AU686564B2 - Sequence of human dopamine transporter cDNA - Google Patents

Description

4) IPCrr INTERNATIONAL APPLI( (51) International Patent classlincatloi C12N 15112, C07K 13100 C12N 51100 GOIN 33150 AfMAOUCEME~Vt0F THE LATER PUSliCATION OFINTERAIATIC7VL SEARCH REPORT

RAI,

n 53 (11) International Publication Number.

(43) International Publication Date: IlON TREATY (PCT) WVO 93/24628 9 December 1993 (09.12.93) (21) International Application Number: (22) International Filing Date: PCT/US93/05 179 I June 1993 (01.06.93) Priority data: 07/889,723 I June 1992 (01.06.92) (71) Applicant: THE GOVERNMENT OF THE UNITED STATES OF AMERICA as represented by THE DE- PARTMENT OF HEALTH AND HUMAN SER- VICES [US/US]; National Institutes or Health, Box OTT, Bethesda, MD 20892 (US).

(72) Inventors: UHL, George, R. 1620 Dogwood Hill Road, Towson, MD 21204 VANDENBERGH, David, J.

;415 Woodlawn Road, Baltimore, MD 21210 (US).

PERSICO, Antonio 2418 Chetwood Circle, Timonium, MD 21903 (US).

(74) Agents: MURPHY, Gerald, Jr. et al.; Birch, Stewart, Kolasch Birch, P.O. Box 747, Falls Church, VA 22040.0747 (US).

(81) Designated States: AU, CA, JP', European patent (AT, BE, ClHi, DE, DK, ES, FR, GB, GR, 11E, IT, Wj, MC, NL, PT, SE).

Published With international search report.

Before the expiration of lte time linit for arnending the claimas and to be republished in the event of the receipt of amnendments.

(88) Date of publication or the International search report: 3 February 1994 (03.02.94) 886564 (54)Title: SEQUENCE OF HUMAN DOPAMINE TRANSPORTER cDNA

AGGAGCGTGT

AGGAGCGTGT

AGGAGCATGT

AGGAGCGTGT

AGGAGCGTGT

TGGAGCGTGT

AGGAGCGTGT

AGGAGCGTGT

AGGAGCGTGT

AGGAGCGTGT

Consensus:

AGGAGCGTGT

CCTATCCCCG

CCTATCCCCG

CCT7ATCCCTG

ACTACCCCAG

ACTACCCCAG

ACTACCCCAG

CCTATCCCCG

ACTACCCCAG

ACTACCCCAG

ACTACCCCAG

GACGC1ATGCA

GACGCATGCS

GACGCATGCA

AACGCATGCA

GACGCATGCA

GACGCATGCA

GAC;CGGACGC

GACGCATGCA

GATGCATGCA

GACGCATGCA

GGGCCCCCAC

GGGCCCCCAC

GGGCCCCCAC

GGGCCCCCAC

GGGCCCCCAC

GGGCCCCCAC

ATGCAGGGCC

GGGCCCCCAC

GGGCCCCCAC

GGGCCCCCAT

CCCAC

ACTATCCCAG GACGCATGCA GGGCCCCCAC (57) Abstract The cloning and characterization of a human dopamine transporter (HUDAT) cDNA is described. RFLP analysis is used to determine the distribution of HUDAT alleles in two ethnic backgrounds. The means by which the association between HU- DAT alleles t.nd behavioral disorders which have altered HUDAT expression as a basis for their etiology is discussed. Methods for evaluating the expression of HUDAT are described.

WO 93/24628 PCT/US93/05179 1 SEQUENCE OF HUMAN DOPAMINE TRANSPORTER cDNA RELATED APPLICATIONS This application is a Continuation-In-Part of U.S.

Patent Application Serial Number 07/762,132, filed September 20, 1991, which is hereby incorporated in its entirety by reference.

BACKGROUND OF THE INVENTION Field of the Invention The invention relates to a cloned cDNA which encodes the human dopamine transporter protein. The cloned cDNA provides a means of expressing human dopamine transorter protein in a variety of contexts and also provides a means of diagnosing and treating diseases presenting abnormal expression of dopamine transporter protein.

Description of the Related Art Throughout this application, reference is made to articles of the scientific literature and the like.

The entire content of such citations is hereby incorporated by such reference.

The dopamine transporter that acts to take released dopamine back up into presynaptic terminals I WO 93/24628 PCT/US93/05179 2 has been implicated in several human disorders. Cocaine binds to the dopamine transporter and blocks dopamine reuptake in a fashion that correlates well with cocaine reward and reinforcement Ritz et al., Science 237, 1219 (1987)). Neurotoxins that cause Parkinsonian syndromes are concentrated in dopaminergic neurons by this transporter Snyder and R.J. D'Amato, Neurology 36, 250 (1986); G. Uhl, Eur. J. Neurol. 21 (1990)). Binding to the dopamine transporter is altered in brains of patients with Tourette's syndrome Singer et al., Ann. Neurol. 30, 558 (1991)).

These clinical links enhance interest in the structure and function of the human dopamine transporter (HUDAT).

Vulnerability to these disorders may have genetic components Devor and C.R. Cloninger, Annu. Rev.

Genet. 23, 19 (1989); D. Pauls and J. Leckman, New Eng.

J. Med. 315, 993 (1986); R. Pickens et al., Arch. Gen.

Psychiatry 48, 19 (3991)); thus identification of linkage markers for the human DAT is also of interest.

Dopamine transporters act to terminate dopaminergic neurotransmission by sodium- and chloridedependent reaccumulation of dopamine into pre-synaptic neurons Iversen, in Handbook of Psychopharmacology, L.L. Iversen, S.J. Iversen, S.H.

Snyder, Eds. (Plenum, New York, 1976), pp. 381-442; M.J. Kuhar and M.A. Zarbin, J. Neurochem. 31, 251 (1978); A.S. Horn, Prog. Neurobiol. 34, 387 (1990)).

Cocaine and related drugs bind to these transporters in a fashion that correlates well with their behavioral reinforcing and psychomotor stimulant properties; these transporters are thus the principal brain "cocaine receptors" related to drug abuse (M.C.

Ritz, R.J. Lamb, S.R. Goldberg, M.J. Kuhar, Science 237,1219 (1987); J. Bergman, B. K. Madras, S. E.

WO 93/24628 PCT/US93/05179 3 Johnson, R. 0. Spealman, J. Pharmacol. Exp. Ther. 251, 150 (1989)). The transporters accumulate neurotoxins with structural features resembling dopamine; their ability to concentrate the parkinsonism-inducing toxin MPP (l-methyl-4-phenylpyridinium) is key to this agent's selective dopaminergic neurotoxicity (S.H.

Snyder, and R. J. D'Amato, Neurology 36(2), 250 (1986); S. B. Ross, Trend. Pharmacol. Sci. 8, 227 (1987)).

Studies of the dopamine transporter protein suggest that it is an 80 kDa glycoprotein, but have not yet yielded protein sequence data Grigoriadis, A.A.

Wilson, R. Lew, J.S. Sharkey M.J. Kuhar, J. Neurosci.

9, 2664 (1989)). Binding of cocaine analogs such as [3H]CFT to membranes prepared from dopamine-rich brain regions reveals two sites with differing affinities (F.

Javory-Agid, and S.Z. Langer, Naunyn-Schmiedeberg's Arch. Pharmacol. 329, 227 (1985); J.W. Boja, and M.J.

Kuhar, Eur. J. Pharmacol. 173, 215 (1989); B.K. Madras et al., Mol. Pharmacol. 36, 518 (1989); M.J. Kuhar et al., Eur. J. Neurol. 30(1), 15 (1990); M.C. Ritz, E.J.

Cone, M.J. Kuhar, Life Sci. 46, 635 (1990).; D.O.

Calligaro, and M.E. Eldefrawi, J. Pharmacol. Exp. Ther.

243, 61 (1987); B.K. Madras et al., J. Pharmacol. Exp.

Ther. 251(1), 131 (1989); M.C. Ritz et al., J.

Neurochem. 55, 1556 (1990)).

Recent elucidation of cDNAs encoding dopamine transporters from experimental animals Gros et al., FEBS Lett. 295, 149 (1992); J.E. Kilty et al., Science 254, 578 (1991); S. Shimada et al., Science 254, 576 (1991); T.B. Usdin et al., Proc. Natl. Acad. Sci. USA 88, 11168 (1991) provides hybridization probes useful for isolation of their human cognate.

Summary of the Invention Described herein is a cDNA (pcHUDAT), which encodes the human dopamine transporter protein (HUDAT). Also described are unique features of the nucleotide sequence of the pcHUDAT predicted for its encoded mRNA and protein, restriction fragment length polymorphisms (RFLPs) and Variable Number Tandem Repeats (VNTRs) identified by this cDNA and estimates of race-specific population frequencies of these RFLPs and VNTRs.

By virtue of its representation of the human dopamine transporter sequence, the pcHUDAT is advantageous over those clones isolated from other species in that better io results in applications having a human context would be expected.

The cDNA encoding the human dopamine transporter protein (HUDAT) provides a means for diagnosing and treating disorders that arise by expression of abnormal amounts of or dysfunctional dopamine transporter molecules in a human being.

One aspect of the invention is to produce a cDNA that encodes the human 15 dopamine transporter protein, a product of dopaminergic neurons that binds dopamine, cocaine and cocaine analogs and will transport dopamine and MPP+ into mammalian cells expressing it on their surface. Accordingly, the present invention provides a cDNA sequence which encodes a protein including an amino acid sequence described for Hdat in Figure 3 of the specification (SEQ. ID. NO. or portions thereof which 20 retain the activity of said protein, said activity comprising the selective binding of dopamine, cocaine or functional analogs thereof. It is a further aspect of the invention to provide a protein encoded by the cDNA sequence. It is a further aspect of the invention to utilize the cDNA to produce cell lines that express human DAT on their surface and to provide a method for the screening of compounds that influence the binding and/or transport of dopamine or cocaine or functional analogs thereof to (into) the cells. Accordingly, one aspect of the invention is to provide a plasmid DNA including the cDNA sequence and a cell line which expresses the protein encoded by the cDNA sequence preferably it will be a eukaryotic cell line derived from a cell type that does not normally express dopamine transport activity at its surface that has been made to transport dopamine or to bind CFT.

1 o f• r WO 93/24628 PCT/US93/05179 A hee of the invention is to provide diagnostic means for assessing HUDAT expression in patients by DNA- or antibody- based tests and for assessing the onset or progression of disease by assay of HUDAT degradation.

These and other lpcas% are accomplished by providing a cDNA encoding the dopamine transporter protein and a purified polypeptide conferring upon cells the phenotype of dopamine uptake from the surrounding extracellular medium. Further, the invention is embodied in cell lines, created by stable transformation of cells by a vector encoding the dopamine transporter protein, expressing the dopamine transporter protein on their surface. Another aspect of the invention relates to a method of using such lines to screen pharmaceutical compositions for their ability to inhibit the binding of dopamine, cocaine or analogs of these compounds to the transporter protein.

Such a screening can also be accomplished by use of cells transiently expressing dopamine transporter cDNA.

The invention also relates to diagnostic applications of the dopamine transporter cDNA and anti-human DAT antibodies and to therapeutic applications of the HUDAT cDNA.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 (SEQ. ID. NO. 1) shows the nucleotide sequence of the pcHUDAT cDNA encoding the human dopamine transporter protein; the sequence is a composite derived from the sequence of clones pHCDAT2, pHCDAT3 and pHCDAT7.

Figure 2 shows the sequences of the repeat elements in the 3' untranslated portion of the pcHUDAT cDNA. Also shown is the consensus sequence of the I I WO 93/24628 PCT/US93/05179 6 repeats.

Figure 3 shows a comparison of the amino acid sequence of the human dopamine transporter (Hdat) protein with the amino acid sequence of the rat DAT (Datl) and also with the sequences of the human norepinephrine transporter (Hnat) and of the human gamma-amino-butyric acid transporter (Hyabat).

Figure 4A shows a representative RFLP analysis of human genomic DNA from nine unrelated individuals digested with TaqI and hybridized with the insert portion of the pHCDAT7 plasmid. Figure 4B shows the same DNA, but hybridized with the Taq492 probe, which corresponds to nucleotides 301-793 of the pcHUDAT sequence.

DETAILED DESCRIPTION OF THE INVENTION For many of the applications described in the examples below subfragments or variants of the HUDAT protein disclosed in the present application wherein the original amino acid sequence is modified or changed by insertion, addition, substitution, inversion or deletion of one or more amino acids are useful so far as they retain the essential binding or transport specificity for dopamine, cocaine, or functional analogs thereof. Thus, such variants of the HUDAT are considered to fall within the scope of the present invention. Such variants are easily produced by mutagenic techniques well developed in the art of genetic engineering.

Expression of heterologous proteins in E. coli is often utilized as a means of obtaining large quantities of a polypeptide. The product is an unglycosylated protein, which may be made as insoluble "inclusion bodies" in the bacterial cells. Alternatively, some IWO 93/24628 PCT/US93/05179 7 proteins can be secreted into the perplasmic space by fusion to a leader sequence that directs the secretion of the translation product. Other useful fusion sequences are those which allow affinity purification of the product, such as the pGEX system (Pharmacia), which allows purification by use of a glutathione- Sepharose column.

The promoter to be employed is dependent upon the particular protein to be expressed. Some proteins are not detrimental to the physiology of the bacteria and may be expressed using a high-level constitutive promoter. Others are somewhat toxic and so are best expressed from an inducible promoter which keeps synthesis of the heterologous protein repressed until growth of the culture is complete. The promoter is then switched on and the heterologous protein is produced at a high level.

Other considerations in bacterial expression include the use of terminator seqences in the transcription unit and the use of sequences in the untranslated portion of the mRNA to abolish secondary structure which might impede translation. Also the choice of bacterial strain can be important. Some heterologous proteins are susceptible to proteolytic degradation and so are best expressed in strains of bacteria which lack proteolytic functions. Also, strains of bacteria other than E. coli are often useful as hosts for expression systems. The best-developed alternative currently being Bacillus strains.

Expression of proteins in bacteria is wellreviewed in "Current Protocols in Molecular Biology", which is published with quarterly updates by Wiley Interscience.

L-ll WO 93/24628 PCr/US93/05179 8 Expression of "foreign" proteins in mammalian cells can be accomplished in two general fashions.

Transient expression refers to the creation of a pool of transfected cells which harbor plasmids that are not stably maintained in the cell and so are gradually diluted out of the population. Transient expression is by nature a short term method. For reproducible expression of a heterologous protein, stable expression systems are preferable.

The current state of this art includes a variety of vector systems; both integrative and autonomous vectors are available. Inducible expression of heterologous proteins in mammalian cells is difficult to achieve at the current time. Some systems have been described, but they are not yet in general use. More commonly used are vectors bearing moderate to highlevel constitutive promoters. Plasmid vectors are relatively easy to use. Retroviral vectors, which rely upon packaging into infective viral particles and integration into the host cell chromosome are more difficult to use, due to the extra steps involved in creating the recombinant viruses and cell lines which secrete them, but have the advantage that they effectively introduce exogenous DNA into human cell lines. Vaccinia virus vector systems are also in widespread use. Other viral vectors are under development for gene therapy systems, including adenovirus-derived vectors.

The preferred embodiments of the invention are described by means of the following examples. These examples are intended to be illustrative, rather than limiting in scope. It is understood that variations in the materials and techniques described below will be apparent to those skilled in art and such are to be WO 93/24628 PCT/US93/05179 9 considered to fall within the scope and spirit of the instant application.

Example 1 Isolation and sequencing of cDNA encoding human dopamine transporter To isolate human cDNAs for the dopamine transporter, cDNA libraries prepared from "substantia nigra" and "brainstem" dissections containing cells known to express the transporter were screened with hybridization probes prepared from the rat cDNA, pDAT1 Shimada et al., Science 254, 576 (1991)).

Sequences from the 3' untranslated region of the rat cDNA were not used because of the presence of CA dinucleotide repeats. Human brain stem and substantia nigra cDNA libraries (Stratagene, La Jolla, CA) were plated and blotted onto duplicate replica nitrocellulose (Schleicher and Schuell, Keene, NH) filters, which were incubated for 1 hour at 37 0 C with proteinase K (50 pg/)l in 2 x SSPE/0.1%SDS) to reduce filter background, washed in 5 x SSC/0.5% SDS/lmM EDTA, prehybridized and hybridized at 42 0 C, and washed at 54 0

C

in 0.4 x SSC/0.5% SDS. The hybridization probe was a 2300 bp Eco RI fragment of the rat dopamine transporter cDNA6 Shimada et al., Science 254, 576 (1991)) [32p] labeled by random priming (Prime It kit, Boehringer Mannheim), and hybridized at approximately 106 cpm/ml.

Positively-hybridizing cDNA clones were purified from the brainstem library, autoexcized according to protocols provided by the manufacturer (Stratagene), and termed pHCDAT2, pHCDAT3, and pHCDAT7. Sequencing was performed on an Applied Biosystems automated sequencer as described Shimada et al., Science 254, 576 (1991)). Sequence analysis was performed using the e I i II WL ,3/24628 iPCT/US93/05179 GCG software package Devereaux, et al., Nucleic Acids Res. 12, 387 (1984)).

Screening of more than 2 x 106 plaques from the substantia nigra library produced no positives.

Screening 1 x 106 plaques from the brainstem library yielded 11 positively-hybridizing plaques, three of which were identified as human DAT clones by sequence analysis. These clones were identified as representing the 5'-half (pHCDAT2, bases 1-1733), the 3'-half (pHCDAT3, bases 1679-3919), and an internal portion (pHCDAT7, bases 653-1434) of the human DAT cDNA whose reconstructed full-length sequence is shown in Figure 1. The structure of this cDNA resembles the structure of the rat cDNA DAT1, with a modest 5' untranslated region and a long 3' untranslated region. Both 5' and 3' untranslated regions are longer than those of the rat cDNA pDAT1, however, making the length of the predicted human mRNA greater than the 3.7 kb observed for the rat mRNA Shimada et al., Science 254, 576 (1991)). A striking difference between rat and human cDNAs is found in the 3' untranslated region where the human cDNA displays 10 copies of a 40 bp repetitive element that are arrayed in head-to-tail fashion and are absent from the rat cDNA (Figs These elements are highly stereotyped. The sequence of each element is more than 90% identical to the consensus sequence listed at the bottom of Figure 2, although the seventh repeat displays a 5 base pair insertion from its 24th to 28th nucleotides. The consensus element found here is 68% G+C. No exact match is found in searches of the EMBL/genbank data base, release However, sequences conferring up to 70% nucleic acid identity over up to 37 of these bases are found in WO 93/24628 PCT/US93/05179 11 viral sequences, especially with herpesvirus sequences locus HS1US).

The open reading frame predicted by the KJDAT cDNA encodes 620 amino acids, identical in size to the rat DAT1 cDNA except for an additional amino acid (199) not found in the rat sequence (Fig. This open reading framv predicts amino acid sequences that are 94% identical to those encoded by the rat dopamine transporter cDNA Shimada et al., Science 254, 576 (1991)). This high degree of conservation, and the weaker identities with the human norepinephrine and GABA transporter cDNA Nelson et al., FEBS Lett.

269, 181-184 (1990); T. Pacholczyk et al., Nature 350, 350-354 (1991)) (Fig. identifies this as the human homolog of the rat DAT1.

The amino acid sequence predicted by the HUDAT cDNA reveals inte:,usting differences from the rat cDNA.

It lacks one of the 4 consensus sites for N-linked glycosylation noted in the rat DAT1 cDNA (Fig 3, symbol). Three adjacent amino acids distinguish the human from the rat proteins at this locus; no other portion of the molecule differs by this extent.

Human DAT amino acids predicted to lie within hydrophobic, putative transmembrane domains show 97% amino acid identity between the rat and human transporter cDNAs. This conservation is higher than the 87% conservation in regions thought not to span the membrane, and is consistent with the high conservation in these regions among different sodium dependent transporter family members. The most striking difference between the rat and human transporters occurs in the putative second extracellular domain, at which each of the transporters cloned to date displays consensus sites for N-linked glycosylation. The WO 93/24628 PCf/US93/05179 12 g3ycosylation of the rat dopamine transporter has been defined in biochemical studies that suggest 20 to 30 kd of the molecular weight of the mature protein may consist of sugar Lew et al., Brain Research 539, 239 (1991). Four potential N-linked glycosylation sites indicated in the rat transporter contain classic asparagine X serine/throonine sequences. Three of these sites are conserved among the rat and human sequences, but a middle glycosylation site, potentially the most distant from the embedding membrane, is absent in the human transporter. The amino acids surrounding this site provide the largest area of amino acid sequence divergence between the rat and human transporters. If glycosylation is evenly distributed among the different potential sites for N-linked glycosylation, these observations would predict that the human dopamine transporter might display less glycosylation thai> the rat, and that its molecular weight might be correspondingly smaller. The function of the glycosylation has not been identified to date; changes in ligand recognition, membrane targeting of the molecule, or even in cell/ cell recognition might conceivably result from these differences in glycosylation.

The repeated motifs in the 3' untranslated regions of these cDNAs are another interesting difference from the rat sequence. Smaller polymorphic repeated elements have gained recent attention due to their implication in the fragile X syndrome and myotonic dystrophy Brook, et al., Cell 68, 799-808 (1992) Y. Fu et al., Cell 67, 1047-1058 (1991) V.A.

McKusick, Mendelian Inheritance in Man, 9th edn., Johns Hopkins University Press, Baltimore, 1990, 2028 The rat sequence does demonstrate 25 copies of a small WO 93/24628 PCT/US93/05179 13 dinucleotide CA repeat from bases 2476 to 2525 of the 3' untranslated region of its mRNA; CA repeats are absent from the human cDNA Shimada et al., Science 254, 576-578 (1991)). The sequence of the longer hDAT repeated element is not found the rat cDNA, nor in searches of other sequences found in databanks. The significance of the partial matches in viral genomes is unclear. These repeated elements might alter mRNA properties, perhaps including secondary structure and/or half-life, in ways that could contribute to the regulation of this gene's expression. Search of this sequence using the stemloop program yields more than 150 possible loops with as many as 18 stabilizing hydrogen bonds. Conceivably, population variants in the number of these repeats could also contribute to heterogeneity in DAT function.

Example 2 Restriction Fracment Length Polymorphism (RFLP) analysis DNA was obtained from leukocytes, digested with TaqI, and analyzed by Southern blotting using pHCDAT7 as the initial hybridization probe. Simpler patterns were also obtained using two other hybridization probes. Taq 120 corresponds to bases 668 to 787 of the HDAT (see below), and was generated by hybridizing and 72 base oligonucleotides of opposite sense and extending the product using large fragment of DNA polymerase I and (3 2 P]-dCTP or by random primin" of these two hybridized oligonucleotides, as descr.bed (A.

Feinberg and B. Vogelstein, Analyt. Biochem. 132, 6-9 (1982); S. Shimada et al., Science 254, 576-578 (1991)). Identical results were also obtained using a random-priming labeled 492 base pair cDNA fragment (Taq WO 93/24628 PCT/US93/05179 14 492) corresponding to bases 301 to 793 of this sequence. Probes were hybridized to filters containing DNA from unrelated individuals at 42°C in hybridization solution containing 50% formamide as described.

Identical results were obtained with final washes at 63 0 C in 0.2 x SSC/0.2% SDS or at 54 0 C in 0.4 x SDS. Patterns from these Southern blots were analyzed by two independent observers.

Digestion of DNA from 20 unrelated individuals with nine different restriction endonucleases revealed Southern blot patterns in each case that were consistent with the presence of a single gene. There were no clear interindividual differences in Southern blot restriction patterns using radiolabeled pHCDAT 7 after digestion with Alu I, Bam HI, Eco RI, Hae III, Hind III, Msp I, and Rsa I. Three other enzymes, Pst I, Hinf I and Tag I revealed polymorphisms. We focused on the polymorphisms identified by Tag I. When probed with radiolabeled pHCDAT 7, more than six bands were obtained from Tag I restricted DNA, maiy of which showed polymorphic patterns (Fig 4A). Hybridization survived washes of up to 68 0 C, consistent with specificity. A simpler pattern was revealed when hybridization was performed with the Tag 120 hybridization probe or with the cDNA hybridization probe Taq 492 (Fig. 4B). Two hybridizing bands of 7 and 5.6 kilobases were observed and termed Al and A2. Tag I Al and A2 RFLP frequencies are presented the Table.

Of 272 chromosomes from 136 individuals examined 36% showed the Al form, 64% showed the A2 form. There was a significant racial dimorphism in these distributions such that 26% of caucasians, but 42% of blacks displayed the Al RFLP (x2=7.45, p< 0.01).

WO 93/24628 PCT/US93/05179 The rich patterns of Tag I RFLPs identified with this cDNA sequence could relate to the fact that the clone itself contains three sites for Taq I cleavage.

Further studies are thus likely to detect other polymorphisms, because extreme variability of bands in the initial Tag I restriction digestions has already been documented.

The tandem repeat in the 3'region of this gene also provides a Variable Number Tandem Repeat (VNTR).

The means for examining the distribution of alleles of the VNTR is set forth at the end of Example 3 below.

The hybridization probes that we have described provide useful markers for linkage analysis that would help to exclude the regions around the dopamine transporter gene from involvement in familial disorders. Human dopamine systems are involved in a number of human disorders, with specific implication of involvement of transporter mechanisms in psychostimulant abuse, Parkinsonism, and Tourette's syndrome Devor and C.R. Cloninger, Annu. Rev.

Genet. 23, 19-36 (1989); D. Pauls and J. Leckman, New Eng. J. Med. 315, 993-997 (1986); R. Pickens et al., Arch. Gen. Psychiatry 48, 19-28 (1991); M.C. Ritz et al., Science 237, 1219-1223 (1987); S. Shimada et al., Science 254, 576-578 (1991); H.S. Singer et al., Ann.

Neurol. 30, 558-562 (1991); S.H. Snyder S.H. and R.J.

D'Amato, Neurology 36, 250-258 (1986); G. Uhl, Eur. J.

Neurol. 30, 21-30 (1990)). The human dopamine transporter cDNAs and RFLP information described here should provide useful tools to study its possible role in these and other human disorders.

WO 93/24628 I'T/ US93/05179 16 Example 3 (Predictive) A genetic component of substance abuse behavior identified by RFLP analysis of the human DAT gene Abuse of substances, including drugs and alcohol, is currently viewed as arising from a combination of biological, psychological, and social factors (J.S.

Searles, J Abnorm Psychol. 97,153-167 (1988); E.J.

Devor and C.R. Cloninger, Annu Rev Genet. 23, 19-36 (1989); K.R. Merikangas, Psychological Medicine 11-22 (1990)). Genetic contributions to susceptibility to alcoholism are supported by family, twin, and adoption studies. Goodwin, Arch Gen Psychiatry 36, 57-61 (1979); C.R. Cloninger et al., Arch Gen Psychiatry 38, 861-868 (1981); C.R. Cloninger, Science 236, 410-416 (1987)). A genetic component of vulnerability to drug abuse has also been suggested in both twin and adoption studies Cadoret et al., Arch Gen Psychiatry 43, 1131-1136 (1987); R.W. Pickens et al., Arch Gen Psychiatry 48, 19-28 (1991)).

A number of substances which share the potential for abuse by humans also share the ability to enhance do'amine activity in mesolimbic/mesocortical circuits thought to be important for behavioral reward and reinforcement Lippa et al., Pharmacol Biochem Behav. 1, 23-28 (1973); G. Di Chiara and A. Imperato, Proc Natl Acad Sci USA 85, 5274-5278 (1988); R.A. Wise and P.P. Rompre, Annu Rev Psychol. 40, 191-225 (1989)).

Cocaine's ability to inhibit re-uptake of dopamine, for example, points strongly toward a possible direct action for this highly-reinforcing drug in these dopaminergic circuits Ritz et al., Science 237, 1219-1223 (1987); D.E. Grigoriadis et al., J Neurosci.

9, 2664-2670 (1989)).

WO 93J/24628 PCT/US93/O5179 17 Blum, Noble and co-workers first reported that the "Al" TaqI restriction fragment length pol- morphism (RFLP) of the human dopamine D, receptor gene (DRD2, D.K. Grandy et al., Am J Hum Genet. 45, 778-785 (1989)) was associated with alcoholism Blum et al., JAMA 263, 2055-2060 (1990)); 69% of alcoholics displayed this RFLP compared to 20% of non-alcoholics. 42% of 504 caucasian alcoholic individuals repoxted in literature to date display this RFLP, while only 27% of 461 caucasian "control" individuals are Al positive Uhl et al., Arch Gen Psychiatry 49, 157-160 (1992); E. Turner et al., Biol Psychiatry 31, 285-290 (1991). These data come from eight previous studies, five of which find significant associations between RFLP and alcoholism, and provide evidence for a significant association between gene markers and behavior.

Examination of gene marker/behavior associations in drug abusers raises several methodological concerns.

Relatively few individuals who abuse drugs abstain from alcohol, and many individuals who use drugs often self-administer multiple substances Wesson et al., eds. Polydrua Abuse: The Results of a National Collaborative Study. New York, NY: Academic Press, Inc.; 1978). Drug-using populations may also differ from one another and from the general population in racial, ethnic and other features that might be associated with altered distributions of the alleles for different genes Gillmore et al., Am J Drug Alcohol Abuse 16, 185-206 (1990)). Also, some clinical assessments may not focus on the heritable features of the disorder Pickens et al., Arch Gen Psychiatry 48, 19-28 (1991)).

WO 3/24628 PC/US93/05179 18 A study of D 2 dopamine receptor gene markers in polysubstance users and control subjects provides a useful model for investigating the association between alleles of the DAT gene and substance abuse behaviors or other behavioral disorders such as Tourette's syndrome. We have investigated the 3' TaqI Al RFLP examined in previous studies of alcoholics, and a more TaqI RFLP located closer to regulatory and structural/coding regions of the gene Hauge et al., Genomics 10, 527-530 (1991)). Only caucasian individuals were included in this study because of evidence for different distributions of TagI A and B markers in white and black individuals (Dr Bruce O'Hara et al, unpublished data). Substance users were identified according to two approaches. One group of users met criteria fcr lifetime DSM-III-R (Diacnostic and Statistical Manual of Mental Disorders, Revised Third Edition. Washington, DC: American Psychiatric Association; 1987) psychoactive substance use disorder(s). A second group of users was identified based on their peak lifetime use of psychoactive substances. This quantity-frequency approach was chosen because of evidence that heavy use of alcohol may display significant heritability in males and females Pickens et al., Arch Gen Psychiatry 48, 19-28 (1991)). Control subjects were free of significant lifetime substance use.

i) Subject Recruitment: 288 Caucasian substance-using and control subjects were recruited from three sources; 21% were female. 224 drug-using and control volunteers consenting to research protocols at the Addiction Research Center (ARC) in Baltimore, Maryland were studied. The ARC is the major federal drug abuse WO 93/24628 I'us93 19 research facility that recruits through advertisement and word of mouth for participation in treatment and non-treatment studies. 12 volunteers from a chronic hemodialysis unit on the same campus, both users and controls, augmented this sample. A third group of users consisted of 52 HIV seronegative participants in an ongoing east Baltimore study of HIV infections in intravenous drug users Vlahov et al., Am J Epid.

132, 847-856 (1990)).

Each subject was individually interviewed to elicit informatioh characterizing substance use. 192 users and 56 controls were assessed according to a quantity-frequency approach. 137 users met criteria for DSM-III-R psychoactive substance use disorders. 97 users received both assessments. Written informed consent was obtained from all subjects.

Quantity-Frequency Approach: Trained interviewers assessed subjects with the Drug Use Survey (DUS) interview (see below) in a confidential setting. The amount, frequency, and/or dollar cost at the time of lifetime peak use were recorded for each of different psychoactive drugs or drug classes used more than five times. Blinded ratings of lifetime peak use of each individual substance were made on a four-point scale: 0=absent, 1=minimal, 2=moderate, or 3=heavy use as indicated in Table I. A composite "Total Use" index was constructed from the pooled ratings of use of all individual substances as follows: up to minimal use of alcohol, marijuana, or nicotine and no use of other drugs; moderate use of alcohol or nicotine and/or minimal use of other drugs; heavy use of alcohol or nicotine, moderate use of marijuana, and/or up to moderate use of other drugs; heavy use of any illicit drug. Thus, neither heavy use of alcohol WO 93/246,28 PCT/US93/05179 or nicotine was sufficient to confer a rating of heavy total drug use. Control subjects were identified as those individuals with Total Use scores of 0 or 1; substance abusers were individuals with Total Use scores of 2 or 3.

DSM-III-R Diagnoses: Trained interviewers administered the Diagnostic Interview Schedule Version III Revised (DIS-III-R, L.N. Robins et al.,NIMH Diagnostic Interview Schedule Version III Revised (Version 11/7/89). Department of Psychiatry, Washington University School of Medicine, St. Louis, MO.) to provide lifetime DSM-III-R diagnoses of psychoactive substance use disorders including nicotine and alcohol.

Reliability and Validity of Drug Use Information: Drug Use Survey (DUS) ratings were evaluated in subjects who were: assessed with the DUS on two different occasions at 3 to 13 months apart (b) tested for lifetime DSM-III-R psychoactive substance use disorders by the DIS-III-R 23 (n=18) and the Structured Clinical Interview for DSM-III-R (R.L.

Spitzer et al., Structured clinical interview for DSM-III-R patient version (with psychotic screen) SCID-P (W/Psychotic Screen) 5/1/89). Biometrics Research Department, New York State Psychiatric Institute, New York, New York)(SCID; n=17), and (c) checked for urinary excretion of psychoactive drugs and metabolites on the day of the DUS For the 18 DIS-III-R-assessed subjects and the 17 SCID-assessed subjects, DUS ratings were completed without knowledge of psychiatric assessment information. Genotypes were not available for 17 subjects assessed with the SCID and were not included in the genetic analyses.

WO 93/24628 PCF/US93/05179 21 Table I. Drug Use Survey Rating Criteria Substance Cigarettes 0 never smoked cigarettes 1 1 to 15 cigarettes per day 2 16 to 25 cigarettes per day 3 more than 25 cigarettes per day Alcohol 0 never used alcohol 1 up to 4 drinks per drinking occasion, fewer than 10 drinking occasions/month 2 up to 4 drinks per drinking occasion, more than 10 drinking occasions/month,

OR,

more than 4 drinks per drinking occasion, but fewer than 10 drinking occasions/month 3 5 or more drinks per drinking occasion, more than 10 drinking occasions/month Heroin; illicitly Other Opiates $100/day $100/day Cocaine $150/week); $150/week up to 7 $300/week, common) 0 never used heroin/other opiates 1 used 1 time/week or less than 2 2 to 6 times/week spending $30 to 3 daily use, typically spending 0 never used cocaine 1 less than 2 grams per week (up to typical use about 1 gram per month 2 2 to 4 grams per week (more than but less than $300/week) 3 more than 4 grams per week, usually to 10 grams/week; (more than usually much higher; daily use WO 93/24628 PCI/US93/05179 Marijuana 0 never used marijuana 1 up to one joint/day 2 2 to 3 joints per day 3 4 or more joints per day Minor Tranquilizers, 0 never used substance Amphetamines, 1 fewer than 1 use per week Barbiturates, 2 1 to 6 uses per week (4 to 24 uses/month) Hallucinogens, 3 7 or more uses/week (more than 24 Inhalants, PCP, uses/month) Antidepressants, Other Tobacco products, Other Substances WO 93/24628 PCT/US93/05179 23 ii) DNA Extraction and Analysis: Blood was obtained in EDTA-containing evacuated sterile tubes from each subject and stored at 4 0 C and/or frozen at -70 0 C in polypropylene tubes. DNA was extracted from non-frozen samples after initial isolation of nuclei and from frozen blood by selective white blood cell sedimentation followed by standard extraction methods Sambrook et al., eds. "Molecular cloning: a laboratory manual" (2Aid edition). Cold Spring Harbor (NY) Laboratory Press; 1989). 5-10 gg of this DNA was digested with TaaI as recommended by the manufacturer, or with 20-fold excess of this enzyme for several individuals displaying A3 alleles. DNA fragments were electrophoresed using 0.8% agarose gels containing ethidium bromide at 1-2 volts per centimeter for 16 hours, transferred to nylon membranes, and immobilized by UV crosslinking.

Hybridization was performed for 16-24 hours at 42 0

C

in 50% formamide, 5xSSC, 50 mM NaP04 (pH 1% SDS, 1mM EDTA, 2.5 x Denhardt's solution, 200 gg/ml herring sperm DNA, and 4X10 6 cpm/ml of radiolabelled DNA (see below). Washing for 20 minutes in 2XSSC at room temperature was followed by two 30 minute washes in 0.4 x SSC/0.5%SDS at 55 0 C. Washed blots were exposed to Kodak XAR film 1-6 days with an intensifying screen at 0 C. Band sizes were compared to X DNA molecular weight standards, and with patterns previously defined Blum et al., JAMA 263, 2055-2060 (1990); A.M. Bolos et al., JAMA 264, 3156-3160 (1990). After TaqI A RFLP status was determined, 32P decay allowed rehybridization of the same blots with hybridization probe for TagI B ascertainment. When background levels of radiation were not reached, filters were incubated at 65 0 C for 30 min in 2 mM TRIS (pH 1 mM EDTA, and WO 93/24628 PC1/US93/05179 24 0.1% SDS to remove residual hybridized probe. RFLP status was assigned by two independent raters unaware of the clinical status of the subjects.

iii) Hybridization probes: A 1.7 kb BamHI fragment of the human genomic clone encoding the dopamine D 2 receptor (AhD2G1) was subcloned into the BamHI site on bluescript SK+ to produce phD2-9, which was used to detect Al, A2, and A3 patterns in the Southern analyses, as described Blum et al., JAMA 263, 2055-2060 (1990); A.M. Bolos et al., JAMA 264, 3156-3160 (1990)) (Dr Bruce O'Hara et al, unpublished data). XhD2G2 was used to detect the TaqI "B" patterns. DNAs were radiolabelled using random priming and 32 P-CTP to specific activities of approximately 109 cpm/ig Feinberg and B Vogelstein, Anal Biochem.

137, 266-267 (1984)).

iv) Analyses: a) Association analyses: A two-tailed Pearson chi square test (with Yates' correction for continuity) was used to evaluate the association between Al RFLP presence and substance use/abuse; the same analysis were repeated for the B1 RFLP.

Association was first tested contrasting controls and substance users meeting criteria for any lifetime DSM-III-R substance dependence disorder.

Next, controls were contrasted with substance users who had been assessed with the DUS. Data for both groups of substance-using subjects were pooled and compared to RFLP frequencies for controls. b) Comparisons with other data: Pooled TaaI Al RFLP data from ARC users was compared with WO 93/24628 PCT/US93/05179 values obtained for caucasian controls in other studies.

c) Subtracting heavy alcohol users: DUS-assessed users free of heavy elcohol use were compareJ with controls to test whether the associations observed might be attributed solely to alcohol.

TaqI A and B RFLPs were assigned with 100% agreement between two independent raters.

Substance use assessment by means of the Drug Use Survey showed several features suggesting validity and reliability. For 31 subjects whose DUS was elicited twice, interrater reliability correlations for severity ratings ranged from 0.83 to 1.00 (median 0.94), while test-retest reliability correlations for individual drugs ranged from 0.53 to 0.94 (median 0.78). For subjects with DIS-III-R or SCID assessments and independent DUS ratinas, analysis of the correspondence between a positive lifetime DSM-III-R Substance Use diagnosis and moderate to heavy substance use on the ';US yielded a kappa value of 0.68 (91% agreement).

Finally, drugs tested as positive in urine drug screening were reported used 84% ot the time 56) in the DUS assessment.

TaqI A and B RFLP frequencies for sub'-ance-using and control subjects are presented in Table II. For the TaqI B1 RFLP, a significant association was found comparing users with at least one lifetime DIS-III-R Substance Use Disorder diagnosis and DUS-assessed controls (X 2 6.74, p 0.01). F-r the TaqI Al RFLP, analysis of the same groups revealed a significant association (X 2 3.98, p 0.05). Comparison of DUSassessed .sers to DUS-assessed controls revealed a significant association for the TagI B1 RFLP (XI 5.45, W%2) 93/24628 ['Cr/US93/05I 79 p 0.02) and a trend towards significant acsociation for the =jI Al RFLP (X 2 3. 14, p 0. 08) Table III presents TMI A and B genotypes (homozygotes and heterozygotes) for DUS-assessed controls and users.

Table 11. D. Dopamine Receptor Gene RFLPs in Users and Controls Group Al Present Cry) B1 Present M% 1. POLYSUBSTANCE USERS a) DSI4-III-R, Substance Use Diagnosis 41.8 (51/122) 34.4 (42/1 b) DUS* Heavy Use (Iotl Use=3) 36.0 (45/125) 29.6 (37/1 c) DUS Moderate Use (Total Use=2) 44.8 (30/67) 34.3 (23/6 d) DUS Total Use 2 3 Combined 40.8 (75/192) 31.3 (60/1 Combined Users@ 41.4 (96/232) 32.3 (7S/2 22) 7) 92) 32) II. CONTROLS a) DUS Minimal Use (Total Use=l) 30.0 (6/20) b) DUS Sparse Use (Total Use=0) 22.2 (8/36) Combined Controls 25.0 (14/56) 15.0 (3/20) 13.9 (5/36) 14.3 (8/56) 0 '0 4' Ch bi III. PREVIOUSLY REPORTED CONTROLS a) Blum et al, 15 (1990)* b) Blum et al, 36 (1991)* c) Comings et al, 35 (1991)* d) Parsian et al, 37 (1991)* e) Todd et al,+ (1991)* f) Bolos et al, 26 (1990) g) Comings et al, 35 (1991) h) Gelernter et al, 3 (1991) i) CEPH-Comings et al, 35 (1991) j) Grandy et al, 14 (1989) k) O'Hara et al," (1992) 16.7 19.4 15.0 12.0 32.6 33.9 23.9 35.3 17.3 37.2 29.7 (4/24) (6/31) (3/20) (3/25) (15/46) (21/62) (21/88) (24/68) (9/52) (16/43) (30/101) Combined Controls: Prior and current Reports subtotal 2' total 2 7.1 (152/560) 9 1 6 5 6 1 3 co DUS Drug Use Survey 'The subject total here (n=232 users) reflects 40 users who received only the DIS-III-R 82 users who -eceived the DIS-III-R and the DUS 110 users who received only the DUS.

Four subjects who received both the DIS-III-R and the DUS did not meet criteria for a DSM- III-R diagnosis but were classified as users (in the DUS and "Combined Users" comparisons) on the basis of their DUS ratings.

*Screened to exclude alcohol or drug abuse.

+Cited in Cloninger et al., JAMA 266, 1833 (1991). 4 Unpublished data.

Table III. D. Dopamine Receptor Gene RFLP Frequencies in Users and Controls DUS Heavy Use DUS Moderate Use DUS Minimal Use DUS Sparse Use GENOTYPE (Total Use=3) (Total Use=2) -(Total Use=l) -(Total Use=0) Al/Al 7/13- .538 4/13 .308 0/13 .000 2/13 .154 Al/A2 38/76 =.500 26/76 .342 6/76 .079 6/76 .079 A2/A2 80/159 =.503 37/159= .233 14/159= .088 28/159= .176 Bi/Bi 3/9 =.333 4/9 .444 0/9 .000 2/9 .222 B1/B2 34/59 .576 19/59 .322 3/-59 =.051 3/59 .051 B2/B2 88/180 =.489 44/180=~ .247 17/180= .094 31/180~= .172 4Denominator =total number of subjects with a given genotype (eg, Al/Al).

(n2

U!

IC~PI~RIWlll""~nsrssrrse~l~-- WO 93/24628 PCT/US93/05179 No significant differences in RFLP frequencies were found between DUS-assessed substance users and DIS-III-R-assessed users (for TaI Al, %2 0.005, ns; for TaI Bl, X 2 0.331, ns). We thus reanalyzed the data by pooling substance users assessed in both fashions for comparison with controls. Analysis of TaaI B1 data (X 2 6.31, p 0.02) and TagI Al data (X 2 4.46, p 0.04) again revealed significant associations.

Comparisons of TagI Al RFLP frequencies in ARC users and controls from all other published studies revealed significant associations when the controls were assessed (X 2 15.41, p 0.001), unassessed (X 2 9.31, p 0.003), or pooled (x 2 14.80, p 0.001).

To examine whether the effects noted could be attributed chiefly to the extent of alcohol intake, heavy alcohol users achieving DUS alcohol ratings of 3 were eliminated from the user group and reanalysis performed. Omitting heavy alcohol users did not significantly alter the elevated frequencies of the TagI B1 RFLP found in the user group. 32.3% of all polysubstance users and 32.9% of the 73 polysubstance users free of heavy alcohol use displayed the TaqI B1 marker.

The hypothesis that individual differences in substance abuse may be due, in part, to different dopamine D 2 receptor alleles marked by Taa I RFLPs at the gene's 3' and 5' ends arises from initial work in alcoholics Blum et al., JAMA 263, 2055-2060 (1990)). The hypothesis is r r! ?1~R)~II1I~Ca~-~9 r~r r WO 93/246,28 IPCr/US93/05179 31 strengthened by a compelling biological rationale for interactions between abused drugs and brain dopamine systems Di Chiara and A. Imperato, Proc Natl Acad Sci USA 85, 5274-5278 (1988); R.A.

Wise and P.P. Rcmpre, Annu Rev Psychol. 191-225 (1989)). In the current example, significant associations with heavy substance use or abuse were found consistently for the TaqI B1 RFLP and less consistently for the TaqI Al RFLP.

These findings provide preliminary evidence that a more 5' TaqI RFLP (Bl) may represent a better marker for a DRD2 gene variant possibly predisposing carriers to heavy substance use or abuse.

Selection of drug using and control populations provides opportunities for different approaches that could influence the results obtained. Many substance abusers use multiple psychoactive substances D.R. Wesson et al., eds. Polydrua Abuse: The Results of a National Collaborative Study. New York, NY: Academic Press, Inc.; 1978); 71% of the 192 DUS-assessed users in the current study reported moderate to heavy use of three or more different substances.

To reflect this fact, we first studied subjects who frequently use multiple drugs, attempted to characterize each drug used by each subject, and analyzed data on the basis of overall lifetime peak use. This approach might provide a weaker test of linkage if only a single abused substance displayed such genetic association. For example, if only alcohol abuse contributed to the WO 93/24628 PCT/US93/05179 32 associations noted here, we might anticipate a weaker association between B1 RFLPs and substance abuse if individuals with heavy alcohol consumption were eliminated from our sample. In fact, elimination of heavy alcohol users (DUS rating=3) resulted in no decrease in the differences between the remaining DUS-assessed drug-abusing and control individuals for the TaqI B RFLP.

The characterization of these subjects also raises important issues of assessment type, validity and reliability. Errors in clinical assessment would weaken tests of the allelic associationi hypothesis. In addition, studying behaviors that could contribute to features of clinical diagnosis but might not reflect the behavioral impact of a DRD2 gene variant could yield false-negative results.

We originally began work with the DUS, an interview-based assessment of substance use that enabled approximate quantification of peak lifetime use for several types of substances and appeared to provide an assessment of a basic feature of substance abuse: level of substance consumption. Psychiatric genetic work using classical methods suggests that heavy substance use can show substantial genetic determinants Pickens et al., Arch Gen Psychiatry 48, 19-28 (1991); C.R. Cloninger and T. Reich, In: Kety SS, Rowland LP, Sidman RL, Matthysse SW, eds. Genetics of neurological and psychiatric disorders. New York, NY: Raven Press: 1983; pp.

WO 93/24628 PCIr/US93/05179 33 145-166). Reliability and validity of the quantity-frequency approach to subjects' drug use were supported by the correlations between drug use assessments made on two occasions, assessments made with multiple instruments, and correlations with results of urine drug screens.

Howe' several individuals who reported heavy us' ious drugs did not fulfill criteria for DSM-III-R diagnoses of dependence or abuse on SCID or DIS-III-R assessments of the same drugs Smith et al., "Validation of an instrument for quantifying drug use self-report: The ARC Drug Use Scale". Presented at the 53rd Annual Scientific Meeting, The Committee on Problems of Drug Dependence, June 16-20, 1991, Palm Beach,

FL).

We also evaluated subjects by determining lifetime psychiatric diagnoses of psychoactive substance use disorders using a structured psychiatric interview, the DIS-III-R, which can also demonstrate reliability and validity (J.E.

Helzer et al., Arch Gen Psychiatry 42, 657-666 (1985); N. Oskooilar et al., DIS Newsletter 8, 9- (1991)).

Comparison of TagI A and B RFLP frequencies in substance-using subjects failed to indicate significant differences between the quantityfrequency and psychiatric diagnosis approaches.

These results suggested that we could combine subjects meeting criteria for DSM-III-R Substance Use diagnsoses with subjects reporting moderate to heavy drug use. It is still conceivable, MMMMMMMMI WO 93/24628 PCT/US93/05179 34 however, that behavioral effects of a gene might be differentially reflected in quantity/frequency or in disease/disorder approaches to defining the affected group.

The RFLPs studied here are the result of polymorphic TaqI restriction sites in which "A" RFLJz are located ca. 9 kb 3' to the final exon of 'he D 2 receptor gene Civelli, personal communication) and RFLPs are located near the first coding exon Hauge et al., Genomics 527-530 (1991)). These polymorphisms could have functional relevance if base pair differences directly influenced the gene's regulation. Alternatively, they could provide markers for structural or regulatory changes in other regions of the gene if these other changes and the TaqI variations were maintained together by linkage disequilibrium resulting in specific haplotypes Uhl et al., Arch Gen Psychiatry 49, 157-160 (1992)). This linkage disequilibrium does exist Hauge et al., Genomics 10, 527- 530 (1991); Dr. Bruce O'Hara et al, unpublished data). In our data, for example, the expected frequency of the A2/A2-B2/B2 haplotype would be 43% based on the frequencies of the A2 and B2 allelic markers. However, the observed frequency of this haplotype was 61% (X 2 16.33, p 0.0001) (76% for controls and 57% for users, X 2 5.15, p 0.03), indicating substantial linkage disequilibrium.

The lack of strong association between D 2 receptor gene RFLPs and substance use evident in I II WO 9)3/24628 PCT/US93/05179 this study is consistent with estimates of the heritable components of alcoholism and drug abuse Devor and C.R. Cloninger, Annu Rev Genet.

23, 19-36 (1989).; R.J. Cadoret et al., Arch Gen Psychiatry 43, 1131-1136 (1987)). One recent study of concordance rates for alcoholism in twin populations suggests that between 20 and 30% of the vulnerability to abuse or dependence on this substance may be genetic in origin Pickens et al., Arch Gen Psychiatry 48, 19-28 (1991)).

Attempts to link familial alcohol susceptibility to specific chromosomal markers and patterns of inheritance in families have not been consistent with a single genetic locus (S.B Gilligan et al., Genet Epidemiol. 4, 395-414 (1987); C.E. Aston and S.Y. Hill, Am J Hum Genet. 46, 879-887 (1990)). The strong association between a single gene RFLP and alcoholism found by Blum et al. (K.

Blum et al., JAMA 263, 2055-2060 (1990)) would thus fit poorly with this extent of heritability.

The large environmental influences on expression of alcoholism, and their study of unrelated individuals rather than defined pedigrees also make the strength of their findings surprising.

To investigate the association between the DAT gene and substance abuse behaviors, one can make use of the variable number tandem repeat (VNTR) at the 3'-end of the mRNA described in example 1. Alternatively the TaqI RFLP described in example 2 could be utilized. In general, examination of VNTR markers is preferred, as such markers have a larger number of alleles and hence I; i I, WO 93/24628 PCT/US93/05179 36 are "more informative", i.e. VNTR markers identify more subtypes than a regular "site-no site" RFLP marker. The same methodology described above for the study of the D2 dopamine receptor gene can be employed. As shown above, particular attention must be paid to the diagnostic criteria for identifying the abuse behavior if the results are to be meaningful.

To assess frequencies of the VNTR, DNA is obtained from leukocytes from research volunteers as described above. Genomic DNA (40 ng) is subjected to 35 cycles of amplification using AmpliTaq DNA Polymerase (1.25 U) and polymerase chain reaction with denaturing for 1 min at 93 0

C,

and annealing/extension for 1 min at 72 0 C in buffer supplied by the manufacturer (Perkin- Elmer). Oligonucleotides T3-5LONG TGTGGTGTAGGGAACGGCCTGAG-3', SEQ. ID. NO. 4) and T7-3aLONG (5'-CTTCCTGGAGGTCACGGCTCAAGG-3', SEQ.

ID. NO. 5) are used at 0.5 uM final concentration. Reaction products are separated by 5% polyacrylamide gel electrophoresis, and product sizes estimated by comparison to molecular weight standards (BRL).

242 of the 254 chromosomes examined displayed either 9 or 10 copies of the basepair repeat. Two chromcsomes showed three copies, two showed 5 copies, three showed 7, four showed 8 and one showed 11 copies of the VNTR.

Among individuals with 9 and/or 10 copies per chromosome there were racial differences in copy number frequencies. Whites displayed 30% and I I 'WO 93/24628 PCI/US93/05179 37 Blacks displayed 20% of the 9-copy variant. The 3' VNTR marker defined by 9 versus 10 copies of the 40 basepair repeat displayed no significant linkage disequilibrium with the more 5' TaqI RFLP

(X

2 values were 5.51 and 4.62 for White and Black subjects, respectively, with 8 degrees of freedom, p 0.1.) Example 4 (predictive) Expression of HUDAT protein in Escherichia coli and purification of the bacterially expressed protein Any of several expression systems can be utilized to obtain HUDAT protein expression in E.

coli. For example, the plasmid vector pFLAG system (International Biotechnologies, Inc., New Haven, CT) produces the polypeptide of interest attached to a short protein sequence that allows purification of the fusion protein by use of a monoclonal antibody directed against a hydrophilic, and thus surface localized, octapeptide. -he open reading frame midportion of the HUDAT cDNA is obtained by digestion of the pHCDAT7 plasmid with EcoRI and purification of the insert fragment encoding the HUDAT protein by electrophoresis and elution from an agarose gel by standard techniques. Oligonucleotides having the sequences 5'-GGGTCTAGACG-3' and AATTCGTCTAGACCC-3' are annealed to form an adaptor and the adaptor is ligated to the ends of the insert DNA. The ligation product is digested with XbaI and cloned into the XbaI restriction I I WO 93/24628 PCI/US93/05179 38 site of the pFLAG vector (International Biotechnologies, Inc.). The appropriate E. coli host is transformed and colonies containing the HUDAT cDNA may be screened by colony hybridization using the pcHUDAT as probe.

Positive clones are grown as large-scale cultures and the fusion protein is obtained in pure form by use of the monoclonal antibody affinity column as iescribed by the manufacturer of the system, except that the elution buffer is modified by the addition of 0.5% CHAPS (3-[(3-Cholamidopropyl)dimethylammonio] 1-propane-sulfonate). Authentic DAT protein lacking the FLAG octapeptide is obtained by enterokinase cleavage of the fusion protein as described by the supplier of the FLAG system.

Example 5 (predictive) Purification of DAT from tissues or from transformed mammalian cells.

As protein isolated from transformed bacterial cells lacks post-translational modifications, such as sugar additions, that occur in mammalian cells, the purification of the protein from tranformed COS cells is discussed.

1'OS cells transformed as described in (S.

Shimada et al., Science 254, 576 (1991)) are subjected to a purification protocol as described for the purification of the GABA transporter (Radian, et al., J. Biol. Chem. 261, 15437-15441 (1987) with the modification that binding of labelled CFT is used to assay for the presence of

I

WO 93/24628 PCF/US93/05179 39 DAT in t.,e sample rather than labelled gammaamino butyric acid. The protocol is modified as required to allow the isolation of DAT as a distinct protein by techniques known tr a practitioner of the art.

Example 5 (predictive) Diagnosis of deficiency, mutant or overtxpression of dopamine transporter by PCR mRNA obtained from tissue biopsy from a patient is converted subjected to quantitative reverse-transcript PCR (for example, see A. M.

Wang, et al. PNAS USA 86:9717 (1989)) utilizing as primers oligonucleotides derived froJn the cDNA sequence of pcHUDAT. Use of the 5' 19-mer, GCTCCGTGGACTCATGTCTTC, bases 118 through 139 of Fig. 2 (SEQ. I.D. NO. 1) as the upstream primer and CACCTTGAGCCAGTGGCGG, the reverse complement of bases 1942 to 1960 of Fig. 1 (SEQ. I.D. NO. 1) as the downstream primer allows examination of the character of the protein coding region of the HUDAT mRNA. Variance in the expression lev-l can be ascertained by comparison of product yield with a normal control. 21norme.l mRNA structures can be diagnosed by observacion of a product band of a length different from the normal control.

Point mutants can be observed by use of primers and conditions appropriate for detection of the mismatch between the mutant and normal alleles.

For example, the "reverse dot blot" procedure for screening the expression of several mutant I; I WO 93/24028 PCI/US93/0$179 alleles in a single experiment, which has been described for the CFTR gene, mutants of which cause -vsi. fibrosis (Erlich, et al Science z.1;:1643 (1991).

The HUDAT mRNA also contains a variable number tandem repeat element in the 3' untranslated portion of the mRNA which can be amplified for examination of an association between specific VNTR alleles and substance abuse behavior or diseases associated with expression of particular HUDAT alleles (See example 3).

Example 7 (predictive) Use of dopamine transporter expression to incorporate as part of overexpression of a panel of dopaminercic genes to reconstruct a dopaminerqic cell line for therapy in human diseases resulting from defective dopamine transporter expression.

cDNAs for the human dopamine transporter, and for tyrosine hydroxylase and aromatic ammino acid decarboxylase (DOPA decarboxylase) are transfected into cell types including COS cells as described above. Cells are cotransfected with the neomycin resistance marker, selected by growth in G418, and then tested for their ability to synthesize and accumulate dopamine.

Individual subclones may be able to take up dopamine, without the ability to synthesize it.

However, individual subclones are also likely to WO 93/24628 PC'/US93/05179 41 integrate several of the plasmids. If the plasmids cannot be introduced serially or together in this direction, seril 1 edition of tyrosine hydroxylase and DOPA decarboxylase to stable cell lines already expressing the dopamine transporter stably should be employed (see above). The ability of cells to incorporate tritiated tyrosine into tritiated dopamine is tested via HPLC analysis and radiochemical detection as described (Uhl et al., Molecular Brain Research, 1991), their ability to take up tritiated dopamine is performed as described in the same reference.

These same procedures are used in transfecting cells obtained from an individual with a disease state caused by defects in dopamine transporter expression, either in the amount expressed or due to expression of a defective protein, so that stable immortalized cell lines expressing human dopamine transporter could be constructed with immunologic identity to the patient. Means of controlling the replication of these cells by encapsulating them in a matrix that is not porous to cell bodies, but able to be permeated by cell processes, or by use of inhibitory growth factors, can also be employed. A third strategy, temperature sensitive cell mutants that would not divide under physiologic temperatures temperature sensitive COS cells variants) could be used to be able to express the dopaminergic cDNA stably, in a fashion that would produce dopaminergic cells.

WO 93/24628 PCT/US93/05179 42 Each of these cell types are potential candidates for use in transplantation into striatum in individuals with striatal dopamine depletion in Parkinson's disease. Alternatively, genes could be incorporated with retroviral vectors as wellknown for practitioners of the art.

Example 8 (predictive) Production of variant sequences in HUDAT protein and testing of their biological function Site directed mutagenesis using olgonucleotides is used to introduce specific single- and multiple-base changes into the HUDAT cDNA that change specific amino acids in the HUDAT protein. The ability of mutant transporters to take up [3H] dopamine, 3

H]

MPP+,and to bind [3H] cocaine and cocaine analogues (especially 3 H] CFT) is tested as described previously Shimada et al., Science 254, 576 (1991)). The Amersham mutagenesis system (version 2.1, technical bulletin code RPN1523) can be used. Initial studies of mutants of the aspartic acid residue in transmembrane domain 1, and the serine residues in transmembrane domain 7 of the rat DAT protein have revealed substantial effects on dopamine transport, and more modest effects on cocaine binding. These results document that the residues key to dopamine transport are not identical to those crucial to cocaine binding; the first transmembrane residue change of aspartic acid (residue 79) to glycine reduces I I I WO 93/24628 PCT/US93/05179 43 cocaine binding by 10%, but reduces dopamine transport by over 95%. Mutations in the second extracellular domain in glycosylation sites help elucidate the role of glycosylation in the functions of this molecule (See also Example 9).

Selective removal of the N and C terminal intracellular and second extracellular loop, and production of chimeric molecules with replacement of these regions with the corresponding regions of the GABA transporter further confirm the molecular features of DAT that are essential for dopamine transport and cocaine binding and allow development of agents dissociating the two processes.

Example 9 (predictive) Alteration of carbohydrate structure in the extracellular domain of the HUDAT protein As noted in example 1, the largest difference in the structure of the proteins predicted by the human and the rat dopamine transporter dDNA sequences is the absence of one of the four consensus sites for N-linked glycosylation of the protein (See figure By virtue of their location in the same domain of the protein expected to most influence substrate binding, that is in the extracellular portion of the protein, it is of interest to investigate the contribution of the sugars to substrate binding.

Site directed mutagaenesis can be performed as described for Example 8 introduce into the human DAT cDNA the asparagine residues to which N- WO 93/24628 IPCT/US93/05179 44 linked sugars are attached and the remaining amino acids which constitute the glycosylation signal for that site that are found in the rat, but not the human cDNA. The result of expression of such mutant proteins can be evaluated by photo-affinity labelling of the protein and analysis by SDS-PAGE. Digestion of the protein with various glycosidases can be performed to assess the degree to which the pattern of glycosylation has been altered, as described by Lew et al. Lew et al., Brain Research 539, 239 (1991)). For instance, compararison of the wild-type and mutant protein, both untreated and digested with N-glycanase, would should show similar sized proteins for the digested protein, but a larger protein for the untreated mutant, compared to the untreated wild-type protein if the introduction of the asparagine glycosylation signal resulted in successful incorporation of sugar into the protein at that site. More detailed information regarding the sugar structure can be obtained by exoglycosidase digestion experiments. For example, the presence of sialic acid residues in the polysaccharide can be detected by digestion with neuraminidase. The influence of the polysaccarhide structure on function of the protein is then assessed by testing the properties of the the transporter using either stably transfected cells expressing the mutant protein, or by using cells transiently expressing the mutant transporter on their surface. The means for carrying out such WO 93/24628 PCT/US93/05179 functional studies are described by Shimada et al. Shimada et al., Science 254, 576 (1991)).

Example 10 (predict- e) Cell lines expressing HUDAT protein on the cell surface can be used to screen candidate compounds for efficacy as dopamine (or cocaine or functional analogs thereof) agonists or antagonist, evaluating the influence of the candidate compound upon the binding of dopamine (or cocaine or functional analogs thereof) to the surface of such cells. Another assay for dopamine agonist or antagonist activity is to measure the cytotoxicity to such cells of MPP+ to such cells in the presence and absence of the candidate compound. Such assays are described using cells expressing the rat DAT cDNA in Shimada et al. Shimada et al., Science 254, 576 (1991)) and can be applied as well to cells expressing the human DAT cDNA.

Example 11 (predictive) Production of antibodies to HUDAT and use of same in a diacnostic test for dopaminercic cell death.

A. Production of polyclonal antibodies.

HUDAT protein obtained as described above or synthetic polypeptides of amino acid sequence derived from the HUDAT sequence are used as immunogens in an appropriate animal. The serum is obtained from the immunized animal and either WO 93/24628 PCT/US93/05179 46 utilized directly or the antibody may be purified from the serum by any commonly utilized techniques. Polyclonal antibody directed only toward HUDAT can be isolated by use of an affinity column derivatized with the immunogen utilized to raise the antibody, again using techniques familiar to one knowledgable in the art.

B. Production of monoclonal antibodies to HUDAT Monoclonal antibodies to HUDAT or to particular epitopes of HUDAT may be produced by immunization of an appropriate animal with HUDAT protein obtained as above or with peptides of amino acid sequence derived from the HUDAT amino acid sequence. Hybridoma cultures are then established from spleen cells as described by Jaffe and McMahon-Pratt (Jaffe, C.L. and MacMahon-Pratt, D. J. Immunol. 131, 1987-1993 (1983)). Alternatively, peripheral blood lymphocytes may be isolated and immortalized by transformation with Epstein-Barr viris. These cells produce monoclonal antibodies, but if desired, hybridomas can then be made from the transformed lymphocytes (Yamaguchi, H. et al.

Proc. Natl. Acad. Sci. 84, 2416-2420 (1987)).

Cell lines producing anti-HUDAT antibodies are identified by commonly employed screening techniques. Monoclonal antibody is then purified by well known techniques from the supernatants of large-scale cultures of the antibody producing cells.

WO 93/24628 PCT/US93/05179 47 C. Diagnosis of dopaminergic cell death in vivo by immunoassay of cerebrospinal fluid of a patient using anti-HUDAT antibodies.

The death of dopaminergic neurons in the brain of a patient should result in the accumulation in the cerebrospinal fluid, which bathes these cells, of membrane debris as a product of lysis of the dead cells. Other pathologic conditions, short of cell death that result in the release of DAT protein, or degraded peptide fragments of HUDAT protein into the surrounding medium can also be imagined. The cerebospinal fluid can be sampled by lumbar puncture of a patient. The presence of degradation products of HUDAT protein is detected by immunoassay, using as the primary antibody at least one of the products obtained as described above. Elevated levels of HUDAT protein detected in the cerebrospinal fluid, compared with the range seen in normal controls is indicative of Parkinsons's disease or drug-induced neurotoxicity. Alternatively, disease progression can be monitored by the assessment of HUDAT levels in serial samples from the same patient.

~II

WO 93/24628 PCT/US93/05179 48 SEQUENCE LISTING GENERAL INFORMATION: APPLICANT: UT' George R.

Vandenbergh, David Perzico, Antonio (ii) TITLE OF INVENTION: Sequence of Human Dopamine Trans'porter (iii) NUMBER OF SEQUENCES: (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: Birch, Stewart, Kolasch Birch STREET: 301 N. Washington St.

CITY: Falls Church STATE: Virginia COUNTRY: USA ZIP: 22046-3487 COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: PatentIn Release Version #1.25 (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: FILING DATE:

CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION: NAME: Murphy Jr., Gerald M.

REGISTRATION NUMBER: 28,977 I I L l a WO 93/24628 WO 9324628PCT/US93/051 79 49 (ix) TELECOMMUNICATION INFORMATION: TELEPHONE: 703-241-1300 TELEFAX: 703-241-2848 TELEX: 248345 INFORMATION FOR SEQ ID NO:1: Wi SEQUENCE CHARACTERISTICS: LENGTH: 3919 base pairs TYPE: nucleic acid STRAflDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (vi) ORIGINAL SOURCE: ORGANISM: Homo sapiens TISSUE TYPE: brainstem (ix) FEATURE: NAME/KEY: CDS LOCATION: 102.. 1961 OTHER 11NFORMATION: /function= "dopamnine transport" /product= 11HUDAT polypeptide" (ix) FEATURE: NAME/KEY: misc RNA LOCATION: 2724. .3117 OTHER INFORMATION: /function= "unlknown" /label= VINTR-region WO 93/ 24628 PCrI/US93/051 79 (xi) SEQUENCE DESCRIPTIONi SEQ ID NO:i: GAATTGCCGC TGTCGGGCG AGGAGTCGCG TGCAAAGCCC AGGCCGGGC GGCCAGACGA AGAGGGAAGA AGGACAGAAT TGGTGAACTC CCAGTGTGCG C ATG AGT A: 1 AGC Met Scr Lys Ser

I

AAA TGC TCG GTG GGA CTC ATG TGT TCG GTG GTG Lys Cys Ser Val Gly Met Ser Ser Val Val.

i5 GGC CCG GCT AAG GAG Ala Pro Ala Lys Giu CCC AAT GCG GTG GGC CGG AAG GAG Pro Asn Ala Val Gly Pro Lys Glu GAG AAC GGA GTG GAG GTC AGC AGG Gin Asn Gly Val. Gin Leu Thr Ser GTG GAG Val Glu 30 CTC ATC CTT GTC AACJ GAG Lu Ile Leu Val. Lys Giu 209 ACC CTC AGG AAG Thr Leu Thr Asn CCG GGG GAG Pro Arg Gin AAG ATC GAG Lys Ile Asp AGC CCC GTG GAG GCC GAG GAT GG GAG AGG TGG GGG Ser Pro Val Glu Ala Gin Asp Arg Giu Thr Trp Gly TTT GTG Phe Leu GTG TGG GTG ATT GGG TTT GGT GTG GAG Leu Ser Val. Ile Gly Phe Aia Vai Asp GGG AAG GTG TGG Ala Asn Vai Trp CGG TTG GGG TAG GTG TGG TAG AAA AAT GGT GGG GGT GGG TTG Arg Phe Pro Tyr Leu Gys Tyr Lys Asn Gly Gly Gly Ala Phe GTG GTG Leu Val 100 GGG TAG GTG GTG Pro Tyr Leu Leu

TTG

Phe 105 ATG GTG ATT GGT GGG ATG GGA GTT TTG TAG ATG Met Val Ile Ala Gly Met Pro Leu Phe Tyr Met GAG GTG GGG Giu Leu Ala

GTG

120 GGG GAG TTG AAG Gly Gin Phe Asn GAA GGG GGG GGT Glu Gly Ala Ala GGT GTG TGG Giy Val. Trp 130 i, WO 93/24628 WO 9324628PCI'/US93/051 79 AAG ATC Lys Ile TCA CTG Ser Leu 150 TGC CCC Cys Pro 135 ATA CTG Ile Leu AAA GGT Lys Gly 140 GTG GGC TTC Val Gly Phe ACG GTC Thr Val 145 ATC CTC ATC Ile Leu Ile TAT GTC GGC TTC Tyr Val Gly Phe TAC AAC GTC ATC Tyr Asn Val Ile GCC TGG GCG CTG Ala Trp Ala Leu

CAC

His 165 TAT CTC TTC TCC Tyr Leu Phe Ser TTC ACC ACG GAG Phe Thr Thr Glu CCC TGG ATC CAC Pro Trp Ile His AAC AAC TCC TGG Asn Asn Ser Trp

AAC

Asn 185 AGC CCC AAC TGC Ser Pro Asn Cys GAT GCC CAT CCT Asp Ala His Pro GGT GAC Gly Asp 195 TCC AGT GGA Ser Ser Gly GCT GCC GAG Ala Ala Glu 215

GAC

Asp 200 AGC TCG GGC CTC Ser Ser Gly Leu GAC ACT TTT GGG Asp Thr Phe Gly ACC ACA CCT Thr Thr Pro 210 CAG AGC CAT Gin Ser His 737 785 TAC TTT GAA CGT Tyr Phe Glu Arg GTG CTG CAC CTC Val Leu His Leu GGC ATC Gly Ile 230 GACG AC CTG GGG Asp Asp Leu Gly CCG CGG TGG CAG Pro Arg Trp Gin

CTC

Leu 240 ACA GCC TGC CTG Thr Ala Cys Leu CTG GTC ATC GTG Leu Val Ile Val CTC TAC TTC AGC Leu Tyr Phe Ser

CTC

Leu 255 TGG AAG GGC GTG AAG Trp Lys Gly Val Lys 260 ACC TCA GGG AAG Thr Ser Gly Lys GTA TGG ATC ACA GCC ACC ATG CCA TAC Val Trp Ile Thr Ala Thr Met Pro Tyr 270 GTG GTC Vai Val 275 WO 93/24628 93242 /US93/05179 CTC ACT GCC CTG CTC CTG CGT GGG GTC ACC CTC CCT GGA Thr Len Pro Gly Leu Thr Ala GGC ATC AGA Gly Ile Arg 295 Leu Len Arg Gly

GCC

Ala 290 ATA GAC Ile Asp GCA TAC CTG AGC Ala Tyr Leu Ser

GTT

Val 300 GAC TTC TAC CGG Asp Phe Tyr Arg CTC TGC GAG GCG Leu Cys Giu Ala 305 TCC CTG GGC GTG Ser Leu Gl.y Val 1025 TCT GTT Ser Val 310 TGG ATT GAC GCG Trp Ile Asp Ala

GCC

Ala 315 ACC CAG GTG TGC Thr Gin Val Cys

GGG

Gly 325

AAC

Asn TTC GGG GTG C.TG Phe Gly Val Len TGC TAC AGG GAC Cys Tyr Arg Asp 345

ATC

Itle 330 GCC TTC TCC AGC Ala Phe Ser Ser AAC AAG TTC ACC Asn Lys Phe Thr

AAC

Asn 340 1073 1121 1169 GCG ATT GTC ACC Ala Ile \'1l Thr TCC ATC AAC TCC Ser Ile Asn Ser CTG ACG Leu Thr 355 AGC TTC TCC Ser Phe Ser CAG AAG CAC Gin Lys His 375 GGC TTC GTC GTC Gly Phe Val Val TCC TTC CTG GGG Ser Phe Leu Giy TAC ATG GCA Tyr Met Ala 370 GGG CCA GGG Gly Pro Gly 1217 1265 AGT GTG CCC ATC Ser Val Pro Ile GAC GTG GCC AAG Asp Val Ala Lys CTG ATC Len Ile 390 TTC ATC ATC TAC CCG GAP'. GCC ATC GCC Phe Ile Ile Tyr Pro Gin Ala Ile Ala 395 CTC CCT CTG TCC Leu Pro Len Ser 1323 1361 TCA Ser 405 GCC TGG GCC GTG GTC TTC TTC ATC ATO Ala Trp Ala Vai Vai Phe Phe Ile Met 410

CTG

Len 415 CTC ACC CTG GGT Len Thr Len Gly WO 93/24628 WO 9324628PCT/US93/051 79 GAC AGC GCC ATG GGT GO-T ATG GAG TCA GTG ATC ACC GGG CTC ATC GAT 1409 Asp Ser Ala GAG TTC CAG Giu Phe Gin GTC CTG GCG Val Leu Ala 455 M~et Gly 425 CTG CTG Leu Leu 440 Gly Met Glu Ser Val Ile 430 Thr Gly Letu Ile Asp 435 CAC AGA CAC His Arg His

CGT

Arg 445 GAG CTC TTC ACG Giu Leu Phe Thr CTC TTC ATC Leu Phe Ile 450 AAC GGT GGC Asn Gly Gly 1457 1505 ACC TTC CTC CTG Thr Phe Leu Leu

TCC

Ser 460 CTG TTC TGC GTC Leu Phe Cys Vai

ACC

Thr 465 ATC TAC Ile Tyr 470 GTC TTC ACG CTC Val Phe Thr Leu GAC CAT TTT GCA Asp His Phe Ala

GCC

Ala 480 GGC ACG TCC ATC Gly Thr Ser Ile 1553 ("PC TTT GGA GTG CTC ATC GAA GCC ATC GGA nTG GCC TGG TTC TAT Phe Gly Vai Leu Ile Giu Ala Ile Gly 1 Ala Trp Phe Tyir 490 1 1601 (ATT GGG CAG TTC Val Gly Gin Phe

AGC

S er 505 GAC GAC ATC CAG Asp Asp Ile Gin

CAG

Gin 510 ATG ACC GGG CAG Met Thr Gly Gin CGG CCC Arg Pro 515 1649 AGC CTG TAC Ser Leu Tyr CTG TTC GTG Leu Phe Val 535 CGG CTG TGC TGG Arg Leu Cys Trp CTG GTC AGC CCC Leu Val Ser Pro TGC TTT CTC Cys Phe Leu 530 CCC CAC TAC Pro His Tyr 1697 1745 GTC GTG GTC AGC Val Val Val Ser CrG ACC TTC AGA Val Thi: Phe Arg GGA GCC Gly Ala 550 TAC ATC Tyr Ile TTC CCC GAC Phe Pro Asp 555 TGG GCC AAC GCG Trp Ala Asn Ala CTG GGC TGG GTC ATC Leu Gly Trp Val Ile 560 1797 WO 93/24628 WO 9324628PCT/US93/0S179 GCC ACA Ala Thr 565 TGC AGC Cys Ser CCC GAG Pro Glu TCC TCC ATG Ser Ser Met CTG CCT GGG Leu Pro Gly 585 AAG GAC CGT Lys Asp Arg 600 ATG GTG CCC ATC Met Val Pro Ile GCG GCC TAC AAG Ala Ala Tyr Lys

TTC

Phe 580

GCA

Ala TTT CGA GAG Phe Arg Glu GCC TAC GCC Ala Tyr Ala ACG CTC CGC CAC TGG Thr Leu Arg His Trp 615 GTCATCCTGC AATGGGAG~ GAG CTG GTG GAC AGA GGG GAG GTG CGC CAG TTC Glu Leu Val Asp Arg Gly Glu Val Arg Gin Phe 605 610 CTC AAG GTG TAGAGGGAGC AGAGACGAAG ACCCCAGGAA Leu Lys Val 620 LACACGAACAA ACCAAGGAAA TCTAAGTTTC GAGAGAAAGG

AGGGCAACTT

CTCTTCTGAC

TGTAATAACG

AAAAACGTCT

GGCTCTGAGG

GCACCTGCTG

TAAAAAGCCA

AATTCATGC.N

CAGTTGACAC

GTCTCACCAG

CTACTCTTCA ACCTCTACTG TGTTTACACC TTTCCGTGCC ACGTAGATCT GTGCAGCGAG AACTTCATGC TGTCTGTGTG CTGCCCCAGG GGCACTGTGT AGAATCCCCG TGCTCACAGT AGTGTCCTGC TTGGTTTAGC AAGTCCTTTC CCGATGCGTG AT'TGCACACA CAGTCTGTTC GAAATTCTGT TTATGTTCTT

AAAACACAAA

GGGAGCGCAC

GTCCACCCCG

AGGCTCCCTC

TCTCAGGCGG

AGCTTCCTAG

TGTGCAGAAG

GCTCCCAGCA

AGAGGCATTG

GCAGCAGAGA

CAACAAAGCA

CTCGCCGTGT

TTGTTGTCCC

CCTCCCTGCT

GGATCACGAT

ACCATTTACT

GTGAAATGGA

GAGGCCGTAA

GAGGATGGGG

GAAPLTAAAAC

GAAGACTCCT

CTTGTGTTGC

TGCAGGGCAG

CCCTGCTCCC

CCTTGTAGAC

TTGCCCATAT

GGAAACCACA

ATTGAGCGTT

GTCCTGGTAT

TCCTTGAAAC

1841 1889 1937 1991 2051 2111 2171 2231 2291 2351 2411 2471 2531 2591 2651 WO 93/24628 P'CT/ US93/O5 179 CAGCTCAGGC TACTGCCACT CAGGCAGCCT GTGGGTCCTT GTGGTGTAGG GAACGGCCTG

AGAGGAGCGT

CGGACGCATG

ACAGGAGCGT

AGGACGCATG

ACAGGAGCGT

ACCCCAGGAC

CCCCCACAGG

AGACCAACAC

TATTTCTCTC

TTAAAATCAT

CTTGCTGATA

GGCCAAAAGC

TAGTTTGAAT

CGTGCAGGGC

TAATGCTCGG

ATGGCTTCCC

GCCGCTGCAG

ACAGTTTCCC

GTCCTATCCC

CAGGGCCCCC

GTACTACCCC

CAGGGCCCCC

GTCCTATCCC

GCATGCAGGG

AGCGTGTACT

TCTGCCTGGC

AGGTGCGTGC

ATTTACCTGT

TTGCAGTTTT

TGCTTTCCAT

TCATGCCTCA

CAGTCATGGC

TGGGAGCCGT

CATTGCCTTC

TCAGCACAGA

CATCGCCTTC

CGGACGCATG

ACAGGAGCAT

AGAACGCATG

ACTGGAGCGT

CGGACCGGAC

CCCCCACAGG

ACCCCAGGAC

CTTGAGCCGT

CACATCAATA

GAATCAAAAC

TGTTTACAAG

GGCACACTGC

AGTCGGTGGG

TGTCCCCTGC

CAGCCTGTGA

TGGGGAGGGA

GAGCGGCTTC

TGGTTGTTGA

CAGGGCCCCC

GTCCTATCCC

CAGGGCCCCC

GTACTACCCC

GCATGCAGGG

AGCGTGTACT

GCATGCAGGG

GACCTCCAGG

ACAACAGTTT

AAATTCAAGA

AATAATTAGC

CCTCTGCCAC

CCTGCCTACG

AAGTGGACGT

ACTGCCAGGC

CACAGAGGAC

CCCATTGCCT

AGACAGCACA

ACAGGAGCGT

TGGACGCATG

ACAGGAGCGT

AGGACGCATG

CCCCCACAGG

ACCCCAGGAT

CCCCCATGCA

AAGGGACCCC

TTATGTn4TGC

ATGCAGTATC

AATACTGAGT

TGACAGGAAA

TGCIGCCCGA

GGGCTCCAGG

AGCTGCAGTT

GGCTTCCCCA

TCTGGGGAGG

GAGAGCGGCT

GTCCTATCCC

CAGGGCCCCC

GTACTACCCC

CAGGGCCCCC

AGCGTGTACT

GCATGCAGGG

GGCAGCCTGC

ACTGGAATTT

GAATGGCTTT

CGCGAGCCTG

GAAGGATGTT

GTGGATGCCA

GGGCAGGGGC

GACTGGAGTG

AGCACAGAGG

TCGCCTTCTG

GACACAGAGG

TCCCCATCGC

2711 2771 2831 2891 2951 3011 3071 3131 3191 3251 3311 3371 3431 3491 3551 3611 3671 3731 3791 WO 93/24628 WO 9324628PCI/US93/051 79 CTTCTGGGGA GGGGCTCCGT GTAGCAACCC AGGTGTTGTC CGTGTCTGTT GACCAATCTC TATTCAGCAT CGTGTGGGTC CCIAAGCACA ATAAAAGACA TCCACAATGG AAAAAAAAAA

AGGAATTC

INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 620 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein 3851.

3911 3919 (xi) SEQUENCE Ser Lys Ser Lys DESCRIPTION: SEQ ID NO:2: Cys Ser Val Gly Leu Met Ser Ser Val Val Ala Ala Lys Glu Pro Asn Ala Val Gly Val Gln Lys Glu Val is Glu Leu Ile Thr Leu Thr Leu Val Lys Asn Pro Arg Glu Gin Asn Gly Leu Thr Ser Ser Gln Ser Pro Lys Lys Val Glu Ala Gin Asp Arg Glu Thr Trp Gly 55 Leu Ser Val Ile Gly Phe Ala Val Asp Leu 75 Ile Asp Phe Leu 70 Phe Ala Asn Val Trp Ala Phe Leu Val 100 Pro Tyr Leu Tyr Lys Asn Gly Tyr Leu Leu Phe 105 Met Val Ile Ala Gly Met Pro 110 WO 93/24628 WO 9324628PCf'/US93/O51 79 Leu Phe Tyr Met Giu Leu Ala Leu Gly Gin Phe A~n Giu Gly Ala Ala Gly 130 Val Trp Lys Ile Pro Ile Leu Lys Val Gly Phe Thr Ile Leu Ile Ser Tyr Val Gly Phe Phe 155 Tyr Asn Val Ile Ala Trp Ala Leu His 165 Tyr Leu Phe Ser Phe Thr Thr Glu Leu Pro 175 Trp Ile His His Pro Gly 195 Asn Asn Ser Trp Asn Ser Pro Asn Cys 185 Ser Asp Ala 190 Asp Thr Phe Asp Ser Ser Gly Ser Ser Gly Leu Giy Thr 210 Thr Pro Ala Ala Tyr Phe Glu Arg Val Leu His Leu Gin Ser His Gly Asp Asp Leu Gly Pro Arg Trp Gin Leu 240 Thr Ala Cys Leu Leu Val Ile Val Leu 250 Leu Tyr Phe Ser Leu Trp 255 Lys Gly Val Pro Tyr Val 275 Thr Ser Giy Lys Val 265 Val Trp Ile Thr Ala Thr Met 270 Val Leu Thr Ala Leu Leu Leu Arg Gly Val Thr Leu Pro 280 285 Gly Ala 290 Ile Asp Gly Ile Ala Tyr Leu Ser Asp Phe Tyr Arg Cys Giu Ala Ser TrliAsAl ThGnVa Cy Trp Ile Asp Ala Thr Gln Val Cys WO 93/24628 WO 9324628PCT/US93/051 79 58 Ser Leu Gly Val Gly Phe Gly Val Leu Ile Ala Phe Ser Ser Tyr Asn Lys Phe Thr Asn 340 Asn Cys Tyr Arg Asp 3 4 Ala Ile Val Thr Thr Ser Ile 350 As:, Ser Leu 355 Thr Ser Phe Ser Gly Phe Val Val Phe 365 Ser Phe Leu Gly Tyr 370 Met Ala Gin Lys Ser Val Pro Ile Gly Asp Val Ala Lys 380 Asp Gly Pro Gly Leu 385 Phe Ile Ile Tyr Pro 395 Glu Ala Ile Ala Thr 400 Leu Pro Leu Ser Ser Ala Trp Ala Val 405 Val 410 Phe Phe Ile Met Leu Leu 415 Thr Leu Gly Giy Leu Ile 435 Ile 420 Asp Ser Ala Met Gly Gly Met Giu Ser Vai Ile Thr 425 430 Leu His Arg His Arg Giu Leu Phe 445 Asp Giu Phe Gin Thr Leu 450 Phe Ile Val Leu Thr Phe Leu Leu Leu Phe Cys Val Asn Gly Gly Ile Val Phe Thr Leu Asp His Phe Ala Ala 480 Giy Thr Ser Trp Phe Tyr Giy Gin Arg 515 Ile Leu 485 Gly Val 500 Phe Gly Val Leu Ile Giu Aia Ile 490 Giy Gin Phe Ser Asp 505 Asp Ile Gin Gly Val Ala 495 Gin Met Thr 510 Leu Val Ser Pro Ser Leu Tyr Trp 520 Arg Leu Cys Trp Lys 525 WO 93/24628 PCT/US93/05179 Pro Cys 530 Phe Leu Leu Phe Val Val Val Ser Val Thr Phe Arg Pro 545 Pro His Tyr Gly Ala 550 Tyr Ile Phe Pro Trp Ala Asn Ala Leu 560 Tyr Ala 575 Gly Trp Val Ile Thr Ser Ser Met Met Val Pro Ile Ala Tyr Lys Tyr Ala Ile 595 Cys Ser Leu Pro Ser Phe Arg Glu Lys Leu Ala 590 Arg Gly Glu Ala Pro Glu Lys Arg Glu Leu Val Val Arg 610 Gin Phe Thr Leu His Trp Leu Lys INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 40 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: YES (iv) ANTI-SENSE: NO (ix) FEATURE: NAME/KEY: LOCATION: 1..40 OTHER INFORMATION: /label= consensus /note= "consensus sequence of VNTR element in 3' untranslated region of HUDAT cDNA" WO 93/24628 PCT/US93/05179 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: AGGAGCGTGT ACTATCCCAG GACGCATGCA GGGCCCCCAC INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS: LENGTH: 23 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (synthetic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) FEATURE: NAME/KEY: LOCATION: 1..23 OTHER INFORMATION: /label= oligonucleotide /note= "synthetic oligonucleotide upstream primer for PCR analysis of VNTR region of in 3' untranslated region of HUDAT gene (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: TGTGGTGTAG GGAACGGCCT GAG 23 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 24 base pairs TYPE: nucleic acid WO 93/24628 WO 93/4628 'f/US93/OS 179 STRAflDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (synthetic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (ix) FEATURE: NAME/KEY: LOCATION: 1. .24 OTHER INFORMATION: /label= oligonucleotide /note= "synthetic oligonucleotide, T7-3aLONG; downstream primer for PCR analysis of VNTR region of 3' untranslated region of HUDAT gene" (xi) SEQUENCE DESCRIPTION: SEQ ID CTTCCTGGAG GTCACGGCTC AAGG

Claims (29)

1. An isolated, purified protein 'inct-AcAk the amino acid sequence described for Hdat in Figure 3 of the specification (seq. I.D. NO. or a variant thereof differing by at least one conservative amino acid substitution, or a portion of said amino acid sequence or variant thereof, which retains the activity of said protein, said activity comprising the selective binding of dopamine, cocaine or functional analogs thereof.

2. An isolated, purified protein as recited in claim 1, wherein said biochemical activity further comprises transport of dopamine, cocaine or functional analogs thereof from one side of a membrane to the other. AUEJDD SHE"t rkJ -63-

3. An isolated cDNA including a nucleotide sequence which encodes the protein of claim 1.

4. An isolated cDNA including a nucleotide sequence which encodes the protein of claim 2.

5. An isolated cDNA including a nucleotide sequence as set forth in Figure 1 (SEQ. ID. NO. 1) of the specification.

6. A cloned DNA encoding a dopamine transporter protein having the amino acid sequence of SEQ. ID. NO. 2.

7. An isolated, purified protein including the amino acid sequence of claim 6. o0

8. An isolated DNA molecule including a nucleotide sequence that encodes the amino acid sequence of SEQ. ID. NO. 2 and that further includes a repetitive element in a 3' untranslated portion of said DNA molecule, wherein said repetitive element includes a plurality of head-to-tail repeats of a nucleotide sequence.

9. An isolated DNA molecule according to claim 8, wherein said repeated 15 sequences are about 40 nucleotides long.

10. An isolated DNA molecule according to claims 8 or 9, wherein the nucleotide sequences of said repeats are at least 90% identical to the nucleotide sequence of SEQ. ID. NO. 3.

11. A plasmid DNA including the cDNA of claim 3, and a DNA sequence that 20 provides for replication in a prokaryotic host cell and DNA sequences that provide for transcription of the cDNA in vitro, such that the resulting mRNA can be isolated and S translated upon introduction into a eukaryotic cell'type.

12. A plasmid DNA including the cDNA of claim 4, and a DNA sequence that o provides for replication in a prokaryotic host cell and DNA sequences that provide for :25 transcription of the cDNA in vitro, such that the resulting mRNA can be isolated and translated upon introduction into a eukaryotic cell type. C C a.. oo ooo INI C IWINWORIACKHINOOELETBMSP459732.DOC 64

13. A eukaryotic cell line derived from a cell type that does not normally express dopamine transport activity at its surface that has been made to transport dopamine or to bind CFT by the introduction of the DNA of claim 2 into its genome.

14. A eukaryotic cell line derived from a cell type that does not normally express dopamine transport activity at its surface that has been made to transport dopamine or to bind CFT by the introduction of the DNA of claim 4 into its genome.

A cell line of claim 9 wherein the cell type is COS cells. *I

16. A method for screening cocaine antagonists which includes measuring the 15 inhibition of binding of cocaine, or of functionally equivalent cocaine analogs, to the surface of cells or to membrane preparations obtained from said cells, wherein said cells express the cDNA of claim 3.

17. A method for screening cocaine antagonists which includes measuring the inhibition of cell toxicity due to MPP+ import into cells expressing the protein of claim 2 or transport across reconstituted membrane preparations obtained from such cells. 454INWORDLACKIEWiODEtETS P45075.DOC S 45 aD

18. A method for screening therapeutic agents effective in the prevention or treatment of Parkinson's disease which includes measuring the inhibition of cell toxicity due to MPP import into cells expressing the protein of claim 2, or measuring MPP transport across reconstituted membrane preparations obtained such cells.

19. A method for screening therapeutic agents effective in the prevention of treatment of Parkinson's disease which includes measuring the inhibition of binding of cocaine, or of functionally equivalent cocaine analogs, to the surface of cells or to membrane preparations obtained from said cells, wherein said cells express the cDNA of claim 3. o

20. A method for the screening of therapeutic agents effective in the 15 prevention or treatment of diseases caused by abnormal dopamine transport which includes measuring either the inhibition of facilitation of binding of cocaine, or of functionally equivalent cocaine analogs, to the cell surface of cells of the line or to membrane preparations obtained from the cell line of claim 9, by candidate Scompounds.

21. A method for the screening of therapeutical agents effective in the prevention or treatment of diseases caused by abnormal dopamine transport S::which includes measuring the cell *I 1 o 0 o* *JCt O ELTft497.O -I 66 toxicity due to MPP import into cells of the line or transport across reconstituted membrane preparations obtained from the cell line of claim 9, by candidate compounds.

22. A method for the treatment of Parkinson's disease, Tourette's syndrome or other disease caused by abnormal HUDAT expression by a gene therapy technique including transplanting into a patient somatic cells which have been transformed with a recombinant DNA construction expressing the cDNA of claim 4, thus obtaining expression of said cDNA in said patient.

23. A method for diagnosing genetic variants in dopamine transporter protein utilizing a Southern blot based testing method which detects genetic rearrangements or deletions in the DAT gene, which includes using the cDNA of 15 claim 3 as a probe.

24. A method for diagnosing genetic variants in dopamine transporter protein as in claim 23 wherein the cDNA probe includes DNA having the nucleotide sequence of Figure 1 (SEQ. ID. NO. 1) or a portion thereof. A method for screening an individual for a genetic marker associated with r. substance abuse behaviour which includes analyzing the alleles of HUDAT present in the genotype of said individual.

G. S a7 -0 CS C: WNWORDUACKIEVNODELETEiSP45g75.DOC *o o C:WNODUCIgODoTS•57.O 67

26. 4 method of claim 23, wherein said alleles are variable .,jmber tandem repeat alleles.

27. A method for diagnosing variant expressior of dopamine transporter utilizing a testing method based on the polymerase chain reaction which includes using polynucleotide primers derived from the cDNA of claim 3.

28. A method for diagnosing variant dopamine transporter expression as in claim 27, wherein the polynucleotide primers are derived from the nucleotide sequence shown in Figure 1 (SEQ. ID. NO. 1). I:

29. A method for detecting changes in the rate of release of human dopamine transporter from dopaminergic cells into cerebrospinal fluid that includes 15 measurement of peptides of the human dopamine transporter released into S: cerebrospinal fluid. An isolated, purified protein according to claim 1 sLostantially as hereinbefore described with reference to the examples. DATED: 19 November 1996 PHILLIPS ORMONDE FITZPATRICK Agents for: 25 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE DEPARTMENT OF HEALTH AND HUMAN SERVICES S 0 W N..,0 i* li