyr Cys Asn Lys His Leu His Pro Thr 100 105 CTG CCA CCA CTG AAA AAT CGA GAC TTT GCT GAA GGA AAC ATT CAC CAT 385 Leu Pro Pro Leu Lys Asn Arg Asp Phe Ala Glu Gly Asn lie His His 110 115 120 125 AAG TGA 391 Lys INFORMATION FOR SEQ ID NO:18: SEQUENCE CHARACTERISTICS: LENGTH: 126 amino acids TYPE: amino acid TOPOLOGY: Linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: Met Pro Leu Leu Ser Ser Ser Lys Leu Ser Met GLu Ser Arg Lys GLtu 1 5 10 Asp Ser GLu Gly Thr Ala Pro Ala Pro Pro Gin Lys Lys Leu Ser Cys 25 Gin Cys His His His Cys Pro GLu Asp Ser Vat Asn Ser Thr Cys Ser 40 Thr Asp Gly Tyr Cys Phe Thr ILe Ile GLu GLu Asp Asp Ser GLy Gly 55 His Leu Vat Thr Lys GLy Cys Leu Gly Leu GLu GLy Ser Asp Phe GiLn 70 75 Cys Arg Asp Thr Pro Ile Pro His GLn Arg Arg Ser ILe GLu Cys Cys 85 90 WO 96/14579 PCTIUS95/14027 74 Thr Gly Gin Asp Tyr Cys Asn Lys His Leu His Pro Thr Leu Pro Pro 100 105 110 Leu Lys Asn Arg Asp Phe Ala Glu GLy Asn lie His His Lys 115 120 125 INFORMATION FOR SEQ ID NO:19: SEQUENCE CHARACTERISTICS: LENGTH: 706 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 11..706 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: GAATCAGACA ATG ACT CAG CTA TAC ACT TAC ATC AGA TTA CTG GGA GCC Met Thr GLn Leu Tyr Thr Tyr lie Arg Leu Leu Gly Ala 1 5 TGT CTG TTC ATC 3U Cys Leu Phe ILe CTC CAT GGC ACT Leu His Gly Thr 30 AAT GGA GTG ACT Asn GLy Val Thr TAT TGC TCA GGA Tyr Cys Ser Gly ACT AAT GGC CAT Thr Asn GLy His ACC ACA TTA ACT Thr Thr Leu Thr TGC AAG GAT TCA Cys Lys Asp Ser 110 CGG ACC AAT TTG Arg Thr Asn Leu GTT ATA GGT CCG Vai Ie GLy Pro 145 ATT TCC ATG GCT lie Ser Met Ala 160 ATT TCT CAT GTT CAA GGG CAG AAT CTA GAT AGT ATG lie Ser His Vat GLn Gly GLn Asn Leu Asp Ser Met 20 GGT ATG AAA TCA GAC TTG GAC CAG AAG AAG CCA GAA GLy Met Lys Ser Asp Leu Asp Gin Lys Lys Pro GLu 35 40 TTA GCA CCA GAG GAT ACC TTG CCT TTC TTA AAG TGC Leu Aa Pro Glu Asp Thr Leu Pro Phe Leu Lys Cys 55 CAC TGC CCA GAT GAT GCT ATT AAT AAC ACA TGC ATA His Cys Pro Asp Asp Ala lie Asn Asn Thr Cys IHe 70 TGC TTT GCC ATT ATA GAA GAA GAT GAT CAG GGA GAA Cys Phe ALa ILe ILe Glu GLu Asp Asp Gin GLy GLu 85 TCT GGG TGT ATG AAG TAT GAA GGC TCT GAT TTT CAA Ser GLy Cys Met Lys Tyr GLu Gly Ser Asp Phe GLn 100 105 CCG AAA GCC CAG CTA CCC AGG ACA ATA GAA TGT TGT Pro Lys Ala Gin Leu Arg Arg Thr lie GLu Cys Cys 115 120 125 TGC AAC CAG TAT TTG CAG CCT ACA CTG CCC CCT GTT Cys Asn GLn Tyr Leu Gin Pro Thr Leu Pro Pro Vat 130 135 140 TTC TTT GAT GGC AGC ATC CGA TGG CTG GTT GTG CTC Phe Phe Asp Gly Ser lie Arg Trp Leu Vat Vat Leu 150 155 GTC TGT ATA GTT GCT ATG ATC ATC TTC TCC AGC TGC Vai Cys ILe Vat Ala Met ILe lie Phe Ser Ser Cys 165 170 TTT TGC TAT AAG CAT TAT TGT AAG AGT ATC TCA AGC AGG GGT CGT TAC Phe Cys Tyr Lys His Tyr Cys Lys Ser ILe Ser Ser Arg Gly Arg Tyr 175 180 185 WO 96/14579 PCT/US95/14027 AAC CGT GAT TTG GAA CAG GAT GAA GCA TTT ATT CCA GTA GGA GAA TCA 625 Asn Arg Asp Leu GLU Gin Asp Glu ALa Phe lie Pro Vat GLy GLu Ser 190 195 200 205 TTG AAA GAC CTG ATT GAC CAG TCC CAA AGC TCT GGG AGT GGA TCT GGA 673 Leu Lys Asp Leu lie Asp Gin Ser GiLn Ser Ser Gly Ser Gly Ser Gly 210 215 220 TTG CCT TTA TTG GTT CAG CGA ACT ATT GCC TGA 706 Leu Pro Leu Leu Vat GLn Arg Thr ILe Ala 225 230 15 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 231 amino acids TYPE: amino acid 20 TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Met Thr GLn Leu Tyr Thr Tyr lIe Arg Leu Leu Gly Ala Cys Leu Phe 1 5 10 lie ILe Ser His Vat Gin Gly GLn Asn Leu Asp Ser Met Leu His Gly 30 20 25 Thr GLy Met Lys Ser Asp Leu Asp Gin Lys Lys Pro GLu Asn Gly Vat 40 Thr Leu Ala Pro GLu Asp Thr Leu Pro Phe Leu Lys Cys Tyr Cys Ser 50 55 Gly His Cys Pro Asp Asp Ala ILe Asn Asn Thr Cys lie Thr Asn Gly 70 75 His Cys Phe Ata lie ILe GLu GLu Asp Asp Gin Gly GLu Thr Thr Leu 90 Thr Ser Gly Cys Met Lys Tyr G(u Gly Ser Asp Phe GLn Cys Lys Asp 100 105 110 Ser Pro Lys Ala Gin Leu Arg Arg Thr lie GLu Cys Cys Arg Thr Asn 115 120 125 Leu Cys Asn Gin Tyr Leu Gin Pro Thr Leu Pro Pro Vai Vat lie Gly 130 135 140 Pro Phe Phe Asp Gly Ser ILe Arg Trp Leu Vat Vat Leu ILe Ser Met 145 150 155 160 Aia val cys lie Vat Ala Met lie lie Phe Ser Ser Cys Phe Cys Tyr 165 170 175 Lys His Tyr Cys Lys Ser Ile Ser Ser Arg GLy Arg Tyr Asn Arg Asp 60 180 185 190 Leu GLu Gin Asp Glu Ala Phe ILe Pro Vat Gly GLu Ser Leu Lys Asp 195 200 205 Leu lie Asp Gin Ser GLn Ser Ser GLy Ser GLy Ser GLy Leu Pro Leu 7 210 215 220 Leu Vat Gin Arg Thr lie Ala 225 230 INFORMATION FOR SEQ ID NO:21: SEQUENCE CHARACTERISTICS: LENGTH: 616 base pairs TYPE: nucleic acid WO 96/14579 PCT/US95/14027 76 STRANDEDNESS: double TOPOLOGY: Linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 11..616 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: TCTGGACAAG ATG CCC TTG CTT AGC TCC AGC AAG TTG AGC ATG GAG AGC 49 15 Met Pro Leu Leu Ser Ser Ser Lys Leu Ser Met GLu Ser 1 5 AGA AAA GAA GAT AGT GAG GGC ACA GCA CCT GCC CCT CCA CAG AAG AAG 97 Arg Lys GLu Asp Ser GLu GLy Thr Ala Pro Ala Pro Pro Gin Lys Lys 15 20 25 CTG TCA TGT CAG TGC CAC CAC CAT TGT CCT GAG GAC TCA GTC AAC AGC 145 Leu Ser Cys GLn Cys His His His Cys Pro Glu Asp Ser Val Asn Ser 35 40 ACC TGC AGC ACT GAT GGC TAC TGC TTC ACC ATA ATA GAA GAA GAT GAT 193 Thr Cys Ser Thr Asp GLy Tyr Cys Phe Thr Ile ILe GLu GLu Asp Asp 55 TCT GGT GGA CAT TTG GTC ACC AAA GGA TGT CTA GGA TTA GAG GGC TCG 241 Ser GLy GLy His Leu Vat Thr Lys Gly Cys Leu Gly Leu GLu GLy Ser 70 GAC TTC CAG TGT CGG GAC ACT CCT ATT CCA CAC CAA AGA AGA TCT ATT 289 Asp Phe GLn Cys Arg Asp Thr Pro ILe Pro His GLn Arg Arg Ser Ile 85 GAA TGC TGC ACA GGC CAA GAT TAC TGT AAC AAA CAT CTT CAC CCA ACG 337 GLu Cys Cys Thr GLy Gin Asp Tyr Cys Asn Lys His Leu His Pro Thr 95 100 105 CTG CCA CCA CTG AAA AAT CGA GAC TTT GCT GAA GGA AAC ATT CAC CAT 385 Leu Pro Pro Leu Lys Asn Arg Asp Phe Aia GLu Gly Asn lie His His 110 115 120 125 AAG GCC CTG CTG ATC TCG GTG ACT GTC TGT AGT ATA CTA CTG GTG CTT 433 Lys Ala Leu Leu Ile Ser Vai Thr Val Cys Ser Ile Leu Leu Vai Leu 130 135 140 ATC ATC ATA TTC TGC TAC TTC AGG TAC MAAG CG CAA GAAM GCC AGG CCC 481 lie ILe Ile Phe Cys Tyr Phe Arg Tyr Lys Arg Gin Glu Ala Arg Pro 145 150 155 CGC TAC AGC ATC GGG CTG GAG CAG GAC GAG ACC TAC ATT CCC CCT GGA 529 Arg Tyr Ser ILe Gly Leu GLu GLn Asp GLu Thr Tyr Ile Pro Pro Gly 160 165 170 GAA TCC CTG AAG GAT CTG ATC GAG CAG TCC CAG AGC TCA GGC AGC GGC 577 GLu Ser Leu Lys Asp Leu lie GLu GLn Ser Gin Ser Ser GLy Ser Gly 175, 180 185 TCC GGG CTC CCT CTC CTG GTT CAA AGG ACC ATA GCA TGA 616 Ser GLy Leu Pro Leu Leu Vai GLn Arg Thr lie Ala 190 195 200 INFORMATION FOR SEQ ID NO:22: SEQUENCE CHARACTERISTICS: LENGTH: 201 amino acids TYPE: amino acid TOPOLOGY: Linear (ii) MOLECULE TYPE: protein WO 96/14579 PCTIUS95/14027 77 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:22: Met Pro Leu Leu Ser Ser Ser Lys Leu Ser Met Glu Ser Arg Lys GLu 1 5 10 Asp Ser GLu GLy Thr Ala Pro Ala Pro Pro GLn Lys Lys Leu Ser Cys 25 Gin Cys His His His Cys Pro GLu Asp Ser Val Asn Ser Thr Cys Ser 35 40 Thr Asp Gly Tyr Cys Phe Thr ILe Ire Glu GLu Asp Asp Ser GLy Gly 55 His Leu Val Thr Lys GLy Cys Leu Gly Leu Glu Gly Ser Asp Phe Gin 70 75 Cys Arg Asp Thr Pro ILe Pro His Gin Arg Arg Ser Ile Glu Cys Cys 85 90 Thr GLy GLn Asp Tyr Cys Asn Lys His Leu His Pro Thr Leu Pro Pro 100 105 110 Leu Lys Asn Arg Asp Phe Ala GLu GLy Asn Ile His His Lys Ala Leu 115 120 125 Leu Ile Ser Vat Thr Val Cys Ser ILe Leu Leu Val Leu Ire ILe ILe 130 135 140 Phe Cys Tyr Phe Arg Tyr Lys Arg Gin Glu Ala Arg Pro Arg Tyr Ser 145 150 155 160 IHe Gly Leu Glu Gin Asp Glu Thr Tyr Ile Pro Pro GLy GLu Ser Leu 165 170 175 Lys Asp Leu ILe GLu Gin Ser Gin Ser Ser Gly Ser Gly Ser Gly Leu 180 185 190 Pro Leu Leu Val Gin Arg Thr Ire Ala 195 200 INFORMATION FOR SEQ ID NO:23: SEQUENCE CHARACTERISTICS: LENGTH: 613 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 11..613 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: TGGCCCAGGG ATG ACT TCC TCG CTG CAG CGG CCC TGG CGG GTG CCC TGG 49 Met Thr Ser Ser Leu Gin Arg Pro Trp Arg Vat Pro Trp 1 5 CTA CCA TGG ACC ATC CTG CTG GTC AGC ACT GCG GCT GCT TCG CAG AAT 97 Leu Pro Trp Thr Ire Leu Leu Vat Ser Thr Ala Ala Ala Ser Gin Asn 20 CAA GAA CGG CTA TGT GCG TTT AAA GAT CCG TAT CAG CAA GAC CTT GGG 145 Gin Glu Arg Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp Leu GLy 35 40 ATA GGT GAG AGT AGA ATC TCT CAT GAA AAT GGG ACA ATA TTA TGC TCG 193 IHe GLy Glu Ser Arg Ile Ser His GLu Asn Gly Thr Ire Leu Cys Ser so 55 WO 96/14579 PCTIUS95/14027 AAA GGT AGC ACC TGC TAT GGC CTT TGG GAG AAA TCA AAA GGG GAC ATA Lys GLy Ser Thr Cys Tyr Gly Leu Trp GLu Lys Ser Lys GLy Asp Ile 70 AAT CTT GTA AAA CAA GGA TGT TGG TCT CAC ATT GGA GAT CCC CAA GAG Asn Leu Vat Lys GLn GLy Cys Trp Ser His lie GLy Asp Pro Gin GLu 85 TGT CAC TAT GAA GAA TGT GTA GTA ACT ACC ACT CCT CCC TCA ATT CAG Cys His Tyr GLu GLu Cys Vai Vai Thr Thr Thr Pro Pro Ser ILe GLn 100 105 AAT GGA ACA TAC CGT TTC TGC TGT TGT AGC ACA GAT TTA TGT AAT GTC Asn GLy Thr Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys Asn Vat 110 115 120 125 AAC TTT ACT GAG AAT TTT CCA CCT CCT GAC ACA ACA CCA CTC AGT CCA 2 Asn Phe Thr GLu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu Ser Pro 130 135 140 CCT CAT TCA TTT AAC CGA GAT GAG ACA ATA ATC ATT GCT TTG GCA TCA Pro His Ser Phe Asn Arg Asp GLu Thr Ile lie lie Ala Leu Ala Ser 25 145 150 155 GTC TCT GTA TTA GCT GTT TTG ATA GTT GCC TTA TGC TTT GGA TAC AGA Vai Ser Vai Leu ALa Vat Leu ILe VaL Ala Leu Cys Phe Gly Tyr Arg 160 165 170 ATG TTG ACA GGA GAC CGT AAA CAA GGT CTT CAC AGT ATG AAC ATG ATG Met Leu Thr GLy Asp Arg Lys GLn Gly Leu His Ser Met Asn Met Met 175 180 185 GAG GCA GCA GCA TCC GAA CCC TCT CTT GAT CTA TGA GLu Ala ALa Ala Ser GLu Pro Ser Leu Asp Leu 190 195 200 INFORMATION FOR SEQ ID NO:24: SEQUENCE CHARACTERISTICS: LENGTH: 200 amino acids TYPE: amino acid TOPOLOGY: Linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: Met Thr Ser Ser Leu Gin Arg Pro Trp Arg Vat Pro Trp Leu Pro Trp 1 5 10 Thr lie Leu Leu Vat Ser Thr Ala Ala Ala Ser Gin Asn GLn GLu Arg 20 25 Leu Cys Ala Phe Lys Asp Pro Tyr GLn Gin Asp Leu Gly ILe GLy Glu 40 Ser Arg Ite Ser His Glu Asn Gly Thr lie Leu Cys Ser Lys Gly Ser 50 55 Thr Cys Tyr Gly Leu Trp GLu Lys Ser Lys GLy Asp ILe Asn Leu Vat 70 75 Lys GLn GLy Cys Trp Ser His ILe Gly Asp Pro Gin Glu Cys His Tyr 90 GLu Glu Cys Vat Vat Thr Thr.Thr Pro Pro Ser lie Gin Asn Gly Thr 100 105 110 Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys Asn Val Asn Phe Thr 115 120 125 GLu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu Ser Pro Pro His Ser 130 135 140 WO 96/14579 PCT/US95/14027 79 Phe Asn Arg Asp GLu Thr iHe ILe Ile Ala Leu Ala Ser Vat Ser Vat 145 150 155 160 Leu Ala Vat Leu Ile Vat Ala Leu Cys Phe Gly Tyr Arg Met Leu Thr 165 170 175 GLy Asp Arg Lys GiLn Gly Leu His Ser Met Asn Met Met GLu Ala Ala 0 180 185 190 Ala Ser GLu Pro Ser Leu Asp Leu 195 200 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 613 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: Linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 11..613 (xi) SEQUENCE DESCRIPTION: SEQ ID TGGCCCAGGG ATG ACT TCC TCG CTG CAT CGG CCC TTT CGG GTG CCC TGG 49 Met Thr Ser Ser Leu His Arg Pro Phe Arg Vat Pro Trp 1 5 CTG CTA TGG GCC GTC CTG CTG GTC AGC ACT ACG GCT GCT TCT CAG AAT 97 Leu Leu Trp ALa Vat Leu Leu Vat Ser Thr Thr ALa Ala Ser GILn Asn 15 20 CAA GAA CGG CTG TGT GCA TTT AAA GAT CCA TAT CAA CAA GAT CTT GGG 145 Gin Glu Arg Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp Leu Gly 35 40 ATA GGT GAG AGT CGA ATC TCT CAT GAA AAT GGG ACA ATA TTA TGT TCC 193 Ile GLy GLu Ser Arg ILe Ser His Glu Asn Gly Thr Ile Leu Cys Ser 55 AAA GGG AGC ACG TGT TAT GGT CTG TGG GAG AAA TCA AAA GGG GAC ATC 241 Lys GLy Ser Thr Cys Tyr GLy Leu Trp Glu Lys Ser Lys Gly Asp Ile 70 AAT CTT GTG AAA CAA GGA TGT TGG TCT CAC ATC GGT GAT CCC CAA GAG 289 Asn Leu VaL Lys Gin GLy Cys Trp Ser His Ile GLy Asp Pro Gin GLu 80 85 TGC CAC TAT GAA GAG TGT GTA GTA ACT ACC ACC CCA CCC TCA ATT CAG 337 Cys His Tyr Glu GLu Cys Val Vat Thr Thr Thr Pro Pro Ser ILe Gin 95 100 105 AAT GGA ACG TAC CGC TTT TGC TGC TGT AGT ACA GAT TTA TGT AAT GTC 385 Asn Gly Thr Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys Asn Vat 110 115 120 125 AAC TTT ACT GAG AAC TTT CCA CCC CCT GAC ACA ACA CCA CTC AGT CCA 433 Asn Phe Thr Glu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu Ser Pro 130 135 140 CCT CAT TCA TTT AAT CGA GAT GAA ACG ATA ATC ATT GCT TTG GCA TCA 481 Pro His Ser Phe Asn Arg Asp Glu Thr Ile ILe lie ALa Leu Ala Ser 145 150 155 GTT TCT GTG TTA GCT GTT TTG ATA GTC GCC TTA TGT TTT GGA TAC AGA 529 Vat Ser Vat Leu Ala Vat Leu Ile Vat Ala Leu Cys Phe GLy Tyr Arg 160 165 170 WO 96/14579 PCT/US95/14027 ATG TTG ACA GGA GAC CGG AAA CAG GGT CTT CAC AGC ATG AAC ATG ATG 577 Met Leu Thr Gly Asp Arg Lys Gin Gly Leu His Ser Met Asn Met Met 175 180 185 GAG GCG GCA GCA GCA GAG CCC TCC CTT GAC CTG TGA 613 Glu Ala Ala ALa Ala GLu Pro Ser Leu Asp Leu 190 195 200 INFORMATION FOR SEQ ID NO:26: SEQUENCE CHARACTERISTICS: LENGTH: 200 amino acids TYPE: amino acid TOPOLOGY: Linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: Met Thr Ser Ser Leu His Arg Pro Phe Arg Val Pro Trp Leu Leu Trp 1 5 10 Ala Vat Leu Leu Val Ser Thr Thr Ala Ala Ser Gin Asn Gin Glu Arg 25 Leu Cys Ala Phe Lys Asp Pro Tyr Gin Gin Asp Leu Gly lie Gly Glu 3035 40 Ser Arg Ire Ser His GLu Asn Gly Thr lie Leu Cys Ser Lys Gly Ser 55 Thr Cys Tyr Gly Leu Trp GLu Lys Ser Lys Gly Asp lie Asn Leu Vat 65 70 75 Lys Gin GLy Cys Trp Ser His ILe Gly Asp Pro Gin Glu Cys His Tyr 90 Glu Glu Cys Vat Val Thr Thr Thr Pro Pro Ser lie Gin Asn Gly Thr 100 105 110 Tyr Arg Phe Cys Cys Cys Ser Thr Asp Leu Cys Asn Vat Asn Phe Thr 115 120 125 GLu Asn Phe Pro Pro Pro Asp Thr Thr Pro Leu Ser Pro Pro His Ser 130 135 140 Phe Asn Arg Asp Glu Thr ILe Ite lie Ala Leu Ala Ser Vat Ser Vat 145 150 155 160 Leu Ala Vat Leu ILe Vat Ala Leu Cys Phe GLy Tyr Arg Met Leu Thr 165 170 175 Gly Asp Arg Lys Gin Gly Leu His Ser Met Asn Met Met GLu Ala Ala 180 185 190 Ala Ala GLu Pro Ser Leu Asp Leu 195 200
Claims (8)
1. A method for determining whether a compound is capable of binding to a BMP receptor kinase protein complex, the method comprising introducing a sample comprising the compound to the complex and allowing the compound to bind to the complex, wherein the complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3, wherein the BMP receptor kinase protein BRK-3 has the amino acid sequence: SEQ ID NO:2 or soluble fragment thereof; SEQ ID NO:4 or soluble fragment thereof; or SEQ ID NO:8 or soluble fragment thereof. 9
2. The method of Claim 1, wherein the BMP type I receptor kinase protein has the amino acid sequence SEQ ID NO:12 or SEQ ID NO:14. 9* 9 S3. The method of Claim 2, wherein the BMP type I receptor kinase protein has the amino acid sequence SEQ ID NO:14 and the BMP receptor kinase S protein BRK-3 has the amino acid sequence SEQ ID NO:4.
4. A host cell co-transfected with an expression vector comprising a DNA sequence that codes for BMP receptor kinase protein BRK-3 and an expression vector comprising a DNA sequence that codes for a BMP type I receptor kinase protein. The host cell of Claim 4, wherein the DNA sequence that codes for the BMP receptor kinase protein BRK-3 is SEQ ID NO:1; SEQ ID NO:3; SEQ ID SEQ ID NO:7; or SEQ ID NO:9.
6. The host cell of Claim 4 or Claim 5, wherein the DNA sequence that codes for the BMP type I receptor kinase protein is SEQ ID NO:11 or SEQ ID 0 :13. i d t\ I 9 9* .9 9 .9
7. The host cell of Claim 4, Claim 5 or Claim 6 wherein the DNA sequence that codes for the BMP receptor kinase protein BRK-3 is SEQ ID NO:3 and the DNA sequence that codes for the BMP type I receptor kinase protein is SEQ ID NO:11 or SEQ ID NO:13.
8. A method for determining the concentration of a BMP receptor ligand in a clinical sample, the method comprising: a. combining the clinical sample comprising the ligand with a BMP receptor kinase protein complex and a labeled BMP; b. allowing the labeled BMP to bind to the complex in the presence of the sample; and c. comparing with a standard curve prepared with known concentration of a BMP ligand; wherein the BMP receptor kinase protein complex is comprised of a BMP type I receptor kinase protein and BMP receptor kinase protein BRK-3, wherein the BMP receptor kinase protein BRK-3 has the amino acid sequence: SEQ ID NO:2 or soluble fragment thereof; SEQ ID NO:4 or soluble fragment thereof; or SEQ ID NO:8 or soluble fragment thereof.
9. The method of Claim 8, wherein the BMP type I receptor kinase protein has the amino acid sequence SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; or SEQ ID NO:18. A method for determining whether a test compound produces a signal upon binding to a BMP receptor protein complex, the method characterized in that it comprises: labeling BMP receptor protein complex expressing cells with 32P, wherein the cells have been transfected with a DNA sequence coding for BMP receptor kinase protein BRK-3 and a DNA sequence coding for a BMP type I receptor kinase protein; 83 culturing: a first set of the cells in the presence of the test compound, and (ii) a second set of the cells in the absence of the test compound; quantitating via autoradiography any phosphorylated proteins produced from step and comparing the amount of phosphorylated proteins quantitated in step from the first set of cells to the amount of phosphorylated proteins quantitated in step for the second set of cells, wherein the BMP receptor kinase protein BRK-3 has the amino acid sequence: SEQ ID NO:2 or soluble fragment thereof; SEQ ID NO:2 or soluble fragment thereof; SEQ ID NO:8 or soluble fragment thereof. SEQ ID NO:8 or soluble fragment thereof. o
11. The method of Claim 10, wherein the BMP type I receptor kinase protein has the amino acid sequence SEQ ID NO:12; SEQ ID NO:14; SEQ ID NO:16; or to SEQ ID NO:18. o. DATED this 27th day of July, 1999 THE PROCTER GAMBLE COMPANY WATERMARK PATENT TRADEMARK ATTORNEYS 290 BURWOOD ROAD HAWTHORN VICTORIA 3122 AUSTRALIA LCG:JGC:PCP DOC 28 AU3971395.WPC 1 \-KN V-t
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US33417894A | 1994-11-04 | 1994-11-04 | |
US08/334178 | 1994-11-04 | ||
US08/462467 | 1995-06-05 | ||
US08/462,467 US6210899B1 (en) | 1994-11-04 | 1995-06-05 | Use of a BMP protein receptor complex for screening bone metabolism actives and cells co-transfected with a type II BMP receptor and type I BMP receptor |
PCT/US1995/014027 WO1996014579A1 (en) | 1994-11-04 | 1995-10-30 | The use of a bmp protein receptor complex for screening bone metabolism actives and cells co-transfected with a type ii bmp receptor and a type i bmp receptor |
Publications (2)
Publication Number | Publication Date |
---|---|
AU3971395A AU3971395A (en) | 1996-05-31 |
AU710559B2 true AU710559B2 (en) | 1999-09-23 |
Family
ID=26989071
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU39713/95A Ceased AU710559B2 (en) | 1994-11-04 | 1995-10-30 | The use of a bmp protein receptor complex for screening bone metabolism actives and cells co-transfected with a type II bmp receptor and a type I bmp receptor |
Country Status (8)
Country | Link |
---|---|
US (2) | US6210899B1 (en) |
EP (1) | EP0789844B1 (en) |
JP (1) | JP3527248B2 (en) |
AT (1) | ATE213064T1 (en) |
AU (1) | AU710559B2 (en) |
DE (1) | DE69525366T2 (en) |
DK (1) | DK0789844T3 (en) |
WO (1) | WO1996014579A1 (en) |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6306622B1 (en) * | 1994-11-04 | 2001-10-23 | The Procter & Gamble Co. | cDNA encoding a BMP type II receptor |
AU4424996A (en) * | 1994-12-14 | 1996-07-03 | Amgen Boulder Inc. | A tgf-beta superfamily type ii receptor having binding affinity |
CA2229557A1 (en) * | 1995-08-14 | 1997-02-27 | Creative Biomolecules, Inc. | Binding of osteogenic protein-i (op-1) and analogs thereof to the cell surface receptor alk-1 and analogs thereof |
IL132922A0 (en) * | 1997-05-16 | 2001-03-19 | Procter & Gamble | The use of a bone morphogenetic protein (bmp) receptor complex for screening |
EP1575485A4 (en) * | 2002-04-12 | 2008-02-27 | Univ Boston | Methods for lightening skin and hair |
CA2571218C (en) | 2004-06-17 | 2015-11-03 | William D. Carlson | Tdf-related compounds and analogs thereof |
HUE026634T2 (en) | 2005-09-20 | 2016-07-28 | Thrasos Innovation Inc | TDF-related compounds and analogs thereof |
US20070293587A1 (en) * | 2006-05-23 | 2007-12-20 | Haley Jeffrey T | Combating sinus, throat, and blood infections with xylitol delivered in the mouth |
BRPI0921726B8 (en) * | 2008-10-31 | 2021-07-27 | Synthes Gmbh | method of preparing an implant composition to promote bone growth in a mammal |
KR101451340B1 (en) * | 2012-08-02 | 2014-10-15 | (주)애드바이오텍 | Composition for hair-growth |
CA3218058A1 (en) * | 2021-04-28 | 2022-11-03 | The Trustees Of Columbia University In The City Of New York | Antibodies for the treatment and prevention of covid-19 and emerging variants |
Family Cites Families (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5013649A (en) | 1986-07-01 | 1991-05-07 | Genetics Institute, Inc. | DNA sequences encoding osteoinductive products |
ZA874681B (en) | 1986-07-01 | 1988-04-27 | Genetics Inst | Novel osteoinductive factors |
CA2002011A1 (en) | 1988-11-14 | 1990-05-14 | Anthony F. Purchio | Normal human growth regulatory receptor for tgf-beta |
US5168050A (en) | 1990-05-24 | 1992-12-01 | Genentech, Inc. | Mammalian expression of the bone morphogenetic protein-2b using bmp2a/bmp2b fusion |
JPH06500574A (en) | 1991-05-10 | 1994-01-20 | ザ ソーク インスティテュート フォア バイオロジカル スタディーズ | Cloning and recombinant production of receptors of the activin/TGF-β superfamily |
US5216126A (en) | 1991-06-19 | 1993-06-01 | Genentech, Inc. | Receptor polypeptides and their production and uses |
JP4124815B2 (en) | 1991-10-31 | 2008-07-23 | ホワイトヘッド インスティチュート フォー バイオメディカル リサーチ | TGF-β type receptor cDNA and use thereof |
AU3920693A (en) | 1992-03-18 | 1993-10-21 | General Hospital Corporation, The | Four novel receptors of the TGF-beta receptor family |
NZ257631A (en) | 1992-11-17 | 1996-03-26 | Ludwig Inst Cancer Res | Serine/threonine kinase domain-containing protein, dna and hosts therefor |
US6291206B1 (en) | 1993-09-17 | 2001-09-18 | Genetics Institute, Inc. | BMP receptor proteins |
US6248554B1 (en) | 1993-11-24 | 2001-06-19 | The Procter & Gamble Company | DNA sequence coding for a BMP receptor |
-
1995
- 1995-06-05 US US08/462,467 patent/US6210899B1/en not_active Expired - Fee Related
- 1995-10-30 JP JP51537396A patent/JP3527248B2/en not_active Expired - Fee Related
- 1995-10-30 DK DK95937676T patent/DK0789844T3/en active
- 1995-10-30 WO PCT/US1995/014027 patent/WO1996014579A1/en active IP Right Grant
- 1995-10-30 DE DE69525366T patent/DE69525366T2/en not_active Expired - Fee Related
- 1995-10-30 AU AU39713/95A patent/AU710559B2/en not_active Ceased
- 1995-10-30 EP EP95937676A patent/EP0789844B1/en not_active Expired - Lifetime
- 1995-10-30 AT AT95937676T patent/ATE213064T1/en not_active IP Right Cessation
-
2000
- 2000-12-20 US US09/742,153 patent/US7105290B2/en not_active Expired - Fee Related
Non-Patent Citations (3)
Title |
---|
MOL AND CELL BIOL, VOL.15, NO.7, JUL 1995, PP3479-3486 * |
PROC.NATL.ACAD.SCI.,VOL 92, AUG 1995, USA PP7632-7636 * |
THE JOURN OF BIOL CHEM,VOL 270,NO.3,22 SEP 1995PP22522-22526 * |
Also Published As
Publication number | Publication date |
---|---|
DE69525366T2 (en) | 2002-11-07 |
JPH10510047A (en) | 1998-09-29 |
EP0789844A1 (en) | 1997-08-20 |
JP3527248B2 (en) | 2004-05-17 |
EP0789844B1 (en) | 2002-02-06 |
US20030096296A1 (en) | 2003-05-22 |
AU3971395A (en) | 1996-05-31 |
ATE213064T1 (en) | 2002-02-15 |
DK0789844T3 (en) | 2002-05-27 |
US6210899B1 (en) | 2001-04-03 |
WO1996014579A1 (en) | 1996-05-17 |
DE69525366D1 (en) | 2002-03-21 |
US7105290B2 (en) | 2006-09-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6835544B2 (en) | Methods of screening for compounds that bind to activin receptor | |
US7893213B2 (en) | Antibodies to activin receptor | |
EP0610427B1 (en) | Tgf-beta type iii receptor, cdna encoding it and uses therefor | |
US5712380A (en) | DNA encoding a soluble VEGF inhibitor | |
US5885794A (en) | Recombinant production of vertebrate activin receptor polypeptides and identification of receptor DNAs in the activin/TGF-β superfamily | |
SK8752000A3 (en) | Novel g protein-coupled receptor | |
AU710559B2 (en) | The use of a bmp protein receptor complex for screening bone metabolism actives and cells co-transfected with a type II bmp receptor and a type I bmp receptor | |
US6248554B1 (en) | DNA sequence coding for a BMP receptor | |
US6306622B1 (en) | cDNA encoding a BMP type II receptor | |
AU7478298A (en) | The use of a bone morphogenetic protein (bmp) receptor complex for screening | |
AU699824C (en) | DNA sequence coding for a BMP receptor |