CA2171869A1 - Novel proteins/polypeptides and cotransfection plasmids and live recombinant carriers therefor - Google Patents

Abstract

Antigenically-active proteins are disclosed which are useful for formulation in vaccines for coronaviruses. The antigenically-active proteins are coronavirus proteins designated as the S protein and the SM protein. The S protein has either the A1, A2 and/or D antigenic regions modified, deleted or otherwise absent therefrom, so as to avoid provoking ADE. The signal peptide of the S protein may also be modified or deleted. Methods are disclosed for preparing the DNA coding sequences coding for these antigenically-active proteins as well as for formulating the proteins or the DNA coding sequences coding therefor in pharmaceutically acceptable carriers, including live recombinant carriers for protecting mammals against coronavirus infection. The antigenically-active proteins and vaccines disclosed herein are particularly directed to FIP and protecting felines against FIPV infection.

Description

~ W 095/07987 21 71 ~ ~ ~ PCTAEP94/02990 NOVEL PROTEINS/POLY~ ~ES AND COTRANSFECTION
pT.A~HTnS AND LIVE R~.COHRTNANT l'.ARRT~.R.S THE:REFOR

The present invention relates to proteins/polypeptides which are antigenically-active so as to be capable of stimulating the immunity of cats (Felidae) against coronaviruses, and in parti-cular, feline infectious peritonitis virus, the preparation and cloning of base sequences coding for such antigenically-active proteins/polypeptides, cotransfection vectors having the base sequences coding for such proteins/polypeptides, live recombinant carriers for expressing such antigenically-active protein/-peptides and to vaccines having such Live Recombinant Carriers.
Feline Infectious Peritonitis (FIP) is a normally-fatal infectious feline disease. FIP is caused by a coronavirus known as the Feline Infectious Peritonitis Virus (FIPV). Infection occurs by one of two routes: in utero transmission; and oral/nasaloral ingestion.
FIPV belongs to the coronavidae family of viruses. The genomic plus-strand RNA of the coronavidae family is approxi-mately 27 to 31 kilo base pairs (kbp), making it the largest among RNA viruses. Among other members of the family, feline enteritis coronavirus (FECV) is the most closely related.
Coronaviruses are spherical particles having a spiral-like nucleocapsid which is enveloped by a lipid-containing envelope.
These viruses contain four proteins of interest herein. These proteins are: the nucleocapsid (N) protein, which is approxi-mately 40-50K (kilodaltons) in size; a membrane protein, known as the spike (S) protein, which is approximately 180-200K in size; a membrane protein, known as the matrix (M) protein, which is approximately 25-30K in size; and another membrane protein known as the small membrane (SM) protein, which is approximately lOK in size.
Classical approaches attempted to develop a vaccine against W O 95/07987 ~ 9 PCT~P94/02990 coronaviruses, especially FIP, include vaccination with live attenuated FIPV and heterologous live coronaviruses. However, the humoral antibodies obtained by the use of such vaccines have largely proven to be ineffective. Indeed, felines which have developed antibodies against FIPV as a result of earlier infection will often develop clinical phenomena and lesions much sooner, and will survive the onset of the infection for a much shorter period (in a phenomena known as "early death" syndrome) than those felines which have not been so treated.
"Early-death" syndrome is, presumably, the result of a phenomena known as antibody dependent enhancement (ADE). This phenomena finds counterparts in herpesviridae, poxviridae, rhabdoviridae, flaviviridae, alphaviridae, reoviridae and bunyaviridae. This phenomenon is believed to be based upon the binding of virus antibody complexes to the Fc-receptors of macrophages. In vitro, ADE of feline macrophage infectivity has been demonstrated to involve the formation of a ternary complex:
virus/anti-virus antibody/macrophage fragment c receptor (FcR).
Such binding is said to be more efficient than binding between macrophages and virus without the intermediary of antibodies.
The result is that infection occurs more rapidly and more efficiently when the virus binds in a complexed form than when the virus binds in a non-complexed form. This complex enhances the uptake of virus by the macrophages and its further replication, suggesting the mediation, in vivo, of ADE of FIP.
These macrophages then behave like vectors for dissemination of the virus in the feline.
European Patent Application No. 411,684 in the name of DUPHAR INTERNATIONAL RESEARCH discloses recombinant vaccines whose antigen is constituted by the M protein or the N protein of FIPV. The vaccines are prepared by coupling the protein to a suitable carrier. The use of various suitable live recombinant carriers is also disclosed therein.
European Patent Application No. 264,979 in the name of DUPHAR INTERNATIONAL RESEARCH discloses a recombinant vaccine for FIPV whose antigen is constituted by the S protein or certain ~ W O 95/07987 21 71 8 ~ 9 PCTAEP94/02990 fragments thereof. The vaccines are prepared with the S protein or fragment thereof being coupled to a suitable carrier. The use of live recombinant carriers is also disclosed.
PCT Patent Application No. 92/08487 discloses the use of the FIPV S protein in a recombinant vaccine introduced by this virus.
European Patent Application No. 510,773 discloses a vaccine for canine coronavirus which includes therein a polypeptide having at least one antigenic determinant of the S protein of the canine coronavirus. It is mentioned therein that that canine coronavirus vaccine also protects cats against infectious peritonitis.
European Patent Application No. 310,362 discloses a temperature sensitive FIP virus, a vaccine containing that virus and the use thereof in immunizing felines against FIP infections.
The vaccine confers partial protection in specified pathogen-free cats. Unfortunately, the high rate of mutation and natural recombination in the coronaviridae family presents a risk in the use of such mutated FIPV strains as a vaccine.
There remains a need for new antigenically-active agents, such as proteins/polypeptides, which stimulate the immunity of cats (Felidae) against coronaviruses, and in particular FIPV.
There further remains a need to provide such proteins/poly-peptides in vaccines, including those having live recombinant carriers, which are capable of protecting -mm~ (such as felines) against the disease while avoiding the phenomena of an~ibody dependent enhancement.
It is a primary object of the present invention to identify and provide new proteins/polypeptides which are antigenically-active against coronaviruses, and in particular against FIPV.
It is another primary object of the present invention to provide such proteins/polypeptides which have been modified, so that regions thereof capable of causing antibody dependent enhancement, are either modified or deleted therefrom, so as to be ADE-inactive, thereby avoiding antibody dependent enhancement.
It is a further primary object of the present invention to determine and provide base sequences coding for the new W 095/07987 PCT~EP94/02990 ~

antigenically-active proteins/polypeptides and to clone the same for providing the antigenically-active proteins/polypeptides.
It is a yet further primary object of the present invention to prepare and provide plasmids (cotransfection and expression plasmids) useful for the expression of antigenically-active proteins/polypeptides, including the proteins/polypeptides of the present invention.
It is a still further primary object of the present invention to prepare and provide plasmids (cotransfection plasmids) useful for the preparation of Live Recombinant Carriers (LRC's).
It is a still yet further primary object of the present invention to provide cotransfection plasmids containing the base sequences coding for antigenically-active proteins/polypeptides, including the new antigenically-active proteins/polypeptides of the present invention, which cotransfection plasmids can be used for cotransfection with viral DNA, such as FHV-1 DNA, so as to form a live recombinant carrier capable of expressing the anti-genically-active proteins/polypeptides in the target animal in vivo.
It is a still yet further object of the present invention to provide live recombinant carriers for expressing various anti-genically-active proteinstpolypeptides, including the proteins/-polypeptides of the present invention, in the target animal in vivo.
It is a further primary object of the present invention to formulate such antigenically-active proteins/polypeptides into vaccines for the protection of l~ -1s against coronaviruses, and in particular for the protection of felines against FIPV.
It is a particular object of the present invention to provide such a vaccine for the protection of ~ma~s against coronaviruses, and in particular for the protection of felines against FIPV, that includes, as a part thereof, a live recombinant carrier.
In accordance with the teachings of the present invention, novel proteins/polypeptides are disclosed herein. These W O 95/07987 ~ 71~ 5 PCT~EP94/02990 proteins/polypeptides are antigenically-active for protecting mammals (such as felines) against coronaviruses (such as FIPV) without provoking ADE.
The proteins disclosed herein include modified coronavirus S
proteins [proteins in which certain regions (fragments) thereof, which can include regions (fragments) which we believe induce ADE, are either modified and/or absent, having been deleted therefrom]. Various of these modified coronavirus S proteins have at least one of the A1, A2 or D antigenic regions modified (so as to be ADE-inactive) or removed (deleted) therefrom, so that said regions are ADE-inactive. In one embodiment, the modified coronavirus S proteins have the Al and the A2 antigenic regions modified or removed therefrom, so that said regions are ADE-inactive. In another embodiment, the modified coronavirus S
proteins have the Al and the D antigenic regions modified or removed therefrom, so that said regions are ADE-inactive. In yet another embodiment, the modified coronavirus S proteins have the A2 and the D antigenic regions thereof modified or removed therefrom, so that said regions are ADE-inactive. Most preferably, the modified coronavirus S proteins of the present invention have the A1, A2 and the D antigenic regions modified or removed therefrom, so that said regions are ADE-inactive.
Such proteins/polypeptides are sometimes generally referred to herein as "ADE-epitope-deleted S proteins".
Preferably, the modified coronavirus proteins of the present invention are a modified S protein. In this regard, most preferred is a modified FIPV S protein, wherein at least one of the A1, A2 or D antigenic regions have been modified or removed therefrom, so that said modified regions are ADE-inactive.
By the term "antigenically-active" what is meant is that the substance or entity spoken of (such as a protein and/or poly-peptide, and/or a portion thereof, which includes one or more epitopes) induces or stimulates a host's immune system to make a humoral and/or cellular antigen-specific response (against, for example, FIPV or FHV-1).
By the term "antigenic region(s)" what is meant are amino W095/07987 ~ PCTI~P9~/0~990 acid sequences ~including one or more epitopes) of, for example, a protein/polypeptide which induce or stimulate a host's immune system to make a humoral and/or cellular antigen-specific response (against, for example, FIPV or FHV-1).
By the term "antigen" what is meant is a molecule (such as, for example, a proteintpolypeptide) having one or more epitopes that will stimulate a host's immune system to make a humoral andJor cellular antigen-specific response.
By the term "ADE-inactive" what is meant is that the substance or entity spoken of (such as a modified protein and/or polypeptide andfor region of a modified protein and/or poly-peptide) does not provoke (induce) antibody dependent enhancement (ADE). As used herein, this term may refer to substances or entities which may or may not still be antigenically-active. As used herein, this term specifically refers to the region(s) of the S protein in which the ADE-epitopes (of the A1 and/or A2 and/or D antigenic regions) have been either modified or removed therefrom, so that such regions do not provoke ADE.
The term "epitope" refers to the site on an antigen to which a specific antibody molecule binds.
The new antigenically-active proteins of the present invention also include modified coronavirus S proteins in which the S protein has had its signal peptide removed therefrom (by, for example, cleaving). Such proteins/polypeptides are variously referred to herein as "deleted S proteins" and "del S proteins".
Preferably, such modified coronavirus S protein is a modified FIPV S protein.
The new antigenically-active proteins of the present invention further include a substantially-pure coronavirus SM
protein having an amino acid sequence being substantially homo-logous with the amino acid sequence of Figure 1. In particular, the novel antigenically-active proteins include a substantially pure FIPV SM protein.
The preferred antigenically-active proteins to be used in the live recombinant carriers and the vaccines of the present invention (including the coronavirus S proteins and the W O9St07987 1 718~9 PCT~EP9~/02990 coronavirus M proteins, in addition to the modified coronavirus S
proteins and the coronavirus SM proteins discussed above) are all derived from the nucleic acid sequence of FIPV. Preferably, the SM and the M proteins of the present invention are derived from the FIPV nucleic acid sequence of plasmid B12 and the S (spike) protein is derived from the FIPV nucleic acid sequence of pUCE2.
As used herein, the term "derived from" when used in reference to amino acid sequences of the proteins/polypeptides and nucleic acid sequences coding therefor, what is meant is that the amino acid and nucleotide sequences being spoken of (before any modification thereof) are native to the particular protein/-polypeptide and/or microorganism (such as FIPV and/or FHV-1) from which they are identified as being derived.
As used herein, the term "M protein" is used to refer to the same protein designated as the M protein in European Patent Application No. 411,684. The complete amino acid sequence, as well as the complete nucleotide sequence which codes therefor are also disclosed in European Patent Application No. 411,684, the entirety of which disclosure is incorporated herein by reference.
As used herein the term "SM protein" refers to the novel small membrane protein of FIPV whose isolation cloning and structure are described herein. The complete amino acid sequence of this SM protein (SEQ ID N0: 3), the complete nucleotide sequence which codes therefor (SEQ ID N0: 1) and the translation of that nucleic acid sequence into amino acids (SEQ ID N0: 2) are set forth in figure 1.
As used herein the term "S protein" is used to refer to the same protein designated as the S protein in European Patent Application No. 264,979. The complete amino acid sequence, as well as the complete nucleotide sequence which codes therefor, J are also described in European Patent Application No. 264,979.
The coding sequence of the S-gene begins with an ATG codon in positions 367-369 as designated therein and ends with the stop codon in the positions 4723-4725 as designated therein. The coding part of the S-gene thus comprises 4356 base pairs and codes for a protein of 1452 amino acids. The entirety of W 095l07987 PCT~EP9~102990 ~ 8 European Patent Application is incorporated herein by reference.
As used herein, the term "Al antigenic region" is used to refer to amino acid residues coded for by the base sequences of the FIPV S protein as designated in European Patent Application No. 264,979 begining with the GCT codon in positions 1963-1965 through the CTA codon in positions 2029-2031.
As used herein, the term "A2 antigenic region" is used to re~er to amino acid residues coded for by the base sequences of the FIPV S protein as designated in European Patent Application No. 264,979 begining with the ACT codon in positions 2116-2118 through the GCT codon in positions 2176-2178.
As used herein, the term "D antigenic region" is used to refer to amino acid residues coded for by the base sequences of the FIPV S protein as designated in European Patent Application No. 264,979 begining with the TCA codon in positions 1489-1491 through the TAC codon in positions 1570-1572.
As used herein, the term "ADE-epitope-deleted S protein" is used to refer to the S protein having at least one of the A1 antigenic region, the A2 antigenic region and/or the D antigenic region thereof either modified, deleted or absent therefrom, so that such region is ADE-inactive.
As used herein, the term "delS protein" is used to refer to amino acid residues coded for by the base sequences of the FIPV S
protein as designated in European Patent Application No. 264,979 (begining with an ATG codon in positions 367-369 as designated therein and ends with the stop codon in the positions 4723-4725 as designated therein) but in uhich the amino acid sequence begining with the ATT codon in positions 370-372 through (and including) the AGT codon in positions 421-423, has been deleted therefrom. In this regard, it is noted that the delS protein is the same as the S protein but without the signal sequence thereof.
As used herein, the term "ADE-epitope-deleted" is generally used to refer to proteins (including the ADE-epitope-deleted S
protein) wherein at least one epitope thereof which may result in antibody dependent enhancement (ADE) is either modi~ied or W O95/07987 ~6~ 9 PCT/EP9~/02990 deleted therefrom, so that said epitope is ADE-inactive.
The proteins to which the invention relates each further have at least one region which is antigenically-active, but which does not provoke ADE.
The proteins/polypeptide according to the present invention may be prepared according to standard methods known for the preparation of peptides and proteins. Such methods include the synthetic preparation thereof by means of known techniques starting from the individual amino acids or smaller peptide fragments.
The antigenically-active protein(s)/polypeptide(s) may also be obtained biosynthetically while using recombinant DNA
techniques and expression systems, for example, by:
a) transformation of host cells with an appropriate (i.e., expression) vector having a nucleotide sequence coding for the antigenically-active proteins/polypeptides of the present invention;
b) expressing the nucleotide sequence coding for the antigeni-cally-active proteins/polypeptides;
c) harvesting the cell culture; and d) isolating the expressed antigenically-active proteins/poly-peptides.
The invention therefore also relates to a method of preparing a DNA mo ecule which codes for the antigenically-active (to coronaviruses) modified S protein(s)/polypeptides according to the invention. Such a method comprises the steps of:
a) isolating an expression cassette coding for the desired coro-navirus S protein (such as the FIPV S protein);
b) determining the location of the nucleotide base sequences coding for the region(s) of interest of the the S protein which are desired to modified or deleted (i.e., at least one antigenic region) ; and c) modifying or deleting the nucleotide base sequences coding for the at least one region of interest.
In a preferred embodiment, the region(s) of interest is the signal peptide sequence of the S protein. In that embodiment, W O 95107987 9 ~ PCT~EP9~/02990 ~

2~ o the nucleotide base sequence coding for the signal peptide sequence is deleted therefrom, so that no signal peptide is coded for by the nucleotide sequences.
In other preferred embodiments, the region(s) of interest are at least one of the antigenic regions. In those embodiments, the nucleotide base sequences coding for at least one of the antigenic regions of interest have been modified or deleted therefrom, so that the corresponding region of any protein coded for thereby is ADE-inactive. Preferably, these antigenically-active region(s) of interest are at least one of the Al, A2 and D
antigenic regions. Most preferred is that the antigenically-active regions are all of the A1, A2 and D regions.
As used herein, the terms "protein of interest" refers to those proteins which are desired to be expressed and/or modified and/or deleted as the case may be.
As used herein, the term "antigenic regions of interest"
refers to those antigenic regions which are desired to be modified and/or deleted from the protein/polypeptide to be expressed.
In further accordance with the teachings of the present invention, coronavirus vaccines (such as FIPV vaccines) are disclosed herein which are effective for protecting a mammal (such as a feline) against a coronavirus (such as FIPV) in the absence of (while avoiding inducing or not provoking) ADE.
In a preferred embodiment, the vaccines include the new antigenically-active coronavirus protein(s)/polypeptide(s) (against coronaviruses) in a suitable carrier. Preferably, these antigenically-active protein(s)/polypeptides(s) are derived from FIPV. When fragments are used instead of whole proteins, they may be used coupled to suitable known carriers in manners well-known to those skilled in the art. Examples of such carriers are KLH or BSA.
Preferably, the vaccines include the coronavirus S protein.
In a most preferred embodiment, the coronavirus S protein is a modified coronavirus S protein. In this regard, it is further preferred that the modified coronavirus S protein be modified so W 095/07987 ~ PCTA~P9~/02990 as to have at least one of the Al, A2 or D antigenic regions thereof modified or deleted therefrom so as to be ADE-inactive.
Alternatively, it is preferred that the modified coronavirus S
protein be modified so as to have the signal peptide sequence deleted therefrom.
In other preferred embodiments, the vaccine includes the novel coronavirus SM protein of the present invention or the coronavirus M protein.
If desired, the vaccines may include any combination of two or more of the above antigenically-active coronavirus proteins/polypeptides.
In another preferred embodiment, the vaccines are formulated to include a live recombinant carrier, whereby expression of the antigenically-active protein(s)~polypeptide(s), in vivo, in a host organism in need thereof, is obtained.
In this respect, the DNA molecule obtained as described above may be inserted in a manner known per se into an expression vector as a result of which a recombinant expression vector is formed. This vector may then be inserted into a suitable host cell, for example, by transformation or cotransfection.
It is especially preferred that the vaccines disclosed herein include the DNA sequences (molecule) coding for the antigenically-active protein(s)/polypeptide(s) of the invention incorporated into a live recombinant carrier (LRC) with the aim of producing a vaccine capable of expression of said peptide(s) or protein(s) in susceptible host cells and/or host organisms.
In this manner, the antigenically-active protein(s)/poly-peptide(s) of the present invention are expressed in the target animal, in vivo. For this purpose, the nucleotide base sequences which code for the SM protein and/or the modified S protein (or parts thereof) may be incorporated in live recombinant carriers (LRC). Examples of such suitable LRC~s are vaccinia LRC, herpes-LRC, adeno-LRC, adeno-associated-LRC, sindbis-LRC, corona-LRC and bacterial-LRC.
In accordance with the further teachings of the present invention, disclosed herein is a live recombinant carrier W 095/07987 PCT~EP9~/02990 ~ ~ S ~ ~ 12 comprising FHV-l, the genome of which has DNA sequences coding for a modified coronavirus S protein, wherein at least one DNA
sequences coding for the A1, A2 or D antigenic regions have been modified or removed therefrom, so that said regions of the protein coded for thereby are ADE-inactive. Preferably, in this live recombinant carrier, the DNA sequences coding for the A1, A2 and D antigenic regions have all been modified or removed therefrom, so that said A1, A2 and D regions of the modified S
protein coded for thereby are all ADE-inactive. It is further preferred that the modified coronavirus S protein is a modified FIPV S protein.
In still further accordance with the teachings of the present invention, also disclosed herein is a live recombinant carrier comprising FHV-1 whose genome has DNA sequences coding for a modified coronavirus S protein, and more preferably, a modified FIPV S protein, whose signal peptide has been modified or removed therefrom.
In a yet further accordance with the teachings of the present invention, also disclosed herein is a live recombinant carrier comprising FHV-1 whose genome has DNA sequences coding for a coronavirus SM protein, and more particularly an FIPV SM
protein. In this fashion, the live recombinant carrier expresses the coronavirus SM protein.
In yet still further accordance with the yet further teachings of the present invention, disclosed herein is a live recombinant carrier comprising FHV-1 whose genome has DNA
sequences coding for a coronavirus M protein, and more preferably an FIPV M protein. In this fashion, the live recombinant carrier expresses the coronavirus SM protein.
In another aspect of the present invention, a live recombinant carrier for in vivo expression of at least one protein/polypeptide of interest in a target mammal is disclosed.
This live recombinant carrier includes a viral strain. This live recombinant carrier further has DNA expression sequences (signals) derived from RSV or HCMV and SV40 which have been incorporated into the genome of the viral strain. Finally, this W O9S/07987 ~ 8 6 9 13 PCT~P94/02990 live recombinant carrier further has a nucleotide coding sequence coding for a protein of interest (such as a coronavirus protein), which has also been incorporated into the genome of the viral strain, for a protein of interest to be expressed by the live recombinant carrier. Preferably, the viral strain is FHV-l and the nucleotide coding sequence codes for an antigenically-active coronavirus protein.
In this respect, the present invention further includes cotransfection vectors useful for cotransfection with viral DNA
(of, for example, FHV-l) for the production of live recombinant carriers capable of expressing proteins/polypeptides of interest, in susceptible target host cells and/or host organisms (animals).
In further accordance with the teachings of the present invention, disclosed herein is a cotransfection plasmid for cotransfection with viral DNA. This cotransfection plasmid includes at least a portion of the DNA sequences which flank (the flanking sequences) the insertion site in the viral genome.
This cotransfection plasmid further includes expression sequences (signals) derived from RSV or HCMV and SV40. Finally, this cotransfection plasmid has the coding sequences for a protein of interest to be expressed by the live recombinant carrier to be produced using this cotransfection plasmid. Preferably, the protein of interest is an FIPV protein. These expression sequences (signals) and the coding sequences are operably joined to one another.
By the term "insertion site" what is meant is that site of the viral genome into which nucleotide sequences including at least those nucleotide sequences coding for the proteins/polypeptides of interest (such as the coronavirus proteins) are inserted.
By the term "fl~nking sequences" what is meant is refers to a portion of those nucleotide sequences which are located adjacent to, and upstream and downstream from, the insertion site.
The inclusion of the flanking sequences permits the cotransfection plasmid to sucessfully recombine with the viral W O 95/07987 PCTAEP9~/02990 6~ 14 DNA (FHV-1) which is cotransfected therewith. In this regard, it is yet further preferred that both the viral DNA (to be cotransfected) and the fl ~nk; ng sequences of the cotransfection plasmid are derived from FHV-1 DNA. It is most preferred that the flanking sequences include nucleotide sequences derived from the thymidine kinase gene of the viral strain (i.e., FHV-1) to be transfected therewith.
Preferably, the proteins~polypeptides of interest are antigenically-active coronavirus proteins/polypeptides and, more particularly, antigenically-active FIPV proteins~polypeptides.
In a preferred cotransfection plasmid, the coding sequences for the protein of interest code for a modified coronavirus S
protein and, more particularly, a modified FIPV S protein.
In one preferred embodiment, the coding sequences for the modified coronavirus S protein (the protein of interest) code for a modified coronavirus S protein which has had the signal peptide deleted therefrom. In such an instance, especially preferred are the cotransfection plasmids pdTKHCMVSIG and pdTKSIGLAC and pdTKRSVSSIG and pdTKRSVSSIGLAC.
In another preferred embodiment, the coding sequences for the modified coronavirus S protein (the protein of interest) code for a modified coronavirus S protein which has had at least one of the antigenic regions thereof either modified or deleted therefrom, so that said regions of the protein coded for thereby are ADE-inactive. In this regard, the preferred antigenic regions of interest are at least one of the A1, A2 or D antigenic regions thereof either modified or deleted therefrom, so that said regions are ADE-inactive. In such an instance, especially preferred are the cotransfection plasmids pdTKHCMVSDAD and pdTKSDADLAC and pdTKRSVSDAD and pd TKRSVSDADLAC.
In still another preferred embodiment, the coding sequences for the protein of interest codes for the coronavirus S protein and, more preferably, the FIPV S protein. In such an instance, especially preferred are the cotransfection plasmids pdTKHCMVS
and pdTKSLAC and pdTKRSMVS and pdTKRSVSLAC.
In still yet another preferred embodiment, the coding ~ W 0 95/079~7 2~ PCT~EP94/02990 ~6~

sequences for the protein of interest codes for the coronavirus S~ protein and, more preferably, the FIPV SM protein. In such an instance, especially preferred are the cotransfection plasmids pdTKHCMVMS and pdTKMSLAC and pdTKRSVMS and pdTKRSVMSLAC.
In a still yet further preferred embodiment, the coding sequences for the protein of interest code for the coronavirus M
protein and, more preferably, the FIPV M protein. In such an instance, especially preferred are the cotransfection plasmids pdTKHCMVM and pdTKMLAC and pdTKRSVM and pdTKRSVMLAC.
Further disclosed herein is a method of preparing the vaccines of the present invention by isolating and purifying the antigenically-active protein(s)/polypeptide(s), including the new antigenically-active protein(s)/polypeptide(s) of the present invention, and then formulating the purified protein(s)/polypeptide(s) in a pharmaceutically-acceptable carrier.
Still further disclosed herein is a method of preparing the vaccines of the present invention comprised of isolating and purifying the DNA nucleotide base sequences coding for the desired antigenically-active protein(s)/polypeptide(s), including those of the present invention, and then incorporating said nucleotide base sequences into viral DNA for production of a live carrier.
In the above regard, disclosed herein is a method of preparing a coronavirus vaccine including the steps of:
a) isolating and purifying a DNA sequence coding for an antigenically-active coronavirus protein;
b) forming a cotransfection plasmid having the DNA sequence coding for the antigenically-active coronavirus protein;
c) cotransfecting the cotransfection plasmid and FHV-1 viral DNA, so as to form a live recombinant carrier capable of coding for the antigenically-active coronavirus protein for expressing the antigenically-active coronavirus protein in the target animal _ vivo; and d) combining the live recombinant carrier with a pharmaceutically-acceptable carrier.

W 095/07987 PCT~EP9~102990 Furthermore, in the above regard, further disclosed herein is a method of preparing an FIPV vaccine including the steps of:
a) isolating a DNA sequence coding for an FIPV S protein being antigenically-active;
b) modifying DNA sequences coding for the Al, A2 or D antigenic regions of the FIPV S protein, so that at least one of the said modified antigenic regions of the protein coded for thereby is ADE-inactive;
c) forming a cotransfection plasmid having the DNA sequence coding for the modified FIPV S protein;
d) cotransfecting FHV-l viral DNA with the cotransfection plasmid, so as to form a live recombinant carrier capable of coding for the antigenically-active modified ~IPV S protein for expressing the antigenically-active modified FIPV S
protein in the target animal in vivo; and e) combining the live recombinant carrier with a pharmaceutically-acceptable carrier.
When used herein, the terms "cloned", "subcloned", "introduced", "ligated", "inserted" and~or the like, when speaking of DNA fragments, what is meant is, when necessary, the digestion (restriction) of donor and/or receptor DNA sequences, the treatment of cohesive protruding 3' and 5' ends (terminii) thereof (when needed and/or desired), the separation of such fragments according to size (or nucleotide sequences) and/or extraction (isolation) of such fragments (when needed and/or desired), the dephosphorylization of such fragments, including linearized vectors (as needed and/or desired) and the ligation of such fragments to one another to form a recombinant moleculeSuch a definition further includes the transformation of host cells with such recombinant molecules, the selection of such transformants and the isolation and purification of recombinant DNA molecules (such as plasmids) from such host cells.
As used herein, the term "expression cassette" refers to discrete DNA sequences which include those regions of DNA
(nucleotide sequences), including a structural gene and expression sequences required for transcription and translation W O95/07g87 PCT~EP94102990 2 ~ 71 ~ ~ ~ 17 of the protein/polypeptide coded for by the structural gene in a host.
As used herein, the term "expression sequences" refers collectively to promoter sequences, ribosome binding sites and polyadenylation signals which collectively provide for the transcription and translation of a coding sequence in a host cell.
By the term "promoter sequences" what is meant are sequences upstream of the structural gene's coding sequence (the nucleotide sequence which codes for the protein/polypeptide of interest) which permit the binding of RNA polymerase and transcription of the coding sequence to occur.
By the term "structural gene" what is meant is a nucleotide sequence which serves as a template for the synthesis of RNA and which allows the synthesis of the protein of interest by a host thereof.
In another aspect of the present invention, disclosed herein is a method for immunizing ~ ls, and in particular felines, against coronavirus infection and, in particular, against FIPV, which comprises preparing the coronavirus vaccine of the present invention and administering a therapeutically-effective quantity of the vaccine to a mammal and, in particular, a feline in need thereof.
In yet another aspect of the present invention, disclosed herein is a method of protecting a feline from FIPV including the steps of preparing the FIPV vaccine disclosed herein and administering a therapeutically-effective quantity of the vaccine to a feline in need thereof.
~ Administration to the target animal of the vaccines of the present invention which include the live recombinant carriers leads to expression of the inserted genes, including the SM
protein and/or the modified S proteins of the present invention, and/or the M protein and/or the S protein, in all infected cells.
Figure l is the amino acid sequence of the SM protein and the corresponding nucleotide base sequence that codes for the SM protein.

Pigure 2 is a restriction map of pdTK.
Figure 3 is a restriction map of pSV40polyAE.
Figure 4 is a restriction map of pSV40polyAL.
Figure 5 is a restriction map of pHCMVpolyAE.
5 Figure 6 is a restriction map of pHCMVpolyAL.
Figure 7 is a restriction map of pRSVpolyAL.
Figure 8 is a restriction map of pRSVpolyAE.
Figure 9 is a restriction map of pSVLACE.
Figure 10 is a restriction map of pHCMVLACE.
10 Figure 11 is a restriction map of pdTKSVLAC.
Figure 12 is a restriction map of pdTKCMVLAC.
Figure 13 is a restriction map of pHCMVMS.
Figure 14 is a restriction map of pHCMVM.
Figure 15 is a restriction map of pRSVMS.
15 Figure 16 is a restriction map of pRSVM.
Figure 17 is a restriction map of pdTKHCMVM.
Figure 18 is a restriction map of pdTKHCMVMS.
Figure 19 is a restriction map of pdTKMLAC.
Figure 20 is a res triction map of pdTKMSLAC.
Figure 21 is a res triction map of pdTKRSVM.
Figure 22 is a restriction map of pdTKRSVMS.
Figure 23 is a restriction map of pdTKRSVMLAC.
Figure 24 is a restriction map of pdTKRSVMSLAC.
Figure 25 is a restriction map of pHCMVS.
Figure 26 is a restriction map of pRSVS.
Figure 27 is a restriction map of pdTKHCMVS.
Figure 28 is a restriction map of pdTKSLAC.
Figure 29 is a restriction map of pdTKRSVS.
Figure 30 is a restriction map of pdTKRSVSLAC.
Figure 31 is a restriction map of pHCMVSIG.
Figure 32 is a restriction map of pRSVSIG.
Figure 33 is a restriction map of pdTKHCMVSIG.
Figure 34 is a restriction map of pdTKSIGLAC.
Figure 35 is a restriction map of pdTKRSVSIG.
35 Figure 36 is a restriction map of pdTKRSVSIGLAC.
Figure 37 is a res tri c t ion map of pHCMVSDAD.

~ ~ 7~ $ ~ PCTMEP94/02990 Figure 38 is a restriction map of pRSVSDAD.
Figure 39 is a restriction map of pdTKHCMVSDAD.
- Figure 40 is a restriction map of pdTKSDADLAC.
Figure 41 is a restriction map of pdTKRSVSDAD.
Figure 42 is a restriction map of pdTKRSVSDADLAC.
The DNA clonings and sequencing techniques and procedures employed herein are those which are described by Sambrook et al, in ~olecular Cloning -- A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989).
The cell and tissue culturing techniques and procedures utilized herein are those which are described by Doyle et al, in Cell & Tissue Culture: Laboratory Procedures, John Uiley Publishing (1993).
The invention will now be described in more detail with reference to the follouing specific examples.
EXAHPLE 1 - PROPAGATION 0~ EELINE ~ER~vlKu~ B~-1).
The FHV-1 viral strain utilized was a live attenuated vaccine strain that was isolated from a bivalent calici-herpes feline vaccine for nasal administration, marketed by SOLVAY
DUPHAR under the trademark DOHYVAC CH using the method described in, and the parameters disclosed by (1).
The virus was groun on Crandell Feline Kidney (CRFK) cells (deposited in the American Type Culture Collection under Accession Number CCL 94). Cells uere grown at 37C in an atmosphere having 3~ of C02 and in culture media of : (1) 500 ml of medium 199 with Earle's salts, 2.2 g/l NaHC03 and L-glutamine (GIBCO); (2) 500 ml of Ham's F12 with L-glutamine (GIBCO); (3) 25 ml of lactalbumin hydrolysate (GIBCO); 25 ml of fetal calf serum (GIBCO); and 5 ml of a fructose solution (conc. of 200 grams of fructose/l). The cells were then infected with approximately 0.01 virus particles per cell at a cell confluence of about 50% to 80%, as visually observed (as used in the Examples herein, 100% confluence is defined as 105 cells/cm2 of plate).
The infected CRFK cells were then incubated for two to three days at 37C in an atmosphere having 3~ C02 and in culture media having the same composition as that described above.

W O9~/07987 9 pcTreps4lo299o E~ANPLE 2 - PURIFICATION OF THE FEV-1 VIRAL DNA.
Supernatants of CRFK cells infected with FHV-1, obtained - from the specimens as described above in Example 1, were then collected when cytopathic effect was almost complete, as determined by visual observation. The supernatants were first clarified by centrifugation at 500 G (Gravities) for 10 minutes.
The clarified supernatants were then centrifuged at 25000 RPM (SW
28 BECKMAN rotor) and 4C for 1 hour, producing a pellet containing viral particles.
The pellet containing viral particles was then resuspended in 10 mM Tris pH 7.5, 1 mM EDTA, 0.1% (v/v) NONIDET P-40 (SIGMA).
This suspension was then loaded on a cushion of 30% (w/v) sucrose in Tris 10 mM pH 7.5, EDTA lmM and centrifuged at 25000 RPM (SW
28 rotor) and 4C for 2 hours, generating a capsid pellet. The capsid pellet was then resuspended in Tris 10 mM pH 8.3, EDTA
lmM, 1% (w/v) SDS (Sodium Dodecyl Sulphate), 500 ~g proteinase K
(BOEHRINGER)/ml of the suspension and incubated at 50C for 2 hours.
Viral DNA was then purified by successive phenol/chloroform extractions and ethanol precipitation.
EXAHPLe 3 - Cu..~ CTION OF pdTR lNI~.RM~.nTATF. TRANSEER PLASNID
~AVING SEQUENCES OF TEE ~EV-1 Tg REGION
It has previously been reported that an FHV-1 SalI A
fragment contains the thymidine kinase (TK) gene (2). This FHV-1 SalI A fragment and the thymidine kinase gene thereof are described at length in (2).
Purified FHV-1 viral DNA, obtained as was described above in Example 2, vas digested by SalI and the resulting fragments cloned in the cosmid pHC79 (BOEHRINGER cat.~ 567 795). One cosmid from this cloning, cont~;ning a 19 kilo basepair (kbp) SalI A fragment was identified by restriction analysis and used for further constructions.
The cosmid containing the 19 kbp SalI A fragment was then subjected to double digestion with SalI and BamHI and a 5.6 kbp SalI-BamHI internal fragment of the SalI A fragment, having the thymidine kinase gene, was isolated. This 5.6 kbp SalI-BamHI

W 095/07987 ~63 PCTrEP9l/~990 fragment was then subcloned in pHC79, resulting in cosmid pFHVAl.
pFHVA1 was then subjected to digestion with SalI and ~in~TTT
and a 3.8 kbp SalI-~;n~TTT fragment isolated therefrom. Other pFHVA-l cosmids were subjected to digestion with HindIII and BamHI and a 1.8 kbp ~in~TTT-BamHI fragment of pFHVAl was isolated therefrom. The TK gene is split between the said 3.8 kbp SalI-HindIII fragment and the 1.8 kbp HindIII-BamHI fragment.
The 3.8 kbp SalI-HindIII and the 1.8 kbp HindIII-BamHI fragments uere then subcloned in respective pBSLK2 (described in European Patent Application No. 517,292) plasmids giving, respectively, plasmid pTKNl (having the 3.8 kbp SalI-HindIII fragment) and plasmid pTKCl (having the 1.8 kbp HindIII-BamHI fragment).
pBSLK1 (also described in European Patent Application No.
517,292), was digested with BclI, treated with T4 DNA polymerase and then digested with XbaI.
A 1.5 kbp XbaI-EcoRV fragment of pTKN1 was then obtained and cloned in pBSLK1, which had been treated as described above. The resulting plasmid was pTKN2.
pTKC1 was then subjected to a double digestion with SmaI and FspI and a 1 kbp SmaI-FspI fragment was isolated therefrom.
The pdTK transfer plasmid was then obtained by insertion of the 1 kbp SmaI-FspI fragment into the SmaI site of pTKN2 (which had previously been digested with SmaI). A restriction map of pdTK can be seen by reference to Figure 2.
The insertion of the 1 kbp SmaI-FspI fragment of pTKCl into pTKN2 resulted in an approximately 0.4 kbp to 0.5 kbp (456 bp) internal EcoRV-SmaI deletion in the thymidine kinase gene of the resulting transfer plasmid pdTK. pdTK also contains a unique BamH1 site which has been introduced in the thymidine kinase coding sequence. This site is used for insertion of foreign genes. Sequences (SEQ ID NO: 4)around the insertion site are:
BamHI

5' ACTATC~ACAATAArA~.ATGATCAGGATCCCCGGGAG~l~-lCCGACC 3' o O

W O 95/07987 PCTAEP9~/02990 ~ 22 Bold nucleotides are derived from the thymidine kinase gene sequence. Nucleotide coordinates 352 and 808 refer to those same ~ nucleotide coordinates mentionned in the sequence published by (2).
EXAHPLE 4 - C~ ~U~ ON 0~ pdgG ~.l~K~lATE TRANSPER PLASHID
~AVING SEQUENCES OF T~ ~HV-1 gG REGION
Purified FHV-1 viral DNA, obtained as described above in Example 2, was digested with EcoRI and the resulting fragments, including a 4.3 kbp EcoRI M fragment (as designated by (5)) were cloned in the cosmid pHC79 (Boehringer). A cosmid containing the 4.3 kbp EcoRI M fragment was then identified by restriction enzyme analysis and used for further constructions. By analogy with the position of gG (glycoprotein G) homologous genes in herpes simplex virus type 1 (HSV-1) and equine herpesvirus-1 (EHV-1) (nucleotide sequences are available in GenBank nucleic acid sequence data bank under the accession number X14112, D00317 and D00374 for HSV-1 and M86664 for EHV-1), it was suspected that the FHV-1 gG (the FHV-1 glycoprotein G) coding sequence was located on this EcoRI M fragment.
The cosmid containing the EcoRI M fragment was then digested with EcoRI and the 4.3 kbp EcoRI-EcoRI fragment was isolated therefrom. This 4.3 kbp EcoRI-EcoRI fragment was then subcloned into the EcoRI site of pBSLK2 (whose construction is described in European Patent Application No. 517,292), resulting in plasmid pECOM. pECOM was then subjected to double digestion with EcoRI
and SacI and a 1 kbp EcoRI-SacI fragment, containing a portion of the EcoRI M fragment, uas isolated therefrom. This 1 kbp EcoRI-SacI fragment was then subcloned in plasmid pBSLK1 (see Example 3), which had been previously digested with EcoRI and SacI. The resulting plasmid, referred to as pECOMdl, contained a portion of the EcoRI M fragment.
The transfer plasmid pdgG was obtained as follows: pECOM was digested with SacI and AvaI, treated with T4 DNA polymerase and then digested with BamHI. A 1.1 kbp SacI-BamHI pECOM fragment was then isolated therefrom. This 1.1 kbp SacI-BamHI fragment was then cloned in plasmid pECOMdl, which had been previously W O 95/07987 ~6~ 23 PCT~EP94/02990 digested with BamHI, treated with T4 DNA polymerase and then digested with BglII. The resulting pdgG transfer plasmid contains a unique BamHI site for insertion of foreign genes.
This site is located in the gG gene, as deduced from partial sequencing of the pdgG plasmid and comparison with the published gG gene sequences of other herpesviruses (such as those nucleotide sequences available in GenBank nucleic acid sequence data bank under the accession number X14112, D00317 and D00374 for HSV-1 and M86664 for EHV-1).
EXA~PLE 5 - C~ ~u~ ON 0~ INTERHEDIATE PLASMIDS ~AVING
~S~lON SIGNALS EOR EOREIGN GENES
Six different plasmids having expression signals were constructed: pSV40polyAE, pSV40polyAL, pHCMVpolyAE, pHCMVpolyAL, pRSVpolyAE and pRSVpolyAL.
pSV40polyAE and pSV40polyAL contain simian virus 40 (SV40) early promoter sequences. As a polyadenylation signal sequence, pSV40polyAE contains the SV40 early transcript polyadenylation sequences, and pSV40polyAL contains the SV40 late transcript polyadenylation sequences.
pHCMVpolyAE and pHCMVpolyAL contain human cytomegalovirus major immediate early gene promoter (HCMVIE) sequences and, respectively, the SV40 early and late polyadenylation signals.
pRSVpolyAE and pRSVpolyAL contain the Rous sarcoma retrovirus (RSV) Long Terminal Repeat (LTR) promoter and, respectively, the SV40 early and late transcript and polyadenylation sequences.
SV40 sequences were obtained from commercial plasmid pSVK3 (PHARMACIA, cat.# 274511).
HCMVIE sequences were obtained from commercial plasmid pOG44 (STRATA~.FNE, cat.~218401).
RSV promoter sequences were obtained from commercial plasmid pOPI3CAT (STRATAGENE, LAC SWITCH TM INDUCIBLE MAMMALIAN
EXPRESSION SYSTEM, Cat.# 217450).
The plasmids that have the expression signals contain a unique BglII site, situated between the promoter and the polyadenylation sequences, for permitting the further insertion W 0 95/07987 ~ ~8~ PCTrEP94/02990 therein of coding sequences which code for foreign peptides which are to be expressed under the control of the said expression signals. The gene expression cassettes having both these expression signals and the peptide coding sequences can then be isolated on a BclI-BamHI fragment and inserted in the BamHI site of either pdTK or pdgG.
Detailed description of pSV40polyAE:
pSV40polyAE was constructed by site-directed mutagenesis performed on pSVK3 uracilated single-stranded DNA, following the supplier recommendations (BioRad Muta-Gene Phagemid In Vitro Mutagenesis Kit, Cat.# 170-3581). Mutagenesis was done using the four synthetic primers (EUROGENTEC) described below:
SV40P1 (SEQ ID NO: 5):
5' CCTGGGGACTTTCCACACCTGATCACTAACTGACACACATTCCACAG 3' SV40P3 (SEQ ID NO: 6):
5' CCTATAATGAGTCGTATTAATTCGATA~ATCTAG~lllllGCAAAAGCCTAGGCC 3' SV40PA1 (SEQ ID NO: 7):
5' GTGGGAG~llllllAAAGC M GTGGATCCAAAACCTCTA~AAATGTGGTATGGC 3' SV40PA2 (SEQ ID NO: 8):
5' GATGCTATTGCTTTATTTGTAACCAGATCTATTATAAGCTGrAATAAACAAGTTAAC 3' The resulting plasmid was pSVK3mut. pSVK3mut was then digested with BglII and self-ligated in order to remove the internal, approximately 1 kbp BglII fragment therefrom, generating pSV40polyAE (see Figure 3).
Plasmid Coordinate Nature and origin of the sequences 1 - 22 SV40 sequences; nucleotides 1 through 22 from pSVK3.
23 - 28 TGATCA linker sequence.
29 - 350 SV40 origin and early promoter (nucleotides 23 through 344 from plasmid pSVK3).
351 - 356 AGATCT linker sequence.
357 - 468 SV40 early transcript polyadenylation sequences (nucleotides 1295 through 1406 from pSVK3).

W O 95/07987 PCT~EP94tO2990 ~ 713~ 25 469 - 2981 vector sequences from pSVK3 (including ~ nucleotides 1407 - through 3919).
- Detailed description of pSV40polyAL:
pSVK3mut was digested with BglII and self-ligated in order to inverse the internal approximately 1 kbp BglII fragment, generating pSVK3muti. pSVK3muti was then digested with BamHI and self-ligated to remove the internal 1 kbp and 0.2 kbp BamHI
fragments therefrom. The resulting plasmid is pSV40polyAL (see Figure 4).
Plasmid Coordinate Nature and origin of the sequences 1 - 22 SV40 sequences (nucleotides 1 through 22 from pSVK3).
23 - 28 TGATCA linker sequence.
29 - 350 SV40 origin and early promoter (nucleotides 23 through 344 from plasmid pSVK3).
351 - 356 AGATCT linker sequence.
357 - 450 SV40 late transcript polyadenylation sequences (nucleotides 1294 through 1201 from pSVK3).
451 - 2969 vector sequences from pSVK3 (including nucleotides 1401 through 3919.
Detailed description of pHCMVpolyAE:
First, pOG44 was digested with AvaI, treated with T4 DNA
polymerase and, finally, digested with XbaI. An approximately 0.9 kbp XbaI-AvaI fragment, which contains HCMVIE sequences was then identified and isolated therefrom. This 0.9 kbp XbaI-AvaI
fragment was then cloned into the SmaI-XbaI sites of pBSLK2 (obtained as described in European Patent Application No.
517,292), generating pHCMV. Uraciliated single-stranded DNA was then prepared from pHCMV and used as template for site-directed mutagenesis with the following synthetic primers:

W 0 95/07987 ~ ~ ~ 9 26 PCT~P9~/02990 HCMVPl (SEQ ID NO: 9):
5' GTACGGGCCAGATATACGCTGCTCAGTTGACATTGATTATTGACTAG 3' HCMVP2 (SEQ ID NO: 10):
5' AGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTAGATCTTCTGGCTAACTA~A~.AACCCA
CTGC 3' The resulting plasmid was pHCMVmut. pHCMVmut was then digested with BclI and BglII and an approximately 0.6 kbp BclI-BglII fragment was identified and isolated therefrom. The 0.6 kbp BclI-BglII fragment was then cloned in a 2.6 kbp BclI-BglII ragment from pSV40polyAE, generating pHCMVpolyAE (see Figure 5).
Plasmid Coordinate Nature and origin of the sequences 1 - 22 vector sequences from pSVK3 (including nucleotides 1 through 22).
23 - 28 TGATCA linker sequence.
29 - 616 human cytomegalovirus immediate early gene promoter sequences (nucleotides 361 through 948 from pOG44).
617 - 630 GTTTAGTGAACCGT (SEQ ID NO: 11) sequence obtained from human cytomegalovirus immediate early gene sequences (including nucleotides 1129 through 1142).
631 - 636 AGATCT linker sequence.
637 - 748 SV40 early transcript polyadenylation sequences (nucleotides 1295 through 1406 from pSVK3).
749 - 3261 vector sequences from pSVK3 (including nucleotides 1407 through 3919).
Coordinates relative to the human cytomegalovirus immediate early gene promoter refer to the sequence accessible in the EMBL
nucleic acid sequence data bank, accession number X03922.
Detailed description of pHCMVpolyAL:
pHCMVpolyAL was prepared by digesting pHCMVmut with BclI and W O 95/07987 ~7 PCTAEP94/02990 ~ 27 BglII and an approximately 0.6 kbp BclI-BglII fragment was identified and isolated therefrom. The 0.6 kbp BclI-BglII
fragment uas then cloned in a 2.6 kbp BclI-BglII fragment from pSV40polyAL, generating pHCMVpolyAL (see ~igure 6).
5 Plasmid Coordinate Nature and origin of the sequences 1 - 22 vector sequences from pSVK3 (including nucleotides 1 through 22).
23 - 28 TGATCA linker sequence.
29 - 616 human cytomegalovirus immediate early gene promoter sequences (nucleotides 361 through 948 from pOG44).
617 - 630 GTTTAGTGAACCGT sequence from human cytomegalovirus immediate early gene sequences (including nucleotides 1129 through 1142).
631 - 636 AGATCT linker sequence.
637 - 730 SV40 late transcript polyadenylation sequences (nucleotides 1294 through 1201 from pSVK3).
731 - 3249 vector sequences from pSVK3 (including nucleotides 1401 through 3919).
Coordinates relative to the human cytomegalovirus immediate early gene promoter refer to the sequence accessible in the E~BL
nucleic acid sequence data bank, accession number X0392Z.
Detailed description of pRSVpolyAL:
pOPI3CAT (ST~ATA~ E, Cat.# 217450) was digested with BstXI, treated with T4 DNA polymerase and subsequently digested with BglII and an approximately 0.6 kbp fragment, containing the RSV
LTR promoter sequences was identified and isolated therefrom.
This 0.6 kbp fragment was then cloned into the approximately 5.7 kbp fragment of pHCMVLACE (obtained as described below in Example 6), which had been previously digested with SpeI, treated with T4 DNA polymerase and, finally, digested with BglII. The resulting plasmid is pRSVLACE. pRSVLACE was then digested with BglII and ScaI and an approximately 2.2 kbp BglII-ScaI fragment was identified and isolated therefrom. This 2.2 kbp BglII-ScaI

wo 95,07987 ~ 6~ PCT~EP9~/02990 fragment was then cloned into the approximately 1.1 kbp BglII-ScaI fragment of pSV40polyAL, generating pRSVpolyAL (see Figure 7).
Plasmid Coordinate Nature and origin of the sequences 1 - 22 SV40 sequences (nucleotides 1 through 22 from pSVK3).
23 - 28 TGATCA linker sequence.
29 - 50 human cytomegalovirus immediate early gene promoter sequences (including nucleotides 541 through 562 from pOG44.
51 - 621 RSV promoter sequences (BstXI-BglII
fragment from pOPI3CAT).
622 - 715 SV40 late transcript polyadenylation sequences (nucleotides 1294 through 1201 from pSVK3).
716 - 3234 vector sequences from pSVK3 (including nucleotides 1407 through 3919).
Coordinates relative to the human cytomegalovirus immediate early gene promoter refer to the sequence accessible in the EMBL
nucleic acid sequence data bank, accession number X03922.
Detailed description of pRSVpolyAE:
pRSVLACE was digested with BglII and ScaI and an approximately 2.2 kbp BglII-ScaI fragment was identified and isolated therefrom. This 2.2 kbp BglII-ScaI fragment was then cloned into the approximately 1.1 kbp BglII-ScaI fragment of pSV40polyAE, generating pRSVpolyAE (see Figure 8).
Plasmid Coordinate Nature and origin of the sequences 1 - 22 SV40 sequences (nucleotides 1 through 22 from pSVK3).
23 - 28 TGATCA linker sequence.
29 - 50 human cytomegalovirus immediate early gene promoter sequences (including nucleotides 541 through 562 from pOG44.

W 095/07987 2~ ~ PCTAEP94/02990 ~8~ 29 51 - 621 RSV promoter sequences (BstXI-BglII fragment - from pOPI3CAT).
622 - 733 SV40 early transcript polyadenylation - sequences (nucleotides 1295 through 1406 from pSVK3).
734 - 3246 vector sequences from pSVK3 (including nucleotides 1407 through 3919).
Coordinates relative to the human cytomegalovirus immediate early gene promoter refer to the sequence accessible in the EMBL
nucleic acid sequence data bank, accession number X03922.
EXAHPLE 6 - C~ llON O~ pSVLACE and pUCHVLACE INTERHEDIATE
pT.A~HTns UAVING LacZ EXPRESSION CASSETTE
Coinsertion of a LacZ expression cassette along with the expression cassette for the peptide coding sequences of the FIPV
genes (to be discussed in detail below) into the FHV-1 genome facilitates the screening of the recombinant viruses.
Two intermediate plasmids having LacZ expression cassettes were constructed for facilitating screening: pSVLACE (see Figure 9) and pHCMVLACE (see Figure 10). These plasmids were obtained by insertion of the approximately 3.1 kbp BglII-BamHI fragment cont~i n; ng a portion of the LacZ coding sequence (obtained by double digestion of pBSMUTLACZ2 with BglII and BamHI and the isolation therefrom) into the unique BglII sites of pSV40polyAE
(to provide pSVLACE) and pHCMVpolyAE (to provide pHCMVLACE).
Plasmid pBSMUTLACZ2 is a derivative of plasmid pBSMUTLACZ1 (described in European Patent Application No. 517,Z92) from which the BclI site located in the LacZ gene has been removed by - site-directed mutagenesis.
Original LacZ sequences in pBSmutLACZ1:
BclI

5' AGT GTG ATC ATC TGG 3' SEQ ID NO: 12 Ser Val Ile Ile Trp LacZ sequence in pBSmutLACZ2:
5' AGT GTT ATC ATC TGG 3' SEQ ID NO: 13 Ser Val Ile Ile Trp W O95lQ7987 PCT~P9~/02990 2~ 30 EXAMPLe 7 - Cu..~l~UCTION O~ pdTKSVLAC, pdTKCMVLAC~ pdgGSVLAC and pdgGCMVLAC COTRANSEECTION PLASMIDS
Four LacZ cotransfection plasmids were constructed for cotransfection with FHV-1 viral DNA for use as controls in the vaccination studies to be discussed below. These LacZ
cotransfection plasmids are: pdTKSVLAC (see Figure 11), pdTKCMVLAC (see Figure 12), pdgGSVLAC and pdgGCMVLAC.
pdTKSVLAC and pdgGSVLAC uere obtained by insertion of the approximately 3.5 kbp BclI-BamHI LacZ expression cassette (derived from pSVLACE by a double digestion thereof with BclI and BamHI) into the unique BamHI sites of, respectively, pdTK
(obtained as described above in Example 3) and pdgG (obtained as described above in Example 4).
pdTKCMVLAC and pdgGCMVLAC were obtained by insertion of the approximately 3.8 kbp BclI-BamHI LacZ expression cassette (derived from pHCMVLACE, obtained as described above in Example 6, by a double digestion thereof with BclI and BamHI) into the unique BamHI sites of, respectively, pdTK (obtained as described above in Example 3) and pdgG (obtained as described above in Example 4).
EXAHPLE 8 - CONSTRUCTION O~ pHCHVM, pHCHVMS, pRSVH and pRSVMS
INTERHEDIATL PLASHIDS EAVING SH OR H E~PRESSION CASSETTES
The sequences coding for the FIPV SM protein and the FIPV M
protein were obtained and isolated from plasmid B12 (described by (3) and European Patent Application No. 441684). These SM and M
coding sequences were then subcloned in the either pHCMVpolyAL or pRSVpolyAL for generating the intermediate plasmids pHCMVM, pHCMVMS, pRSVM and pRSVMS which have either the SM expression cassette or the M expression cassette~
The fragment from plasmid B12 containing the SM and M coding sequences was obtained by double digestion of plasmid B12 with HincII and HindIII, generating a 1.3 kbp HincII-HindIII fragment and isolation thereof. This 1.3 kbp HincII-HindIII fragment was then cloned in the HincII-HindIII sites of pBSLK2 (see European Patent Application No. 517,292), generating pBSM which also possessed the SM and M coding sequences from plasmid B12.

wo 95,07g87 ~8~ PCTIEP94/02990 DNA fragments containing SM or M genes were produced by polymerase chain reaction (PCR) amplification performed on pBSM, as is discussed below. The primers (Eurogentec, Belgium) used for PCR were:
M Fragment MUTM2 (SEQ ID N0: 14) BamHI
5' GTGGCCATTTGAAAGTTTAGGGATCCTTACACCATATGThATAATTTTTCATG 3' MUTM4 (SEQ ID N0: 15) BamHI
5' ATTTTTGGTTTGAACTAAAACAAAGGATCCCCACCATGAAGTACATTTTGCTAAT 3' SM Fragment M~rMS2 (SEQ ID N0: 16) BamHI
5' AATGTACTTCATTTTGTTTTAGTGGATcCTcAAAcr.AAAAAT 3 MUTMS3 (SEQ ID N0: 17) BglII
5~ ~AA~AAGAA~AA~AccATAAcTAGATcTccAccATGAcGTTcccTAGGGcATTTAT 3' Following amplification, the PCR products were digested with BamHI and BglII, generating the following fragments (having restriction sites at the extremities thereof in order to facilitate their further cloning in the BglII site of the expression plasmids), which were then isolated on an agrose gel and purified.
Sequences at the 5' and 3' ends of the cloned fragments are as follows:
SM fragment (0.3 kbp):
SEQ ID N0: 18 SEQ ID N0: 19 5' AGATCTCCACCATGACG........ llG~lllGAGGATCC 3' BglII > SM coding sequence < BamHI
M fragment (0.8 kbp):
SEQ ID N0: 20 SEQ ID N0: 21 5' GGATCCCCACCATG M G....... AlG~l~l M GGATCC 3' BamHI > M coding sequence < BamHI
pHCMVMS, pHCMVM, pRSVMS and pRSVM were then constructed using the above-described SM and M coding sequences as follows:

W O 95/07987 ~ 32 PCTAEP9~/02990 p~CMVMS (see Figure 13) was constructed by insertion of the approximately 0.3 kbp BglII-BamHI SM fragment into the BglII site of pHCMVpolyAL, described above in Example 5.
pHCMVM (see Figure 14) was constructed by insertion of the approximately 0.8 kbp BamHI-BamHI M fragment into the BglII site of pHCMVpolyAL, described above in Example 5.
pRSVMS (see ~igure 15) was constructed by insertion of the approximately 0.3 kbp BglII-BamHI SM fragment into the BglII site of pRSVpolyAL, described above in Example 5.
pRSVM (see Figure 16) was constructed by insertion of the approximately 0.8 kbp BamHI-BamHI M fragment into the BglII site of pRSVpolyAL, described above in Example 5.
E~AMPLE 9 - CONSTRUCTION OP pdTKHLAC, pdTKHSLAC, pdTKRSVHLAC and pdTKRSVHSLAC COTRAN~ lON PT~MTnS
An approximately 1.5 kbp BclI-BamHI fragment containing the M expression cassette was isolated from pHCMVM (obtained as described above in Example 8). Similarily, an approximately 0.9 kbp BclI-BamHI fragment containing the SM expression cassette was isolated from pHCMVMS (obtained as described above in Example 8).
Each of the M and SM expression cassettes were then cloned in the BamHI site of respective pdTK plasmids (obtained as described above in Example 3), resulting in, respectively, pdTKHCMVM (see Figure 17) and pdTKHCMVMS (see Figure 18). If desired, each of these plasmids may be used for cotransfection with the FHV-l viral DNA for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with these plasmids and the FHV-l viral DNA, the 3.5 kbp BclI-BamHI LacZ expression cassettes were obtained by double digestion of pSVLACE (obtained as described above in Example 6) with BclI and BamHI and isolated therefrom. Respective 3.5 kbp BclI-BamHI LacZ expression cassettes were then cloned into the unique BamHI sites of pdTKHCMVM and pdTKHCMVMS, resulting in, respectively, cotransfection plasmids pdTKMLAC (see ~igure 19) and pdTKMSLAC
(see Figure 20).

W 0 95/07987 ~ ~ ~ PCTAEP94/02990 ~6~ 33 The approximately 1.5 kbp BclI-BamHI fragment containing the M expression cassette and the approximately 0.9 kbp BclI-BamHI
fragment containing the SM expression cassette were isolated, respectively, from pRSVM and pRSVMS (obtained as described above in Example 8). These expression cassettes were then cloned in the BamHI site of respective pdTK plasmids (obtained as described above in Example 3), resulting in, respectively, pdTKRSVM (see Figure 21) and pdTKRSVMS (see Figure 22). If desired, each of these plasmids may be used for cotransfection with the FHV-1 viral DNA for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with these plasmids and FHV-l viral DNA, the 3.8 kbp BclI-BamHI LacZ expression cassettes were obtained by double digestion of pHCMVLACE (obtained as described above in Example 6) with BclI and BamHI and isolated therefrom. Respective 3.8 kbp BclI-BamHI LacZ expression cassettes were then cloned into the unique BamHI sites of pdTKRSVM and pdTKRSVMS, resulting in, respectively, cotransfection plasmids pdTKRSVMLAC (see Figure 23) and pdTKRSVMSLAC (see Figure 24).
E~AMPL~ lO - ~u..~ ON OF pdgGHLAC and pdgGHSLAC
COTRANSFECTION PLASHIDS
An approximately 1.5 kbp BclI-BamHI fragment containing the M expression cassette was isolated from pHCMVM (obtained as described above in Example 8). Similarily, an approximately 0.9 kbp BclI-BamHI fragment containing the SM expression cassette was isolated from pHCMVMS (obtained as described above in Example 8).
Each of the M and SM expression cassettes were then cloned - in the BamHI site of respective pdgG plasmids (obtained as described above in Example 4), resulting in, respectively, pdgGHCMVM and pdgGHCMVMS. If desired, each of these plasmids may be used for cotransfection with the FHV-1 viral DNA for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with these plasmids and FHV-l viral DNA, the approximately 3.5 kbp BclI-BamHI fragments, W 095/079X7 ~ PCT~P9~102990 6~

containing the BclI-BamHI LacZ expression cassette, were obtained by double digestion of pSVLACE (obtained as described above in Example 6) with BclI and BamHI and isolation therefrom.
Respective 3.5 kbp BclI-BamHI fragments were then cloned into the BamHI site of pdgGHCMVM and pdgGHCMVMS, resulting in, respectively, cotransfection plasmids pdgGMLAC and pdgGMSLAC.
EXAHPLe 11 - C~ ~U~llON OF p~CHVS and pRSVS INT~.RH~nTATE
pT.A~MTnS ~AVING S EXPRESSION CASSETTES
pUCE2 (described in (4)), containing the FIPV spike (S) coding sequence (described in both (4) and in European Patent Application No. 264,979) was digested with BamHI and an approximately 4.3-4.4 kbp BamHI fragment, carrying the whole S
coding sequence, was isolated therefrom.
This 4.3-4.4 kbp BamHI fragment was then cloned in the BglII
site of pHCMVpolyAL (obtained as described above in Example 5), resulting in pHCMVS (see Figure 25).
Similarily, this 4.3-4.4 BamHI fragment (from pUCE2) was also cloned in the BglII site of pRSVpolyAL (obtained as described above in Example 5), resulting in pRSVS (see Figure 26).
EXAMPLE 12 - CON~1~U~-11ON OF pdTKSLAC, pdgGSLAC and pdTRRSVSLAC
COTRAN~ llON PT~MTns BclI-BamHI S expression cassettes of approximately 5.2 kbp were obtained by double digestion of pHCMVS (obtained as described above in Example 11) with BclI and BamHI and isolation therefrom. These 5.2 kbp BclI-BamHI expression cassettes were then inserted in the BamHI site of pdTK (obtained as described above in Example 3) and in the BamHI site of pdgG (obtained as described above in Example 4), giving, respectively, pdTKHCMVS
(see Figure 27) and pdgGHCMVS. If desired, each of these plasmids may be used for cotransfection with the FHV-1 viral DNA
for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with these plasmids and FHV-1 viral DNA, respective 3.5 kbp BclI-Bam~I LacZ expression cassettes isolated from pSVLACE (obtained as described above in W 095/07987 ~6~ 35 PCT~EP94/02990 Example 6) were then inserted into the BamHI sites of pdTKHCMVS
- and pdgGHCMVS, generating, respectively, the cotransfection plasmids pdTKSLAC (see Figure 28) and pdgGSLAC.
- Another cotransfection plasmid was constructed by first inserting the 5.2 kbp BclI-BamHI S expression cassette, isolated from pRSVS (obtained as described above in Example 11), in the BamHI site of plasmid pdTK, resulting in pdTKRSVS (see Figure 29). If desired, this plasmid may be used for cotransfection with the FHV-1 viral DNA for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with this plasmid and FHV-1 viral DNA, the 3.8 kbp BclI-BamHI LacZ expression cassette, isolated from pHCMVLACE (obtained as described above in Example 6), were then inserted into the BamHI site of pdTKRSVS, resulting in cotransfection plasmid pdTKRSVSLAC (see Figure 30).
EXAHPLE 13 - CONSTRUCTION 0~ p~CMVSIG and pRSVSIG INT~RH~nTAT~.
pT.A~H m S ~AVING T~E delS EXPRESSION CASSETTE
pHCMVSIG was then prepared, as follows, for the expression of the FIPV S protein from which the signal peptide therefor has been deleted therefrom (the signal sequence-deleted S gene), so that the S protein is produced thereby without its N-terminal signal sequence.
First, pHCMVS, which contains the coding sequence for the FIPV spike (S) protein (obtained as described above in Example 11) was used as a template to perform a PCR amplification with the primers FIPSIG1 and FIPSIG2 (Eurogentec, Belgium) described below. Starting from these primers, an approximately 0.5 kbp DNA
- fragment was amplified by PCR (Perkin Elmer).
FIPSIG1 (SEQ ID NO:22) :
5' CCACACAGTTTTGAGTCCGCGGCCACCATGACAACAAATAATGAATGCATACAAGTTAACG 3' SacII
FIPSIG2 (SEQ ID NO:23) :
5' CTGTCAGCACCCGTACATGTGGAATTCCACTG 3' EcoRI

W 095/07987 PCT~P94/02990 The amplified approximately 0.5 kbp fragment was cloned in the SmaI site of pBSLK1 (described in European Patent Application No. 517,292), generating pBSMUTS. An approximately 0.5 kbp SacII-EcoRI fragment of plasmid pHCMVS was then replaced with an approximately 0.4 kbp SacII-EcoRI fragment from pBSMUTS, generating pHCMVSIG (see Figure 31), in which the signal peptide of the S protein is deleted.
A plasmid for the expression of the signal peptide-deleted S
protein under the control of the RSV promoter was then also constructed. pHCMVSIG was subjected to a double digestion with SacII and BamHI and an approximately 4.5 kbp SacII-BamHI fragment was isolated therefrom. Also, pRSVS (obtained as described above in Example 11) was subjected to a double digestion with SacII and BamHI and an approximately 3.2 kbp SacII-BamHI fragment of pRSVS
was isolated therefrom. The 4.5 kbp SacII-BamHI fragment was then ligated with the 3.2 kbp SacII-BamHI fragment, resulting in pRSVSIG (see Figure 32).
E~NPLl~ 14 - C(J~ ~u~ oN OP pdl~;T~'T-A~, pdl~RSVSIGLAC al~d pdgt'~!~TGT.Ar~ COTRAN~ lON PT.A~;MTns Three cotransfection plasmids for the signal sequence-deleted S gene were constructed.
A first cotransfection plasmid for insertion in the FHV-1 thymidine kinase was constructed as follows: an approximately 5.1 kbp BclI-BamHI signal sequence-deleted S gene expression cassette ~5 was isolated from pHCMVSIG (obtained as described above in Example 13) and cloned into the BamHI site of pdTK (obtained as described above in Example 3), generating pdTKHCMVSIG (see Figure 33). If desired, this plasmid may be used for cotransfection with the FHV-l viral DNA for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with this plasmid and FHV-1 viral DNA, a 3.5 kbp BclI-BamHI LacZ expression cassette from pSVLACE (obtained as described above in Example 6) was then obtained and inserted into the BamHI site of pdTKHCMVSIG, giving the cotransfection plasmid pdTKSIGLAC (see Figure 34).

~ W O 95/07~87 PCT~EP94/02990 21 71~ 37 A second cotransfection plasmid for insertion in the FHV-1 - thymidine kinase gene was constructed as follows: an approximately 5.1 kbp BclI-BamHI signal sequence-deleted S gene expression cassette was isolated from pRSVSIG (obtained as described above in Example 13) and cloned into the BamHI site of pdTK (obtained as described above in Example 3), generating pdTKRSVSIG (see Figure 35). If desired, this plasmid may be used for cotransfection with the FHV-l viral DNA for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with this plasmid and FHV-l viral DNA, the 3.8 kbp BclI-BamHI LacZ expression cassette from pHCMVLACE (obtained as described above in Example 6) was then inserted into the BamHI site of pdTKRSVSIG, generating the cotransfection plasmid pdTKRSVSIGLAC (see Figure 36).
A third cotransfection plasmid for insertion in the FHV-l gG
gene was constructed as follows: an approximately 5.1 kbp BclI-BamHI signal sequence-deleted S gene expression cassette was isolated from pHCMVSIG (obtained as described above in Example 13) and cloned into the BamHI site of pdgG (obtained as described above in Example 4), resulting in pd~GHCMVSIG. If desired, this plasmid may be used for cotransfection with the FHV-1 viral DNA
for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with this plasmid and FHV-l viral DNA, the 3.5 kbp BclI-BamHI LacZ expression cassette from pSVLACE (obtained as described above in Example 6) was then inserted into the BamHI site of pdgGHCMVSIG, generating the - cotransfection plasmid pdgGSIGLAC.
EXAHPLE 15 - COh~l~u~-llON OF pHCMVSDAD and pRSVSDAD INTERMEDIATE
PLASMIDS HAVING THE ADE-EPITOPE-DELETED S EXPRESSION CASSETTE
Deletion of what we believe to be the antibody-dependent-enhancement (ADE) epitope coding sequences of the S protein was directly performed, by site-directed mutagenesis, on uracilated single-stranded pHCMVS (obtained as described above in Example 11) DNA, following the supplier -W 095/07987 2~ ~8~9 38 P~T~P9~/02990 ~

reco -~d~tions (BioRad Muta-Gene Phagemid In Vitro Mutagenesis Kit, Cat.# 170-3581). Mutagenesis was done using the four synthetic primers (EUROGENTEC) described below:
1. SDD Primer (SEQ ID NO: 24) to Delete D epitope of the S
protein:
5' CCGTCAGTTATGCCGAACGGGATTTCCA~ CACTATAACATGAAATTTC 3' 2. SDA1 Primer (SEQ ID NO: 25) to Delete A1 epitope of the S
protein 5' GTTACTTAGTGTCGAGGCTATGGGCATACCAAGATCAATGG~TATATTGAC 3' 3. SDA2 Primer (SEQ ID NO: 26) to Delete A2 epitope of the S
protein 5' GCCTCTAAAArATCCGTGCAGTCTTGATTTAAAGA~CTTTTGCAAGTGGAATGAAC 3' The generated plasmid, pHCMVSDAD (see Figure 37), has the D, A1 and A2 epitopes of the S protein deleted therefrom.
Another plasmid, pRSVSDAD (see Figure 38) for the expression of the ADE-epitop- deleted S protein under the control of the RSV
promoter was also constructed by obt~;n;ng an approximately 3.5 kbp PstI-BamHI fragment (having the S expression cassette) by double digestion of pHCMVSDAD (obtained as described above in Example 15) uith PstI and Bam~I and isolation therefrom. An approximately 4.2 kbp PstI-BamHI fragment was obtained by double digestion of pRSVS (obtained as described above in Example 11) with PstI and BamHI and isolation therefro~.
The 3.5 kbp PstI-BamHI fragment was then cloned with the 4.2 kbp PstI-BamHI fragment of pRSVS, resulting in pRSVSDAD which includes ADE-epitope-deleted S expression cassette.
EXAHPLE 16 ~ llON OF p~T~nAnLAC, pdgGSDADLAC and pdTRRSV~n~n!.AC COTRANS~ECTION PT~A~MTns Approximately 5.1 kbp BclI-BamHI fragments, containing respective ADE-epitope-deleted S expression cassettes, were obtained by double digestion of, respectively, pHCMVSDAD and pRSVSDAD (both of which were obtained as described above in Example 15) with BclI and BamHI and isolation of the fragment therefrom.
Respective 5.1 kbp BclI-BamHI fragments from pHCMVDAD were then inserted into the BamHI site of pdTK (obtained as described W O 9S/07987 ~ ~ ~ PCTAEP94/02990 above in Example 3) and the BamHI site of pdgG (obtained as described above in Example 4), resulting in, repectively, pdTKHCMVSDAD (see Figure 39) and pdgGHCMVSDAD. If desired, these plasmids may be used for cotransfection with the FHV-l viral DNA
for producing recombinant viral vectors.
In order to provide a marker to facilitate screening of the recombinant virus after cotransfection with these plasmids and FHV-l viral DNA, respective approximately 3.5 kbp BclI-BamHI LacZ
expression cassettes were then isolated from pSVLACE (obtained as described above in Example 6) and subsequently cloned in the BamHI site of pdTKHCMVSDAD and pdgGHCMVSDAD giving, respectively, cotransfection plasmids pdTKSDADLAC (see Figure 40) and pdgGSDADLAC.
Respective 5.1 kbp Bcl-BamHI fragments from pRSVSDAD were cloned in the BamHI site of pdTK (obtained as described above in Example 3), generating pdTKRSVSDAD (see Figure 41). If desired, this plasmid may be used for cotransfection with the FHV-1 viral DNA for producing a recombinant viral vector.
In order to provide a marker to facilitate screening of the recombinant virus after contransfection with this plasmid and FHV-l viral DNA, the 3.8 kbp BclI-BamHI LacZ expression cassette from pHCMVLACE (obtained as described above in Example 6) was inserted into the BamHI site of pdTKRSVSDAD, resulting in the cotransfection plasmid pdTKRSVSDADLAC (see Figure 42).
EXAKPLE 17 - PRODUCTION OF F~V-1 LIVE RECOHRTNANT ~ARRT~.R
A live recombinant carrier was then obtained by cotransfection (as described below) of CRFK cells (see Example 1) with purified FHV-1 DNA (obtained as described in Example 2) and - with the cotransfection plasmid pdTKCMVLAC (Figure 12), which was obtained as described above in Example 7.
The transfection was performed with LIPOFECTIN reagent (GI~CO BRL) following the supplier recommendations. Crandel feline kidney (CRFK) cells were transfected in 25 cm2 flask, at 50~ to 80~ confluence (visually determined) in the medium described above in Example 1 from which the serum had been ommitted and to which had been added 20 to 25 ~g LIPOFECTIN, 1 to W 095/07987 ~ 6 PCT~EP94/02990 15 ~g viral DNA and an amount of plasmid DNA necessary to provide a plasmid/virus DNA molar ratio between 1 to 20. Total volume, according to the manufacturers specifications, was about 1.8 ml of the medium. Duration of transfection was from 5 to 24 hours.
After transfection, the transfection medium of each sample was removed and replaced with about 5 ml of the CRFK culture medium. The cells were then incubated at 37C for 48 hours.
Cells were subsequently passed in 75 cm2 flasks after trypsination and reincubated again at 37C, until a cytopathic effect was visually observed.
Cells and medium were then harvested after one cycle of freezing-thawing. This virus stock is called transfection stock.
Screening of the transfection stock for the presence of recombinant FHV-1 viruses was based on the expression of the LacZ
gene. Plaques containing recombinant viruses were visualized by a simple plaque assay as follows:
CRFK cells were seeded in growth medium (see Example 1) in a 25 cm2 Petri dish at about 50% confluence (visually determined) and then infected with about 103 to 104 infectious virus particles of the transfection stock (described above).
After incubation for about 5 to 8 hours at 37C with 3% C02, the liquid growth medium was removed and replaced with 5 ml of a mixture of one volume of a 2% (w/v) agarose melted in water (SEA
PLAQUE R agarose, FMC BioProducts, USA) and one volume of 50 (v/v) Medium 199 2x (GIBC0 BRL), 2.5% (v/v) lactalbumin hydrolysate (GIBC0 BRL), 5% (v/v) fetal calf serum (GIBC0 BRL) and 15 mM ~EPES pH 7.2. The Petri dishes were then incubated for about 48 hours at 37C with 3~ C02 until viral plaques develop.
The Petri dishes were then overlaid with 2 ml of a PBS solution (GIBC0 BRL) containing 1~ (w/v) melted agarose and 0.3 mg/ml X-gal (5-bromo-4 chloro-3 indolyl-~-D-galactoside, Boehringer Mannheim).
Plaques expressing the LacZ encoded ~-galactosidase enzyme turned blue. The blue plaques were then stabbed with a Pasteur pipette, transferred onto fresh CRFK cells and purified by successive blue plaque isolations until homogeneity was achieved.

W O 95/07~87 ~ 41 PCT~EP94/02990 Large stocks of recombinant viruses were then produced by infection of CRFK cells at 50% to 80~ confluence (visually - observed) and a multiplicity of infection of 0.01.
- After 48 to 72 hours, when cytopathic effect was almost complete, cells and growth medium were subjected to one cycle of freezing and thawing. The cell suspension was then centrifuged at 500 G for 10 minutes and the supernatant containing the virus was then collected. This stock was then used for further vaccination experiments.
From the above, it can be seen that, using pdTKCMVLAC in the above-described manner, a live recombinant FHV-1 carrier, designated, TKLAC was generated. For production of other various live recombinant carriers which express the antigenically-active proteins/polypeptides of the present invention, one merely needs to cotransfect, in the manner which has just been described in this example, the FHV-1 viral DNA obtained as described above in Example 1 with the various of the above-mentioned cotransfection plasmids described above in Examples 7, 9, 10, 12, 14 and 16, in which the antigenically-active proteins/polypeptides of interest (including those of the present invention) are either incorporated into the cotransfection plasmid with the LacZ gene or wherein the antigenically-active proteins/peptides of interest (including those of the present invention) is incorporated into the cotransfection plasmid in lieu of the LacZ gene.
LXAHPLE 18 - VACCTNATTON OF CATS ~IT~ T~E CONTROLS
This example was designed to evaluate the vaccinating power of FHV/LACZ recombinants using as criteria, protection against feline rhinotracheitis and immune response against - ~-galactosidase. In this regard, the recombinant FHV-1 strain (designated TKLAC) obtained as described above in Example 17, having a LacZ gene under the control of the HCMV promoter, was evaluated in a cat vaccination trial and compared with the parental strain.
Specific-pathogen-free (SPF) cats of about 10 weeks of age were oronasally vaccinated twice three weeks apart with ca. 105-5 TCIDso per dose of either TKLAC FHV-l recombinant (LacZ group, 5 W 095/07987 PCTrEP9~tO2990 ~7~6~ 42 cats), obtained as described above in Example 17, or the parental strain (Parental group, 5 cats), obtained as described above in Example 1, by applying 0.5 ml of the viral suspension in each nostril. A third group (Control group, 5 cats) was innoculated in each nostril with 0.5 ml of vaccine diluent, consisting of M;n; 1 Essential Medium with Earle's Salts (GIBCO BRL, Cat.#
21090-010) as control.
All of the specimens of each of the three groups were then challenged oronasally, 2 weeks after the second vaccination.
These challenges were done by innoculation with ca. 107 TCIDso of the virulent FHV-1 strain B927 (which was isolated and described by (6) and (7)) by applying 0~5 ml of the viral suspension in each nostril.
Evolution of the mean rectal temperatures and clinical signs of rhinotracheitis (appetite, depression, sneezing, oculo-nasal discharge, ulcers, hypersalivation, conjunctivitis, dysponea, gingivitis, neurological signs, diarrhoea) were monitored over a period of two weeks after challenge. Each clinical sign was arbitrarily attributed a score on a scale of from zero (absence of clinical signs) to five (very severe clinical signs).
Results The two groups of vaccinees showed (see Table 1) mild pyrexia (As used herein, the term "pyrexia" is defined as a temperature equal to or above 39.2C) for the first 2 to 4 days after challenge. By contrast, the Control group developed severe pyrexia on the third to fifth days and the seventh to eighth days post challenge.

W O 95/07987 ~ ~ PCT~EP94/02990 DAYS AFTER C~ATT~T~GE

Group 1 2 3 4 5 6 7 8 9 10 11 12 Control 38.8 39.1 40.3 40.8 39.8 39.1 39.7 39.9 39.1 39.2 38.8 38.8 LacZ 39.3 39.2 39.5 39.3 39.1 39.1 39.0 39.1 39.1 39.0 38.9 38.9 PARENTAL 39.2 39.3 39.1 39.0 38.9 39.2 39.0 38.8 39.0 38.9 39.1 39.0 The results of the clinical scoring of the cats following challenge are shown in Table 2. Controls showed the expected wide range of clinical signs, resulting in a high total score of 337. The two vaccinated groups showed the same strong reduction in the scores compared to the Control group, with very mild cli~ical signs comprising sneezing and conjunctivitis.

DAYS AFTER CTTAT.T.T~ GE

CONTROL O 4 22 35 38 42 61 55 44 10 17 8 = 337 LACZ O O 1 7 3 1 3 1 4 1 0 0 = 21 - PARENTAL O O 0 3 2 5 1 3 3 3 0 0 = 20 The clinical observations did not detect any significant signs of rhinotracheitis in the vaccinated specimens in comparison with the control specimens.
These results indicate that the TKLAC recombinant substantially protects SPF cats against severe challenge with wild-type virus and that that protection is as good as that W 095/07987 2 ~ PCT~EP94/02990 obtained with the parental vaccine strain.
Blood samples were taken just before the first vaccination until the end of the experiment. Sera were analysed for seroneutralizing titers against FHV-1 and IgA specific to FHV-l and ~-galactosidase.
Table 3 summarizes the evolution of the seroneutralizing titers. The values represent the inverse of the highest seroneutralizing dilution for all the individual cat sera. All unvaccinated cats remained seronegative prior to the challenge.
All vaccinated cats seroconverted after the first vaccination and the majority showed a small rise in titer after the second vaccination and again after challenge.

W O 95/07987 ~ PCT~EP94/02990 ~ .

GROUP PREVACCINATION DAY OF SECOND pREc~Ar.T~R~GE POST
VACCINATION MORTEM
CONTROLS
Specimen 1 <4 C4 <4 128 Specimen 2 <4 <4 <4 128 Specimen 3 <4 <4 <4 128 Specimen 4 <4 <4 <4 64 Specimen 5 <4 <4 <4 128 I~C Z
Specimen 1 <4 64 128 512 Specimen 2 <4 64 128 512 Specimen 3 <4 32 64 256 Specimen 4 <4 64 128 128 Specimen 5 <4 32 64 256 P~RENTAL
Specimen 1 <4 64 64 128 Specimen 2 <4 64 128 128 Specimen 3 ~4 128 128 128 Specimen 4 <4 64 256 256 Specimen 5 <4 64 64 256 Table 4 summarizes the ELISA analyses of serum IgA. The values represent mean optical density x 1000. The sera were tested for total IgA and IgA specific for FHV-l and ~-galactosidase (~-GAL). Specific anti-~-GAL IgA showed a significant increase (serotiters against ~-galactosidase) in the group vaccinated with the TKLAC recombinant, showing that the LacZ insert is expressed in vivo.

W 0 9S/07~87 PCT~P94/02990 TEST PREVACCINATION DAY OF SECOND PREC~AT.T.F.NGE POST
VACCINATION MORTEM

TOTAL IgA

ANTI-~-GAL IgA

CONTROL 508 632 640 7g5 ANTI-FHV IgA

It is evident from the above results that the Live Recombinant Carrier described herein (and formed by cotransfection with FHV-1 viral DNA with the cotransfection plasmids of the present invention having the coding sequence for a protein of interest) is capable of expressing the proteins o~
interest in vivo. Accordingly, this live recombinant carrier would be suitable not just for use with the proteins/polypeptides W O95/07987 2~ PCT~EP94/02990 ~ 9 47 described herein but other proteins/polypeptides which may be desired to be expressed in vivo.
.XA~PL~ 19 - VA~cTNATToN OF CATS UITB LIVE RFCOHBINANT ~ARRT~R~
This experiment is designed to evaluate the efficacy of the FIPV/FHV Live Recombinant Carriers from Example 17 in protecting cats after challenge with virulent FIPV.
Specified-pathogen-free cats of 9 to 10 weeks of age will be vaccinated. Another vaccination will be administered three weeks after the first vaccination. All vaccinations will be made by the nasal route, with 105 to 107 TCID50 per cat, of the recombinant FIPV/FHV virus from the stock obtained as described above in Example 17. A group of unvaccinated cats will serve as control. Two to four weeks after the last vaccination, cats will be challenged orally, with 102 to 105 TCID50 per cat, of a virulent FIPV strain.
Clinical signs of FIP will be evaluated for 8 consecutive weeks after the challenge. Blood samples will be taken weekly from the time of the first vaccination until the end of the experiment. Sera will be analysed for seroneutralizing titers against PHV-l and ~-galactosidase specific antibodies.
The clinical observations will show that clinically significant signs of FIP in the vaccinated specimens will either not be present or will be ameliorated in comparison with the control specimens. The serotiters against ~-galactosidase will be elevated in the vaccinated specimens in comparison with the control unvaccinated specimens.
The above results will show that the vaccinated specimens demonstrated an immune protective response.
All publications and patent applications mentioned herein are hereby incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
The invention now having been fully described, it will be apparent to one of ordinary skill in the art that changes and modifications can be made thereto without departing from the spirit and/or scope of the appended claims.

W O 95/07987 ~69 48 PCTAEP9J/02990 REFERENCES
1. Payment et al., Manuel De Techniques Virologiques, Presses de l'Universite de Quebec (1989).
2. Nunberg et al. (1989). Journal of Virology 63, 3240-3249.
3. De Groot et al. (1988). Virology 167, 370-376.

4. De Groot et al. (1987). J. gen. Virol. 68, 2639-2646.

5. Rota et al. (1986). Virology 154, 168-179.

6. r.~k~ll and Povey (1979) Research in Veterinary Science 27, 167-174.
I0 7. ~.~ske~l and Povey (1979) Journal of Comparative Pathology 89, 179.
.

W O 95/07987 ~ PCTAEP94/02990 LIST OF ABBREVIATIONS USED IN DRAWINGS
The following is a list of the abbreviations which have been utilized (throughout the application) in the drawings :
ori plasmid origin of replication (ColEl) 5 ori Fl fl origin of replication bla ~-lactamase gene, conferring resistance to ampicillin LacZ E. coli ~-galactosidase coding sequence HCMVp human cytomegalovirus immediate early gene promoter sequences RSVp rous sarcoma virus long terminal repeat promoter sequences SV40p SV40 early promoter sequences Ae SV40 early transcript polyadenylation signals Al SV40 late transcript polyadenylation signals M FIPV Matrix protein coding sequence MS FIPV Small Membrane protein coding sequence S FIPV Spike protein coding sequence SDAD FIPV antibody dependent enhancement epitope-deleted Spike protein coding sequence SIG FIPV signal sequence-deleted Spike protein coding sequence FSu 5' upstream insertion site fl~nk;ng sequences FSd 3' downstream insertion site fl~nk;ng sequences W O 95/07987 PCTrEP9~/02990 SEQUENCE LISTING

(1) GENERAL INFORMATION: ~

(i) APPLICANT:
(A) NAME: SOLVAY (Societe Anonyme) (B) STREET: rue du Prince Albert, 33 (C) CITY: Bruxelles (E) COUNTRY: Belgique (F) POSTAL CODE (ZIP): 1050 (G) TELEPHONE: (02)509.61.11 (ii) TITLE OF lNV~ ON: Antigenically-active proteins/polypeptides and Coronavirus vaccines containing the same (iii) NUMBER OF SEQUENCES: 26 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC~DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 249 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(v) FRAGMENT TYPE: internal W 095S07987 ~ 51 PCTA~P94/02990 (vi) ORIGINAL SOURCE:
(A) ORGANISM: Feline Infectious Peritonitis virus ~ (C) INDIVIDUAL ISOLATE: 79-1146 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 249 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..249 -W 095/07987 ~ 6 ~ PCT~EP94/02990 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Met Thr Phe Pro Arg Ala Phe Thr Ile Ile Asp Asp His Gly Met Val Val Ser Val Phe Phe Trp Leu Leu Leu Ile Ile Ile Leu Ile Leu Phe Ser Ile Ala Leu Leu Asn Val Ile Lys Leu Cys Met Val Cys Cys Asn Leu Gly Lys Thr Ile Ile Val Leu Pro Ala Arg His Ala Tyr Asp Ala Tyr Lys Thr Phe Met Gln Thr Lys Ala Tyr Asn Pro Asp Glu Ala Phe Leu Val (2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 82 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein W 095/07987 ~ ~ PCTAEP94/~2990 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
,, Met Thr Phe Pro Arg Ala Phe Thr Ile Ile Asp Asp His Gly Met Val ~ 1 5 10 15 Val Ser Val Phe Phe Trp Leu Leu Leu Ile Ile Ile Leu Ile Leu Phe Ser Ile Ala Leu Leu Asn Val Ile Lys Leu Cys Met Val Cys Cys Asn Leu Gly Lys Thr Ile Ile Val Leu Pro Ala Arg His Ala Tyr Asp Ala Tyr Lys Thr Phe Met Gln Thr Lys Ala Tyr Asn Pro Asp Glu Ala Phe Leu Val (2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

wo g5/07987 ~ ~ PCT~P91/02990 (2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid 5(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

. CCTGGGGACT TTCCACACCT GATCACTAAC TGACACACAT TCCACAG 47 (2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 55 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

W 095107987 PCT~EP94/02990 ~ 55 (2) I~FORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 54 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

(2) INFORMATION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

-W O 95/07987 PCT~EP91/02990 (2) INFORMATION FOR SEQ ID NO: 9:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

(2) INFORMATION FOR SEQ ID NO: l0:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: lO:

W 0 95/07987 ~ ~ ~ PCT/EP94/0299 (2) INFORMATION FOR SEQ ID NO: 11:
-(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

(2) INFORMATION FOR SEQ ID NO: 12:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:

Ser Val Ile Ile Trp ~ . PCT~EP94/02990 ~ 6 3 58 (2) INFORMATION FOR SEQ ID NO: 13:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
10 (B) LOCATION: 1.. 15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

Ser Val Ile Ile Trp (2) INFORMATION FOR SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 53 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

W O 95/07987 ~ ~ ~ PCTAEP94/02990 (2) INFORMATION FOR SEQ ID NO: 15:
~

(i) SEQUENCE CHARACTERISTICS:
- (A) LENGTH: 55 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:

(2) INFORMATION FOR SEQ ID NO: 16:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:

AATGTACTTC Al Ll 1~111 L AGTGGATCCT CAAACCAAAA AT 42 -PCT~EP94/02990 (2) INFORMATION FOR SEQ ID NO: 17:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:

~AAGAAr~AAG AAGACCATAA CTAGATCTCC ACCATGACGT TCCCTAGGGC ATTTAT 56 (2) INFORMATION FOR SEQ ID NO: 18:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:

PCT~EP94/02990 ~ 6 ~ 61 (2) INFORMATION FOR SEQ ID NO: 19:

- (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid 5(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:

(2) INFORMATION FOR SEQ ID NO: 20:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single l5(D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:

--W 0 95/07987 PCT~EP9~/02990 (2) INFORMATION FOR SEQ ID NO: 21:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:

(2) INFORMATION FOR SEQ ID NO: 22:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 61 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22:

W O 95/07987 ~ ~ ~ ~ PCTtEP94tO2990 (Z) INFORMATION FOR SEQ ID NO: 23:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23:

(2) INFORMATION FOR SEQ ID NO: 24:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 53 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24:

W O95l07987 6~ 64 (2) INFORMATION FOR SEQ ID NO: 25:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25:

(2) INFORMATION FOR SEQ ID NO: 26:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56 base pairs ~B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26:

Claims (48)

C L A I M S

1 - A modified coronavirus S protein, wherein at least one of the A1, A2 or D antigenic regions have been modified or removed therefrom, so that said modified regions are ADE-inactive.

2 - The modified coronavirus S protein of claim 1, wherein the A1 and the A2 antigenic regions have been modified or removed therefrom, so that said modified regions are ADE-inactive.

3 - The modified coronavirus S protein of claim 1, wherein the A1 and the D antigenic regions have been modified or removed therefrom, so that said modified regions are ADE-inactive.

4 - The modified coronavirus S protein of claim 1, wherein the A2 and the D antigenic regions have been modified or removed therefrom, so that said modified regions are ADE-inactive.

5 - The modified coronavirus S protein of claim 1, wherein the A1, A2 and D antigenic regions have been modified or removed therefrom, so that said modified regions are ADE-inactive.

6 - The modified coronavirus S protein of claim 1, wherein the coronavirus S protein is a modified FIPV S protein.

7 - A modified coronavirus S protein, wherein the signal peptide has been deleted therefrom.

8 - A substantially pure coronavirus SM protein having an amino acid sequence being substantially homologous with the amino acid sequence of Figure 1.

9 - A substantially pure FIPV SM protein.

10 - A process for preparing a DNA molecule which codes for a modified coronavirus S protein being antigenically-active to coronaviruses, said process comprised of the steps of :
a) isolating the expression cassette coding for a coronavirus S
protein;

b) determining the location of the nucleotide base sequences coding for at least one region of interest of the S protein;
and c) modifying or deleting the nucleotide base sequences coding for the at least one region of interest.

11 - The process of claim 10, wherein the regions of interest is the signal peptide sequence of the S protein, and further wherein the nucleotide base sequence coding for the signal peptide is deleted therefrom, so that no signal peptide is coded for by the nucleotide sequences.

12 - The process of claim 10, wherein the regions of interest are antigenic regions, and wherein the nucleotide base sequences coding for the regions of interest have been modified or deleted therefrom, so that the region of the protein coded for thereby is ADE-inactive.

13 - The process of claim 12, wherein the regions of interest are at least one of the A1, A2 and D antigenic regions.

14 - The process of claim 10, wherein the coronavirus S
proteins are FIPV S proteins.

15 - A cotransfection plasmid for cotransfection with viral DNA, said cotransfection plasmid including at least a portion of the flanking sequences of the insertion site in the viral genome to be transfected therewith, expression signals derived from RSV
or HCMV and SV40 and the coding sequences for a protein of interest to be expressed by the live recombinant carrier produced by such cotransfection.

16 - The cotransfection plasmid of claim 15, wherein the protein of interest is an FIPV protein.

17 - The cotransfection plasmid of claim 15, wherein the viral strain to be cotransfected is FHV-1 and further wherein the flanking sequences are derived from FHV-1.

18 - The cotransfection plasmid of claim 15, wherein the coding sequences for the protein of interest code for a coronavirus S protein.

19 - The cotransfection plasmid of claim 18, wherein the coding sequences for the protein of interest code for a coronavirus S protein which has had the signal peptide deleted therefrom.

20 - The cotransfection plasmid of claim 18, wherein the coding sequences for the protein of interest code is a coronavirus S protein which has had at least one of the antigenic regions thereof either modified or deleted therefrom, so that said modified regions of the protein coded for thereby are ADE-inactive.

21 - The cotransfection plasmid of claim 15, wherein the coding sequences for the protein of interest code for a coronavirus SM protein.

22 - The cotransfection plasmid of claim 15, wherein the target protein is a coronavirus M protein.

23 - A live recombinant carrier comprising FHV-1 the genome of which has DNA sequences coding for a modified coronavirus S
protein, wherein at least one of the DNA sequences coding for the A1, A2 or D antigenic regions have been modified or removed therefrom, so that said regions of the protein coded for thereby are ADE-inactive.

24 - The live recombinant carrier of claim 23, wherein the DNA sequences coding for the A1, A2 and D antigenic regions have all been modified or removed therefrom, so that said A1, A2 and D
regions of the protein coded for thereby are all ADE-inactive.

25 - The live recombinant carrier of claim 23, wherein the modified coronavirus S protein is a modified FIPV S protein.

26 - A live recombinant carrier comprising FHV-1 the genome of which has DNA sequences coding for a modified coronavirus S
protein, wherein the DNA sequence coding for the signal peptide of the modified coronavirus S protein coded for thereby has been modified or removed therefrom.

27 - The live recombinant carrier of claim 26, wherein the modified coronavirus S protein is a modified FIPV S protein.

28 - A live recombinant carrier comprising FHV-1 the genome of which has DNA sequences coding for a coronavirus SM protein, so that the live recombinant carrier expresses the coronavirus SM
protein.

29 - The live recombinant carrier of claim 28, wherein the coronavirus SM protein is an FIPV SM protein.

30 - A live recombinant carrier comprising FHV-1 the genome of which has DNA sequences coding for a coronavirus M protein, so that the live recombinant carrier expresses the coronavirus M
protein.

31 - The live recombinant carrier of claim 30, wherein the coronavirus M protein is an FIPV M protein.

32 - A live recombinant carrier for in vivo expression of at least one protein/polypeptide of interest in a target mammal, said live recombinant carrier comprising: a viral strain the genome of which has expression signals derived from RSV or HCMV
and SV40 and a nucleotide coding sequence for a protein of interest to be expressed by the live recombinant carrier.

33 - The live recombinant carrier of claim 32, wherein the viral strain is FHV-1.

34 - The live recombinant carrier of claim 32, wherein the nucleotide coding sequence codes for a antigenically-active coronavirus protein.

35 - A coronavirus vaccine effective for protecting a mammal against coronaviruses without provoking ADE.

36 - The coronavirus vaccine of claim 35, wherein the vaccines includes an antigenically-active coronavirus protein in a suitable carrier.

37 - The vaccine of claim 36, wherein the coronavirus protein is a coronavirus S protein.

38 - The vaccine of claim 36, wherein the coronavirus protein is a modified coronavirus S protein.

39 - The vaccine of claim 38, wherein the modified coronavirus S protein has at least one of the A1, A2 or D
antigenic regions thereof modified or deleted therefrom so as to be ADE-inactive.

40 - The vaccine of claim 38, wherein the modified coronavirus S protein has signal peptide deleted therefrom.

41 - The vaccine of claim 36, wherein the coronavirus protein is a coronavirus SM protein.

42 - The vaccine of claim 36, wherein the coronavirus protein is a coronavirus M protein.

43 - The vaccine of claim 36, wherein the vaccine is an FIPV
vaccine for protecting a feline against FIP, and further wherein the protein is an FIPV protein.

44 - The vaccine of claim 36, wherein the further including a live recombinant carrier, whereby expression of the protein in a host organism in need thereof is obtained.

45 - A method of preparing a coronavirus vaccine including the steps of:
a) isolating and purifying a DNA sequence coding for an antigenically-active coronavirus protein;

b) forming a cotransfection plasmid having the DNA sequence coding for the antigenically-active coronavirus protein;
c) cotransfecting FHV-1 viral DNA with the cotransfection plasmid, so as to form a live recombinant carrier capable of coding for the antigenically-active coronavirus protein for expressing the antigenically-active coronavirus protein in the target animal in vivo; and d) combining the live recombinant carrier with a pharmaceutically-acceptable carrier.

46 - A method of preparing an FIPV vaccine including the steps of:
a) isolating a DNA sequence coding for an FIPV S protein being antigenically-active;
b) modifing the DNA sequence for the FIPV S protein coding for at least one of the A1, A2 or D antigenic regions thereof, so that the modified antigenic regions of the protein coded thereby is ADE-inactive; and c) forming a cotransfection plasmid having the DNA sequence coding for the modified FIPV S protein;
d) cotransfecting FHV-1 viral DNA with the cotransfection plasmid, so as to form a live recombinant carrier capable of coding for the antigenically-active modified FIPV S protein for expressing the antigenically-active modified FIPV S
protein in the target animal in vivo; and e) combining the live recombinant carrier with a pharmaceutically-acceptable carrier.

47 - A method of protecting a mammal from a coronavirus infection including the steps of preparing a coronavirus vaccine according to the method of claim 45 and administering a therapeutically-effective quantity of the vaccine to a mammal in need thereof.

48 - A method of protecting a feline from FIPV including the steps of preparing a FIPV vaccine according to the method of claim 46, and administering a therapeutically-effective quantity of the vaccine to a feline in need thereof.