AU708456B2 - Methods and compositions for detecting and treating mycobacterial infections using an ahpCF operon - Google Patents

Description

WO 96/19578 PCT/NZ95/00133 METHODS AND COMPOSITIONS FOR DETECTING AND TREATING MYCOBACTERIAL INFECTIONS USING AN ahpCF OPERON FIELD OF THE INVENTION The invention relates to materials and methods used in the diagnosis and treatment ofmycobacterial diseases, and more specifically to DNA sequence(s) associated with resistance to isoniazid and its analogs in mycobacteria, methods for isolating such sequence(s), and the use of such sequence(s) in human and animal medical practice.

BACKGROUND OF THE INVENTION Tuberculosis caused by members of the M. tuberculosis complex including M.

tuberculosis, M. bovis, and M. africanum remains the largest cause of human death in the world from a single infectious disease, and is responsible for one in four avoidable adult deaths in developing countries. In addition, in 1990, there was a 10% increase in the incidence of tuberculosis in the United States. Further, M. bovis causes tuberculosis in a wide range of animals, and is a major cause of animal suffering and economic loss in animal industries.

Infection with drug-sensitive strains of the M. tuberculosis complex can be effectively cured with a combination of antibiotics, including isoniazid (isonicotinic acid hydrazide, INH), rifampicin, and pyrazinamide. INH was first reported to be active against M. tuberculosis in 1952, and particularly active against M. tuberculosis and M.

bovis. However, mutants resistant to INH have emerged since then, and today such mutants account for as many as 26% of the clinical M. tuberculosis isolates in certain U.S.

cities.

Some INH-resistant strains are associated with a loss of catalase activity, and deletions of the catalase-peroxidase gene (katG) correlate with INH resistance in certain M. tuberculosis isolates. Furthermore, transfer of the wild-type M. tuberculosis katG gene to INH-resistant M. smegmatis; M. tuberculosis and M. bovis confers INH sensitivity, suggesting that catalase-peroxidase activity is required for INH-sensitivity.

However, in some studies only 10 to 25% of the INH-resistant isolates appear to be i i_ WO 96/19578 PCT/NZ95/00133 catalase negative, indicating that INH resistance can be due to other tactors. Recently, another gene involved in INH resistance, inhA, was identified and alterations in this gene, particularly in its promoter region, have been found to occur in some but not all INHresistant isolates that were catalase positive. Thus, there appear to be a group of INHresistant M. tuberculosis strains whose resistance cannot be explained by loss or mutation of either the katG or inhA genes.

Drug resistance can be caused by many mechanisms, including mutations in the drug target that reduce the binding of the drug or mutations that lead to increased production of the target. The mechanism by which INH inhibits mycobacteria and its precise target of action are unknown. Biochemical evidence has suggested that both INH and ethionamide (ETH, a structural analog of INH) block mycolic acid biosynthesis in mycobacteria. It has also been suggested that the cellular response to oxidative stress, particularly levels of hydrogen peroxide, is involved in INH-susceptibility. INH has been found to inhibit mycolic acid biosynthesis in cell-free extracts of mycobacteria, and the target protein has been identified as InhA, an enzyme which has significant homology to the lipid biosynthetic enzyme, enoyl ACP reductase. INH does not appear to act directly on this enzyme so an intermediate or intermediates appear to be involved. In addition, in certain cases, low-level INH resistance correlates not with the loss of catalase activity but with the coacquisition of ETH resistance, suggesting that the two drugs may share a common target. Furthermore, it has been proposed that the reactive oxygen intermediates formed during interactions between INH and peroxidases may suggest a mode of action for INH.

Because such a high percentage of the M. tuberculosis complex strains are resistant to INH, a great need exists to identify its targets of action, and thereby to devise rapid methods for identification ofINH-resistant strains and methods of treating individuals for prevention and/or treatment of the disease associated with them.

WO 96/19578 PCT/NZ95/00133 SUMMARY OF THE INVENTION This invention is based upon the discovery of an operon in mycobacteria, designated as ah CE. It contains two large open reading frames (ORFs) that may encode the two protein components of the enzyme, alkyl hydroperoxide reductase (Ahp reductase). Mutations within this operon, particularly within the promoter region preceding the first open reading frame, upregulate the expression of the operon and confer INH resistance. Thus, the present invention provides isolated and recombinant polynucleotide sequences and polypeptides encoded therein that are associated with resistance to INH and its structural analogs in members of the genus mycobacteria, particularly those of the M. tuberculosis complex, including M. tuberculosis,

M

africanum, M. bovis and M. microti; and the M. avium complex, including M. avium, M.

intracellulare, M. scrofulacum, and M. paratuberculosis. The polynucleotides of the invention have many uses. For example, they are useful in assessing the susceptibility of various strains of the M. tuberculosis complex to INH type antibiotics, as decoys and antisense oligonucleotides to prevent the expression of polypeptides associated with INH resistance, and for the expression of the polypeptides encoded therein. The polypeptides encoded in the polynucleotides and/or antibodies directed to them may also have use in immunoassays for the detection of INH-resistant strains, in the determination of whether an INH-type antibiotic may be effective against tuberculosis, and in the treatment of individuals for infection with these strains.

Accordingly, embodiments of the invention include the following: An isolated polynucleotide comprised of a nucleotide sequence of at least nucleotides of an ahnCE operon of mycobacteria.

A polynucleotide as described above, wherein the operon is selected from the group consisting of that in M. bovis, M. tuberculosis, and M. avium.

A polynucleotide as described above, wherein the operon encodes AhpC and AhpF and wherein the operon is associated with INH-resistance.

A polynucleotide as described above, wherein the nucleotide sequence includes a sequence from a promoter region of the operon.

A polynucleotide as described above, wherein the nucleotide sequence encompasses a sequence selected from the group consisting of CGGTACG,

CGGCACG,

TCGTAAC, TCGCAAC, and their respective complementary sequences.

I i I II II WO 96/19578 PCT/NZ95/00133 An isolated polynucleotide(s) encoding an AhpC and/or AhpF polypeptide or fragment or variant thereof.

A polynucleotide as described above, wherein the polynucleotide is a recombinant expression vector comprised of control sequences operably linked to a segment encoding the AhpC and/or AhpF polypeptide or fragment or variant thereof.

A host cell comprised of a polynucleotide selected from the group of polynucleotides described above.

A method of treating an individual for infection caused by a member of the mycobacterial complex comprising: providing a composition comprised of a polynucleotide capable of inhibiting mRNA activity from an ahpCE operon of the infecting species and a suitable excipient; and administering a pharmacologically effective amount of said composition to the individual.

The method described above, wherein the mode of administration of the polynucleotides is oral, enteral, subcutaneous, intraperitoneal or intravenous.

A method of assessing susceptibility of a strain of mycobacteria in a biological sample to INH comprising: providing the mycobacterial DNA from the biological sample; amplifying a region of the ahpCF operon; determining whether a mutation exists within the ahDCF operon from the biological sample, the presence of the mutation indicating that said mycobacterial strain is resistant to INH.

The method described abov.e, wherein the region which is amplified in step comprises a promoter region of the operon.

The method described above, wherein the amplification is by a polymerase chain reaction (PCR).

The method may be further comprised of providing a comparable portion of wildtype INH-sensitive ahpCF operon from the mycobacteria, and the determination of whether a mutation exists in the biological sample is by comparison with the wild-type ahpCF operon.

The method described above, wherein determining whether a mutation exists is performed by single strand conformation polymorphism analysis.

WO 96/19578 PCT/NZ95/00133 A method of assessing susceptibility of a strain of mycobactena m a biological sample to INH comprising: providing a biological sample containing a first strain ofmycobacteria; providing a control sample containing a second strain ofmycobacteria; and comparing the activity of the ahpC gene in the mycobacteria of the biological sample with the activity of the ahpC gene in the mycobacteria of the control sample.

The method as described above, wherein step is performed by comparing the level of messenger RNA transcribed from the ahpC gene in the biological sample with the level of messenger RNA transcribed by the ahpC gene in the control sample, or alternately, wherein step is performed by comparing the level ofAhpC polypeptide in the biological sample with the level ofAhpC polypeptide in the control sample.

A method of determining whether a drug is effective against mycobacterial infection comprising: providing an isolated AhpC and/or AhpF; providing a candidate drug; mixing AhpC and/or AhpF with organic peroxide substrate in the presence or absence of the candidate drug; and measuring the inhibition of alkyl hydroperoxide reductase caused by the presence of the drug, if any.

A method for producing a compound that inhibits alkyl hydroperoxide reductase activity comprising: providing purified mycobacteria AhpC and/or AhpF; determining the molecular structure of said AhpC and/or AhpF; creating a compound with a similar molecular structure to INH; and determining that said compound inhibits the biochemical activity of AhpC and/or AhpF.

Isolated mycobacteria AhpC and/or AhpF polypeptide(s) or fragments or variants thereof.

A recombinant mycobacterial vaccine comprised of attenuated mutants selected from the group consisting ofBCG, M. tuberculosis, and M. bovis, wherein the mutants are host cells containing a mutated ahpCF operon.

I

in WO 96/19578 PCT/NZ95/00133 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 (SEQ ID NO:1) presents a DNA sequence from M. bovis ATCC 35729 that confers resistance to INH on M. smegmatis mc 155.

Figure 2 (SEQ ID NO: 1 through SEQ ID NO:3) shows the amino acid sequences for two large open reading frames (ORFs) encompassed within the DNA sequence shown in Figure 1.

Figure 3 (SEQ ID NO:4 through SEQ ID NO: 1) shows the alignment of the amino acid sequences of the polypeptides from ORFI of hpCF from M. bovis ATCC 35729 with some other sequences of related amino acid homology.

Figure 4 (SEQ ID NO:12 and SEQ ID NO:13) shows a comparison of the amino acid translation of ORF2 of ahpCF from M. bovi with AhpF from .coli.

Figure 5 is a schematic diagram of pYUBf18, showing significant features of the genome and restriction nuclease cleavage sites.

Figure 6 (SEQ ID NO:14) presents a DNA sequence from the parental M. bovis ATCC 35723 that is INH sensitive.

Figure 7 is a half-tone reproduction of a Southern blot, in which INH sensitive and resistant strains were probed for the catalase gene katG.

Figure 8 is a drawing of subfragments of the ahDCF operon, showing which elements of the operon are capable of conferring INH resistance.

Figure 9 is a half-tone reproduction of a primer extension analysis performed on RNA isolated from M. smegmatis using the primer AGCGGTGAGCTGGTAGGCGGGGAATTGATC (SEQ ID NO: DETAILED DESCRIPTION OF THE INVENTION The invention stems from the discovery of hpCE, an operon comprising two ORFs that encodes polypeptides that are a target for INH in a strain of the M. tuberculosis complex. It is probable that mutations of this operon render mycobacteria INH-resistant.

Methods of screening for INH-resistance are routine, and are known within the art.

The operon was identified using a genetic strategy. A genomic library was constructed in a shuttle cosmid vector from an INH-resistant mutant of M. bovis.

Transferral of the library into a wild type INH-sensitive) M. smegmatis strain 6 RECTIFIED SHEET (RULE 91)

ISNEP

WO 96/19578 PCT/NZ95/00133 allowed the identification of clones that consistently conferred INH-resistance. The DNA fragments that conferred INH-sensitivity to M. segmatgis were subjected to DNA sequencing. The derived DNA sequence is shown in Figure 1. Sequence analysis revealed two ORFs separated by 26 base pairs indicating the two ORFs are part of the same operon.

The first ORF (ORF 1) does not have a ribosome binding site immediately upstream of the first potential start codon, TTG at positions 712-714. The next six potential start codons also lack ribosome binding sites. The first potential start codon with a likely upstream ribosome binding site is ATG at positions 880-882. This has a ribosome binding site GAGGAG at positions 870-875. In Figure 2, ORF1 is therefore shown as beginning at positions 880-882. ORF1 (positions 880-1467) encodes a protein of 25 kDa which has significant homology to the polypeptide encoded in the coding region of ORFI of the ahpEC operon from other bacteria (Figure 3 and Table Because of this high homology, ORF1 is denoted as ahpC.

.I

MMMW

WO 96/19578 PCT/NZ95/00133 Table 1. Degree of similarity between the putative ahpC genes of M bovis and other bacterial species.

Speces .1 .(Submission -No.) identical:: s i mia r: M.avium M leprae I86 93 C pasteurianum (m601 16) 64 E. coli J32 58 (d13 187)

I

WO 96/19578 PCT/NZ95/00133 The second large ORF (ORF2) begins 26 bp downstream from ahWp at positions 1493-1495. It has a potential ribosome binding site GGGA at positions 1485-1488.

ORF2 (positions 1493-2152) encodes a protein of 22 kDa which is 19% identical to ahpE of Efcli. Comparisons at the DNA level revealed a small amount of terminal sequence that was homologous between ORF2 of the M. bovis ahpCE operon, and an ORF downstream of the putative ahpC gene ofM avium. There are also DNA sequences downstream of the putative ahpC gene in M. leprae that have high homology to ORF2, but these are not associated with a large ORF. ORF2 of M. bovis has been denoted ahE.

A polynucleotide from an INH resistant strain of M. bovis that encodes the ahpCF operon has been identified, isolated, cloned, sequenced and characterized. The nucleic acid sequence of the coding strand for this polynucleotide is shown in Figure 1. Figure 2 shows the putative amino acid sequences of the polypeptides encoded in the polynucleotide. The corresponding polynucleotide of the INH sensitive parent has also been obtained and sequenced, revealing that INH resistance is conveyed by a point mutation in the transcriptional start site of the ahpCF promoter region. Examples 9 and (infra) suggest that the mutation leads to increased production of the ahpC gene product, which in turn is responsible for conveying INH resistance.

Disclosed herein are two point mutations in the ahpCF promoter currently known to be associated with INH resistance. This invention also contemplates alternative alterations to the ahpCF operon which would affect the expression and/or function of the gene products thereof, thereby imparting various degrees of sensitivity or resistance to INH. Any of the uses of the invention disclosed herein should be considered generic, and can be adapted, if necessary, for application to any of the contemplated ahpCF alterations.

For example, any mutation in the promoter region which improves the binding of an intracellular component involved in transcription or a positive controlling elements of transcription would increase the transcription rate. Any mutation in the promoter region which impairs the binding of a negative controlling element like a repressor protein would have the same effect. These mutations would lead to increased expression of AhpC, and resistance to INH. The ahpCF operon could be duplicated in the strain, also resulting in increased expression of AhpC, and resistance to INH. Furthermore, mutations in the coding region ofahpC could be associated with INH resistance; in particular, those that altered the active site of AhpC so as to increase its catalytic activity. It is desirable to be able to test and treat any alteration which imparts INH resistance.

I- II

I

I~ g WO 96/19578 PCT/NZ95/00133 This invention also contemplates a converse set of alterations to the ahpU. operon which would result in decreased expression and/or function of the gene products, which may increase sensitivity to INH, compared with the wild type. These include mutations that impair the binding of positive transcription regulation elements to the promoter, and mutations that decrease the catalytic activity of the ahpC gene product. Strains with an increased sensitivity to INH are useful in therapeutic applications, such as providing the attenuated vaccines described below.

The ahpCF operon associated with INH resistance in strains of the M. tuberculosi complex, as disclosed herein, provides the practitioner of ordinary skill with compositions and methods useful in the diagnosis and treatment of pathogenic states resulting from infection with mycobacteria, particularly INH-resistant strains.

This application is based in part on U.S. application Serial No. 08/467,524, filed on June 6, 1995 which was based in part on priority application 270222, filed in New Zealand on December 20, 1994, which is hereby incorporated by reference herein in its entirety.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See Sambrook, Fritsch, and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition (1989), OLIGONUCLEOTIDE SYNTHESIS Gait Ed., 1984), the series METHODS IN ENZYMOLOGY (Academic Press, Inc.); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS Miller and M.P. Calos eds. 1987), HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, Weir and C.C. Blackwell, Eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G.

Siedman, J.A. Smith, and K. Struhl, eds., 1987), and CURRENT PROTOCOLS IN IMMUNOLOGY Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach and W.

Strober, eds., 1991). All patents, patent applications, articles and publications cited herein, both supra and infra, are hereby incorporated herein by reference.

As used herein the term "target of action for INH" refers to one or both of the polypeptides AhpC and AhpF, encoded in an ahpCF operon of mycobacteria, and preferably in members of the M. tuberculosis complex.

IL

WO 96/19578 PCT/NZ95/00133 As used herein, the term "ahpCE operon" refers to a polynucieotide that encodes polypeptides that are present in mycobacteria, wherein the polypeptides have substantial amino acid homology and equivalent function to the AhpC and AhpF proteins of M.

bovis. In this context, substantial amino acid homology means at least about homology, generally at least about 70% homology, even more generally at least about homology, and at times at least about 90% homology to any of the indicated polypeptides. As those of ordinary skill in the art are aware, the operon includes regions that are responsible for the control of transcription or expression of the encoded polypeptide, including promoter regions, enhancer regions, ribosomal binding regions, and sites capable of binding any other component involved in the regulation of transcription.

As used herein, the terms "AhpC polypeptide" and "AhpF polypeptide" refer to polypeptides encoded in individual open reading frames within the ahpCF operon in mycobacteria, in either INH-resistant or INH-sensitive variants. The term "AhpCF polypeptide" refers to any polypeptide encoded within the ahpCF operon.

As used herein the term "polynucleotide" refers to a polymeric form ofnucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA and RNA. It also includes known types of modifications, for example, labels which are known in the art Sambrook, et methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages methyl phosphonates, phosphotriesters, phosphoamidates, carbamates), those containing pendant moieties, such as, for example, proteins (including for nucleases, toxins, antibodies, signal peptides, poly-L-lysine), those with intercalators acridine, psoralen), those containing chelators metals, radioactive metals, boron, oxidative metals), those containing alkylators, those with modified linkages alpha anomeric nucleic acids), as well as unmodified forms of the polynucleotide.

The invention includes as an embodiment isolated polynucleotides comprised of sequences encoding polypeptides associated with isoniazid (INH) resistance in mycobacteria or active fragment thereof. These isolated polynucleotides contain less than about 50%, preferably less than about 70%, and more preferably less than about 90% of the chromosomal genetic material with which the sequence encoding the polypeptide is WO 96/19578 PCT/NZ95/00133 usually associated in nature. An isolated polynucleotide "consisting essentially ot" a sequence encoding an INH resistance associated polypeptide lacks other sequences encoding other polypeptides derived from the mycobacterial chromosome.

As used herein "isoniazid" refers to INH and analogs thereof that inhibit mycobacterial replication by inhibiting the activity of the same polypeptides INH inhibits.

The invention also includes as embodiments recombinant polynucleotides containing a region encoding ahpCF operon gene products for mycobacteria. The term "recombinant polynucleotide" as used herein intends a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation: is not associated with all or a portion of a polynucleotide with which it is associated in nature; or is linked to a polynucleotide other than that to which it is linked in nature; or (3) does not occur in nature.

A purified or recombinant polynucleotide comprised of a sequence encoding AhpC or AhpF of mycobacteria or variant or active fragment thereof, may be prepared by any technique known to those of skill in the art using the polynucleotide sequences provided herein. For example, they can be prepared by isolating the polynucleotides from a natural source, or by chemical synthesis, or by synthesis using recombinant DNA techniques.

It is contemplated that the sequence encoding an AhpC or AhpF encodes polypeptides that are associated with INH resistance or sensitivity in mycobacteria, and that allelic variations of the sequences are contemplated herein. The term "polypeptide" refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term also does not refer to or exclude post-expression modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like.

Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids), polypeptides with substituted linkages, as well as the modifications known in the art, both naturally occurring and non-naturally occurring.

Also contemplated within the invention are cloning vectors and expression vectors comprised of a sequence encoding AhpC and/or AhpF or variant or fragment thereof.

Suitable cloning vectors may be constructed according to standard techniques, or may be selected from the large number of cloning vectors available in the art. While the cloning -i IMM M _d WO 96/19578 PCT/NZ95/00133 vector selected may vary according to the host cell intended to be used, useful clomng vectors will generally have the ability to self replicate, may possess a single target for a restriction endonuclease, and may carry genes for a readily selectable marker antibiotic resistance or sensitivity markers). Suitable examples include plasmids and bacterial viruses, pUC18, mpl8, mpl9, pBR322, pMB9, ColEl, pCRl, RP4, phage DNAs, and shuttle vectors pSA3 and pAT28. Preferred vectors include pBLUSCRIPT IIks (TM) (Stratagene), and pYUB 18.

Expression vectors generally are replicable polynucleotide constructs that encode a polypeptide operably linked to suitable transcriptional and translational regulatory elements. Examples of regulatory elements usually included in expression vectors are promoters, enhancers, ribosomal binding sites, and transcription and translation initiation and termination sequences. The regulatory elements employed in the expression vectors containing a polynucleotide encoding AhpC, AhpF or an active fragment thereof would be functional in the host cell used for expression. It is also contemplated that the regulatory sequences may be derived from the ahpCF operon; thus, a promoter or terminator sequence may be homologous from mycobacteria) to the coding sequence.

The invention also includes recombinant host cells comprised of any of the above described polynucleotides that contain a sequence encoding an AhpC and/or AhpF polypeptide of mycobacteria. The polynucleotides may be inserted into the host cell by any means known in the art. As used herein, "recombinant host cells", "host cells", "cells", "cell lines", "cell cultures", and other such terms denoting microorganisms or higher eukaryotic cell lines cultured as unicellular entities refer to cells which can be, or have been, used as recipients for recombinant vector or other transfer DNA, and include the progeny of the original cell which has been transformed. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation. Hosts which may be used include prokaryotic cells bacterial cells such as E.coli, mycobacteria, and the like) and eukaryotic cells fungal cells, insect cells, animal cells, and plant cells, and the like). Prokaryotic cells are generally preferred, and E. coli and M. smegmatis are particularly suitable. Of the latter, mc 2 155 is particularly preferred.

WO 96/19578 PCT/NZ95/00133 "Transformation", as used herein, refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion, for example, direct uptake, transduction, f-mating or electroporation. The exogenous polynucleotide may be maintained as a non-integrated vector, for example, a plasmid, or alternatively, may be integrated into the host cell genome.

The polynucleotides comprised of sequences encoding AhpC and/or AhpF may-be of use in the detection of mycobacteria in biological samples, and mutant forms of these polypeptides associated with INH resistance may be of use in the detection of INHresistant forms. As used herein, a "biological sample" refers to a sample of tissue or fluid isolated from an individual, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs, and also samples of in yvit cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, putatively infected cells, recombinant cells, and cell components). Particularly useful samples in the diagnosis of human pulmonary tuberculosis are sputum and lung aspirates, and cultures thereof. As used herein, the term "clinical sample" is synonymous with "biological sample".

The term "individual" as used herein refers to vertebrates, particularly members of the mammalian or avian species, and includes but is not limited to domestic animals, sports animals, and primates, including humans.

Using the disclosed portions of the isolated polynucleotides encoding AhpC and/or AhpF as a basis, oligomers of approximately 8 nucleotides or more can be prepared, either by excision from recombinant polynucleotides or synthetically, which hybridize with the mycobacterial sequences in the plasmids and are useful in identification of the INH-resistant and INH-sensitive mycobacteria. The probes are a length which allows the detection of the AhpC and/or AhpF encoding sequences by hybridization. While 6-8 nucleotides may be a workable length, sequences of about 10-12 nucleotides are preferred, about 15 nucleotides are more preferred, and about nucleotides appears optimal. These probes can be prepared using routine methods, including automated oligonucleotide synthetic methods. For use as probes, complete complementarity is desirable, though it may be unnecessary as the length of the fragment is increased.

i- i- I WO 96/19578 PCT/NZ95/00133 Thus, a polynucleotide comprising all or part of the nucleic acid sequences of an ahpCE operon, and particularly polynucleotides with sequences from the promoter region, may be used as probes for INH-resistance. The probes may be labelled, for example with radioactive isotopes. Usual isotopes include, for example 32P and 33p. The probes are capable of hybridizing to the genetic elements associated with INH-resistance. By way of example, the probe may be the entire nucleotide sequence depicted in Figure 1. However, shorter probes are preferred.

A preferred embodiment of this invention is a probe useful for detecting either of the point mutations in the promoter region of the ahpCF operon that convey INH resistance. Particularly preferred are probes capable of hybridizing to the promoter region of either the INH resistant or INH sensitive strains, but not both. "Promoter region" in this context means any region or subregion of the ahpCF operon upstream from the coding region of the ahpC gene, and is at or near a site involved in promoting gene transcription.

Particularly preferred are probes which encompass the actual codon which is mutated in INH resistant strains. Examples of particularly preferred probes are those encompassing the 5-mer sequences GGTAC, GGCAC, CGTAA, and CGCAA, optionally extended in the and/or the 3' direction according to the sequence in Figure 1 to include other residues; probes encompassing the 7-mer sequences CGGTACG, CGGCACG, TCGTAAC,

TCGCAAC,

optionally extended in the same fashion; probes encompassing the 10-mer sequences TCACGGYACG (SEQ ID NO:16), CACGGYACGA (SEQ ID NO:17), ACGGYACGAT (SEQ ID NO: 18), CGGYACGATG (SEQ ID NO: 19), ATGTCGYAAC (SEQ ID TGTCGYAACC (SEQ ID NO:21), GTCGYAACCA (SEQ ID NO:22), TCGYAACCAA (SEQ ID NO:23), optionally extended in the same fashion, where Y is T or C. It is understood that either strand of a double-strapded DNA may be targeted in a hybridization reaction; hence, the complementary sequence of any of the sequences indicated above is equally preferred to the original.

For use of such probes as diagnostics, the biological sample to be analyzed, such as blood or serum, may be treated, if desired, to extract the nucleic acids contained therein. The resulting nucleic acid from the sample may be subjected to gel electrophoresis or other size separation techniques; alternatively, the nucleic acid sample may be dot blotted without size separation. The probes are usually labeled. Suitable labels, and methods for labeling probes are known in the art, and include, for example, radioactive labels incorporated by nick translation or kinasing, biotin, fluorescent probes, RECTIFIED SHEET (RULE 91)

ISA/EP

WO 96/19578 PCT/NZ95/00133 and chemiluminescent probes. The nucleic acids extracted from the sample are then treated with the labeled probe under hybridization conditions of suitable stringencies.

The probes can be made completely complementary to the allelic form ofpolynucleotide that has been targeted. With this goal, high stringency conditions usually are desirable in order to prevent false positives. The stringency of hybridization is determined by a number of factors during hybridization and during the washing procedure, including temperature, ionic strength, length of time, and concentration of formamide. These factors are outlined in, for example, Maniatis, T. (1982).

It may be desirable to use amplification techniques in hybridization assays. Such techniques are known in the art and include, for example, the polymerase chain reaction (PCR) technique described which is by Saiki et al. (1986), by Mullis, U.S. Patent No.

4,683,195, and by Mullis et al. U.S. Patent No. 4,683,202. This technique may be used in conjunction with other techniques, for example, in single-strand conformation polymorphism analysis (see infra., in the Examples).

Suitable reagents to perform a diagnostic procedure can be provided in the form of a diagnostic kit. The reagent supplied will depend on the nature of the assay, and may be a polynucleotide probe, a polypeptide, an antibody, or an enzyme substrate. The reagent may be labeled; alternatively, the reagent may be unlabeled and the ingredients for labeling may be included in the kit in separate containers. The kit may also contain other suitably packaged reagents and materials needed for the particular hybridization protocol, for example, standards, as well as instructions for conducting the test. If the kit is to be used for an assay system which includes PCR technology it may also include primers for the PCR reaction.

The ahCF operon sequences and polypeptides encoded therein may also be used for screening for drugs against mycobacteria, particularly members of the mycobacterial complex, and more particularly M. tuberculosis and M. bovis. For example, it can be used to express the INH-resistant and INH-sensitive polypeptides, or fragments thereof, encoded in allelic forms ofahpCF. Utilizing these polypeptides in in vitro assays, one could monitor the effect of candidate drugs on alkyl hydro peroxidase activity. Drugs that inhibit this enzyme are candidates for therapy of mycobacterial diseases. Drugs that may be tested for effectiveness in this type of system include INH, ETH, rifampicin, streptomycin, ethambutol, ciprofloxacin, novobiocin and cyanide.

I II I

II

WO 96/19578 PCT/NZ95/00133 The hDCF operon sequences may also be used to design polynucleotides that can be used for treatment ofmycobacterial infections, including those caused by M.

tuberculosis, M. avium, and M. bovis. One method of treating a mycobacterial infection utilizing the ah CE operon is by providing antisense polynucleotides or triplex forming polynucleotides which can be used to inhibit the transcription or translation of mRNA from the ahpCE operon, for example antisense polynucleotides, triplex forming polynucleotides, decoys, and ribozymes. Thus, these types of polynucleotides are also included within the invention. These polynucleotides may be prepared by a variety of techniques known in the art, including chemical synthesis and recombinant technology.

After preparation they can then be administered, either alone or in combination with other compositions to treat mycobacterial infections, including tuberculosis. The compositions containing these polynucleotides may also include suitable excipients.

The sequence ofahpCE can also be used to assess the susceptibility of various strains of mycobacteria, and particularly of M. tuberculosis or M. bovis, in a clinical sample to INH. This susceptibility comparison is based upon the detection of a mutant allele as compared to the wild-type ahpCF allele that is INH-sensitive. Procedures to perform this type of assessment will be readily evident to those of skill in the art. For example, one procedure to perform this assessment is described in the Examples, and is based upon isolation of the chromosomal DNA of the bacterium, and amplification of the ahpCE region by PCR using primers specific for the region, based upon the ahpCF sequences provided herein. A mutation associated with INH resistance can then be detected by single-strand conformation polymorphism analysis, or by direct sequencing of the amplified region. In another example, a probe encompassing the sequence associated with INH resistance can be used in a direct hybridization assay, such as a blotting assay.

INH resistance would be indicated by a positive result with a probe specific for a sequence associated with resistance, or by a negative result with a probe specific for a sequence associated with INH sensitivity.

The mutations disclosed herein that convey INH resistance affect the activity of the ahpC gene. Thus, the activity of the ahpC gene can be used to determine the INH susceptibility of a mycobacteria strain in a biological sample. "Activity" in this context means the level of transcription of the gene into messenger RNA, which may be followed by translation of the RNA into a peptide, which in turn may be followed by other events such as a display of enzymatic activity by the transcribed protein.

i WO 96/19578 PCT/NZ95/00133 The following are examples of suitable assays for measuring the activity ot a~hp: 1. hybridization blot assays and single strand protection assays using a polynucleotide specific for ahpC messenger RNA; 2. immunoassays using an antibody specific for the AhpC protein; and 3. enzyme assays using a substrate capable of being catalyzed into a detectable product by the AhpC protein. It is often preferable beforehand to increase the amount of substance being tested, such as by allowing the mycobacteria to grow in culture. To determine whether a particular activity level corresponds to that of an INH resistant or an INH susceptible strain, the assay is usually conducted both on the sample to be tested, and on a control sample.

The control sample should contain a strain of mycobacteria with a known susceptibility to INH. It can be either INH susceptible, or INH resistant. If the strain in the control sample is INH sensitive, then similar activity of ahpC in the test sample indicates INH sensitivity; a higher activity indicates INH resistance. If the strain in the control sample is INH resistant, then similar activity of ah2C in the test sample indicates INH resistance, while lower activity indicates a degree of INH sensitivity. Depending on the nature of the assay, it may or may not be necessary that the testing of the biological sample and the control sample be contemporaneous.

The ahpCE promoter region, particularly in the mutated or INH resistant form, may be used to promote the transcription and expression ofheterologous genes. An example ofheterologous expression of the lacZ gene is described infra. Generally, the ahpCE promoter is isolated, or prepared by polynucleotide synthesis from the sequence data. A fusion polynucleotide is formed, in which the promoter is operably linked to a gene that is not ahL. The construct is then transfected into the desired species of mycobacteria using a suitable vector plasmid.

In addition, compounds which block the activity of AhpC or AhpF polypeptides (which may be enzymes) can be prepared utilizing the sequence information ofahpCE.

This is performed by overexpressing AhpC and/or AhpF, purifying the polypeptide(s), and then performing X-ray crystallography on the purified polypeptide(s) to obtain its(their) molecular structure. Next, compounds are created which have similar molecular structures to all or portions of the polypeptide(s). The compounds are then combined with the polypeptide(s) and attached thereto so as to block the biochemical activity of the polypeptide(s).

I- WO 96/19578 PCT/NZ95/00133 The ahpCE polynucleotide may also be used to produce a vaccine to confer immunity against the product of the gene. This could be provided, for example, as an attenuated mycobacteria strain in which the ahpCF operon was active, or it could be provided as a recombinant vector, comprising the mycobacteria ahpCF operon expressibly transfected into another species. Immunity conferred by the administration of this vaccine would help protect against environmental challenge by a virulent mycobacteria. The protection is likely to be particularly effective against strains that had acquired a resistance against INH by up-regulating the expression of the ahpC gene product.

The ahpC polynucleotide may also be used to prepare attenuated strains of mycobacteria or BCG, and recombinants thereof. In this embodiment, a mutated ahpCE operon is selected or engineered which has a lower level of expression than wild type mycobacteria, which may render it even more susceptible to INH than the wild type.

Ideally, the level of expression would be chosen to maximize INH sensitivity, while leaving the strain with the minimum amount of hpCE activity that is consistent with viability and the desired growth rate. Preferably, this would be combined with other attenuation strategies, such as alteration of the mycobacteria virulence gene. The resulting strain could be used in a vaccine to stimulate immunity against mycobacteria.

Genes expressing proteins from other pathogens could be transfected into the attenuated strain, thereby providing protection against other diseases. The list of pathogens which would be suitable for this strategy is extensive, and includes leprosy, polio, malaria, AIDS, hepatitis B, hepatitis C, and tetanus.

The polypeptides of the invention include those encoded in allelic variants of ah.CE, and are in purified or recombinant form. These polypeptides include fragments of the entire polypeptides encoded in the ORFs. In addition, polypeptides of the invention include variants of AhpC and/or AhpF which differ from the native amino acid sequences by the insertion, substitution, or deletion of one or more amino acids. These variants may be prepared chemically, or by alteration of the polynucleotide sequences encoding AhpC or AhpF, using techniques known in the art, for example, by site-specific primer directed mutagenesis. These polypeptides can be purified by any means known in the art, including, for example freeze-thaw extraction, salt fractionation, column chromatography, affinity chromatography and the like.

I WO 96/19578 PCT/NZ95/00133 The polypeptides of the invention may find use as therapeutic agents tor treatment ofmycobacterial infection. "Treatment" as used herein refers to prophylaxis and/or therapy.

The AhpC and/or AhpF polypeptides can be prepared as discrete entities or incorporated into a larger polypeptide, and may find use as described herein. The immunogenicity of the epitopes of AhpC and/or AhpF may also be enhanced by preparing them in mammalian or yeast systems fused with or assembled with particle-forming proteins such as, for example, that associated with hepatitis B surface antigen. See, e.g., U.S. Pat. No. 4,722,840. Vaccines may be prepared from one or more immunogenic polypeptides derived from AhpC and/or AhpF.

The polypeptides of this invention can also be used in a polypeptide vaccine. In this embodiment, AhpC and/or AhpF are provided in a suitable form for administration to human or other mammalian subjects. Vaccines can be prepared for injection, or for oral or intranasal administration. Optionally, the polypeptide(s) may be prepared to render them more immunogenic by a technique or combination of techniques known in the art, such as aggregation with a cross-linking agent like glutaraldehyde, fragmentation, linking to a carrier like keyhole limpet hemocyanin (KLH), and cyclization.

Typically, such vaccines are prepared as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. The preparation may also be emulsified, or the protein encapsulated in liposomes. The active immunogenic ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the vaccine may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the vaccine. Examples of adjuvants which may be effective include but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-( 2 '-dipalmitoyl-sn-glycero-3-h ydroxyphosphoryloxy)-ethylamine (CGP 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween i WO 96/19578 PCT/NZ95/00133 emulsion. The effectiveness of an adjuvant may be determined by measuring the amount of antibodies directed against an immunogenic polypeptide containing an AhpC or AhpF antigenic sequence resulting from administration of this polypeptide in vaccines which are also comprised of the various adjuvants.

The vaccines are conventionally administered parenterally, by injection, for example, either subcutaneously or intramuscularly. Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations or formulations suitable for distribution as aerosols. For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10%-95% of active ingredient, preferably 25%-70%.

The proteins may be formulated into the vaccine as neutral or salt forms.

Pharmaceutically acceptable salts include the acid addition salts (formed with free amino groups of the peptide) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.

The vaccines are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective. The quantity to be administered, which is generally in the range of 5 micrograms to 250 micrograms of antigen per dose, depends on the subject to be treated, capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired.

Precise amounts of active ingredient required to be administered may depend on the judgment of the practitioner and may be peculiar to each subject.

The vaccine may be given in a single dose schedule, or preferably in a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination I I I I I WO 96/19578 PCT/NZ95/00133 may be with 1-10 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reenforce the immune response, for example, at 1-4 months for a second dose, and if needed, a subsequent dose(s) after several months. The dosage regimen will also, at least in part, be determined by the need of the individual and be dependent upon the judgment of the practitioner.

In addition, the vaccine containing the immunogenic AhpC and/or AhpF antigen(s) may be administered in conjunction with other immunoregulatory agents, for example, immune globulins, as well as antibiotics.

The AhpCF antigens may be used for the preparation of antibodies. The immunogenic polypeptides prepared as described above are used to produce antibodies, including polyclonal and monoclonal. Ifpolyclonal antibodies are desired, a selected mammal mouse, rabbit, goat, horse) is immunized with an immunogenic polypeptide bearing AhpC or AhpF epitope(s). Serum from the immunized animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to an AhpCF epitope contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are known in the art, see for example, Mayer and Walker (1987).

Monoclonal antibodies directed against AhpCF epitopes can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, M.

Schreier et al. (1980); Hammerling.et al. (1981); Kennett et al. (1980); see also, U.S.

Patent Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,466,917; 4,472,500; 4,491,632; and 4,493,890. Panels of monoclonal antibodies produced against AhpC or AhpF epitopes can be screened for various properties; for isotype, epitope affinity, etc.

Antibodies, both monoclonal and polyclonal, which are directed against AhpCF epitopes are particularly useful in diagnosis, and those which are neutralizing may be useful in passive immunotherapy. Monoclonal antibodies, in particular, may be used to raise anti-idiotype antibodies. Anti-idiotype antibodies are immunoglobulins which carry an "internal image" of the antigen of the infectious agent against which protection is WO 96/19578 PCT/NZ95/00133 desired. See, for example, Nisonoff, et al. (1981) and Dreesman et al. (1985).

Techniques for raising anti-idiotype antibodies are known in the art. See, for example, Grzych (1985), MacNamara et al. (1984), and Uytdehaag et al. (1985). These anti-idiotype antibodies may also be useful for treatment, vaccination and/or diagnosis of mycobacterial infections, as well as for an elucidation of the immunogenic regions of AhpCF antigens.

AhpCF polypeptides are useful in immunoassays to detect the presence of antibodies to mycobacteria. Anti-AhpCF antibodies are useful in immunoassays to detect the presence of AhpCF antigens. In particular, relatively high levels of AhpC would indicate that a strain of mycobacteria in a biological sample has a highly active ahpCF operon, and is probably INH resistant.

Designs for immunoassays can be chosen from amongst a number of alternatives, since many formats are known in the art. Protocols may be based, for example, upon competition, direct reaction, or sandwich type assays. Protocols may also, for example, use solid supports, or involve immunoprecipitation. An immunoassay will involve the interaction between at least one epitope derived from either AhpC or AhpF, and an antibody specific for the epitope. A first component of this interaction (the epitope or the antibody) will be supplied as a reagent, the other component (the antibody or the epitope, respectively) will be supplied either as a control sample, or as a biological sample in which the level of the component is to be determined. The formation of the complex between antibody and epitope is detected by many techniques known in the art, including precipitation and nephelometry. Often, the complex is detected by supplying the reagent with a label, either before or after the complexing reaction. The labels may be, for example, enzymatic, fluorescent, chemiluminescent, radioactive, or dye molecules. Assays which amplify the signals from the probe are also known; examples of which are assays which utilize biotin and avidin, and enzyme-labeled and mediated immunoassays, such as ELISA assays. The label may be attached directly to the reagent, or supplied through a reaction with a second reagent, such as anti-immunoglobulin or protein A.

Typically, an immunoassay for an anti-AhpCF antibody(s) will involve selecting and preparing the test sample suspected of containing the antibodies, such as a biological sample, then incubating it with an antigenic epitope-containing) AhpCF polypeptide(s) under conditions that allow antigen-antibody complexes to form, and then detecting the formation of such complexes. The polypeptide component may comprise a

I

WO 96/19578 PCT/NZ95/00133 single epitope or a combination of epitopes derived from AhpC and/or AhpF. The epitopes may be natural isolates, or provided in separate recombinant polypeptides, or together in the same recombinant polypeptides. Suitable incubation conditions are well known in the art. The immunoassay may be, without limitations, in a heterogenous or in a homogeneous format, and of a standard or competitive type.

In a heterogeneous format, the polypeptide is typically bound to a solid support to facilitate separation of the sample from the polypeptide after incubation. Examples of solid supports that can be used are nitrocellulose in membrane or microtiter well form), polyvinyl chloride in sheets or microtiter wells), polystyrene latex in beads or microtiter plates, polyvinylidine fluoride (known as Immulon), diazotized paper, nylon membranes, activated beads, and Protein A beads. For example, Dynatech IMMULON 1 or IMMULON 2 (TM) microtiter plates, or 0.25 inch polystyrene beads (Precision Plastic Ball) can be used in the heterogeneous format. The solid support containing the antigenic polypeptide is typically washed after separating it from the test sample, and prior to detection of bound antibodies. Both standard and competitive formats are known in the art.

Complexes formed comprising anti-AhpCF antibody (or, in the case of competitive assays, the amount of competing antibody) are detected by any of a number of known techniques, depending on the format. For example, unlabeled anti-AhpCF antibodies in the complex may be detected using a conjugate of antixenogeneic Ig complexed with a label, an enzyme label).

In immunoassays where AhpCF polypeptides are the analyte, the test sample, typically a biological sample, is incubated with anti-AhpCF antibodies under conditions that allow the formation of antigen-antibody complexes. The antibody component may be, for example, a monoclonal antibody directed towards an AhpCF epitope(s), a combination of monoclonal antibodies directed towards epitopes of one mycobacterial antigen, monoclonal antibodies directed towards epitopes of different mycobacterial antigens, polyclonal antibodies directed towards the same antigen, or polyclonal antibodies directed towards different antigens. It may be desirable to treat the biological sample to release putative bacterial components prior to testing.

Various formats can be employed. For example, a "sandwich assay" may be employed, where antibody bound to a solid support is incubated with the test sample; washed; incubated with a second, labeled antibody to the analyte, and the support is WO 96/19578 WO 96/19578 PCT/NZ95/00133 washed again. Analyte is detected by determining if the second antinoay is bound to the support. In a competitive format, which can be either heterogeneous or homogeneous, a test sample is usually incubated with antibody and a labeled, competing antigen is also incubated, either sequentially or simultaneously. These and other formats are well known in the art.

The following examples are provided only for illustrative purposes, and not to limit the scope of the present invention. In light of the present disclosure numerous embodiments within the scope of the claims will be apparent to those of ordinary skill in the art.

EXAMPLES

Example 1 Selection of NH-Resistant M. bovis Strains In order to investigate INH-resistance in the M. tuberculosis complex, M. bovis ATCC 35729 and M. bovis ATCC 35728 were selected for study. Both strains were shown to be catalase negative and not to have the inhA mutation that characterized another INH resistant M. bovis strain (Banerjee et al. Science 263:227, 1994).

Example 2 Isolation of INH-resistant Clones from a Cosmid Library prepared from an INH-Resistant Strain A cosmid library from M. bovis ATCC 35729 was prepared in the shuttle vector pYUB 18. Plasmid pYUB 18 is a multicopy Escoli-mycobacteria shuttle cosmid that contains a selectable kanamycin gene and a cos site Beslile et al., J. Bacteriol.

173:6991 (1991); S.B. Snapper et al., Mol. Microbiol. 4:1911 (1990); W.R. Jacobs et al., Methods Enzymol. 204:537 (1991)). A restriction enzyme map ofpYUB18 showing some significant features of the genome is shown in Figure The cosmid library was prepared as follows using standard techniques.

Chromosomal DNA was purified from ATCC 35729, and subjected to partial digestion with Sau3Al; fragments between about 30-50 kb were purified by sucrose gradient WO 96/19578 PCT/NZ95/00133 purification and ligated to linearized pYUB 18. Resulting cosmids were packaged into Sphage using a commercial kit (GIGAPACK GOLD Stratagene) according to the manufacturer's directions, and transfected into E. coli; approximately 10,000 colonies were obtained. The colonies were pooled and the plasmids amplified, using standard plasmid preparation techniques.

The cosmid library was then transformed into M. smegmatis strain mc 2 155 by electroporation. Transformants were selected by growth on medium containing kanamycin. Approximately 2000 kanamycin resistant clones were patched onto media containing 25 Tg/mL INH. Twelve INH resistant clones were identified.

The first ORF is preceded by putative -10 and -35 promoter regions, indicated in Figure 2 by single underlining. The potential ribosome binding site is indicated in Figure 2 by double underlining. This DNA sequence of the ahpCF operon of ATCC 35729 (the INH resistant strain) has been submitted to GenBank, and is assigned the accession number U24084.

Example 3 Isolation and Sequencing of an ahpCF operon associated with INH resistance In order to obtain a cosmid containing mycobacterial genetic material that conferred INH-resistance, the cosmids were extracted from the transformants. Cultures of M. smegmatis (5 ml) were incubated with cycloserine and ampicillin for 3 hours before harvest. The cells were pelleted and resuspended in 0.25 ml of 40 mM Tris acetate, 2 mM EDTA, Ph 7.9. To this, 0.5 ml oflysing solution was added (50 mM Tris, 3% sodium dodecylsulfate (SDS)) and the solution was mixed for 30 minutes. The sample was heated to 600C for 20 minutes, cooled for 10 minutes and the DNA was extracted by adding 0.8 ml phenol (containing 50 mM NaCI). This was centrifuged and the upper layer containing the DNA was removed. To precipitate the DNA, a half volume of 7.5 M ammonium acetate was added, incubated on ice for 30 minutes and then centrifuged for minutes. The DNA was resuspended in 10 mM Tris, 1 mM EDTA.

Southern blot hybridization with a probe of the inhA gene of restriction digests of the cosmids revealed that only one of the cosmids contained the inhA gene. A library of 2-4 kb partial Sau3AI fragments of one (pUHA210) of the remaining 11 cosmids that did not contain inhA was subcloned into pYUB18. A plasmid, pUHA211, conferring INH I r I L I WO 96/19578 PCT/NZ95/00133 resistance on M. megmatis was selected and isolated in the same way as its parent cosrid pUHA210.

The sequence of the insert in pUHA211 was obtained as follows. The insert in pUHA211 was cloned into the vector pBLUESCRIPT II KS+ (TM) (Stratagene, California) to form pUHA212. This vector contains the T3 and T7 promoters which were used for the sequencing. Sequencing of pUHA212 was carried out using the dsDNA cycle sequencing system from GIBCO BRL, Life Technologies, according to the manufacturer's directions. The radioactive labelled nucleotide was [K- 33 P] ATP, available from Amersham. The sequencing program used was, GCG Sequence Analysis Software Package. The nucleic acid sequence for the insert in pUHA212 and the amino acid sequence from two large open reading frames encompassed within it are shown in Figure 2.

The AhpC polypeptide predicted from the M. bovis ahiC gene sequence shows homology with a number of thiol-specific antioxidant enzymes from bacteria, yeast, and human. AhpC and AhpF in E. li and S. typhimurium have been proposed to be involved in the cellular response to oxidative stress. In M. smegmatis, the effect of hydrogen peroxide on INH-susceptibility suggests these genes may be involved in INH resistance. Figure 3 provides a comparison of the AhpC from M. bovis ATCC 35729 with related sequences obtained from GenBank, and aligned using the computer algorithm PILEUP. The thiol-specific antioxidant enzymes are sometimes referred to as "protector" proteins. They act to eliminate peroxides when supplied with electron donor co-substrates such as dithiothreitol, thioredoxin, and NADPH. M. bovis AhpC has 33% amino acid sequence identity to the AhpC component of alkyl hydroperoxide reductase, an E li enzyme which is a heterodimer of AhpC and AhpF chains. M. bovis AhpC also has 65% identity to the gene product ofdirp22 (dirA), iron-repressible genes from Corynebacterium diptherin (GenBank accession number U18620). Other related proteins are AhpC from S. tvphimurim., AhpC from C. asteurianum, TSA from S.

cerevisiae, and PAG from H. sapiens.

The thiol-specific antioxidant of S. cerevisiae exists as a homodimer of 25 kDa subunits, each containing two cysteine residues: Cys-47 and Cys-170. The first constitutes the site of oxidation. M. bovis AhpC has two cysteine residues in equivalent positions. INH and peroxidases form intermediates like carbonyl, peroxy and isonicotinyl radicals (Shoeb et al., Antimicrob. Ag. Chemother 27:404, 1985) and this oxidation ii.- i WO 96/19578 PCT/NZ95/00133 process has been proposed as a mechanism for the mode of action of INH (Johnsson and Schulz, 1994). Thus, AhpC may act as a protector protein to confer INH resistance.

The predicted M. bovis AhpF has only a low level of homology with AhpF from other organisms. Figure 4 shows a best-fit comparision of the protein encoded in ORF2 (top) with the AhpF from E. cli (below). Vertical lines indicated identity; dots between the sequences indicate similarity; asterisks indicate residues that are 10 amino acids apart.

The M. bovis AhpF has a Cys-X-X-Cys (SEQ ID NO:24) motif (underlined), which is characteristic of a family of disulphide oxidoreductases such as thioredoxin, disulphide isomerase, and DsbA, a periplasmic protein required for disulfide bond formation in E. coli.

This family of proteins is believed to catalyse native disulfide bond formation in vivo.

Thioredoxin in yeast donates hydrogens to an antioxidant protein which is capable of removing peroxides. In Sp tphimurium, the sulphydryl groups of AhpC are regenerated by AhpF, which transfers reducing equivalents from NAD(P)H to the disulfide of AhpC.

Example 4 Isolation and Sequencing of Wild Type ahpCF Operon DNA was harvested from M. bovis ATCC 35723 which is the INH-sensitive parent strain from which M. bovis ATCC 35729 was derived. This DNA was digested with the two restriction enzymes No1I and BglII and the resulting fragments were cloned into pBluescript II KS+. A clone containing a plasmid which incorporated the ahpCF operon was identified by colony hybridization with a probe of part of the insert of pUHA212. The wild type ahpCF operon incorporated in this plasmid, denoted pUHA313, was sequenced in a similar manner to the pUHA212 insert. The DNA sequence of the ahpCF operon of ATCC 35723 (the INH sensitive parent) is shown in Figure 6 (SEQ ID NO:14). The sequence has been submitted to GenBank, and is assigned the accession number U24083.

The only difference between the DNA sequences of the fragments from the two strains is a point mutation in the promoter region at position 826 (indicated by the arrow in Figure where C is changed to T. Primer extension reveals that this mutation occurs at the transcriptional start site (Figure 9 and Example In comparison to other similar mycobacterial promoters, this change from a C to a T associated with INH resistance is a change towards greater agreement with the consensus -10 sequence motif.

28 RECTIFIED SHEET (RULE 91)

ISNEP

1 WO 96/19578 WO 96/19578 PCT/NZ95/00133 Example Survey of Catalase Activity in Different Mycobacteria Strains To determine the interrelationship between the ahpCF operon and the katG gene in conferring INH resistance, a panel of strains of the M. tuberculosis complex was surveyed for catalase activity. The panel comprised 5 strains of M. bovis: ATCC 35729, the INH resistant strain characterized in Example 3; ATCC 35723, the INH sensitive strain from which it was derived; ATCC 35728, another INH resistant strain derived from the same parent; WAg201, a different INH sensitive parent; and WAg405, an INH resistant strain derived therefrom. The panel also comprised 2 strains of M. tuberculosis: ATCC 27294, an INH sensitive parent strain; and ATCC 35822, an INH resistant descendant strain of ATCC 27294.

Catalase activity of an INH-sensitive strain ofM. bovis was determined. The enzyme was first isolated from the strain by pelleting a culture of M. bovis, resuspending it in 50 mM potassium phosphate buffer, pH 7, and adding it to a tube containing 0.5 g zirconium beads (Biospecs products), and vortexing for 5 min. The sample was centrifuged briefly, the supernatant collected and diluted to 4 ml with 50 mM potassium phosphate buffer, and filter sterilized through 0.22 Tm filters.

Catalase catalyzes the conversion ofH202 to H 2 0 and 02. Catalase activity was assayed by incubating an aliquot of supernatant, prepared as above, with 3 Tm H 2 0 2 in a total volume of 3 ml for 5 minutes. The reaction was stopped by adding 1.5 ml of titanium tetrachloride reagent (1.5 mg/ml TiCl 4 in 4.5 M H 2 SO4). The absorbance was read at 410 nm and the catalase activity was calculated using a standard curve of the amount of hydrogen peroxide versus wavelength at 410 nm; the activity was expressed as Tmol/min/mg protein.

The results are shown in Table 2. Virulence of strains in guinea pigs is shown as reported by the American Type Culture Collection or, in the case of WAg201 and WAg405, as reported by Wilson et al. (Mol. Microbiol. 15:1009-1015, 1995). Strains shown as INH sensitive had a Minimal Inhibitory Concentration (MIC) of 0.2 Tg/mL.

Strains were defined as INH resistant if they had an MIC of '0.2 Tg/mL; in fact, all strains shown in the table as INH resistant had an MIC of TM64 Tg/mL.

WO 96/19578 PCT/NZ95/00133 Table 2. Characteristics ofM. bovis and M tuberculosis strains.

Strain Virulence... Resistance Virulence^ Resistanceb Catalase Activity mol/min/mg) kaitG gene inhA gene Promoter Coding R egion f .f 4 AM bovi3 ATCC 35723 ATCC 35728 ATCC 35729 WAg201 WAg405 M. tuberculosis H37Rv (ATCC 27294) ATCC 35822 Sensitive Resistant Resistant Sensitive Resistant Sensitive Resistant 2.5 0 0 1.6 0 1.3 0 Intact Mutated Deleted Intact Mutated

W.T.

W.T.

W.T.

W.T.

W.T.

W.T.

W.T.

W.T.

W.T.

Mutated W.T. W.T.

W.T. W.T.

I

Catalase activity was detected in all strains that were sensitive to INH, but none of the strains that were resistant to INH. There is an approximate correlation between catalase activity and the virulence of the strain. However, certain strains (notably ATCC 35728) can be virulent even in the absence of detectable catalase activity.

Example 6 Analysis of the katG Gene DNA preparations from different M. bovis strains were digested with restriction nucleases and subjected to Southern analysis by standard techniques, using a 4.5 kb polynucleotide probe for the katG gene.

I I ill I WO 96/19578 PCT/NZ95/00133 Example 6 Analysis of the katG Gene DNA preparations from different M. bovis strains were digested with restriction nucleases and subjected to Southern analysis by standard techniques, using a 4.5 kb polynucleotide probe for the katG gene.

The results are shown in Figure 7. There was no detectable hybridization with DNA from INH resistant strain ATCC 35729, indicating that the katG gene in this strain had been deleted. In contrast, INH resistant strains ATCC 35728 and WAg405 produced hybridizing restriction fragments of about the same size as the wild type strain WAg201.

This indicates that the loss of catalase activity in these strains was probably due to a point mutation or a small deletion.

A katG gene encoding functional catalase activity was integrated back into the genomes of ATCC 25728 and ATCC 35729, using similar techniques to those outlined elsewhere in this disclosure. As a result, INH resistance was reduced from 64 Tg/ml to 1 Tg/ml and 0.5 Tg/ml, respectively.

These results are consistent with the concept that partial INH resistance can be conferred by alteration of the ahpCF operon alone. Full INH resistance may require that an ahpCE alteration be combined with loss or deactivation of the katG gene. The katG gene is located in a region of the tuberculosis genome that contains at least three 75 bp repeat elements flanked by multiple copies ofa 10 bp tandem repeat. As a result, this region is unstable. Catalase activity could easily be lost from a strain with an altered ahDCF, increasing the INH resistance.

Example 7 Analysis of the inhA Gene Since mutation of the inhA gene can also confer INH resistance, it was important to establish the status of inhA in the strains analyzed herein. Mutations that confer INH resistance have been mapped to two well-separated nucleotides in the coding region of inhA (Banerjee et al., Science 263:227, 1994), and also to the promoter region (Kapur et al., Arch. Pathol. Lab. Med. 119:131, 1995). Therefore, the relevant regions were WO 96/19578 PCT/NZ95/0013 3 retrieved from each of the mycobacteria strains of the panel, and the nucleotide sequence was determined. The promoter region ofinhA was amplified using primer CAGCGCTTTTGCACGCA (SEQ ID NO:25) and 5'-CCAGGACTGAACGGGAT (SEQ ID NO:26) to produce a 350 bp fragment and the PCR product cloned using TA cloning kit (Invitrogen). Both strands were sequenced by cycle sequencing with the amplification primers.

Results are shown in Table 2. The sequence of the inhA promoter was compared to that of WAg201, and if identical is denoted in the Table as wild type The coding region ofinhA was sequenced near the previously reported mutations at positions 16 and 94 of the protein. The presence of any mutation affecting position 16 was determined using primers 5'-GCGAGCTATATCTCCGG (SEQ ID NO:27) and CATGATCGGCAGCAGCG (SEQ ID NO:28). The presence of any mutation affecting position 94 was determined using primer 5'-TCAGCGCATCACCGACC (SEQ ID NO:29) and 5'-CATGATCGGCAGCAGCG (SEQ ID NO:28). The PCR products were cloned and sequences as described above. Sequences identical to WAg201 are denoted as W.T.

Apart from a previously known mutation at position 94 of the coding region of WAg405, all strains were found to have a wild-type inhA in the regions analyzed. Thus, the INH resistance of ATCC 35729 is attributable to the mutation found in the ahpCF operon, not to a change in inhA.

Example 8 A Common Mutation in the ahpCF Promoter To determine which ahpCF promoter sequence was present in other strains of the M. tuberculosis complex, primers were designed to amplify a 200 bp region of the promoter upstream from the start codon. The promoter region was amplified using primers (SEQ ID NO:30) and 5'-CGGTCCTCGAACTCGTC

(SEQ

ID NO:31). The PCR product was cloned into pKSl using the TA CLONING KIT (TM) (Invitrogen), and both strands of the promoter region were sequenced using the amplification primers and an additional primer 5'-GTGGCATGACTCTCCTC (SEQ ID NO:32).

Nucleotide sequences near the previously determined mutation site of ATCC 35729 are shown in Table 3. The three INH sensitive strains, ATCC 35723, WAg201, and ATCC 27294, all had identical wild-type sequences in this region, as did WAg405, the strain with the mutation in the inhA gene. Six additional INH-sensitive strains, M.

32 RECTIFIED SHEET (RULE 91)

ISA/EP

Ij WO 96/19578 PCT/NZ95/00133 beyis BCG Swedish, M~a tubercu Erdman, two clinical New Zealand M. tuberculosis isolates, a New Zealand M. bovis isolate and an Irish M. bovis isolate, also had the identical wild-type promoter sequence. The other INH resistant strains, ATCC 35728 and ATCC 35822, all had a mutation identical to that of ATCC 35729 at position 826. ATCC 35822 had an additional mutation at position 841.

Primer extension analysis revealed that the mutation in position 72 occurs at the transcriptional start site. Total RNS was isolated from a pelleted culture of M. smegmatis which had been transformed with the integrating vector pYUB178::aphC using TRIzolTM (Gibco/BRL) and the manufacturer's protocol. Primer extension analysis was performed as described by Levin and Hatfull (1993) except that the annealing conditions used were 0 C for 16 hours and the reverse transcriptase temperature used was 50 0 C for 2 hours.

Results are shown in Figure 9.

Table 3. Sequence data from the promoter region of the ahpC gene from nucleotides 70 to iStrain:i ATCC 35723 ATCC 35728 ATCC 35729 WAg201 WAg405 H37Rv (ATCC 27294) ATCC 35822 Sequence GGCACGATGG AATGTCGCAA (SEQ ID NO:33) GGTACGATGG AATGTCGCAA (SEQ ID NO:34) GGTACGATGG AATGTCGCAA (SEQ ID NO:34) GGCACGATGG AATGTCGCAA (SEQ ID NO:33) GGCACGATGG AATGTCGCAA (SEQ ID NO:33) GGCACGATGG AATGTCGCAA (SEQ ID NO:33) GGTACGATGG AATGTCGTAA (SEQ ID Functional Dissection of the ahpCF Operon The 2.1 kb insert of ATCC 35729 was treated with restriction nucleases NotI EcoRI PstI and BglII producing the fragments shown in Figure 8. The 33 RECTIFIED SHEET (RULE 91)

ISA/EP

I r fragments were subcloned, and pYUB18 constructs were electroporated into M.smegmatis.

Transfection with the full-length construct doubled the INH resistance of M.smegmatis as before, but did not confer ethionamide resistance, in contrast to inhA which confers both INH and ethionamide resistance. A multicopy plasmid incorporating the 2.1 kb fragment did not confer resistance to INH when transformed into M.bovis ATCC35723. Subfragments encompassing both ORFs, or ORF1 and the promoter region alone, conferred the same degree of INH resistance.

The subfragment encompassing ORF2 alone did not. This is consistent with the idea that AhpC (but not AhpF) is required to confer INH resistance.

When wild-type ahpC was transformed into M.smegmatis, it conferred the S: same level of INH resistance as did ahpC from ATCC 35729. A similar effect was observed with the inhA gene, and probably occurred because pYUB18 is a multicopy plasmid with 5-10 copies per cell. Partial INH resistance can therefore be l o 15 conveyed by increased production of AhpC.

9 *900 Example 00 ahpCF Promoter Activity Detected via a Reporter Gene aThe object of the next experiment was to determine the effect of the mutation in the ahpCF operon of mycobacteria strains on the function of the promoter region.

The strains tested were ATCC 35723 (wild type, INH sensitive), ATCC 35729 (one mutation, INH resistant), and ATCC 35822 (two mutations, INH resistant).

Primers 5'-CTCGGATCCACTGCTGAACCACTGCTT-3' (SEQ ID NO:36) and CTCGGATCCGACTCTCCTCATCATCAA-3' (SEQ ID NO: 37) were used to amplify the promoter region of the ahpC gene from different strains. The amplified prodtct was digested with BamHI and ligated into the BamHI cloning site of pYUB76. This is a mycobacterial shuttle vector with a promoterless reporter gene, lacZ, immediately downstream of the cloning site. The vector constructs were electroporated into E. coli and selected on media containing 25 Tg/ml kanamycin and 40 Tg/ml X-Gal.

Colonies containing the wild-type promoter were colourless, while the colonies containing a mutated promoter were pale blue. All three constructs were sequenced to verify that no errors had been introduced by the amplification S procedure. The constructs i- 1 ^I WO 96/19578 PCT/NZ95/00133 amount of liberated Q-nitrophenol was calculated. The amount of reaction product formed was assumed to depend linearly on the amount of laZ enzyme produced in the cells under control of the respective ahpC promoter.

Results are shown in Table 4. The values shown are the mean standard deviation for three independent experiments. The ahpC promoter with a single mutation (ATCC 35729) showed a six-fold higher level of activity than the wild type. The ahpC promoter with two mutations (ATCC 35822) showed a 10-fold higher level of activity.

Table 4. J-galactosidase activity of cell-free extracts from M smegmatis containing vector constructs.

1 I 'Vector construits i r i:: J-Galactosidase Activity (Tmol/min/ig protein) pYUB76 ATCC 35723 promoter ATCC 35729 nromoter 0.7 1.3 0.2 S5 11 3582 o.J I. ATCC 35822 promoter 13.3 2.9

Claims (27)

1. An isolated polynucleotide including a nucleotide sequence of at least 200 nucleotides of an ahpCF operon of the Mycobacterium tuberculosis complex.

2. A polynucleotide according to claim 1 wherein the operon encodes AhpC and AhpF and wherein the operon is associated with INH-resistance.

3. A polynucleotide according to claim 1, wherein the nucleotide sequence includes a sequence from a promoter region of the operon.

4. A polynucleotide according to claim 1, wherein the nucleotide sequence encompasses a sequence selected from the group consisting of S 15 CGGTACG, CGGCACG, TCGTAAC, TCGCAAC, and their respective complementary sequences.

5. An isolated polynucleotide(s) encoding a polypeptide having at least 96% identity to a Mycobacterium tuberculosis complex AhpC and/or AhpF 20 polypeptide having the sequence shown in Figure 2 or fragment thereof including at least 60 amino acids.

6. A polynucleotide according to claim 5, wherein the polynucleotide is a recombinant expression vector including a control sequence operably linked to a segment encoding the AhpC and/or AhpF polypeptide or fragment thereof including at least 60 amino acids.

7. A host cell including a polynucleotide selected from the group of polynucleotides according to claim 1, or claim 2, or claim 5, or claim 6.

8. A method of treating an individual for infection caused by a member of the Mycobacterium tuberculosis complex including: providing a composition including a polynucleotide capable of inhibiting mRNA activity from an ahpCF operon of the infecting species and a suitable excipient; i i administering a pharmacologically effective amount of said composition to the individual.

9. The method of claim 8 wherein the mode of administration of the polynucleotides is selected from oral, enteral, subcutaneous, intraperitoneal and intravenous.

A method of assessing susceptibility of a strain of mycobacteria in a biological sample to INH including: providing the mycobacterial DNA from the biological sample; amplifying a region of the ahpCF operon; determining whether a mutation exists within the ahpCF operon from the biological sample, the presence of the mutation indicating that said mycobacterial strain is resistant to INH.

11. The method for claim 10 wherein the region which is amplified in step includes a promoter region of the operon.

12. The method for claim 10 wherein the amplification is by a polymerase 20 chain reaction (PCR).

13. The method of claim 12 further including a comparable portion of wild-type INH-sensitive ahpCF operon from the mycobacteria, and the "determination of whether a mutation exists in the biological sample is by comparison with the wild-type ahpCF operon.

14. The method of claim 13, wherein determining whether a mutation exists is performed by single strand conformation polymorphism analysis.

15. A method of assessing susceptibility of a strain of mycobacteria in a biological sample to INH including: providing a biological sample containing a first strain of mycobacteria; providing a control sample containing a second strain of mycobacteria; and I 38 comparing the activity of the ahpC gene in the mycobacteria of the biological sample with the activity of the ahpC gene in the mycobacteria of the control sample.

16. The method of claim 15, wherein step is performed by comparing the level of messenger RNA transcribed from the ahpC gene in the biological sample with the level of messenger RNA transcribed by the ahpC gene in the control sample.

17. The method of claim 15, wherein step is performed by comparing the level of AhpC polypeptide in the biological sample with the level of AhpC polypeptide in the control sample. 0

18. A method of determining whether a drug is effective against mycobacterial infection including: providing an isolated AhpC and/or AhpF; providing a candidate drug; mixing AhpC and/or AhpF with organic peroxide substrate in the 2 presence or absence of the candidate drug; and 20 measuring the inhibition of alkyl hydroperoxide reductase caused by the presence of the drug, if any.

19. A method for producing a compound that inhibits alkyl hydroperoxide reductase activity including: providing purified mycobacteria AhpC and/or AhpF; determining the molecular structure of said AhpC and/or AhpF; creating a compound with a similar molecular structure to INH; and determining that said compound inhibits the biochemical activity of AhpC and/or AhpF. Isolated polypeptide(s), or fragment(s) thereof including at least amino acids, having at least 96% identity with Mycobacterium tuberculosis complex AhpC and/or AhpF polypeptide(s) having the sequence shown in Figure 2 or fragment(s) thereof including at least 60 amino acids.

II I I

21. A recombinant mycobacterial vaccine including attenuated mutants selected from the group consisting of BCG, M. tuberculosis, and M. bovis, wherein the mutants are host cells containing a mutated ahpCF operon.

22. A probe including a sequence of at least 20 nucleotides of an ahpCF operon, wherein the probe is unique to the Mycobacterium tuberculosis complex.

23. A method of identifying an organism which is a member of the M. tuberculosis complex, including determining the presence or absence in the organism of the sequence of claim 22, wherein presence of the sequence is indicative that the organism is a member of the M. tuberculosis complex.

24. The use of a polynucleotide capable of inhibiting mRNA activity from 15 the ahpCF operon for the preparation of a medicament for the treatment of an individual infected with a member of the Mycobacterium tuberculosis complex. 9t

25. The use of claim 24 wherein, the mode of administration of the 20 polynucleotide is selected from oral, enteral, subcutaneous, intraperitoneal and intravenous.

S'26. Isolated polynucleotide(s) encoding Mycobacterium tuberculosis complex AhpC and/or AlpF polypeptide(s), or fragment(s) thereof including at least 27 amino acids of the amino acid sequence shown in Figure 2.

27. Isolated Mycobacterium tuberculosis complex AhpC and/or AhpF polypeptide(s) or fragment(s) thereof including at least 27 amino acids of the sequence shown in Figure 2. Dated this thirtieth day of April 1999. NEW ZEALAND PASTORAL AGRICULTURE RESEARCH INSTITUTE LIMITED Patent Attorneys for the Applicant: /TR' VF B RICE CO .1,