AU666047B2 - Recombinant antigens and vaccines of bovine ephemeral fever virus - Google Patents

Description

OPI DATE 15/03/94 APPLN. ID 49337/93 AOJP DATE 09/06/94 PCT NUMBER PCT/AU93/00430 S I11111 II III 1111AU9349337 AU9349337 INTERNATIONAL APPLICATION PUBLISHED UNDER THE PA1bNI CUU'RKAI IUN IKtH 1 Y trL I) (51) International Patent Classification 5 International Publication Number: WO 94/04685 CI2N 15/47, A61K 39/205 Al C07K 13/00, 7/06, 7/08 (43) International Publication Date: 3 March 1994 (03.03.94) (21) International Application Number: (22) International Filing Date: Priority data: PL 4256 24 Augus PCT/AU93/00430 23 August 1993 (23.08.93) t 1992 (24.08.92) (74) Agent: CULLEN CO.; Level 12, 240 Queen Street, Brisbane, QLD 4000 (AU).

(81) Designated States: AU, CA, JP, NZ, US, European patent (AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE).

Published With international search report.

666047 (71) Applicant (for all designated States except US): COMMON- WEALTH SCIENTIFIC .AND INDUSTRIAL RE- SEARCH ORGANISATION [AU/AU]; Limestone Avenue, Canberra, ACT 2601 (AU).

(72) Inventors; and Inventors/Applicants (for US only): WALKER, Peter, John [AU/AU]; 144 Jubilee Terrace, Bardon, QLD 4065 (AU).

RIDING, George, Alfred [AU/AU]; 5 Nolina Court, Indooroopilly, QLD 4068 McWILLIAM, Sean, Michael [AU/AU]; 58 Raff Avenue, Holland Park, QLD 4121 BOYLE, David, Bernard [AU/AU]; 6 Mary Place, Leopold, VIC 3224 HERTIG, Christian [CH/AU]; 41 Cuthbertson Drive, Ocean Grove, VIC 3226 (AU).

(54)Title: RECOMBINANT ANTIGENS AND VACCINES OF BOVINE EPHEMERAL FEVER VIRUS (57) Abstract This invention provides antigens of bovine ephemeral fever virus (BEFV) and vaccines against BEFV. In particular, the invention provides DNA encoding G protein and GNS protein of BEFV, and recombinant vectors and viruses comprising DNA encoding G protein and GNS protein of BEFV. The invention also provides a method of producing G protein and GNS protein of BEFV utilising the aforementioned DNA, and vaccines against BEFV comprising G protein and GNS protein.

WO 94/04685 PCT/AU93/00430 1 RECOMBINANT ANTIGENS AND VACCINES OF BOVINE EPHEMERAL FEVER VIRUS TECHNICAL FIELD This invention relates to antigens of bovine ephemeral fever virus (BEFV) and vaccines against BEFV.

More particularly, the invention relates to glycoprotein G of BEFV and vaccines comprising glycoprotein G.

BACKGROUND ART Bovine ephemeral fever virus (BEFV) is an arthropod-borne rhabdovirus which causes an acute febrile infection in cattle and water buffalo. The disease occurs in most tropical and sub-tropical regions of Africa, Asia, the Middle-East and Australia, where seasonal epidemics can have significant economic consequences.

BEFV virions are bullet-shaped and contain structural proteins: L (Mr 180 kDa); G (Mr 81 kDa); N (Mr 52 kDa); M1 (Mr 43 kDa); and M2 (Mr 29 kDa) (Walker et al., (1991) J. Gen. Virol. 72, 67-74). As for rabies virus and vesicular stomatitis virus, the BEFV membrane glycoprotein can be removed from virions by treatment with non-ionic detergent. The G protein presents type-specific and neutralising antigenic sites.

Six neutralisation sites have been identified by competitive binding of G protein monoclonal antibodies (Cybinski et al., '.990) J. Gen. Virol. 71, 2065-2072.

The virion G protein also protects cattle from experimental infection with virulent BEFV as described in Australian Patent No. 636907.

The above mentioned Australian Patent No.

636907 discloses that in addition to the virion 81 kDa G protein, a 90 kDa non-structural glycoprotein (GN) is synthesised in BEFV-infected cells. Gs appears in similar abundance to the virion G protein in infected cells but has not been detected in virions. Nonglycosylated precursors and core-glycosylated intermediates of each BEFV glycoprotein have been identified.

WO 94/04685 PCT/AU93/00430 2 BEFV infection is part of a cycle whereby infected cattle may be bitten by insects such as mosquitoes and sandflies which may then transmit the infection to healthy animals. BEFV replicates in cells of the insect vector and it is hypothesised that the G, protein may be present on the surface of virus produced in the insects although this has yet to be established.

While Australian Patent No. 636907 teaches that BEFV G protein is effective as a vaccine component, known methods of producing the protein are unsuitable for the large scale production of vaccine. Virus must be cultured in a host organism, harvested, and proteins isolated therefrom. The overall process yields low levels of protein immunogen and there is the additional disadvantage of having to initially culture the infectious agent. Similarly, any use of GNs protein as a vaccine component would be limited by the difficulties in producing the protein.

SUMMARY OF THE INVENTION It is an object of this invention to provide a method of producing BEFV G and/or GNs protein which does not require the culturing of BEFV.

It is also an object of this invention to provide alternative BEFV vaccines to known BEFV vaccines.

According to one aspect of this invention, there is provided an isolated DNA molecule comprising a nucleotide sequence encoding bovine ephemeral fever virus (BEFV) G protein and/or protein.

A preferred BEFV G protein encoding sequence is a sequence corresponding to nucleotides 21 to 1889 of SEQ ID No:l. A preferred BEFV GNs protein encoding sequence is a sequence corresponding to nucleotides 1969 to 3726 of SEQ ID No:l (as hereinafter defined).

Sequences having about 70% or greater identity with the foregoing sequences which encode proteins having the immunogenic properties of BEFV G protein and/or GN protein are also within the scope of the invention.

In another aspect of the invention, there is WO 94/04685 PCT/AU93/00430 3 provided a DNA vector which includes a sequence encoding BEFV G protein and/or Gs protein.

In further aspects of the invention there are provided BEFV G protein and/or GN protein expressed from the DNA molecules of the invention.

The invention includes within its scope immunogenic fragments of the G protein and/or GN protein encoded by the respective genes. Immunogenic fragments include mature G protein or GNS protein after cleavage of signal peptide or even smaller fragments which may be encoded by portions of the G protein or GN protein genes.

A preferred BEFV G protein amino acid residue sequence is a sequence corresponding to SEQ ID No:2 (as hereinafter defined).

A preferred BEFV GNs protein amino acid sequence is- a sequence corresponding to SEQ ID No:3 (as hereinafter defined).

In yet another aspect of this invention, there is provided a method for the production of BEFV G protein and/or GNS protein, said method comprising the steps of: I) preparing an expression vector incorporating a DNA sequence comprising a sequence encoding bovine ephemeral fever virus (BEFV) G protein and/or G, protein; II) transforming a host cell with the expression vector prepared in step I; III) culturing said host cell under conditions in which G protein and/or GN protein is expressed; and IV) harvesting said expressed G protein and/or GNS protein from the culture prepared in step III.

In other aspects of the invention there are provided vaccines for protecting animals against BEFV comprising BEFV G protein or an immunogenic fragment thereof.

WO 94/04685 PCT/AU93/00430 4 In a still further aspect of the invention, there is provided a vaccine for protecting an animal against BEFV, said vaccine comprising a non-pathological virus which expresses BEFV G protein.

The term "non-pathological" virus denotes a virus which replicates within the vaccinated animal but does not ellicit a deleterious disease state. Typically, the non-pathological virus is vaccinia virus.

The vaccines of the invention can also include BEFV GN protein and/or BEFV N antigen.

In still further aspects of the invention, there are provided methods of protecting animals against BEFV infection, the methods comprising administering to the animals the aforementioned vaccines.

In regard to a preferred embodiment of this invention, and as discussed in greater detail hereinafter, a 3789 nucleotide region of the bovine ephemeral fever virus (BEFV) genome, located 1.65 kb downstream of the N gene, has been cloned and sequenced.

The region contains two long open reading frames (ORFs) which are bounded by putative consensus (AACAGG) and polyadenylation (CATG[A],) sequences and are separated by an intergenic region of 53 nucleotides. Discrete mRNAs corresponding to each ORF have been identified. The first ORF encodes a polypeptide comprising 623 residues which was identified by peptide sequencing as the virion G protein. The deduced amino acid sequence of the G protein includes putative signal and transmembrane domains and 6 potential glycosylation sites. The second ORF encodes a polypeptide of 586 amino acids which also has characteristics of a rhabdovirus glycoprotein, including putative signal and transmembrane domains and 8 potential glycosylation sites, and appears to correspond to the 90 kDa non-structural G, protein discussed above.

A database search described in Walker et al., (1992) Virology 191, 49-61, the entire contents of which are incorporated herein by cross-reference, indicated that both the G and G, proteins share significant amino acid WO 94/04685 PCT/AU93/00430 sequence homology with other rhabdovirus G proteins and with each other. Highest homology scores for each protein were with the virion G proteins of sigma virus and vesicular stomatitis virus serotypes.

The invention also includes within its scope not only the G protein gene and the GN protein gene which each have a specific nucleotide sequence as described hereinafter but also RNA molecules having about 70% or greater identity with the specific sequences discussed hereinafter.

The invention also includes within its scope nucleic acid molecules that can hybridise with the G protein gene and GN protein gene. Such hybrids may include RNA hybrids as determined by Northern hybridisation methods or DNA hybrids.

BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be more fully described with reference to the drawings in which: Figure 1 depicts maps of BEFV cDNA clones used for nucleotide sequence analysis, in which arrows indicate the location of terminal sequences obtained from these clones and from subclones generated by progressive exonuclease digestion or by removal of restriction fragments, and in which the origin of the kilobase scale is the start of the N gene for which the complete nucleotide sequence is known; Figure 2 depicts hydropathy plots of the BEFV G and GNS proteins; Figure 3 depicts the results of Northern hybridisations using 2P-labelled BEFV cDNA probes to detect BEFV G, G, and L mRNA wherein in lane A RNA from uninfected BHK-21 cells was probed with a mixture of clones m5 (G gene), m3 (GNS gene) and m85 (L gene) and wherein RNA from BEFV-infected BHK-21 cells was probed with clone m5, clone m3 or clone m85 in lanes B, C and D respectively; Figure 4 is a map of plasmid pTP41; Figure 5 is a map of plasmid pTP42; WO 94/04685 PCT/AU93/00430 6 Figure 6 depicts the results of neutralising antibody assays wherein the symbols and (v) represent results for rW-G, rW-G,, rVV-G rVV-Gs and VV-NYBH respectively; and Figure 7 depicts the results of blocked ELISA wherein in each set of results the filled bar represents the result for rVV-G, the finely cross-hatched bar represents the result for rVV-Gs, the coarsely crosshatched bar represents the result for rVV-G rVV-GN, and the stippled bar represents the result for VV-NYBH.

BEST MODE AND OTHER MODES OF CARRYING OUT THE INVENTION The methodology used in relation to preparation of the recombinant antigens of this invention can be all based on conventional procedures well known in the art.

Initially purified virus can be prepared which can be treated with detergent and extraction of the desired glycoprotein as discussed in Australian Patent No. 636,909. The purified peptides can then be prepared for determination of sequence analysis after reduction and alkylation as described by Stone et al. (1989) A Practical Guide to Protein and Peptide Purification for Microsequencing (P T Matsudaira, Academic Press, San Diego, pp 31-47, and further purification by HPLC.

Genomic RNA can be purified in any suitable manner as described in Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbour Laboratories, New York. For example, purified virus can be sedimented from density gradients obtained from glycerol, caesium chloride, sucrose or other suitable compound useful in a density gradient. The virus can then be resuspended in appropriate buffer containing a detergent and a ribonuclease inhibitor.

Subsequently the purified virus can be digested with a suitable proteinase to strip nucleoprotein away from the genomic RNA whereafter the genomic RNA can be extracted with a suitable solvent.

It is preferred in regard to the method of this WO 94/04685 PCT/AU93/00430 7 invention that full length genomic RNA from a wild type virus is utilised and to this end preparation of total cytoplasmic RNA can be initiated wherein appropriate host cells are infected with virus substantially depleted of defective-intefering (DI) particles which have large deletions in their genome. In the process using a density gradient as described above, the band corresponding to the wild type virus will have a greater density than the band corresponding to a DI particle which therefore can be discarded.

Subsequently, total cytoplasmic RNA can also be extracted and this can be carried out by infection of host cells with DI particle depleted virus. Actinomycin D or any other suitable inhibitor of transcription of cellular mRNA can be added to the infected cells after initial infection. At a suitable post infection time the host cells can be harvested for RNA extraction and thus the cells can be washed before being lysed with a suitable buffer containing a detergent and ribonuclease inhibitor as described above as well as a proteinase before extraction with a suitable solvent and subsequent extraction with a DNAase free of RNAase to digest cellular DNA.

cDNA clones can then be obtained from the genomic RNA as well as mRNA included in the total cytoplasmic RNA which can be both used as independent templates. In this step the cDNA insert(s) can be inserted into a cloning site of a suitable cloning vector such as a plasmid cloning vector such as pUC18 or a cosmid vector.

cDNA clones derived from mRNA can then be analysed by sequence comparisons with known sequences of other rhabdoviruses to obtain approximate location of the inserts corresponding to the clones in the genome. A primer based on this information can then be designed to generate clones of a substantial length from a genomic RNA template.

Five large clones (g233, g208, g310, g236 and WO 94/04685 PCT/AU93/00430 8 g207) were obtained from a genomic DNA template and a synthetic oligonucleotide corresponding to the 3' coding region of the BEFV N protein mRNA was also obtained for use as a primer. Sequence analysis of these clones together with the obtaining of relevant sub-clones and also clones from BEFV mRNA and the compilation of overlapping sequences lead to the analysis of structures of genes encoding both protein G and protein Clones containing the complete coding regions of each glycoprotein gene can be prepared by subcloning of gene fragments as is well known in the art.

Preferably, complete coding regions are obtained by PCP amplification as described hereinafter.

In relation to commercial production of each of the abovementioned glycoproteins, it will be appreciated that any suitable expression vector can be adopted to express each of the glycoproteins. Typically, the glyproteins are expressed in a eukaryote system: for example, mammalian cells using a poxvirus such as vaccina virus, papilloma virus or retrovirus vectors or alternatively yeast cells harbouring suitable vectors. A suitable expression system for use in commercial production of the glycoproteins is the use of a baculovirus vector to infect an insect host cell such as Spodoptera frugiperda.

Adjuvants for use with the vaccines of the invention are known in the art. Such adjuvants include QuilA or other saponins, ISCOMS or other adjuvants as described in Vanselow (1987) Vet. Bull. 57, 881-886.

It will also be appreciated that the antigens of the invention including G protein, GNS protein and N prote-n can be obtained from a suitable expression system as a fusion protein whereby the antigen is coupled to pgalactosidase, glutathione-S-transferase or other suitable carrier proteins.

In order that the invention described herein be more fully understood, the following examples are set forth. These examples are for illustrative purposes only WO 94/04685 PCT/AU93/00430 9 and are not to be construed as limitations upon the invention.

EXAMPLE 1 PURIFICATION AND PEPTIDE SEQUENCE ANALYSIS OF THE VIRION G PROTEIN The BB7721 strain of BEFV was used as a source of G protein. The virus was isolated in 1968 from a cow with clinical bovine ephemeral fever at Charters Towers (146°16'E, 20°5'S), Australia (Doherty et al. (1969) Australian J. Sci. 31, 365-366) and has the same origin as the current Australian attenuated vaccine strain 919 (Tzipori and Spradbrow (1973) Australian Vet. J. 49, 183- 187). The virus was passaged in calves and in suckling mice before adaptation to cell culture. After an unknown number of passages in BHK-21 cells, the virus was plaque cloned 3 times in Vero cells. After 2 further passages in Vero cells, a DI particle-depleted stock of virus was prepared by sedimentation velocity centrifugation. This stock was used to inoculate cultures for preparation of purified virus and viral mRNA. Virus was grown in BHK-21 cells as described previously (Walker et al., (1991) J.

Gen. Virol. 72, 67-74).

Purified virus was treated with 0.5% Triton X- 100 and the glycoprotein purified from the detergentsoluble fraction by wheat germ lectin-Sepharose affinity chromatography and size-exclusion HPLC. To obtain peptides suitable for amino acid sequence analysis, approximately 55 pg of the purified glycoprotein was reduced and alkylated as described by Stone et al. (1989) in the above cited reference and digested at 24 0 C for 24 h with 3 pg endoproteinase Glu-C (Boehringer-Mannheim) in 2 M urea, 100 mM ammonium bicarbonate pH 8.3. Peptides were purified by 2 cycles of reverse phase HPLC on a Brownlee Aquapore RP-300 C-8 column (Applied Biosystems Inc.). Initial separation was conducted using a linear gradient of 0-75% acetonitrile in 0.1% aqueous heptafluorobutyric acid (HFBA). Selected peptides were then applied to the same column and eluted in a 0-75% r WO 94/04685 PCT/AU93/00430 linear acetonitrile gradient in 0.1% aqueous trifluoroacetic acid (TFA). The purified peptides were sequenced using an Applied Biosystems amino acid sequencer.

Four resolved peptide fractions were obtained in quantities suitable for amino acid sequence analysis.

Two fractions contained unique peptides (G163 and G164) that produced unequivocal sequence data. One fraction contained 2. peptides (G141a and G141b) in 2:1 molar ratio from vt-ich individual sequences could be deduced with certainty. One fraction (G101) contained 2 peptides in equimolar quantities from which unique peptide sequences could be determined only by comparison with sequences deduced from nucleotide sequence data. Amino acid sequences of peptides G116, G164, Gl41a and G141b are shown in Table I. Corresponding sequences deduced from nucleotide sequence analysis of the G protein gene are reported below.

TABLE I PEPTIDE AMINO ACID SEQUENCES PEPTIDE AMINO ACID SEQUENCE Gl41a K I Y N V P V NC G G141b C I T V K S F R S E G163 K L C L S L P D S X R V X X D C N I G164 X W Y F X T C I E In Table I, the standard one letter amino acid code has been used. Residues which could not be assigned with confidence are represented as X. The symbol C has been used to represent carboxymethyl cysteine or glutamic acid which have similar retention times as PTH-amino acids on the reverse phase system used. The initial E residue was assumed to be present because of the specificity of endoproteinase Glu-C. The C residue in peptide G164 differs from the deduced amino acid sequence of the BEFV G gene.

i -r I II WO 94/04685 PCT/AU93/00430 11 EXAMPLE 2 cDNA CLONING AND SEQUENCING OF G AND G, GENES Genomic RNA was prepared from the virus purified as described by Walker et al (1991) J. Gen.

Virol. 72, 67-74). The virus was sedimented from selected sucrose gradient fractions at 70,000 rpm for min at 4 0 C (Beckman TLA-100 rotor), resuspended in RNA Extraction Buffer, digested with 2 mg/ml Proteinase K (Boehringer Mannheim) at 37 0 C for 30 min and extracted with phenol/chloroform/isoamyl alcohol as described by Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbour Laboratories, New York.

For preparation of total cytoplasmic RNA, cells were infected at a multiplicity of 10 pfu/cell with DI particle-depleted virus. At 9 h post-infection, 0.3 pg/ml actinomycin 1 was added and at 15 h post-infection the cultures were harvested for RNA extraction.

Monolayers were washed twice with ice-cold PBS, lysed with equal volumes of RNA Extraction Buffer ai.d Proteinase K Digestion Buffer, extracted with phenol/chloroform/isoamyl alcohol and treated with RQ DNase I (Promega) as described in the above mentior.'I Sambrook et al., (1989).

Synthesis of cDNA was conducted using the cDNA Synthesis System Plus kit (Amersham) according to the manufacturer's instructions. First-strand synthesis from total cytoplasmic RNA was initiated with an oligo (dT), 1 primer (Amersham). Synthesis from genomic RNA template was initiated with the synthetic oligonucleotide primer N.1B (5'AGTTTTGCATCAGGGAGTGCAAGA3') which corresponded to a sequence known to be located in the 3'terminal coding region of BEFV N protein mRNA. Double-stranded cDNA was filled by using T4 DNA polymerase to obtain blunt-ends and cloned into the SmaI site of pUC18.

cDNA clones longer than 350-400 nucleotides were subcloned after unidirectional deletion by using the Erase-a-Base kit (Promega) according to the WO 94/04685 PCT/AU93/00430 12 manufacturer's instructions or after selection deletion of restriction fragments. The size of the clones was determined by agarose gel electrophoresis or by complete nucleotide sequence analysis (clones g207, m5, m3, G1.A6 and G2.Cl). cDNA clones were sequenced using T7 DNA polymerase (Sequenase Version 2.1, United States Biochemicals) according to the manufacturer's instructions and M13 forward and reverse sequencing primers (Pharmacia). All sequences were confirmed on both DNA strands.

Five large clones (g233, g208, g310, g236 and g207) containing inserts of approximately 2.0 kb, 2.3 kb, 3.9 kb, 5.1 kb and 7.0 kb respectively (Figure 1) were obtained from cDNA clones of BEFV genomic DNA.

Nucleotide sequence analysis confirmed that one end of each clone cortesponded to the 3' end of the N protein mRNA. Sequence analysis of the other end of the clones g310 and g233 indicated that these contained putative polyadenalylation (CATG[A]7) and consensus (AACAGG) sequences and were likely to be located at two distinct gene junctions. Subclones of clone g207 were obtained by progressive unidirectional deletion using Exo III and a panel of overlapping clones terminating 2.4 kb 5.2 kb downstream of the N gene were sequenced. Subclone g207.17 contained putative consensus and polyadenylation sequences and appeared to bridge a third gene junction.

Subclones of g207 were also obtained by deletion of BamHI and SacI fragments and were sequenced. A compilation of overlapping subclone sequences indicated that the region between the putative consensus sequence in clone g310 and the putative polyadenylation sequence in clone g207.17 contained a 1758 base pair open reading frame (ORF) which mapped between 3.6 kb and 5.4 kb downstream of the N gene (Figure This region was identified subsequently as the Gs protein gene (see below).

Two cDNA clones were obtained from BEFV mRNA by bligo (dT) priming (Figure Clone m5 contained a 1.55 kb insert and nucleotide sequence analysis indicated that WO 94/04685 PCT/AU93/00430 13 one end mapped to the gene junction identified in clone g233. The sequence of the other end corresponded to that of a g207 subclone (g207.45-4). Overlapping subclones of were obtained by ExoIII digestion and the complete sequence of the insert was determined. A compilation of overlapping sequences of g233, g208, m5 and the g207 subclones indicated that the, region between the putative consensus sequence in clone g233 and the putative polyadenylation sequence in clone g207.17 contained a 1869 base pair ORF which mapped between 1.65 kb and 3.55 kb downstream of the N gene and immediately upstream of the Gs gene (Figure This region was identified subsequently as the G protein gene (see below). Clone m3 contained a 0.5 kb insert. Nucleotide sequence analysis of the complete clone indicated that it mapped in the GNS ORF (Figure Both clones m3 and m5 appeared to have initiated at A rich regions within the G, and G genes and did not represent full length mRNA clones.

EXAMPLE 3 SUBCLONES OF GLYCOPROTEIN GENES Clones containing the complete coding regions of each glycoprotein gene were obtained by PCR amplification from clone g207 described in Example 2 by using the PCR primer pairs Gl.1B (5'GGCCAGATCTACAATGTTCAAGGTCCTCATAATT3' 2B( CTTTAATGATCAAAGAACCTATCATCACCAG3'); and G2.1AB (5'GGCCGGATCCATCATGTTCCTGCAACTATTTAATATCG3')/ G2.2AB (5'GGCCGGATCCGCTCAATAATCCAACTTAAAG3'). PCR reactions were conducted in 50 1l Taq polymerase Buffer (Boehringer Mannheim) containing 10 ng plasmid DNA, 100 ng each primer DNA, 250mM dNTPs, lpl Perfect Match (Promega), mM MgC12 and 5 units Taq DNA polymerase. Reactions were conducted using the temperature cycle program: 95 0 37"C/30s, 50*C/30s, 72*C/180s (4 cycles); 95*C/90s, 57*C/60s, 72*C/180s (30 cycles) and 95*C/90s, 60*C/60s, 72*C/5 min (1 cycle). The PCR products were filled with T4 DNA polymerase and purified by LGT Agarose (BRL) gel electrophoresis and extraction with phenol and lp~ I WO 94/04685 PCT/AU93/00430 14 phenol/chloroform before cloning in the SmaI site of pUC118.

Clones G1.A6 (G gene) and G2.C1 (GN gene) were used to obtain subclones by progressive unidirectional deletion using ExoIII. Analysis of overlapping subclones allowed completion of the bidirectional sequence of the G and GS genes and the associated non-coding regions (Figure One sequence discrepancy G at position +27 from the putative initiation codon) was detected in PCR clone G1.A6. However, independent bidirectional analysis of the corresponding sequence in clones g207 and g310 indicated that the substitution is likely to have occurred during PCR. The substitution did not change the deduced amino acid sequence of the G protein.

The sequence of a 3789 nucleotide region of the BEFV genome located 1.65 kb downstream of the N gene polyadenylation signal is shown as sense DNA in Sequence ID No:l. The region contains two long ORFs (1869 and 1758 nucleotides), each bounded by a consensus sequence (AACAGG) and a common polyadenylation sequence (CATG[A]I). The ORFs are separated by an intergenic sequence of 53 nucleotides which features a sequence similar to the consensus sequence (AACAG) followed by the unusual pallindrome (T) 6

(A)

10 The polyadenylation signal of the second gene is followed by an intergenic region of 37 nucleotides and another consensus sequence (AACAGG) which marks the start of another long ORF immediately downstream (not shown). The 5' and 3' non-coding regions of each putative mRNA are very short, comprising 8, 0, 6 and 1 nucleotides excluding consensus and polyadenylation sequences. At position 1490 in the first ORF, a sequence similar to the common polyadenylation signal (CATG[A] 6 is followed by a sequence similar to the consensus sequence (AACAGA). The significance of these sequences is not evident but they are not adjacent to initiation or termination codons.

Amino acid sequences deduced from the consecutive ORFs are shown in SEQ ID No:2 and SEQ ID c 19 WVO 94/04685 PCT/AU93/00430 No:3. The first ORF encodes the BEFV virion G protein.

The G protein sequence consists of 623 amino acids with a calculated pi of 6.191 and molecular weight of 72,278 Da.

The calculated molecular weight is similar to that of the 71 kDa glycoprotein precursor detected in BEFV-infected cells (Walker et al., (1991) J. Gen. Virol. 72, 67-74).

As can be seen from SEQ ID No:2, the protein contains amino acid sequences corresponding to all 4 peptides derived by endoproteinase Glu-C digestion of the BEFV virion G protein (Table G141a corresponds to residues 17 to 28; Gl41b to residues 210 to 220; G163 to residues 349 to 367; and G164 to residues 90 to 99. The first three of these peptides were identical to the deduced sequence. Peptide G164 differed in one residue from the deduced sequence. This may have resulted from a single base transversion which would change the serine codon (TCT) to cysteine (TGT). No similar peptide sequences were detected in the protein encoded in the second ORF. The hydropathicity profile of the G protein (Figure calculated by the method of Kyte and Doolittle (1982) J. Mol. Biol. 157, 105-132, displays hydrophobic domains bounded by basic residues (lysine or arginine) corresponding to the signal peptide and transmembrane regions of other rhabdovirus glycoproteins.

The transmembrane domain is relatively short (16 residues) and is adjacent to a second shorter hydrophobic region (13 residues) bounded by lysine residues which may also by associated with the viral membrane. Six putative glycosylation sites were identified in the deduced sequence of the BEFV G protein (SEQ ID No:2). One of these is located in the COOH-terminal domain and is unlikely to be glycosylated in vivo The second ORF, SEQ ID No:3 encodes the BEFV GNS non-structural glycoprotein. The GN protein sequence consists of 586 amino acids with a calculated molecular weight of 68,806 La and a pi of 8.144. The calculated molecular weight is similar to that reported for the 67 kDa glycoprotein precursor detected in BEFV-infected WO 94/04685 PCT/AU93/00430 16 cells (Walker et al., (1991) J. Gen. Virol. 72, 67-74).

The hydropathicity plot of G s protein also features hydrophobic domains bounded by acidic and basic residues which are likely to constitute signal peptide and transmembrane domains (Figure Eight potential Nglycosylation sites were identified in the protein and all appear to be located in the external domain (Sequence ID No:3).

The putative signal domain of the BEFV G protein, residues 1 to 12 of SEQ ID No:2, conforms with those recognised in the signal peptides of othe eukaryote membrane proteins, comprising an N-terminal charged region, a central hydrophobic core and a more polar domain approaching the peptidase cleavage site. It is known that the peptidase cleavage site of vesicular stomatitis virus (VSV) serotypes (other than Chandipura virus) and rabies virus is followed by a basic residue (lysine or arginine) which is subsequently located at the N-terminus of the mature glycoprotein. Similar potential cleavage sites have been recognised in the putative signal domains of the G proteins of other viruses. Two potential peptidase cleavage sites can be identified in the BEFV G protein corresponding to lysine residues at positions 13 and 18.

A stretch of 16 hydrophobic amino acids at residues 539-554 appears to constitute the transmembrane domain of the BEFV G protein. This region is bounded by basic residues (R and K) which are characteristic of other rhabdovirus transmembrane segments. In addition, it is preceded by the sequence VXGWF(X)S which also precedes the transmembrane domains of VSV Indiana, VSV New Jersey and Chandipura viruses. However, it haz been suggested that a minimum segment of 21 amino acids may be required to span the non-polar region of the cytoplasmic membrane, suggesting that a second hydrophobic region comprising residues 522-534 may also be involved. If so, the transmembrane domain of the BEFV G protein would comprise 32 amino acids including 2 charged residues (K,,s WO 94/04685 PCT/AU93/00430 17 and R 5 8 The BEFV GNS gene is located immediately downstream of the G gene. Although there is no direct evidence that this gene encodes the GN, protein, the structure predicted from the deduced amino acid sequence corresponds to that expected for GS. The predicted size of the G and GN gene products (72,278 daltons and 68,806 daltons) correspond closely to those of non-glycosylated precursors (Mr=71 kDa; Mr=68 kDa) detected in BEFVinfected cells (Walker et al., (1991) J. Gen. Virol. 72, 67-74). The GN gene product has the structural characteristics of a rhabdovirus glycoprotein including a signal domain, hydrophobic transmembrane domain and 8 potential N-glycosylation sites (SEQ ID No:3) The signal domain comprises a primarily hydrophobic segment at the N-terminus which appears to terminate .at arginine (residue 15). The putative transmembrane domain comprises a stretch of 19 uncharged amino acids (residues 544-562) bounded by the highly charged sequences (QNKEYWNEE) and (RKNRREK). The large number of potential glycosylation sites on the GN gene product during maturation. The function of the GN protein is not yet known.

EXAMPLE 4 Identification of G, G, and L mRNA BEFV cDNA inserts were cut from plasmids by restriction endonuclease digestion and purified by LGT Agarose (BRL) gel electrophoresis and by binding to Geneclean II (BIO 101, La Jolla, Ca.) according to the manufacturer's instructions. The purified inserts were used to prepare 3P-labelled DNA probes by random hexanucleotide priming using the Multiprime DNA labelling system (Amersham). Northern hybridisations were conducted on RNA transferred from formamide-agarose gels to nylon membranes (Hybond N Plus, Amersham) according to methods described by Sambrook et al. (1989) in the above cited reference.

Total RNA was purified from BEFV-infected cells WO 94/04685 PCT/AU93/00430 18 at 15 h post-infection and reacted in northern hybridizations with probes prepared from cDNA clones and m3. A 1.8 kb cDNA clone (m85) which was known to be derived from the 3' end of the BEFV L gene was also included for reference (Figure Clone m5 detected a 2.2 kb band corresponding to G mRNA. Clone m3 detected a smaller 2.0 kb band corresponding to GN mRNA. Clone detected a 6.5 kb band corresponding to L mRNA. All probes failed to react with total RNA prepared from uninfected cells. Each mRNA appeared to represent a full-length polyadenylated transcript of the corresponding gene. There was no evidence that a smaller RNA was transcribed from the G gene, terminating at the

CATG(A)

6 at positions 1521 to 1530.

EXAMPLE Plasmid insertion vectors and recombinant vaccinia viruses expressing G and G.

Both BEFV glycoprotein genes were subcloned into the BamHI site of vaccinia virus transfer vector pFN243, G as a BglII fragment derived from pUC118 clone G1.A6 and GN as BamHI fragment from pUC118 clone G2.H4.

Maps of the two plasmids pTP41 and pTP42 are presented in Figures 4 and 5. In Figure 4, the symbol denotes the point of fusion of the ends of the linearised pFN243 and the G gene fragment while in Figure 5 the symbol "B" denotes the BamHI sites reformed after insertion of the GNs gene at the BamHI site of pFN243. In pFN243, the vaccinia virus thymidine kinase region is interrupted by a fowlpox early-late promoter and a multiple cloning site. Human TK 143B cells infected with vaccinia virus strain NYBH were used to construct recombinant vaccinia viruses (rVV-G and rW-GNS) by homologous recombination.

rVV were plaque purified three times on 143B cells selecting recombinants by screening for expression of Bglactosidase.

Expression of G protein was determined by western blots, and immunifluorescence using monoclonal antibodies against G. In western blots rVV-G expressed G WO 94/04685 PCT/AU93/00430 19 migrates at the same molecular weight as G from BEFV infected cells and in the immunofluor-escence assay rVV-G infected cells stain at the same intensity as BEFV infected cells with a panel of monoclonal antibodies to BEFV G protein. At present time we have no GNS specific antisera. To test expression of recombinant G,s we vaccinated rabbits with rW-G.s. In the immunofluorescence assay these rabbit sera stain GNs in BEFV infected cells and in western blots detect a protein of the appropriate size in lysates of BEFV infected cells.

EXAMPLE 6 Vaccination of cattle and challenge with BEFV Eighteen six month old Hereford cattle were vaccinated intradermally by day 1, revaccinated on day and challenged on day 29. Six animals were vaccinated with rVV-G, six with rVV-Gs, three animals received a combination of rVV-G and rVV-G sand three control animals were vaccinated with a wild type vaccinia virus (NYBH).

Blood samples were collected and the rectal temperature determined prior to vaccination, revaccination and challenge. After challenge this was done twice a day for nine days (day 30-38). Additional blood samples were collected on day 39 and Animals vaccinated with rVV-G alone or in combination with rVV-Gs developed neutralising antibodies (see Table II and Fig. 6) Titres continued to rise after revaccination. Vaccination with rVV-Gs or wild type vaccinia virus did not induce the production of neutralising antibodies. The neutralising antibody response in rVV-G vaccinated animals was confirmed by the blocking ELISA (Fig. 7).

At day 29 cattle were challenged with 5 ml of blood from a BEFV infected cow. Protection of vaccinated animals was evaluated by monitoring viremia (Table III).

Virus was isolated from the blood samples of 4 out of 6 rVV-Gus and 2 out of 3 NYBH vaccinated animals. No virus was isolated from animals vaccinated with rVV-G alone or rVV-G in combination with rW-GNs.

MS'

TABLE II

U

BOVINE EPHEMERAL FEVER VIRUS NEUTRALISATION ASSAY RESULTS F DAY VACCINE ANIMAL 0 15 28 29 30 31 32 33 34 35 3 6 37 38 39 rVV-G 2 <2 16 51 32 25 45 32 38 38 51 45 89 >256 >256 >256 7 <2 8 89 89 102 77 >256 64 89 >256 154 177 128 154 >256 9 <2 12 128 128 102 102 >256 177 >256 >256 128 204 204 154 102 12 <2 10 45 22 64 64 102 89 89 177 38 204 >256 >256 >256 17 >2 8 32 25 45 89 45 89 51 128 77 89 128 89 8 77 <2 8 45 32 51 51 45 32 154 154 51 102 89 51 32 rVV-NS <2<2 2 <2 <2 2 <2 2 2 2 <2 3 0 4V-N 3 <2 <2 <2 <2 <2 <2 2 2 <2 <2 2 36 19 41 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 2 3 6 19 11 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 42 32 <1 <2 <2 <2 <2 <2 <2 <2 <2 2 <2 2 4 6 4 38 16 <2 2 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 rVV-G 1 <2 10 45 64 51 154 45 77 64 45 89 64 45 1 >256 rVV-GNS 5 <2 5 25 32 45 45 45 32 89 51 64 128 102 51 >256 8 <2 6 11 11 11 11 16 19 25 22 16 16 12 10 12 VV NYBH 6 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 <2 3 2 12 <2 <2 <2 <2 <2 <2 <2 <2 <2 2 3 5 10 5 64 13 <2 <2 <2 <2 <2 <2 <2 <2 <2 2 <2 <2 <2 <2 <2 TABLE III BOVINE EPHEMERAL FEVER VIRUS ISOLATION (IMMUNIFLUORESCENCE) both samples negative, both samples positive, one postive and one negative, (nd) not done i-I WO 94/04685 PCT/AU93/00430 22 While a number of embodiments of the invention have been presented above, it will be apparent that a number of variations can be made thereto without deparing from the broad ambit of the invention.

Therefore, it will be appreciated that the scope of this invention is to be defined by the claims appended hereto rather than the specific embodiments which have been presented hereinbefore by way of example.

It will also be appreciated that the term "bovine ephemeral fever virus" used herein also includes within its scope Malakal virus, Puchong virus, Berrimah virus, Kimberley virus and Adelaide River virus.

DEPOSIT OF MATERIAL ASSOCIATED WITH THE INVENTION A sample of g207 plasmid DNA was deposited with the Australian Government Analytical..Laboratories, P.O.

Box 385, Pymble NSW 2073, Australia on 14 September 1992 and given the Accession No. N92/44230 WO 94/04685 PCT/AU93/00430 23 SEQUENCE LISTING GENERAL INFORMATION APPLICANTS: Commonwealth Scientific and Industrial Research Organization (all states except US) Walker, Peter John (US only) Riding, George Alfred (US only) McWilliam, Sean Michael (US only) Boyle, David Bernard (US only) Hertig, Christian (US only) (ii) TITLE OF INVENTION: Recombinant antigens and vaccines of bovine ephemeral fever virus (iii) NUMBER OF SEQUENCES: 3 (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: Cullen Co STREET: Level 12,-240 Queen Street CITY: Brisbane STATE: Queensland COUNTRY: Australia POSTAL CODE: 4000 COMPUTER READABLE FORM: MEDIUM TYPE: Diskette, 3.5 inch, 2DD COMPUTER: IBM compatible OPERATING SYSTEM: MS-DOS version 5.1 SOFTWARE: WordPerfect version 5.1 INFORMATION FOR SEQ ID No:1 SEQUENCE CHARACTERISTICS: LENGTH: 3789 base pairs TYPE: nucleotide STRANDEDNESS: single stranded TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to genomic DNA (iii) HYPOTHETICAL: no (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: ORGANISM: bovine ephemeral fever virus STRAIN: BB7721 (vii) IMMEDIATE SOURCE: CLONE: g207 WO 94/04685 PCT/AU93/00430 24 (ix) FEATURE: NAME/KEY: consensus sequence LOCATION: 7..12 IDENTIFICATION METHOD: by similarity to an established consensus sequence (ix) FEAITRE: NAME/KEY: coding sequence LOCATION: 21..1889 IDENTIFICATION METHOD: experimentally OTHER INFORMATION: encodes bovine ephemeral fever virus G prote.n (ix) FEATURE: NAME/KEY: polyadenylation site LOCATION: 1893..1903 IDENTIF1CATION METHOD: by similarity to an established consensus sequr;ice (ix) FEATURE: NAME/KEY: consensus sequences LOCATION: 1957..1962 IDENTIIICATION METHOD: by similarity to an established consensus sequence (ix) FEATURE: NAME/KEY: coding sequence LOCATION: 1969..3726 IDENTIFICATION METHOD: by similarity with known sequences OTHER INFORMATION: encodes bovine ephemeral fever virus GNS protein (ix) FEATURE: NAME/KEY: polyadenylation site LOCATION: 3731..3741 IDENTIFICATION METHOD: by similarity to an established consensus sequence PUBLICATION INFORMATION: AUTHORS: Walker, Peter J.

Byrne, Keren A.

Riding, George A.

Cowley, Jeff A.

WO 94/04685 WO 9404685PCI'/AU93/00430 Wang, Yonghong McWilliam, Sean The genome of bovine ephemeral fe\er TITLE: rhabdovirus contains two related glycoprotein genes JOURNAL: Virology VOLUME: 191 PAGES: 49-61 PUBLICATION: NOVEMBER 1992 (xi) SEQUENCE DESCRIPTION: SEQ ID No:1:

TTTGTCAACA

TTCATTTGGA

CTCATGAGAT

TTGCAA.AGGA

TAGAAGGATT

TTTCTACATC

ATGCAGTTAA

Cf:TTTTGGAA

CTTTCTTAA.A

TTAATGATAG

ATGTAAGAGT

TTAAATCATT

GGCTAGTCCA

TTGAGGATGG

AAATTGAAAA

TTGAAGAATT

AAATACTTAA

CAGGAAGGGA

CCTTACCAGA

GAGGGGGAAT

AATACAGACC

GACATAACAT

GAAATAGGCT

TGCATACAAA

TAATGGAGTA

AACCAGTAAA

AAATTCAAAA

CAAAGGCAGT

ACAAATTGTA

TAGAAGGACT

ATCAAGATTT

kAACTGGTGA

TGACAAAACA

CTATTTAATA

CCTGAGAATT

CAGTTGATGA

TGTACCCCAA

AAAAAGGTAA

TCACACCCAA

AATATTGAAG

GAGCTCGAAT

AATdAAGATA

TACCAATCAG

GGACCTCACA

GAAAATTTAC

CAAATGTCCA

TGAACATTAT

CATTTGTAGG

TATAGAATAT

GAAATTAGAT

TACTGAAATG

TCCTTATGAT

TAAAACAAAG

CGAAGAAATA

TAGGAGTGAA

CGTAAATAAA

AGAATGGTGG

ATGCAAGGGT

AGATATTAAG

TAAAGAAAAT

TTATGCATAT

CTCGGGTAGA

GGTGAAAAAG

TTTTGTTGAC

GTCTGGGAAT

GAATGTAACT

ATCTCTATAT

TGATAATGTG

TTTAA.ATCCA

AGGAGGGAAA

AAGATGGACA

TAAAATGGTC

TCA.ATCAACA

AGAATTAGGA

TGATAGGTTC

GTTTTTTAAA

TCGTATTAAT

GCACATCTAT

ACATCCGAAA

ATTATAGTAT

TTTGTAAAAT

TAGACAAGGC

AGCCTTATTA

TCATCAAATT

ATTATTTATE

AGTTTTGTCA

ATGTTCAAGG

AATGTTCCGG

CAACGTTTAA

AATAAGATTT

AAGCAAAGGT

CAGATATTAG

CAGGGTGCAT

AATCAAGAAA

AATTTAATTT

GGATGTCCTC

AGTGAGCACT

TTAAATGATA

GGATGTTTGT

AGTATAGAAA

AAAAAACCAG

GCTGAATTAG

ATAAATACAT

TTATTTGAGC

GTTTCCAAGG

AATCATTATG

AAGAACGAAG

CATGCTATAT

CTAAACGGAA

GAGGGGATAG

GAAGAGAACT

CATGAAAAAA

AAGGTTTTAT

ATTTGGGCTG

AAGTCCAACT

ACAAAAGAAA

TTATATGAAG

TTTGATCATT

AAAAAAATCA

ATACGGTGTG

CAGCCTGCAA

TCAGCTTTTG

GGAGAAAAAA

GCTGGAAAAT

CAAATGCCAT

TCCTCCTCCA

GATCAATTAT

TCAATTTGAT

ATCAAAAA.A7

TCCTCATAAT

TGAATTGTGG

ATGAATTATC

GTAGACCACA

GGATAACTAA

AGGTAATACC

TAATTCCCCC

TAGAATTCTA

ATGATTCTCG

TAAAAGACAT

GCAATAATAA

AAGAGAGATT

CGACATTTTG

ACCAAACAGA

GTTTTAGGAT

AACATGAAAG

TAGATATGTC

AAACAAGTTG

ATTGTAATAT

GGATAGGATC

ATGGCTATAT

TGGAAACAGC

TGATCTTCGT

AGGATTATCA

TGATTAGGTA

GTCAAATCAA

CTGCTGTTGT

TTGGTGCAAT

CATCTCACAG

ATATGAGGGT

AGATTAGAAG

AACATGAAAA

AGAGGCAACA

AGAACTTCCC

GATGGATTGA

GATGATACAT

TCAGAAGGGT

TTCGATCATG

GAG CTAATrAA

AAGTGTGATT

GATGTTATCC

AAAACTAACC

TGGATATGCC

TACCTTGCTA

AGAGCTTCAT

ACTTCAAGCC

GTTGAAAGAT

ATGTAGTGAA

AGAATATTCC

TTATTACCCT

TGTCCTAATA

ATTTTTAACT

AACC(.GAACA

ACATTGGGAA

ATGGGAAGCT

TGGGAAAAAT

ATCTGACTTC

GCACACAGAT

ATGCTTAAAC

TTACTTGGCT

GCAAGAAAAA

TGATTGGAGA

CTATAAAAGA

TGATATACAA

GCCGGCAGGA

GGAACCAACT

AAAATTGATC

TGAGGAGGAT

CAGAACTGAT

AGGTTGGTTT

AGTCACCACA

TAAGCATAGG

GGAAAAGAAT

CATCAAAGGT

AAACCATTTG

GGGCAATCAT

AGTCAACTTG

GAGAATTATG

ATAAAGAAAT

ATCGATGCGC

AAGTGACATA

TTAATAAAGA

CCTCTAAATC

TAGATCCGGT

CTATCCCTAT

ATGGGGATAA

GTCAATAAGA CCGGTAAAAG 120 CATCATAATC 180 GACGCTCATC 240 ACCTGGTATT 300 GGTTGCACAG 360 CCTGCTGGAT 420 CAACATAAGC 480 CCTTGTACTA 540 TGGATACCAG (00 TGCATTACAG 660 CCAGATATCG 720 GGCATCATTT 780 CAAAATTTTA 840 AGAACAGAGT 900 ACTATCAGTA 960 CCCACGAGAC 1020 CTCTGTTTGT 1080 ACATCAACAA 1140 GCTTGGTGTG 1200 GAATTGAATG 1260 GGAAGCTCCG J.320 AAATTATATT 1380 AAATTCGAGG 1440 GAGAAATTTA 1500 ATCGTAAGAG 1560 ACAAGCACGG 1620 TATGCTATCT 1680 GAAGCTGACC 1740 GACAAGAATT 1800 GGAAGTAAAC 1860 TGTCATGTGT 1920 GTTCCTGCAA 1980 GATTAACTAC 2040 CGGAGGTGAT 2100 AGGAGAA.ATA 2160 ATCGATAAAG 2220 TATAAGTGAA 2280 CTTGCTTAAC 2340 TTCAGTTAGT 2400 GGGATTTCAG 2460 TGATTATATA 2520 ATCTTACATC 2580 WO 94/04685 WO 9404685PCT/AU93/00430

CCGTTAGAAA

AGCATTATAT

TACTGCGGAA

CCTATAGTCT

TTGGCTAAGA

TTCGAACTTT

AATCTTCATT

GTTAGTACAA

ATGAGTATGT

ACTGATGAAG

AAGGGTAGAG

GATCACTTGT

CCATCTCGCT

AGAATATCAT

TTTAGGGATA

GAAGGCGATG

GGGTCTAGAG

TCCATCTGGG

AATAGAAGAG

GATTATTGAG

CAGGCAATG

TATTTAAAGG

ATGATAGCAA

AGCCAGCAAT

TAGGACTACC

AAAGATATTC

GCAAAA.AGAT

ATCTAGCTCC

CAATCAATCA

GTGAGTACAT

ATACTGTCAT

AGAATTGGTA

CTTATTACTG

ATATCCTTCA

TTTTCAAGTT

TAGAAGAATC

ATTACTGGAA

GAGATGAGAA

GGATTTCAAC

AAAAGATCTT

CATGAAAAAA

TGATAATCAG

TTTTGGAGAA

TAAATTATTC

ATCTTGCAAT

AAATGTTGGC

TAAAAAGAAC

ATTTGAGCA

ATCCCTAAGA

AACAGGTCAA

TATATTGGCC

rCAAGAACAG

GTACAATGGA

AACATTAAAG

TAGATTAGAA

ATCTGACCAA

TTGGGTTGAA

ACAAACCATA

TATAATCACA

CTTGAATATG

ATAATAACAA

GCTAGTATTA

TTACCAATTA

AATGGTGCCA

AGGAGTAGAA

CCTGTTTTAT

TTGGAATTAA

GGCAAGCATC

AATAAAGTTG

ATTATTGAAG

AATAACAAAG

GCTAATCCAA

GTTATGAGGA

AAAATATATA

AGAAACATAA

GATCACTCAC

GAAACCACAA

CAGAACAAAG

GTTCTCGGCA

AAACACAGAG

TAATTTACAC

GACTTGAGTT

GAGATGCCTG

TCATAAAGAT

TAGAAATGCC

TAACTACATT

AACAGCCAAT

CTGCCTTAGT

TACCTGTTAG

ATGGAATCAA

AGATCAAATG

ATATA'1ATAGA

GAGAAGATAA

CTGACACTGA

GATTAAGCTT

TAGGTTACAC

CAAAGAGTCA

AGAGACTAAT

GAATAAGAGA

ACCAATTAAC

GTATCGATTA

TATGCTGTCT

AAGGAATTTA

GAAAGATCTC

TAAAA.ACCCA

GTTTACCTAC

AAGAGAATCC

2640 2700 2760 2820 2880 2940 3000 3060 3120 3180 3240 3300 3360 3420 3480 3540 3600 3660 3720 3780 3789 CCAAA.ACGGA AGTAATTAAA AATCAGTCAA TAAAACACTA GTGACAAAAA TAAGACGGAT AATATTGGAA TGAAGA.ATCA TTTATTATAT ATATAGGAAA TACAAAGATT CTTTAAGTTG CGATCAATTT TAAATTGCAA INFQRMATION FOR SEQ ID No:2 SEQUENCE CHARACTERISTICS: LENGTH: 623 amino acid residues TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) if POTHETICAL: yes (iv) ANTI-SENSE: no (vi) ORIGINAL-SOURCE: ORGANISM: bovine ephemeral fever virus STRAIN: BB7721 (vii) IMMEDIATE SOURCE: CLONE: g207 (ix) FEATURE: NAME/KEY: N-glycosylation site LOCATION: 175.. 177 IDENTIFICATION METHOD: by similarity with known Nglycosylation sites (ix) FEATURE: NAME/KEY: N-glycosylation site LOCATION: 264. .266 IDENTIFICATION METHOD: by similarity with known NglycosyTlation sites WO 94/04685 WO 9404685PCTr/A U93/ 00430 (ix) FEATURE: CA) NAME/KEY: N-giycosyiation site CE) LOCATION: 416. .418 CC) IDENTIFICATION METHOD: by similarity with known Nglycosylation sites Cix) FEATURE: CA) NAME/KEY: N-glycosylation site CE) LOCATION: 438. .440 CC) IDENTIFICATION METHOD: by similarity with known Nglycosylation sites Cix) FEATURE: CA" NAME/KEY: N-glycosyiation site CB) LOCATION: 507. .509 CC) IDENTIFICATION METHOD: by similarity with known Nglycosylation sites Cix) FEATURE: CA) NAME/KEY: N-giycosyiation site CE) LOCATION: 563. .565 CC) IDENTIFICATION METHOD: by similarity with known Nglycosylation sites Cxi) SEQUENCE DESCRIPTION: SEQ ID No:2: Met Giu Lys Gin Arg Lys S er Thr Phe Lys Ala Ala Pro Gin Ile Asp Lys Val Ile Tyr His Giu His His Gin Leu Arg Trp Giu Tyr 100 Ala Val 115 Leu Asn Ile Asn Lys Ile Gin Lys Ile Val1 Ly s Leu Asp 70 Thr Ilie Ly s Ile Thr Leu Leu Val Asn Lys Ile His Leu Pro Cys Ala 55 Asp Ly s Leu Leu Val Asn 25 Pro Gin 40 Lys Asp Ala His Cys Ser Giu Val 105 Asp Gin 120 10 Cys Ar g Giu Leu Giu 90 Ile Gly Giy Leu His Giu Thr Pro Ala G lu Asn Tyr Gly Trp Giu Leu Leu Giu Asn Phe Tyr Tyr Ile 125 His Leu Lys Ile Phe S er 110 Pro Pro S er Ile Cys S er Gly Pro Tyr Pro Pro Ala Gly Cys Phe Trp Asn Thr Giu Met Asn Gin Giu Ile 130 135 140 WO 94/04685 WO 9404685PCT/AU93/ 00430 Giu Phe Tyr Val Leu Ile Gin His Lys Pro Phe Leu Asn Pro Tyr Asp 150 155 Asn Ser Pro Trp Giu 225 Gly Gly Ph e Thr His 305 Ile Asp Leu Tr p Ile 385 Ly s Met eu Lys Asp Glu 210 Arg Cys Giu Ly s Asp 290 Giu Asn Tyr S er Ar g 370 Gly Asn S er Ile Thr Val1 195 Cys Leu Leu Trp Ile 275 Arg Ar g Thr Ala Leu 355 Thr S er Glu Gly Tyr Lys 180 Arg Ile Trp S er Trp 260 Giu Thr Cys Leu Tyr 340 Pro S er Tyr Asy Asr 42( Asp 165 Sly Val Thr Giu Thr 245 S er Lys Glu Leu Asp 325 Leu *Asp Thr *Lys Sly 405 SHis 3 er Cys Glu VTal Ala 230 Phe Ile Cys Phe Asn 310 Met Phe S er Arg Arg 390 Tyr Ala Arg Pro Glu Lys 215 Pro Cys Giu Lys Glu 295 Thr S er Giu Gly Gly 375 Ala Ile Ile Phe Leu Ile 200 S er Asp Gly Asn Gly 280 Giu Ile Tyr Gin Arg 360 Gly Trp Asp Leu Leu Lys 185 S er Phe Ile Lys Gin 265 Lys Leu S er Leu Thr 345 Val1 Met Cys Ile Glu 425~ Thr 170 Asp Glu Arg Giy Asn 250 Thr Lys Asp Lys Ala 330 S er S er Val Glu Gin 410 Thr ?ro Ile Hi S er Leu 235 Gly Slu Pro Ile Ile 315 Pro Trp Lys Lys Tyr 395 Glu Ala Cys Thr Cys Gin 220 Vai Ile S er Sly Lys 300 Leu Thr Gin Asp Lys 380 Arg Leu Pro rhr Gly Asn 205 Leu His Ile Asp Ph e 285 Ala Asn Ar g Glu Cys 365 Asn Pro Asn Ala Ile Thr 190 Asn Asn Val Phe Phe 270 Ar g Gin Lys Pro Lys 350 Asn His Phe Sly Sly 430 Asn 175 rp Lys As p Asn Slu 255 Gin Met Len Sin Gly 335 Len Ile Tyr Val His 415 Sly 160 Asp Ile His Lys Lys 240 Asp Asn His Slu Asn 320 Arg Cys Asp Sly Asp 400 Asn Ser Ser Sly Asn Arg Leu Asn Val Thr Leu Asn Sly Met Ile Phe Val Slu 435 440 445 WO 94/04685 WO 9404685PCr/AU93/00430 Pro Thr Lys Leu Tyr Leu, His Thr Lys Ser Leu Tyr Giu Asp 465 Giu Asn Arg Trp Gly 545 Lys La~u Asn Lys (2) 450 455 Tyr Gin Lys Leu Ile Lys Phe Giu 470 Giu Asn Leu Ile Arg Tyr Giu. Giu 485 Leu Asn Pro His Giu Lys Ser Gin 500 505 Giu Ile Gin Lys Gly Gly Lys Lys 515 520 Phe Thr Ser Thr Aia Lys &la Vai 530 535 Aia Ile Vai Thr Thr Tyr Ala Ile 550 Ser Asn Ser Ser His Ser Lys His 565 Gin Ser Thr Thr Lys Giu Asn Met 580 585 Tyr Gin Asp Leu Giu Leu Gly Len 595 600 Giy Giy Ser Lys '3mn Thr Giy Asp 610 615 INFORMATION FOR SEQ ID No:3 SEQUENCE CHARACTERISTIC Vai Met 475 Asp Giu 490 Ile Asn Vai Leu Arg Trp Tyr Lys 555 Arg Giu 570 Arg Vai Tyr Gin Asp Arg 460 Giu Lys Ar g S er Thr 540 Leu Ala Giu Giu Phe 620 Tyr Phe Thr Aia 525 Ile Tyr Asp Lys Ile 605 Phe Giy Asp Lys Asp 510 Val1 Trp Lys Leu Asn 590 Arg Asp Ile Asn Pro 495 Ile Val Aia Met Giu 575 Asp S er His Giu Vali 480 Val1 Val1 Giy Vali Val1 560 Giy Lys Ile (iv) (vi) Cvii) Cix) CA) LENGTH: 586 amino acid residues TYPE: amino acid TOPOLOGY: linear MOLECULE TYPE: protein HYPOTHETICAL: yes ANTI-SENSE: no ORIGINAL S0URCEi ORGANISM: bovine ephemerai fever virus STRAIN: BB772i IMMEDIATE SOURCE: CLONE: g207

FEATURE:

CA) NAME/KEY: N-giycosyiation site LOCATION: 27. .29 WO 94/04685 PCT/AU93/00430 IDENTIFICATION METHOD: by similarity with known Nglycosylation sites (ix) FEATURE: NAME/KEY: N-glycosylation LOCATION: 68..70 IDENTIFICATION METHOD: by glycosylation sites (ix) FEATURE: NAME/KEY: N-glycosylation LOCATION: 274..276 IDENTIFICATION METHOD: by glycosylation sites similarity with known Nsimilarity with known N- (ix) FEATURE: NAME/KEY: N-glycosylation site LOCATION: 350..352 IDENTIFICATION METHOD: by similarity with known Nglycosylation sites (ix) FEATURE: NAME/KEY: N-glycosylation site LOCATION: 383..385 IDENTIFICATION METHOD: by similarity with known Nglycosylation sites (ix) FEATURE: NAME/KEY: N-glycosylation site LOCATION: 476..478 IDENTIFICATION METHOD: by similarity with known Nglycosylation sites (ix) FEATURE: NAME/KEY: N-glycosylation LOCATION: 501..503 IDENTIFICATION METHOD: by glycosylation sites similarity with known N- (ix) FEATURE: NAME/KEY: N-glycosylation site LOCATION: 521..523 IDENTIFICATION METHOD: by similarity with known Nglycosylation sites (xi) SEQUENCE DESCRIPTION: SEQ ID No:3: WO 94/04685 PTA9/03 PCF/AU93/00430 Met S er Leu Ile Cys Al a His Cys Pro Giu 145 Val1 Asn Lys Ph e S er 225 Cys Ala Cy s Phe Gin Gin Arg Thr S er Giu Hi Tyr 130 Leu Gly Pro Asn Ly s 210 le Ar g Ile Asn Leu S er Asp Asn Pro Ile Val Giu 115 Tyr Giu Ph e Ile Tr p 195 Giy Ile Leu Ile Ar g 275 Gin Leu Phe Asn Ile Val Leu Ile Tyr Gly Val Thr Gly Gin Asn Lys Thr 100 Leu Pro Phe Gin Pro 180 Ile Asp Tyr His Lys 260 S er Trp Leu Leu Tyr Lys Tyr Ile Pro Ile Asn 165 Ile Cys Asn Asp Tyr 245 Ile Ar g Ile Arg Leu S er 70 Lys Ile Ile Pro Lys 150 Giu Asp His Gin S er 230 Cy s Lys Ile Asn Giu Asp 55 Met Val1 S er Asn.

Lys 135 Leu As- Tyr Gly Al a 215 Asn Gly Giu Glu Tyr Leu 40 Asp Giu Ile Giu Lys 120 Cys Ile Asn Ile Asp 200 Ser Phe Ly s S er Met 280 Pro 25 Cys Thr Lys Cys S er 105 Asp Asp Asn Tyr Tyr 185 Lys Ile Gly Pro Pro 265 Pro Cys Asp Giu Giu Leu Ile Asn Lys 140 Val Gin Giu Ile Giu 220 Pro Lys Leu Asn Thr Gin Ile Gly Giu Asp Asn 125 S er Ile Phe Phe Pro 205 Leu Ile Leu Gly Leu 285 S er Leu Gly Tyr Asn Lys 110 Ile S er Leu Asp Cys 190 Leu Ile Ar g Phe Leu 270 Ala Arg Ile Met Giu Arg Phe Ala Giu Val Asp Lys 175 Gin Giu Lys Asp Asn 255 Pro Lys Thr S er Asn Ile Cys

ASP

Lys Giu Ser Pro 160 Thr S er Ile Leu Al a 240 Giy Ser Ly s Arg Tyr 290 Ser Asn Val Gly Pro Val Leu Leu Thr Thr 295 300 Leu Asn Lys Arg WO 94/04685 WO 9404685PCr/AU93/00430 Phe Giu Lt-u Cys Lys Lys Ile Lys Lys Asn Leu Giu Leu Lys Gin Pro 305 Ile His Leu Giu Thr 385 Trp Pro Asn Ile Arg 465 Giu Ser Val1 Asp S er 545 Ile Pro Pro Ar g Tyr 370 Asp Lys Asn Giy Leu 450 Ile Val1 Gin Giu Giu 530 Ile Tyr Ile Aia Asn 355 Ile G iu Asp Ile Vali 435 Gin S er Ile S er Giu 515 Lys Trp Ar g Asn Leu 340 Lys Thr Asp Leu Ile 420 Met Thr Phe Lys Vali 500 Thr Gin Gly Lys Asn 325 Vai Val Giy Thr Lys 405 Asp Arg Leu Phe Phe 485 Asn Thr Thr Ile Asn 565 310 Leu ryr Vali Gin Vali 390 Gly Lys Ar g Ly s Lys 470 Arg Lys S er Ile S er 550 Arg His Arg Pro Ile 375 Ile Arg Asn Giu Lys 455 Phe Asp Thr Asp Gin 535 Thr Arg Tyr Leu Vali 360 Ile Ile Giu Pro Asp 440 Ile Arg Ile Leu Lys 520 Asn Ile Giu Leu Vali 345 S er Giu Leu Asn Asp 425 Lys Tyr Leu Giu Giu 505 Asn Lys Ile Lys Aia 330 Ser Met Asp Aia Trp 41i0 His Phe Thr Giu Giu 490 Gly Lys Giu Thr Ile 570 315 Pro rhr Leu Giy Asn 395 Tyr Leu Thr Asp Ar g 475 S er Asp Thr Tyr Vali 555 Phe Phe Thr S er Ile 380 Asn Gin S er Tyr Thr 460 Asn S er Asp Asp Trp 540 Leu Leu Giu 11ia Met 365 Lys Lys Giu Ty:- Pro 445 Giu Ile Asp Ty= G ly 525 Asn Gly Asn Pro Asn 350 S er Arg Giu Gin Tyr 430 S er Arg Thr Gin Trp 510 S er Glu Ile Met Giy 335 Gin Met Asn Ile Ala 415 Trp Arg Giu Lys Asp 495 Asn Ar g Giu Tyr Ly s 575 320 Lys S er Cys Leu Lys 400 Asn Tyr Tyr S er Thr 480 His Trp Gly S er Tyr 560 His Arg Vai Gin Arg Phe Phe Lys Leu Asp Tyr

Claims (17)

1. An isolated DNA molecule comprising a nucleotide sequence encoding bovine ephemeral fever virus (BEFV) G protein and/or GN, protein.

2. The DNA molecule of claim 1, wherein said sequence encoding BEFV G protein has a sequence corresponding to nucleotides 21 to 1889 of SEQ ID No:l (as herein defined), or sequences having about 70% or greater identity therewith which encode proteins having the immunogeni. properties of said BEFV G protein.

3. The DNA molecule of claim 1, wherein said sequence encoding BEFV G, protein has a sequence corresponding to nucleotides 1969 to 3726 of SEQ ID No:l (as herein defined), or sequences having about 70% or greater identity therewith which encode proteins having the immunogenic properties of said BEFV G, protein.

4. A DNA vector which includes a sequence encoding BEFV G protein or GN, protein. The DNA vector of claim 4, wherein said vector is plasmid g207 deposited with the Australian Government Analytical Laboratories under accession number N92/44230.

6. BEFV G protein or an immunogenic fragment thereof, wherein said BEFV protein G or fragment thereof is the expression product of all or a portion of the DNA molecule of claim 2.

7. The BEFV G protein of claim 6 wherein the amino acid residue sequence of said G protein corresponds to SEQ ID No:2 (as herein defined).

8. BEFV GNS protein or an immunogenic fragment thereof wherein said BEFV GN protein or fragment thereof is the expression product of all or a portion of the DNA molecule of claim 3.

9. The BEFV GNs protein of claim 8 wherein the amino acid residue sequence of said protein corresponds to SEQ ID No:3 (as herein defined). A method for the production of BEFV G protein or G*s protein, said method comprising the steps of: I) preparing an expression vector WO 94/04685 PCT/AU93/00430 34 incorporating a DNA sequence comprising a sequence encoding bovine ephemeral fever virus (BEFV) G protein and/or protein; II) transforming a host cell with the expression vector prepared in step I; III) culturing said host cell under conditions in which G protein and/or Gn, protein is expressed; and IV). harvesting said expressed G protein and/or GN, protein from the culture prepared in step III.

11. A vaccine for protecting an animal against BEFV, said vaccine comprising BEFV G protein or an immunogenic fragment thereof together with an adjuvant, wherein said BEFV G protein or fragment thereof is the expression product of all or a portion of the DNA molecule of claim 2.

12. The vaccine of claim 11, wherein said vaccine further comprises BEFV Gs protein or an immunogenic fragment thereof, wherein said BEFV GNS protein or fragment thereof is the expression product of all or a portion of the DNA molecule of claim 3.

13. A vaccine for protecting an animal against BEFV, said vaccine comprising a non-patholog'al virus which expresses BEFV G protein.

14. The vaccine of claim 13, wherein said non- pathological virus is vaccinia virus. The vaccine of claim 13, wherein said non- pathological virus is rVV-G.

16. A method of protecting an animal agai.:st BEFV infection, said method comprising administering to said animal a vaccine according to claim 11.

17. A method of protecting an animal against BEFV infection, said method comprising administering to said animal a vaccine according to claim 12.

18. A method of protecting an animal against BEFV infection, said method comprising administering to said animal a vaccine according to claim 13. WO 94/04685 PCT/AU93/00430

19. A method of protecting an animal against BEFV infection, said method comprising administering to said animal a vaccine according to claim 14. A method of protecting an animal against BEFV infection, said method comprising administering to said animal a vaccine according to claim

21. The method according to claim 20 wherein a non- pathological virus which expresses BEFV GNS protein is administered in combination with said non-pathological virus which expresses BEFV G protein.